Polymeric Nanoassemblies based Gene/drug Co-delivery for Autophagy Modulation and Tumor Multidrug-resistance

Polymeric Nanoassemblies based Gene/drug Co-delivery for Autophagy Modulation and Tumor Multidrug-resistance | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Polymeric Nanoassemblies based Gene/drug Co-delivery for Autophagy Modulation and Tumor Multidrug-resistance Yong Sun, Changduo Wang, Zhipeng Li, Ping Xu, Lisa Xu, Shangcong Han This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-1495473/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 7 You are reading this latest preprint version Abstract Multidrug resistance (MDR) has been restricting the efficacy of chemotherapy, which mainly include pump resistance and nonpump resistance. In order to fight overall MDR, a novel targeted gene/drug co-deliver nano system is developed, which can suppress the drug efflux pumps and modulate autophagy to overcoming both pump and nonpump resistance. RNA interference (RNAi) is widely applied in combating MDR through knocking down MDR-related gene. Here, small interfere RNA (siRNA) is incorporated into polymer-drug conjugates (PP) which are composed of polyethyleneimine (PEI) and paclitaxel (PTX) via covalent bonds, and hyaluronic acid (HA) is coated on the surface of PP/siRNA to achieve long blood cycle and CD44-targeted delivery. The polymeric nanoassemblies (PP/siRNA/HA) would be shattered and release PTX under the enrich-enzyme intracellular environment. This study identifies PP/siRNA/HA could efficiently facilitate apoptosis of Taxol-resistant lung cancer cells (A549/T) to reverse MDR through down-regulating P-gp and block autophagic flux. Further study indicates that PEI conjugates play a significant role to block the autophagosome–lysosome fusion process by means of alkalizing lysosomes. Both in vitro and in vivo studies confirm that the nanoassemblies can successfully deliver drug into tumor cells and significantly inhibited A549/T tumor growth. In summary, the polymeric nanoassemblies provide a potential strategy for combating both pump and nonpump resistance via the synergism of RNAi and autophagy modulation. MDR autophagy siRNA tumor therapy prodrug Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Introduction Multidrug resistance (MDR) is well recognized as one of the major obstacles that deteriorate the clinic effect of chemotherapy for non-small cell lung cancer (NSCLC) [ 1 ]. The development of MDR is complex, which can be generally divided into two major types, “pump” resistance and “non-pump” resistance [ 2 ]. For the pump resistance, it is raised by the overexpression of drug-efflux pumps, known as ATP-binding cassette (ABC) transporters, on the cell member to reducing intercellular drug concentration [ 3 ]. Among different types of ABC transporters, P-glycoprotein (P-gp), coded by the mdr1 gene, has been reported to overexpress in many cancer cells to induce MDR [ 4 – 6 ]. RNA interference (RNAi) technology is frequently combined with chemotherapy to suppress the expression of P-gp [ 7 – 9 ]. It takes advantage of small interfering RNA (siRNA) molecules to silence specific gene and regulate gene expression to obtain high specificity and excellent treatment effect [ 10 , 11 ]. Polyethyleneimine (PEI), a cationic polymer, has strong nucleic acids compaction capacity due to the high density of amines. The “proton-sponge” effect of PEI would rupture endosomal and help gene translocate without degradation [ 12 , 13 ], therefore, PEI has been widely applied in RNAi. High molecular weight PEI has higher transfection efficiency than PEI with low molecular weight (LMW), but also brings more side effects [ 14 , 15 ]. Thus, LMW PEIs (such as 1.8k PEI or 10K PEI) are adopted and modified to reduce the toxicity, improve transfection and functionalization (such as tumor-targeted, long blood circle, and drug loading). Apart from pump resistance, non-pump resistance also contributes significantly to MDR [ 16 ]. For instance, autophagy as a pro-survival factor has a role in the development of MDR [ 17 ]. Autophagy is a lysosome-based degradative pathway activated in limited growth conditions, which could degrade cytoplasmic materials (damaged organelles, obsolete proteins, and invading pathogens) and recycle energy to maintain homeostasis in cells [ 18 ]. It is a double-edged sword for MDR tumors. Excessive autophagy could promote apoptosis and autophagic death of tumor cell which is also known as the type II programmed cell death [ 19 ]. What’s more, there are increasing evidences suggesting that autophagy protect cells under therapeutic stress and promote the development of MDR [ 20 , 21 ]. Chloroquine (CQ) and hydroxychloroquine (HCQ), clinical antimalarial drugs, can block the fusion of autophagosomes with lysosomes via alkalizing lysosomes [ 22 ]. There are many studies co-delivering CQ (or HCQ) and chemotherapeutic drugs to sensitize the cancer cells [ 23 – 26 ]. However, the long-term use of CQ or HCQ are associated with various side effects, and the irreversible retinopathy caused by CQ (or HCQ) could remain develop after drug withdrawal [ 27 – 29 ]. Recently, nanoparticle-based autophagy inhibitors have attracted attentions in tumor MDR [ 30 ]. Gold nanoparticles are proven to block autophagic flux by impairing lysosome and induce autophagosome accumulation [ 31 ]. The pH-sensitive nanoparticles based on poly(β-amino ester) copolymers can lead to block autophagic flux and autophagic cell death under high concentrations [ 32 ]. The pH-sensitive polymer, mPEG-b-p(DPA-bDMAEMA), could self-assemble into micelles and be capable of loading chemotherapeutic agent, which unfold autophagic inhibition ability and high antitumor efficiency [ 33 ]. The autophagy inhibition facilitated by nanoparticles have also been successfully applied in reversing MDR, but there are few reports about suppressing both P-gp and autophagy to work on “pump” and “non-pump” resistance and to combat tumor MDR. Herein, in order to reverse overall MDR, we designed a novel hyaluronic acid (HA)-coated siRNA/Paclitaxel (PTX) co-delivery nanoassemblies which can suppress P-gp level, block autophagic flux, and obtain efficient delivery of siRNA and paclitaxel. We synthesized the polymer-drug conjugates of low molecular weight polyethyleneimine (1.8k PEI) and PTX, named PEI-PTX (PP), which has high drug loading content (~ 25.2%) and can encapsulate siRNA for gene therapy. Subsequently, mdr1-siRNA was condensed onto PP to form PP/siRNA driven by electrostatic interaction. Finally, HA was coated on the surface of PP/siRNA to stable nanoassemblies (PP/siRNA/HA). HA, viscous mucopolysaccharide, is widely used in nano drug delivery because of excellent biocompatibility and biodegradability, meanwhile it also can reduce the clearance of mononuclear macrophages and target CD44-overexpression tumor [ 34 , 35 ]. After entering cells mediated by CD44-receptors, PP/siRNA/HA would be shattered within the enrich-enzyme endo/lysosomal. The endo/lysosomal can be impaired by the “proton-sponge” effect of PEI, and siRNA (as well as PP) would release into cytoplasm to silence the mdr1 gene expression. Then, PTX will be released after the hydrolytic cleavage of PP and act on tubulin to prevent cell's mitosis. PP/siRNA/HA nanoassemblies can achieve suppression to P-gp expression and growth inhibition of tumor cell to combat Taxol-resistant non-small cell lung cancer cells (A549/T cells). We further demonstrate the PEI conjugate plays a significant role in autophagy modulation, which can alkalize and impair lysosomes to block autophagosome–lysosome fusion and lead to the accumulation of autophagosome. The potency of polymeric nanoassemblies is evaluated by A549/T cells and by A549/T tumor-bearing mice. Our work advances a novel strategy for MDR that could block autophagic flux, and achieve overcoming pump and nonpump resistance when combined with RNAi and chemotherapy Experimental Section Materials Succinic anhydride, b -PEI (MW 1,800), b -PEI (MW 250,000), 2-(7-Azabenzotriazol-1-yl)- N, N, N', N' -tetramethyluronium hexafluorophosphate (HATU), N-ethyldiisopropylamine (DPIEA) et.al was purchased from Adamas-beta (Shanghai, China). All of solvent were purchased from Macklin (Shanghai, China). Chloroquine Phosphate was obtained from Sigma-Aldrich (St. Louis, MO, USA). Antibodies used for Western Blotting and immunofluorescence including rabbit anti-LC3B, anti-p62, anti-Pgp, goat anti-rabbit IgG (H + L) (HRP, Cora Lite 594) were obtained from Proteintech (Wuhan, China). Alexa fluor 647-labeled goat anti-rabbit IgG (H + L), rabbit anti-CD44, anti-ki67, Ad-GFP-LC3B, Lyso-Tracker Red, TUNEL Apoptosis Assay Kit, acid phosphatase assay kit et.al were purchased from Beyotime (Shanghai, China). All other reagents for western blotting and gel electrophoresis were obtained from Solarbio (Beijing, China). Targeting human P-gp siRNA sequences: Sense: 5’-AAGAAGGAAAAGAAACCAACUdTdT-3’; Anti-sense: 5’-AGUUGGUUUCUUUUCCUUCUUdTdT-3’. All of siRNA were obtained by GenePharma Co. Ltd. (Shanghai, China). Preparation of PEI-PTX (PP) Synthesis of PEI-PTX was carried in two steps, as shown in Fig. 1 . In the first step, PTX (100 mg/0.117 mmol) and succinyloxide (146 mg/1.459 mmol) were added in anhydrous pyridine for stirring at room temperature for 12 h. Then, the solvent was evaporated under reduced pressure, and deionized water was added for another 2 h. The pH was adjusted at 2–3 with HCl, and solution was extracted with ethyl acetate. The ethyl acetate extractant was washed with 0.2 M NaHCO 3 and saturated salt water, respectively. The organic layer was dried over MgSO 4 . Removal of the solvents provided a white solid of PTX-SA (99.34 mg, productivity 89.1%). The formed PTX-SA was characterized by FT-IR, 1 H NMR and mass spectrum. In the second step, PEI-PTX was synthesized as follows: briefly, 200.0 mg PEI (MW 1,800) was dissolved 5 mL water, and the pH was adjusted at 8 with HCL. The solution was lyophilized and dissolved in 5 mL DMSO for further use. PTX-SA (100 mg/ 0.11 mmol), HATU (76 mg/0.20 mmol), HOBt (28 mg/0.20 mmol) were dissolved in 1 mL DMSO, and DIPEA (130 mg/1.0 mmol) was added to the solution. The mixture was reacted at room temperature for 3 h. Then, the activated PTX-SA reaction solution was mixed with the PEI solution as mentioned above. After 24 h reaction, PEI-PTX solution was obtained through dialysis and lyophilization to obtain a purple solid. The product was characterized by FT-IR and gel permeation chromatography (GPC). Preparation and Characterization of Nanocomplex As illustrated in Fig. 2 A, PP was dissolved in deionized water and mixed with siRNA at a proper ratio under ultrasonic agitation. The siRNA-loaded PP (PP/siRNA) were coated with HA by incubation in 10-times volume HA solution under ultrasonic agitation. Finally, the HA-coated, siRNA-loaded PP (PP/siRNA/HA) were collected by centrifugation (12000 r, 20 min). PP/siRNA and PP/HA were also prepared and collected with above methods. After diluting the micelle solution with distilled water, the mean particle diameter (Z-average) and zeta potentials of the nanomicelles were determined via a Malvern Zetasizer Nano ZS90 (British Malvern Instrument Co. Ltd). The morphological features of PP, PP/siRNA and PP/siRNA/HA were observed by using a transmission electron microscope (TEM, JSM-6490LA, Japanese company JEOL). Briley, a copper grid was immersed in a pre-diluted micellar solution for 3–5 min and then stained with 1% phosphotungstic acid after air-drying. The TEM images of the samples were taken after being dried again with an incandescent lamp. Hemolytic Toxicity Study To assess the potential hemolytic toxicity of PP and PP/HA, a red blood cell suspension was diluted to 2% with phosphate buffer solution (pH7.4). Different concentrations of PP and PP/HA were dispersed in the 2% RBC suspension (1:1, volume ratio). In addition, TritonX-100 and physiological saline were used as the positive control and negative control, respectively. All samples were incubated in a constant temperature water bath at 37℃ for 3 h and then centrifuged at 4000 rpm for 15 min. The supernatant was collected, and its absorbance was measured at 540 nm using a microplate reader. The percentage of hemolysis was calculated by taking the absorbance of the TritonX-100 sample as the hemolysis rate of 100%. The hemolysis rate was calculated according to the following equations: The Drug Loading and in vitro PTX Release The PTX loading of PP, PP/siRNA, PP/HA, PP/siRNA/HA were determined by high-performance liquid chromatography (HPLC, 1260 Infinity, Agilent) after the hydrolysis in methanol/water (1:1) solution at 37℃ for 24 h. The accumulative release of PTX from PP/siRNA/HA NPs were conducted in the release medium of pH7.4 or 6.0 PBS, with or without 0.4 mg/mL HAase at 37℃, under a shaking at the speed of 100 rpm/min. The dialysis bag (MW = 1000 Da) containing 0.5 mL solution of PP/siRNA/HA NPs was put into 10 mL release media. 1 mL release media was withdrawn and determined at the selected time. The HPLC was applied to determine the content of PTX (mobile phase: acetonitrile/water = 50/50). During the whole process, the UV detection was set at 227 nm, the flow rate was 1 mL/min and the temperature of C18 column was 30℃. Cytotoxicity Assay Human lung cancer cell lines, A549 and Taxol-resistant A549 (A549/T) were purchased from Procell Life Science&Technology Co.,Ltd (Wuhan, China). All cells were cultured in F-12K media containing 10% FBS and 100 IU/ml penicillin, 100 mg/ml streptomycin and 2 mM L-glutamine. All cells were maintained in a 37℃ incubator with 5% CO2 for further treatment. The cell viability/cytotoxic potential of individual formulation were performed by MTT assay. Briefly, cells were seeded into at a seeding density of 5000 cells/96-well plate and incubated for 24 h. Following day, medium was removed and cells were incubated with free PTX, PP, PP/HA, PP/siRNA, and PP/siRNA/HA at different concentrations of PTX (ranged from 10 − 5 to 1µg/mL) and incubated for 48 h. At designated time intervals, cells were treated with 100 µL/well MTT solution (0.5 mg/ml in serum free media) and incubated for 4 h. The purple blue formazan crystals were extracted by the addition of 150 µL/well DMSO and absorbance was measured by microplate reader (Sunrise, TECAN). The IC 50 value of PTX in these cells was calculated by GraphPad Prsim software. Cell Uptake Study Cellular uptake by flow cytometer analysis The A549 cells, as well as A549/T cells, were seeded at a density of 2×10 5 cells/6-well plate and allowed to attach for 24 h. The cells were exposed to PP/FAM-siRNA/HA and incubated for 1 and 4 h. The cells were washed twice with PBS, trypsinized, collected and resuspended in PBS. The amount of cellular uptake was confirmed by flow cytometry (Beckman coulter life sciences, CytoFLEX, USA). The cellular uptake of drugs was observed by confocal laser scanning microscope (CLSM). In order to make the PP/siRNA/HA NPs have fluorescence signal, we attempted to label FAM-siRNA to NPs. The cell nuclei were stained by DAPI. During the whole process, in short, 2×10 4 A549 cells, as well as A549/T cells, were seeded into 24-well plates and incubated for 24h. The media was removed and the cells were cultured with FAM-siRNA (1 µg/mL) loaded in PP/siRNA/HA NPs. After 1 h and 4h, the cells were washed, fixed, stained, and ultimately observed by CLSM. Apoptosis Assay and Cell-cycle Analysis The A549 and A549/T were seeded at a density of 3×10 5 cells/6-well plate and allowed to attach for 24 h. The cells were treated with free PTX, PP, PP/HA, PP/siRNA and PP/siRNA/HA and incubated for 24 h at 37℃ in a standard incubator. A control was maintained as untreated cells. After the incubation period, cells were washed with PBS, trypsinized, collected and resuspended in a 195 µL of binding buffer. Immediately, 5 µL of annexin V-FITC and 10 µL of propidium iodide (PI) was added and gently votexed and kept aside for 30 min. The proportions of apoptotic or stained cells were observed by flow cytometer. 3×10 5 cells A549 and A549/T cells were seeded into 6-well plate and cultured overnight respectively. Then, the media was replaced and cells were cultured with free PTX, PP, PP/HA, PP/siRNA and PP/siRNA/HA. The cells were collected, fixed (70% ethanol V/V, -20℃, overnight) and stained with PI (50 µg/mL, 20 min, 4℃) for the further analysis of cell cycle distribution by flow cytometry. In vitro siRNA Transfection and Analysis of P-gp Expression The A549 and A549/T cells were seeded at a density of 3×10 5 cells/6-well plate. After reaching 70% confluence, the cells were incubated with control (fresh media), PP, PP/HA, PP/siRNA, and PP/siRNA/HA (100nM siRNA) for 48 (mRNA extraction) or 72 hours (protein isolation). The intracellular mRNA level and protein content were detected by reverse transcription PCR (RT-PCR) and Western blot, respectively. Total RNA from cells was extracted using the Total RNA Extraction Kit (Solarbio, China) according to the manufacturer's protocol. The concentration of extracted RNA was determined with NanoDrop One (Thermo scientific, USA). The cDNA was produced using the MonScript™ RTIII All-in-One Mix with dsDNase (Monad Biotech, China). The reverse-transcribed cDNA was used for PCR amplification using MonAmp™ ChemoHS qPCR Mix (Monad Biotech, China). The primer sequences for MDR1-mRNA amplification: Forward 5’-AGGAAGCCAATGCCTATGACTTTA-3’; Reverse 5’-CAACTGGGCCCCTCTCTCTC-3’. The primer sequences for GAPDH amplification: Forward 5’- AAATCAAGTGGGGCGATGCTG − 3’; Reverse 5’- GCAGGAGGCATTGCTGATGAT − 3’. GAPDH was used as a reference gene. PCR was performed on ABI StepOne Plus™ (Applied Biosystems®, USA). For western blotting, the cells were lysed using RIPA buffer (Solarbio, China) after treatment. The protein content was determined by BCA Protein Assay Kit (Solarbio, China). For all western blots, samples containing 50–150 µg of total protein were separated by SDS-PAGE on 10–15% gel. The separated polypeptides were transferred to polyvinylidene fluoride (PVDF) membrane, probed with antibodies, and visualized by ECL with ChemiDoc™ XRS+ (Bio-Rad Laboratories, USA) as previously described. All primary antibodies were purchased from Proteintech® (Wuhan, China) with 1:500 dilution. In vitro Autoghagy Modulation Study The A549/T cells were seeded on 6-well plate. The cells were treated with PP (different concentrations ranged from 0.1 to 50 µM), negative control (PBS), and positive control (10µM CQ), respectively. The intracellular LC3/p62 proteins were detected by Western blotting. For immunofluorescence, after treatment, the A549/T cells expressing GFP-LC3B were fixed using 4% paraformaldehyde, washed in PBS, permeabilized with 0.1% Triton X-100, and blocked in 5% goat serum. Cells were then stained with rabbit anti-p62 antibody and secondary antibody (Alexa Fluor® 647 Conjugate) followed by DAPI nuclear stains. For co-localization analysis, the cells expressing GFP-LC3B were fixed and stained nuclear after treatment of Cy5-siRNA loaded nanoassemblies (PP/Cy5-siRNA/HA). All stained samples were visualized under CLSM (Leica, USA). For observation of autophagosome, A549/T cells were collected using cell scraper and centrifuged after treatment, and the cell sediments were fixed in 2.5% glutaraldehyde for at least 24 h. Then, the cells were graded dehydrated and fixed in epoxy. Ultrathin sections of the cells were examined by transmission electron microscope. Gel Retardation Assay for Testing siRNA-Loading Capacity and siRNA Stability The siRNA-loading capacity of PP was evaluated by the agarose gel retardation assay. The siRNA-loaded PP (PP/siRNA) complexes were prepared by varying the PP/siRNA weight ratio from 1/1 to 8/1. The complexes were loaded in 1% agarose gel and run in 1×TAE buffer at 120 V for 15 min. The gel was stained with SuperRed/GelRed (Biosharp, China), and siRNA bands were visualized with ChemiDoc™ XRS+ (Bio-Rad Laboratories, USA). For stability testing, siRNA or NPs were challenged with 50% FBS at 37°C for different time (0 to 24h) and analyzed by agarose gel electrophoresis. For the anion resistance of nanoassemblies, PP/siRNA and PP/siRNA/HA, various dosage of heparin (heparin/siRNA range 1 to 8 IU/µg) were used to replace siRNA from complexes at 37°C for 2h. In vivo Biodistribution All animal experiments complied with the regulations of the Animal Experiments Ethic Committee for the care and use of research animals in Qingdao University. BALB/c nude mice bearing A549/T tumor were used to study the biodistribution of PP/siRNA/HA nanoassemblies via fluorescence imaging [ 36 ]. When the tumor volume was about 300 mm 3 , Cy5-siRNA solution or PP/Cy5-siRNA/HA nanoassemblies were intravenously administrated (1 mg/kg equal to Cy5-siRNA). The mice were observed with in vivo fluorescence imaging system at 1, 3, 6, 12 and 24 h after injection (n = 3). Furthermore, at 24 h after injection, the mice were dissected and the heart, liver, spleen, lungs, kidneys, and tumors were used for imaging. In vivo Antitumor Efficacy Balb/c nude mice (male, 3 − 4 weeks) were purchased from Beijing Vital River Laboratory Animal Technology Co. Ltd., China. After one week of adaptation, tumor bearing mice were established by subcutaneous injection of 1×10 7 A549/T cells suspended in in PBS and Matrigel media mixed at 1:1 ratio. When the tumor size reached 100 mm3, mice were randomly classified into 4 groups (n = 6): untreated control (0.9% NaCl), free PTX (Taxol), PP/HA, and PP/siRNA/HA. Then, these formulations were administrated via tail vein (5 mg/kg/time of PTX, 5 mg/kg/time of siRNA) for five injections every four day. Tumor size was monitored every 2 days. The length (L) and width (W) of each tumor were measured by a digital caliper, and the volume (V) was calculated by the modified ellipsoid formula: V = (L × W 2 )/2. At the 21th day of observation, all of mice were sacrificed and its tumors were weighed. The tumor burden was calculated as: Tumor burden (%) = (W tumor /W mice ) ×100. Moreover, the heart, liver, spleen, lung, kidney, and tumor were dissected for H&E staining to evaluate physiological changes of main organs and tumors. TUNEL and Ki67 fluorescence staining were used to test the apoptosis and proliferation of tumor. The immunofluorescence staining of P-gp, LC3B, and p62 were valuated to the gene silencing and autophagy modulation of nanoassemblies in vivo. Statistical Analysis All data in the study are shown in means ± SD. The unpaired Student’s t test (two-tailed) was used for two-group comparison with *p < 0.05, **p < 0.01, and ***p < 0.001 as indicative of statistically significant differences. The Graphpad Prism software was used for data analysis and visualization. Results And Discussion Synthesis and Characterization of PEI-PTX (PP) Polymers The procedure for synthesizing PP polymers is shown in Figure S1. PTX-SA was obtained by conjugating succinic acid to the 2’-OH group of PTX via ester bond, where the characterizations were showed in Figure S2-S4. Then, PP was synthesized via amide reaction. As shown in Figure S5-S6, the results of FT-IR, 1 H NMR, and GPC indicated that PP was successfully synthesized. The FT-IR peak of the amide bond appeared at V C=O 1729.35 cm − 1 and δ NH 1648.84 cm − 1 . The GPC result further confirmed the PP was successfully synthesized. Table 1 Loading efficiency of PP, PP/siRNA, PP/HA, and PP/siRNA/HA PP PP/siRNA PP/HA PP/siRNA/HA Loading PTX Efficiency (wt%) 25.15 ± 0.90 17.44 ± 0.43 7.27 ± 0.19 6.99 ± 0.15 Preparation and Characterization of PP/siRNA/HA Nanoassemblies The preparation processes of nanoassemblies were shown in Fig. 2 A. Initially, the PP copolymer dissolved in Milli-Q water can be self-assembled into micelles under sonication. Dynamic light scattering (DLS) analysis showed that the hydrodynamic diameter of PP micelles was 215.7 ± 2.4 nm (Fig. 2 F), and the transmission electron microscopy (TEM) images showed that the micelles were spherical (Fig. 2 E). As shown in Figure S7, the critical micelle concentration (CMC) of PP micelles was 6.3×10 − 3 mg/mL, indicating the excellent thermodynamic stability of micelles. To determine the optimal weight ratio (PP/siRNA) for siRNA delivery, we used agarose gel electrophoresis to evaluate the siRNA encapsulation of PP (Fig. 2 B). It was found that binding capacity increased with increasing the ratio of PP, and all of siRNA were encapsulated when the weight ratio of PP: siRNA increased to 3:1. The encapsulation efficiency of siRNA was up to 92.68 ± 0.78% at 3:1 weight ratio and maintained unchanged when further increasing ratios (Figure S8). As shown in Fig. 2 C, an increasing tendency of zeta potential was detected during the increase of weight ratios, further indicating the successful loading of siRNA. Therefore, the optimal weight ratio (PP/siRNA, w/w) of 3:1 was used for further anti-tumor study considering the encapsulation efficiency, z-average size, and zeta potential. The siRNA-loaded PP (PP/siRNA) showed a reduction of positive charge (from + 54.3 ± 1.6 mV of PP to + 47.5 ± 1.3 mV of PP/siRNA) and the slight decrease of particle size (from 215.7 ± 2.4 nm to 197.3 ± 2.6 nm), indicating the condensing of siRNA on the PP surface (Fig. 2 F). Subsequently, PP/siRNA was coated with a HA shell by electrostatic interaction. To determine the optimal ratio of HA and PP, we measured the z-average size and zeta potential of HA-coated PP/siRNA (PP/siRNA/HA) with different (HA: PP) ratios ranged from 1:2 to 3:1. The surface charge of PP/siRNA/HA emerged reversal from positive charge to negative when the weight ratio of HA: PP increased to 2:1, and the particle size was decreased during the increase of HA ratio (Fig. 2 D). Considering longer blood circulation and higher tumor targeting, we used 2:1 as optimal weight ratio of HA/PP (w/w) for further study. PP/siRNA/HA showed a gelatinous shell on surface in TEM (Fig. 2 E), a reversal of zeta potential (from + 47.5 ± 1.3 mV of PP/siRNA to − 9.0 ± 0.3 mV of PP/siRNA/HA), and the decrease of particle size (from 197.3 ± 2.6 nm of PP/siRNA to 144.4 ± 1.0 nm of PP/siRNA/HA) (Fig. 2 F), revealing the presence of HA shell. The photos of nanoassemblies PBS solutions were showed in Figure S9, there were transoarent, azure, well-distributed colloidal solutions in PBS. To confirm the drug loading contents (DLs) of PTX, different preparations were hydrolyzed, and then the content of PTX was measured by HPLC. The PP exhibited high drug loading efficiency (25.15 ± 0.90%, wt%), and the DLs of PP/siRNA, PP/HA, and PP/siRNA/HA were 17.44 ± 0.43%, 7.27 ± 0.19% and 6.99 ± 0.15%, respectively (Table 1 ). The PTX release under the simulation conditions of body fluid (pH7.4), lysosome (pH5.0) and lysosome with enzyme (pH5.0 with hyaluronidase) was investigated. As shown in Figure S11, under conditions of pH5.0 and pH7.4, there were almost no release of PTX due to the protection of the HA shell. Under condition with hyaluronidase (1%, w/w), the drug release rate was faster and higher. These results demonstrated that the PP/siRNA/HA could achieve longer blood circulation and release drug from nanoassemblies within intracellular. Stability in Vitro The stability of nanoparticle system is vital for its application in vivo [ 37 ]. Both PP/siRNA and PP/siRNA/HA in 50% FBS showed no free siRNA band upon gel electrophoresis (Fig. 2 H). This result demonstrated that the HA shell contributed to the stable encapsulation of siRNA. To test whether the HA shell protects siRNA from anionic environment in physiological fluids and enzymatic challenge in FBS, PP/siRNA and PP/siRNA/HA were subjected to 50% FBS. PP and PP/siRNA/HA remained stable for 24 h and showed no signs of degradation due to the presence of serum nucleases, whereas naked siRNA was completely degraded in 12 h (Figure S10A). Consistently, the PP/siRNA/HA showed stronger heparin resistance ability than samples without HA-coated (Figure S10B), further supporting the protective effect of the HA shell. Solubilizers, particularly cationic polymerization, usually cause severe hemolytic reaction when injected into blood vessel. Thus, we conducted a hemolysis test to evaluate the safety of the PP and PP/HA. The PP cause severe hemolysis as we expected, but the PP/HA did not cause hemolysis at a high concentration and there was no significant difference when compared to the saline group (Fig. 2 G), which demonstrated the HA shell not only improved the safe and biocompatibility of nanoparticles, but also enhanced its stability. Thus, HA-coated PP could be used for intravenous injection. Considering the severe hemolysis and unsafety of PP without HA-coated, we used the PP/HA or PP/siRNA/HA as main preparations for further anti-tumor study in vivo . Cell Uptake and Endocytosis study Efficient cellular uptake is vital for gene transfection [ 36 ]. The confocal laser scanning microscope (CLSM) images of the FAM-siRNA in A549 and A549/T cells for 1 h and 4 h were shown in Fig. 3 A. Naked FAM-siRNA, in either A549 cells or A549/T cells, exhibited weak fluorescence intensity at 1 h and 4 h since nucleic acid can hardly pass through cell membrane[ 38 ]. However, the green fluorescence was obviously brighter after incubated with PP/siRNA/HA for 4 h, indicating PP/siRNA/HA could be taken up by both A549 cells and A549/T cells. Meanwhile, as incubation time was prolonged, the green fluorescence signals became stronger, indicating that more nanoassemblies were internalized into cells. This phenomenon was also verified by quantitative evaluation by flow cytometry (Fig. 3 B, C). The results confirmed that the PP/siRNA/HA could promote the uptake of siRNA compared to naked siRNA. Endo/lysosomal escape capacity, avoiding the acid hydrolysis of gene, of FAM-siRNA loaded PP/siRNA/HA was evaluated by CLSM in either A549 or A549/T cells. As shown in Figure S12, we could observe that the FAM-siRNA loaded nanoparticles were mainly entrapped in endo/lysosomal compartments at 1h after uptake, while most FAM-siRNA could successfully escape into the cytoplasm at 4 h. Therefore, the PP/siRNA/HA can exhibit excellent cellular internalization and endo/lysosomal escape ability, and could be used in gene and protein drug delivery. The internalization of PP/siRNA/HA nanocomplexes was investigated by A549/T cells following treatment with caveolin-mediated endocytosis inhibitors (nystatin), clathrin-mediated endocytosis inhibitors (chlorpromazine), macropinocytosis inhibitors (amiloride), and energy inhibition (4°C), respectively [ 39 ]. As displayed in Fig. 3 D, the endocytosis of nanocomplexes was significantly inhibited under microtherm condition (4°C), demonstrating the energy-dependent endocytosis mechanisms. The results in Fig. 3 D revealed that nanoparticle uptake was significantly inhibited by chlorpromazine and amiloride treatment, suggesting that clathrin-mediated endocytosis and macropinocytosis may both play a role in the uptake of PP/siRNA/HA. Meanwhile, there is an additional group of overdose HA blocking CD44-receptor to investigate the uptake of PP/siRNA/HA, indicating that the endocytosis would be CD44-mediated endocytosis pathway. Hyaluronic acid, as we all know, can enhance the internalization of nanocomplexes through binding CD44 receptor [ 40 ]. The CD44 expression of A549 cells, A549/T cells, and HepG2 cells (as CD44-negative cells) were detected by Western blotting (Fig. 3 F). This result demonstrates that the CD44 expression of A549/T cells was significantly higher than A549 cells and HepG2 cells. To evaluate the CD44-mediated internalization, we investigated the uptake of PP/siRNA/HA by flow cytometry (Fig. 3 G). The fluorescence intensity in A549/T cells was statistically higher than A549 and CD44-negative HepG2, suggesting the high potential targeting ability of HA-coated nanocomplexes. Silences Gene Expression in Vitro Comparing to that on A549 cells, the P-gp on the membrane of A549/T cells was significant over-expressed (Fig. 4 A). 25 K b-PEI, as we all know, was always used as positive control on account of its excellent transfection efficiency [ 41 ]. After treated with PP/siRNA and PP/siRNA/HA, the amount of P-gp on A549/T cells was significantly reduced. The silence efficiency was confirmed by quantitative PCR (q-PCR) analysis of transfected A549/T cells, the expressions of mdr1 were reduced to 36% and 16% (Fig. 4 A and B). There is no significant difference in gene silencing between PP/siRNA/HA and 25K PEI. However, it was found that both PP and PP/HA, without siRNA-loading, showed the suppression to mdr1 gene and decreased mdr1 expression to 49% and 30%, respectively. Some previous studies showed that autophagy had an important role in the development of multi-drug resistance [ 42 ]. Furthermore, some compounds like chloroquine or cationic polymers could block normal autophagy flux by alkalizing lysosomes [ 43 ]. Thus, we initially guessed that the gene suppression may be caused by autophagy modulation. In addition, it could be explained for the instability of PP/siRNA without HA-coated that the silence efficiency was lower than PP/HA and PP/siRNA/HA. Cytotoxicity and MDR-Reversing of Nanoparticles The cytotoxicity levels of different PTX formulations on A549 and A549/T cells were determined by MTT assay [ 44 ]. A549/T cells was selected to study MDR-reversing because it could overexpress P-gp, as mentioned above, and exhibited resistance to PTX. As shown in Fig. 4 C, all different PTX formulations could reduce the viability of A549 and A549/T cells and exhibit concentration-dependent cytotoxic effects. The results showed both PTX formulations unfolded excellent anticancer effects on A549 cells (Fig. 4 D). The inhibition ratios against A549/T cells were evidently lower than that on A549 because of the drug-resistance of A549/T cells (Fig. 4 E). More important, PP/siRNA/HA could more effectively enhance the inhibition ratio of A549/T cells than other PTX formulations. Notably, the excellent anticancer effect of PP/siRNA/HA may suggest gene silencing the cytotoxicity levels of different formulations on A549/T cells having relationship with the suppression of P-gp. Although PP could decrease the expression of P-gp, the inhibition ratio of it was lower than free PTX, which may be interpreted as the nanostructure disturbed by rich serum environment [ 36 ]. The half maximal inhibitory concentration (IC 50 ), lower IC 50 representing higher cytotoxicity, were further used to verify the cytotoxicity of the different formulations against cancer cells. Meanwhile, the IC 50 value is one of the most important indexes about drug resistance of cancer cells [ 9 ]. The IC 50 values of different PTX formulations against A549 and A549/T cells were listed in Table 2 . The IC 50 of free PTX on A549/T cells (5.5 ± 0.5 ng/mL) was 16.5-fold over that on A549 cells (90.6 ± 14.0 ng/mL), indicating the A549/T cells had acquired a great drug-resistance. The IC 50 values to A549 cells were similar and slightly higher than that of free PTX, respectively. This was because active ingredient (PTX) needed released from preparations [ 37 ]. The IC 50 of PP, PP/siRNA, PP/HA, and PP/siRNA/HA against A549/T cells were 35.5 ± 14.6 ng/mL, 77.5 ± 10.4 ng/mL, 28.4 ± 18.1 ng/mL, and 14.0 ± 4.4 ng/mL, respectively. PP/siRNA/HA exhibited better cytotoxicity and reversal of drug resistance on A549/T cells than other formulations. Table 2 IC 50 values of free PTX, PP, PP/siRNA, PP/HA, and PP/siRNA/HA against A549 and A549/T cells for 48 h IC50(ng/mL) A549 A549/T PTX 5.5 ± 0.47 90.6 ± 14.00 PP 5.4 ± 0.79 35.5 ± 14.56 PP/siRNA 9.9 ± 1.67 77.5 ± 10.43 PP/HA 7.3 ± 0.83 28.4 ± 18.11 PP/siRNA/HA 7.6 ± 1.69 14.0 ± 4.35 Cell Apoptosis and Cell Cycle To further confirm the therapeutic effect of different PTX formulations on A549 and A549/T cells, the cell apoptosis by Annexin V-FITC/PI staining was performed at the same concentrations of 10 ng/mL PTX. As displayed in the results in Figure S13A, both PTX formulations significantly induced late apoptosis against A549 cells. However, for A549/T cells, free PTX could not induce significant apoptosis (Figure S13B). PP/siRNA/HA induced the highest apoptosis rate (87.9%) against A549/T cells compared with the control (6.7%), and PP/HA could induce similar apoptosis rate (85.4%). Notably, PTX formulations mainly induced early apoptosis against A549 cells but, to A549/T cells, mainly late apoptosis. This may result from the higher tolerance of A549/T cells. As shown in Figure S14A and B, PTX could tend to arrest A549 cells in G2/M phase. However, the cell cycle of A549/T cells was not significantly different between PTX and controls, further indicating the drug resistance of A549/T cells. PP/siRNA/HA could reduce G0/G1 phase (from 65.7–34.7%) and tend to arrest in S phase and G2/M phase (Figure S14C). These results confirmed the ability of PP/siRNA/HA to reverse drug resistance. Autophagy Modulation Study The gene silences experiments showed that both PP and PP/HA, without siRNA-loading, could suppress mdr1 gene expression (Fig. 4 A and B). To better understand the reason that PP and PP/HA decreased mdr1 expression, the LC3/P62 expressions and numbers of autophag/autolysosomes were used to evaluating their autophagy-modulated effects. The symbol of autophagy flux initiation is the conversion of LC3B-I into LC3B-II, LC3B-I is free in cytoplasm but LC3B-II is directly binding to autophagosomes membranes [ 45 ]. Meanwhile, the level of p62, as a degradation substrate of autophagy, can reflect the autophagy flux [ 46 ]. As illustrated in Fig. 4 F-H, after treatment by same gene silences experiments, there were significant accumulate of LC3-II and p62 compared to control group. Subsequently, the GFP-LC3 puncta were observed to dramatic increases under CLSM (Fig. 4 I-J). Our previous research shows that the abilities of lysosomal acidity and blocking autophagic flux would reflect in the decreased activity of acid phosphatase (ACP) [ 47 ]. As shown in Fig. 4 k, both nanocomplexes could decrease the ACP activity. These results suggested that nanocomplexes (PP, PP/siRNA, PP/HA, and PP/siRNA/HA) could induce autophagosome accumulation and block autophagic flux. Furthermore, we preliminarily considered that PP was the main component to modulating autophagic flux. To further verify the autophagy modulation of PP, the markers of autophagy were assessed by western blotting and CMSL. CQ, as a common autophagy inhibitor, can block the fusion of autophagosomes via alkalizing lysosomes [ 48 ]. In our study, CQ (10 µM) would be acted as positive control of autophagy inhibition. After treated with PP for 24h, LC3-II/LC3-I ratio showed increased and caused the accumulation of p62 (Fig. 5 A-C). As showed in Fig. 5 d and e, the GFP-LC3 dots per cell were increased from 7.4 to 28.5 as the concentration increase from 0.1 to 50 µM PP. The relative fluorescence intensities of p62 also were increased from 1.1 to 2.9 (Fig. 5 F). The results of relative ACP activity confirmed that PP could alkaline lysosome and block degradation of autophagic substrates (Fig. 5 G). TEM is an important method to observe the ultrastructural features of autophagosomes [ 49 ]. Bio-TEM images showed that upon comparisons with the control, many small double/multi-membrane vesicles and huge vacuoles were observed after treatment of 100 µM PP or PP/siRNA/HA for 24 h (Fig. 5 H). These results demonstrated that high dose of PP could blocked autophagic flux via alkalizing lysosomes. In Vivo Biodistribution The bio-distribution of Cy5-siRNA loaded nanoassemblies was assessed by in vivo fluorescence imaging system after the tail vein injection of PP/Cy5-siRNA/HA in mice [ 50 ]. As shown in Fig. 6 A-C, the fluorescence of naked Cy5-siRNA intensely distributed in the kidneys, but the PP/Cy5-siRNA/HA groups showed fluorescence mainly distributed in the liver, tumor, and kidneys. This could be explained by that Cy5-siRNA in solution could be excreted by the kidneys but the nanoassemblies (~ 200 nm) could be enriched in liver [ 51 ]. In addition, the fluorescence signals arising from the tumors of mice treated with PP/Cy5-siRNA/HA was 1.9-fold higher than that treated with naked Cy5-siRNA (Fig. 6 D). This suggests that HA-coated nanoassemblies can not only prolong blood circulation time but also enrich at the level of tumor tissue. In Vivo Anti-tumor Effect and RNAi Efficiency The antitumor effect was further evaluated in A549/T tumor-bearing nude mice. As illustrated in Fig. 7 A, there was no significant difference between 0.9% NaCl group and Taxol group. In comparison, PP/siRNA/HA exhibited a superior antitumor efficiency with the tumor growth inhibition rates of 36.43% (Fig. 7 C-E). Compared with the 0.9% NaCl and paclitaxel groups, the PP/HA group had enhanced therapeutic effects, but was still insufficient to suppress drug-resistant tumors. The tumor tissue treated with PP/siRNA/HA exhibited a more obviously decline in P-gp protein expression (Fig. 7 G) and mdr1 gene expression (Fig. 7 J) compared with other groups. The TUNEL results showed that the PP/siRNA/HA effectively induced more apoptosis in the tumor compared with Taxol and PP/HA (Fig. 8 ). The cellular proliferation of tumor was assessed by Ki67 assay (Fig. 8 ). Compared with the other groups, the PP/siRNA/HA group had the least cellular proliferation and was found to have the best antitumor efficacy. The result of immunofluorescence staining further confirmed the gene silence efficiency of PP/siRNA/HA with greatly reduced P-gp expression (Fig. 8 ). This demonstrated the PP/siRNA/HA nanocomplexes could successfully reverse the drug-resistance of tumors, and realized tumor inhibition by gene/ drug co-delivery. The weights of all groups keep basically untouched throughout the treatment (Fig. 7 B). There was no significant physiological morphology abnormality in heart, liver, spleen, lung, and kidney, confirming the safety for these samples (Figure S15). In Vivo Autophagy Modulation To further confirm the autophagy blockade effect of nanocomplexes, the expression of autophagy-associated proteins (LC3 and p62) in tumor were monitored at the end of the treatments. The LC3B-I/II and p62 proteins expression in tumor tissue were evaluated by western bolting and immunofluorescence staining. As showed in Fig. 7 F-I, the LC3B-I/II and p62 proteins expression of PP/HA and PP/siRNA/HA were higher than 0.9% NaCl and Taxol. Moreover, there are no significant different between PP/HA and PP/siRNA/HA in the protein expressions of LC3B-I/II and p62. The results of immunofluorescence staining further confirmed the efficiency of blocking autophagic flux (Fig. 8 ). Conclusion We have successfully developed PP/siRNA/HA, a gene/drug co-delivery system, for combating MDR to improve clinical chemotherapy. PP is synthesized to load PTX and condense siRNA as the core of nanoassemblies, followed by coating the HA shell. This nanoassemblies can simultaneously load siRNA and PTX, which could down-regulate P-gp and efficaciously inhibit tumor growth. Furthermore, the nanoassemblies exhibited good biocompatibility with targeting lung tumor and long blood circulation time. Unlike other gene/drug delivery systems, the PP/siRNA/HA can induce autophagosome accumulation and blocks autophagic flux, which show potentials in overcoming nonpump resistance. The work provides a simple and effective strategy to combating both pump and nonpump resisitance via suppressing the drug efflux pumps and blocking autophagtic flow. These results support that PP/siRNA/HA could overcome overall MDR to improve chemotherapy in vivo . Declarations Acknowledgment The authors thank the Qingdao Science and Technology Demonstration and Guidance Project (21-1-4-rkjk-10-nsh). Authors’ contributions Changduo Wang and Shangcong Han conducted the preparation and characterization. Changduo Wang and Zhipeng Li performed the anti-cancer measurements and data analysis both in vitro and in vivo. Changduo Wang, Zhipeng Li and Ping Xu performed the biodistribution analysis. Changduo Wang and Lisa Xu wrote the manuscript. Yong Sun conceived the idea of nanoassemblies, guided the conduct of studies, supervised data analysis, and authored the manuscript. All authors read and approved the final manuscript. Availability of data and materials All supporting data for this study are included in this published article and its additional information files. Ethics approval and consent to participate All the experimental animals were approved by the Qingdao University Laboratory Animal Wefare Ethic Committee (No.20211008BALB/cN3020211129060). All animal experiments complied with the regulations of the Animal Experiments Ethic Committee for the care and use of research animals in Qingdao University. All authors agree to publish this manuscript. Competing Interests The authors report no conflicts of interest in this work. Author details Changduo Wang, Zhipeng Li, Shangcong Han and Yong Sun, Department of Pharmaceutics, School of Pharmacy, Qingdao University, Qingdao 266071, China. Ping Xu, Department of Thoracic Surgery, the Second Affiliated Hospital of Qingdao University, Qingdao 266000, China. Lisa Xu, School of Public Health, Qingdao University, Qingdao 266071, China. References Lin YX, Wang Y, Wang H: Recent Advances in Nanotechnology for Autophagy Detection. Small 2017, 13: 1700996. Minko T, Rodriguez-Rodriguez L, Pozharov V: Nanotechnology approaches for personalized treatment of multidrug resistant cancers. Adv Drug Deliv Rev 2013, 65: 1880-1895. Wang T, Luo Y, Lv H, Wang J, Zhang Y, Pei R: Aptamer-Based Erythrocyte-Derived Mimic Vesicles Loaded with siRNA and Doxorubicin for the Targeted Treatment of Multidrug-Resistant Tumors. ACS Appl Mater Interfaces 2019, 11: 45455-45466. Shen J, Wang Q, Hu Q, Li Y, Tang G, Chu PK: Restoration of chemosensitivity by multifunctional micelles mediated by P-gp siRNA to reverse MDR. Biomaterials 2014, 35: 8621-8634. Zhang R, Gao S, Wang Z, Han D, Liu L, Ma Q, Tan W, Tian J, Chen X: Multifunctional Molecular Beacon Micelles for Intracellular mRNA Imaging and Synergistic Therapy in Multidrug-Resistant Cancer Cells. Adv Funct Mater 2017, 27 . Zheng W, Cao C, Liu Y, Yu Q, Zheng C, Sun D, Ren X, Liu J: Multifunctional polyamidoamine-modified selenium nanoparticles dual-delivering siRNA and cisplatin to A549/DDP cells for reversal multidrug resistance. Acta Biomater 2015, 11: 368-380. Liu M, Fu M, Yang X, Jia G, Shi X, Ji J, Liu X, Zhai G: Paclitaxel and quercetin co-loaded functional mesoporous silica nanoparticles overcoming multidrug resistance in breast cancer. Colloids Surf B Biointerfaces 2020, 196: 111284. Wang Y, Wang F, Liu Y, Xu S, Shen Y, Feng N, Guo S: Glutathione detonated and pH responsive nano-clusters of Au nanorods with a high dose of DOX for treatment of multidrug resistant cancer. Acta Biomater 2018, 75: 334-345. Yin Q, Shen J, Chen L, Zhang Z, Gu W, Li Y: Overcoming multidrug resistance by co-delivery of Mdr-1 and survivin-targeting RNA with reduction-responsible cationic poly(β-amino esters). Biomaterials 2012, 33: 6495-6506. Zhu KY, Palli SR: Mechanisms, Applications, and Challenges of Insect RNA Interference. Annu Rev Entomol 2020, 65: 293-311. Yan J, Zhan X, Zhang Z, Chen K, Wang M, Sun Y, He B, Liang Y: Tetrahedral DNA nanostructures for effective treatment of cancer: advances and prospects. J Nanobiotechnology 2021, 19: 412. He W, Guo Z, Wen Y, Wang Q, Xie B, Zhu S, Wang Q: Alginate-graft-PEI as a gene delivery vector with high efficiency and low cytotoxicity. J Biomater Sci Polym Ed 2012, 23: 315-331. Lee J, Sands I, Zhang W, Zhou L, Chen Y: DNA-inspired nanomaterials for enhanced endosomal escape. Proc Natl Acad Sci U S A 2021, 118 . Hashemzadeh I, Hasanzadeh A, Radmanesh F, Khodadadi Chegeni B, Hosseini ES, Kiani J, Shahbazi A, Naseri M, Fatahi Y, Nourizadeh H, et al: Polyethylenimine-Functionalized Carbon Dots for Delivery of CRISPR/Cas9 Complexes. ACS Appl Bio Mater 2021, 4: 7979-7992. Yan J, Chen J, Zhang N, Yang Y, Zhu W, Li L, He B: Mitochondria-targeted tetrahedral DNA nanostructures for doxorubicin delivery and enhancement of apoptosis. J Mater Chem B 2020, 8: 492-503. Chen W, Shi K, Chu B, Wei X, Qian Z: Mitochondrial Surface Engineering for Multidrug Resistance Reversal. Nano Lett 2019, 19: 2905-2913. Liang B, Liu X, Liu Y, Kong D, Liu X, Zhong R, Ma S: Inhibition of autophagy sensitizes MDR-phenotype ovarian cancer SKVCR cells to chemotherapy. Biomed Pharmacother 2016, 82: 98-105. Guo JY, Xia B, White E: Autophagy-mediated tumor promotion. Cell 2013, 155: 1216-1219. Zhang Y, Zhang L, Gao J, Wen L: Pro-Death or Pro-Survival: Contrasting Paradigms on Nanomaterial-Induced Autophagy and Exploitations for Cancer Therapy. Acc Chem Res 2019, 52: 3164-3176. Lin J, Huang Z, Wu H, Zhou W, Jin P, Wei P, Zhang Y, Zheng F, Zhang J, Xu J, et al: Inhibition of autophagy enhances the anticancer activity of silver nanoparticles. Autophagy 2014, 10: 2006-2020. Sun WL, Lan D, Gan TQ, Cai ZW: Autophagy facilitates multidrug resistance development through inhibition of apoptosis in breast cancer cells. Neoplasma 2015, 62: 199-208. Mauthe M, Orhon I, Rocchi C, Zhou X, Luhr M, Hijlkema KJ, Coppes RP, Engedal N, Mari M, Reggiori F: Chloroquine inhibits autophagic flux by decreasing autophagosome-lysosome fusion. Autophagy 2018, 14: 1435-1455. Chen X, Tao Y, He M, Deng M, Guo R, Sheng Q, Wang X, Ren K, Li T, He X, et al: Co-delivery of autophagy inhibitor and gemcitabine using a pH-activatable core-shell nanobomb inhibits pancreatic cancer progression and metastasis. Theranostics 2021, 11: 8692-8705. Zhao L, Yang G, Shi Y, Su C, Chang J: Co-delivery of Gefitinib and chloroquine by chitosan nanoparticles for overcoming the drug acquired resistance. J Nanobiotechnology 2015, 13: 57. Gao M, Xu Y, Qiu L: Enhanced combination therapy effect on paclitaxel-resistant carcinoma by chloroquine co-delivery via liposomes. Int J Nanomedicine 2015, 10: 6615-6632. Panagiotaki KN, Sideratou Z, Vlahopoulos SA, Paravatou-Petsotas M, Zachariadis M, Khoury N, Zoumpourlis V, Tsiourvas D: A Triphenylphosphonium-Functionalized Mitochondriotropic Nanocarrier for Efficient Co-Delivery of Doxorubicin and Chloroquine and Enhanced Antineoplastic Activity. Pharmaceuticals (Basel) 2017, 10 . Yusuf IH, Sharma S, Luqmani R, Downes SM: Hydroxychloroquine retinopathy. Eye (Lond) 2017, 31: 828-845. Stokkermans TJ, Goyal A, Bansal P, Trichonas G: Chloroquine And Hydroxychloroquine Toxicity. In StatPearls. Treasure Island (FL): Archives of Ophthalmology; 2022 Marmor MF, Kellner U, Lai TY, Melles RB, Mieler WF: Recommendations on Screening for Chloroquine and Hydroxychloroquine Retinopathy (2016 Revision). Ophthalmology 2016, 123: 1386-1394. Panzarini E, Dini L: Nanomaterial-induced autophagy: a new reversal MDR tool in cancer therapy? Mol Pharm 2014, 11: 2527-2538. Ma X, Wu Y, Jin S, Tian Y, Zhang X, Zhao Y, Yu L, Liang XJ: Gold nanoparticles induce autophagosome accumulation through size-dependent nanoparticle uptake and lysosome impairment. ACS Nano 2011, 5: 8629-8639. Lin YX, Wang Y, Qiao SL, An HW, Zhang RX, Qiao ZY, Rajapaksha RP, Wang L, Wang H: pH-Sensitive Polymeric Nanoparticles Modulate Autophagic Effect via Lysosome Impairment. Small 2016, 12: 2921-2931. Li N, Han S, Ma B, Huang X, Xu L, Cao J, Sun Y: Chemosensitivity enhanced by autophagy inhibition based on a polycationic nano-drug carrier. Nanoscale Advances 2021, 3: 1656-1673. Jia N, Ma J, Gao Y, Hu H, Chen D, Zhao X, Yuan Y, Qiao M: HA-Modified R8-Based Bola-Amphiphile Nanocomplexes for Effective Improvement of siRNA Delivery Efficiency. ACS Biomater Sci Eng 2020, 6: 2084-2093. Yan J, Zhang Z, Zhan X, Chen K, Pu Y, Liang Y, He B: In situ injection of dual-delivery PEG based MMP-2 sensitive hydrogels for enhanced tumor penetration and chemo-immune combination therapy. Nanoscale 2021, 13: 9577-9589. Liu H, Liu C, Ye L, Ma D, He X, Tang Q, Zhao X, Zou H, Chen X, Liu P: Nanoassemblies with Effective Serum Tolerance Capability Achieving Robust Gene Silencing Efficacy for Breast Cancer Gene Therapy. Adv Mater 2021, 33: e2003523. Zhao D, Zhang H, Yang S, He W, Luan Y: Redox-sensitive mPEG-SS-PTX/TPGS mixed micelles: An efficient drug delivery system for overcoming multidrug resistance. Int J Pharm 2016, 515: 281-292. Zou M, Du Y, Liu R, Zheng Z, Xu J: Nanocarrier-delivered small interfering RNA for chemoresistant ovarian cancer therapy. Wiley Interdiscip Rev RNA 2021, 12: e1648. Musalli AH, Talukdar PD, Roy P, Kumar P, Wong TW: Folate-induced nanostructural changes of oligochitosan nanoparticles and their fate of cellular internalization by melanoma. Carbohydr Polym 2020, 244: 116488. Maiolino S, Moret F, Conte C, Fraix A, Tirino P, Ungaro F, Sortino S, Reddi E, Quaglia F: Hyaluronan-decorated polymer nanoparticles targeting the CD44 receptor for the combined photo/chemo-therapy of cancer. Nanoscale 2015, 7: 5643-5653. Zhou Z, Zhang Q, Zhang M, Li H, Chen G, Qian C, Oupicky D, Sun M: ATP-activated decrosslinking and charge-reversal vectors for siRNA delivery and cancer therapy. Theranostics 2018, 8: 4604-4619. Wang B, Feng D, Han L, Fan J, Zhang X, Wang X, Ye L, Shi X, Feng M: Combination of apolipoprotein A1-modi liposome-doxorubicin with autophagy inhibitors overcame drug resistance in vitro. J Pharm Sci 2014, 103: 3994-4004. Shi C, Zhang Z, Shi J, Wang F, Luan Y: Co-delivery of docetaxel and chloroquine via PEO-PPO-PCL/TPGS micelles for overcoming multidrug resistance. Int J Pharm 2015, 495: 932-939. Li Z, Wang F, Li Y, Wang X, Lu Q, Wang D, Qi C, Li C, Li Z, Lian B, et al: Combined anti-hepatocellular carcinoma therapy inhibit drug-resistance and metastasis via targeting "substance P-hepatic stellate cells-hepatocellular carcinoma" axis. Biomaterials 2021, 276: 121003. Kaizuka T, Morishita H, Hama Y, Tsukamoto S, Matsui T, Toyota Y, Kodama A, Ishihara T, Mizushima T, Mizushima N: An Autophagic Flux Probe that Releases an Internal Control. Mol Cell 2016, 64: 835-849. Rathore B, Sunwoo K, Jangili P, Kim J, Kim JH, Huang M, Xiong J, Sharma A, Yang Z, Qu J, Kim JS: Nanomaterial designing strategies related to cell lysosome and their biomedical applications: A review. Biomaterials 2019, 211: 25-47. Feng A, Gao L, Yue P, Liu Y, Zhou Q, Ren Z, Teng J: Autophagy-lysosome dysfunction is involved in gastric ischemia-reperfusion injury by promoting microglial activation in the paraventricular nucleus. J Biochem Mol Toxicol 2021 : e22957. Chen X, Yu Q, Liu Y, Sheng Q, Shi K, Wang Y, Li M, Zhang Z, He Q: Synergistic cytotoxicity and co-autophagy inhibition in pancreatic tumor cells and cancer-associated fibroblasts by dual functional peptide-modified liposomes. Acta Biomater 2019, 99: 339-349. Lin YX, Wang Y, Wang H: Recent Advances in Nanotechnology for Autophagy Detection. Small 2017, 13 . Yhee JY, Song S, Lee SJ, Park SG, Kim KS, Kim MG, Son S, Koo H, Kwon IC, Jeong JH, et al: Cancer-targeted MDR-1 siRNA delivery using self-cross-linked glycol chitosan nanoparticles to overcome drug resistance. J Control Release 2015, 198: 1-9. Wang H, Zhang F, Wen H, Shi W, Huang Q, Huang Y, Xie J, Li P, Chen J, Qin L, Zhou Y: Tumor- and mitochondria-targeted nanoparticles eradicate drug resistant lung cancer through mitochondrial pathway of apoptosis. J Nanobiotechnology 2020, 18: 8. Additional Declarations No competing interests reported. Supplementary Files Supplementaryfile.doc Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Major revision 18 Apr, 2022 Reviews received at journal 12 Apr, 2022 Reviewers agreed at journal 04 Apr, 2022 Reviewers invited by journal 04 Apr, 2022 Submission checks completed at journal 04 Apr, 2022 Editor assigned by journal 04 Apr, 2022 First submitted to journal 27 Mar, 2022 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-1495473","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":95816770,"identity":"7cc62563-7d65-4831-ad99-80c8bb7dfce1","order_by":0,"name":"Yong Sun","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAzElEQVRIiWNgGAWjYBADOQaGBCDFRoIWY9K1JDYQrUV+Ru4xiY87atP7jucYMHwoO8zAP7sBvxaDG3lpkjPPHM+deeaNAeOMc4cZJO4cIKBFIsdMmrftWO6GGzkGzLxth4EiCYQcBtGSbgDS8pcYLQw3wFpqEsBaGInRYnDmjbHlzLYDhjPPPCs42HMunUfiBiGHtecY3vjYVifPdzx544MfZdZy/DMIOYyBgUWCgeEwA8MBMGLgIageCJg/MDDUQdSPglEwCkbBKMAGAHw8RdqpYHU2AAAAAElFTkSuQmCC","orcid":"","institution":"Qingdao University","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Yong","middleName":"","lastName":"Sun","suffix":""},{"id":95816763,"identity":"1890995b-b3ea-4b78-a918-5d3a8c74279c","order_by":1,"name":"Changduo Wang","email":"","orcid":"","institution":"Qingdao University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Changduo","middleName":"","lastName":"Wang","suffix":""},{"id":95816764,"identity":"2506caec-9a2b-4689-8307-d260f46f5573","order_by":2,"name":"Zhipeng Li","email":"","orcid":"","institution":"Qingdao University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Zhipeng","middleName":"","lastName":"Li","suffix":""},{"id":95816766,"identity":"189a7582-d50f-4a4e-810a-7f858d45f171","order_by":3,"name":"Ping Xu","email":"","orcid":"","institution":"the Second Affiliated Hospital of Qingdao University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Ping","middleName":"","lastName":"Xu","suffix":""},{"id":95816768,"identity":"d8da192c-9d50-4170-8810-ea9e5ef8741f","order_by":4,"name":"Lisa Xu","email":"","orcid":"","institution":"Qingdao University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Lisa","middleName":"","lastName":"Xu","suffix":""},{"id":95816769,"identity":"044c742c-f579-4fc5-88c6-ca4dbed41536","order_by":5,"name":"Shangcong Han","email":"","orcid":"","institution":"Qingdao University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Shangcong","middleName":"","lastName":"Han","suffix":""}],"badges":[],"createdAt":"2022-03-28 02:14:15","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-1495473/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-1495473/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":20027373,"identity":"0aa929f7-7ae0-41ee-a8e6-b33a720f463c","added_by":"auto","created_at":"2022-04-06 15:50:59","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":2542349,"visible":true,"origin":"","legend":"\u003cp\u003eSchematic illustration displayed the strategy of siRNA/PTX co-delivery and the autophagic effects of nanoassemblies.\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-1495473/v1/28d01f1858cc04dd531d6d14.png"},{"id":20027376,"identity":"a345697d-a643-4027-b249-23d6bf413834","added_by":"auto","created_at":"2022-04-06 15:50:59","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":3423173,"visible":true,"origin":"","legend":"\u003cp\u003ePreparation, characterization, and stabilities of the nanoassemblies. (A) Schematic of PP/siRNA/HA nanoassemblies. PP: PEI-PTX conjugates; PP/siRNA: PP with siRNA condensed on the surface; PP/siRNA/HA; PP/siRNA covered with HA. (B) Gel electrophoresis of PP/siRNA at various wiegh ratios (C) The ζ-potenial and z-average of PP/siRNA at different ratio of PP and siRNA (D) The ζ-potenial and z-average of PP/siRNA/HA at different ratio of PP/siRNA and HA. (E) TEM images of PP, PP/siRNA, and PP/siRNA/HA; visualized by negative staining with 1% phosphotungstic acid. (F) Size distributiion of PP, PP/siRNA, and PP/siRNA/HA. (G) Hemolytic toxicity study of PP and PP/HA. (H) The stabilities of PP/siRNA and PP/siRNA/HA after incubated in 50% FBS. The data are presented as means ± SD\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-1495473/v1/e39a5e7fb5d05a402d0dc05f.png"},{"id":20028289,"identity":"ca0f1d5a-2e83-46fc-8a4a-6e1c1d60ea27","added_by":"auto","created_at":"2022-04-06 16:00:59","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":4431628,"visible":true,"origin":"","legend":"\u003cp\u003eInternalization of nanoassemblies. (A) CLSM imgages of A549 cells and A549/T cells incubated with naked FAM-siRNA or PP/FAM-siRNA/HA nanoassemblies for 1 h and 4 h. Cell nuclei were stained with DAPI. Scale bars: 50 μm (B) Flow cytometry analysis of internalization in A549 cells after treated with naked FAM-siRNA or PP/FAM-siRNA/HA for 1h and 4 h. (C) Flow cytometry analysis of internalization in A549/T cells (D) Endocytosis study of PP/siRNA/HA in A549/T cells by Flow cytometry (E) Left: Western blot of P-gp expression in HepG2 cells, A549 cells, and A549/T cells. Right: Quantitive presentation of Western blotting. (F) Flow cytometry analysis of uptake in HepG2 cells, A549 cells, and A549/T cells after treated with PP/FAM-siRNA/HA for 4h. The data are presented as means ± SD.*p \u0026lt; 0.05, **p \u0026lt; 0.01, and ***p \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-1495473/v1/1fb3e838cbc81d72b3f622c4.png"},{"id":20027377,"identity":"a2d053fb-b7d7-4f5a-971e-ca7725bb6df8","added_by":"auto","created_at":"2022-04-06 15:50:59","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":3268936,"visible":true,"origin":"","legend":"\u003cp\u003eReversing MDR of nanoassemblies (A) Western blot of P-gp expression in A549/T cells after treated with PP, PP/siRNA, PP/HA, PP/siRNA/HA, and 25K PEI/siRNA (B) Relative quantification of mdr1-gene expression by q-PCR analysis. (C) Cytotoxicities of PTX in A549 and A549/T cells.\u0026nbsp;Cell viability treated with various concentrations of PTX and nanoassemblies. (D) A549 cells, (E) A549/T cells. (F) Wertern blot of LC3 and p62 expression in A549/T cells after treated with nanoassemblies for 48 h. (G) (H) Quantitative presentation of Western blotting. (I) CLSM images of GFP-LC3 positive dots in A549T/GFP-LC3 treated with nanoassemblies for 48 h. Scale bars: 20 μm (J) Quantified result of GFP-LC3 positive puncta. (K) The acid phosphatase activity in A549/T cells by nanoassemblies for 48 h. The data are presented as means ± SD. *p \u0026lt; 0.05, **p \u0026lt; 0.01, and ***p \u0026lt; 0.001\u003c/p\u003e\u003cp\u003e\t\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-1495473/v1/062dce0d2d3139cdf54c2294.png"},{"id":20027378,"identity":"710f5761-284f-4dee-99f7-ad58cd0a1aea","added_by":"auto","created_at":"2022-04-06 15:50:59","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":9390943,"visible":true,"origin":"","legend":"\u003cp\u003eAutophagy modulation of nanoassemblies (A) Western blot of LC3 and p62 expression after incubated with various concentrations of PP (0-50 μM), 10 μM CQ as positive control. (B)(C) Quantitative presentation of Western blotting. (D) CLSM images of GFP-LC3 positve dots (green) and p62 immunofluorescence staining (red) in A549T/GFP-LC3 incubated with various concentrations of PP. Cell nucleus were stained by DAPI. Scale bars: 20 μm (E) Quantified result of GFP-LC3 positive puncta. (F) The quantitative fluorescence intensity of p62. (G) The acid phosphatase activity after treatment of PP. (H) Bio-TEM images of A549/T cells after incubated with PP (50 μM) and PP/siRNA/HA (50 μM) for 24 h. The arrows indicate the autophagosomes. The data are presented as means ± SD. *p \u0026lt; 0.05, **p \u0026lt; 0.01, and ***p \u0026lt; 0.001\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-1495473/v1/9c6b17b882af9a185be2a8c2.png"},{"id":20027713,"identity":"d52d7ff0-eb92-49f7-bc3a-d64d10d2fab4","added_by":"auto","created_at":"2022-04-06 15:55:59","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":3026360,"visible":true,"origin":"","legend":"\u003cp\u003eIn vivo biodistribution of the PP/Cy5-siRNA/HA (1 mg/kg of Cy5-siRNA). (A) Images of whole-body after intravenous administration of Naked Cy5-siRNA or PP/Cy5-siRNA/HA in mice. The arrows indicate the tumor location. (B) Images of extracted main organs. (C) Images of extracted tumors alone. (D) Fluorescence efficiency of extracted main organs at 24 h. The data are presented as means ± SD. *p \u0026lt; 0.05\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-1495473/v1/8de501a8aa3ec72bfd3680e1.png"},{"id":20027372,"identity":"8a4ed712-f5e2-4f9a-8243-ffddff798f4a","added_by":"auto","created_at":"2022-04-06 15:50:59","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":990119,"visible":true,"origin":"","legend":"\u003cp\u003eIn vivo treatment efficacy of nanoassemblies against A549/T xenograft tumors (n=6). (A) The tumor growth curves after treated with different formulations. The red arrows indicate the dates of administration. (B) Body weight changes. (C) Pictures of extracted tumors after last treatment. (D) The weights of extracted tumors. (E) Tumor burden. (F) Western blot of P-gp, p62, and LC3 expression of the tumors. (G-I) Quantitative presentation of Western blotting. (J) The mdr1-gene expression of the tumors by q-PCR analysis. The data are presented as means ± SD. *p \u0026lt; 0.05, **p \u0026lt; 0.01, and ***p \u0026lt; 0.001\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-1495473/v1/50bc6d392d8f8a5da0ab5a32.png"},{"id":20027380,"identity":"1768748b-249f-425e-85ca-98f044ea4a84","added_by":"auto","created_at":"2022-04-06 15:50:59","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":24222494,"visible":true,"origin":"","legend":"\u003cp\u003eThe inducing-apoptosis of nanoassemblies in tumor tissues. Immunohistochemistry assays Ki-67-positive levels and immunofluorescence staining of TUNEL-, P-gp-, LC3-, and p62- positive levels in tumor tissues. Cell nucleus were stained by DAPI. Scale bars: 50 μm.\u003c/p\u003e","description":"","filename":"8.png","url":"https://assets-eu.researchsquare.com/files/rs-1495473/v1/e54e92ea48a10b29aa6974ff.png"},{"id":20028290,"identity":"a8998de0-e01d-41fd-befd-7b13cae81857","added_by":"auto","created_at":"2022-04-06 16:01:02","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1639800,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-1495473/v1/e947ac71-8eca-4ff2-ab43-a1456034e1b5.pdf"},{"id":20027379,"identity":"69a767ef-05cf-4ab4-896f-6dd90b73c335","added_by":"auto","created_at":"2022-04-06 15:50:59","extension":"doc","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":5205504,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementaryfile.doc","url":"https://assets-eu.researchsquare.com/files/rs-1495473/v1/092f921cbb1a0004c393ec3e.doc"}],"financialInterests":"No competing interests reported.","formattedTitle":"Polymeric Nanoassemblies based Gene/drug Co-delivery for Autophagy Modulation and Tumor Multidrug-resistance","fulltext":[{"header":"Introduction","content":"\u003cp\u003eMultidrug resistance (MDR) is well recognized as one of the major obstacles that deteriorate the clinic effect of chemotherapy for non-small cell lung cancer (NSCLC) [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. The development of MDR is complex, which can be generally divided into two major types, \u0026ldquo;pump\u0026rdquo; resistance and \u0026ldquo;non-pump\u0026rdquo; resistance [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. For the pump resistance, it is raised by the overexpression of drug-efflux pumps, known as ATP-binding cassette (ABC) transporters, on the cell member to reducing intercellular drug concentration [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Among different types of ABC transporters, P-glycoprotein (P-gp), coded by the mdr1 gene, has been reported to overexpress in many cancer cells to induce MDR [\u003cspan additionalcitationids=\"CR5\" citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. RNA interference (RNAi) technology is frequently combined with chemotherapy to suppress the expression of P-gp [\u003cspan additionalcitationids=\"CR8\" citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. It takes advantage of small interfering RNA (siRNA) molecules to silence specific gene and regulate gene expression to obtain high specificity and excellent treatment effect [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Polyethyleneimine (PEI), a cationic polymer, has strong nucleic acids compaction capacity due to the high density of amines. The \u0026ldquo;proton-sponge\u0026rdquo; effect of PEI would rupture endosomal and help gene translocate without degradation [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e], therefore, PEI has been widely applied in RNAi. High molecular weight PEI has higher transfection efficiency than PEI with low molecular weight (LMW), but also brings more side effects [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Thus, LMW PEIs (such as 1.8k PEI or 10K PEI) are adopted and modified to reduce the toxicity, improve transfection and functionalization (such as tumor-targeted, long blood circle, and drug loading).\u003c/p\u003e \u003cp\u003eApart from pump resistance, non-pump resistance also contributes significantly to MDR [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. For instance, autophagy as a pro-survival factor has a role in the development of MDR [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Autophagy is a lysosome-based degradative pathway activated in limited growth conditions, which could degrade cytoplasmic materials (damaged organelles, obsolete proteins, and invading pathogens) and recycle energy to maintain homeostasis in cells [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. It is a double-edged sword for MDR tumors. Excessive autophagy could promote apoptosis and autophagic death of tumor cell which is also known as the type II programmed cell death [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. What\u0026rsquo;s more, there are increasing evidences suggesting that autophagy protect cells under therapeutic stress and promote the development of MDR [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Chloroquine (CQ) and hydroxychloroquine (HCQ), clinical antimalarial drugs, can block the fusion of autophagosomes with lysosomes via alkalizing lysosomes [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. There are many studies co-delivering CQ (or HCQ) and chemotherapeutic drugs to sensitize the cancer cells [\u003cspan additionalcitationids=\"CR24 CR25\" citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. However, the long-term use of CQ or HCQ are associated with various side effects, and the irreversible retinopathy caused by CQ (or HCQ) could remain develop after drug withdrawal [\u003cspan additionalcitationids=\"CR28\" citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Recently, nanoparticle-based autophagy inhibitors have attracted attentions in tumor MDR [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Gold nanoparticles are proven to block autophagic flux by impairing lysosome and induce autophagosome accumulation [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. The pH-sensitive nanoparticles based on poly(β-amino ester) copolymers can lead to block autophagic flux and autophagic cell death under high concentrations [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. The pH-sensitive polymer, mPEG-b-p(DPA-bDMAEMA), could self-assemble into micelles and be capable of loading chemotherapeutic agent, which unfold autophagic inhibition ability and high antitumor efficiency [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. The autophagy inhibition facilitated by nanoparticles have also been successfully applied in reversing MDR, but there are few reports about suppressing both P-gp and autophagy to work on \u0026ldquo;pump\u0026rdquo; and \u0026ldquo;non-pump\u0026rdquo; resistance and to combat tumor MDR.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eHerein, in order to reverse overall MDR, we designed a novel hyaluronic acid (HA)-coated siRNA/Paclitaxel (PTX) co-delivery nanoassemblies which can suppress P-gp level, block autophagic flux, and obtain efficient delivery of siRNA and paclitaxel. We synthesized the polymer-drug conjugates of low molecular weight polyethyleneimine (1.8k PEI) and PTX, named PEI-PTX (PP), which has high drug loading content (~\u0026thinsp;25.2%) and can encapsulate siRNA for gene therapy. Subsequently, mdr1-siRNA was condensed onto PP to form PP/siRNA driven by electrostatic interaction. Finally, HA was coated on the surface of PP/siRNA to stable nanoassemblies (PP/siRNA/HA). HA, viscous mucopolysaccharide, is widely used in nano drug delivery because of excellent biocompatibility and biodegradability, meanwhile it also can reduce the clearance of mononuclear macrophages and target CD44-overexpression tumor [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. After entering cells mediated by CD44-receptors, PP/siRNA/HA would be shattered within the enrich-enzyme endo/lysosomal. The endo/lysosomal can be impaired by the \u0026ldquo;proton-sponge\u0026rdquo; effect of PEI, and siRNA (as well as PP) would release into cytoplasm to silence the mdr1 gene expression. Then, PTX will be released after the hydrolytic cleavage of PP and act on tubulin to prevent cell's mitosis. PP/siRNA/HA nanoassemblies can achieve suppression to P-gp expression and growth inhibition of tumor cell to combat Taxol-resistant non-small cell lung cancer cells (A549/T cells). We further demonstrate the PEI conjugate plays a significant role in autophagy modulation, which can alkalize and impair lysosomes to block autophagosome\u0026ndash;lysosome fusion and lead to the accumulation of autophagosome. The potency of polymeric nanoassemblies is evaluated by A549/T cells and by A549/T tumor-bearing mice. Our work advances a novel strategy for MDR that could block autophagic flux, and achieve overcoming pump and nonpump resistance when combined with RNAi and chemotherapy\u003c/p\u003e"},{"header":"Experimental Section","content":"\u003cdiv class=\"Section2\" id=\"Sec3\"\u003e\n \u003ch2\u003eMaterials\u003c/h2\u003e\n \u003cp\u003eSuccinic anhydride, \u003cem\u003eb\u003c/em\u003e-PEI (MW 1,800), \u003cem\u003eb\u003c/em\u003e-PEI (MW 250,000), 2-(7-Azabenzotriazol-1-yl)-\u003cem\u003eN, N, N\u0026apos;, N\u0026apos;\u003c/em\u003e-tetramethyluronium hexafluorophosphate (HATU), N-ethyldiisopropylamine (DPIEA) et.al was purchased from Adamas-beta (Shanghai, China). All of solvent were purchased from Macklin (Shanghai, China). Chloroquine Phosphate was obtained from Sigma-Aldrich (St. Louis, MO, USA). Antibodies used for Western Blotting and immunofluorescence including rabbit anti-LC3B, anti-p62, anti-Pgp, goat anti-rabbit IgG (H\u0026thinsp;+\u0026thinsp;L) (HRP, Cora Lite 594) were obtained from Proteintech (Wuhan, China). Alexa fluor 647-labeled goat anti-rabbit IgG (H\u0026thinsp;+\u0026thinsp;L), rabbit anti-CD44, anti-ki67, Ad-GFP-LC3B, Lyso-Tracker Red, TUNEL Apoptosis Assay Kit, acid phosphatase assay kit et.al were purchased from Beyotime (Shanghai, China). All other reagents for western blotting and gel electrophoresis were obtained from Solarbio (Beijing, China).\u003c/p\u003e\n \u003cp\u003eTargeting human P-gp siRNA sequences:\u003c/p\u003e\n \u003cp\u003eSense: 5\u0026rsquo;-AAGAAGGAAAAGAAACCAACUdTdT-3\u0026rsquo;;\u003c/p\u003e\n \u003cp\u003eAnti-sense: 5\u0026rsquo;-AGUUGGUUUCUUUUCCUUCUUdTdT-3\u0026rsquo;.\u003c/p\u003e\n \u003cp\u003eAll of siRNA were obtained by GenePharma Co. Ltd. (Shanghai, China).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec4\"\u003e\n \u003ch2\u003ePreparation of PEI-PTX (PP)\u003c/h2\u003e\n \u003cp\u003eSynthesis of PEI-PTX was carried in two steps, as shown in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e. In the first step, PTX (100 mg/0.117 mmol) and succinyloxide (146 mg/1.459 mmol) were added in anhydrous pyridine for stirring at room temperature for 12 h. Then, the solvent was evaporated under reduced pressure, and deionized water was added for another 2 h. The pH was adjusted at 2\u0026ndash;3 with HCl, and solution was extracted with ethyl acetate. The ethyl acetate extractant was washed with 0.2 M NaHCO\u003csub\u003e3\u003c/sub\u003e and saturated salt water, respectively. The organic layer was dried over MgSO\u003csub\u003e4\u003c/sub\u003e. Removal of the solvents provided a white solid of PTX-SA (99.34 mg, productivity 89.1%). The formed PTX-SA was characterized by FT-IR, \u003csup\u003e1\u003c/sup\u003eH NMR and mass spectrum.\u003c/p\u003e\n \u003cp\u003eIn the second step, PEI-PTX was synthesized as follows: briefly, 200.0 mg PEI (MW 1,800) was dissolved 5 mL water, and the pH was adjusted at 8 with HCL. The solution was lyophilized and dissolved in 5 mL DMSO for further use. PTX-SA (100 mg/ 0.11 mmol), HATU (76 mg/0.20 mmol), HOBt (28 mg/0.20 mmol) were dissolved in 1 mL DMSO, and DIPEA (130 mg/1.0 mmol) was added to the solution. The mixture was reacted at room temperature for 3 h. Then, the activated PTX-SA reaction solution was mixed with the PEI solution as mentioned above. After 24 h reaction, PEI-PTX solution was obtained through dialysis and lyophilization to obtain a purple solid. The product was characterized by FT-IR and gel permeation chromatography (GPC).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec5\"\u003e\n \u003ch2\u003ePreparation and Characterization of Nanocomplex\u003c/h2\u003e\n \u003cp\u003eAs illustrated in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eA, PP was dissolved in deionized water and mixed with siRNA at a proper ratio under ultrasonic agitation. The siRNA-loaded PP (PP/siRNA) were coated with HA by incubation in 10-times volume HA solution under ultrasonic agitation. Finally, the HA-coated, siRNA-loaded PP (PP/siRNA/HA) were collected by centrifugation (12000 r, 20 min). PP/siRNA and PP/HA were also prepared and collected with above methods.\u003c/p\u003e\n \u003cp\u003eAfter diluting the micelle solution with distilled water, the mean particle diameter (Z-average) and zeta potentials of the nanomicelles were determined via a Malvern Zetasizer Nano ZS90 (British Malvern Instrument Co. Ltd). The morphological features of PP, PP/siRNA and PP/siRNA/HA were observed by using a transmission electron microscope (TEM, JSM-6490LA, Japanese company JEOL). Briley, a copper grid was immersed in a pre-diluted micellar solution for 3\u0026ndash;5 min and then stained with 1% phosphotungstic acid after air-drying. The TEM images of the samples were taken after being dried again with an incandescent lamp.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec6\"\u003e\n \u003ch2\u003eHemolytic Toxicity Study\u003c/h2\u003e\n \u003cp\u003eTo assess the potential hemolytic toxicity of PP and PP/HA, a red blood cell suspension was diluted to 2% with phosphate buffer solution (pH7.4). Different concentrations of PP and PP/HA were dispersed in the 2% RBC suspension (1:1, volume ratio). In addition, TritonX-100 and physiological saline were used as the positive control and negative control, respectively. All samples were incubated in a constant temperature water bath at 37℃ for 3 h and then centrifuged at 4000 rpm for 15 min. The supernatant was collected, and its absorbance was measured at 540 nm using a microplate reader. The percentage of hemolysis was calculated by taking the absorbance of the TritonX-100 sample as the hemolysis rate of 100%. The hemolysis rate was calculated according to the following equations:\u003c/p\u003e\n \u003cp\u003e\u003cimg src=\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAgIAAABJCAIAAADAJ9kdAAAAAXNSR0IArs4c6QAAAARnQU1BAACxjwv8YQUAAAAJcEhZcwAADsMAAA7DAcdvqGQAABZYSURBVHhe7d0tmBxFF4ZhZCQyEhkZGRkZGRmJjETGIZHISCQyEolEIpGRyE8i893M23uuorpnsjszu9nJnEfsVVVdXT+nut5zqnsC33xqmqZprph2A03TNFdNu4GmaZqrpt1A0zTNVdNuoGma5qppN9A0TXPVtBtomqa5atoNNBfMH3/88eeffy6Z5kvQS/AV0G6guVQ+fvz4zTfffPfdd0u+eXCyBE+fPl3yzWXSbqC5VH788UcaBAHpUtQ8LL0EXwftBppLxTng3bt3NIgYLUXNw9JL8HXQbqC5SH7//fenT5/+888/T548ef78+VJ6A1XCb7/9tuQ/ffrll19SuOQfN+Zlgn///feSX/H+/ftvv/32+++/X/JfgnEJnj17tpTenR9++IEjsUDJfvz4sc8WD0y7geYiefv2rThU4vXr10SEdqQ8cAAKiVQpad5iP1p9+d///jeOLaMtZdzk5cuXX9YNHF6CO+FUUZPlqvt7zwPTbqC5PESgYuH8QIV80CDRcS4FksQHQKS5FHnWT5Oqe8UsRu377GkAX9YNrJfgp59+yqUjGN2ANerTwAPTbqC5PH799dd6C0EraRBNTDaQEsry888/u1Q/Z5zcgBspl3NDFapJfKNBElwLsculIGZXjir/66+/UiKtqQ8fPkzarU3hrQruTYn2ZZWntcjfq1evOK1/G9qpvzpaq5EjjkFTukjvazdQLS/5HUp0YS5T+Yl8dgmgR6NlZGNYirbMjnIDrqqs8ZRLpyZbKdRaygv2N7Wx/eYI2g00lwfRHGPPFy9ePHnypHQWcQPk8vnz566msNyAmm92UJbob+4loyJcB4jXr18TXGl1drf+y7t371SmOG/fvnULAVLor/bJcXAL0ou/6qusl3EYdM1ItK8Xg6Se1M1fNyoE9UydCpCV6FEWZhrVG92AmerLyN1InUtGdapQfTXXMn0K6yUw4NEFMpcJ6jrOWEnM7sbJ7BjdgDqyKVfoXi0ozCeEOvZlyuaVKY+Dae5Ku4HmwkjsSV4jmogGlfYhbkCCDNUliXID7kpMrUR5hBXu0louURZSlXIeQrWSOQKkhaQpkWppWQVpsiWtpLQpsl63S2tBQkmCdK2V9gV1oozgIaopc0lfoxsgkeWx1ExTXJRG0r4ZJXEW9i1BDRjsUCvCev7G7DFCzF4VDLjulRhNoVpNk9FiN5hypZl3igOaO9FuoLkwos5Rn0ABR7EAlSkpEZOqTwcpRQR0wr2jG9Bg0glFkyZ5ozapU8G1fkuCIa3HJXNDvFH1Lj0qJjQ4to+qQ77HERajG3DaSNQPTakf0demS1Qy1dak8ibTeEb2LcE4ccPjvaZpjqhfV/VVaYmxa9Vq/Doqs3M8Os2Uc+CQyKXmrrQbaC4MujYqPhKcEp0l/1834CoHQCmUlBCLlDVCtsjKqCDq0Jqk6ZFLSQs86U7SUKe60844Hul6aU6/SBWMWVPHuQEh83hvMboBE9TCThIXEhqbuzpuV/mMwfJ6CTRuDMhBKiV8JyuZVx1EmF0hS8bsZQR1Ki0xmkI100l6dAPqGEMmG/o0cDTtBppLIi9n8pJhJDpLC5Id3QASvZKkiClVki5tGm9016YbEGtrIWmoo8ekiVG9nYBsgmI+oHrUvqaOcwOZ8jqiH90Ax5Pfbm6iXxUm4T6anE7WX2uj7FM5aeYFMzU+iUHqRdBoBBUqLTGaQrVandENsD+PknRzIu0Gmksicp/PsyM0TnkpHeGjOElDiEpZVIgQOxnU1cTaoxug+EnTI5eSpm5jv3S/NEino2xJ5z2+8nIVSqp3SE+/cM2QEkrnrzpRRlkeqLrjFfJ6nSBS2BTGSyUcVj+N8xylrZxECeiJZAnKiRbjErhaZozpJAymjgsprOGV0WDwoz1V23QDmXJMgWqqOYJ2A1cEmagddVeoT6nYlyLxJijRKEPUgYYqpzL5PEv1ZMfJRncyBfeqT0NpVkSHyDKOOSrXOHGhVtG1il4j69ohQC9evKhXECV/utMmD1FKZzxadikvr6N01FlatZIwJFIWsztJGB5RS5tpKgKq90i/QhMhgupnRv5Ka0EF08mY3aVE1xLK1+eJIzBsA4PuxiWIG1OeJWAKaYZiBLdk4gapjgmyiTrGmbkwu7uYlBGgvqxCt8QOVpO1a45xxmq6RU1TY5lapuYI2g1cBXZRoqeKue6Kje12e3gdiV8KlCWqCiJiRiXlt4QSuWuUPxBrpEF/l9IdqV+dHiaVl8wKQ113PWGC6oyTyl1T4YORrkebHGf2AzDIeRu8Tr5ON+DJECFCNLEUXTFkKB/lJpG6K9oRl1U41gQ+oF7ONNcG572kLpkj3YCjdM6AObItpTfvDSFyzLHuS5HXAjzBkj8NoTQZPRyLPVqcsse3qMGxQCH3YMnWsm6mrLf5GsGBwHH+63j6z4IHw164ZcjffDXQN9tnn8LYO67aYp4NiU3pcK+tBHVsq+lMY4vZm8+ePVOB/iylA25RYcmcxvGnAXOgFPXlqogn+LI+AA4EZ3QDtrrWtLnkHwQ2PD3uzpvoSdDz2jqPnYfJwzqpmAdX+ZL5L+7y1G4+l1eI7e0ZQ587r4cci20rbCqMnWt/JT5WOYHCtJfFYW63E6Upvj1IOcdtKJtdJoBz9efdR68i+/pcinS8G8jXm7UVophfPFo8rxv4Iq8gRQHfn/wjvzdv3qxjVc673mN4EBlq9BNW1kN8YAU322yaCyL6uwkRP/Bs2ykidBJvb+5TGCGUHVSNRIvGyImSqDC+S9SOOvWhm/TLlufQ1xj4a9kYzvgqst3AI8VKe1BOdAMeps1GBPtVGENVMKtfocdhu2Xp+7cZzYWyT7tA5W2Z2g5rVMj71X2NZNNNh2lhk221ZG7uHX80TPGVlLJzRbKlonoRFCYNJwNdZBhn4YHcAO/nEOQSCFC9KZNIYebPLsnWD1rqrvXCEKy6Krwd41mMbqB6CalQ9yLjsRLaWYpevrSQCf+NLSWj3U1ws/KI+rma2ZlCsjV9PearA5iljKbcLcbv0cnVej5gajWkMtQmk8QX4zljqmM8Oq1AZhPjdEu/F2ouF89/6UMRH7B+0b3JPgHM8XqUeORVeW1we0fW1ks2KCmtT+NVf3QDcTOHN/5deQg3QFOiWQqRE1OZILNy1cKwjmadd7TA46np8KULvlRJqSe0+erVK8almFpQR4WSNkTdangZ7SRw2leY42Fe5xmACogKZxay0yrq1JCMTYmr+TF1XR1R06XMLm5DNnPP76MNTDbDE6TXXWJtJeq4CsPLpTFaUUdanVxak2YnB4m1G0hoz8IaPHBeDmbqFtZb8luUCzzMeZ/mprk9kyfIzho15DDZXGsBJFzKs0OL6EkpWJSnNnWgTgaQdHZlSYpeqGLSmrJ/yU6yZ+FUN2BAy4a+IZI9aiJtNT26kGyUcRQRjSgp/5kDkVvKTMRCyWjxmFVTS371jxtjx/EWFcZhgIDWMNQcG2RlJRXg5+q4KmPl+KH1aSCoiWhrmk07pjCKINOpVo1EaqeHUiHzjmF47DA9T0XGObrPwN+Uy4m/yVyyghJmpNztmy7BLNxSLWzSbqB5/JQniA84EFGt2ecG8vV4cgPpiCgla+/IjiKJyGAUICJZAZxtDonIWnalfc3l2EGjDB7HqW7A9IxsZAqcSQb7TpKhZHxTZv7UbcncKGB5P2g2fSXLUus24yrqe3puGRcpXrqcDZ3SiGrJ5qqAfdPNRk9rUhqRzcJ8FjVNcMnsJ+fEEvQYYXIDkewxup9mPTENu8gxwtNjsrQ4E0lhfIZC42Ecq7B5RtbsuEBnR/tNczrTDloTgQYfsLn397HPDaTBqTyFpTZR/GljprDiVOPJxrQlo1SGR10TuSqkmfwBBXB1feK/E/f+Uihurd5xB+NWWEY3fySNKKBqS36liTkuTC8lWERhRcprN8C+Y7Okk02TBtcSB2aoa1Wd9LQqG/bk9tek2pLZgomMdnpQpimHBBr8386K/5IXaOP5YCS+rdocqc8wpmYhYOJpxyULlMcxVp1aWC/Q2cnYmuZEPnvcJKAeZlSAeEv2CWC0Yion6ArrXG5gstO2iioumZ3IkDg1/U10aDurk9ifCNSup0VI+jju3Q1Esg8HzjsvcAc3wHzrNlM41ZmGx8EqzNgI6LTwpFD9vNRytdYMWdqaFCzSWHm8NKHCphvQAlmPgzTs6cmYphxkFd7+DBgRF+Yv+f14pIzEkKQZtp4qJVqY/GJc+zS2CcY0l89y+7k0zdmpd0Gbb3IOs08A86pgKp9UMULk+U82KNkUipC3F5F+m0vl2tcKZZM+jnt3A1MMvsnOC9zBDUSGpjbZVGGNZ8qGjFmA4CrVY83lwoDCvGkZK2hHSU2qoJKpfGD9Nq9qOT48yot0UU/G2gjIek9PzwHig9eHmwn29ISVUzQqj2nS0ML0XigBlJ2z5LfI+D/LYV/SNPdH+YBscw+5B/L2nmCfAGZ3TO8q7CkhY+lJNvK4MbNfxn03YaeUImVflw7sU6fbc+9uAEbPBKV3oSyCnRe4gxtwr/UbzYr483w8QdzAJFXG4EbnKQHvdIllxxHmEFeziKErdHVQWFceTw8jLq3dQOL08TiSRmppTU3W05Ns2Aw0RiOs0fXkS9Z4+MaOHG7GW/SYGKSINfbNt2keP5MPCBTGg31LT7BPAEHxsGRujtRjxLN+R5LWSr4mUr8GFnEzhWSzHyeBvRPHu4FI0jokjBsYD/sRaO6xBkpWRmUh6KPVIvrjF2CKo2S0Y9qsY5EzhxZ0XYsaS423hKitHvPuuyCXY2XVPCXVWiKF0mgdjeM3NVf3LYNLazdg5MrLeoxp/GMXcJcxxBV5DgwGqimsJ0C5kgOvVnJYmSY7Eoc0arrZlfH16Or0gpXPmPxT01wQmz4gRB9u4wmyszZ/QJFL1Yis7qawSbClsDZm9tR6PMGlUQ/zOqTaJyOaSvo4jnQD1MrIDIUGlSQh8wcT1wzpY2TUWHMXwa0Jx5UhflW5q7IqR+W1ozUl+ipvmWrqaNmNbKrlEmLSGWkebwlRvenIBpqbcq2ReH6i5iWhHVcNI6JMKHU9Vt733LjqRkz+0qTSo6bigWK66gJxFTA1T2csxvIZjLviPkf7r9GRoY5Oa0SbWhj9H/JhOcunO7fXUkKJq7fZJ03zOLHFakNNKLSvRVdLfoV77Xqi/O/O3GHPKqltG+wp25M6JbHepOrbwkhro3xNZD9OXsS2LQ80RaVHcKQb4I7IQRjHtxTtGLUDsimfQtcUBlnLsGRu/s1U3YjJFkyZ8smCh29h081lXm7YMTaohaV0mNSS37Fv/bDU2LEU3eCulGeENZfRbrHzerSpiQNdF/F8kzsMiSPGHqFND6Vny9XJw6k5Pn8PiX27dt7NI8RD4uGhbkv+66K27cR6J9aOXvJbRFsOnOYZM+5kyd9gV9rUdigndMCF3JLjXwpdKNwmqy2Zq0FA4WFafyvmYDYfwTjj9+/fj1eVOHV9ES02Tg89Nv1386jIudbztuSbE+AG7LtNlbc3OQPnjM1jzZ24CjfAiJEP/lnwe51SIu4QUIsdlvwd4RK4z80jxQMgGuKBiMvXGmN+TVipLNbhQLh5PFyFG/A4eihf7P4vEFeuI0cHDieeOk/BmC2cReTCr/AkF0QwS+pxI8ayWEJUO276HnYn7FNcyqwvnatwAwLhl7t/jNcfNi8RR5Dvdj+1cpQhLqM0xMGLPa0vJ0GAJFSeqo3klnPpC++YyNdJKyXf737g8NP5/ltJvCA9jQVGTEHX+vX3h91/EnG5sPtxQV1yjFtKHwTnNhjMt7v/uf9Senf+3v17ozpPsKqVTbo5O1f3baC5OPjvxJX5jfL4hYNM0McooER+8kRBuIR9Qq9cmFmHGwJ6+KdWn0WQMY5K43Qw6dPhAuPYsBTdQGTTqbmYbzmeTD+v7xKVP9hbUAuh63THCen6FHc7ugHT6Rju/mg30DxqonH1aYc0jFEhCSa7SZcbAHGnhkkfxgHidH2h+9oxVCM0jDEwP5GMzRwnN5AzTc3RAAT+SatsMElj83cm94TR1jiljfCUs8joBpp7pd1A86ihI6MCCoF5hYrlR0Y3EJwhSAlZFDW7Ku1GcimRKFW5tBKupd7qKHyxQ2HF0YltSVve+WiNB8olaJby8j0OLvVPGs/I2g1k5EtmV6GyxlBzQSayZPbDddHcz3LYuerISJJmE0OafpLAngyImCuFrOpGmOP4Ms3tepRQwaKrIK1Zz4BL7G9qEpZvHJUWMmV2OPBDzGak3UDzqLGlxy+N0Tu6sOQH1m4ACrXw4cMHAhQdoSxaqJcVU2sCZyqTcJ5OUZ9ITERNC7LxJVRmd8cC9S+pOjtrN8AmY8gfs2So5jvagRDXQeEAOWl9lk3Lh7QwKi9rsMl4NnI0qYNd3IDlKCPHtzHvv1X/exqwLmVbXbgkq6Z2tFlPSAyVHrOUKW8O026gebzUhi8SAI7RbrHPDUyFh90ATan3GOm9stJ0KmltGkzSgfSQs8O643Y6tUle5e9DhckNGMBYokJNSvkYg08193H6acAYWC/LFPRrVDU1XcjWIWBNDF4nMGk9Jq1xDSYdf1PVlNcSs3+5BMuq2uiEmn20G2geL7b0JKyREnKz3t5EZ1J8KKQgS2YHZdHCphugcbIlPaDsdftYc+0GxJ7R4gPx8hndAMsY25K5cQNJ55VI0nBqmYZ6T6xNnQ/U46IwjrVTk3MdV5DN3ctDjPYf065ObqBWUPvVBZvkFV9xwG81RbuB5vFCL9a/vOQYqMD65z0qj4oT1tp0wA1EX0ZFHg8HY00dkZikoc0E4ITs6ef+h/5HYAomsmR2MIvx1PuT9Jv09BaIV5jeX90HsWpF6IEd6PL48grGbDrKs1hsbkE5SC3kNFDSP6Zv6QaU13o1t6fdQPNIIcd29VruEzPWzi+OcwNEaqxAnuqtQuRmfEex6QaIHdnNF2Map8ED7z2OY+0GMrbyWOuXIfEQEeL7+Go9wdPodO3/DLvGKTAvs3NjmZGp1YGPqVU+xQ1YiEqj3GRzmHYDzWOEIkRBph872tiiXeXUrTQCBIj+ju/Eg8JRFzD9lJ5+0Q5NJYokpm6JxLx586bujfTU0cSl0mV1xjdX+U3ROLYTqSlPsbaRi/RdpfIGU28/lBhP7GY67l2r83kxAMNbj5DRHKeUG4/h8U81TsOLbRWqw09Aicpx/KpJV2g/HnHUHPvSeK27+i7xGexv7pvfkJo17Qaax8j4Gn2U1On1+lK6U5OUjJWlU1iRI9JC6Qu5oT746+YnLkSNfIg9K/ZHtU9S1Uxa+zQr6dxOgpNFbjwRkrc0d4MucslIuCUKSO/GCSLDcEmF+/YB45QxjmQp2sGALhkqw0JJTcSKGGpWRLmsRBncAuVfhyAeIisYl1xLXL/fVSfLl3aa29BuoGma5qppN9A0TXPVtBtomqa5atoNNE3TXDXtBpqmaa6adgNN0zRXTbuBpmmaq6bdQNM0zVXTbqBpmuaqaTfQNE1z1bQbaJqmuWraDTRN01w17QaapmmumnYDTdM0V027gaZpmqum3UDTNM1V026gaZrmqmk30DRNc9W0G2iaprlq2g00TdNcMZ8+/R8R4MOIAlVLKgAAAABJRU5ErkJggg==\"\u003e\u003c/p\u003e\n \u003ch2\u003e\u003cstrong\u003eThe Drug Loading and\u003c/strong\u003e \u003cspan class=\"BoldItalic\" name=\"Emphasis\" type=\"BoldItalic\"\u003ein vitro\u003c/span\u003e \u003cstrong\u003ePTX Release\u003c/strong\u003e\u003c/h2\u003e\n \u003cp\u003eThe PTX loading of PP, PP/siRNA, PP/HA, PP/siRNA/HA were determined by high-performance liquid chromatography (HPLC, 1260 Infinity, Agilent) after the hydrolysis in methanol/water (1:1) solution at 37℃ for 24 h. The accumulative release of PTX from PP/siRNA/HA NPs were conducted in the release medium of pH7.4 or 6.0 PBS, with or without 0.4 mg/mL HAase at 37℃, under a shaking at the speed of 100 rpm/min. The dialysis bag (MW\u0026thinsp;=\u0026thinsp;1000 Da) containing 0.5 mL solution of PP/siRNA/HA NPs was put into 10 mL release media. 1 mL release media was withdrawn and determined at the selected time. The HPLC was applied to determine the content of PTX (mobile phase: acetonitrile/water\u0026thinsp;=\u0026thinsp;50/50). During the whole process, the UV detection was set at 227 nm, the flow rate was 1 mL/min and the temperature of C18 column was 30℃.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec7\"\u003e\n \u003ch2\u003eCytotoxicity Assay\u003c/h2\u003e\n \u003cp\u003eHuman lung cancer cell lines, A549 and Taxol-resistant A549 (A549/T) were purchased from Procell Life Science\u0026amp;Technology Co.,Ltd (Wuhan, China). All cells were cultured in F-12K media containing 10% FBS and 100 IU/ml penicillin, 100 mg/ml streptomycin and 2 mM L-glutamine. All cells were maintained in a 37℃ incubator with 5% CO2 for further treatment. The cell viability/cytotoxic potential of individual formulation were performed by MTT assay. Briefly, cells were seeded into at a seeding density of 5000 cells/96-well plate and incubated for 24 h. Following day, medium was removed and cells were incubated with free PTX, PP, PP/HA, PP/siRNA, and PP/siRNA/HA at different concentrations of PTX (ranged from 10\u003csup\u003e\u0026minus;\u0026thinsp;5\u003c/sup\u003e to 1\u0026micro;g/mL) and incubated for 48 h. At designated time intervals, cells were treated with 100 \u0026micro;L/well MTT solution (0.5 mg/ml in serum free media) and incubated for 4 h. The purple blue formazan crystals were extracted by the addition of 150 \u0026micro;L/well DMSO and absorbance was measured by microplate reader (Sunrise, TECAN). The IC\u003csub\u003e50\u003c/sub\u003e value of PTX in these cells was calculated by GraphPad Prsim software.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec8\"\u003e\n \u003ch2\u003eCell Uptake Study\u003c/h2\u003e\n \u003cp\u003eCellular uptake by flow cytometer analysis The A549 cells, as well as A549/T cells, were seeded at a density of 2\u0026times;10\u003csup\u003e5\u003c/sup\u003e cells/6-well plate and allowed to attach for 24 h. The cells were exposed to PP/FAM-siRNA/HA and incubated for 1 and 4 h. The cells were washed twice with PBS, trypsinized, collected and resuspended in PBS. The amount of cellular uptake was confirmed by flow cytometry (Beckman coulter life sciences, CytoFLEX, USA).\u003c/p\u003e\n \u003cp\u003eThe cellular uptake of drugs was observed by confocal laser scanning microscope (CLSM). In order to make the PP/siRNA/HA NPs have fluorescence signal, we attempted to label FAM-siRNA to NPs. The cell nuclei were stained by DAPI. During the whole process, in short, 2\u0026times;10\u003csup\u003e4\u003c/sup\u003e A549 cells, as well as A549/T cells, were seeded into 24-well plates and incubated for 24h. The media was removed and the cells were cultured with FAM-siRNA (1 \u0026micro;g/mL) loaded in PP/siRNA/HA NPs. After 1 h and 4h, the cells were washed, fixed, stained, and ultimately observed by CLSM.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec9\"\u003e\n \u003ch2\u003eApoptosis Assay and Cell-cycle Analysis\u003c/h2\u003e\n \u003cp\u003eThe A549 and A549/T were seeded at a density of 3\u0026times;10\u003csup\u003e5\u003c/sup\u003e cells/6-well plate and allowed to attach for 24 h. The cells were treated with free PTX, PP, PP/HA, PP/siRNA and PP/siRNA/HA and incubated for 24 h at 37℃ in a standard incubator. A control was maintained as untreated cells. After the incubation period, cells were washed with PBS, trypsinized, collected and resuspended in a 195 \u0026micro;L of binding buffer. Immediately, 5 \u0026micro;L of annexin V-FITC and 10 \u0026micro;L of propidium iodide (PI) was added and gently votexed and kept aside for 30 min. The proportions of apoptotic or stained cells were observed by flow cytometer.\u003c/p\u003e\n \u003cp\u003e3\u0026times;10\u003csup\u003e5\u003c/sup\u003e cells A549 and A549/T cells were seeded into 6-well plate and cultured overnight respectively. Then, the media was replaced and cells were cultured with free PTX, PP, PP/HA, PP/siRNA and PP/siRNA/HA. The cells were collected, fixed (70% ethanol V/V, -20℃, overnight) and stained with PI (50 \u0026micro;g/mL, 20 min, 4℃) for the further analysis of cell cycle distribution by flow cytometry.\u003c/p\u003e\n \u003ch2\u003e\u003cspan class=\"BoldItalic\" name=\"Emphasis\" type=\"BoldItalic\"\u003eIn vitro\u003c/span\u003e \u003cstrong\u003esiRNA Transfection and Analysis of P-gp Expression\u003c/strong\u003e\u003c/h2\u003e\n \u003cp\u003eThe A549 and A549/T cells were seeded at a density of 3\u0026times;10\u003csup\u003e5\u003c/sup\u003e cells/6-well plate. After reaching 70% confluence, the cells were incubated with control (fresh media), PP, PP/HA, PP/siRNA, and PP/siRNA/HA (100nM siRNA) for 48 (mRNA extraction) or 72 hours (protein isolation). The intracellular mRNA level and protein content were detected by reverse transcription PCR (RT-PCR) and Western blot, respectively.\u003c/p\u003e\n \u003cp\u003eTotal RNA from cells was extracted using the Total RNA Extraction Kit (Solarbio, China) according to the manufacturer\u0026apos;s protocol. The concentration of extracted RNA was determined with NanoDrop One (Thermo scientific, USA). The cDNA was produced using the MonScript\u0026trade; RTIII All-in-One Mix with dsDNase (Monad Biotech, China). The reverse-transcribed cDNA was used for PCR amplification using MonAmp\u0026trade; ChemoHS qPCR Mix (Monad Biotech, China).\u003c/p\u003e\n \u003cp\u003eThe primer sequences for MDR1-mRNA amplification:\u003c/p\u003e\n \u003cp\u003eForward 5\u0026rsquo;-AGGAAGCCAATGCCTATGACTTTA-3\u0026rsquo;;\u003c/p\u003e\n \u003cp\u003eReverse 5\u0026rsquo;-CAACTGGGCCCCTCTCTCTC-3\u0026rsquo;.\u003c/p\u003e\n \u003cp\u003eThe primer sequences for GAPDH amplification:\u003c/p\u003e\n \u003cp\u003eForward 5\u0026rsquo;- AAATCAAGTGGGGCGATGCTG \u0026minus;\u0026thinsp;3\u0026rsquo;;\u003c/p\u003e\n \u003cp\u003eReverse 5\u0026rsquo;- GCAGGAGGCATTGCTGATGAT \u0026minus;\u0026thinsp;3\u0026rsquo;.\u003c/p\u003e\n \u003cp\u003eGAPDH was used as a reference gene. PCR was performed on ABI StepOne Plus\u0026trade; (Applied Biosystems\u0026reg;, USA).\u003c/p\u003e\n \u003cp\u003eFor western blotting, the cells were lysed using RIPA buffer (Solarbio, China) after treatment. The protein content was determined by BCA Protein Assay Kit (Solarbio, China). For all western blots, samples containing 50\u0026ndash;150 \u0026micro;g of total protein were separated by SDS-PAGE on 10\u0026ndash;15% gel. The separated polypeptides were transferred to polyvinylidene fluoride (PVDF) membrane, probed with antibodies, and visualized by ECL with ChemiDoc\u0026trade; XRS+ (Bio-Rad Laboratories, USA) as previously described. All primary antibodies were purchased from Proteintech\u0026reg; (Wuhan, China) with 1:500 dilution.\u003c/p\u003e\n \u003ch2\u003e\u003cspan class=\"BoldItalic\" name=\"Emphasis\" type=\"BoldItalic\"\u003eIn vitro\u003c/span\u003e \u003cstrong\u003eAutoghagy Modulation Study\u003c/strong\u003e\u003c/h2\u003e\n \u003cp\u003eThe A549/T cells were seeded on 6-well plate. The cells were treated with PP (different concentrations ranged from 0.1 to 50 \u0026micro;M), negative control (PBS), and positive control (10\u0026micro;M CQ), respectively. The intracellular LC3/p62 proteins were detected by Western blotting.\u003c/p\u003e\n \u003cp\u003eFor immunofluorescence, after treatment, the A549/T cells expressing GFP-LC3B were fixed using 4% paraformaldehyde, washed in PBS, permeabilized with 0.1% Triton X-100, and blocked in 5% goat serum. Cells were then stained with rabbit anti-p62 antibody and secondary antibody (Alexa Fluor\u0026reg; 647 Conjugate) followed by DAPI nuclear stains. For co-localization analysis, the cells expressing GFP-LC3B were fixed and stained nuclear after treatment of Cy5-siRNA loaded nanoassemblies (PP/Cy5-siRNA/HA). All stained samples were visualized under CLSM (Leica, USA).\u003c/p\u003e\n \u003cp\u003eFor observation of autophagosome, A549/T cells were collected using cell scraper and centrifuged after treatment, and the cell sediments were fixed in 2.5% glutaraldehyde for at least 24 h. Then, the cells were graded dehydrated and fixed in epoxy. Ultrathin sections of the cells were examined by transmission electron microscope.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec10\"\u003e\n \u003ch2\u003eGel Retardation Assay for Testing siRNA-Loading Capacity and siRNA Stability\u003c/h2\u003e\n \u003cp\u003eThe siRNA-loading capacity of PP was evaluated by the agarose gel retardation assay. The siRNA-loaded PP (PP/siRNA) complexes were prepared by varying the PP/siRNA weight ratio from 1/1 to 8/1. The complexes were loaded in 1% agarose gel and run in 1\u0026times;TAE buffer at 120 V for 15 min. The gel was stained with SuperRed/GelRed (Biosharp, China), and siRNA bands were visualized with ChemiDoc\u0026trade; XRS+ (Bio-Rad Laboratories, USA).\u003c/p\u003e\n \u003cp\u003eFor stability testing, siRNA or NPs were challenged with 50% FBS at 37\u0026deg;C for different time (0 to 24h) and analyzed by agarose gel electrophoresis. For the anion resistance of nanoassemblies, PP/siRNA and PP/siRNA/HA, various dosage of heparin (heparin/siRNA range 1 to 8 IU/\u0026micro;g) were used to replace siRNA from complexes at 37\u0026deg;C for 2h.\u003c/p\u003e\n \u003ch2\u003e\u003cspan class=\"BoldItalic\" name=\"Emphasis\" type=\"BoldItalic\"\u003eIn vivo\u003c/span\u003e \u003cstrong\u003eBiodistribution\u003c/strong\u003e\u003c/h2\u003e\n \u003cp\u003eAll animal experiments complied with the regulations of the Animal Experiments Ethic Committee for the care and use of research animals in Qingdao University. BALB/c nude mice bearing A549/T tumor were used to study the biodistribution of PP/siRNA/HA nanoassemblies via fluorescence imaging [\u003cspan class=\"CitationRef\"\u003e36\u003c/span\u003e]. When the tumor volume was about 300 mm\u003csup\u003e3\u003c/sup\u003e, Cy5-siRNA solution or PP/Cy5-siRNA/HA nanoassemblies were intravenously administrated (1 mg/kg equal to Cy5-siRNA). The mice were observed with in vivo fluorescence imaging system at 1, 3, 6, 12 and 24 h after injection (n\u0026thinsp;=\u0026thinsp;3). Furthermore, at 24 h after injection, the mice were dissected and the heart, liver, spleen, lungs, kidneys, and tumors were used for imaging.\u003c/p\u003e\n \u003ch2\u003e\u003cspan class=\"BoldItalic\" name=\"Emphasis\" type=\"BoldItalic\"\u003eIn vivo\u003c/span\u003e \u003cstrong\u003eAntitumor Efficacy\u003c/strong\u003e\u003c/h2\u003e\n \u003cp\u003eBalb/c nude mice (male, 3\u0026thinsp;\u0026minus;\u0026thinsp;4 weeks) were purchased from Beijing Vital River Laboratory Animal Technology Co. Ltd., China. After one week of adaptation, tumor bearing mice were established by subcutaneous injection of 1\u0026times;10\u003csup\u003e7\u003c/sup\u003e A549/T cells suspended in in PBS and Matrigel media mixed at 1:1 ratio. When the tumor size reached 100 mm3, mice were randomly classified into 4 groups (n\u0026thinsp;=\u0026thinsp;6): untreated control (0.9% NaCl), free PTX (Taxol), PP/HA, and PP/siRNA/HA. Then, these formulations were administrated via tail vein (5 mg/kg/time of PTX, 5 mg/kg/time of siRNA) for five injections every four day. Tumor size was monitored every 2 days. The length (L) and width (W) of each tumor were measured by a digital caliper, and the volume (V) was calculated by the modified ellipsoid formula: V = (L \u0026times; W\u003csup\u003e2\u003c/sup\u003e)/2. At the 21th day of observation, all of mice were sacrificed and its tumors were weighed. The tumor burden was calculated as: Tumor burden (%) = (W\u003csub\u003etumor\u003c/sub\u003e/W\u003csub\u003emice\u003c/sub\u003e) \u0026times;100. Moreover, the heart, liver, spleen, lung, kidney, and tumor were dissected for H\u0026amp;E staining to evaluate physiological changes of main organs and tumors. TUNEL and Ki67 fluorescence staining were used to test the apoptosis and proliferation of tumor. The immunofluorescence staining of P-gp, LC3B, and p62 were valuated to the gene silencing and autophagy modulation of nanoassemblies in vivo.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec11\"\u003e\n \u003ch2\u003eStatistical Analysis\u003c/h2\u003e\n \u003cp\u003eAll data in the study are shown in means\u0026thinsp;\u0026plusmn;\u0026thinsp;SD. The unpaired Student\u0026rsquo;s t test (two-tailed) was used for two-group comparison with *p\u0026thinsp;\u0026lt;\u0026thinsp;0.05, **p\u0026thinsp;\u0026lt;\u0026thinsp;0.01, and ***p\u0026thinsp;\u0026lt;\u0026thinsp;0.001 as indicative of statistically significant differences. The Graphpad Prism software was used for data analysis and visualization.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Results And Discussion","content":"\u003cdiv class=\"Section2\" id=\"Sec13\"\u003e\n \u003ch2\u003eSynthesis and Characterization of PEI-PTX (PP) Polymers\u003c/h2\u003e\n \u003cp\u003eThe procedure for synthesizing PP polymers is shown in Figure S1. PTX-SA was obtained by conjugating succinic acid to the 2\u0026rsquo;-OH group of PTX via ester bond, where the characterizations were showed in Figure S2-S4. Then, PP was synthesized via amide reaction. As shown in Figure S5-S6, the results of FT-IR, \u003csup\u003e1\u003c/sup\u003eH NMR, and GPC indicated that PP was successfully synthesized. The FT-IR peak of the amide bond appeared at V\u003csub\u003eC=O\u003c/sub\u003e 1729.35 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e and \u0026delta;\u003csub\u003eNH\u003c/sub\u003e 1648.84 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e. The GPC result further confirmed the PP was successfully synthesized.\u0026nbsp;\u003c/p\u003e\u0026nbsp;\u003ctable border=\"1\" id=\"Tab1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eLoading efficiency of PP, PP/siRNA, PP/HA, and PP/siRNA/HA\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\u0026nbsp;\u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003ePP\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003ePP/siRNA\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003ePP/HA\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003ePP/siRNA/HA\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eLoading PTX Efficiency (wt%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e25.15\u0026thinsp;\u0026plusmn;\u0026thinsp;0.90\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e17.44\u0026thinsp;\u0026plusmn;\u0026thinsp;0.43\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e7.27\u0026thinsp;\u0026plusmn;\u0026thinsp;0.19\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e6.99\u0026thinsp;\u0026plusmn;\u0026thinsp;0.15\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003cp\u003e\u003c/p\u003e\n \u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec14\"\u003e\n \u003ch2\u003ePreparation and Characterization of PP/siRNA/HA Nanoassemblies\u003c/h2\u003e\n \u003cp\u003eThe preparation processes of nanoassemblies were shown in Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eA. Initially, the PP copolymer dissolved in Milli-Q water can be self-assembled into micelles under sonication. Dynamic light scattering (DLS) analysis showed that the hydrodynamic diameter of PP micelles was 215.7\u0026thinsp;\u0026plusmn;\u0026thinsp;2.4 nm (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eF), and the transmission electron microscopy (TEM) images showed that the micelles were spherical (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eE). As shown in Figure S7, the critical micelle concentration (CMC) of PP micelles was 6.3\u0026times;10\u003csup\u003e\u0026minus;\u0026thinsp;3\u003c/sup\u003e mg/mL, indicating the excellent thermodynamic stability of micelles. To determine the optimal weight ratio (PP/siRNA) for siRNA delivery, we used agarose gel electrophoresis to evaluate the siRNA encapsulation of PP (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eB). It was found that binding capacity increased with increasing the ratio of PP, and all of siRNA were encapsulated when the weight ratio of PP: siRNA increased to 3:1. The encapsulation efficiency of siRNA was up to 92.68\u0026thinsp;\u0026plusmn;\u0026thinsp;0.78% at 3:1 weight ratio and maintained unchanged when further increasing ratios (Figure S8). As shown in Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eC, an increasing tendency of zeta potential was detected during the increase of weight ratios, further indicating the successful loading of siRNA. Therefore, the optimal weight ratio (PP/siRNA, w/w) of 3:1 was used for further anti-tumor study considering the encapsulation efficiency, z-average size, and zeta potential. The siRNA-loaded PP (PP/siRNA) showed a reduction of positive charge (from +\u0026thinsp;54.3\u0026thinsp;\u0026plusmn;\u0026thinsp;1.6 mV of PP to +\u0026thinsp;47.5\u0026thinsp;\u0026plusmn;\u0026thinsp;1.3 mV of PP/siRNA) and the slight decrease of particle size (from 215.7\u0026thinsp;\u0026plusmn;\u0026thinsp;2.4 nm to 197.3\u0026thinsp;\u0026plusmn;\u0026thinsp;2.6 nm), indicating the condensing of siRNA on the PP surface (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eF). Subsequently, PP/siRNA was coated with a HA shell by electrostatic interaction. To determine the optimal ratio of HA and PP, we measured the z-average size and zeta potential of HA-coated PP/siRNA (PP/siRNA/HA) with different (HA: PP) ratios ranged from 1:2 to 3:1. The surface charge of PP/siRNA/HA emerged reversal from positive charge to negative when the weight ratio of HA: PP increased to 2:1, and the particle size was decreased during the increase of HA ratio (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eD). Considering longer blood circulation and higher tumor targeting, we used 2:1 as optimal weight ratio of HA/PP (w/w) for further study. PP/siRNA/HA showed a gelatinous shell on surface in TEM (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eE), a reversal of zeta potential (from +\u0026thinsp;47.5\u0026thinsp;\u0026plusmn;\u0026thinsp;1.3 mV of PP/siRNA to \u0026minus;\u0026thinsp;9.0\u0026thinsp;\u0026plusmn;\u0026thinsp;0.3 mV of PP/siRNA/HA), and the decrease of particle size (from 197.3\u0026thinsp;\u0026plusmn;\u0026thinsp;2.6 nm of PP/siRNA to 144.4\u0026thinsp;\u0026plusmn;\u0026thinsp;1.0 nm of PP/siRNA/HA) (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eF), revealing the presence of HA shell. The photos of nanoassemblies PBS solutions were showed in Figure S9, there were transoarent, azure, well-distributed colloidal solutions in PBS. To confirm the drug loading contents (DLs) of PTX, different preparations were hydrolyzed, and then the content of PTX was measured by HPLC. The PP exhibited high drug loading efficiency (25.15\u0026thinsp;\u0026plusmn;\u0026thinsp;0.90%, wt%), and the DLs of PP/siRNA, PP/HA, and PP/siRNA/HA were 17.44\u0026thinsp;\u0026plusmn;\u0026thinsp;0.43%, 7.27\u0026thinsp;\u0026plusmn;\u0026thinsp;0.19% and 6.99\u0026thinsp;\u0026plusmn;\u0026thinsp;0.15%, respectively (Table \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e). The PTX release under the simulation conditions of body fluid (pH7.4), lysosome (pH5.0) and lysosome with enzyme (pH5.0 with hyaluronidase) was investigated. As shown in Figure S11, under conditions of pH5.0 and pH7.4, there were almost no release of PTX due to the protection of the HA shell. Under condition with hyaluronidase (1%, w/w), the drug release rate was faster and higher. These results demonstrated that the PP/siRNA/HA could achieve longer blood circulation and release drug from nanoassemblies within intracellular.\u003c/p\u003e\n \u003ch2\u003e\u003cstrong\u003eStability\u003c/strong\u003e \u003cspan class=\"BoldItalic\" name=\"Emphasis\" type=\"BoldItalic\"\u003ein Vitro\u003c/span\u003e\u003c/h2\u003e\n \u003cp\u003eThe stability of nanoparticle system is vital for its application \u003cem\u003ein vivo\u003c/em\u003e [\u003cspan class=\"CitationRef\"\u003e37\u003c/span\u003e]. Both PP/siRNA and PP/siRNA/HA in 50% FBS showed no free siRNA band upon gel electrophoresis (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eH). This result demonstrated that the HA shell contributed to the stable encapsulation of siRNA. To test whether the HA shell protects siRNA from anionic environment in physiological fluids and enzymatic challenge in FBS, PP/siRNA and PP/siRNA/HA were subjected to 50% FBS. PP and PP/siRNA/HA remained stable for 24 h and showed no signs of degradation due to the presence of serum nucleases, whereas naked siRNA was completely degraded in 12 h (Figure S10A). Consistently, the PP/siRNA/HA showed stronger heparin resistance ability than samples without HA-coated (Figure S10B), further supporting the protective effect of the HA shell. Solubilizers, particularly cationic polymerization, usually cause severe hemolytic reaction when injected into blood vessel. Thus, we conducted a hemolysis test to evaluate the safety of the PP and PP/HA. The PP cause severe hemolysis as we expected, but the PP/HA did not cause hemolysis at a high concentration and there was no significant difference when compared to the saline group (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eG), which demonstrated the HA shell not only improved the safe and biocompatibility of nanoparticles, but also enhanced its stability. Thus, HA-coated PP could be used for intravenous injection. Considering the severe hemolysis and unsafety of PP without HA-coated, we used the PP/HA or PP/siRNA/HA as main preparations for further anti-tumor study \u003cem\u003ein vivo\u003c/em\u003e.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec15\"\u003e\n \u003ch2\u003eCell Uptake and Endocytosis study\u003c/h2\u003e\n \u003cp\u003eEfficient cellular uptake is vital for gene transfection [\u003cspan class=\"CitationRef\"\u003e36\u003c/span\u003e]. The confocal laser scanning microscope (CLSM) images of the FAM-siRNA in A549 and A549/T cells for 1 h and 4 h were shown in Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eA. Naked FAM-siRNA, in either A549 cells or A549/T cells, exhibited weak fluorescence intensity at 1 h and 4 h since nucleic acid can hardly pass through cell membrane[\u003cspan class=\"CitationRef\"\u003e38\u003c/span\u003e]. However, the green fluorescence was obviously brighter after incubated with PP/siRNA/HA for 4 h, indicating PP/siRNA/HA could be taken up by both A549 cells and A549/T cells. Meanwhile, as incubation time was prolonged, the green fluorescence signals became stronger, indicating that more nanoassemblies were internalized into cells. This phenomenon was also verified by quantitative evaluation by flow cytometry (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eB, C). The results confirmed that the PP/siRNA/HA could promote the uptake of siRNA compared to naked siRNA. Endo/lysosomal escape capacity, avoiding the acid hydrolysis of gene, of FAM-siRNA loaded PP/siRNA/HA was evaluated by CLSM in either A549 or A549/T cells. As shown in Figure S12, we could observe that the FAM-siRNA loaded nanoparticles were mainly entrapped in endo/lysosomal compartments at 1h after uptake, while most FAM-siRNA could successfully escape into the cytoplasm at 4 h. Therefore, the PP/siRNA/HA can exhibit excellent cellular internalization and endo/lysosomal escape ability, and could be used in gene and protein drug delivery.\u003c/p\u003e\n \u003cp\u003eThe internalization of PP/siRNA/HA nanocomplexes was investigated by A549/T cells following treatment with caveolin-mediated endocytosis inhibitors (nystatin), clathrin-mediated endocytosis inhibitors (chlorpromazine), macropinocytosis inhibitors (amiloride), and energy inhibition (4\u0026deg;C), respectively [\u003cspan class=\"CitationRef\"\u003e39\u003c/span\u003e]. As displayed in Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eD, the endocytosis of nanocomplexes was significantly inhibited under microtherm condition (4\u0026deg;C), demonstrating the energy-dependent endocytosis mechanisms. The results in Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eD revealed that nanoparticle uptake was significantly inhibited by chlorpromazine and amiloride treatment, suggesting that clathrin-mediated endocytosis and macropinocytosis may both play a role in the uptake of PP/siRNA/HA. Meanwhile, there is an additional group of overdose HA blocking CD44-receptor to investigate the uptake of PP/siRNA/HA, indicating that the endocytosis would be CD44-mediated endocytosis pathway. Hyaluronic acid, as we all know, can enhance the internalization of nanocomplexes through binding CD44 receptor [\u003cspan class=\"CitationRef\"\u003e40\u003c/span\u003e]. The CD44 expression of A549 cells, A549/T cells, and HepG2 cells (as CD44-negative cells) were detected by Western blotting (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eF). This result demonstrates that the CD44 expression of A549/T cells was significantly higher than A549 cells and HepG2 cells. To evaluate the CD44-mediated internalization, we investigated the uptake of PP/siRNA/HA by flow cytometry (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eG). The fluorescence intensity in A549/T cells was statistically higher than A549 and CD44-negative HepG2, suggesting the high potential targeting ability of HA-coated nanocomplexes.\u003c/p\u003e\n \u003ch2\u003e\u003cstrong\u003eSilences Gene Expression\u003c/strong\u003e \u003cspan class=\"BoldItalic\" name=\"Emphasis\" type=\"BoldItalic\"\u003ein Vitro\u003c/span\u003e\u003c/h2\u003e\n \u003cp\u003eComparing to that on A549 cells, the P-gp on the membrane of A549/T cells was significant over-expressed (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eA). 25 K b-PEI, as we all know, was always used as positive control on account of its excellent transfection efficiency [\u003cspan class=\"CitationRef\"\u003e41\u003c/span\u003e]. After treated with PP/siRNA and PP/siRNA/HA, the amount of P-gp on A549/T cells was significantly reduced. The silence efficiency was confirmed by quantitative PCR (q-PCR) analysis of transfected A549/T cells, the expressions of mdr1 were reduced to 36% and 16% (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eA and B). There is no significant difference in gene silencing between PP/siRNA/HA and 25K PEI. However, it was found that both PP and PP/HA, without siRNA-loading, showed the suppression to mdr1 gene and decreased mdr1 expression to 49% and 30%, respectively. Some previous studies showed that autophagy had an important role in the development of multi-drug resistance [\u003cspan class=\"CitationRef\"\u003e42\u003c/span\u003e]. Furthermore, some compounds like chloroquine or cationic polymers could block normal autophagy flux by alkalizing lysosomes [\u003cspan class=\"CitationRef\"\u003e43\u003c/span\u003e]. Thus, we initially guessed that the gene suppression may be caused by autophagy modulation. In addition, it could be explained for the instability of PP/siRNA without HA-coated that the silence efficiency was lower than PP/HA and PP/siRNA/HA.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec16\"\u003e\n \u003ch2\u003eCytotoxicity and MDR-Reversing of Nanoparticles\u003c/h2\u003e\n \u003cp\u003eThe cytotoxicity levels of different PTX formulations on A549 and A549/T cells were determined by MTT assay [\u003cspan class=\"CitationRef\"\u003e44\u003c/span\u003e]. A549/T cells was selected to study MDR-reversing because it could overexpress P-gp, as mentioned above, and exhibited resistance to PTX. As shown in Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eC, all different PTX formulations could reduce the viability of A549 and A549/T cells and exhibit concentration-dependent cytotoxic effects. The results showed both PTX formulations unfolded excellent anticancer effects on A549 cells (Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eD). The inhibition ratios against A549/T cells were evidently lower than that on A549 because of the drug-resistance of A549/T cells (Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eE). More important, PP/siRNA/HA could more effectively enhance the inhibition ratio of A549/T cells than other PTX formulations. Notably, the excellent anticancer effect of PP/siRNA/HA may suggest gene silencing the cytotoxicity levels of different formulations on A549/T cells having relationship with the suppression of P-gp. Although PP could decrease the expression of P-gp, the inhibition ratio of it was lower than free PTX, which may be interpreted as the nanostructure disturbed by rich serum environment [\u003cspan class=\"CitationRef\"\u003e36\u003c/span\u003e].\u003c/p\u003e\n \u003cp\u003eThe half maximal inhibitory concentration (IC\u003csub\u003e50\u003c/sub\u003e), lower IC\u003csub\u003e50\u003c/sub\u003e representing higher cytotoxicity, were further used to verify the cytotoxicity of the different formulations against cancer cells. Meanwhile, the IC\u003csub\u003e50\u003c/sub\u003e value is one of the most important indexes about drug resistance of cancer cells [\u003cspan class=\"CitationRef\"\u003e9\u003c/span\u003e]. The IC\u003csub\u003e50\u003c/sub\u003e values of different PTX formulations against A549 and A549/T cells were listed in Table \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e. The IC\u003csub\u003e50\u003c/sub\u003e of free PTX on A549/T cells (5.5\u0026thinsp;\u0026plusmn;\u0026thinsp;0.5 ng/mL) was 16.5-fold over that on A549 cells (90.6\u0026thinsp;\u0026plusmn;\u0026thinsp;14.0 ng/mL), indicating the A549/T cells had acquired a great drug-resistance. The IC\u003csub\u003e50\u003c/sub\u003e values to A549 cells were similar and slightly higher than that of free PTX, respectively. This was because active ingredient (PTX) needed released from preparations [\u003cspan class=\"CitationRef\"\u003e37\u003c/span\u003e]. The IC\u003csub\u003e50\u003c/sub\u003e of PP, PP/siRNA, PP/HA, and PP/siRNA/HA against A549/T cells were 35.5\u0026thinsp;\u0026plusmn;\u0026thinsp;14.6 ng/mL, 77.5\u0026thinsp;\u0026plusmn;\u0026thinsp;10.4 ng/mL, 28.4\u0026thinsp;\u0026plusmn;\u0026thinsp;18.1 ng/mL, and 14.0\u0026thinsp;\u0026plusmn;\u0026thinsp;4.4 ng/mL, respectively. PP/siRNA/HA exhibited better cytotoxicity and reversal of drug resistance on A549/T cells than other formulations.\u0026nbsp;\u003c/p\u003e\u0026nbsp;\u003ctable border=\"1\" id=\"Tab2\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eIC\u003csub\u003e50\u003c/sub\u003e values of free PTX, PP, PP/siRNA, PP/HA, and PP/siRNA/HA against A549 and A549/T cells for 48 h\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eIC50(ng/mL)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eA549\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eA549/T\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003ePTX\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e5.5\u0026thinsp;\u0026plusmn;\u0026thinsp;0.47\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e90.6\u0026thinsp;\u0026plusmn;\u0026thinsp;14.00\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003ePP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e5.4\u0026thinsp;\u0026plusmn;\u0026thinsp;0.79\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e35.5\u0026thinsp;\u0026plusmn;\u0026thinsp;14.56\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003ePP/siRNA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e9.9\u0026thinsp;\u0026plusmn;\u0026thinsp;1.67\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e77.5\u0026thinsp;\u0026plusmn;\u0026thinsp;10.43\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003ePP/HA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e7.3\u0026thinsp;\u0026plusmn;\u0026thinsp;0.83\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e28.4\u0026thinsp;\u0026plusmn;\u0026thinsp;18.11\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003ePP/siRNA/HA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e7.6\u0026thinsp;\u0026plusmn;\u0026thinsp;1.69\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e14.0\u0026thinsp;\u0026plusmn;\u0026thinsp;4.35\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003cp\u003e\u003c/p\u003e\n \u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec17\"\u003e\n \u003ch2\u003eCell Apoptosis and Cell Cycle\u003c/h2\u003e\n \u003cp\u003eTo further confirm the therapeutic effect of different PTX formulations on A549 and A549/T cells, the cell apoptosis by Annexin V-FITC/PI staining was performed at the same concentrations of 10 ng/mL PTX. As displayed in the results in Figure S13A, both PTX formulations significantly induced late apoptosis against A549 cells. However, for A549/T cells, free PTX could not induce significant apoptosis (Figure S13B). PP/siRNA/HA induced the highest apoptosis rate (87.9%) against A549/T cells compared with the control (6.7%), and PP/HA could induce similar apoptosis rate (85.4%). Notably, PTX formulations mainly induced early apoptosis against A549 cells but, to A549/T cells, mainly late apoptosis. This may result from the higher tolerance of A549/T cells.\u003c/p\u003e\n \u003cp\u003eAs shown in Figure S14A and B, PTX could tend to arrest A549 cells in G2/M phase. However, the cell cycle of A549/T cells was not significantly different between PTX and controls, further indicating the drug resistance of A549/T cells. PP/siRNA/HA could reduce G0/G1 phase (from 65.7\u0026ndash;34.7%) and tend to arrest in S phase and G2/M phase (Figure S14C). These results confirmed the ability of PP/siRNA/HA to reverse drug resistance.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec18\"\u003e\n \u003ch2\u003eAutophagy Modulation Study\u003c/h2\u003e\n \u003cp\u003eThe gene silences experiments showed that both PP and PP/HA, without siRNA-loading, could suppress mdr1 gene expression (Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eA and B). To better understand the reason that PP and PP/HA decreased mdr1 expression, the LC3/P62 expressions and numbers of autophag/autolysosomes were used to evaluating their autophagy-modulated effects. The symbol of autophagy flux initiation is the conversion of LC3B-I into LC3B-II, LC3B-I is free in cytoplasm but LC3B-II is directly binding to autophagosomes membranes [\u003cspan class=\"CitationRef\"\u003e45\u003c/span\u003e]. Meanwhile, the level of p62, as a degradation substrate of autophagy, can reflect the autophagy flux [\u003cspan class=\"CitationRef\"\u003e46\u003c/span\u003e]. As illustrated in Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eF-H, after treatment by same gene silences experiments, there were significant accumulate of LC3-II and p62 compared to control group. Subsequently, the GFP-LC3 puncta were observed to dramatic increases under CLSM (Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eI-J). Our previous research shows that the abilities of lysosomal acidity and blocking autophagic flux would reflect in the decreased activity of acid phosphatase (ACP) [\u003cspan class=\"CitationRef\"\u003e47\u003c/span\u003e]. As shown in Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003ek, both nanocomplexes could decrease the ACP activity. These results suggested that nanocomplexes (PP, PP/siRNA, PP/HA, and PP/siRNA/HA) could induce autophagosome accumulation and block autophagic flux. Furthermore, we preliminarily considered that PP was the main component to modulating autophagic flux.\u003c/p\u003e\n \u003cp\u003eTo further verify the autophagy modulation of PP, the markers of autophagy were assessed by western blotting and CMSL. CQ, as a common autophagy inhibitor, can block the fusion of autophagosomes via alkalizing lysosomes [\u003cspan class=\"CitationRef\"\u003e48\u003c/span\u003e]. In our study, CQ (10 \u0026micro;M) would be acted as positive control of autophagy inhibition. After treated with PP for 24h, LC3-II/LC3-I ratio showed increased and caused the accumulation of p62 (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eA-C). As showed in Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003ed and e, the GFP-LC3 dots per cell were increased from 7.4 to 28.5 as the concentration increase from 0.1 to 50 \u0026micro;M PP. The relative fluorescence intensities of p62 also were increased from 1.1 to 2.9 (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eF). The results of relative ACP activity confirmed that PP could alkaline lysosome and block degradation of autophagic substrates (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eG). TEM is an important method to observe the ultrastructural features of autophagosomes [\u003cspan class=\"CitationRef\"\u003e49\u003c/span\u003e]. Bio-TEM images showed that upon comparisons with the control, many small double/multi-membrane vesicles and huge vacuoles were observed after treatment of 100 \u0026micro;M PP or PP/siRNA/HA for 24 h (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eH). These results demonstrated that high dose of PP could blocked autophagic flux via alkalizing lysosomes.\u003c/p\u003e\n \u003ch2\u003e\u003cspan class=\"BoldItalic\" name=\"Emphasis\" type=\"BoldItalic\"\u003eIn Vivo\u003c/span\u003e \u003cstrong\u003eBiodistribution\u003c/strong\u003e\u003c/h2\u003e\n \u003cp\u003eThe bio-distribution of Cy5-siRNA loaded nanoassemblies was assessed by \u003cem\u003ein vivo\u003c/em\u003e fluorescence imaging system after the tail vein injection of PP/Cy5-siRNA/HA in mice [\u003cspan class=\"CitationRef\"\u003e50\u003c/span\u003e]. As shown in Fig. \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003eA-C, the fluorescence of naked Cy5-siRNA intensely distributed in the kidneys, but the PP/Cy5-siRNA/HA groups showed fluorescence mainly distributed in the liver, tumor, and kidneys. This could be explained by that Cy5-siRNA in solution could be excreted by the kidneys but the nanoassemblies (~\u0026thinsp;200 nm) could be enriched in liver [\u003cspan class=\"CitationRef\"\u003e51\u003c/span\u003e]. In addition, the fluorescence signals arising from the tumors of mice treated with PP/Cy5-siRNA/HA was 1.9-fold higher than that treated with naked Cy5-siRNA (Fig. \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003eD). This suggests that HA-coated nanoassemblies can not only prolong blood circulation time but also enrich at the level of tumor tissue.\u003c/p\u003e\n \u003ch2\u003e\u003cspan class=\"BoldItalic\" name=\"Emphasis\" type=\"BoldItalic\"\u003eIn Vivo\u003c/span\u003e \u003cstrong\u003eAnti-tumor Effect and RNAi Efficiency\u003c/strong\u003e\u003c/h2\u003e\n \u003cp\u003eThe antitumor effect was further evaluated in A549/T tumor-bearing nude mice. As illustrated in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003eA, there was no significant difference between 0.9% NaCl group and Taxol group. In comparison, PP/siRNA/HA exhibited a superior antitumor efficiency with the tumor growth inhibition rates of 36.43% (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003eC-E). Compared with the 0.9% NaCl and paclitaxel groups, the PP/HA group had enhanced therapeutic effects, but was still insufficient to suppress drug-resistant tumors. The tumor tissue treated with PP/siRNA/HA exhibited a more obviously decline in P-gp protein expression (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003eG) and mdr1 gene expression (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003eJ) compared with other groups. The TUNEL results showed that the PP/siRNA/HA effectively induced more apoptosis in the tumor compared with Taxol and PP/HA (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e8\u003c/span\u003e). The cellular proliferation of tumor was assessed by Ki67 assay (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e8\u003c/span\u003e). Compared with the other groups, the PP/siRNA/HA group had the least cellular proliferation and was found to have the best antitumor efficacy. The result of immunofluorescence staining further confirmed the gene silence efficiency of PP/siRNA/HA with greatly reduced P-gp expression (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e8\u003c/span\u003e). This demonstrated the PP/siRNA/HA nanocomplexes could successfully reverse the drug-resistance of tumors, and realized tumor inhibition by gene/ drug co-delivery. The weights of all groups keep basically untouched throughout the treatment (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003eB). There was no significant physiological morphology abnormality in heart, liver, spleen, lung, and kidney, confirming the safety for these samples (Figure S15).\u003c/p\u003e\n \u003ch2\u003e\u003cspan class=\"BoldItalic\" name=\"Emphasis\" type=\"BoldItalic\"\u003eIn Vivo\u003c/span\u003e \u003cstrong\u003eAutophagy Modulation\u003c/strong\u003e\u003c/h2\u003e\n \u003cp\u003eTo further confirm the autophagy blockade effect of nanocomplexes, the expression of autophagy-associated proteins (LC3 and p62) in tumor were monitored at the end of the treatments. The LC3B-I/II and p62 proteins expression in tumor tissue were evaluated by western bolting and immunofluorescence staining. As showed in Fig. \u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003eF-I, the LC3B-I/II and p62 proteins expression of PP/HA and PP/siRNA/HA were higher than 0.9% NaCl and Taxol. Moreover, there are no significant different between PP/HA and PP/siRNA/HA in the protein expressions of LC3B-I/II and p62. The results of immunofluorescence staining further confirmed the efficiency of blocking autophagic flux (Fig. \u003cspan class=\"InternalRef\"\u003e8\u003c/span\u003e).\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Conclusion","content":"\u003cp\u003eWe have successfully developed PP/siRNA/HA, a gene/drug co-delivery system, for combating MDR to improve clinical chemotherapy. PP is synthesized to load PTX and condense siRNA as the core of nanoassemblies, followed by coating the HA shell. This nanoassemblies can simultaneously load siRNA and PTX, which could down-regulate P-gp and efficaciously inhibit tumor growth. Furthermore, the nanoassemblies exhibited good biocompatibility with targeting lung tumor and long blood circulation time. Unlike other gene/drug delivery systems, the PP/siRNA/HA can induce autophagosome accumulation and blocks autophagic flux, which show potentials in overcoming nonpump resistance. The work provides a simple and effective strategy to combating both pump and nonpump resisitance via suppressing the drug efflux pumps and blocking autophagtic flow. These results support that PP/siRNA/HA could overcome overall MDR to improve chemotherapy \u003cem\u003ein vivo\u003c/em\u003e.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgment\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors thank the Qingdao Science and Technology Demonstration and Guidance Project (21-1-4-rkjk-10-nsh).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eChangduo Wang and Shangcong Han conducted the preparation and characterization. Changduo Wang and Zhipeng Li performed the anti-cancer measurements and data analysis both in vitro and in vivo. Changduo Wang, Zhipeng Li and Ping Xu performed the biodistribution analysis. Changduo Wang and Lisa Xu wrote the manuscript. Yong Sun conceived the idea of nanoassemblies, guided the conduct of studies, supervised data analysis, and authored the manuscript. All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll supporting data for this study are included in this published article and its additional information files. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll the experimental animals were approved by the Qingdao University Laboratory Animal Wefare Ethic Committee (No.20211008BALB/cN3020211129060). All animal experiments complied with the regulations of the Animal Experiments Ethic Committee for the care and use of research animals in Qingdao University. All authors agree to publish this manuscript.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors report no conflicts of interest in this work.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor details\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eChangduo Wang, Zhipeng Li, Shangcong Han and Yong Sun, Department of Pharmaceutics, School of Pharmacy, Qingdao University, Qingdao 266071, China. Ping Xu, Department of Thoracic Surgery, the Second Affiliated Hospital of Qingdao University, Qingdao 266000, China. Lisa Xu, School of Public Health, Qingdao University, Qingdao 266071, China.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003e Lin YX, Wang Y, Wang H: \u003cstrong\u003eRecent Advances in Nanotechnology for Autophagy Detection.\u003c/strong\u003e \u003cem\u003eSmall\u003c/em\u003e2017, \u003cstrong\u003e13:\u003c/strong\u003e1700996.\u003c/li\u003e\n \u003cli\u003e Minko T, Rodriguez-Rodriguez L, Pozharov V: \u003cstrong\u003eNanotechnology approaches for personalized treatment of multidrug resistant cancers.\u003c/strong\u003e \u003cem\u003eAdv Drug Deliv Rev\u003c/em\u003e2013, \u003cstrong\u003e65:\u003c/strong\u003e1880-1895.\u003c/li\u003e\n \u003cli\u003e Wang T, Luo Y, Lv H, Wang J, Zhang Y, Pei R: \u003cstrong\u003eAptamer-Based Erythrocyte-Derived Mimic Vesicles Loaded with siRNA and Doxorubicin for the Targeted Treatment of Multidrug-Resistant Tumors.\u003c/strong\u003e \u003cem\u003eACS Appl Mater Interfaces\u003c/em\u003e2019, \u003cstrong\u003e11:\u003c/strong\u003e45455-45466.\u003c/li\u003e\n \u003cli\u003e Shen J, Wang Q, Hu Q, Li Y, Tang G, Chu PK: \u003cstrong\u003eRestoration of chemosensitivity by multifunctional micelles mediated by P-gp siRNA to reverse MDR.\u003c/strong\u003e \u003cem\u003eBiomaterials\u003c/em\u003e2014, \u003cstrong\u003e35:\u003c/strong\u003e8621-8634.\u003c/li\u003e\n \u003cli\u003e Zhang R, Gao S, Wang Z, Han D, Liu L, Ma Q, Tan W, Tian J, Chen X: \u003cstrong\u003eMultifunctional Molecular Beacon Micelles for Intracellular mRNA Imaging and Synergistic Therapy in Multidrug-Resistant Cancer Cells.\u003c/strong\u003e \u003cem\u003eAdv Funct Mater\u003c/em\u003e2017, \u003cstrong\u003e27\u003c/strong\u003e.\u003c/li\u003e\n \u003cli\u003e Zheng W, Cao C, Liu Y, Yu Q, Zheng C, Sun D, Ren X, Liu J: \u003cstrong\u003eMultifunctional polyamidoamine-modified selenium nanoparticles dual-delivering siRNA and cisplatin to A549/DDP cells for reversal multidrug resistance.\u003c/strong\u003e \u003cem\u003eActa Biomater\u003c/em\u003e2015, \u003cstrong\u003e11:\u003c/strong\u003e368-380.\u003c/li\u003e\n \u003cli\u003e Liu M, Fu M, Yang X, Jia G, Shi X, Ji J, Liu X, Zhai G: \u003cstrong\u003ePaclitaxel and quercetin co-loaded functional mesoporous silica nanoparticles overcoming multidrug resistance in breast cancer.\u003c/strong\u003e \u003cem\u003eColloids Surf B Biointerfaces\u003c/em\u003e2020, \u003cstrong\u003e196:\u003c/strong\u003e111284.\u003c/li\u003e\n \u003cli\u003e Wang Y, Wang F, Liu Y, Xu S, Shen Y, Feng N, Guo S: \u003cstrong\u003eGlutathione detonated and pH responsive nano-clusters of Au nanorods with a high dose of DOX for treatment of multidrug resistant cancer.\u003c/strong\u003e \u003cem\u003eActa Biomater\u003c/em\u003e2018, \u003cstrong\u003e75:\u003c/strong\u003e334-345.\u003c/li\u003e\n \u003cli\u003e Yin Q, Shen J, Chen L, Zhang Z, Gu W, Li Y: \u003cstrong\u003eOvercoming multidrug resistance by co-delivery of Mdr-1 and survivin-targeting RNA with reduction-responsible cationic poly(\u0026beta;-amino esters).\u003c/strong\u003e \u003cem\u003eBiomaterials\u003c/em\u003e2012, \u003cstrong\u003e33:\u003c/strong\u003e6495-6506.\u003c/li\u003e\n \u003cli\u003e Zhu KY, Palli SR: \u003cstrong\u003eMechanisms, Applications, and Challenges of Insect RNA Interference.\u003c/strong\u003e \u003cem\u003eAnnu Rev Entomol\u003c/em\u003e2020, \u003cstrong\u003e65:\u003c/strong\u003e293-311.\u003c/li\u003e\n \u003cli\u003e Yan J, Zhan X, Zhang Z, Chen K, Wang M, Sun Y, He B, Liang Y: \u003cstrong\u003eTetrahedral DNA nanostructures for effective treatment of cancer: advances and prospects.\u003c/strong\u003e \u003cem\u003eJ Nanobiotechnology\u003c/em\u003e2021, \u003cstrong\u003e19:\u003c/strong\u003e412.\u003c/li\u003e\n \u003cli\u003e He W, Guo Z, Wen Y, Wang Q, Xie B, Zhu S, Wang Q: \u003cstrong\u003eAlginate-graft-PEI as a gene delivery vector with high efficiency and low cytotoxicity.\u003c/strong\u003e \u003cem\u003eJ Biomater Sci Polym Ed\u003c/em\u003e2012, \u003cstrong\u003e23:\u003c/strong\u003e315-331.\u003c/li\u003e\n \u003cli\u003e Lee J, Sands I, Zhang W, Zhou L, Chen Y: \u003cstrong\u003eDNA-inspired nanomaterials for enhanced endosomal escape.\u003c/strong\u003e \u003cem\u003eProc Natl Acad Sci U S A\u003c/em\u003e2021, \u003cstrong\u003e118\u003c/strong\u003e.\u003c/li\u003e\n \u003cli\u003e Hashemzadeh I, Hasanzadeh A, Radmanesh F, Khodadadi Chegeni B, Hosseini ES, Kiani J, Shahbazi A, Naseri M, Fatahi Y, Nourizadeh H, et al: \u003cstrong\u003ePolyethylenimine-Functionalized Carbon Dots for Delivery of CRISPR/Cas9 Complexes.\u003c/strong\u003e \u003cem\u003eACS Appl Bio Mater\u003c/em\u003e2021, \u003cstrong\u003e4:\u003c/strong\u003e7979-7992.\u003c/li\u003e\n \u003cli\u003e Yan J, Chen J, Zhang N, Yang Y, Zhu W, Li L, He B: \u003cstrong\u003eMitochondria-targeted tetrahedral DNA nanostructures for doxorubicin delivery and enhancement of apoptosis.\u003c/strong\u003e \u003cem\u003eJ Mater Chem B\u003c/em\u003e2020, \u003cstrong\u003e8:\u003c/strong\u003e492-503.\u003c/li\u003e\n \u003cli\u003e Chen W, Shi K, Chu B, Wei X, Qian Z: \u003cstrong\u003eMitochondrial Surface Engineering for Multidrug Resistance Reversal.\u003c/strong\u003e \u003cem\u003eNano Lett\u003c/em\u003e2019, \u003cstrong\u003e19:\u003c/strong\u003e2905-2913.\u003c/li\u003e\n \u003cli\u003e Liang B, Liu X, Liu Y, Kong D, Liu X, Zhong R, Ma S: \u003cstrong\u003eInhibition of autophagy sensitizes MDR-phenotype ovarian cancer SKVCR cells to chemotherapy.\u003c/strong\u003e \u003cem\u003eBiomed Pharmacother\u003c/em\u003e2016, \u003cstrong\u003e82:\u003c/strong\u003e98-105.\u003c/li\u003e\n \u003cli\u003e Guo JY, Xia B, White E: \u003cstrong\u003eAutophagy-mediated tumor promotion.\u003c/strong\u003e \u003cem\u003eCell\u003c/em\u003e2013, \u003cstrong\u003e155:\u003c/strong\u003e1216-1219.\u003c/li\u003e\n \u003cli\u003e Zhang Y, Zhang L, Gao J, Wen L: \u003cstrong\u003ePro-Death or Pro-Survival: Contrasting Paradigms on Nanomaterial-Induced Autophagy and Exploitations for Cancer Therapy.\u003c/strong\u003e \u003cem\u003eAcc Chem Res\u003c/em\u003e2019, \u003cstrong\u003e52:\u003c/strong\u003e3164-3176.\u003c/li\u003e\n \u003cli\u003e Lin J, Huang Z, Wu H, Zhou W, Jin P, Wei P, Zhang Y, Zheng F, Zhang J, Xu J, et al: \u003cstrong\u003eInhibition of autophagy enhances the anticancer activity of silver nanoparticles.\u003c/strong\u003e \u003cem\u003eAutophagy\u003c/em\u003e2014, \u003cstrong\u003e10:\u003c/strong\u003e2006-2020.\u003c/li\u003e\n \u003cli\u003e Sun WL, Lan D, Gan TQ, Cai ZW: \u003cstrong\u003eAutophagy facilitates multidrug resistance development through inhibition of apoptosis in breast cancer cells.\u003c/strong\u003e \u003cem\u003eNeoplasma\u003c/em\u003e2015, \u003cstrong\u003e62:\u003c/strong\u003e199-208.\u003c/li\u003e\n \u003cli\u003e Mauthe M, Orhon I, Rocchi C, Zhou X, Luhr M, Hijlkema KJ, Coppes RP, Engedal N, Mari M, Reggiori F: \u003cstrong\u003eChloroquine inhibits autophagic flux by decreasing autophagosome-lysosome fusion.\u003c/strong\u003e \u003cem\u003eAutophagy\u003c/em\u003e2018, \u003cstrong\u003e14:\u003c/strong\u003e1435-1455.\u003c/li\u003e\n \u003cli\u003e Chen X, Tao Y, He M, Deng M, Guo R, Sheng Q, Wang X, Ren K, Li T, He X, et al: \u003cstrong\u003eCo-delivery of autophagy inhibitor and gemcitabine using a pH-activatable core-shell nanobomb inhibits pancreatic cancer progression and metastasis.\u003c/strong\u003e \u003cem\u003eTheranostics\u003c/em\u003e2021, \u003cstrong\u003e11:\u003c/strong\u003e8692-8705.\u003c/li\u003e\n \u003cli\u003e Zhao L, Yang G, Shi Y, Su C, Chang J: \u003cstrong\u003eCo-delivery of Gefitinib and chloroquine by chitosan nanoparticles for overcoming the drug acquired resistance.\u003c/strong\u003e \u003cem\u003eJ Nanobiotechnology\u003c/em\u003e2015, \u003cstrong\u003e13:\u003c/strong\u003e57.\u003c/li\u003e\n \u003cli\u003e Gao M, Xu Y, Qiu L: \u003cstrong\u003eEnhanced combination therapy effect on paclitaxel-resistant carcinoma by chloroquine co-delivery via liposomes.\u003c/strong\u003e \u003cem\u003eInt J Nanomedicine\u003c/em\u003e2015, \u003cstrong\u003e10:\u003c/strong\u003e6615-6632.\u003c/li\u003e\n \u003cli\u003e Panagiotaki KN, Sideratou Z, Vlahopoulos SA, Paravatou-Petsotas M, Zachariadis M, Khoury N, Zoumpourlis V, Tsiourvas D: \u003cstrong\u003eA Triphenylphosphonium-Functionalized Mitochondriotropic Nanocarrier for Efficient Co-Delivery of Doxorubicin and Chloroquine and Enhanced Antineoplastic Activity.\u003c/strong\u003e \u003cem\u003ePharmaceuticals (Basel)\u003c/em\u003e2017, \u003cstrong\u003e10\u003c/strong\u003e.\u003c/li\u003e\n \u003cli\u003e Yusuf IH, Sharma S, Luqmani R, Downes SM: \u003cstrong\u003eHydroxychloroquine retinopathy.\u003c/strong\u003e \u003cem\u003eEye (Lond)\u003c/em\u003e2017, \u003cstrong\u003e31:\u003c/strong\u003e828-845.\u003c/li\u003e\n \u003cli\u003e Stokkermans TJ, Goyal A, Bansal P, Trichonas G: \u003cstrong\u003eChloroquine And Hydroxychloroquine Toxicity.\u003c/strong\u003e In \u003cem\u003eStatPearls.\u003c/em\u003e Treasure Island (FL): Archives of Ophthalmology; 2022\u003c/li\u003e\n \u003cli\u003e Marmor MF, Kellner U, Lai TY, Melles RB, Mieler WF: \u003cstrong\u003eRecommendations on Screening for Chloroquine and Hydroxychloroquine Retinopathy (2016 Revision).\u003c/strong\u003e \u003cem\u003eOphthalmology\u003c/em\u003e2016, \u003cstrong\u003e123:\u003c/strong\u003e1386-1394.\u003c/li\u003e\n \u003cli\u003e Panzarini E, Dini L: \u003cstrong\u003eNanomaterial-induced autophagy: a new reversal MDR tool in cancer therapy?\u003c/strong\u003e \u003cem\u003eMol Pharm\u003c/em\u003e2014, \u003cstrong\u003e11:\u003c/strong\u003e2527-2538.\u003c/li\u003e\n \u003cli\u003e Ma X, Wu Y, Jin S, Tian Y, Zhang X, Zhao Y, Yu L, Liang XJ: \u003cstrong\u003eGold nanoparticles induce autophagosome accumulation through size-dependent nanoparticle uptake and lysosome impairment.\u003c/strong\u003e \u003cem\u003eACS Nano\u003c/em\u003e2011, \u003cstrong\u003e5:\u003c/strong\u003e8629-8639.\u003c/li\u003e\n \u003cli\u003e Lin YX, Wang Y, Qiao SL, An HW, Zhang RX, Qiao ZY, Rajapaksha RP, Wang L, Wang H: \u003cstrong\u003epH-Sensitive Polymeric Nanoparticles Modulate Autophagic Effect via Lysosome Impairment.\u003c/strong\u003e \u003cem\u003eSmall\u003c/em\u003e2016, \u003cstrong\u003e12:\u003c/strong\u003e2921-2931.\u003c/li\u003e\n \u003cli\u003e Li N, Han S, Ma B, Huang X, Xu L, Cao J, Sun Y: \u003cstrong\u003eChemosensitivity enhanced by autophagy inhibition based on a polycationic nano-drug carrier.\u003c/strong\u003e \u003cem\u003eNanoscale Advances\u003c/em\u003e2021, \u003cstrong\u003e3:\u003c/strong\u003e1656-1673.\u003c/li\u003e\n \u003cli\u003e Jia N, Ma J, Gao Y, Hu H, Chen D, Zhao X, Yuan Y, Qiao M: \u003cstrong\u003eHA-Modified R8-Based Bola-Amphiphile Nanocomplexes for Effective Improvement of siRNA Delivery Efficiency.\u003c/strong\u003e \u003cem\u003eACS Biomater Sci Eng\u003c/em\u003e2020, \u003cstrong\u003e6:\u003c/strong\u003e2084-2093.\u003c/li\u003e\n \u003cli\u003e Yan J, Zhang Z, Zhan X, Chen K, Pu Y, Liang Y, He B: \u003cstrong\u003eIn situ injection of dual-delivery PEG based MMP-2 sensitive hydrogels for enhanced tumor penetration and chemo-immune combination therapy.\u003c/strong\u003e \u003cem\u003eNanoscale\u003c/em\u003e2021, \u003cstrong\u003e13:\u003c/strong\u003e9577-9589.\u003c/li\u003e\n \u003cli\u003e Liu H, Liu C, Ye L, Ma D, He X, Tang Q, Zhao X, Zou H, Chen X, Liu P: \u003cstrong\u003eNanoassemblies with Effective Serum Tolerance Capability Achieving Robust Gene Silencing Efficacy for Breast Cancer Gene Therapy.\u003c/strong\u003e \u003cem\u003eAdv Mater\u003c/em\u003e2021, \u003cstrong\u003e33:\u003c/strong\u003ee2003523.\u003c/li\u003e\n \u003cli\u003e Zhao D, Zhang H, Yang S, He W, Luan Y: \u003cstrong\u003eRedox-sensitive mPEG-SS-PTX/TPGS mixed micelles: An efficient drug delivery system for overcoming multidrug resistance.\u003c/strong\u003e \u003cem\u003eInt J Pharm\u003c/em\u003e2016, \u003cstrong\u003e515:\u003c/strong\u003e281-292.\u003c/li\u003e\n \u003cli\u003e Zou M, Du Y, Liu R, Zheng Z, Xu J: \u003cstrong\u003eNanocarrier-delivered small interfering RNA for chemoresistant ovarian cancer therapy.\u003c/strong\u003e \u003cem\u003eWiley Interdiscip Rev RNA\u003c/em\u003e2021, \u003cstrong\u003e12:\u003c/strong\u003ee1648.\u003c/li\u003e\n \u003cli\u003e Musalli AH, Talukdar PD, Roy P, Kumar P, Wong TW: \u003cstrong\u003eFolate-induced nanostructural changes of oligochitosan nanoparticles and their fate of cellular internalization by melanoma.\u003c/strong\u003e \u003cem\u003eCarbohydr Polym\u003c/em\u003e2020, \u003cstrong\u003e244:\u003c/strong\u003e116488.\u003c/li\u003e\n \u003cli\u003e Maiolino S, Moret F, Conte C, Fraix A, Tirino P, Ungaro F, Sortino S, Reddi E, Quaglia F: \u003cstrong\u003eHyaluronan-decorated polymer nanoparticles targeting the CD44 receptor for the combined photo/chemo-therapy of cancer.\u003c/strong\u003e \u003cem\u003eNanoscale\u003c/em\u003e2015, \u003cstrong\u003e7:\u003c/strong\u003e5643-5653.\u003c/li\u003e\n \u003cli\u003e Zhou Z, Zhang Q, Zhang M, Li H, Chen G, Qian C, Oupicky D, Sun M: \u003cstrong\u003eATP-activated decrosslinking and charge-reversal vectors for siRNA delivery and cancer therapy.\u003c/strong\u003e \u003cem\u003eTheranostics\u003c/em\u003e2018, \u003cstrong\u003e8:\u003c/strong\u003e4604-4619.\u003c/li\u003e\n \u003cli\u003e Wang B, Feng D, Han L, Fan J, Zhang X, Wang X, Ye L, Shi X, Feng M: \u003cstrong\u003eCombination of apolipoprotein A1-modi liposome-doxorubicin with autophagy inhibitors overcame drug resistance in vitro.\u003c/strong\u003e \u003cem\u003eJ Pharm Sci\u003c/em\u003e2014, \u003cstrong\u003e103:\u003c/strong\u003e3994-4004.\u003c/li\u003e\n \u003cli\u003e Shi C, Zhang Z, Shi J, Wang F, Luan Y: \u003cstrong\u003eCo-delivery of docetaxel and chloroquine via PEO-PPO-PCL/TPGS micelles for overcoming multidrug resistance.\u003c/strong\u003e \u003cem\u003eInt J Pharm\u003c/em\u003e2015, \u003cstrong\u003e495:\u003c/strong\u003e932-939.\u003c/li\u003e\n \u003cli\u003e Li Z, Wang F, Li Y, Wang X, Lu Q, Wang D, Qi C, Li C, Li Z, Lian B, et al: \u003cstrong\u003eCombined anti-hepatocellular carcinoma therapy inhibit drug-resistance and metastasis via targeting \u0026quot;substance P-hepatic stellate cells-hepatocellular carcinoma\u0026quot; axis.\u003c/strong\u003e \u003cem\u003eBiomaterials\u003c/em\u003e2021, \u003cstrong\u003e276:\u003c/strong\u003e121003.\u003c/li\u003e\n \u003cli\u003e Kaizuka T, Morishita H, Hama Y, Tsukamoto S, Matsui T, Toyota Y, Kodama A, Ishihara T, Mizushima T, Mizushima N: \u003cstrong\u003eAn Autophagic Flux Probe that Releases an Internal Control.\u003c/strong\u003e \u003cem\u003eMol Cell\u003c/em\u003e2016, \u003cstrong\u003e64:\u003c/strong\u003e835-849.\u003c/li\u003e\n \u003cli\u003e Rathore B, Sunwoo K, Jangili P, Kim J, Kim JH, Huang M, Xiong J, Sharma A, Yang Z, Qu J, Kim JS: \u003cstrong\u003eNanomaterial designing strategies related to cell lysosome and their biomedical applications: A review.\u003c/strong\u003e \u003cem\u003eBiomaterials\u003c/em\u003e2019, \u003cstrong\u003e211:\u003c/strong\u003e25-47.\u003c/li\u003e\n \u003cli\u003e Feng A, Gao L, Yue P, Liu Y, Zhou Q, Ren Z, Teng J: \u003cstrong\u003eAutophagy-lysosome dysfunction is involved in gastric ischemia-reperfusion injury by promoting microglial activation in the paraventricular nucleus.\u003c/strong\u003e \u003cem\u003eJ Biochem Mol Toxicol\u003c/em\u003e2021\u003cstrong\u003e:\u003c/strong\u003ee22957.\u003c/li\u003e\n \u003cli\u003e Chen X, Yu Q, Liu Y, Sheng Q, Shi K, Wang Y, Li M, Zhang Z, He Q: \u003cstrong\u003eSynergistic cytotoxicity and co-autophagy inhibition in pancreatic tumor cells and cancer-associated fibroblasts by dual functional peptide-modified liposomes.\u003c/strong\u003e \u003cem\u003eActa Biomater\u003c/em\u003e2019, \u003cstrong\u003e99:\u003c/strong\u003e339-349.\u003c/li\u003e\n \u003cli\u003e Lin YX, Wang Y, Wang H: \u003cstrong\u003eRecent Advances in Nanotechnology for Autophagy Detection.\u003c/strong\u003e \u003cem\u003eSmall\u003c/em\u003e2017, \u003cstrong\u003e13\u003c/strong\u003e.\u003c/li\u003e\n \u003cli\u003e Yhee JY, Song S, Lee SJ, Park SG, Kim KS, Kim MG, Son S, Koo H, Kwon IC, Jeong JH, et al: \u003cstrong\u003eCancer-targeted MDR-1 siRNA delivery using self-cross-linked glycol chitosan nanoparticles to overcome drug resistance.\u003c/strong\u003e \u003cem\u003eJ Control Release\u003c/em\u003e2015, \u003cstrong\u003e198:\u003c/strong\u003e1-9.\u003c/li\u003e\n \u003cli\u003e Wang H, Zhang F, Wen H, Shi W, Huang Q, Huang Y, Xie J, Li P, Chen J, Qin L, Zhou Y: \u003cstrong\u003eTumor- and mitochondria-targeted nanoparticles eradicate drug resistant lung cancer through mitochondrial pathway of apoptosis.\u003c/strong\u003e \u003cem\u003eJ Nanobiotechnology\u003c/em\u003e2020, \u003cstrong\u003e18:\u003c/strong\u003e8.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"journal-of-nanobiotechnology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"jnan","sideBox":"Learn more about [Journal of Nanobiotechnology](http://jnanobiotechnology.biomedcentral.com)","snPcode":"12951","submissionUrl":"https://submission.nature.com/new-submission/12951/3","title":"Journal of Nanobiotechnology","twitterHandle":"@BioMedCentral","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"MDR, autophagy, siRNA, tumor therapy, prodrug","lastPublishedDoi":"10.21203/rs.3.rs-1495473/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-1495473/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eMultidrug resistance (MDR) has been restricting the efficacy of chemotherapy, which mainly include pump resistance and nonpump resistance. In order to fight overall MDR, a novel targeted gene/drug co-deliver nano system is developed, which can suppress the drug efflux pumps and modulate autophagy to overcoming both pump and nonpump resistance. RNA interference (RNAi) is widely applied in combating MDR through knocking down MDR-related gene. Here, small interfere RNA (siRNA) is incorporated into polymer-drug conjugates (PP) which are composed of polyethyleneimine (PEI) and paclitaxel (PTX) via covalent bonds, and hyaluronic acid (HA) is coated on the surface of PP/siRNA to achieve long blood cycle and CD44-targeted delivery. The polymeric nanoassemblies (PP/siRNA/HA) would be shattered and release PTX under the enrich-enzyme intracellular environment. This study identifies PP/siRNA/HA could efficiently facilitate apoptosis of Taxol-resistant lung cancer cells (A549/T) to reverse MDR through down-regulating P-gp and block autophagic flux. Further study indicates that PEI conjugates play a significant role to block the autophagosome\u0026ndash;lysosome fusion process by means of alkalizing lysosomes. Both in vitro and in vivo studies confirm that the nanoassemblies can successfully deliver drug into tumor cells and significantly inhibited A549/T tumor growth. In summary, the polymeric nanoassemblies provide a potential strategy for combating both pump and nonpump resistance via the synergism of RNAi and autophagy modulation.\u003c/p\u003e","manuscriptTitle":"Polymeric Nanoassemblies based Gene/drug Co-delivery for Autophagy Modulation and Tumor Multidrug-resistance","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2022-04-06 15:50:57","doi":"10.21203/rs.3.rs-1495473/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Major revision","date":"2022-04-18T22:38:17+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2022-04-12T06:36:20+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"670f9657-f2ce-4f02-935d-4c781d42234b","date":"2022-04-04T21:49:17+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2022-04-04T21:17:11+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2022-04-04T05:24:24+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2022-04-04T05:24:24+00:00","index":"","fulltext":""},{"type":"submitted","content":"Journal of Nanobiotechnology","date":"2022-03-28T02:13:02+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"journal-of-nanobiotechnology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"jnan","sideBox":"Learn more about [Journal of Nanobiotechnology](http://jnanobiotechnology.biomedcentral.com)","snPcode":"12951","submissionUrl":"https://submission.nature.com/new-submission/12951/3","title":"Journal of Nanobiotechnology","twitterHandle":"@BioMedCentral","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"b277dc35-3023-4aa5-9865-018376188db3","owner":[],"postedDate":"April 6th, 2022","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2022-10-26T21:14:15+00:00","versionOfRecord":[],"versionCreatedAt":"2022-04-06 15:50:57","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-1495473","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-1495473","identity":"rs-1495473","version":["v1"]},"buildId":"WrCJVZZCHTDjtuVLN7oU0","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}