Effect of Curcumin Supplementation in Laying Hen Diet on Performance, Yolk Fatty Acid Composition and Elovl Genes

Effect of Curcumin Supplementation in Laying Hen Diet on Performance, Yolk Fatty Acid Composition and Elovl Genes | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Effect of Curcumin Supplementation in Laying Hen Diet on Performance, Yolk Fatty Acid Composition and Elovl Genes Büşra DUMLU, Şaziye Canan BÖLÜKBAŞI, Abdulkadir BAYIR This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6504409/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract The study was designed to determine the effects of different levels of curcumin supplementation in the diets of laying hens on performance, egg quality criteria, yolk fatty acid composition, and the identification, characterization, and mRNA transcription of the elongation of very long chain fatty acids (ELOVL) genes. In the experimental design, Hy-Line Brown commercial laying hens were selected for a feeding trial lasting ten weeks. During this period, the hens were fed diets supplemented with curcumin at 0, 100, 200, 300, and 400 mg/kg. Performance characteristics, egg quality criteria and yolk fatty acid compositionwere determined by measurements made during the experimental period. At the end of the experiment, the expression levels of ELOVL genes were determined in liver tissue samples. At the end of the experiment, it was found that 100 mg/kg curcumin significantly (p < 0.05) increased Haugh unit, while 300 mg/kg significantly (p < 0.05) increased egg weight. Addition of 100 mg/kg curcumin to the diet increased the ratio of linoleic acid and linolenic acid, while 200 mg/kg curcumin increased the ratio of docosahexaenoic acid (DHA) to the highest level. In addition, it was observed that 100 mg/kg curcumin significantly increased ELOVL6 and ELOVL7 gene expression levels, and 400 mg/kg significantly increased ELOVL5 gene expression levels. These findings add to the further evidence suggesting that dietary curcumin can modulate ELOVL mRNA transcription in chickens. As a result, it was concluded that especially 100 mg/kg curcumin level would be suitable for use in the diet of laying hens. curcumin ELOVL laying hens molecular cloning RT-qPCR Figures Figure 1 Figure 2 1. Introduction About one-third of a chicken ( Gallus gallus ) egg's overall nutrient composition consists of lipids. These are crucial for nutrition as they provide ω-3 fatty acids (ω-3 FAs), which are essential for healthy growth, development, and cognitive function during early life. Chicken eggs are a source of various nutrients required by the human body in appropriate amounts and proportions, highlighting the importance of lipids. Since mammals have a limited ability, if any, to produce ω-3 FAs, they must acquire these FAs through their diets. A typical chicken egg contains between 30 mg and 200 mg of ω-3, and the ω-3 FA levels can be significantly enhanced by providing the chickens with a diet rich in ω-3 FAs (Kralik et al. 2021 ). Chickens excel compared to many other species in converting linoleic acid (18:2n-6; LA) into arachidonic acid (20:4n-6; ARA) through elongation and desaturation activities. They also demonstrate efficiency in synthesizing ω-3 FAs, including eicosapentaenoic acid (20:5n-3; EPA) and docosahexaenoic acid (22:6n-3; DHA) from α-linolenic acid (18:3n-3; ALA) (Gregory et al., 2013 ). This advantage is attributed to the enzymatic actions of the elongation of very long chain fatty acids ( ELOVL ) and fatty acid desaturase ( FADS ) gene families that facilitate the elongation and desaturation processes. The ELOVL gene family consists of seven isoforms ( ELOVL 1-7), which are important regulators of substrate specificity, tissue distribution, and regulation, as well as overall FA elongation and cellular lipid composition (Ma et al., 2017 ). Each member of the ELOVL gene family has distinct functions. For example, ELOVL 6 is involved in de novo lipogenesis in chicken liver (Claire D'Andre et al., 2013). It encodes the ELOVL 6 enzyme, which regulates the final step of the endogenous saturated fatty acids (SFAs) synthesis. The ELOVL2 , ELOVL4 and ELOVL5 genes are involved in the elongation of long-chain (LC) FAs (Jakobsson et al., 2006 ). ELOVL5 is responsible for the hepatic synthesis of LC-polyunsaturated fatty acids (LC-PUFAs) (Feng et al., 2020 ). In addition, this gene plays an important role in the biosynthesis of ω-3 PUFA, including EPA and DHA, as well as ω-6 PUFA (Fu et al., 2018 ). It has been reported that ELOVL5 can be extended to tetracosapentaenoic acid (24:5n-3; DPA) in chickens, unlike to other poultry, such as ducks and turkeys. Therefore, it has been suggested that chicken may be a dietary source of EPA and DHA, like fish. Numerous investigations have been conducted to enhance the levels of EPA and DHA in eggs (Kralik et al., 2021 ). Studies indicate that certain biologically active substances incorporated into the diet may promote the conversion of ALA into DHA by stimulating ELOVL enzymes (Wu et al., 2015 ). The utilization of these active compounds can lead to improved yield and product quality, such as curcumin. Curcumin, recognized as the 'golden spice', is derived from the roots of the turmeric plant ( Curcuma longa ), which is cultivated in India and other regions of South Asia. This yellow powder serves not only as a food colorant and flavoring but also functions as a medicinal compound. Within turmeric, there are several curcuminoids, including curcumin (the most biologically active), demethoxycurcumin, bisdemethoxycurcumin, and cyclocurcumin (Shahrajabian and Sun, 2023 ). Notably, curcumin constitutes about 77–80% of the total curcuminoid content (Alves et al., 2019 ). The properties of curcumin, such as increasing DHA in the brain and liver (by enhancing ELOVL2 ), increasing enzymes involved in the DHA synthesis pathway, and reducing anxiety-like behavior, have been identified (Wu et al., 2015 ). Some researchers have reported that the number of studies investigating the conversion of ALA to EPA and DHA at the molecular level in laying hens is quite limited and that ELOVL genes play key roles in elongation and desaturation processes in living organisms (Zhang et al., 2016 ). For these reasons, we identified and characterized ELOVL genes in the chicken genome for the first time to better understand their functions in FA metabolism in chickens. We also investigated the effects of diets supplemented with various levels of curcumin on hen performance, egg quality characteristics, the FA composition of egg yolk, and the expression levels of the ELOVL genes. 2. Material and Methods 2.1. Animals, diets, and sampling A total of 40 Hy-Line Brown commercial laying hens, aged 68 weeks, were used in this study. Approval for conducting the study was obtained from the Atatürk University Animal Experiments Local Ethics Committee (2022/59). The hens were divided into five groups of eight, with each hen placed in individual cages measuring 60x60x50 cm. The first group received a basal diet (C0), while the other groups were given diets supplemented with 100 (C100), 200 (C200), 300 (C300), and 400 (C400) mg/kg of curcumin, added to the basal diet. The C0 diet used in the experiment was sourced from a commercial feed mill (Table 1 ), and the curcumin (99% purity) was acquired from Grenera Nutrients Pvt Ltd. Throughout the ten-week experiment, feed and water were provided ad libitum to the individually housed hens. Following the conclusion of the feeding trial, the hens were euthanized, and approximately 1 gram of liver was collected (n = 3). This sample was placed into 2 ml DNase/RNase-free tubes along with 1 ml of RNAlater and stored at -20°C overnight. Subsequently, it was kept at -80°C until further analysis. Samples from various tissues, including the liver, small intestine, chest muscle, brain, heart, eyes, adipose tissue, gizzard, kidney, skin, ovary, spleen, lung, peel stomach, and leg muscle were obtained from the chickens (n = 3) to investigate the tissue-specific distribution of FADS genes. 2.2. Determination of general performance characteristics Feed intake, egg weight, egg mass, egg production, and feed conversion ratio were measured every two weeks. Quality criteria such as shell thickness, shell strength, Haugh unit, egg yolk color, and the proportions of egg white, yolk, and shell were also assessed through these fortnightly measurements. 2.3. Determination of yolk fatty acid composition The extraction of total lipids from both diets and egg yolks was performed following the methodology established by Folch et al. ( 1957 ) at the end of the experiment. To create a homogenate, six samples from each treatment group and diet were combined and ground together. The preparation of fatty acid methyl esters (FAMEs) was conducted using the method described by Metcalfe and Schmitz ( 1961 ). These FAMEs were analyzed through gas chromatography, employing a DB-23 capillary column with specifications of 60 m length, 0.25 mm inner diameter, and a film thickness of 0.25 µm. The initial temperature for the ejector and detector was set at 190°C for 35 minutes and then was raised to 220°C at a rate of 30°C per minute, holding this temperature for an additional 5 minutes. Hydrogen was used as the carrier gas at a flow rate of 2 ml per minute, with a fixed split ratio of 30:1. Individual fatty acids (FAs) were identified by comparing their retention times to those of a standard FA mixture (Supelco 37 component FAME mix). The quantification of each fatty acid was based on the peak area of the internal standard C19:0 (Sigma, USA) and expressed as a percentage of the total FAMEs. 2.4. Identification of ELOVL genes The sequences of mRNA for the chicken ELOVL1 to ELOVL7 genes were determined by utilizing the polypeptide sequences of the corresponding zebrafish ( Danio rerio ) Elovls as queries in a specific BLASTP search within the Ensembl genome database ( http://useast.ensembl.org/Multi/Tools/Blast?db=core ). Additionally, second tBLASTn search was performed at the National Center for Biotechnology Information (NCBI) ( http://blast.ncbi.nlm.nih.gov ) with the ELOVL polypeptide sequences to obtain Expressed Sequence Tags (ESTs) for each ELOVL gene. However, no ESTs for ELOVL1 , ELOVL2 , ELOVL3 , ELOVL4 , ELOVL5 , ELOVL6 , or ELOVL7 were identified in the NCBI EST database (release: 248). As a result, RT-PCR was conducted to synthesize the mRNAs for ELOVL1 through ELOVL7 , followed by sequencing. The newly obtained sequences were aligned with the genomic sequences of ELOVL from Ensembl to verify their exon/intron structures. The molecular weights (MWs) and theoretical isoelectric points (p I ) chicken of ELOVL proteins were computed with the Protparam software ( https://web.expasy.org/protparam/ ) (Gasteiger et al., 2005 ). The identification of the ELO domain (Pfam: PF01151) was carried out using the HMMER software, version 3.3 ( https://www.ebi.ac.uk/Tools/hmmer/ ) (Potter et al., 2018 ). The SignalP-6.0 server was used to determine signal peptide cleavage of ELOVL polypeptides ( https://services.healthtech.dtu.dk/services/SignalP-6.0/ ) (Teufel et al., 2022 ). The putative TATA boxes and transcription initiation sites were determined using SoftBerry algorithm ( http://www.softberry.com/ ), and putative polyadenylation signals [poly(A) tail] were calculated at http://www.fruitfly.org/seq_tools/promoter.html (Reese, 2001 ). 2.5. Orthology of ELOVL amino acids The relationships of orthologous chicken ELOVL genes were established through individual BLAST searches, utilizing each putative sequence as a query via the OrthoInspector database ( https://www.lbgi.fr/orthoinspectorv3/ ; Nevers et al., 2019 ). The MAFFT program was employed for multiple alignments of ELOVL/Elovl amino acid sequences (Katoh et al., 2019 ). These alignments were reexamined with trimAl to enhance the bootstrap values by eliminating poorly aligned sections (Capella-Gutierrez et al., 2009). A Bayesian phylogenetic tree, created with NGPhlogeny.fr ( https://ngphylogeny.fr/ ; Lemoine et al., 2019 ), illustrated the phylogenetic relationships among chicken ELOVLs and ELOVLs/Elovls from other vertebrates, comprising 10 6 generations, a sampling frequency of 100, and a burn-in of 10,000. A neighbor-joining phylogenetic tree was also generated with 1000 bootstrap replicates using MEGA5 software to allow for comparison of the two phylogenetic trees (Tamura et al., 2011 ). To assess sequence identity and similarity, the amino acid sequences of chicken ELOVL genes were examined against the amino acid sequences of other vertebrates with the BLOSUM62 (Gromiha, 2010 ). Conserved gene synteny of the ELOVL genes was analyzed in relation to the ELOVL / elovl genes from D. rerio and humans ( Homo sapiens ) through the Genomicus online database ( https://www.genomicus.bio.ens.psl.eu/ ; Nguyen et al., 2018 ). All the protein sequences used in this study was supplied in Supplementary file 1. 2.6. Total RNA extraction and reverse transcription Total RNA was extracted from all examined tissues utilizing RNAlater reagent (Invitrogen), with the integrity of the resulting RNA confirmed through 2% agarose gel electrophoresis. The amount of RNA was quantified at 260 nm with a spectrophotometer. To eliminate genomic DNA from the RNA, the DNAse I kit (Life Technologies) was employed. The synthesis of the first-strand cDNA was conducted using an Omniscript Reverse Transcription kit (Qiagen), incorporating two micrograms of total RNA from each tissue sample. Reverse transcription was applied at 37 o C for 60 minutes using a PCR machine. 2.7. Tissue-specific transcription and nutrigenomics of chicken ELOVL genes The quantitative polymerase chain reaction (qPCR) analysis was carried out with the SYBR Green PCR kit (Qiagen). The conditions for qPCR included, an initial denaturation phase at 95°C for 15 minutes, followed by 40 cycles of denaturation at 95°C for 20 seconds, annealing for 30 seconds, elongation at 72°C for one minute, and a final elongation step at 72°C for five minutes. Negative controls for the qPCR analysis of each ELOVL gene were conducted using template-free tubes. PCR and quantitative PCR (qPCR) primers, as listed in Table 2 , were designed using NCBI Primer-BLAST ( http://www.ncbi.nlm.nih.gov/tools/primerblast/ ). The differences in hepatic mRNA expression in laying hens fed diets containing various levels of curcumin were assessed using the 2 −ΔΔCt method described by Livak and Schmittgen ( 2001 ). ELOVL mRNA expression levels were normalized by calculating the ratio of their copy number to that of the reference gene, TATA-box binding protein (ENSGALG00010007866; TBP) (Na et al., 2021 ). Specific primers that span the exon-exon splice junctions for ELOVL1, ELOVL2, ELOVL3, ELOVL4, ELOVL5, ELOVL6 , and ELOVL7 were designed using the NCBI-Primer BLAST tool. 2.8 Statistical Analysis The data obtained at the end of the research were analyzed using the General Linear Model procedure and the SPSS package program. The significance of the means found to be significant between the groups was determined by Duncan's multiple comparison test. 3. Results 3.1. Performance traits Our study revealed that the addition of different amounts of curcumin to the diet did not significantly affect feed intake, egg production or feed conversion ratio (FCR) in laying hens (P > 0.05), but there was a significant difference (P < 0.05) in egg weight between the curcumin supplemented groups (Table 3 ). 3.2. Egg internal and external quality criteria In the present study, it was found that the addition of curcumin to the diet affected the egg quality criteria in laying hens (Table 4). In particular, it was observed that Haugh Unit increased significantly (P < 0.05) in the group supplemented with 100 mg/kg curcumin, the highest albumin and the lowest yolk ratio were in the C300 group. Shell ratio and shell thickness were found to be the lowest in the C100 and C300 groups (P < 0.01), and shell breaking strengt was found to be decreased (P < 0.01) in all curcumin supplemented groups compared to the control group. 3.3. Fatty acid composition of egg yolk The study's conclusion revealed that the inclusion of curcumin had a significant impact on the fatty acid composition of egg yolk, with the exceptions of myristic and palmitoleic acids. Palmitic acid levels rose alongside curcumin concentration, peaking in the C300 and C400 groups (P < 0.01). Meanwhile, curcumin supplementation notably reduced stearic acid levels, with the C100 group exhibiting the lowest amount (P < 0.01). Additionally, oleic acid levels were also lowest in the C100 group. As indicated in Table 5, there were highly significant differences in LA and ALA levels among the groups, with the C100 group showing the highest values for both FAs (P < 0.01). However, rising levels of curcumin led to a marked decrease in the ratios of these FAs. A significant difference was observed in ARA levels, with the C400 group presenting the lowest value and the C300 group the highest (P < 0.01). The C200 group had the highest ratio of DHA (P < 0.01). Although the EPA levels differed significantly between groups (P < 0.01), the addition of curcumin at 100 and 300 mg/kg resulted in a reduced EPA ratio (Table 5). 3.4. ELOVL genes in the chicken genome We identified seven ELOVL genes in the chicken genome based on in silico analyses and subsequently uploaded their open reading frame (ORF) sequences to the NCBI genome database. The accession numbers for these cDNAs are as follows: ELOVL1 (873 bp) is PP601341, ELOVL2 (894 bp) is PP601342, ELOVL3 (759 bp) is PP601343, ELOVL4 (945 bp) is PP601344, ELOVL5 (888 bp) is PP601345, ELOVL6 (798 bp) is PP601346, and ELOVL7 (840 bp) is PP601347. Correspondingly, the ORFs translate into 290, 297, 252, 314, 295, 265, and 279 amino acids. 3.5. Alignment of chicken ELOVL polypeptides with polypeptide sequences of ELOVL/Elovl from various vertebrate species The ELOVL protein sequences in chickens showed the highest levels of identity and similarity when compared to ELOVL/Elovl orthologs found in other avian species (Supplementary file 4). A gradual decline in sequence identity and similarity was observed between the chicken ELOVL sequences and their orthologous counterparts in fish and mammals. This decline continued further with non-orthologous sequences from these same groups, providing additional evidence that the chicken genome comprises seven ELOVL genes. 3.6. The phylogenetic relationships of chicken ELOVL proteins in comparison to those from other vertebrate species A Bayesian phylogenetic tree was constructed using ELOVL amino acid sequences from a variety of birds, fishes, and mammals to explore the evolutionary relationships of the putative ELOVL proteins in chickens and their orthologous counterparts across different vertebrates (Fig. 2 ). The clustering of chicken ELOVL proteins was observed in specific clades alongside ELOVL/Elovl proteins from other vertebrate species. Moreover, a neighbor-joining method applied to the same vertebrate ELOVL/Elovl protein sequences produced a phylogenetic tree with a topology similar to the Bayesian analysis (Supplementary file 5). 3.7. Conserved gene synteny analysis of chicken ELOVL genes with ELOVL / elovl genes from zebrafish and humans The ELOVL1 , ELOVL2, ELOVL3, ELOVL4, ELOVL5, ELOVL6 , and ELOVL7 genes in the chicken genome were located on chromosomes 8, 2, 6, 3, 3, 4, and Z, respectively. Additionally, the conserved synteny shared by the chicken ELOVL gene family and the ELOVL / elovl genes found in zebrafish and humans supports the hypothesis that the chicken ELOVL genes are orthologous to those in other vertebrates (Supplementary file 6). Consequently, in silico analyses indicated that the chicken ELOVL genes evolved from a shared ancestral gene. 3.8. Tissue-specific transcription of ELOVL genes in the chicken genome Examining Supplementary file 6, no significant difference was observed between tissues in terms of ELOVL1 and ELOVL7 genes. The differences in the expression levels of ELOVL2 , ELOVL3 , ELOVL4, ELOVL5 and ELOVL6 genes were found to be significant (p < 0.01). The highest levels of ELOVL2 and ELOVL6 were found in the liver. The highest mRNA level of ELOVL3 gene was found in adipose tissue, the highest level of ELOVL4 gene was found in skin tissue, and the highest expression level of ELOVL5 gene was found in glandular stomach tissue. 3.9. Nutritional regulation of the ELOVL genes by diets containing various levels of curcumin Figure 1 shows the Ct values of ELOVL gene family expression in liver tissues of laying hens whose diets were supplemented with different levels of curcumin. It is understood that the level of curcumin has a significant (P < 0.05) effect on the ELOVL1 gene. It is observed that the expression level is highest in the groups to which 200 and 300 mg/kg curcumin was added. It was found that the mRNA expression level of ELOVL2 gene decreased significantly (P < 0.01) in C200 and C300 groups compared to C0 group. However, the expression levels in the C100 and C400 groups were not different from the C0 group. ELOVL3 and ELOV4 gene expression levels were not affected by the addition of curcumin to the diet. A significant (P < 0.01) difference was found between the groups in terms of ELOVL5 gene expression levels. The ELOVL5 expression level increased due to the increase in curcumin level and the highest value was found in the C400 group. It was found that the addition of 100 mg/kg curcumin to the diet increased the ELOVL6 and ELOVL7 gene expression levels to the highest level (p < 0.05). 4. Discussion Our investigation revealed that the addition of of curcumin to the diet did not affect feed intake, egg production, or feed conversion rates in laying hens, which is by previous studies (Park et al. ,2012; Li et al., 2024 ). However, adding 300 mg/kg of curcumin to the diet significantly increased egg weight, consistent with findings from Park et al. ( 2012 ). Therefore, we concluded that curcumin has a biological effect and may exhibit different effects above or below a certain threshold value (Gupta et al., 2011 ). However, more research is needed to determine the biological mechanism of action and the optimal dose of curcumin. The C100 group exhibited the highest Haugh Unit value ( P < 0.019), likely attributable to the mineral and moisture content of albumin, along with the antioxidant properties of curcumin (Park et al., 2012 ; Li et al., 2024 ). Notable differences emerged among the groups concerning the ratios of egg white to yolk, with the C300 group displaying the peak white ratio and the lowest yolk ratio ( P < 0.01; Table 4). Nevertheless, Li et al. ( 2024 ) indicated that the inclusion of curcumin as a dietary additive did not influence the weight of the yolks. A decrease in the shell ratio was observed in both the C100 and C300 groups ( P < 0.030). Some studies suggest that curcumin might assist in preserving shell ratio due to its properties, which include neutralizing free radicals, lowering oxidative stress, offering anti-inflammatory benefits, mitigating inflammation-related damage, and providing cellular protection (Gupta et al., 2011 ). Our findings also indicated that the inclusion of curcumin in diets led to a reduction in shell thickness in all treatment groups apart from C200 in comparison to the control group. Conversely, Liu et al. ( 2020 ) reported that varying concentrations of curcumin added to the diets of hens under heat stress significantly enhanced shell thickness. Many problems such as anxiety, Alzheimer's disease, major depressive disorder, and attention deficit disorder, are associated with DHA deficiency (Chen and Su, 2013 ; McNamara et al., 2013 ). Therefore, ω-3 PUFAs play a critical role in brain health and the prevention of cognitive disorders in general. In this study, LA levels were quite low in the C200 group, while DHA levels were the highest. It is thought that the addition of 200 mg/kg of curcumin to the diet promotes the conversion of LA to DHA. It has been reported that the ELOVL4 and ELOVL5 genes are responsible for the elongation of PUFA (Zhang et al., 2016 ). It was found that the ELOVL5 gene expression was significantly higher in the C200 group than in the C0 group (Fig. 1 ). Similarly, DHA levels in the liver of rats fed diets containing ALA + 250 ppm curcumin was found to be the highest compared to other groups. The same researchers reported that curcumin may increase the conversion of ALA to DHA in vivo , resulting in increased DHA in the liver, which might be explanation of the highest DHA content in the C200 group. The EPA level was lower in the C200 group than in the C0 group. As EPA is converted to DHA (Li et al., 2010 ; Morais et al., 2012 ), the lowest level of EPA and the highest level of DHA in the C200 group can be explained by the conversion of EPA to DHA. The ELOVL genes comprise varying numbers of exons: ELOVL1 has 7, ELOVL2 has 8, ELOVL3 has 4, ELOVL4 has 6, ELOVL5 has 7, ELOVL6 has 4, and ELOVL7 has 7. Consequently, there is a lack of a conserved gene structure amongst the ELOVL genes in chickens. All characterised ELOVL genes adhered to the GT-AG intron splicing motif (Mount, 1982 ) (Supplementary file 2). The putative TATA boxes, transcription initiation sites, and poly(A) tails of ELOVL genes were also provided in supplementary file 2. The MWs and theoretical p I values of ELOVL amino acids varied, ranging from 29.92 kDa for ELOVL3 to 36.76 kDa for ELOVL4, and from 9.18 for ELOVL7 to 9.65 for ELOVL4, respectively. No signal peptide cleavage was determined in FADS polypeptides, indicating they could be non-secretory proteins (Ding et al., 2017 ). The HXXHH motif along with the ELO domain (Pfam: PF01151) is highly conserved across ELOVL polypeptides (Liu et al., 2024 ). All chicken ELOVL proteins examined included both the PF01151 domain and the HXXHH motif (Supplementary file 3). When the phylogenetic relationships of chicken ELOVL proteins compared to other vertebrate species are evaluated, both phylogenetic analyses reveal that ELOVL polypeptides can be categorized into three main branches. Branch 1 includes ELOVL2, ELOVL4, and ELOVL5, branch 2 comprises ELOVL1 and ELOVL4, while branch 3 contains ELOVL3 and ELOVL6. These phylogenetic evaluations aligned with the findings from BLAST database searches that pinpointed the amino acid-encoding ELOVL genes, as well as the protein sequence alignments that demonstrated levels of sequence identity and similarity, confirming the presence of seven ELOVL genes within the chicken genome, which is the same as in mammals (Liu et al., 2024 ). According to quantitative RT-PCR analysis, the expression levels of ELOVL gene transcripts varied significantly across different tissues in chickens, including the liver, small intestine, chest muscle, brain, heart, eyes, adipose, gizzard, kidney, skin, ovaries, spleen, lungs, peel stomach, and leg muscle, with the exception of ELOVL1 and ELOVL7 (Supplementary file 7). Wang et al. ( 2022 ) identified 51 single nucleotide polymorphisms (SNPs) within chicken ELOVL genes, noting that SNPs were absent only in the ELOVL1 and ELOVL7 genes. Consequently, we proposed that ELOVL1 and ELOVL7 could retain the original functions of ELOVL genes. The highest mRNA expression of ELOVL2 , ELOVL3 , ELOVL4 , ELOVL5 , and ELOVL6 were determined in the liver, adipose, skin, peel stomach, and liver, respectively. A similar tissue-specific distribution was reported by Mihelic et al. ( 2020 ) for ELOVL2 , ELOVL5 , and ELOVL6 in chickens. Differential transcription of chicken ELOVL genes in various tissues suggests that they have different functions due to the accumulation of mutations in their transcriptional control sites after their divergence from the ancestral ELOVL gene. At this point, we examined how dietary curcumin influences the transcripts of the chicken ELOVL genes, aiming to gain a deeper insight into the role of ELOVL genes in the metabolism of FAs in chickens. The hepatic mRNA expression levels of chicken ELOVL genes were significantly influenced by diets containing various levels of curcumin. Both ELOVL1 and ELOVL7 genes exhibited a similar response to the curcumin supplemented diets, with the C400 diet leading to a reduction in their transcriptions (Fig. 1 ). This observation further suggests that ELOVL1 and ELOVL7 may share functional similarities. As previously mentioned, ELOVL2 , ELOVL4 , and ELOVL5 genes cluster in the Bayesian and NJ phylogenetic trees. However, dietary curcumin did not uniformly affect the mRNA expressions of ELOVL genes. The lowest expression of ELOVL2 mRNA was observed in the C200 and C300 diets, whereas the highest transcription levels of ELOVL4 were found in the same C200 and C300 diets. Meanwhile, the ELOVL5 gene showed maximum expression when provided with C200, C300, and C400 diets. Previous reports suggested that ELOVL genes show substrate specificity: ELOVL2 , ELOVL4 , and ELOVL5 preferentially utilize PUFAs, while ELOVL1 , ELOVL3 , ELOVL6 , and ELOVL7 prefer SFAs and MUFAs as their substrates (Monroig et al., 2010 ). The ELOVL1 gene exhibited the highest transcription levels in the C200 and C300 groups, while ELOVL3 showed peak expression in the C0, C100, C300, and C400 groups. For ELOVL6 , the maximum transcription was observed in the C100 group, and ELOVL7 demonstrated elevated levels in the C100, C200, and C300 groups (Fig. 1 ). These findings effectively demonstrate that diets supplemented with various levels of curcumin do not influence substrate specificity in chicken ELOVL genes. 5. Conclusions In our study, we cloned ORFs of seven ELOVL genes found in the chicken genome. From our bioinformatics investigations, along with examinations of tissue-specific distribution and the nutritional regulation of ELOVL genes, we proposed several conclusions: (1) ELOVL/elovl genes in chickens and other vertebrates are orthologous and likely evolved from a common ancestral gene. (2) ELOVL1 and ELOVL7 demonstrated similar patterns in tissue-specific transcription; however, their reactions to diets supplemented with curcumin differed. Consequently, a thorough promoter analysis is necessary to clarify their functions in chickens. (4) It was determined that the diet enriched with 200 mg/kg curcumin significantly increased the Haugh Unit and DHA ratio in egg yolk. (5) This research is the first to investigate the nutritional regulation of ELOVL genes using various curcumin dietary levels in chickens, revealing that the mRNA expression of each ELOVL gene responds differently to dietary curcumin. Nevertheless, the intricate nature of FA metabolism complicates a complete understanding of the results and more detail investigation are needed. Declarations Author contributions B Dumlu: conceptualization, methodology, sampling, experimentation, data curation, writing the original draft, and editing; ŞC Bölükbaşı: conceptualization, methodology, project administration, funding acquisition, sampling, experimentation, data curation, writing the original draft, and editing; A Bayır: conceptualization, methodology,writing the original draft, and editing Funding: This study was funded by Scientific Projects Unit of Atatürk University with the project number FDK-2022-10825. Ethics and animal welfare The study was conducted in accordance with the ethics committee principles of Ataturk University Animal Experiments Local Ethics Committee (2022/59). Consent for participation Informed consent was obtained from all individual participants included in the study. Consent to publish Not applicable. Competing interest, The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Data availability The data that support the findings of this study are available from the corresponding author upon reasonable reques. References Alves RC, Fernandes RP, Fonseca-Santos B, Victorelli FD, Chorilli M.. A critical review of the properties and analytical methods for the determination of curcumin in biological and pharmaceutical matrices. Critic Review Analyts Chemist 2019; 49(2), 138-149. Doi: 10.1080/10408347.2018.1489216 Capella-Gutierrez S, Silla-Martinez JM, Gabaldon T. trimAl: a tool for automated alignment trimming in large-scale phylogenetic analyses. Bioinformatics 2009:25: 1972-1973. doi: 10.1093/bioinformatics/btp348. Chen HF, Su HM. Exposure to a maternal n-3 fatty acid-deficient diet during brain development provokes excessive hypothalamic–pituitary–adrenal axis responses to stress and behavioral indices of depression and anxiety in male rat offspring later in life. J Nutr Biochem 2013;24: 70-80. doi: 10.1016/j.jnutbio.2012.02.006 Claire D’Andre H, Paul W, Shen X, Jia X, Zhang R, Sun L, Zhang X. Identification and characterization of genes that control fat deposition in chickens. J Anim Sci Biotechnol 2013; 4: 43. Ding LY, Jin M, Sun P, Lu Y, Ma HN, Yuan Y, Fu HY, Zhou QC. Cloning, tissue expression of the fatty acid-binding protein (Pt-FABP1) gene, and effects of dietary phospholipid levels on fabp and vitellogenin gene expression in the female swimming crab Portunus trituberculatus . Aquaculture 2017; 474: 57-65. doi: 10.1016/j.aquaculture.2017.03.029. Feng X, Zhang ., Xu S, Shen A. ATP-citrate lyase (ACLY) in lipid metabolism and atherosclerosis: an updated review. Prog Lipid Res 2020; 77: 101006. Folch J, Less M, Stanley S. A Simple method for the isolation and purification of total lipides from animal tissues. J Biol Chem 1957; 226: 497-509. Fu S, Zhao Y, Li Y, Li G, Chen Y, L, Z, Sun G, Li H, Kang, Yan F. Characterization of miRNA transcriptome profiles related to breast muscle development and intramuscular fat deposition in chickens. J Cell Biochem 2018; 119: 7063-7079. Gasteiger E, Hoogland C, Gattiker A, Duvaud S, Wilkins MR, Appel RD, Bairoch A. Protein Identification and Analysis Tools on the Expasy Server; (In) John M. Walker (ed): The Proteomics Protocols Handbook, Humana Press 2005; pp571-607. Gregory MK, Geier MS, Gibson RA, James MJ. Functional characterization of the chicken fatty acid elongases. J Nutr 2013;143: 12-16. doi:10.3945/jn.112.170290 Gromiha MM. Protein sequence analysis. In: Protein Bioinformatics: From Sequence to Function. Elsevier Inc., New Delhi, India. 2010; pp: 29-62. Gupta SC, Patchva S, Aggarwal BB. Therapeutic roles of curcumin: lessons learned from clinical trials. The AAPS Journal 2011; 13: 195-218. Jakobsson A, Westerberg R, Jacobsson A. Fatty acid elongases in mammals: their regulation and roles in metabolism. Prog Lipid Res 2006; 45: 237-249. https://doi.org/10.1016/J.PLIPRES.2006.01.004 Katoh K, Rozewicki J, Yamada KD. MAFFT online service: multiple sequence alignment, interactive sequence choice and visualization. Brief Bioinfo 2019; 20: 1160-1166. doi: 10.1093/bib/bbx108. Kralik G, Kralik Z, Grčević M, Galović O, Hanžek D, Biazik E. Fatty acid profile of eggs produced by laying hens fed diets containing different shares of fish oil. Poultry Sci 2021; 100: 101379. Lemoine F, Correia D, Lefort V, Doppelt-Azeroual O, Mareuil F, Cohen-Boulakia S, Gascuel O. NGPhylogeny.fr: new generation phylogenetic services for non-specialists. Nucleic Acid Res 2019; 47: W260-W265. https://doi.org/10.1093/nar/gkz303 Li C, Gao J, Guo S, He B, Ma W. Effects of curcumin on the egg quality and hepatic lipid metabolism of laying hens. Animal 2024; 14: 138. https://doi.org/10.3390/ani14010138 Li Y, Monroig O, Zhang L, Wang S, Zheng X, Dick JR, You C, Tocher DR. Vertebrate fatty acyl desaturase with Δ4 activity. PNAS 2010; 107. 16840-16845. Liu M, Lu Y, Gao P, Xie X, Li D, Yu D, Yu M. Effect of curcumin on laying performance, egg quality, endocrine hormones, and immune activity in heat-stressed hens. Poultry Sci 2020; 99: 2196-2202. https://doi.org/10.1016/j.psj.2019.12.001 Liu MY, Wang QC, Li JQ, Zhang D, Mu JH, Shen XH. Genome-wide identification and comparative analysis of elongation of very long-chain fatty acid (Elovl) genes in echinoderms. General Genetic 2024; 60: 450-459. doi: 10.1134/S1022795424040070 Livak KJ Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2 −ΔΔCT method. Methods 2001; 25: 402-408. https://doi.org/10.1006/meth.2001.1262 Ma Z, Li H, Zheng H, Jiang K, Yan F, Kang X, Wang Y, Liu X, Tian Y. Hepatic ELOVL6 mRNA is regulated by the gga-miR-22-3p in egg-laying hen. Gene, 2017; 623: 72-79. McNamara RK, Jandacek R, Rider T, Tso P, Dwivedi Y, Pandey GN. Adult medication-free schizophrenic patients exhibit long-chain omega-3 fatty acid deficiency: implications for cardiovascular disease risk. Cardiovas Psychiat Neurol 2013; 796462. doi: 10.1155/2013/796462 Metcalfe L, Schmitz A. The rapid preparation of fatty acid esters for gass chromatographic analysis. Anal Chem 1961; 33: 363-364. doi: 10.1021/ac60171a016. Mihelic R, Winter H, Powers JB, Das S, Lamour K, Campagna SR, Voy BH. Genes controlling polyunsaturated fatty acid synthesis are developmentally regulated in broiler chicks. Br Poult Sci 2020; 61: 508–517. https://doi.org/10.1080/00071668.2020.1759788 Monroig O, Rotllant J, Cerda-Reverter JM, Dick JR, Figueras A, Tocher DR. Expression and role of Elovl4 elongases in biosynthesis of very long-chain fatty acids during zebrafish Danio rerio early embryonic development. Biochim Biophys Acta 2010; 1801: 1145-1154. doi: 10.1016/j.bbalip.2010.06.005 Morais S, Castanheira F, Martinez-Rubio L, Conceição LEC, Tocher DR. Long chain polyunsaturated fatty acid synthesis in a marine vertebrate: ontogenetic and nutritional regulation of a fatty acyl desaturase with Δ4 activity. BBA- Mol Cell Biol L 2012; 1821: 660-671. Mount S.M. A catalog of splice junction sequences. Nucleic Acid Res 1982; 10: 459-472. doi: 10.1093/nar/10.2.459. Na W, Wang Y, Gong P, Zhang X, Zhang K, Zhang H, Wang N, Li H. Screening of reference genes for RT-qPCR in chicken adipose tissue and adipocytes. Front Physiol 2021; 12: 676864. https://doi.org/10.3389/fphys.2021.676864 Nevers Y, Kress A, Defosset A, Ripp R, Linard B, Thompson JD, Poch O, Lecompte O. OrthoInspector 3.0: open portal for comparative genomics. Nucleic Acid Res 2019; 47: D411-D418. doi: 10.1093/nar/gky1068 Nguyen NTT, Vincens P, Crollius HR, Louis A. Genomicus 2018: karyotype evolutionary trees and on-the-fly synteny computing. Nucleic Acid Res 2018; 46: D816-D822. doi: 10.1093/nar/gkx1003 Park SS, Kim JM, Kim EJ, Kim HS, An BK, Kang CW. Effects of dietary turmeric powder on laying performance and egg qualities in laying hens. Korean J Poult Sci 2012; .39: 27-32. Potter SC, Luciani A, Eddy SR, Park Y, Lopez R, Finn RD. HMMER web server: 2018 update. Nucleic Acid Res 2018; 46 (Web server issue), W200-W204. doi: 10.1093/nar/gky448 Reese MG. Application of a time-delay neural network to promoter annotation in the Drosophila melanogaster genome. Comput Chem 2001; 26: 51-56. doi: https://doi.org/10.1016/S0097-8485(01)00099-7 Shahrajabian MH, Sun W. The Golden spice for life: turmeric with the pharmacological benefits of curcuminoids components, including curcumin, bisdemethoxycurcumin, and demethoxycurcumin. Current Org Synth 2023; doi: 10.2174/1570179420666230607124949 Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. MEGA5: Molecular evolutionary genetic analysis using maximum likelihood. Evolutionary distance, and maximum parsimony methods. Mole Biol and Evol 2011; 28: 2731-2739. Teufel F, Almagro Armenteros JJ, Johansen AR, Gíslason MH, Pihl SI, Tsirigos KD, Winther O, Brunak S, von Heijne G, Nielsen H. SignalP 6.0 predicts all five types of signal peptides using protein language models. Nat Biotechnol 2022; 40: 1023-1025. doi: 10.1038/s41587-021-01156-3 Wang D, Li X, Zhang P, Cao Y, Zhang K, Qin P, Guo Y, Li Z, Tian Y, Kang X, Liu X, Li H. ELOVL gene family plays a virtual role in response to breeding selection and lipid deposition in different tissues in chicken ( Gallus gallus ). BMC Genomics 2022; 17: 705. doi: 10.1186/s12864-022-08932-8 Wu A, Noble EE, Tyagi E, Ying Z, Zhuang Y, Gomez-Pinilla F. Curcumin boosts DHA in the brain: implications for the prevention of anxiety disorders. Biochim Biophys Acta 2015;1852: 951-961. https://doi.org/10.1016/j.bbadis.2014.12.005 Zhang JY, Qin X, Park H, Kim E, Liu G, Kothapalli K, Brenna JT. Alternative splicing generates novel FADS3 transcript in mice. Molecular Biol Report 2016; 43: 761-766. Tables Table 1. Composition of basal diet used in the trial(%) Feed Raw Materials Raw Material Rates Corn (CP %8,5) 62,99 Soybean meal (CP %45) 16,57 Corn gluten (CP %60) 7,98 Limestone 10,18 DCP (P %18) 1,44 Vitamin-Mineral mixture* 0,25 NaCl 0,22 Sodium Bicarbonate 0,16 L-Lysine 0,11 DL-Methionine 0,10 Calculated composition (%) Dry matter 88,41 Crude protein 16,52 Crude fat 2,20 Crude ash 12,07 Crude cellulose 2,78 D-Methtionine 0,38 Methionine 0,40 Lysine 0,76 ME ( kcal/kg) 2726 Chemical analyses (%) Dry matter 88,78 Crude protein 17,02 Crude fat 2,43 Crude ash 11,74 Crude cellulose 3,18 * Per kilogram of diet: 12,000 IU vitamin A; 2,500 IU vitamin D3; 30 IU vitamin E; 4 mg vitamin K3; 3 mg vitamin B1; 6 mg vitamin B2; 30 mg niacin; 10 mg calcium D-pantothenate; 5 mg vitamin B6; 0.015 mg vitamin B12; 1 mg folic acid; 0.050 mg D-biotin; 50 mg vitamin C; 300 mg choline chloride; 80 mg manganese; 60 mg iron; 60 mg zinc; 5 mg copper; 0.5 mg cobalt; 2 mg iodine; 0.15 mg selenium. Table 2. PCR and quantitative PCR (qPCR) primers Gene Primers (5’-3’) Tm (°C) ELOVL1 F: CCCTCAGGATGGTCAGTGTT 60 R: CTCCAGGGCAGAACAGAGTG ELOVL2 F: CTGACATCCGGGTAGCCAAG 59 R: TCGTGGCATGGTGATACACA ELOVL3 F: GGCCTTGTTCAGTGCCATT 58 R: CCCAGTTCCAGGACTTTGCT ELOVL4 F: TGGAGCATCCGAGACAAACG 59 R: TGGCAGACATAGCTGTACCC ELOVL5 F: TGGACCCAGAGATCCCAGA 59 R: GCCCCTGCATGAGAATGGTT ELOVL6 F: GCTGTCTTCAGTATATTCGGTGC 60 R: CCAGCCACCATGTCCTTGTA ELOVL7 F: ATCAAAGATGCCGATCCGAG 58 R: TTCTTAGGGCTGTAGGCGAC TBP F: CAGGAGCAAAAAGCGAGGAAC 58,5 R: TGCTGGTGTGTGAGTACCAA Table 3. Effect of diets containing different levels of curcumin on performance . Groups Feed Intake (g) Egg Weight (g) Egg production (%) Feed Covertion Ratio (g/g) C0 115,03 64,14 ab 87,10 2,10 C100 109,55 62,92 b 86,72 2,05 C200 117,40 64,73 ab 90,00 2,04 C300 116,14 66,10 a 87,67 2,04 C400 112,33 63,08 b 91,76 1,96 SE 1,133 0,354 0,795 0,025 P 0,176 0,027* 0.236 0.578 C0: Group without added curcumin, C100: 100 mg curcumin added group, C200: 200 mg curcumin added group, C300: 300 mg curcumin added group, C400: 400 mg curcumin added group, a,b: Differences between group means shown with different letters in the same column are significant, SE: Standard error, *: (p<0.05), **: (p<0.01), ns: Not significant Tablo 4. Effect of diets containing different levels of curcumin on egg quality criteria Groups Haugh Unit Albumen (%) Egg Yolk (%) Shell Ratio (%) Shell Thickness (µm) Shell Breaking Strengt(kg/cm2) C0 78,12 bc 59,15 c 29,04 a 11,81 a 0,393 ab 4,30 a C100 84,61 a 61,14 ab 27,61 ab 11,26 b 0,376 c 3,69 bc C200 82,60 ab 60,04 bc 28,06 ab 11,90 a 0,399 a 4,09 ab C300 79,99 abc 62,22 a 26,57 b 11,22 b 0,372 c 3,77 bc C400 77,29 c 59,53 bc 28,92 a 11,54 ab 0,383 bc 3,51 c SE 0,793 0,289 0,251 0,085 0,002 0,071 P 0,019* 0,003** 0,012** 0,030* 0,001** 0,002** C0: Group without added curcumin, C100: 100 mg curcumin added group, C200: 200 mg curcumin added group, C300: 300 mg curcumin added group, C400: 400 mg curcumin added group, a,b: Differences between group means shown with different letters in the same column are significant, SE: Standard error, *: (p<0.05), **: (p<0.01), ns: Not significant Tablo 5. Effect of diets containing different levels of curcumin on the fatty acid composition of egg yolk (%) Fatty acids C0 C100 C200 C300 C400 SE P 14:0 2.02 2.12 1.85 1.86 1.79 0,044 0.163 16:0 22.40 bc 21.79 c 22.93 ab 23.27 a 23.15 a 0,139 0,002** 18:0 8.37 a 7.64 c 7.89 bc 8.17 ab 7.88 bc 0,049 0.003 ∑SFA 32.80 a 31.56 b 32.68 a 33.31 a 32.83 a 0,066 0,003** 16:1n-7 2.21 2.28 2.42 2.41 2.60 0,292 0,096 18:1n-9 40.05 ab 37.79 c 39.33 b 41.22 a 40.47 ab 0,373 0,001** ∑MUFA 42.26 bc 40.07 c 41.76 b 43.64 a 43.07 ab 0,028 0,000** 18:3n-3 1.05 b 1.10 a 0.86 c 0.78 d 0.85 c 0,026 0,023* 20:5n-3 0.31 a 0.26 b 0.27 b 0.25 b 0.30 a 0,017 0,013* 22:6n-3 1.15 c 1.15 b 1.18 a 1.13 d 1.02 e 0,006 0,001** ∑ω-3 PUFA 2.51 a 2.50 a 2.30 b 2.16 c 2.17 c 0,157 0,011* 18:2n-6 17.74 b 20.98 a 18.67 b 16.05 c 17.34 bc 0,303 0,001** 20:4n-6 2.07 ab 2.15 ab 2.10 ab 2.21 a 1.97 b 0,399 0,000** ∑ω-6 PUFA 19.82 bc 23.13 a 20.77 b 18.26 d 19.31 cd 0,037 0,000** ∑PUFA 22.33 bc 25.64 a 23.08 b 20.42 d 21.49 cd 0,371 0,000** ∑ω-3 PUFA/∑ω-6 PUFA 0.13 a 0.11 c 0.11 c 0.12 b 0.11 c 0,001 0,000** DHA/EPA 3.74 c 4.50 a 4.10 b 4.56 a 3.35 d 0,10 0,000** C0: Group without added curcumin, C100: 100 mg curcumin added group, C200: 200 mg curcumin added group, C300: 300 mg curcumin added group, C400: 400 mg curcumin added group, a,b,c,d,e: Differences between group means shown with different letters in the same raw are significant, SE: Standard error, *: (p<0.05), **: (p<0.01), ns: Not significant Supplementary Files Supplments.doc Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6504409","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":452068710,"identity":"d111fded-465f-4350-8957-c5bec751b2ce","order_by":0,"name":"Büşra DUMLU","email":"","orcid":"","institution":"Ataturk University: Ataturk Universitesi","correspondingAuthor":false,"prefix":"","firstName":"Büşra","middleName":"","lastName":"DUMLU","suffix":""},{"id":452068711,"identity":"76a527de-74ef-4021-82c9-8228bef6ff04","order_by":1,"name":"Şaziye Canan BÖLÜKBAŞI","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAz0lEQVRIiWNgGAWjYNCCCgh1gIGBmVgtZxgkEFrYiNHB2AbRwkCUFv72swc/F86zq+OfkXvwAEOFdWKDfO8DvFokzuQlS8/cliwhcSMv4QDDmfTEBjZ2A7xaDBhyDKR5tzFLMNzIMTjA2HYYqIWAywz43xj/5p1TLyEP1vKPGC0SOWbSvA2HJQzAWhqI0CJx442ZNc+x45Ibz7wxOJBwLN24jS0Nvxb+/hzj2zw11fxyx3OMP3yosZbtZz6GXwsqSGAgMiZHwSgYBaNgFOAHABlaP4hwteH2AAAAAElFTkSuQmCC","orcid":"https://orcid.org/0000-0003-1153-3489","institution":"Ataturk University: Ataturk Universitesi","correspondingAuthor":true,"prefix":"","firstName":"Şaziye","middleName":"Canan","lastName":"BÖLÜKBAŞI","suffix":""},{"id":452068712,"identity":"65fd35c8-cc41-4505-b04a-4c88c31ab16c","order_by":2,"name":"Abdulkadir BAYIR","email":"","orcid":"","institution":"Ataturk University: Ataturk Universitesi","correspondingAuthor":false,"prefix":"","firstName":"Abdulkadir","middleName":"","lastName":"BAYIR","suffix":""}],"badges":[],"createdAt":"2025-04-22 12:46:39","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6504409/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6504409/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":82249670,"identity":"5a4a1d82-5d13-4e08-9b84-f037b7c1da74","added_by":"auto","created_at":"2025-05-08 09:48:36","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":590533,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of curcumin on \u003cem\u003eELOVL\u003c/em\u003e genes expression in liver tissue\u003c/p\u003e","description":"","filename":"Figures1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6504409/v1/cacb13088fc34ee1a0974dcf.jpg"},{"id":82249675,"identity":"cf973d4d-b412-4f61-b702-80881ff8addf","added_by":"auto","created_at":"2025-05-08 09:48:36","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":540410,"visible":true,"origin":"","legend":"\u003cp\u003eA Bayesian phylogenetic tree illustrating the phylogenetic relationships among chicken ELOVLs and ELOVL/Elovl from other vertebrates.\u003c/p\u003e","description":"","filename":"Figures2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6504409/v1/0fef1b60d69b9f778734f3eb.jpg"},{"id":82373717,"identity":"6a5a4bb6-9876-4315-9226-9732642d6ef4","added_by":"auto","created_at":"2025-05-09 14:20:01","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2389767,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6504409/v1/d559c599-b98c-4c34-ab88-a970513e5057.pdf"},{"id":82249686,"identity":"d4f60483-879a-4b02-aa33-685196c280e9","added_by":"auto","created_at":"2025-05-08 09:48:36","extension":"doc","order_by":6,"title":"","display":"","copyAsset":false,"role":"supplement","size":2557952,"visible":true,"origin":"","legend":"","description":"","filename":"Supplments.doc","url":"https://assets-eu.researchsquare.com/files/rs-6504409/v1/42d0dc038a477af42a6c2934.doc"}],"financialInterests":"","formattedTitle":"\u003cp\u003eEffect of Curcumin Supplementation in Laying Hen Diet on Performance, Yolk Fatty Acid Composition and Elovl Genes\u003c/p\u003e","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eAbout one-third of a chicken (\u003cem\u003eGallus gallus\u003c/em\u003e) egg's overall nutrient composition consists of lipids. These are crucial for nutrition as they provide ω-3 fatty acids (ω-3 FAs), which are essential for healthy growth, development, and cognitive function during early life. Chicken eggs are a source of various nutrients required by the human body in appropriate amounts and proportions, highlighting the importance of lipids. Since mammals have a limited ability, if any, to produce ω-3 FAs, they must acquire these FAs through their diets. A typical chicken egg contains between 30 mg and 200 mg of ω-3, and the ω-3 FA levels can be significantly enhanced by providing the chickens with a diet rich in ω-3 FAs (Kralik et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eChickens excel compared to many other species in converting linoleic acid (18:2n-6; LA) into arachidonic acid (20:4n-6; ARA) through elongation and desaturation activities. They also demonstrate efficiency in synthesizing ω-3 FAs, including eicosapentaenoic acid (20:5n-3; EPA) and docosahexaenoic acid (22:6n-3; DHA) from α-linolenic acid (18:3n-3; ALA) (Gregory et al., \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). This advantage is attributed to the enzymatic actions of the elongation of very long chain fatty acids (\u003cem\u003eELOVL\u003c/em\u003e) and fatty acid desaturase (\u003cem\u003eFADS\u003c/em\u003e) gene families that facilitate the elongation and desaturation processes.\u003c/p\u003e \u003cp\u003eThe \u003cem\u003eELOVL\u003c/em\u003e gene family consists of seven isoforms (\u003cem\u003eELOVL\u003c/em\u003e1-7), which are important regulators of substrate specificity, tissue distribution, and regulation, as well as overall FA elongation and cellular lipid composition (Ma et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Each member of the \u003cem\u003eELOVL\u003c/em\u003e gene family has distinct functions. For example, \u003cem\u003eELOVL\u003c/em\u003e6 is involved in de novo lipogenesis in chicken liver (Claire D'Andre et al., 2013). It encodes the \u003cem\u003eELOVL\u003c/em\u003e6 enzyme, which regulates the final step of the endogenous saturated fatty acids (SFAs) synthesis. The \u003cem\u003eELOVL2\u003c/em\u003e, \u003cem\u003eELOVL4\u003c/em\u003e and \u003cem\u003eELOVL5\u003c/em\u003e genes are involved in the elongation of long-chain (LC) FAs (Jakobsson et al., \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2006\u003c/span\u003e). \u003cem\u003eELOVL5\u003c/em\u003e is responsible for the hepatic synthesis of LC-polyunsaturated fatty acids (LC-PUFAs) (Feng et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). In addition, this gene plays an important role in the biosynthesis of ω-3 PUFA, including EPA and DHA, as well as ω-6 PUFA (Fu et al., \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). It has been reported that \u003cem\u003eELOVL5\u003c/em\u003e can be extended to tetracosapentaenoic acid (24:5n-3; DPA) in chickens, unlike to other poultry, such as ducks and turkeys. Therefore, it has been suggested that chicken may be a dietary source of EPA and DHA, like fish.\u003c/p\u003e \u003cp\u003eNumerous investigations have been conducted to enhance the levels of EPA and DHA in eggs (Kralik et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Studies indicate that certain biologically active substances incorporated into the diet may promote the conversion of ALA into DHA by stimulating ELOVL enzymes (Wu et al., \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). The utilization of these active compounds can lead to improved yield and product quality, such as curcumin.\u003c/p\u003e \u003cp\u003eCurcumin, recognized as the 'golden spice', is derived from the roots of the turmeric plant (\u003cem\u003eCurcuma longa\u003c/em\u003e), which is cultivated in India and other regions of South Asia. This yellow powder serves not only as a food colorant and flavoring but also functions as a medicinal compound. Within turmeric, there are several curcuminoids, including curcumin (the most biologically active), demethoxycurcumin, bisdemethoxycurcumin, and cyclocurcumin (Shahrajabian and Sun, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Notably, curcumin constitutes about 77\u0026ndash;80% of the total curcuminoid content (Alves et al., \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). The properties of curcumin, such as increasing DHA in the brain and liver (by enhancing \u003cem\u003eELOVL2\u003c/em\u003e), increasing enzymes involved in the DHA synthesis pathway, and reducing anxiety-like behavior, have been identified (Wu et al., \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Some researchers have reported that the number of studies investigating the conversion of ALA to EPA and DHA at the molecular level in laying hens is quite limited and that \u003cem\u003eELOVL\u003c/em\u003e genes play key roles in elongation and desaturation processes in living organisms (Zhang et al., \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2016\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eFor these reasons, we identified and characterized \u003cem\u003eELOVL\u003c/em\u003e genes in the chicken genome for the first time to better understand their functions in FA metabolism in chickens. We also investigated the effects of diets supplemented with various levels of curcumin on hen performance, egg quality characteristics, the FA composition of egg yolk, and the expression levels of the \u003cem\u003eELOVL\u003c/em\u003e genes.\u003c/p\u003e"},{"header":"2. Material and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1. Animals, diets, and sampling\u003c/h2\u003e \u003cp\u003eA total of 40 Hy-Line Brown commercial laying hens, aged 68 weeks, were used in this study. Approval for conducting the study was obtained from the Atat\u0026uuml;rk University Animal Experiments Local Ethics Committee (2022/59). The hens were divided into five groups of eight, with each hen placed in individual cages measuring 60x60x50 cm. The first group received a basal diet (C0), while the other groups were given diets supplemented with 100 (C100), 200 (C200), 300 (C300), and 400 (C400) mg/kg of curcumin, added to the basal diet. The C0 diet used in the experiment was sourced from a commercial feed mill (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e), and the curcumin (99% purity) was acquired from Grenera Nutrients Pvt Ltd. Throughout the ten-week experiment, feed and water were provided \u003cem\u003ead libitum\u003c/em\u003e to the individually housed hens. Following the conclusion of the feeding trial, the hens were euthanized, and approximately 1 gram of liver was collected (n\u0026thinsp;=\u0026thinsp;3). This sample was placed into 2 ml DNase/RNase-free tubes along with 1 ml of RNAlater and stored at -20\u0026deg;C overnight. Subsequently, it was kept at -80\u0026deg;C until further analysis. Samples from various tissues, including the liver, small intestine, chest muscle, brain, heart, eyes, adipose tissue, gizzard, kidney, skin, ovary, spleen, lung, peel stomach, and leg muscle were obtained from the chickens (n\u0026thinsp;=\u0026thinsp;3) to investigate the tissue-specific distribution of \u003cem\u003eFADS\u003c/em\u003e genes.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2. Determination of general performance characteristics\u003c/h2\u003e \u003cp\u003eFeed intake, egg weight, egg mass, egg production, and feed conversion ratio were measured every two weeks. Quality criteria such as shell thickness, shell strength, Haugh unit, egg yolk color, and the proportions of egg white, yolk, and shell were also assessed through these fortnightly measurements.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3. Determination of yolk fatty acid composition\u003c/h2\u003e \u003cp\u003eThe extraction of total lipids from both diets and egg yolks was performed following the methodology established by Folch et al. (\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e1957\u003c/span\u003e) at the end of the experiment. To create a homogenate, six samples from each treatment group and diet were combined and ground together. The preparation of fatty acid methyl esters (FAMEs) was conducted using the method described by Metcalfe and Schmitz (\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e1961\u003c/span\u003e). These FAMEs were analyzed through gas chromatography, employing a DB-23 capillary column with specifications of 60 m length, 0.25 mm inner diameter, and a film thickness of 0.25 \u0026micro;m. The initial temperature for the ejector and detector was set at 190\u0026deg;C for 35 minutes and then was raised to 220\u0026deg;C at a rate of 30\u0026deg;C per minute, holding this temperature for an additional 5 minutes. Hydrogen was used as the carrier gas at a flow rate of 2 ml per minute, with a fixed split ratio of 30:1. Individual fatty acids (FAs) were identified by comparing their retention times to those of a standard FA mixture (Supelco 37 component FAME mix). The quantification of each fatty acid was based on the peak area of the internal standard C19:0 (Sigma, USA) and expressed as a percentage of the total FAMEs.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4. Identification of \u003cem\u003eELOVL\u003c/em\u003e genes\u003c/h2\u003e \u003cp\u003eThe sequences of mRNA for the chicken \u003cem\u003eELOVL1\u003c/em\u003e to \u003cem\u003eELOVL7\u003c/em\u003e genes were determined by utilizing the polypeptide sequences of the corresponding zebrafish (\u003cem\u003eDanio rerio\u003c/em\u003e) Elovls as queries in a specific BLASTP search within the Ensembl genome database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://useast.ensembl.org/Multi/Tools/Blast?db=core\u003c/span\u003e\u003cspan address=\"http://useast.ensembl.org/Multi/Tools/Blast?db=core\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). Additionally, second tBLASTn search was performed at the National Center for Biotechnology Information (NCBI) (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://blast.ncbi.nlm.nih.gov\u003c/span\u003e\u003cspan address=\"http://blast.ncbi.nlm.nih.gov\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) with the ELOVL polypeptide sequences to obtain Expressed Sequence Tags (ESTs) for each \u003cem\u003eELOVL\u003c/em\u003e gene. However, no ESTs for \u003cem\u003eELOVL1\u003c/em\u003e, \u003cem\u003eELOVL2\u003c/em\u003e, \u003cem\u003eELOVL3\u003c/em\u003e, \u003cem\u003eELOVL4\u003c/em\u003e, \u003cem\u003eELOVL5\u003c/em\u003e, \u003cem\u003eELOVL6\u003c/em\u003e, or \u003cem\u003eELOVL7\u003c/em\u003e were identified in the NCBI EST database (release: 248). As a result, RT-PCR was conducted to synthesize the mRNAs for \u003cem\u003eELOVL1\u003c/em\u003e through \u003cem\u003eELOVL7\u003c/em\u003e, followed by sequencing. The newly obtained sequences were aligned with the genomic sequences of \u003cem\u003eELOVL\u003c/em\u003e from Ensembl to verify their exon/intron structures. The molecular weights (MWs) and theoretical isoelectric points (p\u003cem\u003eI\u003c/em\u003e) chicken of ELOVL proteins were computed with the Protparam software (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://web.expasy.org/protparam/\u003c/span\u003e\u003cspan address=\"https://web.expasy.org/protparam/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) (Gasteiger et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2005\u003c/span\u003e). The identification of the ELO domain (Pfam: PF01151) was carried out using the HMMER software, version 3.3 (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ebi.ac.uk/Tools/hmmer/\u003c/span\u003e\u003cspan address=\"https://www.ebi.ac.uk/Tools/hmmer/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) (Potter et al., \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). The SignalP-6.0 server was used to determine signal peptide cleavage of ELOVL polypeptides (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://services.healthtech.dtu.dk/services/SignalP-6.0/\u003c/span\u003e\u003cspan address=\"https://services.healthtech.dtu.dk/services/SignalP-6.0/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) (Teufel et al., \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). The putative TATA boxes and transcription initiation sites were determined using SoftBerry algorithm (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.softberry.com/\u003c/span\u003e\u003cspan address=\"http://www.softberry.com/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), and putative polyadenylation signals [poly(A) tail] were calculated at \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.fruitfly.org/seq_tools/promoter.html\u003c/span\u003e\u003cspan address=\"http://www.fruitfly.org/seq_tools/promoter.html\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (Reese, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2001\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5. Orthology of ELOVL amino acids\u003c/h2\u003e \u003cp\u003eThe relationships of orthologous chicken \u003cem\u003eELOVL\u003c/em\u003e genes were established through individual BLAST searches, utilizing each putative sequence as a query via the OrthoInspector database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.lbgi.fr/orthoinspectorv3/\u003c/span\u003e\u003cspan address=\"https://www.lbgi.fr/orthoinspectorv3/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e; Nevers et al., \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). The MAFFT program was employed for multiple alignments of ELOVL/Elovl amino acid sequences (Katoh et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). These alignments were reexamined with trimAl to enhance the bootstrap values by eliminating poorly aligned sections (Capella-Gutierrez et al., 2009). A Bayesian phylogenetic tree, created with NGPhlogeny.fr (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://ngphylogeny.fr/\u003c/span\u003e\u003cspan address=\"https://ngphylogeny.fr/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e; Lemoine et al., \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2019\u003c/span\u003e), illustrated the phylogenetic relationships among chicken ELOVLs and ELOVLs/Elovls from other vertebrates, comprising 10\u003csup\u003e6\u003c/sup\u003e generations, a sampling frequency of 100, and a burn-in of 10,000. A neighbor-joining phylogenetic tree was also generated with 1000 bootstrap replicates using MEGA5 software to allow for comparison of the two phylogenetic trees (Tamura et al., \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). To assess sequence identity and similarity, the amino acid sequences of chicken \u003cem\u003eELOVL\u003c/em\u003e genes were examined against the amino acid sequences of other vertebrates with the BLOSUM62 (Gromiha, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). Conserved gene synteny of the \u003cem\u003eELOVL\u003c/em\u003e genes was analyzed in relation to the \u003cem\u003eELOVL\u003c/em\u003e/\u003cem\u003eelovl\u003c/em\u003e genes from \u003cem\u003eD. rerio\u003c/em\u003e and humans (\u003cem\u003eHomo sapiens\u003c/em\u003e) through the Genomicus online database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.genomicus.bio.ens.psl.eu/\u003c/span\u003e\u003cspan address=\"https://www.genomicus.bio.ens.psl.eu/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e; Nguyen et al., \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). All the protein sequences used in this study was supplied in Supplementary file 1.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6. Total RNA extraction and reverse transcription\u003c/h2\u003e \u003cp\u003eTotal RNA was extracted from all examined tissues utilizing RNAlater reagent (Invitrogen), with the integrity of the resulting RNA confirmed through 2% agarose gel electrophoresis. The amount of RNA was quantified at 260 nm with a spectrophotometer. To eliminate genomic DNA from the RNA, the DNAse I kit (Life Technologies) was employed. The synthesis of the first-strand cDNA was conducted using an Omniscript Reverse Transcription kit (Qiagen), incorporating two micrograms of total RNA from each tissue sample. Reverse transcription was applied at 37 \u003csup\u003eo\u003c/sup\u003eC for 60 minutes using a PCR machine.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.7. Tissue-specific transcription and nutrigenomics of chicken \u003cem\u003eELOVL\u003c/em\u003e genes\u003c/h2\u003e \u003cp\u003eThe quantitative polymerase chain reaction (qPCR) analysis was carried out with the SYBR Green PCR kit (Qiagen). The conditions for qPCR included, an initial denaturation phase at 95\u0026deg;C for 15 minutes, followed by 40 cycles of denaturation at 95\u0026deg;C for 20 seconds, annealing for 30 seconds, elongation at 72\u0026deg;C for one minute, and a final elongation step at 72\u0026deg;C for five minutes. Negative controls for the qPCR analysis of each \u003cem\u003eELOVL\u003c/em\u003e gene were conducted using template-free tubes. PCR and quantitative PCR (qPCR) primers, as listed in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, were designed using NCBI Primer-BLAST (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.ncbi.nlm.nih.gov/tools/primerblast/\u003c/span\u003e\u003cspan address=\"http://www.ncbi.nlm.nih.gov/tools/primerblast/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). The differences in hepatic mRNA expression in laying hens fed diets containing various levels of curcumin were assessed using the 2\u003csup\u003e\u0026minus;ΔΔCt\u003c/sup\u003e method described by Livak and Schmittgen (\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2001\u003c/span\u003e). \u003cem\u003eELOVL\u003c/em\u003e mRNA expression levels were normalized by calculating the ratio of their copy number to that of the reference gene, TATA-box binding protein (ENSGALG00010007866; TBP) (Na et al., \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Specific primers that span the exon-exon splice junctions for \u003cem\u003eELOVL1, ELOVL2, ELOVL3, ELOVL4, ELOVL5, ELOVL6\u003c/em\u003e, and \u003cem\u003eELOVL7\u003c/em\u003e were designed using the NCBI-Primer BLAST tool.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.8 Statistical Analysis\u003c/h2\u003e \u003cp\u003eThe data obtained at the end of the research were analyzed using the General Linear Model procedure and the SPSS package program. The significance of the means found to be significant between the groups was determined by Duncan's multiple comparison test.\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e3.1. Performance traits\u003c/h2\u003e \u003cp\u003eOur study revealed that the addition of different amounts of curcumin to the diet did not significantly affect feed intake, egg production or feed conversion ratio (FCR) in laying hens (P\u0026thinsp;\u0026gt;\u0026thinsp;0.05), but there was a significant difference (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) in egg weight between the curcumin supplemented groups (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e3.2. Egg internal and external quality criteria\u003c/h2\u003e \u003cp\u003eIn the present study, it was found that the addition of curcumin to the diet affected the egg quality criteria in laying hens (Table\u0026nbsp;4). In particular, it was observed that Haugh Unit increased significantly (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) in the group supplemented with 100 mg/kg curcumin, the highest albumin and the lowest yolk ratio were in the C300 group. Shell ratio and shell thickness were found to be the lowest in the C100 and C300 groups (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01), and shell breaking strengt was found to be decreased (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01) in all curcumin supplemented groups compared to the control group.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e3.3. Fatty acid composition of egg yolk\u003c/h2\u003e \u003cp\u003eThe study's conclusion revealed that the inclusion of curcumin had a significant impact on the fatty acid composition of egg yolk, with the exceptions of myristic and palmitoleic acids. Palmitic acid levels rose alongside curcumin concentration, peaking in the C300 and C400 groups (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01). Meanwhile, curcumin supplementation notably reduced stearic acid levels, with the C100 group exhibiting the lowest amount (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01). Additionally, oleic acid levels were also lowest in the C100 group. As indicated in Table\u0026nbsp;5, there were highly significant differences in LA and ALA levels among the groups, with the C100 group showing the highest values for both FAs (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01). However, rising levels of curcumin led to a marked decrease in the ratios of these FAs. A significant difference was observed in ARA levels, with the C400 group presenting the lowest value and the C300 group the highest (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01). The C200 group had the highest ratio of DHA (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01). Although the EPA levels differed significantly between groups (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01), the addition of curcumin at 100 and 300 mg/kg resulted in a reduced EPA ratio (Table\u0026nbsp;5).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e3.4. \u003cem\u003eELOVL\u003c/em\u003e genes in the chicken genome\u003c/h2\u003e \u003cp\u003eWe identified seven \u003cem\u003eELOVL\u003c/em\u003e genes in the chicken genome based on \u003cem\u003ein silico\u003c/em\u003e analyses and subsequently uploaded their open reading frame (ORF) sequences to the NCBI genome database. The accession numbers for these cDNAs are as follows: \u003cem\u003eELOVL1\u003c/em\u003e (873 bp) is PP601341, \u003cem\u003eELOVL2\u003c/em\u003e (894 bp) is PP601342, \u003cem\u003eELOVL3\u003c/em\u003e (759 bp) is PP601343, \u003cem\u003eELOVL4\u003c/em\u003e (945 bp) is PP601344, \u003cem\u003eELOVL5\u003c/em\u003e (888 bp) is PP601345, \u003cem\u003eELOVL6\u003c/em\u003e (798 bp) is PP601346, and \u003cem\u003eELOVL7\u003c/em\u003e (840 bp) is PP601347. Correspondingly, the ORFs translate into 290, 297, 252, 314, 295, 265, and 279 amino acids.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e3.5. Alignment of chicken ELOVL polypeptides with polypeptide sequences of ELOVL/Elovl from various vertebrate species\u003c/h2\u003e \u003cp\u003eThe ELOVL protein sequences in chickens showed the highest levels of identity and similarity when compared to ELOVL/Elovl orthologs found in other avian species (Supplementary file 4). A gradual decline in sequence identity and similarity was observed between the chicken ELOVL sequences and their orthologous counterparts in fish and mammals. This decline continued further with non-orthologous sequences from these same groups, providing additional evidence that the chicken genome comprises seven \u003cem\u003eELOVL\u003c/em\u003e genes.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003e3.6. The phylogenetic relationships of chicken ELOVL proteins in comparison to those from other vertebrate species\u003c/h2\u003e \u003cp\u003eA Bayesian phylogenetic tree was constructed using ELOVL amino acid sequences from a variety of birds, fishes, and mammals to explore the evolutionary relationships of the putative ELOVL proteins in chickens and their orthologous counterparts across different vertebrates (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e2\u003c/span\u003e). The clustering of chicken ELOVL proteins was observed in specific clades alongside ELOVL/Elovl proteins from other vertebrate species. Moreover, a neighbor-joining method applied to the same vertebrate ELOVL/Elovl protein sequences produced a phylogenetic tree with a topology similar to the Bayesian analysis (Supplementary file 5).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003e3.7. Conserved gene synteny analysis of chicken \u003cem\u003eELOVL\u003c/em\u003e genes with \u003cem\u003eELOVL\u003c/em\u003e/\u003cem\u003eelovl\u003c/em\u003e genes from zebrafish and humans\u003c/h2\u003e \u003cp\u003eThe \u003cem\u003eELOVL1\u003c/em\u003e, \u003cem\u003eELOVL2, ELOVL3, ELOVL4, ELOVL5, ELOVL6\u003c/em\u003e, and \u003cem\u003eELOVL7\u003c/em\u003e genes in the chicken genome were located on chromosomes 8, 2, 6, 3, 3, 4, and Z, respectively. Additionally, the conserved synteny shared by the chicken \u003cem\u003eELOVL\u003c/em\u003e gene family and the \u003cem\u003eELOVL\u003c/em\u003e/\u003cem\u003eelovl\u003c/em\u003e genes found in zebrafish and humans supports the hypothesis that the chicken \u003cem\u003eELOVL\u003c/em\u003e genes are orthologous to those in other vertebrates (Supplementary file 6). Consequently, \u003cem\u003ein silico\u003c/em\u003e analyses indicated that the chicken \u003cem\u003eELOVL\u003c/em\u003e genes evolved from a shared ancestral gene.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003e3.8. Tissue-specific transcription of \u003cem\u003eELOVL\u003c/em\u003e genes in the chicken genome\u003c/h2\u003e \u003cp\u003eExamining Supplementary file 6, no significant difference was observed between tissues in terms of \u003cem\u003eELOVL1\u003c/em\u003e and \u003cem\u003eELOVL7\u003c/em\u003e genes. The differences in the expression levels of \u003cem\u003eELOVL2\u003c/em\u003e, \u003cem\u003eELOVL3\u003c/em\u003e, ELOVL4, \u003cem\u003eELOVL5\u003c/em\u003e and \u003cem\u003eELOVL6\u003c/em\u003e genes were found to be significant (p\u0026thinsp;\u0026lt;\u0026thinsp;0.01). The highest levels of \u003cem\u003eELOVL2\u003c/em\u003e and \u003cem\u003eELOVL6\u003c/em\u003e were found in the liver. The highest mRNA level of \u003cem\u003eELOVL3\u003c/em\u003e gene was found in adipose tissue, the highest level of \u003cem\u003eELOVL4\u003c/em\u003e gene was found in skin tissue, and the highest expression level of \u003cem\u003eELOVL5\u003c/em\u003e gene was found in glandular stomach tissue.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003e3.9. Nutritional regulation of the \u003cem\u003eELOVL\u003c/em\u003e genes by diets containing various levels of curcumin\u003c/h2\u003e \u003cp\u003eFigure \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003e shows the Ct values of \u003cem\u003eELOVL\u003c/em\u003e gene family expression in liver tissues of laying hens whose diets were supplemented with different levels of curcumin. It is understood that the level of curcumin has a significant (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) effect on the \u003cem\u003eELOVL1\u003c/em\u003e gene. It is observed that the expression level is highest in the groups to which 200 and 300 mg/kg curcumin was added. It was found that the mRNA expression level of \u003cem\u003eELOVL2\u003c/em\u003e gene decreased significantly (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01) in C200 and C300 groups compared to C0 group. However, the expression levels in the C100 and C400 groups were not different from the C0 group. \u003cem\u003eELOVL3\u003c/em\u003e and \u003cem\u003eELOV4\u003c/em\u003e gene expression levels were not affected by the addition of curcumin to the diet. A significant (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01) difference was found between the groups in terms of \u003cem\u003eELOVL5\u003c/em\u003e gene expression levels. The \u003cem\u003eELOVL5\u003c/em\u003e expression level increased due to the increase in curcumin level and the highest value was found in the C400 group. It was found that the addition of 100 mg/kg curcumin to the diet increased the \u003cem\u003eELOVL6\u003c/em\u003e and \u003cem\u003eELOVL7\u003c/em\u003e gene expression levels to the highest level (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eOur investigation revealed that the addition of of curcumin to the diet did not affect feed intake, egg production, or feed conversion rates in laying hens, which is by previous studies (Park et al. ,2012; Li et al., \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). However, adding 300 mg/kg of curcumin to the diet significantly increased egg weight, consistent with findings from Park et al. (\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). Therefore, we concluded that curcumin has a biological effect and may exhibit different effects above or below a certain threshold value (Gupta et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). However, more research is needed to determine the biological mechanism of action and the optimal dose of curcumin.\u003c/p\u003e \u003cp\u003eThe C100 group exhibited the highest Haugh Unit value (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.019), likely attributable to the mineral and moisture content of albumin, along with the antioxidant properties of curcumin (Park et al., \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Li et al., \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Notable differences emerged among the groups concerning the ratios of egg white to yolk, with the C300 group displaying the peak white ratio and the lowest yolk ratio (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01; Table\u0026nbsp;4). Nevertheless, Li et al. (\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2024\u003c/span\u003e) indicated that the inclusion of curcumin as a dietary additive did not influence the weight of the yolks. A decrease in the shell ratio was observed in both the C100 and C300 groups (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.030). Some studies suggest that curcumin might assist in preserving shell ratio due to its properties, which include neutralizing free radicals, lowering oxidative stress, offering anti-inflammatory benefits, mitigating inflammation-related damage, and providing cellular protection (Gupta et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). Our findings also indicated that the inclusion of curcumin in diets led to a reduction in shell thickness in all treatment groups apart from C200 in comparison to the control group. Conversely, Liu et al. (\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2020\u003c/span\u003e) reported that varying concentrations of curcumin added to the diets of hens under heat stress significantly enhanced shell thickness.\u003c/p\u003e \u003cp\u003eMany problems such as anxiety, Alzheimer's disease, major depressive disorder, and attention deficit disorder, are associated with DHA deficiency (Chen and Su, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; McNamara et al., \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). Therefore, ω-3 PUFAs play a critical role in brain health and the prevention of cognitive disorders in general. In this study, LA levels were quite low in the C200 group, while DHA levels were the highest. It is thought that the addition of 200 mg/kg of curcumin to the diet promotes the conversion of LA to DHA. It has been reported that the \u003cem\u003eELOVL4\u003c/em\u003e and \u003cem\u003eELOVL5\u003c/em\u003e genes are responsible for the elongation of PUFA (Zhang et al., \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). It was found that the \u003cem\u003eELOVL5\u003c/em\u003e gene expression was significantly higher in the C200 group than in the C0 group (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Similarly, DHA levels in the liver of rats fed diets containing ALA\u0026thinsp;+\u0026thinsp;250 ppm curcumin was found to be the highest compared to other groups. The same researchers reported that curcumin may increase the conversion of ALA to DHA \u003cem\u003ein vivo\u003c/em\u003e, resulting in increased DHA in the liver, which might be explanation of the highest DHA content in the C200 group. The EPA level was lower in the C200 group than in the C0 group. As EPA is converted to DHA (Li et al., \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; Morais et al., \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2012\u003c/span\u003e), the lowest level of EPA and the highest level of DHA in the C200 group can be explained by the conversion of EPA to DHA.\u003c/p\u003e \u003cp\u003eThe \u003cem\u003eELOVL\u003c/em\u003e genes comprise varying numbers of exons: \u003cem\u003eELOVL1\u003c/em\u003e has 7, \u003cem\u003eELOVL2\u003c/em\u003e has 8, \u003cem\u003eELOVL3\u003c/em\u003e has 4, \u003cem\u003eELOVL4\u003c/em\u003e has 6, \u003cem\u003eELOVL5\u003c/em\u003e has 7, \u003cem\u003eELOVL6\u003c/em\u003e has 4, and \u003cem\u003eELOVL7\u003c/em\u003e has 7. Consequently, there is a lack of a conserved gene structure amongst the \u003cem\u003eELOVL\u003c/em\u003e genes in chickens. All characterised \u003cem\u003eELOVL\u003c/em\u003e genes adhered to the GT-AG intron splicing motif (Mount, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e1982\u003c/span\u003e) (Supplementary file 2). The putative TATA boxes, transcription initiation sites, and poly(A) tails of \u003cem\u003eELOVL\u003c/em\u003e genes were also provided in supplementary file 2.\u003c/p\u003e \u003cp\u003eThe MWs and theoretical p\u003cem\u003eI\u003c/em\u003e values of ELOVL amino acids varied, ranging from 29.92 kDa for ELOVL3 to 36.76 kDa for ELOVL4, and from 9.18 for ELOVL7 to 9.65 for ELOVL4, respectively. No signal peptide cleavage was determined in FADS polypeptides, indicating they could be non-secretory proteins (Ding et al., \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). The HXXHH motif along with the ELO domain (Pfam: PF01151) is highly conserved across ELOVL polypeptides (Liu et al., \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). All chicken ELOVL proteins examined included both the PF01151 domain and the HXXHH motif (Supplementary file 3).\u003c/p\u003e \u003cp\u003eWhen the phylogenetic relationships of chicken ELOVL proteins compared to other vertebrate species are evaluated, both phylogenetic analyses reveal that ELOVL polypeptides can be categorized into three main branches. Branch 1 includes ELOVL2, ELOVL4, and ELOVL5, branch 2 comprises ELOVL1 and ELOVL4, while branch 3 contains ELOVL3 and ELOVL6. These phylogenetic evaluations aligned with the findings from BLAST database searches that pinpointed the amino acid-encoding \u003cem\u003eELOVL\u003c/em\u003e genes, as well as the protein sequence alignments that demonstrated levels of sequence identity and similarity, confirming the presence of seven \u003cem\u003eELOVL\u003c/em\u003e genes within the chicken genome, which is the same as in mammals (Liu et al., \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2024\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eAccording to quantitative RT-PCR analysis, the expression levels of \u003cem\u003eELOVL\u003c/em\u003e gene transcripts varied significantly across different tissues in chickens, including the liver, small intestine, chest muscle, brain, heart, eyes, adipose, gizzard, kidney, skin, ovaries, spleen, lungs, peel stomach, and leg muscle, with the exception of \u003cem\u003eELOVL1\u003c/em\u003e and \u003cem\u003eELOVL7\u003c/em\u003e (Supplementary file 7). Wang et al. (\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2022\u003c/span\u003e) identified 51 single nucleotide polymorphisms (SNPs) within chicken \u003cem\u003eELOVL\u003c/em\u003e genes, noting that SNPs were absent only in the \u003cem\u003eELOVL1\u003c/em\u003e and \u003cem\u003eELOVL7\u003c/em\u003e genes. Consequently, we proposed that \u003cem\u003eELOVL1\u003c/em\u003e and \u003cem\u003eELOVL7\u003c/em\u003e could retain the original functions of \u003cem\u003eELOVL\u003c/em\u003e genes. The highest mRNA expression of \u003cem\u003eELOVL2\u003c/em\u003e, \u003cem\u003eELOVL3\u003c/em\u003e, \u003cem\u003eELOVL4\u003c/em\u003e, \u003cem\u003eELOVL5\u003c/em\u003e, and \u003cem\u003eELOVL6\u003c/em\u003e were determined in the liver, adipose, skin, peel stomach, and liver, respectively. A similar tissue-specific distribution was reported by Mihelic et al. (\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2020\u003c/span\u003e) for \u003cem\u003eELOVL2\u003c/em\u003e, \u003cem\u003eELOVL5\u003c/em\u003e, and \u003cem\u003eELOVL6\u003c/em\u003e in chickens. Differential transcription of chicken \u003cem\u003eELOVL\u003c/em\u003e genes in various tissues suggests that they have different functions due to the accumulation of mutations in their transcriptional control sites after their divergence from the ancestral \u003cem\u003eELOVL\u003c/em\u003e gene. At this point, we examined how dietary curcumin influences the transcripts of the chicken \u003cem\u003eELOVL\u003c/em\u003e genes, aiming to gain a deeper insight into the role of \u003cem\u003eELOVL\u003c/em\u003e genes in the metabolism of FAs in chickens.\u003c/p\u003e \u003cp\u003eThe hepatic mRNA expression levels of chicken \u003cem\u003eELOVL\u003c/em\u003e genes were significantly influenced by diets containing various levels of curcumin. Both \u003cem\u003eELOVL1\u003c/em\u003e and \u003cem\u003eELOVL7\u003c/em\u003e genes exhibited a similar response to the curcumin supplemented diets, with the C400 diet leading to a reduction in their transcriptions (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003e). This observation further suggests that \u003cem\u003eELOVL1\u003c/em\u003e and \u003cem\u003eELOVL7\u003c/em\u003e may share functional similarities. As previously mentioned, \u003cem\u003eELOVL2\u003c/em\u003e, \u003cem\u003eELOVL4\u003c/em\u003e, and \u003cem\u003eELOVL5\u003c/em\u003e genes cluster in the Bayesian and NJ phylogenetic trees. However, dietary curcumin did not uniformly affect the mRNA expressions of ELOVL genes. The lowest expression of \u003cem\u003eELOVL2\u003c/em\u003e mRNA was observed in the C200 and C300 diets, whereas the highest transcription levels of \u003cem\u003eELOVL4\u003c/em\u003e were found in the same C200 and C300 diets. Meanwhile, the \u003cem\u003eELOVL5\u003c/em\u003e gene showed maximum expression when provided with C200, C300, and C400 diets. Previous reports suggested that \u003cem\u003eELOVL\u003c/em\u003e genes show substrate specificity: \u003cem\u003eELOVL2\u003c/em\u003e, \u003cem\u003eELOVL4\u003c/em\u003e, and \u003cem\u003eELOVL5\u003c/em\u003e preferentially utilize PUFAs, while \u003cem\u003eELOVL1\u003c/em\u003e, \u003cem\u003eELOVL3\u003c/em\u003e, \u003cem\u003eELOVL6\u003c/em\u003e, and \u003cem\u003eELOVL7\u003c/em\u003e prefer SFAs and MUFAs as their substrates (Monroig et al., \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). The \u003cem\u003eELOVL1\u003c/em\u003e gene exhibited the highest transcription levels in the C200 and C300 groups, while \u003cem\u003eELOVL3\u003c/em\u003e showed peak expression in the C0, C100, C300, and C400 groups. For \u003cem\u003eELOVL6\u003c/em\u003e, the maximum transcription was observed in the C100 group, and \u003cem\u003eELOVL7\u003c/em\u003e demonstrated elevated levels in the C100, C200, and C300 groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003e). These findings effectively demonstrate that diets supplemented with various levels of curcumin do not influence substrate specificity in chicken \u003cem\u003eELOVL\u003c/em\u003e genes.\u003c/p\u003e"},{"header":"5. Conclusions","content":"\u003cp\u003eIn our study, we cloned ORFs of seven \u003cem\u003eELOVL\u003c/em\u003e genes found in the chicken genome. From our bioinformatics investigations, along with examinations of tissue-specific distribution and the nutritional regulation of \u003cem\u003eELOVL\u003c/em\u003e genes, we proposed several conclusions: (1) \u003cem\u003eELOVL/elovl\u003c/em\u003e genes in chickens and other vertebrates are orthologous and likely evolved from a common ancestral gene. (2) \u003cem\u003eELOVL1\u003c/em\u003e and \u003cem\u003eELOVL7\u003c/em\u003e demonstrated similar patterns in tissue-specific transcription; however, their reactions to diets supplemented with curcumin differed. Consequently, a thorough promoter analysis is necessary to clarify their functions in chickens. (4) It was determined that the diet enriched with 200 mg/kg curcumin significantly increased the Haugh Unit and DHA ratio in egg yolk. (5) This research is the first to investigate the nutritional regulation of \u003cem\u003eELOVL\u003c/em\u003e genes using various curcumin dietary levels in chickens, revealing that the mRNA expression of each \u003cem\u003eELOVL\u003c/em\u003e gene responds differently to dietary curcumin. Nevertheless, the intricate nature of FA metabolism complicates a complete understanding of the results and more detail investigation are needed.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eB Dumlu:\u0026nbsp;\u003c/strong\u003econceptualization, methodology, sampling, experimentation, data curation, writing the original draft, and editing;\u003cstrong\u003e\u0026nbsp;ŞC B\u0026ouml;l\u0026uuml;kbaşı:\u0026nbsp;\u003c/strong\u003econceptualization, methodology, project administration, funding acquisition, sampling, experimentation, data curation, writing the original draft, and editing;\u003cstrong\u003e\u0026nbsp;A Bayır:\u0026nbsp;\u003c/strong\u003econceptualization, methodology,writing the original draft, and editing\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding:\u0026nbsp;\u003c/strong\u003eThis study was funded by Scientific Projects Unit of Atat\u0026uuml;rk University with the project number FDK-2022-10825.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics and animal welfare\u0026nbsp;\u003c/strong\u003eThe study was conducted in accordance with the ethics committee principles of Ataturk University\u0026nbsp;Animal Experiments Local Ethics Committee (2022/59).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for participation\u0026nbsp;\u003c/strong\u003eInformed consent was obtained from all individual participants included in the study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to publish\u0026nbsp;\u003c/strong\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interest,\u0026nbsp;\u003c/strong\u003eThe authors declare that they have no known competing financial interests or personal \u0026nbsp;relationships that could have appeared to influence the work reported in this paper.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u0026nbsp;\u003c/strong\u003eThe data that support the findings of this study are available from the corresponding author upon reasonable reques.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAlves RC, Fernandes RP, Fonseca-Santos B, Victorelli FD, Chorilli M.. A critical review of the properties and analytical methods for the determination of curcumin in biological and pharmaceutical matrices. Critic Review Analyts Chemist 2019; 49(2), 138-149. Doi: 10.1080/10408347.2018.1489216\u003c/li\u003e\n\u003cli\u003eCapella-Gutierrez S, Silla-Martinez JM, Gabaldon T. trimAl: a tool for automated alignment trimming in large-scale phylogenetic analyses. Bioinformatics 2009:25: 1972-1973. doi: 10.1093/bioinformatics/btp348.\u003c/li\u003e\n\u003cli\u003eChen HF, Su HM. Exposure to a maternal n-3 fatty acid-deficient diet during brain development provokes excessive hypothalamic\u0026ndash;pituitary\u0026ndash;adrenal axis responses to stress and behavioral indices of depression and anxiety in male rat offspring later in life. J Nutr Biochem 2013;24: 70-80. doi: 10.1016/j.jnutbio.2012.02.006\u003c/li\u003e\n\u003cli\u003eClaire D\u0026rsquo;Andre H, Paul W, Shen X, Jia X, Zhang R, Sun L, Zhang X. Identification and characterization of genes that control fat deposition in chickens. J Anim Sci Biotechnol 2013; 4: 43.\u003c/li\u003e\n\u003cli\u003eDing LY, Jin M, Sun P, Lu Y, Ma HN, Yuan Y, Fu HY, Zhou QC. Cloning, tissue expression of the fatty acid-binding protein (Pt-FABP1) gene, and effects of dietary phospholipid levels on fabp and vitellogenin gene expression in the female swimming crab \u003cem\u003ePortunus trituberculatus\u003c/em\u003e. Aquaculture 2017; 474: 57-65. doi: 10.1016/j.aquaculture.2017.03.029.\u003c/li\u003e\n\u003cli\u003eFeng X, Zhang ., Xu S, Shen A. ATP-citrate lyase (ACLY) in lipid metabolism and atherosclerosis: an updated review. Prog Lipid Res 2020; 77: 101006.\u003c/li\u003e\n\u003cli\u003eFolch J, Less M, Stanley S. A Simple method for the isolation and purification of total lipides from animal tissues. J Biol Chem 1957; 226: 497-509. \u003c/li\u003e\n\u003cli\u003eFu S, Zhao Y, Li Y, Li G, Chen Y, L, Z, Sun G, Li H, Kang, Yan F. Characterization of miRNA transcriptome profiles related to breast muscle development and intramuscular fat deposition in chickens. J Cell Biochem 2018; 119: 7063-7079.\u003c/li\u003e\n\u003cli\u003eGasteiger E, Hoogland C, Gattiker A, Duvaud S, Wilkins MR, Appel RD, Bairoch A. Protein Identification and Analysis Tools on the Expasy Server; \u003cbr\u003e (In) John M. Walker (ed): The Proteomics Protocols Handbook, Humana Press 2005; pp571-607.\u003c/li\u003e\n\u003cli\u003eGregory MK, Geier MS, Gibson RA, James MJ. Functional characterization of the chicken fatty acid elongases. J Nutr 2013;143: 12-16. doi:10.3945/jn.112.170290\u003c/li\u003e\n\u003cli\u003eGromiha MM. Protein sequence analysis. In: Protein Bioinformatics: From Sequence to Function. Elsevier Inc., New Delhi, India. 2010; pp: 29-62.\u003c/li\u003e\n\u003cli\u003eGupta SC, Patchva S, Aggarwal BB. Therapeutic roles of curcumin: lessons learned from clinical trials. The AAPS Journal 2011; 13: 195-218.\u003c/li\u003e\n\u003cli\u003eJakobsson A, Westerberg R, Jacobsson A. Fatty acid elongases in mammals: their regulation and roles in metabolism. Prog Lipid Res 2006; 45: 237-249. https://doi.org/10.1016/J.PLIPRES.2006.01.004\u003c/li\u003e\n\u003cli\u003eKatoh K, Rozewicki J, Yamada KD. MAFFT online service: multiple sequence alignment, interactive sequence choice and visualization. Brief Bioinfo 2019; 20: 1160-1166. doi: 10.1093/bib/bbx108.\u003c/li\u003e\n\u003cli\u003eKralik G, Kralik Z, Grčević M, Galović O, Hanžek D, Biazik E. Fatty acid profile of eggs produced by laying hens fed diets containing different shares of fish oil. Poultry Sci 2021; 100: 101379.\u003c/li\u003e\n\u003cli\u003eLemoine F, Correia D, Lefort V, Doppelt-Azeroual O, Mareuil F, Cohen-Boulakia S, Gascuel O. NGPhylogeny.fr: new generation phylogenetic services for non-specialists. Nucleic Acid Res 2019; 47: W260-W265. https://doi.org/10.1093/nar/gkz303\u003c/li\u003e\n\u003cli\u003eLi C, Gao J, Guo S, He B, Ma W. Effects of curcumin on the egg quality and hepatic lipid metabolism of laying hens. Animal 2024; 14: 138. https://doi.org/10.3390/ani14010138\u003c/li\u003e\n\u003cli\u003eLi Y, Monroig O, Zhang L, Wang S, Zheng X, Dick JR, You C, Tocher DR. Vertebrate fatty acyl desaturase with \u0026Delta;4 activity. PNAS 2010; 107. 16840-16845.\u003c/li\u003e\n\u003cli\u003eLiu M, Lu Y, Gao P, Xie X, Li D, Yu D, Yu M. Effect of curcumin on laying performance, egg quality, endocrine hormones, and immune activity in heat-stressed hens. Poultry Sci 2020; 99: 2196-2202. https://doi.org/10.1016/j.psj.2019.12.001\u003c/li\u003e\n\u003cli\u003eLiu MY, Wang QC, Li JQ, Zhang D, Mu JH, Shen XH. Genome-wide identification and comparative analysis of elongation of very long-chain fatty acid (Elovl) genes in echinoderms. General Genetic 2024; 60: 450-459. doi: 10.1134/S1022795424040070 \u003c/li\u003e\n\u003cli\u003eLivak KJ Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2\u003csup\u003e\u0026minus;\u0026Delta;\u0026Delta;CT\u003c/sup\u003e method. Methods 2001; 25: 402-408. https://doi.org/10.1006/meth.2001.1262\u003c/li\u003e\n\u003cli\u003eMa Z, Li H, Zheng H, Jiang K, Yan F, Kang X, Wang Y, Liu X, Tian Y. Hepatic ELOVL6 mRNA is regulated by the gga-miR-22-3p in egg-laying hen. Gene, 2017; 623: 72-79.\u003c/li\u003e\n\u003cli\u003eMcNamara RK, Jandacek R, Rider T, Tso P, Dwivedi Y, Pandey GN. Adult medication-free schizophrenic patients exhibit long-chain omega-3 fatty acid deficiency: implications for cardiovascular disease risk. Cardiovas Psychiat Neurol 2013; 796462. doi: 10.1155/2013/796462\u003c/li\u003e\n\u003cli\u003eMetcalfe L, Schmitz A. The rapid preparation of fatty acid esters for gass chromatographic analysis. Anal Chem 1961; 33: 363-364. doi: 10.1021/ac60171a016.\u003c/li\u003e\n\u003cli\u003eMihelic R, Winter H, Powers JB, Das S, Lamour K, Campagna SR, Voy BH. Genes controlling polyunsaturated fatty acid synthesis are developmentally regulated in broiler chicks. Br Poult Sci 2020; 61: 508\u0026ndash;517. https://doi.org/10.1080/00071668.2020.1759788\u003c/li\u003e\n\u003cli\u003eMonroig O, Rotllant J, Cerda-Reverter JM, Dick JR, Figueras A, Tocher DR. Expression and role of Elovl4 elongases in biosynthesis of very long-chain fatty acids during zebrafish \u003cem\u003eDanio rerio\u003c/em\u003e early embryonic development. Biochim Biophys Acta 2010; 1801: 1145-1154. doi: 10.1016/j.bbalip.2010.06.005\u003c/li\u003e\n\u003cli\u003eMorais S, Castanheira F, Martinez-Rubio L, Concei\u0026ccedil;\u0026atilde;o LEC, Tocher DR. Long chain polyunsaturated fatty acid synthesis in a marine vertebrate: ontogenetic and nutritional regulation of a fatty acyl desaturase with \u0026Delta;4 activity. BBA- Mol Cell Biol L 2012; 1821: 660-671.\u003c/li\u003e\n\u003cli\u003eMount S.M. A catalog of splice junction sequences. Nucleic Acid Res 1982; 10: 459-472. doi: 10.1093/nar/10.2.459.\u003c/li\u003e\n\u003cli\u003eNa W, Wang Y, Gong P, Zhang X, Zhang K, Zhang H, Wang N, Li H. Screening of reference genes for RT-qPCR in chicken adipose tissue and adipocytes. Front Physiol 2021; 12: 676864. https://doi.org/10.3389/fphys.2021.676864\u003c/li\u003e\n\u003cli\u003eNevers Y, Kress A, Defosset A, Ripp R, Linard B, Thompson JD, Poch O, Lecompte O. OrthoInspector 3.0: open portal for comparative genomics. Nucleic Acid Res 2019; 47: D411-D418. doi: 10.1093/nar/gky1068 \u003c/li\u003e\n\u003cli\u003eNguyen NTT, Vincens P, Crollius HR, Louis A. Genomicus 2018: karyotype evolutionary trees and on-the-fly synteny computing. Nucleic Acid Res 2018; 46: D816-D822. doi: 10.1093/nar/gkx1003 \u003c/li\u003e\n\u003cli\u003ePark SS, Kim JM, Kim EJ, Kim HS, An BK, Kang CW. Effects of dietary turmeric powder on laying performance and egg qualities in laying hens. Korean J Poult Sci 2012; .39: 27-32.\u003c/li\u003e\n\u003cli\u003ePotter SC, Luciani A, Eddy SR, Park Y, Lopez R, Finn RD. HMMER web server: 2018 update. Nucleic Acid Res 2018; 46 (Web server issue), W200-W204. doi: 10.1093/nar/gky448\u003c/li\u003e\n\u003cli\u003eReese MG. Application of a time-delay neural network to promoter annotation in the \u003cem\u003eDrosophila melanogaster\u003c/em\u003e genome. Comput Chem 2001; 26: 51-56. doi: https://doi.org/10.1016/S0097-8485(01)00099-7\u003c/li\u003e\n\u003cli\u003eShahrajabian MH, Sun W. The Golden spice for life: turmeric with the pharmacological benefits of curcuminoids components, including curcumin, bisdemethoxycurcumin, and demethoxycurcumin. Current Org Synth 2023; doi: 10.2174/1570179420666230607124949\u003c/li\u003e\n\u003cli\u003eTamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. MEGA5: Molecular evolutionary genetic analysis using maximum likelihood. Evolutionary distance, and maximum parsimony methods. Mole Biol and Evol 2011; 28: 2731-2739. \u003c/li\u003e\n\u003cli\u003eTeufel F, Almagro Armenteros JJ, Johansen AR, G\u0026iacute;slason MH, Pihl SI, Tsirigos KD, Winther O, Brunak S, von Heijne G, Nielsen H. SignalP 6.0 predicts all five types of signal peptides using protein language models. Nat Biotechnol 2022; 40: 1023-1025. doi: 10.1038/s41587-021-01156-3 \u003c/li\u003e\n\u003cli\u003eWang D, Li X, Zhang P, Cao Y, Zhang K, Qin P, Guo Y, Li Z, Tian Y, Kang X, Liu X, Li H. ELOVL gene family plays a virtual role in response to breeding selection and lipid deposition in different tissues in chicken (\u003cem\u003eGallus gallus\u003c/em\u003e). BMC Genomics 2022; 17: 705. doi: 10.1186/s12864-022-08932-8\u003c/li\u003e\n\u003cli\u003eWu A, Noble EE, Tyagi E, Ying Z, Zhuang Y, Gomez-Pinilla F. Curcumin boosts DHA in the brain: implications for the prevention of anxiety disorders. Biochim Biophys Acta 2015;1852: 951-961. https://doi.org/10.1016/j.bbadis.2014.12.005\u003c/li\u003e\n\u003cli\u003eZhang JY, Qin X, Park H, Kim E, Liu G, Kothapalli K, Brenna JT. Alternative splicing generates novel FADS3 transcript in mice. Molecular Biol Report 2016; 43: 761-766.\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003e\u003cstrong\u003eTable 1.\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eComposition \u0026nbsp; of basal diet used in the trial(%)\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"96%\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 73px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eFeed Raw Materials\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 26px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eRaw Material Rates\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 73px;\"\u003e\n \u003cp\u003eCorn (CP %8,5)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 26px;\"\u003e\n \u003cp\u003e62,99\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 73px;\"\u003e\n \u003cp\u003eSoybean meal (CP %45)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 26px;\"\u003e\n \u003cp\u003e16,57\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 73px;\"\u003e\n \u003cp\u003eCorn gluten (CP %60)\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 26px;\"\u003e\n \u003cp\u003e7,98\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 73px;\"\u003e\n \u003cp\u003eLimestone\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 26px;\"\u003e\n \u003cp\u003e10,18\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 73px;\"\u003e\n \u003cp\u003eDCP (P %18)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 26px;\"\u003e\n \u003cp\u003e1,44\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 73px;\"\u003e\n \u003cp\u003eVitamin-Mineral mixture*\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 26px;\"\u003e\n \u003cp\u003e0,25\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 73px;\"\u003e\n \u003cp\u003eNaCl\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 26px;\"\u003e\n \u003cp\u003e0,22\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 73px;\"\u003e\n \u003cp\u003eSodium Bicarbonate\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 26px;\"\u003e\n \u003cp\u003e0,16\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 73px;\"\u003e\n \u003cp\u003eL-Lysine\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 26px;\"\u003e\n \u003cp\u003e0,11\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 73px;\"\u003e\n \u003cp\u003eDL-Methionine\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 26px;\"\u003e\n \u003cp\u003e0,10\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 73px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eCalculated \u0026nbsp;composition (%)\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 26px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 73px;\"\u003e\n \u003cp\u003eDry matter\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 26px;\"\u003e\n \u003cp\u003e88,41\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 73px;\"\u003e\n \u003cp\u003eCrude protein\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 26px;\"\u003e\n \u003cp\u003e16,52\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 73px;\"\u003e\n \u003cp\u003eCrude fat\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 26px;\"\u003e\n \u003cp\u003e2,20\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 73px;\"\u003e\n \u003cp\u003eCrude ash\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 26px;\"\u003e\n \u003cp\u003e12,07\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 73px;\"\u003e\n \u003cp\u003eCrude cellulose\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 26px;\"\u003e\n \u003cp\u003e2,78\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 73px;\"\u003e\n \u003cp\u003eD-Methtionine\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 26px;\"\u003e\n \u003cp\u003e0,38\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 73px;\"\u003e\n \u003cp\u003eMethionine\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 26px;\"\u003e\n \u003cp\u003e0,40\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 73px;\"\u003e\n \u003cp\u003eLysine\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 26px;\"\u003e\n \u003cp\u003e0,76\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 73px;\"\u003e\n \u003cp\u003eME ( kcal/kg)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 26px;\"\u003e\n \u003cp\u003e2726\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 73px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eChemical analyses (%)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 26px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 73px;\"\u003e\n \u003cp\u003eDry matter\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 26px;\"\u003e\n \u003cp\u003e88,78\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 73px;\"\u003e\n \u003cp\u003eCrude protein\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 26px;\"\u003e\n \u003cp\u003e17,02\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 73px;\"\u003e\n \u003cp\u003eCrude fat\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 26px;\"\u003e\n \u003cp\u003e2,43\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 73px;\"\u003e\n \u003cp\u003eCrude ash\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 26px;\"\u003e\n \u003cp\u003e11,74\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 73px;\"\u003e\n \u003cp\u003eCrude cellulose\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 26px;\"\u003e\n \u003cp\u003e3,18\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003csup\u003e*\u003c/sup\u003ePer kilogram of diet: 12,000 IU vitamin A; 2,500 IU vitamin D3; 30 IU vitamin E; 4 mg vitamin K3; 3 mg vitamin B1; 6 mg vitamin B2; 30 mg niacin; 10 mg calcium D-pantothenate; 5 mg vitamin B6; 0.015 mg vitamin B12; 1 mg folic acid; 0.050 mg D-biotin; 50 mg vitamin C; 300 mg choline chloride; 80 mg manganese; 60 mg iron; 60 mg zinc; 5 mg copper; 0.5 mg cobalt; 2 mg iodine; 0.15 mg selenium.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 2.\u003c/strong\u003e PCR and quantitative PCR (qPCR) primers\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"96%\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 19px;\"\u003e\n \u003cp\u003eGene\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 48px;\"\u003e\n \u003cp\u003ePrimers (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 32px;\"\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Tm (\u0026deg;C)\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 19px;\"\u003e\n \u003cp\u003e\u003cem\u003eELOVL1\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 48px;\"\u003e\n \u003cp\u003eF: CCCTCAGGATGGTCAGTGTT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 32px;\"\u003e\n \u003cp\u003e60\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 48px;\"\u003e\n \u003cp\u003eR: CTCCAGGGCAGAACAGAGTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 19px;\"\u003e\n \u003cp\u003e\u003cem\u003eELOVL2\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 48px;\"\u003e\n \u003cp\u003eF: CTGACATCCGGGTAGCCAAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 32px;\"\u003e\n \u003cp\u003e59\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 48px;\"\u003e\n \u003cp\u003eR: TCGTGGCATGGTGATACACA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 19px;\"\u003e\n \u003cp\u003e\u003cem\u003eELOVL3\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 48px;\"\u003e\n \u003cp\u003eF: GGCCTTGTTCAGTGCCATT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 32px;\"\u003e\n \u003cp\u003e58\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 48px;\"\u003e\n \u003cp\u003eR: CCCAGTTCCAGGACTTTGCT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 19px;\"\u003e\n \u003cp\u003e\u003cem\u003eELOVL4\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 48px;\"\u003e\n \u003cp\u003eF: TGGAGCATCCGAGACAAACG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 32px;\"\u003e\n \u003cp\u003e59\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 48px;\"\u003e\n \u003cp\u003eR: TGGCAGACATAGCTGTACCC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 19px;\"\u003e\n \u003cp\u003e\u003cem\u003eELOVL5\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 48px;\"\u003e\n \u003cp\u003eF: TGGACCCAGAGATCCCAGA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 32px;\"\u003e\n \u003cp\u003e59\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 48px;\"\u003e\n \u003cp\u003eR: GCCCCTGCATGAGAATGGTT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 19px;\"\u003e\n \u003cp\u003e\u003cem\u003eELOVL6\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 48px;\"\u003e\n \u003cp\u003eF: GCTGTCTTCAGTATATTCGGTGC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 32px;\"\u003e\n \u003cp\u003e60\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 48px;\"\u003e\n \u003cp\u003eR: CCAGCCACCATGTCCTTGTA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 19px;\"\u003e\n \u003cp\u003e\u003cem\u003eELOVL7\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 48px;\"\u003e\n \u003cp\u003eF: ATCAAAGATGCCGATCCGAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 32px;\"\u003e\n \u003cp\u003e58\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 48px;\"\u003e\n \u003cp\u003eR: TTCTTAGGGCTGTAGGCGAC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 19px;\"\u003e\n \u003cp\u003eTBP\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 48px;\"\u003e\n \u003cp\u003eF: CAGGAGCAAAAAGCGAGGAAC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 32px;\"\u003e\n \u003cp\u003e58,5\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 48px;\"\u003e\n \u003cp\u003eR: TGCTGGTGTGTGAGTACCAA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 3.\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eEffect of diets containing different levels of curcumin on performance\u003cstrong\u003e.\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"68%\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 26px;\"\u003e\n \u003cp\u003eGroups\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18px;\"\u003e\n \u003cp\u003eFeed Intake (g)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18px;\"\u003e\n \u003cp\u003eEgg Weight (g)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18px;\"\u003e\n \u003cp\u003e\u0026nbsp;Egg production (%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18px;\"\u003e\n \u003cp\u003eFeed Covertion Ratio (g/g)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 26px;\"\u003e\n \u003cp\u003eC0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18px;\"\u003e\n \u003cp\u003e115,03\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18px;\"\u003e\n \u003cp\u003e64,14\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18px;\"\u003e\n \u003cp\u003e87,10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18px;\"\u003e\n \u003cp\u003e2,10\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 26px;\"\u003e\n \u003cp\u003eC100\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18px;\"\u003e\n \u003cp\u003e109,55\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18px;\"\u003e\n \u003cp\u003e62,92\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18px;\"\u003e\n \u003cp\u003e86,72\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18px;\"\u003e\n \u003cp\u003e2,05\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 26px;\"\u003e\n \u003cp\u003eC200\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18px;\"\u003e\n \u003cp\u003e117,40\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18px;\"\u003e\n \u003cp\u003e64,73\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18px;\"\u003e\n \u003cp\u003e90,00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18px;\"\u003e\n \u003cp\u003e2,04\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 26px;\"\u003e\n \u003cp\u003eC300\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18px;\"\u003e\n \u003cp\u003e116,14\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18px;\"\u003e\n \u003cp\u003e66,10\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18px;\"\u003e\n \u003cp\u003e87,67\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18px;\"\u003e\n \u003cp\u003e2,04\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 26px;\"\u003e\n \u003cp\u003eC400\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18px;\"\u003e\n \u003cp\u003e112,33\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18px;\"\u003e\n \u003cp\u003e63,08\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18px;\"\u003e\n \u003cp\u003e91,76\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18px;\"\u003e\n \u003cp\u003e1,96\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 26px;\"\u003e\n \u003cp\u003eSE\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18px;\"\u003e\n \u003cp\u003e1,133\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18px;\"\u003e\n \u003cp\u003e0,354\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18px;\"\u003e\n \u003cp\u003e0,795\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18px;\"\u003e\n \u003cp\u003e0,025\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 26px;\"\u003e\n \u003cp\u003eP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18px;\"\u003e\n \u003cp\u003e0,176\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18px;\"\u003e\n \u003cp\u003e0,027*\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18px;\"\u003e\n \u003cp\u003e0.236\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18px;\"\u003e\n \u003cp\u003e0.578\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eC0: Group without added curcumin, C100: 100 mg curcumin added group, C200: 200 mg curcumin added group, C300: 300 mg curcumin added group, C400: 400 mg curcumin added group, a,b: Differences between group means shown with different letters in the same column are significant, SE: Standard error, *: (p\u0026lt;0.05), **: (p\u0026lt;0.01), ns: Not significant\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTablo 4.\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eEffect of diets containing different levels of curcumin on\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eegg quality criteria\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"88%\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 14px;\"\u003e\n \u003cp\u003eGroups\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16px;\"\u003e\n \u003cp\u003eHaugh Unit\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 12px;\"\u003e\n \u003cp\u003eAlbumen (%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003eEgg Yolk (%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11px;\"\u003e\n \u003cp\u003eShell Ratio (%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 14px;\"\u003e\n \u003cp\u003eShell Thickness\u003c/p\u003e\n \u003cp\u003e(\u0026micro;m)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 20px;\"\u003e\n \u003cp\u003eShell Breaking Strengt(kg/cm2)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 14px;\"\u003e\n \u003cp\u003eC0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16px;\"\u003e\n \u003cp\u003e78,12\u003csup\u003ebc\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 12px;\"\u003e\n \u003cp\u003e59,15\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e29,04\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11px;\"\u003e\n \u003cp\u003e11,81\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 14px;\"\u003e\n \u003cp\u003e0,393\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 20px;\"\u003e\n \u003cp\u003e4,30\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 14px;\"\u003e\n \u003cp\u003eC100\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16px;\"\u003e\n \u003cp\u003e84,61\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 12px;\"\u003e\n \u003cp\u003e61,14\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e27,61\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11px;\"\u003e\n \u003cp\u003e11,26\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 14px;\"\u003e\n \u003cp\u003e0,376\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 20px;\"\u003e\n \u003cp\u003e3,69\u003csup\u003ebc\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 14px;\"\u003e\n \u003cp\u003eC200\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16px;\"\u003e\n \u003cp\u003e82,60\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 12px;\"\u003e\n \u003cp\u003e60,04\u003csup\u003ebc\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e28,06\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11px;\"\u003e\n \u003cp\u003e11,90\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 14px;\"\u003e\n \u003cp\u003e0,399\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 20px;\"\u003e\n \u003cp\u003e4,09\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 14px;\"\u003e\n \u003cp\u003eC300\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16px;\"\u003e\n \u003cp\u003e79,99\u003csup\u003eabc\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 12px;\"\u003e\n \u003cp\u003e62,22\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e26,57\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11px;\"\u003e\n \u003cp\u003e11,22\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 14px;\"\u003e\n \u003cp\u003e0,372\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 20px;\"\u003e\n \u003cp\u003e3,77\u003csup\u003ebc\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 14px;\"\u003e\n \u003cp\u003eC400\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16px;\"\u003e\n \u003cp\u003e77,29\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 12px;\"\u003e\n \u003cp\u003e59,53\u003csup\u003ebc\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e28,92\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11px;\"\u003e\n \u003cp\u003e11,54\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 14px;\"\u003e\n \u003cp\u003e0,383\u003csup\u003ebc\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 20px;\"\u003e\n \u003cp\u003e3,51\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 14px;\"\u003e\n \u003cp\u003eSE\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16px;\"\u003e\n \u003cp\u003e0,793\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 12px;\"\u003e\n \u003cp\u003e0,289\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e0,251\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11px;\"\u003e\n \u003cp\u003e0,085\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 14px;\"\u003e\n \u003cp\u003e0,002\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 20px;\"\u003e\n \u003cp\u003e0,071\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 14px;\"\u003e\n \u003cp\u003eP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16px;\"\u003e\n \u003cp\u003e0,019*\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 12px;\"\u003e\n \u003cp\u003e0,003**\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e0,012**\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11px;\"\u003e\n \u003cp\u003e0,030*\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 14px;\"\u003e\n \u003cp\u003e0,001**\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 20px;\"\u003e\n \u003cp\u003e0,002**\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eC0: Group without added curcumin, C100: 100 mg curcumin added group, C200: 200 mg curcumin added group, C300: 300 mg curcumin added group, C400: 400 mg curcumin added group, a,b: Differences between group means shown with different letters in the same column are significant, SE: Standard error, *: (p\u0026lt;0.05), **: (p\u0026lt;0.01), ns: Not significant\u0026nbsp;\u003c/p\u003e\n\u003cp id=\"_Toc168418738\"\u003e\u003cstrong\u003eTablo 5.\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eEffect of diets containing different levels of curcumin on the fatty acid composition of egg yolk (%)\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"100%\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 27px;\"\u003e\n \u003cp\u003eFatty acids\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9px;\"\u003e\n \u003cp\u003eC0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003eC100\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003eC200\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003eC300\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003eC400\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003eSE\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003eP\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 27px;\"\u003e\n \u003cp\u003e14:0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9px;\"\u003e\n \u003cp\u003e2.02\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e2.12\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e1.85\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e1.86\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e1.79\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e0,044\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e0.163\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 27px;\"\u003e\n \u003cp\u003e16:0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9px;\"\u003e\n \u003cp\u003e22.40\u003csup\u003ebc\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e21.79\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e22.93\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e23.27\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e23.15\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e0,139\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e0,002**\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 27px;\"\u003e\n \u003cp\u003e18:0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9px;\"\u003e\n \u003cp\u003e8.37\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e7.64\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e7.89\u003csup\u003ebc\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e8.17\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e7.88\u003csup\u003ebc\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e0,049\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e0.003\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 27px;\"\u003e\n \u003cp\u003e\u0026sum;SFA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9px;\"\u003e\n \u003cp\u003e32.80\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e31.56\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e32.68\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e33.31\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e32.83\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e0,066\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e0,003**\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 27px;\"\u003e\n \u003cp\u003e16:1n-7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9px;\"\u003e\n \u003cp\u003e2.21\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e2.28\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e2.42\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e2.41\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e2.60\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e0,292\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e0,096\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 27px;\"\u003e\n \u003cp\u003e18:1n-9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9px;\"\u003e\n \u003cp\u003e40.05\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e37.79\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e39.33\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e41.22\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e40.47\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e0,373\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e0,001**\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 27px;\"\u003e\n \u003cp\u003e\u0026sum;MUFA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9px;\"\u003e\n \u003cp\u003e42.26\u003csup\u003ebc\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e40.07\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e41.76\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e43.64\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e43.07\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e0,028\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e0,000**\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 27px;\"\u003e\n \u003cp\u003e18:3n-3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9px;\"\u003e\n \u003cp\u003e1.05\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e1.10\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e0.86\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e0.78\u003csup\u003ed\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e0.85\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e0,026\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e0,023*\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 27px;\"\u003e\n \u003cp\u003e20:5n-3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9px;\"\u003e\n \u003cp\u003e0.31\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e0.26\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e0.27\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e0.25\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e0.30\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e0,017\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e0,013*\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 27px;\"\u003e\n \u003cp\u003e22:6n-3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9px;\"\u003e\n \u003cp\u003e1.15\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e1.15\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e1.18\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e1.13\u003csup\u003ed\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e1.02\u003csup\u003ee\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e0,006\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e0,001**\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 27px;\"\u003e\n \u003cp\u003e\u0026sum;\u0026omega;-3 PUFA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9px;\"\u003e\n \u003cp\u003e2.51\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e2.50\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e2.30\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e2.16\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e2.17\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e0,157\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e0,011*\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 27px;\"\u003e\n \u003cp\u003e18:2n-6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9px;\"\u003e\n \u003cp\u003e17.74\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e20.98\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e18.67\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e16.05\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e17.34\u003csup\u003ebc\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e0,303\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e0,001**\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 27px;\"\u003e\n \u003cp\u003e20:4n-6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9px;\"\u003e\n \u003cp\u003e2.07\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e2.15\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e2.10\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e2.21\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e1.97\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e0,399\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e0,000**\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 27px;\"\u003e\n \u003cp\u003e\u0026sum;\u0026omega;-6 PUFA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9px;\"\u003e\n \u003cp\u003e19.82\u003csup\u003ebc\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e23.13\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e20.77\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e18.26\u003csup\u003ed\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e19.31\u003csup\u003ecd\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e0,037\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e0,000**\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 27px;\"\u003e\n \u003cp\u003e\u0026sum;PUFA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9px;\"\u003e\n \u003cp\u003e22.33\u003csup\u003ebc\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e25.64\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e23.08\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e20.42\u003csup\u003ed\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e21.49\u003csup\u003ecd\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e0,371\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e0,000**\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 27px;\"\u003e\n \u003cp\u003e\u0026sum;\u0026omega;-3 PUFA/\u0026sum;\u0026omega;-6 PUFA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9px;\"\u003e\n \u003cp\u003e0.13\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e0.11\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e0.11\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e0.12\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e0.11\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e0,001\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e0,000**\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 27px;\"\u003e\n \u003cp\u003eDHA/EPA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9px;\"\u003e\n \u003cp\u003e3.74\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e4.50\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e4.10\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e4.56\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e3.35\u003csup\u003ed\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e0,10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e0,000**\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eC0: Group without added curcumin, C100: 100 mg curcumin added group, C200: 200 mg curcumin added group, C300: 300 mg curcumin added group, C400: 400 mg curcumin added group, a,b,c,d,e: Differences between group means shown with different letters in the same raw are significant, SE: Standard error, *: (p\u0026lt;0.05), **: (p\u0026lt;0.01), ns: Not significant\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"curcumin, ELOVL, laying hens, molecular cloning, RT-qPCR","lastPublishedDoi":"10.21203/rs.3.rs-6504409/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6504409/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThe study was designed to determine the effects of different levels of curcumin supplementation in the diets of laying hens on performance, egg quality criteria, yolk fatty acid composition, and the identification, characterization, and mRNA transcription of the elongation of very long chain fatty acids (ELOVL) genes. In the experimental design, Hy-Line Brown commercial laying hens were selected for a feeding trial lasting ten weeks. During this period, the hens were fed diets supplemented with curcumin at 0, 100, 200, 300, and 400 mg/kg. Performance characteristics, egg quality criteria and yolk fatty acid compositionwere determined by measurements made during the experimental period. At the end of the experiment, the expression levels of ELOVL genes were determined in liver tissue samples.\u003c/p\u003e \u003cp\u003eAt the end of the experiment, it was found that 100 mg/kg curcumin significantly (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) increased Haugh unit, while 300 mg/kg significantly (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) increased egg weight. Addition of 100 mg/kg curcumin to the diet increased the ratio of linoleic acid and linolenic acid, while 200 mg/kg curcumin increased the ratio of docosahexaenoic acid (DHA) to the highest level. In addition, it was observed that 100 mg/kg curcumin significantly increased ELOVL6 and ELOVL7 gene expression levels, and 400 mg/kg significantly increased ELOVL5 gene expression levels. These findings add to the further evidence suggesting that dietary curcumin can modulate ELOVL mRNA transcription in chickens.\u003c/p\u003e \u003cp\u003eAs a result, it was concluded that especially 100 mg/kg curcumin level would be suitable for use in the diet of laying hens.\u003c/p\u003e","manuscriptTitle":"Effect of Curcumin Supplementation in Laying Hen Diet on Performance, Yolk Fatty Acid Composition and Elovl Genes","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-05-08 09:48:31","doi":"10.21203/rs.3.rs-6504409/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"aee81a77-0469-4fa5-b7ae-d2415979080d","owner":[],"postedDate":"May 8th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-05-09T14:11:53+00:00","versionOfRecord":[],"versionCreatedAt":"2025-05-08 09:48:31","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-6504409","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6504409","identity":"rs-6504409","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}