The Role and Potential Mechanism of Nuclear Protein PCNP in Retinal Neovascularization in Vitro

The Role and Potential Mechanism of Nuclear Protein PCNP in Retinal Neovascularization in Vitro | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article The Role and Potential Mechanism of Nuclear Protein PCNP in Retinal Neovascularization in Vitro Yuxi Du, Chaoyuan Xu, Yalong Dang This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7314367/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 11 Dec, 2025 Read the published version in Scientific Reports → Version 1 posted 11 You are reading this latest preprint version Abstract Purpose Retinal neovascularization (RNV) drives vision loss in diseases like diabetic retinopathy, and current anti-VEGF therapies have limitations. PEST-containing nuclear protein (PCNP) has roles in malignancy and angiogenesis, but its function in RNV is unclear. This study explored the function and underlying mechanisms of PCNP in RNV under in vitro conditions. Methods To achieve PCNP overexpression or knockdown, human umbilical vein endothelial cells (HUVECs) were subjected to transfection. The effects on cell proliferation (CCK-8 assay), migration (wound healing assay), and in vitro angiogenesis (tube formation assay) were subsequently evaluated. VEGF levels in supernatants (ELISA, CBA) and cell lysates (Western blot) were quantified. Transcriptome sequencing was performed on PCNP-overexpressing HUVECs to identify altered signaling pathways. Results PCNP overexpression significantly inhibited HUVEC proliferation, migration, and tube formation, key steps in neovascularization. Conversely, PCNP knockdown promoted these processes. While supernatant VEGF decreased unexpectedly in both groups, intracellular VEGF levels remained unchanged. Transcriptome analysis highlighted enrichment of IL-17, TNF, and NF-κB inflammatory signaling pathways with PCNP overexpression. Conclusion PCNP inhibits endothelial cell processes essential for neovascularization in vitro. The mechanism appears potentially independent of direct VEGF modulation and may involve inflammatory signaling pathways. PCNP emerges as a novel factor in RNV regulation, warranting further investigation for potential therapeutic targeting. Biological sciences/Cancer Biological sciences/Cell biology Health sciences/Diseases Biological sciences/Molecular biology Retinal Neovascularization PCNP VEGF Mechanism Transcriptome Sequencing Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 1. Introduction Retinal neovascularization (RNV) represents a pathological condition marked by the unregulated proliferation of neovascular structures within the retinal tissue. This pathological state serves as a defining feature of multiple vision-endangering disorders, including proliferative diabetic retinopathy, retinopathy of prematurity, and neovascular age-related macular degeneration. 1 , 2 The resulting vascular leakage, retinal edema, and retinal detachment can lead to severe vision impairment and blindness. 3 , 4 Current clinical treatments for neovascular retinal diseases primarily include surgical interventions like retinal laser photocoagulation and pharmacological interventions such as intraocular anti-VEGF therapy. Although these therapeutic interventions may exhibit efficacy in certain patient cohorts, they are accompanied by inherent limitations, such as potential detrimental adverse effects and the emergence of drug resistance. 5 Consequently, there exists an imperative to investigate the fundamental mechanisms underlying RNV and discover innovative therapeutic targets. The equilibrium between pro-angiogenic and anti-angiogenic factors plays a crucial role in preserving the stability of endothelial cell function. 6 Vascular endothelial growth factor (VEGF) functions as a principal promoter of angiogenesis and contributes critically to the pathological process of RNV. Under conditions of retinal ischemia and hypoxia, hypoxia-inducible factor becomes upregulated, thereby inducing the transcriptional activation of VEGF and subsequently triggering the downstream VEGF signaling cascade. 7 VEGF facilitates the proliferative and migratory activities of endothelial cells, thereby contributing to the development of neovascularization. 8 In addition to VEGF, inflammation also exerts a pivotal influence in the pathogenesis of RNV. 9 Inflammatory cell infiltration and mediator accumulation in the retinal microenvironment can promote angiogenic processes. 10 NF-κB, a key transcription factor in inflammatory signaling pathways, stimulates the production of various inflammatory mediators and pro-angiogenic factors, with VEGF acting as a major downstream target. 11 – 13 The TNF signaling axis, initiated via the ligation of TNF-α to its receptor TNFR, proceeds to engage downstream signaling cascades such as NF-κB, thereby stimulating the production of inflammatory cytokines and VEGF, and eventually contributing to pathological endothelial cell proliferation and RNV. 14 The IL-17 signaling cascade, in a parallel manner, can stimulate the synthesis of pro-inflammatory cytokines and VEGF, impair the integrity of the blood-retinal barrier, and regulate endothelial cell proliferative and migratory capacities, thereby facilitating the development of RNV. PEST-containing nuclear protein (PCNP) represents a newly identified 178 amino acid protein that exhibits nuclear localization and is characterized by the presence of a PEST motif. 15 , 16 PEST motifs represent amino acid sequences characterized by enrichment of proline (P), glutamic acid (E), serine (S), and threonine (T) residues, typically bordered by positively charged amino acid residues, and are commonly implicated in mediating protein degradation processes. 17 While initially found in short-lived proteins, PEST sequences have also been implicated in other cellular processes, including protein sorting and protein-protein interactions. 18 – 20 Recent investigations have revealed that PCNP exerts a critical regulatory role in malignant transformation and pathological angiogenesis across multiple cancer types. 21 – 23 However, the role and underlying mechanisms of PCNP in RNV have not been fully elucidated. Considering the constraints of existing therapeutic approaches for RNV, investigating the functional involvement of PCNP in this pathological context may yield novel insights to inform the development of innovative therapeutic interventions. This research endeavored to delineate the role of PCNP in RNV at the cellular level using HUVECs as an in vitro model. Specifically, experiments assessed the functional impacts of PCNP overexpression and knockdown on HUVEC proliferation, migration, and tube formation capacity. Furthermore, we explored the potential molecular mechanisms by which PCNP might influence RNV, focusing on the VEGF signaling pathway and utilizing transcriptome sequencing to identify other potential pathways involved. 2. Materials and Methods 2.1 Cell Culture and Transfection HUVECs were employed in this study because their in vitro culture retains favorable proliferation, migration, and tube-forming abilities, effectively simulating the biological process of neovascularization in vivo. These cells were procured from Qisai Life Technology Co., Ltd. and cultured in DMEM/F12 medium supplemented with 10% fetal bovine serum (FBS) (Cat. No. 10099141C, Gibco, USA), maintained at 37°C in a humidified atmosphere containing 5% CO₂. PCNP overexpression and knockdown plasmids were generously provided by the Henan University Nuclear Protein Gene Regulation International Joint Laboratory. For transfection, HUVECs were plated in 6-well plates and transfected with PCNP overexpression plasmids, PCNP knockdown plasmids (shPCNP), or control plasmids using Lipofectamine 3000 transfection reagent (Cat. No. L3000008, Thermo Fisher Scientific, USA) according to the manufacturer’s instructions. 2.2 RNA Extraction and Quantitative Real-Time PCR (qPCR) Total RNA was isolated from HUVECs 24 hours post-transfection using the RNA Rapid Extraction Kit (Cat. No. 9767, BaoRi Medical, China). cDNA was generated using the Reverse Transcription Kit (Cat. No. RR092A, BaoRi Medical, China). qPCR was conducted using the High Specificity qPCR Kit (Cat. No. RR820A, BaoRi Medical, China) with the following primers (Sangon Biotech, China): The qPCR reaction consisted of 95°C for 30 seconds, followed by 40 cycles of 95°C for 5 seconds and 60°C for 30 seconds. GAPDH served as an internal control, and the relative expression levels of PCNP mRNA were calculated using the 2 -ΔΔCt method. 2.3 Western Blot Analysis Total protein was isolated from HUVECs 48 hours post-transfection using RIPA lysis buffer (Cat. No. P0013B, Beyotime, China) supplemented with protease and phosphatase inhibitors (Cat. No. P1045, Beyotime, China). Protein concentration was measured using the BCA Protein Assay Kit (Cat. No. P0012, Beyotime, China). Equal amounts of protein were resolved by SDS-PAGE and transferred to PVDF membranes (Cat. No. IPVH00010, Millipore, USA). The membranes were blocked with 5% non-fat milk in TBS-T and incubated overnight at 4°C with primary antibodies against PCNP (Cat. No. ab97909, Abcam, UK) and GAPDH (Cat. No. Ab8245, Abcam, UK). After washing, the membranes were incubated with corresponding HRP-conjugated secondary antibodies (Cat. No. ab150077, Abcam, UK) for 1.5 hours at room temperature. Protein bands were detected using the ECL Plus Chemiluminescence Kit (Cat. No. P0018S, Beyotime, China), and band intensities were quantified using ImageJ software. Full,uncropped Western blot images are provided in the Supplementary information. 2.4 CCK-8 Cell Proliferation Assay HUVECs were transfected as described above and seeded in 96-well plates at a density of 3000 cells per well. Cell proliferation was evaluated at 24, 48, and 72 hours post-seeding using the CCK-8 assay kit (Cat. No. C0037, Beyotime, China). Briefly, 10 µL of CCK-8 solution was added to each well, and the plates were incubated at 37°C for 1 hour. Absorbance was measured at 450 nm using a microplate reader (Cat. No. 357-711144T, Thermo Fisher Scientific, USA) 2.5 Scratch Wound Healing Assay HUVECs were transfected and seeded in 6-well plates. Upon reaching confluence, a linear scratch was created in the cell monolayer using a 200 µL pipette tip. Cellular debris was removed by washing with PBS, and fresh medium containing 2% FBS was added. Images of the scratch area were captured at 0 and 48 hours using an inverted microscope (TS100-F, Nikon, Japan). Wound area was quantified using ImageJ software, and the percentage of wound closure was calculated accordingly. 2.6 Tube Formation Assay Matrigel (Cat. No. 354248, Corning, USA) was thawed overnight at 4°C and added to pre-chilled 24-well plates (300µL per well). The plates were incubated at 37°C for 1 hour to permit the Matrigel to solidify. Transfected HUVECs were trypsinized, counted, and plated onto the Matrigel-coated wells at a density of 80,000 cells per well in serum-free medium. After 4–6 hours of incubation at 37°C, tube formation was visualized and imaged using an inverted microscope (TS100-F, Nikon, Japan). The number of nodes (branching points) in five randomly selected fields per well was counted. 2.7 Enzyme-Linked Immunosorbent Assay (ELISA) and Cytometric Bead Array (CBA) Supernatants were harvested from transfected HUVECs 24 hours post-transfection. VEGF levels in the supernatants were determined using a human VEGF ELISA kit (Cat. No. Ab222510, Abcam, UK) and a BD Cytometric Bead Array (CBA) Human Angiogenesis Kit (Cat. No. 558336, BD Biosciences, USA) following the manufacturers’ instructions. 2.8 Transcriptome Sequencing Total RNA was isolated from control and PCNP-overexpressing HUVECs 24 hours after transfection. RNA quality was evaluated using an Agilent 2100 Bioanalyzer. Sequencing libraries were constructed with the NEBNext Ultra™ RNA Library Prep Kit for Illumina® (Cat. No. E3330S, NEB, USA) and sequenced on an Illumina NovaSeq 6000 platform at Megigene Biotechnology Co., Ltd. (China). Raw sequencing reads were processed to generate clean reads by eliminating adapter sequences, poly-N-containing reads, and low-quality reads. Clean reads were then aligned to the human reference genome (GRCh38) using HISAT2 software. Gene expression levels were quantified with featureCounts. Differential gene expression analysis was conducted using DESeq2 software. Genes with a Q value 1 were considered significantly differentially expressed. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analyses were performed using Metascape.The raw sequencing data have been deposited in the NCBI BioProject database under accession number PRJNA1309071. 2.9 Statistical Analysis Data are expressed as mean ± standard deviation (SD) from no fewer than three independent experiments. Statistical analysis was conducted with GraphPad Prism 9.5 software. Variations between groups were assessed via one-way ANOVA followed by Tukey’s post-hoc test. A p value < 0.05 was deemed statistically significant. 3. Results 3.1 Successful Construction of PCNP Overexpression and Knockdown in HUVECs To explore the function of PCNP in retinal angiogenesis, we initially generated HUVECs with modified PCNP expression levels. PCNP overexpression and knockdown plasmids were introduced into HUVECs, and transfection efficiency was verified by examining fluorescence 24 hours post-transfection ( Fig. 1 A ) . qPCR analysis demonstrated a marked elevation in PCNP mRNA levels in the PCNP overexpression group and a marked reduction in the PCNP knockdown group relative to the control group (p < 0.0001) ( Fig. 1 B ) . Western blot analysis exhibited a consistent marked increase in PCNP protein levels in the overexpression group (p < 0.01) and a marked decrease in the knockdown group (p < 0.05) relative to the control group ( Fig. 1 C and 1 D ) . These results confirmed the successful construction of PCNP-overexpressing and PCNP-knockdown HUVECs. 3.2 PCNP Inhibits HUVEC Proliferation The impact of PCNP on HUVEC proliferation was assessed using the CCK-8 assay. The results demonstrated that PCNP overexpression significantly decreased HUVEC proliferation at 24, 48, and 72 hours relative to the control group (p < 0.0001). Conversely, PCNP knockdown significantly increased HUVEC proliferation at the same time points relative to the control group (p < 0.0001) ( Fig. 2 ) . These findings suggest that PCNP negatively regulates HUVEC proliferation. 3.3 PCNP Inhibits HUVEC Migration A scratch wound healing assay was conducted to evaluate the effect of PCNP on HUVEC migration. After 48 hours, the wound area was significantly larger in the PCNP overexpression group relative to the control group (p < 0.0001), indicating reduced cell migration. Conversely, the wound area was significantly smaller in the PCNP knockdown group relative to the control group (p < 0.0001), suggesting enhanced cell migration ( Fig. 3 ) . These results demonstrate that PCNP inhibits HUVEC migration. 3.4 PCNP Inhibits HUVEC Tube Formation To investigate the role of PCNP in angiogenesis, the tube formation assay on Matrigel was performed. After 4 hours, the number of nodes formed by HUVECs in the PCNP overexpression group was significantly reduced relative to the control group (32.33 ± 2.52 vs. 73.00 ± 3.61, p < 0.0001). Conversely, the PCNP knockdown group showed a significantly increased number of nodes relative to the control group (146.00 ± 5.29 vs. 73.00 ± 3.61, p < 0.0001) ( Fig. 4 ) . These results indicate that PCNP inhibits the ability of HUVECs to form capillary-like structures. 3.5 PCNP May Influence Neovascularization Independently of VEGF To investigate the potential molecular mechanisms underlying the effects of PCNP on angiogenesis, we measured VEGF levels in the supernatant and within HUVECs with altered PCNP expression. ELISA and CBA results showed that VEGF levels in the cell supernatant were significantly reduced in both the PCNP overexpression and knockdown groups compared to the control group (p < 0.0001) ( Fig. 5 A and 5 B ) . However, Western blot analysis revealed no statistically significant difference in intracellular VEGF protein levels between the control, PCNP overexpression, and PCNP knockdown groups ( Fig. 6 ) . Transcriptome sequencing was performed on control and PCNP-overexpressing HUVECs to further explore potential mechanisms. Differential gene expression analysis identified 2102 significantly differentially expressed genes (Q value 1) ( Fig. 7 A ) . GO and KEGG enrichment analyses revealed that the most significantly enriched pathways in the PCNP overexpression group were the IL-17 signaling pathway, the TNF signaling pathway, and the NF-κB signaling pathway ( Fig. 7 B and 7 C ) . 4. Discussion Retinal neovascularization (RNV) is a key pathological process in multiple ocular disorders that can result in severe vision loss. The current primary treatment for RNV involves anti-VEGF drugs, but their effectiveness can diminish over time, and they do not address all underlying causes. Therefore, exploring new therapeutic strategies and targets is essential. In this study, we explored the function and mode of action of the nuclear protein PCNP in RNV. Our in vitro experiments demonstrated that PCNP overexpression inhibited HUVEC proliferation, migration, and tube formation, while PCNP knockdown promoted these processes. These findings indicate that PCNP exerts an inhibitory effect on neovascularization. The equilibrium between endogenous pro-angiogenic and anti-angiogenic factors sustains endothelial cell function. VEGF is a crucial driver of angiogenesis and RNV. 24 However, inflammation also plays a significant role in RNV development. 25 , 26 Inflammatory cells and mediators can stimulate angiogenesis, and key transcription factors such as NF-κB can induce the expression of multiple inflammatory and angiogenic factors, including VEGF. 27 , 28 TNF and IL-17 signaling pathways are also implicated in promoting inflammation and VEGF expression, contributing to RNV. Our initial hypothesis, based on previous literature, was that PCNP might exert its effects through the VEGF pathway. However, our results demonstrated that VEGF levels in the cell supernatant were decreased in both PCNP overexpression and knockdown groups, and there was no disparity in intracellular VEGF levels among the groups. This suggests that PCNP's role in RNV might not be directly mediated by VEGF. The observed decrease in supernatant VEGF in both PCNP altered groups could potentially be due to compensatory mechanisms, which warrants further investigation. The transcriptome sequencing analysis indicated that in PCNP-overexpressing HUVECs, inflammatory pathways—such as IL-17, TNF, and NF-κB signaling—were significantly enriched. This suggests a potential link between PCNP and the regulation of inflammatory responses in endothelial cells, which may contribute to its role in neovascularization. While inflammation is known to influence RNV, often through the regulation of VEGF, our findings suggest a potential VEGF-independent mechanism involving these inflammatory pathways.Further analysis of the differentially expressed genes identified several genes, including TGM2, EGR1, and ETS1, which have been implicated in angiogenesis. EGR1 downregulation has been shown to inhibit VEGF expression and reduce retinal neovascularization. 29 , 30 TGM2 can promote angiogenesis by upregulating VEGF expression. 31 Subsequent examination of genes exhibiting differential expression uncovered multiple genes, including TGM2, EGR1, and ETS1, which have been implicated in angiogenesis. EGR1 downregulation has been shown to inhibit VEGF expression and reduce retinal neovascularization. ETS1, a transcription factor, also plays a role in promoting ocular neovascularization and inflammation. 32 , 33 Whether these specific genes are directly involved in PCNP-mediated inhibition of RNV requires further experimental validation. Our study provides evidence at the cellular level that PCNP may inhibit endothelial cell neovascularization, potentially through mechanisms that are not significantly dependent on VEGF. This suggests that PCNP might play a role in RNV through alternative pathways, possibly involving inflammatory signaling. The precise regulatory mechanisms and pathways involved require more detailed and in-depth investigation. This study has some limitations. Our experiments were conducted at the cellular level, and the complex in vivo environment might yield different results. Additionally, while we successfully knocked down PCNP expression using plasmid transfection, the efficiency of overexpression was generally more pronounced in our experiments. Future studies could explore alternative knockdown methods, such as siRNA, to achieve more significant and sustained reductions in PCNP expression. Furthermore, in vivo studies using animal models of RNV will be crucial to validate our in vitro findings and further elucidate the role of PCNP in this disease. 5. Conclusion PCNP appears to have an inhibitory effect on retinal neovascularization. The mechanism by which PCNP influences retinal neovascularization may not be dependent on VEGF signaling. Abbreviations RNV Retinal neovascularization VEGF Vascular endothelial growth factor PCNP PEST-Containing Nuclear Protein FBS Fetal bovine serum PCR Polymerase chain reaction DMEM Dulbecco’s Modified Eagle Medium Declarations Conflict of interest No conflict of interest needs to be declared. Statement of Ethics N/A. Funding This study was supported by the International Science and Technology Co-operation Program of Henan (232102521033), and the Medical Education Research Project of Henan (WJLX2022165), and the Henan Province Medical Science and Technology Key Project (LHGJ20230956). Author Contribution Yuxi Du Chaoyuan Xu and Yalong Dang drafted the manuscript. Yalong Dang supervised and approved the study, revised the manuscript. Yuxi Du prepared the figures and table. Yuxi Du conducted this study Acknowledgments We thank Kanehisa Laboratories for granting permission to use KEGG pathway images. Data Availability The RNA-seq data generated in this study have been deposited in the NCBI BioProject database under accession number PRJNA1309071. All other data supporting the findings of this study are available from the corresponding author upon reasonable request. References Cheung, N., Mitchell, P. & Wong, T. Y. Diabetic retinopathy. Lancet 376 (9735), 124–136. 10.1016/S0140-6736(09)62124-3 (2010). Yang, Y. et al. MicroRNA-15b Targets VEGF and Inhibits Angiogenesis in Proliferative Diabetic Retinopathy. J. Clin. Endocrinol. Metab. 105 (11), 3404–3415. 10.1210/clinem/dgaa538 (2020). Muniyandi, A. et al. Targeting Inflammation and Other Pathways for Treatment of Retinal Disease. J. Pharmacol. Exp. Ther. 386 (1), 15–25. 10.1124/jpet.122.001563 (2023). Antonetti, D. A., Silva, P. S. & Stitt, A. W. Current understanding of the molecular and cellular pathology of diabetic retinopathy. Nat. Rev. Endocrinol. 17 (4), 195–206. 10.1038/s41574-020-00451-4 (2021). Apte, R. S., Chen, D. S. & Ferrara, N. VEGF in Signaling and Disease: Beyond Discovery and Development. Cell 176 (6), 1248–1264. 10.1016/j.cell.2019.01.021 (2019). La Mendola, D., Trincavelli, M. L. & Martini, C. Angiogenesis in Disease. Int. J. Mol. Sci. 23 (18). 10.3390/ijms231810962 (2022). Zhang, J. et al. HIF-1α and HIF-2α redundantly promote retinal neovascularization in patients with ischemic retinal disease. J. Clin. Invest. 131 (12). 10.1172/jci139202 (2021). Rattner, A., Williams, J. & Nathans, J. Roles of HIFs and VEGF in angiogenesis in the retina and brain. J. Clin. Invest. 129 (9), 3807–3820. 10.1172/jci126655 (2019). Tang, X. et al. Novel transcriptional regulation of VEGF in inflammatory processes. J. Cell. Mol. Med. 17 (3), 386–397. 10.1111/jcmm.12020 (2013). Zegeye, M. M. et al. Activation of the JAK/STAT3 and PI3K/AKT pathways are crucial for IL-6 trans-signaling-mediated pro-inflammatory response in human vascular endothelial cells. Cell. Commun. Signal. 16 (1), 55. 10.1186/s12964-018-0268-4 (2018). Li, B. et al. Nuclear proteins and diabetic retinopathy: a review. Biomed. Eng. Online . 23 (1), 62. 10.1186/s12938-024-01258-4 (2024). Zhou, W., Yang, L., Nie, L. & Lin, H. Unraveling the molecular mechanisms between inflammation and tumor angiogenesis. Am. J. Cancer Res. 11 (2), 301–317 (2021). Jeong, J. H., Ojha, U. & Lee, Y. M. Pathological angiogenesis and inflammation in tissues. Arch. Pharm. Res. 44 (1), 1–15. 10.1007/s12272-020-01287-2 (2021). Weigelt, C. M. et al. AAV-Mediated Expression of Human VEGF, TNF-α, and IL-6 Induces Retinal Pathology in Mice. Transl Vis. Sci. Technol. 10 (11), 15. 10.1167/tvst.10.11.15 (2021). Mori, T., Li, Y., Hata, H., Ono, K. & Kochi, H. NIRF, a novel RING finger protein, is involved in cell-cycle regulation. Biochem. Biophys. Res. Commun. 296 (3), 530–536. 10.1016/s0006-291x(02)00890-2 (2002). Mori, T., Li, Y., Hata, H. & Kochi, H. NIRF is a ubiquitin ligase that is capable of ubiquitinating PCNP, a PEST-containing nuclear protein. FEBS Lett. 557 , 209–214. 10.1016/s0014-5793(03)01495-9 (2004). Rechsteiner, M. & Rogers, S. PEST sequences and regulation by proteolysis. Trends Biochem. Sci. 21 (7), 267–271. 10.1016/s0968-0004(96)10031-1 (1996). Hou, C., Li, Y., Wang, M., Wu, H. & Li, T. Systematic prediction of degrons and E3 ubiquitin ligase binding via deep learning. BMC Biol. 20 (1), 162. 10.1186/s12915-022-01364-6 (2022). Xiaolei, Z. & Kausik, K. N. J. R. Large putative PEST-like sequence motif at the carboxyl tail of human calcium receptor directs lysosomal degradation and regulates cell surface receptor level. J. Biol. Chem. ; 287 (6). (2012). Juraj, B., Ján, M. & Linda, W. Covalent attachment of the SUMO-1 protein to the negative regulatory domain of the c-Myb transcription factor modifies its stability and transactivation capacity. J. Biol. Chem. ; 277 (11). (2002). Khan, N. et al. Biology of PEST-Containing Nuclear Protein: A Potential Molecular Target for Cancer Research. Front. Oncol. 12 , 784597. 10.3389/fonc.2022.784597 (2022). Chen, Y. et al. PCNP is a novel regulator of proliferation, migration, and invasion in human thyroid cancer. Int. J. Biol. Sci. 18 (9), 3605–3620. 10.7150/ijbs.70394 (2022). Wang, D. et al. PEST-containing nuclear protein regulates cell proliferation, migration, and invasion in lung adenocarcinoma. Oncogenesis 8 (3), 22. 10.1038/s41389-019-0132-4 (2019). Xu, Y. et al. Melatonin attenuated retinal neovascularization and neuroglial dysfunction by inhibition of HIF-1α-VEGF pathway in oxygen-induced retinopathy mice. J. Pineal Res. 64 (4), e12473. 10.1111/jpi.12473 (2018). Yue, T. et al. The role of inflammation in immune system of diabetic retinopathy: Molecular mechanisms, pathogenetic role and therapeutic implications. Front. Immunol. 13 , 1055087. 10.3389/fimmu.2022.1055087 (2022). Forrester, J. V., Kuffova, L. & Delibegovic, M. The Role of Inflammation in Diabetic Retinopathy. Front. Immunol. 11 , 583687. 10.3389/fimmu.2020.583687 (2020). Wang, J., Xu, X., Elliott, M. H., Zhu, M. & Le, Y. Z. Müller cell-derived VEGF is essential for diabetes-induced retinal inflammation and vascular leakage. Diabetes 59 (9), 2297–2305. 10.2337/db09-1420 (2010). Lawrence, T. The nuclear factor NF-kappaB pathway in inflammation. Cold Spring Harb Perspect. Biol. 1 (6), a001651. 10.1101/cshperspect.a001651 (2009). Hwang, D. B. et al. Egr1 Gene Expression as a Potential Biomarker for In Vitro Prediction of Ocular Toxicity. Pharmaceutics 13 (10). 10.3390/pharmaceutics13101584 (2021). Peng, N., Zheng, M., Song, B., Jiao, R. & Wang, W. Transcription Factor EGR1 Facilitates Neovascularization in Mice with Retinopathy of Prematurity by Regulating the miR-182-5p/EFNA5 Axis. Biochem. Genet. 62 (2), 1070–1086. 10.1007/s10528-023-10433-6 (2024). Lei, Z. et al. Novel peptide GX1 inhibits angiogenesis by specifically binding to transglutaminase-2 in the tumorous endothelial cells of gastric cancer. Cell. Death Dis. 9 (6), 579. 10.1038/s41419-018-0594-x (2018). Zhu, M. et al. Intravitreal Ets1 siRNA alleviates choroidal neovascularization in a mouse model of age-related macular degeneration. Cell. Tissue Res. 376 (3), 341–351. 10.1007/s00441-019-03001-1 (2019). Zhao, J. et al. MicroRNA-mediated Ets1 repression in retinal endothelial cells: A novel anti-angiogenic mechanism in nonproliferative diabetic retinopathy. Diabetes Obes. Metab. 27 (4), 1888–1901. 10.1111/dom.16182 (2025). Kanehisa, M., Sato, Y., Kawashima, M., Furumichi, M. & Tanabe, M. KEGG as a reference resource for gene and protein annotation. Nucleic Acids Res. 44 , D457–D462 (2016). Kanehisa, M. & Goto, S. KEGG: Kyoto Encyclopedia of Genes and Genomes. Nucleic Acids Res. 28 , 27–30 (2000). Tables Table. 1 Primer Sequence for qPCR Gene Forward Reverse NCBI Product Length Human PCNP CCGCCGGAGGACCTGAAGAAG TGGCTGATGCTTTCTTTGTCGTCTG NM_001320395.1 201 bp Human GAPDH CAAGGCTGTGGGCAAGGTCATC GTGTCGCTGTTGAAGTCAGAGGAG NM_001256799.3 228 bp Additional Declarations No competing interests reported. Supplementary Files SupplementaryFigture.pdf Cite Share Download PDF Status: Published Journal Publication published 11 Dec, 2025 Read the published version in Scientific Reports → Version 1 posted Editorial decision: Revision requested 13 Oct, 2025 Reviews received at journal 08 Oct, 2025 Reviewers agreed at journal 28 Sep, 2025 Reviews received at journal 28 Sep, 2025 Reviewers agreed at journal 28 Sep, 2025 Reviewers agreed at journal 27 Sep, 2025 Reviewers invited by journal 15 Sep, 2025 Editor invited by journal 27 Aug, 2025 Editor assigned by journal 26 Aug, 2025 Submission checks completed at journal 25 Aug, 2025 First submitted to journal 25 Aug, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7314367","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":518216487,"identity":"a205bb4c-37fa-4a2d-81bb-1c2645cfc955","order_by":0,"name":"Yuxi Du","email":"","orcid":"","institution":"Sanmenxia Central Hospital of Henan University of Science and Technology/College of Clinical Medicine of Henan University of Science and Technology","correspondingAuthor":false,"prefix":"","firstName":"Yuxi","middleName":"","lastName":"Du","suffix":""},{"id":518216488,"identity":"951961c4-c0b3-48f1-a758-367b9210dca1","order_by":1,"name":"Chaoyuan Xu","email":"","orcid":"","institution":"Sanmenxia Central Hospital of Henan University of Science and Technology/College of Clinical Medicine of Henan University of Science and Technology","correspondingAuthor":false,"prefix":"","firstName":"Chaoyuan","middleName":"","lastName":"Xu","suffix":""},{"id":518216489,"identity":"5c5fe68d-4baf-4745-a935-be4a0e69f38a","order_by":2,"name":"Yalong Dang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA9UlEQVRIiWNgGAWjYFAC5gYQyQgkGR8AGTx8hLUwwrUwG4C0sJGihU0CxCKoxeD4wcbHBb8YZPtnt1+r/JpjJ8PGwPzw0Q18Ws4kNhvP7GMwnnHnTNlt2W3JQIexGRvn4NNyILFNmreHIbHhRk7abcltzEAtPGzSeLWcfwjRMh+opVhyWz0RWm4AbeH5wZC44Ub6McaP2w4T1iJ542GzMW+DhPHGGznM0ozbjvOwMRPwC9/55IOPef7YyM67kf7w489t1fb87M0PH+PTonAASDC2gWKEx4CZByTEjEc5CMg3gMg/IIL9AeMPAqpHwSgYBaNgZAIATP1MsWjApboAAAAASUVORK5CYII=","orcid":"","institution":"Sanmenxia Central Hospital of Henan University of Science and Technology/College of Clinical Medicine of Henan University of Science and Technology","correspondingAuthor":true,"prefix":"","firstName":"Yalong","middleName":"","lastName":"Dang","suffix":""}],"badges":[],"createdAt":"2025-08-07 03:53:18","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7314367/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7314367/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41598-025-27494-9","type":"published","date":"2025-12-11T15:59:02+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":92023928,"identity":"ebb4f114-f701-445e-be8f-b8829b7213b4","added_by":"auto","created_at":"2025-09-23 18:24:39","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1240013,"visible":true,"origin":"","legend":"","description":"","filename":"TheRoleandPotentialMechanismofNuclea.docx","url":"https://assets-eu.researchsquare.com/files/rs-7314367/v1/3cfd8aa1d4bef65892266ca4.docx"},{"id":92024109,"identity":"62b784ba-d118-4779-a8e6-7f504f721603","added_by":"auto","created_at":"2025-09-23 18:32:38","extension":"json","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":5247,"visible":true,"origin":"","legend":"","description":"","filename":"6a3af38cdb464be39cbb77762ca2cef3.json","url":"https://assets-eu.researchsquare.com/files/rs-7314367/v1/5d9d1f6db10ea965ed4253ab.json"},{"id":92023931,"identity":"70acecb7-7a47-4256-90f9-75e57ab07e5c","added_by":"auto","created_at":"2025-09-23 18:24:39","extension":"pdf","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1638778,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryFigture.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7314367/v1/0d0d1985e9cfe3b5942bef7d.pdf"},{"id":92023434,"identity":"07f4cfdb-89aa-4526-aba0-412fec80637d","added_by":"auto","created_at":"2025-09-23 18:16:39","extension":"xml","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":88863,"visible":true,"origin":"","legend":"","description":"","filename":"6a3af38cdb464be39cbb77762ca2cef31enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7314367/v1/4b002df806982339428dfa6b.xml"},{"id":92023429,"identity":"f82bd83e-77ea-41b9-9332-6910227784f9","added_by":"auto","created_at":"2025-09-23 18:16:38","extension":"jpeg","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":382086,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7314367/v1/155a917bd9794af905555223.jpeg"},{"id":92024112,"identity":"fcc6dfe5-480d-4815-bbe5-04170d2ea609","added_by":"auto","created_at":"2025-09-23 18:32:39","extension":"png","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":34008,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7314367/v1/fcb165c26180e07742101785.png"},{"id":92023436,"identity":"5ea713ea-769a-4bf5-bd01-767ecaf99d07","added_by":"auto","created_at":"2025-09-23 18:16:39","extension":"png","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":386192,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7314367/v1/3f47c9f5827221454e72d8b6.png"},{"id":92023439,"identity":"818be654-a6a7-497b-bd9e-d15a4ae108a6","added_by":"auto","created_at":"2025-09-23 18:16:39","extension":"png","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":149410,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7314367/v1/b8b5674660483e2aad3a5cb2.png"},{"id":92023932,"identity":"293c5cca-3c49-40a5-8e01-db1dbd2b722c","added_by":"auto","created_at":"2025-09-23 18:24:39","extension":"png","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":36180,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-7314367/v1/24fa6e89af07c0dad245326d.png"},{"id":92023432,"identity":"62c19d9d-1e38-4c9d-b178-59c9ec433c78","added_by":"auto","created_at":"2025-09-23 18:16:39","extension":"png","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":51706,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-7314367/v1/690a04052cbd57b51cc0cbe9.png"},{"id":92023437,"identity":"093a8375-d7f5-4a60-a813-33f10e6e8977","added_by":"auto","created_at":"2025-09-23 18:16:39","extension":"png","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":168388,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-7314367/v1/d803a92b8d2b9a64136f14e5.png"},{"id":92023441,"identity":"23d9bd92-b8cf-448e-8d62-57e338c3f666","added_by":"auto","created_at":"2025-09-23 18:16:39","extension":"xml","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":88025,"visible":true,"origin":"","legend":"","description":"","filename":"6a3af38cdb464be39cbb77762ca2cef31structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7314367/v1/d421b363a6196872687a62a7.xml"},{"id":92023933,"identity":"47db8536-9eca-47ac-b642-7a7d9a0c4c31","added_by":"auto","created_at":"2025-09-23 18:24:39","extension":"html","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":97556,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7314367/v1/2a4eef642d66632a2eb4c12b.html"},{"id":92023420,"identity":"3e95c2f1-fbd9-4fca-a98f-f4118f253c5c","added_by":"auto","created_at":"2025-09-23 18:16:38","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":95042,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSuccessful Construction of PCNP Overexpression and Knockdown in HUVECs.\u003c/strong\u003e (A) a Fluorescence microscopy of PCNP in HUVECs; original magnification 40×. (B) The expression level of PCNP mRNA was examined by qPCR. (C) The protein expression of PCNP was examined by Western blotting. GAPDH was used as the loading control. Full-length blots are presented in supplementary Figure 1.D) The densitometry analysis of PCNP was performed, normalized to the corresponding GAPDH level. * indicates that \u003cem\u003ep\u003c/em\u003e\u0026lt;0.05; ** indicates that \u003cem\u003ep\u003c/em\u003e\u0026lt;0.01; *** indicates that \u003cem\u003ep\u003c/em\u003e\u0026lt;0.001; **** indicates that \u003cem\u003ep\u003c/em\u003e\u0026lt;0.0001.\u003c/p\u003e","description":"","filename":"Picture1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7314367/v1/414621db30bddf21e8e66fa8.jpg"},{"id":92023421,"identity":"0ccbfac3-14c7-4387-b8bf-0f037eaf450e","added_by":"auto","created_at":"2025-09-23 18:16:38","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":61961,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePCNP Inhibits HUVEC proliferation. \u003c/strong\u003ePCNP overexpression significantly reduced HUVEC proliferation at 24, 48, and 72 hours. Conversely, PCNP knockdown significantly increased HUVEC proliferation at the same time points. **** indicates that \u003cem\u003ep\u003c/em\u003e\u0026lt;0.0001.\u003c/p\u003e","description":"","filename":"Picture2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7314367/v1/872a223b50ba1dd0b55d6e1f.jpg"},{"id":92023423,"identity":"117cba3e-072b-48e1-9c93-9d5f29fce94a","added_by":"auto","created_at":"2025-09-23 18:16:38","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":21621,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePCNP Inhibits HUVEC migration.\u003c/strong\u003e (A) The effect of PCNP on cell migration was measured by wound healing assay; original magnification 100×. (B) The migration rates of HUVEC. **** indicates that \u003cem\u003ep\u003c/em\u003e\u0026lt;0.0001.\u003c/p\u003e","description":"","filename":"Picture3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7314367/v1/1e2f1786e16f4630fec214d5.jpg"},{"id":92023924,"identity":"16c675c8-5224-4423-8874-ba1ee2f38570","added_by":"auto","created_at":"2025-09-23 18:24:38","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":15625,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePCNP Inhibits HUVEC tube formation. \u003c/strong\u003e(A) Measure the effect of PCNP on HUVEC tubular formation through tubular formation experiments; original magnification 100×. (B) Number of junction points in HUVEC. **** indicates that \u003cem\u003ep\u003c/em\u003e\u0026lt;0.0001.\u003c/p\u003e","description":"","filename":"Picture4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7314367/v1/6c591d245db5a43866e12031.jpg"},{"id":92023926,"identity":"cd6b90a7-980e-42d0-b85e-d28dcf282989","added_by":"auto","created_at":"2025-09-23 18:24:38","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":18506,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eRelative expression level of VEGF in cell supernatant.\u003c/strong\u003e (A) Detection of VEGF expression levels in the supernatant of each group of cells by ELISA. (B) Detection of VEGF expression levels in the supernatant of each group of cells by CBA. ** indicates that \u003cem\u003ep\u003c/em\u003e\u0026lt;0.01; **** indicates that \u003cem\u003ep\u003c/em\u003e\u0026lt;0.0001.\u003c/p\u003e","description":"","filename":"Picture5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7314367/v1/70e4b719a00902cc7548de3a.jpg"},{"id":92023425,"identity":"ae16d7d5-abb8-4ca3-a3ca-3cadfacda4a1","added_by":"auto","created_at":"2025-09-23 18:16:38","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":16711,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe expression of intracellular VEGF protein in vitro.\u003c/strong\u003e (A) Western blotting analysis for the expression of VEGF in HUVEC. GAPDH was used as the loading control. Full-length blots are presented in supplementary Figure 2(B) The relative intensity of VEGF by densitometry scanning are shown, normalized to the corresponding GAPDH level.\u003c/p\u003e","description":"","filename":"Picture6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7314367/v1/73d764c69a0f7b9440d39361.jpg"},{"id":92024716,"identity":"d63dd118-2619-40a9-98bf-6f865c47c3b5","added_by":"auto","created_at":"2025-09-23 18:40:39","extension":"jpg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":54533,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTranscriptome sequencing results.\u003c/strong\u003e (A) Volcano Plot. (B) GO enrichment analysis. (C) KEGG enrichment analysis.KEGG pathway images (map04657, map04668, map04064) are reproduced with permission from Kanehisa Laboratories. Copyright Kanehisa Laboratories\u003csup\u003e34, 35\u003c/sup\u003e.\u003c/p\u003e","description":"","filename":"Picture7.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7314367/v1/6ec71e014728aa5d1467f48c.jpg"},{"id":98245161,"identity":"fda8379e-402c-4b37-b21c-62d0be27dd24","added_by":"auto","created_at":"2025-12-15 16:16:57","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1259889,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7314367/v1/c4143209-6fed-4991-8f27-a31d0b7b2c5d.pdf"},{"id":92024110,"identity":"a2cb8db9-fea9-4427-bb20-dc2f3fadad43","added_by":"auto","created_at":"2025-09-23 18:32:38","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":1638778,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryFigture.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7314367/v1/a51afa4c7c2d82928c570407.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"The Role and Potential Mechanism of Nuclear Protein PCNP in Retinal Neovascularization in Vitro","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eRetinal neovascularization (RNV) represents a pathological condition marked by the unregulated proliferation of neovascular structures within the retinal tissue. This pathological state serves as a defining feature of multiple vision-endangering disorders, including proliferative diabetic retinopathy, retinopathy of prematurity, and neovascular age-related macular degeneration.\u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e The resulting vascular leakage, retinal edema, and retinal detachment can lead to severe vision impairment and blindness.\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e Current clinical treatments for neovascular retinal diseases primarily include surgical interventions like retinal laser photocoagulation and pharmacological interventions such as intraocular anti-VEGF therapy. Although these therapeutic interventions may exhibit efficacy in certain patient cohorts, they are accompanied by inherent limitations, such as potential detrimental adverse effects and the emergence of drug resistance.\u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e Consequently, there exists an imperative to investigate the fundamental mechanisms underlying RNV and discover innovative therapeutic targets.\u003c/p\u003e\u003cp\u003eThe equilibrium between pro-angiogenic and anti-angiogenic factors plays a crucial role in preserving the stability of endothelial cell function.\u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e Vascular endothelial growth factor (VEGF) functions as a principal promoter of angiogenesis and contributes critically to the pathological process of RNV. Under conditions of retinal ischemia and hypoxia, hypoxia-inducible factor becomes upregulated, thereby inducing the transcriptional activation of VEGF and subsequently triggering the downstream VEGF signaling cascade.\u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e VEGF facilitates the proliferative and migratory activities of endothelial cells, thereby contributing to the development of neovascularization.\u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e In addition to VEGF, inflammation also exerts a pivotal influence in the pathogenesis of RNV.\u003csup\u003e\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003e Inflammatory cell infiltration and mediator accumulation in the retinal microenvironment can promote angiogenic processes.\u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003eNF-κB, a key transcription factor in inflammatory signaling pathways, stimulates the production of various inflammatory mediators and pro-angiogenic factors, with VEGF acting as a major downstream target.\u003csup\u003e\u003cspan additionalcitationids=\"CR12\" citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e The TNF signaling axis, initiated via the ligation of TNF-α to its receptor TNFR, proceeds to engage downstream signaling cascades such as NF-κB, thereby stimulating the production of inflammatory cytokines and VEGF, and eventually contributing to pathological endothelial cell proliferation and RNV.\u003csup\u003e\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e The IL-17 signaling cascade, in a parallel manner, can stimulate the synthesis of pro-inflammatory cytokines and VEGF, impair the integrity of the blood-retinal barrier, and regulate endothelial cell proliferative and migratory capacities, thereby facilitating the development of RNV.\u003c/p\u003e\u003cp\u003ePEST-containing nuclear protein (PCNP) represents a newly identified 178 amino acid protein that exhibits nuclear localization and is characterized by the presence of a PEST motif.\u003csup\u003e\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e PEST motifs represent amino acid sequences characterized by enrichment of proline (P), glutamic acid (E), serine (S), and threonine (T) residues, typically bordered by positively charged amino acid residues, and are commonly implicated in mediating protein degradation processes.\u003csup\u003e\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u003c/sup\u003e While initially found in short-lived proteins, PEST sequences have also been implicated in other cellular processes, including protein sorting and protein-protein interactions.\u003csup\u003e\u003cspan additionalcitationids=\"CR19\" citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e Recent investigations have revealed that PCNP exerts a critical regulatory role in malignant transformation and pathological angiogenesis across multiple cancer types.\u003csup\u003e\u003cspan additionalcitationids=\"CR22\" citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e However, the role and underlying mechanisms of PCNP in RNV have not been fully elucidated. Considering the constraints of existing therapeutic approaches for RNV, investigating the functional involvement of PCNP in this pathological context may yield novel insights to inform the development of innovative therapeutic interventions.\u003c/p\u003e\u003cp\u003eThis research endeavored to delineate the role of PCNP in RNV at the cellular level using HUVECs as an in vitro model. Specifically, experiments assessed the functional impacts of PCNP overexpression and knockdown on HUVEC proliferation, migration, and tube formation capacity. Furthermore, we explored the potential molecular mechanisms by which PCNP might influence RNV, focusing on the VEGF signaling pathway and utilizing transcriptome sequencing to identify other potential pathways involved.\u003c/p\u003e"},{"header":"2. Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003e2.1 Cell Culture and Transfection\u003c/h2\u003e\u003cp\u003eHUVECs were employed in this study because their in vitro culture retains favorable proliferation, migration, and tube-forming abilities, effectively simulating the biological process of neovascularization in vivo. These cells were procured from Qisai Life Technology Co., Ltd. and cultured in DMEM/F12 medium supplemented with 10% fetal bovine serum (FBS) (Cat. No. 10099141C, Gibco, USA), maintained at 37\u0026deg;C in a humidified atmosphere containing 5% CO₂. PCNP overexpression and knockdown plasmids were generously provided by the Henan University Nuclear Protein Gene Regulation International Joint Laboratory. For transfection, HUVECs were plated in 6-well plates and transfected with PCNP overexpression plasmids, PCNP knockdown plasmids (shPCNP), or control plasmids using Lipofectamine 3000 transfection reagent (Cat. No. L3000008, Thermo Fisher Scientific, USA) according to the manufacturer\u0026rsquo;s instructions.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\u003ch2\u003e2.2 RNA Extraction and Quantitative Real-Time PCR (qPCR)\u003c/h2\u003e\u003cp\u003eTotal RNA was isolated from HUVECs 24 hours post-transfection using the RNA Rapid Extraction Kit (Cat. No. 9767, BaoRi Medical, China). cDNA was generated using the Reverse Transcription Kit (Cat. No. RR092A, BaoRi Medical, China). qPCR was conducted using the High Specificity qPCR Kit (Cat. No. RR820A, BaoRi Medical, China) with the following primers (Sangon Biotech, China):\u003c/p\u003e\u003cp\u003eThe qPCR reaction consisted of 95\u0026deg;C for 30 seconds, followed by 40 cycles of 95\u0026deg;C for 5 seconds and 60\u0026deg;C for 30 seconds. GAPDH served as an internal control, and the relative expression levels of PCNP mRNA were calculated using the 2\u003csup\u003e-ΔΔCt\u003c/sup\u003e method.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\u003ch2\u003e2.3 Western Blot Analysis\u003c/h2\u003e\u003cp\u003eTotal protein was isolated from HUVECs 48 hours post-transfection using RIPA lysis buffer (Cat. No. P0013B, Beyotime, China) supplemented with protease and phosphatase inhibitors (Cat. No. P1045, Beyotime, China). Protein concentration was measured using the BCA Protein Assay Kit (Cat. No. P0012, Beyotime, China). Equal amounts of protein were resolved by SDS-PAGE and transferred to PVDF membranes (Cat. No. IPVH00010, Millipore, USA). The membranes were blocked with 5% non-fat milk in TBS-T and incubated overnight at 4\u0026deg;C with primary antibodies against PCNP (Cat. No. ab97909, Abcam, UK) and GAPDH (Cat. No. Ab8245, Abcam, UK). After washing, the membranes were incubated with corresponding HRP-conjugated secondary antibodies (Cat. No. ab150077, Abcam, UK) for 1.5 hours at room temperature. Protein bands were detected using the ECL Plus Chemiluminescence Kit (Cat. No. P0018S, Beyotime, China), and band intensities were quantified using ImageJ software. Full,uncropped Western blot images are provided in the Supplementary information.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e\u003ch2\u003e2.4 CCK-8 Cell Proliferation Assay\u003c/h2\u003e\u003cp\u003eHUVECs were transfected as described above and seeded in 96-well plates at a density of 3000 cells per well. Cell proliferation was evaluated at 24, 48, and 72 hours post-seeding using the CCK-8 assay kit (Cat. No. C0037, Beyotime, China). Briefly, 10 \u0026micro;L of CCK-8 solution was added to each well, and the plates were incubated at 37\u0026deg;C for 1 hour. Absorbance was measured at 450 nm using a microplate reader (Cat. No. 357-711144T, Thermo Fisher Scientific, USA)\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e\u003ch2\u003e2.5 Scratch Wound Healing Assay\u003c/h2\u003e\u003cp\u003eHUVECs were transfected and seeded in 6-well plates. Upon reaching confluence, a linear scratch was created in the cell monolayer using a 200 \u0026micro;L pipette tip. Cellular debris was removed by washing with PBS, and fresh medium containing 2% FBS was added. Images of the scratch area were captured at 0 and 48 hours using an inverted microscope (TS100-F, Nikon, Japan). Wound area was quantified using ImageJ software, and the percentage of wound closure was calculated accordingly.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003e2.6 Tube Formation Assay\u003c/h2\u003e\u003cp\u003eMatrigel (Cat. No. 354248, Corning, USA) was thawed overnight at 4\u0026deg;C and added to pre-chilled 24-well plates (300\u0026micro;L per well). The plates were incubated at 37\u0026deg;C for 1 hour to permit the Matrigel to solidify. Transfected HUVECs were trypsinized, counted, and plated onto the Matrigel-coated wells at a density of 80,000 cells per well in serum-free medium. After 4\u0026ndash;6 hours of incubation at 37\u0026deg;C, tube formation was visualized and imaged using an inverted microscope (TS100-F, Nikon, Japan). The number of nodes (branching points) in five randomly selected fields per well was counted.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e\u003ch2\u003e2.7 Enzyme-Linked Immunosorbent Assay (ELISA) and Cytometric Bead Array (CBA)\u003c/h2\u003e\u003cp\u003eSupernatants were harvested from transfected HUVECs 24 hours post-transfection. VEGF levels in the supernatants were determined using a human VEGF ELISA kit (Cat. No. Ab222510, Abcam, UK) and a BD Cytometric Bead Array (CBA) Human Angiogenesis Kit (Cat. No. 558336, BD Biosciences, USA) following the manufacturers\u0026rsquo; instructions.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e\u003ch2\u003e2.8 Transcriptome Sequencing\u003c/h2\u003e\u003cp\u003eTotal RNA was isolated from control and PCNP-overexpressing HUVECs 24 hours after transfection. RNA quality was evaluated using an Agilent 2100 Bioanalyzer. Sequencing libraries were constructed with the NEBNext Ultra\u0026trade; RNA Library Prep Kit for Illumina\u0026reg; (Cat. No. E3330S, NEB, USA) and sequenced on an Illumina NovaSeq 6000 platform at Megigene Biotechnology Co., Ltd. (China). Raw sequencing reads were processed to generate clean reads by eliminating adapter sequences, poly-N-containing reads, and low-quality reads. Clean reads were then aligned to the human reference genome (GRCh38) using HISAT2 software. Gene expression levels were quantified with featureCounts. Differential gene expression analysis was conducted using DESeq2 software. Genes with a Q value\u0026thinsp;\u0026lt;\u0026thinsp;0.05 and |log2FC| \u0026gt;1 were considered significantly differentially expressed. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analyses were performed using Metascape.The raw sequencing data have been deposited in the NCBI BioProject database under accession number PRJNA1309071.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003e2.9 Statistical Analysis\u003c/h2\u003e\u003cp\u003eData are expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (SD) from no fewer than three independent experiments. Statistical analysis was conducted with GraphPad Prism 9.5 software. Variations between groups were assessed via one-way ANOVA followed by Tukey\u0026rsquo;s post-hoc test. A p value\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was deemed statistically significant.\u003c/p\u003e\u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003e3.1 Successful Construction of PCNP Overexpression and Knockdown in HUVECs\u003c/h2\u003e\u003cp\u003eTo explore the function of PCNP in retinal angiogenesis, we initially generated HUVECs with modified PCNP expression levels. PCNP overexpression and knockdown plasmids were introduced into HUVECs, and transfection efficiency was verified by examining fluorescence 24 hours post-transfection \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA\u003cb\u003e)\u003c/b\u003e. qPCR analysis demonstrated a marked elevation in PCNP mRNA levels in the PCNP overexpression group and a marked reduction in the PCNP knockdown group relative to the control group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB\u003cb\u003e)\u003c/b\u003e. Western blot analysis exhibited a consistent marked increase in PCNP protein levels in the overexpression group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.01) and a marked decrease in the knockdown group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) relative to the control group \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC and \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD\u003cb\u003e)\u003c/b\u003e. These results confirmed the successful construction of PCNP-overexpressing and PCNP-knockdown HUVECs.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003e3.2 PCNP Inhibits HUVEC Proliferation\u003c/h2\u003e\u003cp\u003eThe impact of PCNP on HUVEC proliferation was assessed using the CCK-8 assay. The results demonstrated that PCNP overexpression significantly decreased HUVEC proliferation at 24, 48, and 72 hours relative to the control group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001). Conversely, PCNP knockdown significantly increased HUVEC proliferation at the same time points relative to the control group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e. These findings suggest that PCNP negatively regulates HUVEC proliferation.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\u003ch2\u003e3.3 PCNP Inhibits HUVEC Migration\u003c/h2\u003e\u003cp\u003eA scratch wound healing assay was conducted to evaluate the effect of PCNP on HUVEC migration. After 48 hours, the wound area was significantly larger in the PCNP overexpression group relative to the control group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001), indicating reduced cell migration. Conversely, the wound area was significantly smaller in the PCNP knockdown group relative to the control group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001), suggesting enhanced cell migration \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e. These results demonstrate that PCNP inhibits HUVEC migration.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\u003ch2\u003e3.4 PCNP Inhibits HUVEC Tube Formation\u003c/h2\u003e\u003cp\u003eTo investigate the role of PCNP in angiogenesis, the tube formation assay on Matrigel was performed. After 4 hours, the number of nodes formed by HUVECs in the PCNP overexpression group was significantly reduced relative to the control group (32.33\u0026thinsp;\u0026plusmn;\u0026thinsp;2.52 vs. 73.00\u0026thinsp;\u0026plusmn;\u0026thinsp;3.61, p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001). Conversely, the PCNP knockdown group showed a significantly increased number of nodes relative to the control group (146.00\u0026thinsp;\u0026plusmn;\u0026thinsp;5.29 vs. 73.00\u0026thinsp;\u0026plusmn;\u0026thinsp;3.61, p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e. These results indicate that PCNP inhibits the ability of HUVECs to form capillary-like structures.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\u003ch2\u003e3.5 PCNP May Influence Neovascularization Independently of VEGF\u003c/h2\u003e\u003cp\u003eTo investigate the potential molecular mechanisms underlying the effects of PCNP on angiogenesis, we measured VEGF levels in the supernatant and within HUVECs with altered PCNP expression. ELISA and CBA results showed that VEGF levels in the cell supernatant were significantly reduced in both the PCNP overexpression and knockdown groups compared to the control group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA and \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB\u003cb\u003e)\u003c/b\u003e.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eHowever, Western blot analysis revealed no statistically significant difference in intracellular VEGF protein levels between the control, PCNP overexpression, and PCNP knockdown groups \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eTranscriptome sequencing was performed on control and PCNP-overexpressing HUVECs to further explore potential mechanisms. Differential gene expression analysis identified 2102 significantly differentially expressed genes (Q value\u0026thinsp;\u0026lt;\u0026thinsp;0.05), including 55 upregulated and 95 downregulated genes (|log2FC| \u0026gt;1) \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA\u003cb\u003e)\u003c/b\u003e. GO and KEGG enrichment analyses revealed that the most significantly enriched pathways in the PCNP overexpression group were the IL-17 signaling pathway, the TNF signaling pathway, and the NF-κB signaling pathway \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eB and \u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eC\u003cb\u003e)\u003c/b\u003e.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eRetinal neovascularization (RNV) is a key pathological process in multiple ocular disorders that can result in severe vision loss. The current primary treatment for RNV involves anti-VEGF drugs, but their effectiveness can diminish over time, and they do not address all underlying causes. Therefore, exploring new therapeutic strategies and targets is essential. In this study, we explored the function and mode of action of the nuclear protein PCNP in RNV. Our in vitro experiments demonstrated that PCNP overexpression inhibited HUVEC proliferation, migration, and tube formation, while PCNP knockdown promoted these processes. These findings indicate that PCNP exerts an inhibitory effect on neovascularization.\u003c/p\u003e\u003cp\u003eThe equilibrium between endogenous pro-angiogenic and anti-angiogenic factors sustains endothelial cell function. VEGF is a crucial driver of angiogenesis and RNV.\u003csup\u003e\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e However, inflammation also plays a significant role in RNV development.\u003csup\u003e\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/sup\u003e Inflammatory cells and mediators can stimulate angiogenesis, and key transcription factors such as NF-κB can induce the expression of multiple inflammatory and angiogenic factors, including VEGF.\u003csup\u003e\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/sup\u003e TNF and IL-17 signaling pathways are also implicated in promoting inflammation and VEGF expression, contributing to RNV.\u003c/p\u003e\u003cp\u003eOur initial hypothesis, based on previous literature, was that PCNP might exert its effects through the VEGF pathway. However, our results demonstrated that VEGF levels in the cell supernatant were decreased in both PCNP overexpression and knockdown groups, and there was no disparity in intracellular VEGF levels among the groups. This suggests that PCNP's role in RNV might not be directly mediated by VEGF. The observed decrease in supernatant VEGF in both PCNP altered groups could potentially be due to compensatory mechanisms, which warrants further investigation.\u003c/p\u003e\u003cp\u003eThe transcriptome sequencing analysis indicated that in PCNP-overexpressing HUVECs, inflammatory pathways\u0026mdash;such as IL-17, TNF, and NF-κB signaling\u0026mdash;were significantly enriched. This suggests a potential link between PCNP and the regulation of inflammatory responses in endothelial cells, which may contribute to its role in neovascularization. While inflammation is known to influence RNV, often through the regulation of VEGF, our findings suggest a potential VEGF-independent mechanism involving these inflammatory pathways.Further analysis of the differentially expressed genes identified several genes, including TGM2, EGR1, and ETS1, which have been implicated in angiogenesis. EGR1 downregulation has been shown to inhibit VEGF expression and reduce retinal neovascularization.\u003csup\u003e\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u003c/sup\u003e TGM2 can promote angiogenesis by upregulating VEGF expression.\u003csup\u003e\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003eSubsequent examination of genes exhibiting differential expression uncovered multiple genes, including TGM2, EGR1, and ETS1, which have been implicated in angiogenesis. EGR1 downregulation has been shown to inhibit VEGF expression and reduce retinal neovascularization. ETS1, a transcription factor, also plays a role in promoting ocular neovascularization and inflammation.\u003csup\u003e\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u003c/sup\u003e Whether these specific genes are directly involved in PCNP-mediated inhibition of RNV requires further experimental validation.\u003c/p\u003e\u003cp\u003eOur study provides evidence at the cellular level that PCNP may inhibit endothelial cell neovascularization, potentially through mechanisms that are not significantly dependent on VEGF. This suggests that PCNP might play a role in RNV through alternative pathways, possibly involving inflammatory signaling. The precise regulatory mechanisms and pathways involved require more detailed and in-depth investigation.\u003c/p\u003e\u003cp\u003eThis study has some limitations. Our experiments were conducted at the cellular level, and the complex \u003cem\u003ein vivo\u003c/em\u003e environment might yield different results. Additionally, while we successfully knocked down PCNP expression using plasmid transfection, the efficiency of overexpression was generally more pronounced in our experiments. Future studies could explore alternative knockdown methods, such as siRNA, to achieve more significant and sustained reductions in PCNP expression. Furthermore, in vivo studies using animal models of RNV will be crucial to validate our in vitro findings and further elucidate the role of PCNP in this disease.\u003c/p\u003e"},{"header":"5. Conclusion","content":"\u003cp\u003ePCNP appears to have an inhibitory effect on retinal neovascularization. The mechanism by which PCNP influences retinal neovascularization may not be dependent on VEGF signaling.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cdiv class=\"DefinitionList\"\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eRNV\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eRetinal neovascularization\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eVEGF\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eVascular endothelial growth factor\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003ePCNP\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003ePEST-Containing Nuclear Protein\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eFBS\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eFetal bovine serum\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003ePCR\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003ePolymerase chain reaction\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eDMEM\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eDulbecco\u0026rsquo;s Modified Eagle Medium\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003ch2\u003eConflict of interest\u003c/h2\u003e\u003cp\u003eNo conflict of interest needs to be declared.\u003c/p\u003e\u003c/p\u003e\u003cp\u003e\u003ch2\u003eStatement of Ethics\u003c/h2\u003e\u003cp\u003eN/A.\u003c/p\u003e\u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e\u003cp\u003eThis study was supported by the International Science and Technology Co-operation Program of Henan (232102521033), and the Medical Education Research Project of Henan (WJLX2022165), and the Henan Province Medical Science and Technology Key Project (LHGJ20230956).\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eYuxi Du Chaoyuan Xu and Yalong Dang drafted the manuscript. Yalong Dang supervised and approved the study, revised the manuscript. Yuxi Du prepared the figures and table. Yuxi Du conducted this study\u003c/p\u003e\u003ch2\u003eAcknowledgments\u003c/h2\u003e\u003cp\u003eWe thank Kanehisa Laboratories for granting permission to use KEGG pathway images.\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eThe RNA-seq data generated in this study have been deposited in the NCBI BioProject database under accession number PRJNA1309071. All other data supporting the findings of this study are available from the corresponding author upon reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eCheung, N., Mitchell, P. \u0026amp; Wong, T. Y. Diabetic retinopathy. \u003cem\u003eLancet\u003c/em\u003e \u003cb\u003e376\u003c/b\u003e (9735), 124\u0026ndash;136. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/S0140-6736(09)62124-3\u003c/span\u003e\u003cspan address=\"10.1016/S0140-6736(09)62124-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2010).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYang, Y. et al. MicroRNA-15b Targets VEGF and Inhibits Angiogenesis in Proliferative Diabetic Retinopathy. \u003cem\u003eJ. Clin. Endocrinol. Metab.\u003c/em\u003e \u003cb\u003e105\u003c/b\u003e (11), 3404\u0026ndash;3415. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1210/clinem/dgaa538\u003c/span\u003e\u003cspan address=\"10.1210/clinem/dgaa538\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2020).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMuniyandi, A. et al. Targeting Inflammation and Other Pathways for Treatment of Retinal Disease. \u003cem\u003eJ. Pharmacol. Exp. Ther.\u003c/em\u003e \u003cb\u003e386\u003c/b\u003e (1), 15\u0026ndash;25. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1124/jpet.122.001563\u003c/span\u003e\u003cspan address=\"10.1124/jpet.122.001563\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2023).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAntonetti, D. A., Silva, P. S. \u0026amp; Stitt, A. W. Current understanding of the molecular and cellular pathology of diabetic retinopathy. \u003cem\u003eNat. Rev. Endocrinol.\u003c/em\u003e \u003cb\u003e17\u003c/b\u003e (4), 195\u0026ndash;206. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41574-020-00451-4\u003c/span\u003e\u003cspan address=\"10.1038/s41574-020-00451-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eApte, R. S., Chen, D. S. \u0026amp; Ferrara, N. VEGF in Signaling and Disease: Beyond Discovery and Development. \u003cem\u003eCell\u003c/em\u003e \u003cb\u003e176\u003c/b\u003e (6), 1248\u0026ndash;1264. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.cell.2019.01.021\u003c/span\u003e\u003cspan address=\"10.1016/j.cell.2019.01.021\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2019).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLa Mendola, D., Trincavelli, M. L. \u0026amp; Martini, C. Angiogenesis in Disease. \u003cem\u003eInt. J. Mol. Sci.\u003c/em\u003e \u003cb\u003e23\u003c/b\u003e (18). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/ijms231810962\u003c/span\u003e\u003cspan address=\"10.3390/ijms231810962\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2022).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhang, J. et al. HIF-1α and HIF-2α redundantly promote retinal neovascularization in patients with ischemic retinal disease. \u003cem\u003eJ. Clin. Invest.\u003c/em\u003e \u003cb\u003e131\u003c/b\u003e (12). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1172/jci139202\u003c/span\u003e\u003cspan address=\"10.1172/jci139202\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRattner, A., Williams, J. \u0026amp; Nathans, J. Roles of HIFs and VEGF in angiogenesis in the retina and brain. \u003cem\u003eJ. Clin. Invest.\u003c/em\u003e \u003cb\u003e129\u003c/b\u003e (9), 3807\u0026ndash;3820. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1172/jci126655\u003c/span\u003e\u003cspan address=\"10.1172/jci126655\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2019).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTang, X. et al. Novel transcriptional regulation of VEGF in inflammatory processes. \u003cem\u003eJ. Cell. Mol. Med.\u003c/em\u003e \u003cb\u003e17\u003c/b\u003e (3), 386\u0026ndash;397. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/jcmm.12020\u003c/span\u003e\u003cspan address=\"10.1111/jcmm.12020\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2013).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZegeye, M. M. et al. Activation of the JAK/STAT3 and PI3K/AKT pathways are crucial for IL-6 trans-signaling-mediated pro-inflammatory response in human vascular endothelial cells. \u003cem\u003eCell. Commun. Signal.\u003c/em\u003e \u003cb\u003e16\u003c/b\u003e (1), 55. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s12964-018-0268-4\u003c/span\u003e\u003cspan address=\"10.1186/s12964-018-0268-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2018).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLi, B. et al. Nuclear proteins and diabetic retinopathy: a review. \u003cem\u003eBiomed. Eng. Online\u003c/em\u003e. \u003cb\u003e23\u003c/b\u003e (1), 62. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s12938-024-01258-4\u003c/span\u003e\u003cspan address=\"10.1186/s12938-024-01258-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2024).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhou, W., Yang, L., Nie, L. \u0026amp; Lin, H. Unraveling the molecular mechanisms between inflammation and tumor angiogenesis. \u003cem\u003eAm. J. Cancer Res.\u003c/em\u003e \u003cb\u003e11\u003c/b\u003e (2), 301\u0026ndash;317 (2021).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJeong, J. H., Ojha, U. \u0026amp; Lee, Y. M. Pathological angiogenesis and inflammation in tissues. \u003cem\u003eArch. Pharm. Res.\u003c/em\u003e \u003cb\u003e44\u003c/b\u003e (1), 1\u0026ndash;15. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s12272-020-01287-2\u003c/span\u003e\u003cspan address=\"10.1007/s12272-020-01287-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWeigelt, C. M. et al. AAV-Mediated Expression of Human VEGF, TNF-α, and IL-6 Induces Retinal Pathology in Mice. \u003cem\u003eTransl Vis. Sci. Technol.\u003c/em\u003e \u003cb\u003e10\u003c/b\u003e (11), 15. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1167/tvst.10.11.15\u003c/span\u003e\u003cspan address=\"10.1167/tvst.10.11.15\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMori, T., Li, Y., Hata, H., Ono, K. \u0026amp; Kochi, H. NIRF, a novel RING finger protein, is involved in cell-cycle regulation. \u003cem\u003eBiochem. Biophys. Res. Commun.\u003c/em\u003e \u003cb\u003e296\u003c/b\u003e (3), 530\u0026ndash;536. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/s0006-291x(02)00890-2\u003c/span\u003e\u003cspan address=\"10.1016/s0006-291x(02)00890-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2002).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMori, T., Li, Y., Hata, H. \u0026amp; Kochi, H. NIRF is a ubiquitin ligase that is capable of ubiquitinating PCNP, a PEST-containing nuclear protein. \u003cem\u003eFEBS Lett.\u003c/em\u003e \u003cb\u003e557\u003c/b\u003e, 209\u0026ndash;214. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/s0014-5793(03)01495-9\u003c/span\u003e\u003cspan address=\"10.1016/s0014-5793(03)01495-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2004).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRechsteiner, M. \u0026amp; Rogers, S. PEST sequences and regulation by proteolysis. \u003cem\u003eTrends Biochem. Sci.\u003c/em\u003e \u003cb\u003e21\u003c/b\u003e (7), 267\u0026ndash;271. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/s0968-0004(96)10031-1\u003c/span\u003e\u003cspan address=\"10.1016/s0968-0004(96)10031-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (1996).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHou, C., Li, Y., Wang, M., Wu, H. \u0026amp; Li, T. Systematic prediction of degrons and E3 ubiquitin ligase binding via deep learning. \u003cem\u003eBMC Biol.\u003c/em\u003e \u003cb\u003e20\u003c/b\u003e (1), 162. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s12915-022-01364-6\u003c/span\u003e\u003cspan address=\"10.1186/s12915-022-01364-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2022).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eXiaolei, Z. \u0026amp; Kausik, K. N. J. R. Large putative PEST-like sequence motif at the carboxyl tail of human calcium receptor directs lysosomal degradation and regulates cell surface receptor level. \u003cem\u003eJ. Biol. Chem.\u003c/em\u003e ; \u003cb\u003e287\u003c/b\u003e(6). (2012).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJuraj, B., J\u0026aacute;n, M. \u0026amp; Linda, W. Covalent attachment of the SUMO-1 protein to the negative regulatory domain of the c-Myb transcription factor modifies its stability and transactivation capacity. \u003cem\u003eJ. Biol. Chem.\u003c/em\u003e ; \u003cb\u003e277\u003c/b\u003e(11). (2002).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKhan, N. et al. Biology of PEST-Containing Nuclear Protein: A Potential Molecular Target for Cancer Research. \u003cem\u003eFront. Oncol.\u003c/em\u003e \u003cb\u003e12\u003c/b\u003e, 784597. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fonc.2022.784597\u003c/span\u003e\u003cspan address=\"10.3389/fonc.2022.784597\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2022).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChen, Y. et al. PCNP is a novel regulator of proliferation, migration, and invasion in human thyroid cancer. \u003cem\u003eInt. J. Biol. Sci.\u003c/em\u003e \u003cb\u003e18\u003c/b\u003e (9), 3605\u0026ndash;3620. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.7150/ijbs.70394\u003c/span\u003e\u003cspan address=\"10.7150/ijbs.70394\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2022).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang, D. et al. PEST-containing nuclear protein regulates cell proliferation, migration, and invasion in lung adenocarcinoma. \u003cem\u003eOncogenesis\u003c/em\u003e \u003cb\u003e8\u003c/b\u003e (3), 22. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41389-019-0132-4\u003c/span\u003e\u003cspan address=\"10.1038/s41389-019-0132-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2019).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eXu, Y. et al. Melatonin attenuated retinal neovascularization and neuroglial dysfunction by inhibition of HIF-1α-VEGF pathway in oxygen-induced retinopathy mice. \u003cem\u003eJ. Pineal Res.\u003c/em\u003e \u003cb\u003e64\u003c/b\u003e (4), e12473. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/jpi.12473\u003c/span\u003e\u003cspan address=\"10.1111/jpi.12473\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2018).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYue, T. et al. The role of inflammation in immune system of diabetic retinopathy: Molecular mechanisms, pathogenetic role and therapeutic implications. \u003cem\u003eFront. Immunol.\u003c/em\u003e \u003cb\u003e13\u003c/b\u003e, 1055087. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fimmu.2022.1055087\u003c/span\u003e\u003cspan address=\"10.3389/fimmu.2022.1055087\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2022).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eForrester, J. V., Kuffova, L. \u0026amp; Delibegovic, M. The Role of Inflammation in Diabetic Retinopathy. \u003cem\u003eFront. Immunol.\u003c/em\u003e \u003cb\u003e11\u003c/b\u003e, 583687. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fimmu.2020.583687\u003c/span\u003e\u003cspan address=\"10.3389/fimmu.2020.583687\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2020).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang, J., Xu, X., Elliott, M. H., Zhu, M. \u0026amp; Le, Y. Z. M\u0026uuml;ller cell-derived VEGF is essential for diabetes-induced retinal inflammation and vascular leakage. \u003cem\u003eDiabetes\u003c/em\u003e \u003cb\u003e59\u003c/b\u003e (9), 2297\u0026ndash;2305. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.2337/db09-1420\u003c/span\u003e\u003cspan address=\"10.2337/db09-1420\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2010).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLawrence, T. The nuclear factor NF-kappaB pathway in inflammation. \u003cem\u003eCold Spring Harb Perspect. Biol.\u003c/em\u003e \u003cb\u003e1\u003c/b\u003e (6), a001651. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1101/cshperspect.a001651\u003c/span\u003e\u003cspan address=\"10.1101/cshperspect.a001651\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2009).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHwang, D. B. et al. Egr1 Gene Expression as a Potential Biomarker for In Vitro Prediction of Ocular Toxicity. \u003cem\u003ePharmaceutics\u003c/em\u003e \u003cb\u003e13\u003c/b\u003e (10). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/pharmaceutics13101584\u003c/span\u003e\u003cspan address=\"10.3390/pharmaceutics13101584\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePeng, N., Zheng, M., Song, B., Jiao, R. \u0026amp; Wang, W. Transcription Factor EGR1 Facilitates Neovascularization in Mice with Retinopathy of Prematurity by Regulating the miR-182-5p/EFNA5 Axis. \u003cem\u003eBiochem. Genet.\u003c/em\u003e \u003cb\u003e62\u003c/b\u003e (2), 1070\u0026ndash;1086. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s10528-023-10433-6\u003c/span\u003e\u003cspan address=\"10.1007/s10528-023-10433-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2024).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLei, Z. et al. Novel peptide GX1 inhibits angiogenesis by specifically binding to transglutaminase-2 in the tumorous endothelial cells of gastric cancer. \u003cem\u003eCell. Death Dis.\u003c/em\u003e \u003cb\u003e9\u003c/b\u003e (6), 579. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41419-018-0594-x\u003c/span\u003e\u003cspan address=\"10.1038/s41419-018-0594-x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2018).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhu, M. et al. Intravitreal Ets1 siRNA alleviates choroidal neovascularization in a mouse model of age-related macular degeneration. \u003cem\u003eCell. Tissue Res.\u003c/em\u003e \u003cb\u003e376\u003c/b\u003e (3), 341\u0026ndash;351. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s00441-019-03001-1\u003c/span\u003e\u003cspan address=\"10.1007/s00441-019-03001-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2019).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhao, J. et al. MicroRNA-mediated Ets1 repression in retinal endothelial cells: A novel anti-angiogenic mechanism in nonproliferative diabetic retinopathy. \u003cem\u003eDiabetes Obes. Metab.\u003c/em\u003e \u003cb\u003e27\u003c/b\u003e (4), 1888\u0026ndash;1901. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/dom.16182\u003c/span\u003e\u003cspan address=\"10.1111/dom.16182\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2025).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKanehisa, M., Sato, Y., Kawashima, M., Furumichi, M. \u0026amp; Tanabe, M. KEGG as a reference resource for gene and protein annotation. \u003cem\u003eNucleic Acids Res.\u003c/em\u003e \u003cb\u003e44\u003c/b\u003e, D457\u0026ndash;D462 (2016).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKanehisa, M. \u0026amp; Goto, S. KEGG: Kyoto Encyclopedia of Genes and Genomes. \u003cem\u003eNucleic Acids Res.\u003c/em\u003e \u003cb\u003e28\u003c/b\u003e, 27\u0026ndash;30 (2000).\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"},{"header":"Tables","content":"\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" width=\"567\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"5\"\u003e\n \u003cp\u003e\u003cstrong\u003eTable. 1 Primer Sequence for qPCR\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eGene\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eForward\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eReverse\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eNCBI\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eProduct Length\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eHuman PCNP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eCCGCCGGAGGACCTGAAGAAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eTGGCTGATGCTTTCTTTGTCGTCTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eNM_001320395.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e201 bp\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eHuman GAPDH\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eCAAGGCTGTGGGCAAGGTCATC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eGTGTCGCTGTTGAAGTCAGAGGAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eNM_001256799.3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e228 bp\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Retinal Neovascularization, PCNP, VEGF, Mechanism, Transcriptome Sequencing","lastPublishedDoi":"10.21203/rs.3.rs-7314367/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7314367/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003ePurpose\u003c/h2\u003e\u003cp\u003eRetinal neovascularization (RNV) drives vision loss in diseases like diabetic retinopathy, and current anti-VEGF therapies have limitations. PEST-containing nuclear protein (PCNP) has roles in malignancy and angiogenesis, but its function in RNV is unclear. This study explored the function and underlying mechanisms of PCNP in RNV under in vitro conditions.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e\u003cp\u003eTo achieve PCNP overexpression or knockdown, human umbilical vein endothelial cells (HUVECs) were subjected to transfection. The effects on cell proliferation (CCK-8 assay), migration (wound healing assay), and in vitro angiogenesis (tube formation assay) were subsequently evaluated. VEGF levels in supernatants (ELISA, CBA) and cell lysates (Western blot) were quantified. Transcriptome sequencing was performed on PCNP-overexpressing HUVECs to identify altered signaling pathways.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e\u003cp\u003ePCNP overexpression significantly inhibited HUVEC proliferation, migration, and tube formation, key steps in neovascularization. Conversely, PCNP knockdown promoted these processes. While supernatant VEGF decreased unexpectedly in both groups, intracellular VEGF levels remained unchanged. Transcriptome analysis highlighted enrichment of IL-17, TNF, and NF-κB inflammatory signaling pathways with PCNP overexpression.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e\u003cp\u003ePCNP inhibits endothelial cell processes essential for neovascularization in vitro. The mechanism appears potentially independent of direct VEGF modulation and may involve inflammatory signaling pathways. PCNP emerges as a novel factor in RNV regulation, warranting further investigation for potential therapeutic targeting.\u003c/p\u003e","manuscriptTitle":"The Role and Potential Mechanism of Nuclear Protein PCNP in Retinal Neovascularization in Vitro","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-09-23 18:16:34","doi":"10.21203/rs.3.rs-7314367/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-10-13T11:59:03+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-10-09T01:51:27+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"181874676949019535184377488617431585432","date":"2025-09-28T06:59:07+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-09-28T05:35:30+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"335680896382812379897910346674942849226","date":"2025-09-28T05:33:03+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"311186369219531428294007958586552449153","date":"2025-09-28T02:54:41+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-09-15T07:55:20+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2025-08-27T08:07:18+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-08-26T09:18:15+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-08-26T02:54:27+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2025-08-26T02:51:38+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"a044d39e-b4f7-4744-adb2-3ceaba10485f","owner":[],"postedDate":"September 23rd, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":55068759,"name":"Biological sciences/Cancer"},{"id":55068760,"name":"Biological sciences/Cell biology"},{"id":55068761,"name":"Health sciences/Diseases"},{"id":55068762,"name":"Biological sciences/Molecular biology"}],"tags":[],"updatedAt":"2025-12-15T16:12:32+00:00","versionOfRecord":{"articleIdentity":"rs-7314367","link":"https://doi.org/10.1038/s41598-025-27494-9","journal":{"identity":"scientific-reports","isVorOnly":false,"title":"Scientific Reports"},"publishedOn":"2025-12-11 15:59:02","publishedOnDateReadable":"December 11th, 2025"},"versionCreatedAt":"2025-09-23 18:16:34","video":"","vorDoi":"10.1038/s41598-025-27494-9","vorDoiUrl":"https://doi.org/10.1038/s41598-025-27494-9","workflowStages":[]},"version":"v1","identity":"rs-7314367","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7314367","identity":"rs-7314367","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}