An Intronic GBF1 Variant (c.2015-19C>G) is Associated with Charcot-Marie-Tooth Disease Type 2GG by Disrupting mRNA Splicing and a comprehensive review of the literature.

An Intronic GBF1 Variant (c.2015-19C>G) is Associated with Charcot-Marie-Tooth Disease Type 2GG by Disrupting mRNA Splicing and a comprehensive review of the literature. | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article An Intronic GBF1 Variant (c.2015-19C>G) is Associated with Charcot-Marie-Tooth Disease Type 2GG by Disrupting mRNA Splicing and a comprehensive review of the literature. Wenqian Zhao, Yanping Zhu, Jinghua Gao, Honghan Zhang, Lanxin Ma, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8304862/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Charcot-Marie-Tooth disease type 2GG (CMT2GG) is an autosomal dominant axonal peripheral neuropathy caused by heterozygous mutations in the GBF1 gene, primarily characterized by slowly progressive distal muscle weakness. Pathogenic variants of GBF1 associated with this disorder have been shown to be mainly located in exonic regions. This study reported a case induced by an intronic variant. Objective This study aimed to clarify the impact of the c.2015−19C > G intronic variant located in intron 16 of the GBF1 gene on pre-mRNA splicing, as well as to elucidate its potential pathogenic mechanism in CMT2GG. Methods A patient diagnosed with CMT2GG who was admitted to the Department of Neurology, Chuxiong Prefecture People's Hospital in June 2022 was retrospectively analyzed for clinical phenotype, neurophysiological findings, and imaging results. Whole-exome sequencing (WES) was performed on the proband to identify potential genetic variants, and the candidate variant was confirmed by Sanger sequencing. Reverse transcription PCR (RT-PCR) was employed to further examine the effect of the identified variant on mRNA splicing. Results The patient exhibited marked generalized muscle atrophy, and neurophysiological assessment revealed electrophysiological changes indicative of widespread neurogenic impairment. WES identified a heterozygous GBF1 variant (c.2015−19C > G), and RT-PCR analysis confirmed that this mutation affects normal mRNA splicing, resulting in nine distinct alternatively spliced transcripts. Conclusion These findings highlight the diagnostic significance of intronic variants in the GBF1 gene in CMT2GG.We believe this study will benefit researchers in the field and facilitate earlier diagnosis and treatment of CMT2GG. Charcot-Marie-Tooth disease type 2GG (CMT2GG) Golgi brefeldin A-resistant guanine nucleotide exchange factor 1 (GBF1) mRNA splicing intronic variant Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Charcot-Marie-Tooth disease (CMT), also known as hereditary motor and sensory neuropathy, is one of the most common inherited peripheral neuropathies, with a prevalence of approximately 1:2500 [1] . It exhibits marked clinical and genetic heterogeneity and is predominantly inherited in an autosomal dominant manner. Clinically, CMT can be classified into three subtypes based on neuropathological features and patterns of inheritance: (1) Demyelinating type (CMT1): Primarily characterized by demyelination of peripheral nerves, leading to reduced nerve conduction velocity (NCV) (38 m/s). (3) Intermediate type (ICMT): Features both demyelination and axonal degeneration, with NCV ranging between 35–45 m/s [2] . Among these, CMT2 accounts for approximately 24% of all CMT cases [3] , and is clinically characterized by slowly progressive distal muscle weakness and atrophy, predominantly affecting the lower limbs, often resulting in gait disturbances and musculoskeletal deformities. Although onset typically occurs in adulthood, some patients may exhibit mild symptoms during childhood. Charcot-Marie-Tooth type 2GG (CMT2GG) is a newly identified subtype of autosomal dominant axonal peripheral neuropathy (OMIM 606483), primarily caused by heterozygous mutations in the Golgi brefeldin A-resistant guanine nucleotide exchange factor 1 ( GBF1 , MIM 603698). The GBF1 gene is located on chromosome 10q24.1 and encodes a protein of 1859 amino acids with a molecular weight exceeding 200 kDa [4] . GBF1 belongs to the guanine nucleotide exchange factors (GEFs) family for ADP-ribosylation factor 1 (Arf), playing a critical role in the cycling of Arf between its inactive and active GTP-bound forms. GBF1 is expressed in more than 25 tissues, predominantly in neurons associated with motor neuron diseases, and is involved in endoplasmic reticulum (ER)-Golgi transport [5] . GBF1 mutation can lead to the dissociation of coat protein complex I (COPI) from the Golgi membrane and its dispersion into the cytoplasm. This disruption ultimately causes the collapse of the Golgi apparatus into the ER, severely impairing the transport of transmembrane proteins [6] . Therefore, GBF1 is essential for ER-Golgi transport, the formation, differentiation, and trafficking of ER-Golgi intermediate compartment, and maintaining the structural integrity of the Golgi apparatus, serving as a key regulator of membrane trafficking in both the secretory and endosomal signaling pathways [7] . Mendoza-Ferreira et al. [8] identified four heterozygous mutations (three missense and one nonsense) in the exonic regions of GBF1 across four families comprising seven affected individuals. These mutations disrupted the localization and function of GBF1 in the Golgi apparatus, leading to Golgi fragmentation, with affected individuals manifesting CMT2GG. Valentina Ciampana et al. [9] identified a heterozygous mutation in exon 10 of GBF1 in two siblings, resulting in a valine deletion and subsequent onset of CMT2GG. Pre-mRNA splicing is a common post-transcriptional regulatory process in eukaryotes, with approximately 10%–62% of pathogenic single-nucleotide variants affecting alternative splicing by disrupting splice sites [10] . Previous studies have established a close association between various heterozygous exonic mutations in GBF1 and the pathogenesis of CMT2GG [8, 9] . However, no pathogenic splice-site variant has been reported. This study identified a c.2015-19C>G variant in intron 16 of the GBF1 gene, which affects normal mRNA splicing. Based on the previously reported association between GBF1 and CMT2GG, we speculate that this mutation could potentially have a substantial impact on the pathogenic mechanisms of CMT2GG. This finding provides a novel perspective for research direction of CMT2GG. Subjects and Methods 1.1 Research Subject A patient (female, aged 62) diagnosed with CMT2GG based on clinical and electrophysiological findings at the Department of Neurology, Chuxiong Prefecture People's Hospital in June 2022 was enrolled in this study. The patient presented with more than one year of slurred speech, dysarthria, and choking while drinking, followed by progressive limb weakness, muscle atrophy, and diffuse muscle edema. Electromyography indicated widespread neurogenic damage with electrophysiological abnormalities involving cervical, thoracic, and lumbosacral segments. The patient denied any family history of genetic disorders and had one daughter who did not exhibit similar symptoms. Neurological examinations were conducted by specialized neurologists from the hospital. Comprehensive data, including clinical symptoms, physical signs, neurophysiological findings, and pathological results, were retrospectively analyzed. The study was conducted in accordance with human research guidelines stated in the Declaration of Helsinki and approved by the Ethics Committee of Chuxiong Yi Autonomous Prefecture People's Hospital (KYCS2024017), and informed consent was obtained from the patient and her legal guardian. NCV testing and needle electromyography were performed in accordance with the standard protocols for motor neuron diseases. 1.2 Methods 1.2.1 Neurophysiological Examination NCV testing and needle electromyography were conducted following standard protocols for motor neuron diseases. The nerves examined included motor nerves (bilateral median, ulnar, common peroneal, and tibial nerves) and sensory nerves (bilateral median, ulnar, sural, superficial peroneal, and superficial radial nerves). The following parameters were assessed: motor nerve conduction velocity (MNCV), latency, conduction distance, compound muscle action potential (CMAP) amplitude; sensory nerve conduction velocity (SNCV), latency, conduction distance, and sensory nerve action potential (SNAP) amplitude. Needle electromyography was performed on the following muscles: sternocleidomastoid, genioglossus, paraspinal muscles, biceps brachii, flexor carpi radialis, dorsal interosseous, gastrocnemius, rectus femoris, and tibialis anterior. Additionally, bilateral ulnar and radial nerves were assessed using F-wave testing, and repetitive nerve stimulation (RNS) was performed on the left abductor digiti minimi, right trapezius, and right orbicularis oculi muscles. 1.2.2 Whole-exome sequencing for Gene Mutation Analysis Peripheral venous blood (4 mL, EDTA anticoagulated) was collected from the patient and her daughter. Genomic DNA was isolated from the peripheral blood of the proband and her daughter. All processes were conducted according to the manufacturer's protocols. High-throughput sequencing was performed to analyze the exonic regions and ±20 bp of the intronic flanking sequences of approximately 20,000 genes in the patient's genomic DNA. First-generation Sanger sequencing was used for validation of the detected variants. The analysis focused on pathogenic genes associated with the nervous system, ataxia, and neuromuscular diseases. Variants were identified and annotated using databases including 1000 Genomes (http://www.1000genomes.org), gnomAD (http://gnomad-old.broadinstitute.org), ClinVar (https://www.ncbi.nlm.nih.gov/clinvar/), OMIM (http://omim.org/), and HGMD (http://www.biobase-international.com/product/hgmd). Available family members were also tested for segregation analysis [11] . The pathogenicity of candidate variants was interpreted according to the guidelines of the American College of Medical Genetics and Genomics (ACMG). 1.2.3 RT-PCR Validation of the Impact of the Variant on mRNA Splicing Total RNA was extracted from the patient's peripheral blood samples using a total RNA extraction kit (Genstone Biotech, Cat. No.: TR121-50). The reverse transcription reaction mixture was prepared on ice according to the manufacturer's protocols (YEASEN, Cat. No.: 11123ES70), mixed by vortexing, briefly centrifuged, and then incubated in a PCR instrument at 55°C for 15 min, followed by 85°C for 5 min. The resulting 20 µL cDNA was either stored on ice for immediate use or at -20°C for later experiments. Based on the mutation site and gene sequence, RT-PCR primers were designed, as listed in Table 1. The synthesized cDNA served as the template for PCR amplification (TaKaRa, Cat. No.: R045A). The reaction mixture was prepared according the protocol in qPCR tubes, mixed thoroughly, briefly centrifuged, and then subjected to amplification on a real-time PCR instrument (Bio-Rad, Model: T100). The PCR amplification program was as follows: 95°C for 5 min, 95°C for 30 s, 57°C for 30 s, 72°C for 90 s (35 cycles), and 72°C for 5 min. PCR products were analyzed by 2% agarose gel electrophoresis. The amplified PCR products were subjected to gel extraction, and the recovered fragments were subsequently analyzed by Sanger sequencing. Table 1 Primer Design Primer Primer sequence 5'-3' GBF1 -1455-F1 AGCATGCGAGAGCACCTCAA GBF1 -1591-F2 ATCCCCAGCTTTGTCACAGA GBF1 -2497-R1 GCATGATGACAGCATAGGCC GBF1 -2426-R2 AACGCTCTGTGAATGCCTCC Results 2.1 Clinical Characteristics The patient first presented to the hospital in June 2022 with no family history of similar disorders and denied consanguineous marriage. Disease onset occurred at the age of 61, with initial symptoms of hoarseness, slurred speech, dysphagia, and prolonged mealtimes, followed by choking while drinking and progressive involvement of the distal lower limbs. Six months after onset, the patient exhibited impaired movement of the left lower limb, which gradually progressed to the left hand and the right limbs. By one year after onset, the patient had lost the ability to swallow food or drink water, experienced severe sialorrhea, and required nasal feeding for nutrition and medication. She exhibited significant generalized muscle atrophy, was completely unable to walk. At follow-up in March 2024, the patient presented with marked cachexia (weight: 39 kg), difficulty with mouth opening, tongue extension, chewing, and swallowing, dysarthria, rigid facial expression, hyperactive pharyngeal reflexes, and a grade 5 result on the water-swallowing test. Generalized muscle atrophy of the trunk was observed, along with symmetric atrophy of proximal and distal limb muscles, and notable wasting of the thenar, hypothenar, and interosseous muscles of both hands (Figure 1). Muscle strength on the left side was graded 4/5 in wrist flexion/extension, forearm, and upper arm, with left foot drop and 3/5 strength in both distal and proximal lower limbs; on the right side, muscle strength was 3/5 in wrist flexion/extension, forearm, upper arm, and both distal and proximal lower limbs, accompanied by right foot drop. Muscle tone was increased in both proximal and distal limb muscles. For the left side, tendon reflexes were hyperactive in the upper limb (biceps, triceps, and brachioradialis) and exaggerated in the lower limb (patellar and Achilles). For the right side, tendon reflexes were hyperactive in both upper (biceps, triceps, and brachioradialis) and lower limbs (patellar and Achilles). Pathological reflexes included bilateral positive Hoffmann's signs in the upper limbs and positive Babinski's and Chaddock's signs in the lower limbs, while superficial and deep sensation in the distal limbs remained generally preserved. 2.2 Neurophysiological Findings Neurophysiological examination revealed that MNCV and SNCV were within normal ranges in both upper and lower limbs, except for a reduced SNAP in the right ulnar nerve. However, a decrease in CMAP was observed in certain muscles. Additionally, the right ulnar nerve showed reduced F-wave persistence (Figure 3). Electromyography (EMG) demonstrated spontaneous activity in some examined muscles of both upper and lower limbs as well as the paraspinal muscles. Some muscles exhibited motor unit potentials (MUPs) with prolonged duration, increased peak amplitude, and reduced recruitment patterns. These findings suggest widespread neurogenic damage involving the cervical, thoracic, lumbar, sacral, and intracranial segments, with partial involvement of the right ulnar nerve. The results are consistent with anterior horn cell degeneration-related diseases. 2.3 Genetic Screening Results Whole-exome sequencing(WES) was performed on both the patient and her daughter, then reads were aligned to the human reference genome GRCh38 (hg38). A heterozygous intronic variant in GBF1, chr10:102363691 C>G (c.1754-3C>G; NM_004193.3), was identified (Figure 4). In silico splicing predictors (SpliceAI Δ=0.97, MaxEntScan Δ=−8.1) indicate a strong loss-of-function effect that aligns with high regional genomic constraint (LOEUF = 0.17).According to the 2015 ACMG guidelines [11] , this variant was classified as a variant of uncertain significance (VUS) with evidence codes PM2_Supporting and PM4. The inheritance pattern of CMT2GG is autosomal dominant. However, this variant was not detected in the patient's daughter (Mei Cao) (Figure 4). 2.4 Effects of the Variant on mRNA Splicing Nested RT-PCR targeting exons 12–16 of the canonical 835-bp GBF1 transcript was performed on the patient and a healthy control using the designed primers. Electrophoresis results revealed two bands in the healthy control and nine in the patient (Figure 5C). The PCR products from both the healthy control and the patient were subsequently purified, subjected to TA cloning, and analyzed via Sanger sequencing (Table 4). Sequencing results confirmed that the healthy control did not carry the mutation and exhibited bands corresponding to normal splicing as well as transcripts with skipping of three exons. In contrast, the patient, who carried the c.2015-19C>G mutation, displayed bands of both normal splicing and multiple aberrant splicing patterns. The detailed splicing patterns are illustrated in Figure 2B. Table 2. Sanger sequencing results Band Splicing Pattern Reading Frame Expression at cDNA and Protein Level a Exon14（195bp）-Exon15（190bp）-Exon16（141bp）-Exon17（89bp）-Exon18（203bp）-Exon19（124bp） Unchanged Normal expression b Exon14（195bp）-Exon18（203bp）-Exon19（124bp） Unchanged c.1684_2013del p.Asn562_Gly671del c Exon14（195bp）-△Exon15（154bp）-Exon16（141bp）-Exon17（89bp）-Exon18（203bp）-Exon19（124bp） Altered c.1839_1873del p.Glu614 d Exon14（195bp）-△Exon15（2bp）-△Exon19（70bp） Unchanged c.1686_2360del p.Asn562_Glu787delinsLys e Exon14（195bp）-Exon15-△Exon16（63bp）-△Exon19（84bp） Altered c.1937_2346del p.Leu646Profs31 f Exon14（195bp）-Exon15-△Exon16（30bp）-△Exon19（24bp） Altered c.1904_2406del p. Val635Glyfs11 g Exon14（195bp）-Exon15-△Exon16（22bp）-△Exon19（71bp） Unchanged c.1896_2459del p. Lys633_Ser820del h △Exon14（129bp）-△Exon19（75bp） Altered c.1618_2360del p.Ile540Serfs26 i Exon14（195bp）-Exon19（124bp） Altered c.1684_2306del p. Asn562Hisfs44 Discussion Due to the high clinical and genetic heterogeneity of CMT, its diagnosis remains challenging [12] . Currently, the overall diagnostic rate of CMT, especially CMT2, is relatively low [13, 14] . As a rare subtype of CMT2, CMT2GG has been reported in only nine cases [8, 9] . Therefore, expanding the spectrum of pathogenic variants associated with CMT2GG and elucidating their underlying molecular mechanisms is of considerable significance for improving the diagnosis and treatment of this disease [15, 16] . This study identified a heterozygous intronic variant in GBF1 (c.1754-3C>G) that resulted in a clinical phenotype consistent with CMT2GG. This variant leads to abnormal mRNA splicing, resulting in exon skipping or partial exon deletions and ultimately generating truncated or amino acid-deficient GBF1 protein products. RNA splicing represents a crucial step in eukaryotic gene expression, bridging transcriptional outputs to translational processes through the precise excision of introns and ligation of exons [17] . This process not only accounts for the discontinuity of genes in eukaryotes but also enhances transcript diversity and enables dynamic post-transcriptional regulation [18] . Aberrant alternative splicing has been recognized as a major contributor to various diseases. It is estimated that approximately 50% of pathogenic mutations affect RNA splicing [19] , and over one-third of inherited disorders are attributable to splicing abnormalities [20] . Accurate splicing requires precise recognition of the dinucleotide sequences at intron boundaries (GT at the 5′ end and AG at the 3′ end), which serve as key elements for spliceosome recognition and binding [21, 22] . Mutations within introns that disrupt these conserved splice sites may impede proper spliceosome binding, thereby altering the fidelity of splicing. For instance, such disruptions can lead to the utilization of cryptic splice sites, exon skipping, or intron retention, resulting in aberrant mRNA transcripts [23] . Yilai Han et al. demonstrated that the c.1754-3C>G intronic mutation disrupts the NYAG/G consensus sequence at the 3′ splice site, leading to exon 13 skipping. This generates a truncated CSF1R protein and impairs its tyrosine kinase activity, revealing a novel pathogenic mechanism involving splicing defects in CSF1R [24] . In addition, introns contain numerous splicing regulatory elements (enhancers or silencers). Intronic mutations can disrupt these elements, thereby altering splicing patterns. For example, mutations may abrogate enhancer activity or augment silencer function, leading to exon skipping or intron retention and ultimately compromising protein structure and function [25] . Homolová et al. reported a deep intronic mutation (c.903+469T>C) in the MTRR gene, which introduced a novel SF2/ASF-binding exonic splicing enhancer, leading to pseudo-exon activation and causing cblE-type homocystinuria [26] . Previous studies on GBF1 primarily focused on its coding regions, while intronic mutations have received comparatively little attention. This study identified a novel intronic variant c.2015-19C>G in GBF1 , which perturbs alternative mRNA splicing, resulting in multiple aberrant splice variants. Such splicing abnormalities may lead to reduced expression or loss of function of GBF1 , thereby compromising Golgi apparatus integrity and its intracellular trafficking functions. The Golgi apparatus plays a critical role in neurons by mediating protein modification, transport, and secretion. Its fragmentation can disrupt the localization and function of key proteins such as neurotransmitter receptors and ion channels, impairing neurotransmitter release [13, 14] . Moreover, GBF1 mutations have been implicated in the dysregulation of mitochondrial transport and localization, further exacerbating neuronal damage [27] . GBF1 has been demonstrated to be widely expressed in tissues and cells relevant to hereditary motor neuropathies (HMN) and CMT2 phenotypes, including the spinal cord, brain, muscle tissue, and motor neurons (MNs) [8] . GBF1 promotes the GDP-GTP exchange of Arf proteins, facilitating COPI vesicle formation, Golgi maintenance, and mitochondrial trafficking and positioning [28, 29] . In Caenorhabditis elegans, inactivation of gbf-1 leads to severe muscle dysfunction and developmental arrest [30] . In vertebrate models such as zebrafish, GBF1 mutations result in vascular collapse and evident intracerebral and trunk hemorrhages [31] . These findings highlight GBF1 's vital role in neuronal tissue, particularly in regions implicated in motor neuron pathology, as well as its essential contribution to the maintenance of normal neuronal physiology. GBF1 encodes a protein of 1859 amino acids, rendering it relatively intolerant to missense mutations (Z-score = 4.16; observed/expected ratio: 0.74, gnomAD v2.1.1, accessed July 2025), indicating that any mutation affecting its coding sequence or splicing may lead to severe functional impairments. Five heterozygous pathogenic variants associated with CMT2GG (c.855-857delGTG p.Val286del, c.3410C>T p.Ala1137Val, c.4382G>A p.Arg1461Gln, c.2945G>A p.Cys982Tyr, c.3525G>A p.Trp1175Ter) have been reported in five families [8, 9] . The onset of this disorder ranges from childhood to adulthood. In pediatric cases, primary manifestations include delayed motor development, while adult onset is characterized by lower limb muscle spasms, sensory deficits, gait instability, and foot deformities. As the disease progresses, symptoms gradually worsen and eventually involve generalized muscle weakness and atrophy, predominantly affecting the lower limbs. In this study, the detected variant (c.1754-3C>G) was classified as a VUS. The initial clinical presentation included slurred speech, dysarthria, and choking while drinking, followed by progressive limb weakness, muscle atrophy, and diffuse muscular edema. Most CMT2GG patients exhibit MNCV within normal or mildly reduced ranges; SNCV may be normal or mildly abnormal, with some patients showing reduced SNAP amplitudes or slowed conduction velocities. Needle EMG typically reveals chronic neurogenic changes and spontaneous activity, such as fibrillation potentials and positive sharp waves. In this study, needle EMG in the reported patient demonstrated widespread neurogenic damage, spontaneous activity, prolonged motor unit potential duration, increased peak amplitude, and reduced recruitment. Although CMT2GG usually progresses slowly with relatively stable symptoms, this patient exhibited unusually rapid deterioration, with complete loss of swallowing ability and severe generalized muscle atrophy, rendering ambulation impossible within approximately one year of onset. While the clinical phenotype largely aligns with typical CMT2GG manifestations, the atypical initial symptoms and accelerated progression may be attributable to the particularly deleterious effects of this specific variant. As far as we know, this is the first report on patients with CMT2GG from the Asian population. This study broadens the mutational spectrum associated with CMT2GG,offering novel insights into the genetic and pathogenic mechanisms underlying this rare subtype of CMT. Meanwhile, it underscores the necessity of including intronic regions in genetic analyses, particularly in cases with a high suspicion of CMT where exonic sequencing fails to identify pathogenic variants. Nevertheless, this study has certain limitations. The small sample size constrains the ability to comprehensively capture the clinical heterogeneity and genetic diversity of CMT2GG. Although RT-PCR confirmed the impact of the GBF1 intronic variant on mRNA splicing, no further functional studies were conducted to evaluate its impact on GBF1 protein function. Future investigations with larger cohorts and in-depth functional analyses are warranted to elucidate the pathogenic mechanisms of CMT2GG, thereby providing more robust evidence to inform clinical diagnosis and therapeutic strategies. Declarations Ethics approval and consent to participate This study was conducted in accordance with the Declaration of Helsinki, with written informed consent obtained from all patients or their legal guardians. The study protocol was approved by the Ethics Committee of the People's Hospital of Chuxiong Yi Autonomous Prefecture (KYCS2024017). Consent to publish Informed consent was obtained from the enrolled families to allow publication of the clinical and diagnostic information collected in the study. Funding Yunnan Provincial Department of Education Scientifc Research（2025J0793）；National Clinical Key Specialty Construction Project of Cardiovascular Medicine at Chuxiong People's Hospital（2024ZK01）；Scientific Research Project of Chuxiong Medical College（2019YYMX01）；Scientific Research Fund of the People's Hospital of Chuxiong Yi Autonomous Prefecture（2023Y05）；Doctoral Research Project of the Kunming Medical University Second Affiliated Hospital（2025BS16） Author's ’contribution Jian Han and Ying Hu organized and designed the study.Jian Han provided funding support for the project.Wenqian Zhao and Yanping Zhu was responsible for implementing the research and drafting the manuscript. Yuyan Wu and Yurong Zheng contributed to the case collection and follow-up of patients. Jinghua Gao, Honghan Zhang , Lanxin Ma and Xiaoling Liu collected and analyzed the data. All authors reviewed the manuscript. Competing interests The authors declare no competing interests. Availability of data and material The datasets used and/or analysed during the current study available from the corresponding author on reasonable request. References Barisic N, Claeys KG, Sirotković-Skerlev M et al (2008) Ann Hum Genet 72(Pt 3):416–441. http://dx.doi.org/10.1111/j.1469-1809.2007.00412.x . Charcot-Marie-Tooth disease: a clinico-genetic confrontation [J] Berciano J, García A, Gallardo E et al (2017) Intermediate Charcot-Marie-Tooth disease: an electrophysiological reappraisal and systematic review [J]. J Neurol 264(8):1655–1677. http://dx.doi.org/10.1007/s00415-017-8474-3 Pisciotta C, Bertini A, Tramacere I et al (2023) Clinical spectrum and frequency of Charcot-Marie-Tooth disease in Italy: Data from the National CMT Registry [J]. Eur J Neurol 30(8):2461–2470. http://dx.doi.org/10.1111/ene.15860 Mansour SJ, Herbrick JA, Scherer SW et al (1998) Human GBF1 is a ubiquitously expressed gene of the sec7 domain family mapping to 10q24 [J]. Genomics 54(2):323–327. http://dx.doi.org/10.1006/geno.1998.5563 Barzilay E, Ben-Califa N, Hirschberg K et al (2005) Uncoupling of brefeldin a-mediated coatomer protein complex-I dissociation from Golgi redistribution [J]. Traffic 6(9):794–802. http://dx.doi.org/10.1111/j.1600-0854.2005.00317.x Lee TH, Linstedt AD (2000) Potential role for protein kinases in regulation of bidirectional endoplasmic reticulum-to-Golgi transport revealed by protein kinase inhibitor H89 [J]. Mol Biol Cell 11(8):2577–2590. http://dx.doi.org/10.1091/mbc.11.8.2577 Magliozzi R, Carrero ZI, Low TY et al (2018) Inheritance of the Golgi Apparatus and Cytokinesis Are Controlled by Degradation of GBF1 [J]. Cell Rep 23(11):3381–3391e3384. .http://dx.doi.org/10.1016/j.celrep.2018.05.031 Mendoza-Ferreira N, Karakaya M, Cengiz N et al (2020) De Novo and Inherited Variants in GBF1 are Associated with Axonal Neuropathy Caused by Golgi Fragmentation [J]. Am J Hum Genet 107(4):763–777. http://dx.doi.org/10.1016/j.ajhg.2020.08.018 Ciampana V, Corrado L, Magistrelli L et al (2024) A Novel GBF1 Variant in a Charcot-Marie-Tooth Type 2: Insights from Familial Analysis [J]. Genes (Basel) 15(12). http://dx.doi.org/10.3390/genes15121556 Li K, Xiao J, Ling Z et al (2024) Prioritizing de novo potential non-canonical splicing variants in neurodevelopmental disorders [J]. EBioMedicine 99:104928. http://dx.doi.org/10.1016/j.ebiom.2023.104928 Richards S, Aziz N, Bale S et al (2015) Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology [J]. Genet Med 17(5):405–424. http://dx.doi.org/10.1038/gim.2015.30 Nam SH, Hong YB, Hyun YS et al (2016) Identification of Genetic Causes of Inherited Peripheral Neuropathies by Targeted Gene Panel Sequencing [J]. Mol Cells 39(5):382–388. http://dx.doi.org/10.14348/molcells.2016.2288 Haukedal H, Corsi GI, Gadekar VP et al (2023) Golgi fragmentation - One of the earliest organelle phenotypes in Alzheimer's disease neurons [J]. Front Neurosci 17:1120086. http://dx.doi.org/10.3389/fnins.2023.1120086 Gonatas NK, Stieber A, Gonatas JO (2006) Fragmentation of the Golgi apparatus in neurodegenerative diseases and cell death [J]. J Neurol Sci 246(1–2):21–30. http://dx.doi.org/10.1016/j.jns.2006.01.019 Gemelli C, Geroldi A, Massucco S et al (2022) Life (Basel) 12(3). http://dx.doi.org/10.3390/life12030402 . Genetic Workup for Charcot-Marie-Tooth Neuropathy: A Retrospective Single-Site Experience Covering 15 Years [J] Rudnik-Schöneborn S, Tölle D, Senderek J et al (2016) Diagnostic algorithms in Charcot-Marie-Tooth neuropathies: experiences from a German genetic laboratory on the basis of 1206 index patients [J]. Clin Genet 89(1):34–43. http://dx.doi.org/10.1111/cge.12594 Apostolidi M, Stamatopoulou V (2023) Aberrant splicing in human cancer: An RNA structural code point of view [J]. Front Pharmacol 14:1137154. http://dx.doi.org/10.3389/fphar.2023.1137154 Scotti MM, Swanson MS (2016) RNA mis-splicing in disease [J]. Nat Rev Genet 17(1):19–32. http://dx.doi.org/10.1038/nrg.2015.3 Pan Q, Shai O, Lee LJ et al (2008) Deep surveying of alternative splicing complexity in the human transcriptome by high-throughput sequencing [J]. Nat Genet 40(12):1413–1415. http://dx.doi.org/10.1038/ng.259 Lopez-Bigas N, Audit B, Ouzounis C et al (2005) Are splicing mutations the most frequent cause of hereditary disease? [J]. FEBS Lett 579(9):1900–1903. http://dx.doi.org/10.1016/j.febslet.2005.02.047 Hoskins AA, Moore MJ (2012) The spliceosome: a flexible, reversible macromolecular machine [J]. Trends Biochem Sci 37(5):179–188. http://dx.doi.org/10.1016/j.tibs.2012.02.009 Fica SM, Nagai K (2017) Cryo-electron microscopy snapshots of the spliceosome: structural insights into a dynamic ribonucleoprotein machine [J]. Nat Struct Mol Biol 24(10):791–799. http://dx.doi.org/10.1038/nsmb.3463 Baralle D, Baralle M (2005) Splicing in action: assessing disease causing sequence changes [J]. J Med Genet 42(10):737–748. http://dx.doi.org/10.1136/jmg.2004.029538 Han Y, Han J, Li Z et al (2024) Identification and characterization of a novel intronic splicing mutation in CSF1R-related leukoencephalopathy [J]. CNS Neurosci Ther 30(6):e14815. .http://dx.doi.org/10.1111/cns.14815 Pagani F, Baralle FE (2004) Genomic variants in exons and introns: identifying the splicing spoilers [J]. Nat Rev Genet 5(5):389–396. http://dx.doi.org/10.1038/nrg1327 Homolova K, Zavadakova P, Doktor TK et al (2010) The deep intronic c.903 + 469T > C mutation in the MTRR gene creates an SF2/ASF binding exonic splicing enhancer, which leads to pseudoexon activation and causes the cblE type of homocystinuria [J]. Hum Mutat 31(4):437–444. http://dx.doi.org/10.1002/humu.21206 Walch L, Pellier E, Leng W et al (2018) GBF1 and Arf1 interact with Miro and regulate mitochondrial positioning within cells [J]. Sci Rep 8(1):17121. http://dx.doi.org/10.1038/s41598-018-35190-0 Donaldson JG, Jackson CL (2011) ARF family G proteins and their regulators: roles in membrane transport, development and disease [J]. Nat Rev Mol Cell Biol 12(6):362–375. http://dx.doi.org/10.1038/nrm3117 Zou YJ, Shan MM, Pan ZN et al (2021) Loss of Arf Guanine Nucleotide Exchange Factor GBF1 Activity Disturbs Organelle Dynamics in Mouse Oocytes [J]. Microsc Microanal 27(2):400–408. http://dx.doi.org/10.1017/s1431927620024885 Ackema KB, Hench J, Böckler S et al (2014) The small GTPase Arf1 modulates mitochondrial morphology and function [J]. Embo j 33(22):2659–2675. http://dx.doi.org/10.15252/embj.201489039 Chen J, Wu X, Yao L et al (2017) Impairment of Cargo Transportation Caused by gbf1 Mutation Disrupts Vascular Integrity and Causes Hemorrhage in Zebrafish Embryos [J]. J Biol Chem 292(6):2315–2327. http://dx.doi.org/10.1074/jbc.M116.767608 Attached Table 1: electromyography (EMG) test report table Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8304862","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":562040772,"identity":"8d1ae99f-b54a-47b5-8b79-6a3800cce64d","order_by":0,"name":"Wenqian Zhao","email":"","orcid":"","institution":"Kunming Medical University Second Affiliated Hospital","correspondingAuthor":false,"prefix":"","firstName":"Wenqian","middleName":"","lastName":"Zhao","suffix":""},{"id":562040774,"identity":"eb4c7048-65af-4db0-a75c-47c3a36607e5","order_by":1,"name":"Yanping Zhu","email":"","orcid":"","institution":"Chuxiong Yi Autonomous Prefecture People's Hospital","correspondingAuthor":false,"prefix":"","firstName":"Yanping","middleName":"","lastName":"Zhu","suffix":""},{"id":562040776,"identity":"fe89b3d8-327d-42e7-833e-acfa81c904e5","order_by":2,"name":"Jinghua Gao","email":"","orcid":"","institution":"Chuxiong Yi Autonomous Prefecture People's Hospital","correspondingAuthor":false,"prefix":"","firstName":"Jinghua","middleName":"","lastName":"Gao","suffix":""},{"id":562040778,"identity":"7ccc20df-49e9-49d2-8c3b-b269bcf42a10","order_by":3,"name":"Honghan Zhang","email":"","orcid":"","institution":"Chuxiong Yi Autonomous Prefecture People's Hospital","correspondingAuthor":false,"prefix":"","firstName":"Honghan","middleName":"","lastName":"Zhang","suffix":""},{"id":562040779,"identity":"71951d1f-acad-44e3-b5a3-dba0cc10b40b","order_by":4,"name":"Lanxin Ma","email":"","orcid":"","institution":"Chuxiong Yi Autonomous Prefecture People's Hospital","correspondingAuthor":false,"prefix":"","firstName":"Lanxin","middleName":"","lastName":"Ma","suffix":""},{"id":562040782,"identity":"87f02887-c5be-4503-854f-700234f91dbc","order_by":5,"name":"Liyan Wu","email":"","orcid":"","institution":"Chuxiong Yi Autonomous Prefecture People's Hospital","correspondingAuthor":false,"prefix":"","firstName":"Liyan","middleName":"","lastName":"Wu","suffix":""},{"id":562040783,"identity":"c24cc96a-0e0f-498d-92f4-8d10ae09e3f0","order_by":6,"name":"Yurong Zheng","email":"","orcid":"","institution":"Chuxiong Yi Autonomous Prefecture People's Hospital","correspondingAuthor":false,"prefix":"","firstName":"Yurong","middleName":"","lastName":"Zheng","suffix":""},{"id":562040784,"identity":"06e28c4b-0a78-4da0-bbd7-c7e21ad64f9a","order_by":7,"name":"Xiaoling Liu","email":"","orcid":"","institution":"Kunming Medical University Second Affiliated Hospital","correspondingAuthor":false,"prefix":"","firstName":"Xiaoling","middleName":"","lastName":"Liu","suffix":""},{"id":562040787,"identity":"7cda7aeb-222a-4734-9a7b-abe29228181c","order_by":8,"name":"Ying Hu","email":"","orcid":"","institution":"Kunming Medical University Second Affiliated Hospital","correspondingAuthor":false,"prefix":"","firstName":"Ying","middleName":"","lastName":"Hu","suffix":""},{"id":562040791,"identity":"4d28214c-6653-4ae9-b309-d87dc68b7e6a","order_by":9,"name":"Jian Han","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA40lEQVRIie3PvQrCMBDA8ZNAXAJdK4i+wolQ8W0SBKcqjh0KOkg7+LXqWzg6VgKdoq4dHCqCk4uLOInt5tRmFMwPMgTuzyUAhvGDMD8coEGrq0vKPV8/aVtMEUxVrJfkxGbt0tplSsqTTvUQjVL/XNlGg9gTEwpWOOOFSXc+5MjjG8Ho2E/Erg62OmyLHxa5iJxKivuJkwhFAe1BSXK6Z8lbMpTgjERANJIk2yICadcC5oBmkm0RS4kWoz2bq5iV/+XkOq3XU46D5nX/eHl+wwoXxUmG4veNlY3nSKozZRiG8cc+q/ZOtrDduSgAAAAASUVORK5CYII=","orcid":"","institution":"Chuxiong Yi Autonomous Prefecture People's Hospital","correspondingAuthor":true,"prefix":"","firstName":"Jian","middleName":"","lastName":"Han","suffix":""}],"badges":[],"createdAt":"2025-12-08 07:38:30","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8304862/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8304862/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":98753419,"identity":"b4f319eb-f0ab-4065-bfcb-1f70e97c6405","added_by":"auto","created_at":"2025-12-22 09:21:46","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":891732,"visible":true,"origin":"","legend":"","description":"","filename":"GBF1Neurogenetics.docx","url":"https://assets-eu.researchsquare.com/files/rs-8304862/v1/1c30817f97ba3d0af22cfd3f.docx"},{"id":98753418,"identity":"9cee33e5-f256-40e4-ae1e-ddc5ad8eb3a9","added_by":"auto","created_at":"2025-12-22 09:21:46","extension":"json","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":10670,"visible":true,"origin":"","legend":"","description":"","filename":"69a4e046473445cabc10a6559022c49c.json","url":"https://assets-eu.researchsquare.com/files/rs-8304862/v1/13da59044e55dae82f2db516.json"},{"id":98777815,"identity":"b81423d5-abab-4013-b3ef-4e70138fb0bf","added_by":"auto","created_at":"2025-12-22 12:28:30","extension":"xml","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":118933,"visible":true,"origin":"","legend":"","description":"","filename":"69a4e046473445cabc10a6559022c49c1enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-8304862/v1/2a37ee636c814fdc61e42337.xml"},{"id":98779835,"identity":"3a77109c-a903-44a3-beea-e6926285228f","added_by":"auto","created_at":"2025-12-22 12:30:48","extension":"jpeg","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":772400,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8304862/v1/f186378c039d663c021fb04c.jpeg"},{"id":98753429,"identity":"2be89fe3-8628-4939-801a-cae33e2f8c8f","added_by":"auto","created_at":"2025-12-22 09:21:46","extension":"jpeg","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":320434,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8304862/v1/1fe9c197a798c61c5bb83a6d.jpeg"},{"id":98753426,"identity":"0a0ee85d-51f1-40ef-a7f4-b80527c9c069","added_by":"auto","created_at":"2025-12-22 09:21:46","extension":"jpeg","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":105779,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8304862/v1/0bea7d056652c8759f9057ba.jpeg"},{"id":98779879,"identity":"f2ecf546-f9d8-4920-bdc8-95ba89a24aa3","added_by":"auto","created_at":"2025-12-22 12:30:52","extension":"jpeg","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":15336,"visible":true,"origin":"","legend":"","description":"","filename":"groupimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8304862/v1/0c5fb45c386c93aa1a53f0a2.jpeg"},{"id":98753432,"identity":"cc65abd3-658d-47e9-8f66-9f83e2051890","added_by":"auto","created_at":"2025-12-22 09:21:46","extension":"jpeg","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":31802,"visible":true,"origin":"","legend":"","description":"","filename":"groupimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8304862/v1/e139781f3f0adc65a5d1a9fc.jpeg"},{"id":98753431,"identity":"89fc40bd-a851-4537-882e-67f2822ef7a9","added_by":"auto","created_at":"2025-12-22 09:21:46","extension":"png","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":281425,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-8304862/v1/b2915649d3335665f69eae1c.png"},{"id":98777660,"identity":"5655cf64-df5a-4af1-8a40-9fe15f174949","added_by":"auto","created_at":"2025-12-22 12:28:18","extension":"png","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":524499,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-8304862/v1/cdd79c6e96a3300dcd541e12.png"},{"id":98753434,"identity":"29db40d7-bb01-4589-b2d8-0696c22d949f","added_by":"auto","created_at":"2025-12-22 09:21:46","extension":"png","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":77757,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-8304862/v1/73c47bc634ceb89cce47c6d3.png"},{"id":98753436,"identity":"d6bdbb52-a599-49f2-b4df-797d164febca","added_by":"auto","created_at":"2025-12-22 09:21:46","extension":"png","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":8554,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinegroupimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-8304862/v1/59801ac233ae5e1c61d13942.png"},{"id":98779169,"identity":"3b8d032f-97b1-43b8-a763-ebacb07c4fa4","added_by":"auto","created_at":"2025-12-22 12:30:00","extension":"png","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":9719,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinegroupimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-8304862/v1/2c1d62678eb44628ee1a9b71.png"},{"id":98778586,"identity":"ebf2368a-8dd1-4b49-acc8-241e25fc2aa7","added_by":"auto","created_at":"2025-12-22 12:29:27","extension":"xml","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":117294,"visible":true,"origin":"","legend":"","description":"","filename":"69a4e046473445cabc10a6559022c49c1structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-8304862/v1/89c49383f338f7078d731d06.xml"},{"id":98780054,"identity":"22d5ec76-f27e-4ace-b5ce-d595ecc8f24f","added_by":"auto","created_at":"2025-12-22 12:31:00","extension":"html","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":130174,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-8304862/v1/2ebea666a038c9e7ac39b781.html"},{"id":98753421,"identity":"82291510-85de-4a8f-a66c-475d06dc5e99","added_by":"auto","created_at":"2025-12-22 09:21:46","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":846211,"visible":true,"origin":"","legend":"\u003cp\u003eClinical features of the patient\u003c/p\u003e\n\u003cp\u003e(Symmetrical atrophy of muscles in the distal and proximal limbs, and significant wasting of bilateral palmar muscles, as well as the thenar and hypothenar muscles.)\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-8304862/v1/1f1858ac0214185f3bbdd9c6.png"},{"id":98753424,"identity":"4c6d410d-18db-469b-9a46-c1387523eafd","added_by":"auto","created_at":"2025-12-22 09:21:46","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":293099,"visible":true,"origin":"","legend":"\u003cp\u003eMRI slice of the lower limbs\u003c/p\u003e\n\u003cp\u003e(Bilateral atrophy of leg muscle groups, with no significant abnormalities in subcutaneous soft tissue and muscle groups of the thigh; Diffuse edema of bilateral calf muscle groups, uneven signal of muscle bundles, blurred muscle fascia with a small amount of fluid accumulation in the space, and subcutaneous soft tissue edema.)\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-8304862/v1/ef889644f7a58f995cf1ec65.png"},{"id":98779822,"identity":"a9498d06-7935-4c67-b163-0f9d2f7b0fd1","added_by":"auto","created_at":"2025-12-22 12:30:47","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":411161,"visible":true,"origin":"","legend":"\u003cp\u003eF-curve of the right ulnar nerve\u003c/p\u003e\n\u003cp\u003e(F-latency is 30.4ms, and the F-wave persistence decreases by 50%.)\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-8304862/v1/7b75824d81f92891008d1d2e.png"},{"id":98753423,"identity":"3bbf2f00-66fa-4321-828f-cad6a7d70a82","added_by":"auto","created_at":"2025-12-22 09:21:46","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":139161,"visible":true,"origin":"","legend":"\u003cp\u003eFamily pedigree charts and sanger sequencing validation\u003c/p\u003e\n\u003cp\u003e( II-1: proband; III-1: daughter of the proband.)\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-8304862/v1/6aa39fb176b8970438005759.png"},{"id":98777671,"identity":"7cf327ca-2f78-4164-89f3-1e8a87bf3fda","added_by":"auto","created_at":"2025-12-22 12:28:19","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":146356,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of Mutation on mRNA Splicing\u003c/p\u003e\n\u003cp\u003e(A) Primer Design and Splicing, with the red arrow pointing to the mutation location; (B) The sequencing result map corresponding to the slicing bands; (C) Agarose gel electrophoresis of RT-PCR products.\u003c/p\u003e","description":"","filename":"5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8304862/v1/a0826e59c4dc165f6cc82e1d.jpg"},{"id":99798298,"identity":"2e538a8f-04be-4510-9b07-15453e41466b","added_by":"auto","created_at":"2026-01-08 13:47:54","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2856371,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8304862/v1/e66f838b-5633-429d-83eb-b2cf365a7786.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"An Intronic GBF1 Variant (c.2015-19C\u003eG) is Associated with Charcot-Marie-Tooth Disease Type 2GG by Disrupting mRNA Splicing and a comprehensive review of the literature.","fulltext":[{"header":"Introduction","content":"\u003cp\u003eCharcot-Marie-Tooth disease (CMT), also known as hereditary motor and sensory neuropathy, is one of the most common inherited peripheral neuropathies, with a prevalence of approximately 1:2500\u003csup\u003e[1]\u003c/sup\u003e. It exhibits marked clinical and genetic heterogeneity and is predominantly inherited in an autosomal dominant manner. Clinically, CMT can be classified into three subtypes based on neuropathological features and patterns of inheritance: (1) Demyelinating type (CMT1): Primarily characterized by demyelination of peripheral nerves, leading to reduced nerve conduction velocity (NCV) (\u0026lt;38 m/s). (2) Axonal type (CMT2): Characterized by axonal degeneration with relatively preserved myelin sheaths, presenting with normal or mildly reduced NCV (\u0026gt;38 m/s). (3) Intermediate type (ICMT): Features both demyelination and axonal degeneration, with NCV ranging between 35–45 m/s\u003csup\u003e[2]\u003c/sup\u003e. Among these, CMT2 accounts for approximately 24% of all CMT cases\u003csup\u003e[3]\u003c/sup\u003e, and is clinically characterized by slowly progressive distal muscle weakness and atrophy, predominantly affecting the lower limbs, often resulting in gait disturbances and musculoskeletal deformities. Although onset typically occurs in adulthood, some patients may exhibit mild symptoms during childhood.\u003c/p\u003e\n\u003cp\u003eCharcot-Marie-Tooth type 2GG (CMT2GG) is a newly identified subtype of autosomal dominant axonal peripheral neuropathy (OMIM 606483), primarily caused by heterozygous mutations in the Golgi brefeldin A-resistant guanine nucleotide exchange factor 1 (\u003cem\u003eGBF1\u003c/em\u003e, MIM 603698). The \u003cem\u003eGBF1\u003c/em\u003e gene is located on chromosome 10q24.1 and encodes a protein of 1859 amino acids with a molecular weight exceeding 200 kDa\u003csup\u003e[4]\u003c/sup\u003e. \u003cem\u003eGBF1\u003c/em\u003e belongs to the guanine nucleotide exchange factors (GEFs) family for ADP-ribosylation factor 1 (Arf), playing a critical role in the cycling of Arf between its inactive and active GTP-bound forms. \u003cem\u003eGBF1\u003c/em\u003e is expressed in more than 25 tissues, predominantly in neurons associated with motor neuron diseases, and is involved in endoplasmic reticulum (ER)-Golgi transport\u003csup\u003e[5]\u003c/sup\u003e. \u003cem\u003eGBF1\u003c/em\u003e mutation can lead to the dissociation of coat protein complex I (COPI) from the Golgi membrane and its dispersion into the cytoplasm. This disruption ultimately causes the collapse of the Golgi apparatus into the ER, severely impairing the transport of transmembrane proteins\u003csup\u003e[6]\u003c/sup\u003e. Therefore, \u003cem\u003eGBF1\u003c/em\u003e is essential for ER-Golgi transport, the formation, differentiation, and trafficking of ER-Golgi intermediate compartment, and maintaining the structural integrity of the Golgi apparatus, serving as a key regulator of membrane trafficking in both the secretory and endosomal signaling pathways\u003csup\u003e[7]\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eMendoza-Ferreira et al.\u003csup\u003e[8]\u003c/sup\u003eidentified four heterozygous mutations (three missense and one nonsense) in the exonic regions of \u003cem\u003eGBF1\u003c/em\u003e across four families comprising seven affected individuals. These mutations disrupted the localization and function of \u003cem\u003eGBF1\u003c/em\u003e in the Golgi apparatus, leading to Golgi fragmentation, with affected individuals manifesting CMT2GG. Valentina Ciampana et al.\u003csup\u003e[9]\u003c/sup\u003e identified a heterozygous mutation in exon 10 of \u003cem\u003eGBF1\u003c/em\u003e in two siblings, resulting in a valine deletion and subsequent onset of CMT2GG. Pre-mRNA splicing is a common post-transcriptional regulatory process in eukaryotes, with approximately 10%–62% of pathogenic single-nucleotide variants affecting alternative splicing by disrupting splice sites\u003csup\u003e[10]\u003c/sup\u003e. Previous studies have established a close association between various heterozygous exonic mutations in \u003cem\u003eGBF1\u003c/em\u003e and the pathogenesis of CMT2GG\u003csup\u003e[8, 9]\u003c/sup\u003e. However, no pathogenic splice-site variant has been reported. This study identified a c.2015-19C\u0026gt;G variant in intron 16 of the \u003cem\u003eGBF1\u003c/em\u003e gene, which affects normal mRNA splicing. Based on the previously reported association between GBF1 and CMT2GG, we speculate that this mutation could potentially have a substantial impact on the pathogenic mechanisms of CMT2GG. This finding provides a novel perspective for research direction of CMT2GG.\u003c/p\u003e"},{"header":"Subjects and Methods","content":"\u003cp\u003e\u003cstrong\u003e1.1 Research Subject\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA patient (female, aged 62) diagnosed with CMT2GG based on clinical and electrophysiological findings at the Department of Neurology, Chuxiong Prefecture People's Hospital in June 2022 was enrolled in this study. The patient presented with more than one year of slurred speech, dysarthria, and choking while drinking, followed by progressive limb weakness, muscle atrophy, and diffuse muscle edema. Electromyography indicated widespread neurogenic damage with electrophysiological abnormalities involving cervical, thoracic, and lumbosacral segments. The patient denied any family history of genetic disorders and had one daughter who did not exhibit similar symptoms. Neurological examinations were conducted by specialized neurologists from the hospital. Comprehensive data, including clinical symptoms, physical signs, neurophysiological findings, and pathological results, were retrospectively analyzed. The study was conducted in accordance with human research guidelines stated in the Declaration of Helsinki and approved by the Ethics Committee of Chuxiong Yi Autonomous Prefecture People's Hospital (KYCS2024017), and informed consent was obtained from the patient and her legal guardian. NCV testing and needle electromyography were performed in accordance with the standard protocols for motor neuron diseases.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e1.2 Methods\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e1.2.1 Neurophysiological Examination\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNCV testing and needle electromyography were conducted following standard protocols for motor neuron diseases. The nerves examined included motor nerves (bilateral median, ulnar, common peroneal, and tibial nerves) and sensory nerves (bilateral median, ulnar, sural, superficial peroneal, and superficial radial nerves). The following parameters were assessed: motor nerve conduction velocity (MNCV), latency, conduction distance, compound muscle action potential (CMAP) amplitude; sensory nerve conduction velocity (SNCV), latency, conduction distance, and sensory nerve action potential (SNAP) amplitude. Needle electromyography was performed on the following muscles: sternocleidomastoid, genioglossus, paraspinal muscles, biceps brachii, flexor carpi radialis, dorsal interosseous, gastrocnemius, rectus femoris, and tibialis anterior. Additionally, bilateral ulnar and radial nerves were assessed using F-wave testing, and repetitive nerve stimulation (RNS) was performed on the left abductor digiti minimi, right trapezius, and right orbicularis oculi muscles.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e1.2.2 Whole-exome sequencing for Gene Mutation Analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePeripheral venous blood (4 mL, EDTA anticoagulated) was collected from the patient and her daughter. Genomic DNA was isolated from the peripheral blood of the proband and her daughter. All processes were conducted according to the manufacturer's protocols. High-throughput sequencing was performed to analyze the exonic regions and ±20 bp of the intronic flanking sequences of approximately 20,000 genes in the patient's genomic DNA. First-generation Sanger sequencing was used for validation of the detected variants. The analysis focused on pathogenic genes associated with the nervous system, ataxia, and neuromuscular diseases. Variants were identified and annotated using databases including 1000 Genomes (http://www.1000genomes.org), gnomAD (http://gnomad-old.broadinstitute.org), ClinVar (https://www.ncbi.nlm.nih.gov/clinvar/), OMIM (http://omim.org/), and HGMD (http://www.biobase-international.com/product/hgmd). Available family members were also tested for segregation analysis\u003csup\u003e[11]\u003c/sup\u003e. The pathogenicity of candidate variants was interpreted according to the guidelines of the American College of Medical Genetics and Genomics (ACMG).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e1.2.3 RT-PCR Validation of the Impact of the Variant on mRNA Splicing\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal RNA was extracted from the patient's peripheral blood samples using a total RNA extraction kit (Genstone Biotech, Cat. No.: TR121-50). The reverse transcription reaction mixture was prepared on ice according to the manufacturer's protocols (YEASEN, Cat. No.: 11123ES70), mixed by vortexing, briefly centrifuged, and then incubated in a PCR instrument at 55°C for 15 min, followed by 85°C for 5 min. The resulting 20 µL cDNA was either stored on ice for immediate use or at -20°C for later experiments.\u003c/p\u003e\n\u003cp\u003eBased on the mutation site and gene sequence, RT-PCR primers were designed, as listed in Table 1. The synthesized cDNA served as the template for PCR amplification (TaKaRa, Cat. No.: R045A). The reaction mixture was prepared according the protocol in qPCR tubes, mixed thoroughly, briefly centrifuged, and then subjected to amplification on a real-time PCR instrument (Bio-Rad, Model: T100). The PCR amplification program was as follows: 95°C for 5 min, 95°C for 30 s, 57°C for 30 s, 72°C for 90 s (35 cycles), and 72°C for 5 min. PCR products were analyzed by 2% agarose gel electrophoresis. The amplified PCR products were subjected to gel extraction, and the recovered fragments were subsequently analyzed by Sanger sequencing.\u003c/p\u003e\n\u003cp\u003eTable 1 \u0026nbsp;Primer Design\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003ePrimer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003ePrimer sequence 5'-3'\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eGBF1\u003c/em\u003e-1455-F1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eAGCATGCGAGAGCACCTCAA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eGBF1\u003c/em\u003e-1591-F2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eATCCCCAGCTTTGTCACAGA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eGBF1\u003c/em\u003e-2497-R1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eGCATGATGACAGCATAGGCC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eGBF1\u003c/em\u003e-2426-R2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eAACGCTCTGTGAATGCCTCC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003e2.1 Clinical Characteristics\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe patient first presented to the hospital in June 2022 with no family history of similar disorders and denied consanguineous marriage. Disease onset occurred at the age of 61, with initial symptoms of hoarseness, slurred speech, dysphagia, and prolonged mealtimes, followed by choking while drinking and progressive involvement of the distal lower limbs. Six months after onset, the patient exhibited impaired movement of the left lower limb, which gradually progressed to the left hand and the right limbs. By one year after onset, the patient had lost the ability to swallow food or drink water, experienced severe sialorrhea, and required nasal feeding for nutrition and medication. She exhibited significant generalized muscle atrophy, was completely unable to walk.\u003c/p\u003e\n\u003cp\u003eAt follow-up in March 2024, the patient presented with marked cachexia (weight: 39 kg), difficulty with mouth opening, tongue extension, chewing, and swallowing, dysarthria, rigid facial expression, hyperactive pharyngeal reflexes, and a grade 5 result on the water-swallowing test. Generalized muscle atrophy of the trunk was observed, along with symmetric atrophy of proximal and distal limb muscles, and notable wasting of the thenar, hypothenar, and interosseous muscles of both hands (Figure 1). Muscle strength on the left side was graded 4/5 in wrist flexion/extension, forearm, and upper arm, with left foot drop and 3/5 strength in both distal and proximal lower limbs; on the right side, muscle strength was 3/5 in wrist flexion/extension, forearm, upper arm, and both distal and proximal lower limbs, accompanied by right foot drop. Muscle tone was increased in both proximal and distal limb muscles. For the left side, tendon reflexes were hyperactive in the upper limb (biceps, triceps, and brachioradialis) and exaggerated in the lower limb (patellar and Achilles). For the right side, tendon reflexes were hyperactive in both upper (biceps, triceps, and brachioradialis) and lower limbs (patellar and Achilles). Pathological reflexes included bilateral positive Hoffmann\u0026apos;s signs in the upper limbs and positive Babinski\u0026apos;s and Chaddock\u0026apos;s signs in the lower limbs, while superficial and deep sensation in the distal limbs remained generally preserved.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.2 Neurophysiological Findings\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNeurophysiological examination revealed that MNCV and SNCV were within normal ranges in both upper and lower limbs, except for a reduced SNAP in the right ulnar nerve. However, a decrease in CMAP was observed in certain muscles. Additionally, the right ulnar nerve showed reduced F-wave persistence (Figure 3). Electromyography (EMG) demonstrated spontaneous activity in some examined muscles of both upper and lower limbs as well as the paraspinal muscles. Some muscles exhibited motor unit potentials (MUPs) with prolonged duration, increased peak amplitude, and reduced recruitment patterns. These findings suggest widespread neurogenic damage involving the cervical, thoracic, lumbar, sacral, and intracranial segments, with partial involvement of the right ulnar nerve. The results are consistent with anterior horn cell degeneration-related diseases.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.3 Genetic Screening Results\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWhole-exome sequencing(WES) was performed on both the patient and her daughter, then reads were aligned to the human reference genome GRCh38 (hg38). A heterozygous intronic variant in GBF1, chr10:102363691 C\u0026gt;G (c.1754-3C\u0026gt;G; NM_004193.3), was identified (Figure 4). In silico splicing predictors (SpliceAI \u0026Delta;=0.97, MaxEntScan \u0026Delta;=\u0026minus;8.1) indicate a strong loss-of-function effect that aligns with high regional genomic constraint (LOEUF = 0.17).According to the 2015 ACMG guidelines\u003csup\u003e[11]\u003c/sup\u003e, this variant was classified as a variant of uncertain significance (VUS) with evidence codes PM2_Supporting and PM4. The inheritance pattern of CMT2GG is autosomal dominant. However, this variant was not detected in the patient\u0026apos;s daughter (Mei Cao) (Figure 4).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.4 Effects of the Variant on mRNA Splicing\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNested RT-PCR targeting exons 12\u0026ndash;16 of the canonical 835-bp GBF1 transcript was performed on the patient and a healthy control using the designed primers. Electrophoresis results revealed two bands in the healthy control and nine in the patient (Figure 5C). The PCR products from both the healthy control and the patient were subsequently purified, subjected to TA cloning, and analyzed via Sanger sequencing (Table 4). Sequencing results confirmed that the healthy control did not carry the mutation and exhibited bands corresponding to normal splicing as well as transcripts with skipping of three exons. In contrast, the patient, who carried the c.2015-19C\u0026gt;G mutation, displayed bands of both normal splicing and multiple aberrant splicing patterns. The detailed splicing patterns are illustrated in Figure 2B.\u003c/p\u003e\n\u003cp\u003eTable 2. Sanger sequencing results\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 46px;\"\u003e\n \u003cp\u003eBand\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 257px;\"\u003e\n \u003cp\u003eSplicing Pattern\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003eReading Frame\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 180px;\"\u003e\n \u003cp\u003eExpression at cDNA and Protein Level\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 46px;\"\u003e\n \u003cp\u003ea\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 257px;\"\u003e\n \u003cp\u003eExon14（195bp）-Exon15（190bp）-Exon16（141bp）-Exon17（89bp）-Exon18（203bp）-Exon19（124bp）\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003eUnchanged\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 180px;\"\u003e\n \u003cp\u003eNormal expression\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 46px;\"\u003e\n \u003cp\u003eb\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 257px;\"\u003e\n \u003cp\u003eExon14（195bp）-Exon18（203bp）-Exon19（124bp）\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003eUnchanged\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 180px;\"\u003e\n \u003cp\u003ec.1684_2013del p.Asn562_Gly671del\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 46px;\"\u003e\n \u003cp\u003ec\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 257px;\"\u003e\n \u003cp\u003eExon14（195bp）-△Exon15（154bp）-Exon16（141bp）-Exon17（89bp）-Exon18（203bp）-Exon19（124bp）\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003eAltered\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 180px;\"\u003e\n \u003cp\u003ec.1839_1873del\u003c/p\u003e\n \u003cp\u003ep.Glu614\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 46px;\"\u003e\n \u003cp\u003ed\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 257px;\"\u003e\n \u003cp\u003eExon14（195bp）-△Exon15（2bp）-△Exon19（70bp）\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003eUnchanged\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 180px;\"\u003e\n \u003cp\u003ec.1686_2360del p.Asn562_Glu787delinsLys\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 46px;\"\u003e\n \u003cp\u003ee\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 257px;\"\u003e\n \u003cp\u003eExon14（195bp）-Exon15-△Exon16（63bp）-△Exon19（84bp）\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003eAltered\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 180px;\"\u003e\n \u003cp\u003ec.1937_2346del p.Leu646Profs31\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 46px;\"\u003e\n \u003cp\u003ef\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 257px;\"\u003e\n \u003cp\u003eExon14（195bp）-Exon15-△Exon16（30bp）-△Exon19（24bp）\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003eAltered\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 180px;\"\u003e\n \u003cp\u003ec.1904_2406del\u003c/p\u003e\n \u003cp\u003ep. \u003ca href=\"https://mutalyzer.nl/normalizer/NM_004193.3(NP_004184.1):p.(Val635Glyfs*11)\"\u003eVal635Glyfs11\u003c/a\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 46px;\"\u003e\n \u003cp\u003eg\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 257px;\"\u003e\n \u003cp\u003eExon14（195bp）-Exon15-△Exon16（22bp）-△Exon19（71bp）\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003eUnchanged\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 180px;\"\u003e\n \u003cp\u003ec.1896_2459del\u003c/p\u003e\n \u003cp\u003ep. Lys633_Ser820del\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 46px;\"\u003e\n \u003cp\u003eh\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 257px;\"\u003e\n \u003cp\u003e△Exon14（129bp）-△Exon19（75bp）\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003eAltered\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 180px;\"\u003e\n \u003cp\u003ec.1618_2360del p.Ile540Serfs26\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 46px;\"\u003e\n \u003cp\u003ei\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 257px;\"\u003e\n \u003cp\u003eExon14（195bp）-Exon19（124bp）\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 85px;\"\u003e\n \u003cp\u003eAltered\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 180px;\"\u003e\n \u003cp\u003ec.1684_2306del\u003c/p\u003e\n \u003cp\u003ep. Asn562Hisfs44\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e"},{"header":"Discussion","content":"\u003cp\u003eDue to the high clinical and genetic heterogeneity of CMT, its diagnosis remains challenging\u003csup\u003e[12]\u003c/sup\u003e. Currently, the overall diagnostic rate of CMT, especially CMT2, is relatively low\u003csup\u003e[13, 14]\u003c/sup\u003e. As a rare subtype of CMT2, CMT2GG has been reported in only nine cases\u003csup\u003e[8, 9]\u003c/sup\u003e. Therefore, expanding the spectrum of pathogenic variants associated with CMT2GG and elucidating their underlying molecular mechanisms is of considerable significance for improving the diagnosis and treatment of this disease\u003csup\u003e[15, 16]\u003c/sup\u003e. This study identified a heterozygous intronic variant in \u003cem\u003eGBF1\u003c/em\u003e (c.1754-3C\u0026gt;G) that resulted in a clinical phenotype consistent with CMT2GG. This variant leads to abnormal mRNA splicing, resulting in exon skipping or partial exon deletions and ultimately generating truncated or amino acid-deficient \u003cem\u003eGBF1\u003c/em\u003e protein products.\u003c/p\u003e\n\u003cp\u003eRNA splicing represents a crucial step in eukaryotic gene expression, bridging transcriptional outputs to translational processes through the precise excision of introns and ligation of exons\u003csup\u003e[17]\u003c/sup\u003e. This process not only accounts for the discontinuity of genes in eukaryotes but also enhances transcript diversity and enables dynamic post-transcriptional regulation\u003csup\u003e[18]\u003c/sup\u003e. Aberrant alternative splicing has been recognized as a major contributor to various diseases. It is estimated that approximately 50% of pathogenic mutations affect RNA splicing\u003csup\u003e[19]\u003c/sup\u003e, and over one-third of inherited disorders are attributable to splicing abnormalities\u003csup\u003e[20]\u003c/sup\u003e. Accurate splicing requires precise recognition of the dinucleotide sequences at intron boundaries (GT at the 5′ end and AG at the 3′ end), which serve as key elements for spliceosome recognition and binding\u003csup\u003e[21, 22]\u003c/sup\u003e. Mutations within introns that disrupt these conserved splice sites may impede proper spliceosome binding, thereby altering the fidelity of splicing. For instance, such disruptions can lead to the utilization of cryptic splice sites, exon skipping, or intron retention, resulting in aberrant mRNA transcripts\u003csup\u003e[23]\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eYilai Han et al. demonstrated that the c.1754-3C\u0026gt;G intronic mutation disrupts the NYAG/G consensus sequence at the 3′ splice site, leading to exon 13 skipping. This generates a truncated CSF1R protein and impairs its tyrosine kinase activity, revealing a novel pathogenic mechanism involving splicing defects in CSF1R\u003csup\u003e[24]\u003c/sup\u003e. In addition, introns contain numerous splicing regulatory elements (enhancers or silencers). Intronic mutations can disrupt these elements, thereby altering splicing patterns. For example, mutations may abrogate enhancer activity or augment silencer function, leading to exon skipping or intron retention and ultimately compromising protein structure and function\u003csup\u003e[25]\u003c/sup\u003e. Homolová et al. reported a deep intronic mutation (c.903+469T\u0026gt;C) in the MTRR gene, which introduced a novel SF2/ASF-binding exonic splicing enhancer, leading to pseudo-exon activation and causing cblE-type homocystinuria\u003csup\u003e[26]\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003ePrevious studies on \u003cem\u003eGBF1\u003c/em\u003e primarily focused on its coding regions, while intronic mutations have received comparatively little attention. This study identified a novel intronic variant c.2015-19C\u0026gt;G in \u003cem\u003eGBF1\u003c/em\u003e, which perturbs alternative mRNA splicing, resulting in multiple aberrant splice variants. Such splicing abnormalities may lead to reduced expression or loss of function of \u003cem\u003eGBF1\u003c/em\u003e, thereby compromising Golgi apparatus integrity and its intracellular trafficking functions. The Golgi apparatus plays a critical role in neurons by mediating protein modification, transport, and secretion. Its fragmentation can disrupt the localization and function of key proteins such as neurotransmitter receptors and ion channels, impairing neurotransmitter release\u003csup\u003e[13, 14]\u003c/sup\u003e. Moreover, \u003cem\u003eGBF1\u003c/em\u003e mutations have been implicated in the dysregulation of mitochondrial transport and localization, further exacerbating neuronal damage\u003csup\u003e[27]\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eGBF1\u003c/em\u003e has been demonstrated to be widely expressed in tissues and cells relevant to hereditary motor neuropathies (HMN) and CMT2 phenotypes, including the spinal cord, brain, muscle tissue, and motor neurons (MNs)\u003csup\u003e[8]\u003c/sup\u003e. \u003cem\u003eGBF1\u003c/em\u003e promotes the GDP-GTP exchange of Arf proteins, facilitating COPI vesicle formation, Golgi maintenance, and mitochondrial trafficking and positioning\u003csup\u003e[28, 29]\u003c/sup\u003e. In Caenorhabditis elegans, inactivation of gbf-1 leads to severe muscle dysfunction and developmental arrest\u003csup\u003e[30]\u003c/sup\u003e. In vertebrate models such as zebrafish, \u003cem\u003eGBF1\u003c/em\u003e mutations result in vascular collapse and evident intracerebral and trunk hemorrhages\u003csup\u003e[31]\u003c/sup\u003e. These findings highlight \u003cem\u003eGBF1\u003c/em\u003e's vital role in neuronal tissue, particularly in regions implicated in motor neuron pathology, as well as its essential contribution to the maintenance of normal neuronal physiology. \u003cem\u003eGBF1\u003c/em\u003e encodes a protein of 1859 amino acids, rendering it relatively intolerant to missense mutations (Z-score = 4.16; observed/expected ratio: 0.74, gnomAD v2.1.1, accessed July 2025), indicating that any mutation affecting its coding sequence or splicing may lead to severe functional impairments.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eFive heterozygous pathogenic variants associated with CMT2GG (c.855-857delGTG p.Val286del, c.3410C\u0026gt;T p.Ala1137Val, c.4382G\u0026gt;A p.Arg1461Gln, c.2945G\u0026gt;A p.Cys982Tyr, c.3525G\u0026gt;A p.Trp1175Ter) have been reported in five families\u003csup\u003e[8, 9]\u003c/sup\u003e. The onset of this disorder ranges from childhood to adulthood. In pediatric cases, primary manifestations include delayed motor development, while adult onset is characterized by lower limb muscle spasms, sensory deficits, gait instability, and foot deformities. As the disease progresses, symptoms gradually worsen and eventually involve generalized muscle weakness and atrophy, predominantly affecting the lower limbs.\u003c/p\u003e\n\u003cp\u003eIn this study, the detected variant (c.1754-3C\u0026gt;G) was classified as a VUS. The initial clinical presentation included slurred speech, dysarthria, and choking while drinking, followed by progressive limb weakness, muscle atrophy, and diffuse muscular edema. Most CMT2GG patients exhibit MNCV within normal or mildly reduced ranges; SNCV may be normal or mildly abnormal, with some patients showing reduced SNAP amplitudes or slowed conduction velocities. Needle EMG typically reveals chronic neurogenic changes and spontaneous activity, such as fibrillation potentials and positive sharp waves. In this study, needle EMG in the reported patient demonstrated widespread neurogenic damage, spontaneous activity, prolonged motor unit potential duration, increased peak amplitude, and reduced recruitment. Although CMT2GG usually progresses slowly with relatively stable symptoms, this patient exhibited unusually rapid deterioration, with complete loss of swallowing ability and severe generalized muscle atrophy, rendering ambulation impossible within approximately one year of onset. While the clinical phenotype largely aligns with typical CMT2GG manifestations, the atypical initial symptoms and accelerated progression may be attributable to the particularly deleterious effects of this specific variant.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;As far as we know, this is the first report on patients with CMT2GG from the Asian population. This study broadens the mutational spectrum associated with CMT2GG,offering novel insights into the genetic and pathogenic mechanisms underlying this rare subtype of CMT. Meanwhile, it underscores the necessity of including intronic regions in genetic analyses, particularly in cases with a high suspicion of CMT where exonic sequencing fails to identify pathogenic variants. Nevertheless, this study has certain limitations. The small sample size constrains the ability to comprehensively capture the clinical heterogeneity and genetic diversity of CMT2GG. Although RT-PCR confirmed the impact of the \u003cem\u003eGBF1\u003c/em\u003e intronic variant on mRNA splicing, no further functional studies were conducted to evaluate its impact on \u003cem\u003eGBF1\u003c/em\u003e protein function. Future investigations with larger cohorts and in-depth functional analyses are warranted to elucidate the pathogenic mechanisms of CMT2GG, thereby providing more robust evidence to inform clinical diagnosis and therapeutic strategies.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was conducted in accordance with the Declaration of Helsinki, with written informed consent obtained from all patients or their legal guardians. The study protocol was approved by the Ethics Committee of the People's Hospital of Chuxiong Yi Autonomous Prefecture (KYCS2024017).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to publish\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eInformed consent was obtained from the enrolled families to allow publication of the clinical and diagnostic information collected in the study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eYunnan Provincial Department of Education Scientifc Research（2025J0793）；National Clinical Key Specialty Construction Project of Cardiovascular Medicine at Chuxiong People's Hospital（2024ZK01）；Scientific Research Project of Chuxiong Medical College（2019YYMX01）；Scientific Research Fund of the People's Hospital of Chuxiong Yi Autonomous Prefecture（2023Y05）；Doctoral Research Project of the Kunming Medical University Second Affiliated Hospital（2025BS16）\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor's ’contribution\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eJian Han and Ying Hu organized and designed the study.Jian Han provided funding support for the project.Wenqian Zhao and Yanping Zhu was responsible for implementing the research and drafting the manuscript. Yuyan Wu and Yurong Zheng contributed to the case collection and follow-up of patients. Jinghua Gao, Honghan Zhang , Lanxin Ma and Xiaoling Liu collected and analyzed the data. All authors reviewed the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and material\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets used and/or analysed during the current study available from the corresponding author on reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eBarisic N, Claeys KG, Sirotković-Skerlev M et al (2008) Ann Hum Genet 72(Pt 3):416\u0026ndash;441. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://dx.doi.org/10.1111/j.1469-1809.2007.00412.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1469-1809.2007.00412.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Charcot-Marie-Tooth disease: a clinico-genetic confrontation [J]\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBerciano J, Garc\u0026iacute;a A, Gallardo E et al (2017) Intermediate Charcot-Marie-Tooth disease: an electrophysiological reappraisal and systematic review [J]. J Neurol 264(8):1655\u0026ndash;1677. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://dx.doi.org/10.1007/s00415-017-8474-3\u003c/span\u003e\u003cspan address=\"10.1007/s00415-017-8474-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePisciotta C, Bertini A, Tramacere I et al (2023) Clinical spectrum and frequency of Charcot-Marie-Tooth disease in Italy: Data from the National CMT Registry [J]. Eur J Neurol 30(8):2461\u0026ndash;2470. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://dx.doi.org/10.1111/ene.15860\u003c/span\u003e\u003cspan address=\"10.1111/ene.15860\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMansour SJ, Herbrick JA, Scherer SW et al (1998) Human GBF1 is a ubiquitously expressed gene of the sec7 domain family mapping to 10q24 [J]. Genomics 54(2):323\u0026ndash;327. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://dx.doi.org/10.1006/geno.1998.5563\u003c/span\u003e\u003cspan address=\"10.1006/geno.1998.5563\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBarzilay E, Ben-Califa N, Hirschberg K et al (2005) Uncoupling of brefeldin a-mediated coatomer protein complex-I dissociation from Golgi redistribution [J]. Traffic 6(9):794\u0026ndash;802. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://dx.doi.org/10.1111/j.1600-0854.2005.00317.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1600-0854.2005.00317.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee TH, Linstedt AD (2000) Potential role for protein kinases in regulation of bidirectional endoplasmic reticulum-to-Golgi transport revealed by protein kinase inhibitor H89 [J]. Mol Biol Cell 11(8):2577\u0026ndash;2590. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://dx.doi.org/10.1091/mbc.11.8.2577\u003c/span\u003e\u003cspan address=\"10.1091/mbc.11.8.2577\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMagliozzi R, Carrero ZI, Low TY et al (2018) Inheritance of the Golgi Apparatus and Cytokinesis Are Controlled by Degradation of GBF1 [J]. Cell Rep 23(11):3381\u0026ndash;3391e3384. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e.http://dx.doi.org/10.1016/j.celrep.2018.05.031\u003c/span\u003e\u003cspan address=\".10.1016/j.celrep.2018.05.031\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMendoza-Ferreira N, Karakaya M, Cengiz N et al (2020) De Novo and Inherited Variants in GBF1 are Associated with Axonal Neuropathy Caused by Golgi Fragmentation [J]. Am J Hum Genet 107(4):763\u0026ndash;777. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://dx.doi.org/10.1016/j.ajhg.2020.08.018\u003c/span\u003e\u003cspan address=\"10.1016/j.ajhg.2020.08.018\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCiampana V, Corrado L, Magistrelli L et al (2024) A Novel GBF1 Variant in a Charcot-Marie-Tooth Type 2: Insights from Familial Analysis [J]. Genes (Basel) 15(12). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://dx.doi.org/10.3390/genes15121556\u003c/span\u003e\u003cspan address=\"10.3390/genes15121556\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi K, Xiao J, Ling Z et al (2024) Prioritizing de novo potential non-canonical splicing variants in neurodevelopmental disorders [J]. EBioMedicine 99:104928. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://dx.doi.org/10.1016/j.ebiom.2023.104928\u003c/span\u003e\u003cspan address=\"10.1016/j.ebiom.2023.104928\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRichards S, Aziz N, Bale S et al (2015) Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology [J]. Genet Med 17(5):405\u0026ndash;424. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://dx.doi.org/10.1038/gim.2015.30\u003c/span\u003e\u003cspan address=\"10.1038/gim.2015.30\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNam SH, Hong YB, Hyun YS et al (2016) Identification of Genetic Causes of Inherited Peripheral Neuropathies by Targeted Gene Panel Sequencing [J]. Mol Cells 39(5):382\u0026ndash;388. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://dx.doi.org/10.14348/molcells.2016.2288\u003c/span\u003e\u003cspan address=\"10.14348/molcells.2016.2288\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHaukedal H, Corsi GI, Gadekar VP et al (2023) Golgi fragmentation - One of the earliest organelle phenotypes in Alzheimer's disease neurons [J]. Front Neurosci 17:1120086. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://dx.doi.org/10.3389/fnins.2023.1120086\u003c/span\u003e\u003cspan address=\"10.3389/fnins.2023.1120086\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGonatas NK, Stieber A, Gonatas JO (2006) Fragmentation of the Golgi apparatus in neurodegenerative diseases and cell death [J]. J Neurol Sci 246(1\u0026ndash;2):21\u0026ndash;30. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://dx.doi.org/10.1016/j.jns.2006.01.019\u003c/span\u003e\u003cspan address=\"10.1016/j.jns.2006.01.019\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGemelli C, Geroldi A, Massucco S et al (2022) Life (Basel) 12(3). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://dx.doi.org/10.3390/life12030402\u003c/span\u003e\u003cspan address=\"10.3390/life12030402\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Genetic Workup for Charcot-Marie-Tooth Neuropathy: A Retrospective Single-Site Experience Covering 15 Years [J]\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRudnik-Sch\u0026ouml;neborn S, T\u0026ouml;lle D, Senderek J et al (2016) Diagnostic algorithms in Charcot-Marie-Tooth neuropathies: experiences from a German genetic laboratory on the basis of 1206 index patients [J]. Clin Genet 89(1):34\u0026ndash;43. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://dx.doi.org/10.1111/cge.12594\u003c/span\u003e\u003cspan address=\"10.1111/cge.12594\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eApostolidi M, Stamatopoulou V (2023) Aberrant splicing in human cancer: An RNA structural code point of view [J]. Front Pharmacol 14:1137154. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://dx.doi.org/10.3389/fphar.2023.1137154\u003c/span\u003e\u003cspan address=\"10.3389/fphar.2023.1137154\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eScotti MM, Swanson MS (2016) RNA mis-splicing in disease [J]. Nat Rev Genet 17(1):19\u0026ndash;32. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://dx.doi.org/10.1038/nrg.2015.3\u003c/span\u003e\u003cspan address=\"10.1038/nrg.2015.3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePan Q, Shai O, Lee LJ et al (2008) Deep surveying of alternative splicing complexity in the human transcriptome by high-throughput sequencing [J]. Nat Genet 40(12):1413\u0026ndash;1415. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://dx.doi.org/10.1038/ng.259\u003c/span\u003e\u003cspan address=\"10.1038/ng.259\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLopez-Bigas N, Audit B, Ouzounis C et al (2005) Are splicing mutations the most frequent cause of hereditary disease? [J]. FEBS Lett 579(9):1900\u0026ndash;1903. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://dx.doi.org/10.1016/j.febslet.2005.02.047\u003c/span\u003e\u003cspan address=\"10.1016/j.febslet.2005.02.047\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHoskins AA, Moore MJ (2012) The spliceosome: a flexible, reversible macromolecular machine [J]. Trends Biochem Sci 37(5):179\u0026ndash;188. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://dx.doi.org/10.1016/j.tibs.2012.02.009\u003c/span\u003e\u003cspan address=\"10.1016/j.tibs.2012.02.009\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFica SM, Nagai K (2017) Cryo-electron microscopy snapshots of the spliceosome: structural insights into a dynamic ribonucleoprotein machine [J]. Nat Struct Mol Biol 24(10):791\u0026ndash;799. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://dx.doi.org/10.1038/nsmb.3463\u003c/span\u003e\u003cspan address=\"10.1038/nsmb.3463\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBaralle D, Baralle M (2005) Splicing in action: assessing disease causing sequence changes [J]. J Med Genet 42(10):737\u0026ndash;748. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://dx.doi.org/10.1136/jmg.2004.029538\u003c/span\u003e\u003cspan address=\"10.1136/jmg.2004.029538\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHan Y, Han J, Li Z et al (2024) Identification and characterization of a novel intronic splicing mutation in CSF1R-related leukoencephalopathy [J]. CNS Neurosci Ther 30(6):e14815. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e.http://dx.doi.org/10.1111/cns.14815\u003c/span\u003e\u003cspan address=\".10.1111/cns.14815\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePagani F, Baralle FE (2004) Genomic variants in exons and introns: identifying the splicing spoilers [J]. Nat Rev Genet 5(5):389\u0026ndash;396. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://dx.doi.org/10.1038/nrg1327\u003c/span\u003e\u003cspan address=\"10.1038/nrg1327\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHomolova K, Zavadakova P, Doktor TK et al (2010) The deep intronic c.903\u0026thinsp;+\u0026thinsp;469T\u0026thinsp;\u0026gt;\u0026thinsp;C mutation in the MTRR gene creates an SF2/ASF binding exonic splicing enhancer, which leads to pseudoexon activation and causes the cblE type of homocystinuria [J]. Hum Mutat 31(4):437\u0026ndash;444. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://dx.doi.org/10.1002/humu.21206\u003c/span\u003e\u003cspan address=\"10.1002/humu.21206\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWalch L, Pellier E, Leng W et al (2018) GBF1 and Arf1 interact with Miro and regulate mitochondrial positioning within cells [J]. Sci Rep 8(1):17121. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://dx.doi.org/10.1038/s41598-018-35190-0\u003c/span\u003e\u003cspan address=\"10.1038/s41598-018-35190-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDonaldson JG, Jackson CL (2011) ARF family G proteins and their regulators: roles in membrane transport, development and disease [J]. Nat Rev Mol Cell Biol 12(6):362\u0026ndash;375. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://dx.doi.org/10.1038/nrm3117\u003c/span\u003e\u003cspan address=\"10.1038/nrm3117\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZou YJ, Shan MM, Pan ZN et al (2021) Loss of Arf Guanine Nucleotide Exchange Factor GBF1 Activity Disturbs Organelle Dynamics in Mouse Oocytes [J]. Microsc Microanal 27(2):400\u0026ndash;408. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://dx.doi.org/10.1017/s1431927620024885\u003c/span\u003e\u003cspan address=\"10.1017/s1431927620024885\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAckema KB, Hench J, B\u0026ouml;ckler S et al (2014) The small GTPase Arf1 modulates mitochondrial morphology and function [J]. Embo j 33(22):2659\u0026ndash;2675. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://dx.doi.org/10.15252/embj.201489039\u003c/span\u003e\u003cspan address=\"10.15252/embj.201489039\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen J, Wu X, Yao L et al (2017) Impairment of Cargo Transportation Caused by gbf1 Mutation Disrupts Vascular Integrity and Causes Hemorrhage in Zebrafish Embryos [J]. J Biol Chem 292(6):2315\u0026ndash;2327. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://dx.doi.org/10.1074/jbc.M116.767608\u003c/span\u003e\u003cspan address=\"10.1074/jbc.M116.767608\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAttached Table 1: electromyography (EMG) test report table\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Charcot-Marie-Tooth disease type 2GG (CMT2GG), Golgi brefeldin A-resistant guanine nucleotide exchange factor 1 (GBF1), mRNA splicing, intronic variant","lastPublishedDoi":"10.21203/rs.3.rs-8304862/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8304862/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eCharcot-Marie-Tooth disease type 2GG (CMT2GG) is an autosomal dominant axonal peripheral neuropathy caused by heterozygous mutations in the \u003cem\u003eGBF1\u003c/em\u003e gene, primarily characterized by slowly progressive distal muscle weakness. Pathogenic variants of \u003cem\u003eGBF1\u003c/em\u003e associated with this disorder have been shown to be mainly located in exonic regions. This study reported a case induced by an intronic variant.\u003c/p\u003e\u003ch2\u003eObjective\u003c/h2\u003e \u003cp\u003eThis study aimed to clarify the impact of the c.2015\u0026minus;19C\u0026thinsp;\u0026gt;\u0026thinsp;G intronic variant located in intron 16 of the \u003cem\u003eGBF1\u003c/em\u003e gene on pre-mRNA splicing, as well as to elucidate its potential pathogenic mechanism in CMT2GG.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eA patient diagnosed with CMT2GG who was admitted to the Department of Neurology, Chuxiong Prefecture People's Hospital in June 2022 was retrospectively analyzed for clinical phenotype, neurophysiological findings, and imaging results. Whole-exome sequencing (WES) was performed on the proband to identify potential genetic variants, and the candidate variant was confirmed by Sanger sequencing. Reverse transcription PCR (RT-PCR) was employed to further examine the effect of the identified variant on mRNA splicing.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eThe patient exhibited marked generalized muscle atrophy, and neurophysiological assessment revealed electrophysiological changes indicative of widespread neurogenic impairment. WES identified a heterozygous \u003cem\u003eGBF1\u003c/em\u003e variant (c.2015\u0026minus;19C\u0026thinsp;\u0026gt;\u0026thinsp;G), and RT-PCR analysis confirmed that this mutation affects normal mRNA splicing, resulting in nine distinct alternatively spliced transcripts.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e \u003cp\u003eThese findings highlight the diagnostic significance of intronic variants in the \u003cem\u003eGBF1\u003c/em\u003e gene in CMT2GG.We believe this study will benefit researchers in the field and facilitate earlier diagnosis and treatment of CMT2GG.\u003c/p\u003e","manuscriptTitle":"An Intronic GBF1 Variant (c.2015-19C\u0026gt;G) is Associated with Charcot-Marie-Tooth Disease Type 2GG by Disrupting mRNA Splicing and a comprehensive review of the literature.","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-12-22 09:21:41","doi":"10.21203/rs.3.rs-8304862/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"1e0e8c2e-6173-4129-9bd7-a8233844b6a0","owner":[],"postedDate":"December 22nd, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2026-01-08T07:55:15+00:00","versionOfRecord":[],"versionCreatedAt":"2025-12-22 09:21:41","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8304862","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8304862","identity":"rs-8304862","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}