The impact of metformin on the Bcl-2/Bax/Caspase3 signaling pathway in placental tissue of preeclampsia rats

The impact of metformin on the Bcl-2/Bax/Caspase3 signaling pathway in placental tissue of preeclampsia rats | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article The impact of metformin on the Bcl-2/Bax/Caspase3 signaling pathway in placental tissue of preeclampsia rats Huiniu HAO, Fang Wang, Ran Jia, Yinmin Chen, Hailan Yang, Huijing Ma This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4390427/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background: Preeclampsia (PE) is one of the leading complications affecting pregnant women globally during the perinatal period, with excessive apoptosis of trophoblast cells playing a crucial role in its pathogenesis. While Metformin (MET) has shown promise in preventing or treating PE, its mechanisms remain unclear. Objective: We sought to establish a PE rat model and evaluate MET's impact on the intrinsic (mitochondrial) apoptotic pathway (Bcl-2/Bax/Caspase3) in placental cells. We investigated whether MET could reduce excessive trophoblast cell apoptosis through this pathway, thereby improving pregnancy outcomes in PE rats. Methods: Thirty successfully impregnated Sprague-Dawley (SD) rats were randomly divided into normal saline (NS), PE, and PE+MET groups. The NS group received physiological saline injections (200mg/kg/d) from gestational day 14 to gestational day 18 (GD14-GD18). The PE and PE+MET groups received L-NAME injections (200mg/kg/d) from gestational day 14 to 18 (GD14-GD18). The PE+MET group additionally received MET via gastric gavage from GD13 to GD18. Western blot, RT-qPCR, and immunohistochemistry were employed to assess the expression of Bcl-2, Bax, and Caspase3 in placental tissues. ELISA was used to measure the expression of Bcl-2, Bax, Caspase3, tumor necrosis factor-α (TNF-α), interleukin-6 (IL-6), interleukin-10 (IL-10), soluble FMS-like tyrosine kinase 1 (sFlt-1), soluble endoglin (sEng), placental growth factor (PlGF), and endothelial nitric oxide synthase (eNOS) in serum. Results: MET treatment reduced blood pressure and proteinuria in PE rats and improved pregnancy outcomes. It lowered serum levels of pro-inflammatory cytokines (TNF-α, IL-6) and increased the anti-inflammatory cytokine IL-10 in PE rats. MET also restored the balance of angiogenic factors. Moreover, MET upregulated Bcl-2 expression and suppressed Bax and Caspase3 levels, suggesting its ability to suppress excessive trophoblast cell apoptosis. Conclusion: MET effectively mitigated PE in L-NAME-induced rats by lowering blood pressure, proteinuria, inflammatory damage, and trophoblast cell death while improving pregnancy outcomes and restoring the balance of angiogenic factors. This effect appears to be mediated, at least partly, by modulating the Bcl-2/Bax/Caspase3 apoptotic pathway. Preeclampsia Metformin Bcl-2/Bax/Caspase3 pathway Cell apoptosis Inflammation Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction Pre-eclampsia (PE), a complication typically observed in pregnant women, is marked by elevated blood pressure (BP) and proteinuria, posing significant threats to maternal and neonatal health, and is a major contributor to increased maternal and neonatal mortality rates worldwide(Cui et al., 2022 ; de Alwis et al., 2022 ). PE is a dynamic condition that can potentially lead to hepatic and renal dysfunction, thrombocytopenia, pulmonary edema, visual disturbances, or central nervous system abnormalities. In extreme cases, it may progress to eclampsia(Dimitriadis et al., 2023 ). This multifactorial, multi-mechanistic, and multi-pathway disorder has growing evidence highlighting the placenta as its central pathological mechanism(Dimitriadis et al., 2023 ). Insufficient invasion of uterine trophoblast cells, inadequate remodeling of spiral arteries, and excessive apoptosis of placental trophoblast cells are key pathological features(Rana, Lemoine, Granger, & Karumanchi, 2019 ). Recently, increasing attention has been focused on the excessive apoptosis of trophoblast layer cells in PE(Xu et al., 2019 ). In PE patients, inadequate remodeling of uterine spiral arteries results in decreased placental perfusion pressure. This leads to long-term ischemia-reperfusion injury to trophoblast layer cells, generating excessive reactive oxygen species (ROS) that disrupt the balance between inflammation and apoptosis, ultimately causing excessive apoptosis(G. Wang et al., 2022 ). Poor development of placental vasculature, resulting in diminished blood perfusion and a state of chronic oxygen deprivation, serve as the primary triggers for apoptosis within trophoblast layer cells(Melchiorre, Giorgione, & Thilaganathan, 2022 ). Bcl-2, a pivotal protein within the Bcl-2 family known for its suppression of apoptosis, can alleviate mitochondria-dependent cell apoptosis(Akgul, Moulding, & Edwards, 2004 ). Several studies have indicated decreased expression of Bcl-2 in PE(Tong, Niu, Chen, & Zhang, 2020 ). Meanwhile, Bax, belonging to the Bcl-2 family, acts as a pro-apoptotic factor and promotes the release of cytochrome C (CytC) from mitochondria during stress, leading to the formation of apoptotic bodies with other apoptotic factors in the cytoplasm, activating pro-Caspase3 into its active form, thus causing cell death(Raguema, Moustadraf, & Bertagnolli, 2020 ). Currently, treatment options for PE patients are limited, with delivery remaining the most effective approach. Metformin (MET), a medication commonly used orally for type 2 diabetes, has shown promise for both preventing and treating PE(Gatford, Andraweera, Roberts, & Care, 2020 ; LaMoia & Shulman, 2021 ). MET can inhibit cellular apoptosis induced by methylglyoxal (MGO) by suppressing oxidative stress both internally and externally(G. Wang et al., 2022 ). This reduces the production of soluble FMS-like tyrosine kinase 1 (sFlt-1) and soluble endoglin (sEng), thereby improving endothelial dysfunction in PE(Kaitu'u-Lino et al., 2018 ). Additionally, MET can activate the AMPK pathway, which in turn modulates the NF-κB/sFlt-1 and Nrf2/HO-1 pathways, ultimately inhibiting apoptosis and inflammatory damage to human trophoblast cells (HTR-8/SVneo)(He, Wu, Zhan, Li, & Wu, 2023 ). Compared to normal pregnancy, excessive activation of immune cells against the trophoblast layer, a key mechanism triggering trophoblast cell apoptosis in PE, primarily occurs within the mitochondria(Raguema et al., 2020 ). MET's low toxicity and minimal side effects make it a relatively safe option, and its small molecular weight allows for easy passage through the placenta(Romero et al., 2017 ). However, research on the mechanism by which MET attenuates excessive apoptosis of trophoblast layer cells in PE placentas remains limited. Therefore, we sought to investigate the impact of MET on apoptosis in trophoblast layer cells in rat models of L-NAME-induced preeclampsia. Materials and Methods Preeclampsia Rat Model This study utilized thirty female Sprague-Dawley rats aged 8-10 weeks and weighing between 220 and 260 grams. After mating with adult males, vaginal smears confirmed pregnancy on day zero (GD 0). Throughout the experiment, the rats lived in standard laboratory conditions with unrestricted access to food and water. Following random assignment, the pregnant rats were divided into three groups ( Fig. 1 ): The first group (NS, n=10) received daily subcutaneous saline injections (200mg/kg/d) from GD 14 to GD 18. The second group (PE, n=10) received daily L-NAME injections (200mg/kg/d) subcutaneously during the same period (GD 14 to GD 18). The third group (PE+MET, n=10) received both L-NAME injections (200mg/kg/d) subcutaneously and oral gavage of MET (200mg/kg/d) from GD 13 to GD 18. The study adhered to ethical guidelines established by the Ethics Committee of Experimental Animals at the First Hospital of Shanxi Medical University (DWLL-2024-0023) and the Institutional Animal Care and Use Committee of Shanxi Medical University Experimental Animal Center (licenses: Animal License: SYXK (Jin) 2019-0008, Animal Production License: SCXK (Jin) 2019-004). Blood Pressure and Proteinuria Measurement Blood Pressure Measurement: Tail artery BP was assessed in the pregnant rats throughout gestation using a specialized non-invasive rodent BP measurement device (BW-NIBP1106, Nanjing Calvin). Measurements were taken on gestational days 0, 6, 12, 15, 17, and 19 (GD0, GD6, etc.). Prior to each measurement, the rats were gently restrained, and the device was pre-warmed to 36°C to ensure comfort. Three blood pressure readings were obtained for each rat, and the average value was recorded. 24-Hour Urinary Protein Determination: Pregnant rats were monitored for urine protein levels on GD12 and GD19. A method utilizing Coomassie Brilliant Blue reagent (A045-2-2, Nanjing Jiancheng) was employed to quantify protein concentration. Samples were thoroughly mixed with the reagent and incubated for 10 minutes. Following incubation, absorbance was measured at a wavelength of 595nm. The protein content within the 24-hour urine samples was then calculated based on the obtained absorbance values. Specimen Collection On GD20 of pregnancy, pregnant rats were anesthetized, followed by maternal blood collection. Fetal pups and placentas were then carefully separated. Placental diameter and weight were measured, along with the body weight and crown-rump length of the fetal pups. Some placental samples were stored in 4% paraformaldehyde, while the remainder was cryopreserved at -80°. RT-qPCR A homogenization technique was used to completely break down placental tissue with TRIzol reagent (15596026CN, Ambion) to isolate all the RNA content, and RNA purity was determined. Reverse transcription of RNA to cDNA was performed using the Mei5bio kit (MF-166, PolymerMei). Next, real-time quantitative PCR (RT-qPCR) was performed using the Mei5bio kit (MF787, PolymerMei) on a LightCycler System. The reaction conditions were as follows: an initial denaturation step at 95°C for 30 s, followed by 40 cycles of denaturation at 95°C for 5 s, annealing at 60°C for 20 s, and a final extension step at 65°C for 15 s. The relative expression levels of target mRNAs were calculated using the 2 -ΔΔCT method using β-actin as the reference gene. The primers were：Bcl-2 (Forward): TGGAGAGCGTCAACAGGGAGATG, (Reverse): GGTGTGCAGATGCCGGTTCAG; Bax (Forward): GACGCATCCACCAAGAAGCTGAG, (Reverse): GCTGCCACACGGAAGAAGACC; Caspase3 (Forward): ACGAACGGACCTGTGGACCTG, (Reverse): AAGAGTTTCGGCTTTCCAGTCAGAC; β-actin (Forward): CGCTTCGGCAGCACATATAC, (Reverse): TTCACGAATTTGCGTGTCATC. Western Blot Protein extraction and Western blot analysis were employed to investigate the expression levels of Bcl-2, Bax, Caspase3, and β-actin in placental tissue. Placental lysates were prepared using a commercially available protein lysis buffer (AR0102, Boster) supplemented with a protease inhibitor cocktail (AR1178, Boster) to prevent protein degradation. Protein concentration was then quantified with a BCA assay kit (AR0146, Boster). Equal amounts of protein (30 μg) were denatured by boiling with protein loading buffer (AR1112-10, Boster) for 5 minutes. Subsequently, proteins were separated by size using sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Following electrophoretic separation, proteins were transferred from the gel onto a polyvinylidene fluoride (PVDF) membrane. To minimize non-specific antibody binding, the membrane was blocked with 5% skim milk for 2 hours at room temperature. The blocked membrane was then incubated overnight at 4°C with primary antibodies specific for Bcl-2 (68103-1-Ig, Wuhan Sanying, 1:5000 dilution), Bax (60267-1-Ig, Wuhan Sanying, 1:5000 dilution), Caspase3 (CSB-PA423088, Chengdu Biosciences, 1:500 dilution), and β-actin (AC038, Abclonal, 1:10000 dilution). After washing away unbound primary antibodies, the membrane was probed with species-specific fluorescent secondary antibodies: donkey anti-mouse IgG (511103, Chengdu Biosciences, 1:10000 dilution) for Bcl-2 and Bax, and goat anti-rabbit IgG (AS014, Abclonal) for Caspase3, all at a 1:10000 dilution and incubated at room temperature for 2 hours. Finally, the membrane was washed extensively to remove unbound secondary antibodies and protein bands were visualized using the ECL chemiluminescence method. ImageJ software was utilized for protein grayscale analysis to quantify the relative expression levels of target proteins normalized to β-actin. ELISA ELISA kits were employed to quantify the expression levels of TNF-α (JM-01587, Jiangsu Jingmei), IL-6 (JM-01597, Jiangsu Jingmei), IL-10 (JM-01602, Jiangsu Jingmei), eNOs (JM-11856, Jiangsu Jingmei), sFlt-1 (JM-11256, Jiangsu Jingmei), sEng (JM-10493, Jiangsu Jingmei), PlGF (JM-01525, Jiangsu Jingmei), Bcl-2 (JM-01711, Jiangsu Jingmei), Bax (JM-10471, Jiangsu Jingmei), and Caspase3 (JM-10474, Jiangsu Jingmei) in the serum of three groups of rats. Immunohistochemistry Paraffin-embedded tissue blocks, previously fixed in 4% paraformaldehyde, were sectioned to a fine thickness of 5 micrometers. These sections underwent deparaffinization in xylene, followed by dehydration with ethanol. To facilitate antibody binding, antigen retrieval was performed using a citrate buffer solution (ZLI-9065, Beijing Zhongshan Golden Bridge). After blocking with serum for 20 minutes to minimize nonspecific binding, the sections were incubated overnight at 4°C with primary antibodies targeting Bcl-2 (68103-1-Ig, Wuhan Sanying, 1:400 dilution), Bax (60267-1-Ig, Wuhan Sanying, 1:400 dilution), and Caspase3 (CSB-PA423088, Chengdu Biosciences, 1:100 dilution). The following day, the sections were thoroughly washed with PBS three times to remove unbound primary antibodies. Subsequently, incubation with species-specific secondary antibodies (PV-6000, Beijing Zhongshan Golden Bridge) was carried out at 37°C for 30 minutes. Visualization of the target proteins was achieved through DAB staining (ZLI-9019, Beijing Zhongshan Golden Bridge), followed by counterstaining with hematoxylin. Data Analysis All experimental data were quantitative and followed a normal distribution with homogeneous variances. Statistical analyses were performed using GraphPad Prism 9 software. To assess differences between groups, a one-way analysis of variance (ANOVA) was employed. Further post-hoc analysis using Tukey's test was conducted to identify specific group differences. A p-value less than 0.05 was statistically significant. Statistical significance was denoted relative to the NS group with asterisks (* p =0.05, ** p= 0.01, * p= 0.001) and relative to the PE group with number signs ( # p= 0.05, ## p= 0.01, ### p= 0.001). Results MET attenuates L-NAME-induced preeclampsia in rats via reduced systolic blood pressure, decreased proteinuria, and improved pregnancy outcomes Systolic blood pressure remained comparable between the NS and PE groups on GD0, GD6 and GD12. However, on GD15, GD17, and GD19, the PE group exhibited a significant rise in systolic blood pressure compared to the NS group. Conversely, systolic blood pressure in the PE group treated with MET (PE + MET) was markedly lower compared to the untreated PE group (Fig. 2 A). Similarly, proteinuria levels remained comparable across all groups on GD12. By GD19, the PE group displayed a significant increase in proteinuria compared to the NS group. However, MET administration in the PE + MET group resulted in a significant decrease in proteinuria (Fig. 2 B). These observations suggest that subcutaneous L-NAME injections effectively established a PE model in pregnant rats, characterized by elevated systolic BP and proteinuria. Furthermore, MET treatment demonstrated efficacy in reducing both systolic BP and proteinuria in this PE rat model. The PE group exhibited significantly lower placental and fetal weights compared to the NS group. Additionally, placental diameter and fetal crown-rump length were markedly reduced in the PE group. Notably, the PE + MET group displayed a reversal trend in these developmental indices compared to the PE group, suggesting that MET treatment may counteract abnormal pregnancy outcomes in the PE rat model (Fig. 2 C —F ). In summary, we successfully established a L-NAME-induced PE rat model, and MET administration influenced both the physiological characteristics and pregnancy outcomes associated with PE. MET Reduces Serum TNF-α and IL-6 Levels in L-NAME-induced PE Pregnant Rats while increasing IL-10 and eNOS Levels Building upon prior studies that implicated inflammatory dysregulation in PE development, this investigation sought to evaluate the influence of MET on the inflammatory response in PE rats. Serum levels of key inflammatory factors were quantified across three pregnant rat groups. ELISA results demonstrated a marked elevation of pro-inflammatory cytokines TNF-α and IL-6 in the PE group compared to the control group. Conversely, the anti-inflammatory cytokine IL-10 displayed a significant decrease. Notably, MET administration resulted in a substantial reduction in TNF-α and IL-6 levels, accompanied by a significant rise in IL-10 levels (Fig. 3 A —C ). These observations suggest that MET may exert a protective effect by mitigating the inflammatory imbalance observed in PE rats, highlighting its potential therapeutic role in PE. Endothelial nitric oxide synthase (eNOS), a critical molecule for healthy blood vessel function, is known to be deficient in PE rats, contributing to damaged endothelial cells(Kozan et al., 2016 ; Lankhorst, Danser, & van den Meiracker, 2016 ). Next, we examined eNOS levels in the serum of PE rats. As expected, PE rats had significantly lower eNOS levels compared to healthy pregnant rats. Interestingly, when treated with MET via intragastric administration, PE rats exhibited a notable increase in serum eNOS levels (Fig. 3 D). This suggests that MET may improve dysfunctional blood vessel linings in the placenta of PE rats by upregulating eNOS in the serum, which likely leads to increased production of nitric oxide. MET regulates the serum levels of sFlt-1, PlGF, and sEng in L-NAME-induced preeclampsia rat Several proteins, including sFlt-1, sEng, and PlGF, are employed in clinical practice to evaluate the likelihood of developing PE. These proteins significantly influence vascular development regulation in PE, a critical process for PE onset and progression. Consequently, this study investigated and compared the serum levels of sFlt-1, sEng, and PlGF in three rat groups. ELISA results revealed a marked elevation of sFlt-1 and sEng in the PE group's pregnant rat serum, while PlGF levels were notably reduced. Conversely, MET intervention (PE + MET group) resulted in a significant decrease in sFlt-1 and sEng serum levels, accompanied by a significant increase in PlGF (Fig. 4 A —C ). Clinicians additionally utilize the sFlt-1/PlGF ratio for risk assessment and management of PE in pregnant women(Verlohren et al., 2022 ). The PE group displayed a significantly higher sFlt-1/PlGF ratio compared to the NS group. Conversely, the PE + MET group exhibited a significantly lower sFlt-1/PlGF ratio compared to the PE group (Fig. 4 D). These findings collectively suggest that L-NAME disrupts the normal expression of sFlt-1, PlGF, and sEng, while MET treatment protects pregnant rats from PE by regulating these factors. MET ameliorates excessive apoptosis in L-NAME-induced preeclampsia rat placental tissue PE is a pregnancy disorder likely caused by disruptions in multiple cellular signaling pathways. In PE, the placenta experiences prolonged periods of hypoxia, which triggers excessive apoptosis of trophoblast cells, which are vital for placental implantation and invasion into the uterus. The Bcl-2/Bax/Caspase3 pathway is a key regulator of trophoblast cell apoptosis. This study investigated the effect of MET on apoptosis in L-NAME-induced PE rats by examining the mRNA levels of Bcl-2, Bax, and Caspase3, which are markers of apoptosis. Compared to the NS group, PE rats displayed a decrease in Bcl-2 mRNA expression and an increase in Bax and Caspase3 mRNA expression, as measured by RT-qPCR (Fig. 5 A —C ). Notably, MET treatment reversed these trends, restoring Bcl-2 expression and preventing the rise of Bax and Caspase3 expression induced by PE. The findings from Western blot analysis mirrored those of RT-qPCR. Placental tissue from the PE group exhibited a marked reduction in Bcl-2 protein levels, accompanied by a significant increase in Bax and Caspase3 protein expression, indicative of heightened placental cell apoptosis. Conversely, the PE + MET group displayed significantly higher Bcl-2 protein expression and demonstrably lower levels of Bax and Caspase3 compared to the PE group (Fig. 5 D and E ). These observations suggest a potential role for MET in mitigating L-NAME-induced preeclampsia by modulating the apoptotic pathways within placental tissue, potentially leading to improved maternal and fetal health outcomes. Serum levels of Bcl-2, Bax, and Caspase3 were further investigated using ELISA. Compared to the NS group, the PE group exhibited a decrease in Bcl-2 expression, while the PE + MET group showed an increase in Bax and Caspase3 expression relative to the PE group (Fig. 6 A —C ). MET inhibits excessive apoptosis of trophoblast cells induced by L-NAME To investigate the effects of L-NAME and MET on apoptosis in placental tissue, researchers used immunohistochemistry to assess the expression of Bcl-2, Bax, and Caspase3. Compared to the control group (NS), the preeclampsia group exhibited a significant decrease in Bcl-2 staining intensity, indicating reduced levels of this anti-apoptotic protein. Conversely, staining intensity for the pro-apoptotic factors Bax and Caspase3 was markedly increased in the PE group, suggesting heightened apoptotic activity. This pattern was particularly evident in trophoblast cells, where Bcl-2 expression was lower and Bax and Caspase3 expression were higher in the PE group compared to the control group. Notably, MET treatment reversed these trends in the PE group. As shown in Fig. 7 , MET restored Bcl-2 expression and normalized Bax and Caspase3 expression in placental tissue, particularly within trophoblast cells. These findings suggest that MET exerts its protective effects in PE by inhibiting excessive trophoblast cell apoptosis through modulation of the Bcl-2/Bax/Caspase3 pathway. This indicates that MET possesses anti-apoptotic properties, potentially improving trophoblast cell function in pregnant rats with preeclampsia. Discussion Despite established benefits of MET in various diseases, its role in PE remains less explored. This study provides compelling evidence that MET treatment effectively mitigates hypertension and reduces 24-hour proteinuria in pregnant rats with L-NAME-induced PE, additionally promoting recovery from placental and fetal injuries. Previous research suggests that PE patients experience a decline in functional eNOS, potentially limiting NO production and worsening endothelial dysfunction, a hallmark of PE(Kim et al., 2017 ). Consistent with this, L-NAME, a compound that inhibits NOS activity, lowered serum eNOS levels in pregnant rats. Conversely, MET treatment increased serum eNOS levels, potentially restoring endothelial function in PE by promoting NO production. Prior research has established the critical involvement of imbalanced immune cell activity in PE development(Deer et al., 2023 ). Macrophages and natural killer (NK) cells exhibit abnormal secretion of chemotactic factors, fostering a pro-inflammatory environment. This inflammatory state is further fueled by elevated levels of pro-inflammatory cytokines like TNF-α and IL-6, which ultimately lead to increased C-reactive protein (CRP), a marker of inflammation, and contribute to PE development(Jena, Sharma, Petitt, Maulik, & Nayak, 2020 ). Notably, excess TNF-α can specifically hinder trophoblast cell migration and integration, potentially playing a key role in PE progression(Zhong, Yao, & Zhong, 2023 ). Our study corroborates these findings, demonstrating significantly higher levels of the inflammatory factors TNF-α and IL-6 in the serum of L-NAME-induced pregnant rats compared to the control group. Conversely, levels of IL-10, a crucial immune regulator, were likely insufficient. IL-10 not only maintains a balanced inflammatory state at the maternal-fetal interface but also offers benefits in endothelial dysfunction associated with PE(Cubro, Kashyap, Nath, Ackerman, & Garovic, 2018 ). Kuusiniemi et al. demonstrated that MET can alleviate inflammation and oxidative stress in the skeletal muscles of mice fed a high-fat diet; other studies have found that MET can activate AMPK-regulated signaling pathways and inhibit inflammation(Bahramzadeh, Samavarchi Tehrani, Goodarzi, Seyyedebrahimi, & Meshkani, 2024 ; Kuusiniemi, Karihtala, Puistola, Ahtikoski, & Urpilainen, 2023 ). Our findings indicate that MET treatment in PE rats led to a reduction in pro-inflammatory factors TNF-α and IL-6 within the serum. This suppression may create an environment more conducive for the anti-inflammatory effects of IL-10, potentially offering a novel therapeutic approach for targeting the inflammatory pathways associated with PE. Emerging evidence suggests a critical role for abnormal protein signaling in PE. Studies have shown that sFlt-1 can bind to PlGF, hindering its function(Verlohren et al., 2022 ). This disrupts vascular function and prevents proper remodeling of spiral arteries in the uterus, ultimately leading to placental ischemia in PE pregnancies. Notably, sFlt-1 treatment in mice has been linked to mitochondrial swelling in placental tissues and increased markers of apoptosis(Jiang et al., 2015 ). Furthermore, hypoxia in the placenta can trigger the release of another anti-angiogenic factor, sEng. Research by Karumanchi et al. has shed light on the role of these molecules in PE development, demonstrating that excessive production of sFlt-1 and sEng can induce dysfunction in the mother's endothelial cells(Rana, Burke, & Karumanchi, 2022 ). Our study provides compelling evidence that MET intervention effectively reverses the rise in the sFlt-1/PlGF ratio observed in the serum of L-NAME-induced PE rats. Additionally, MET treatment suppressed the elevation of serum sFlt-1 and sEng levels, while promoting an increase in PlGF levels. PlGF plays a vital role in stimulating endothelial cell generation during pregnancy, thus contributing to improved function of the endothelium in both the mother and the placenta. Therefore, monitoring changes in factors like sFlt-1, PlGF, and sEng, along with the sFlt-1/PlGF ratio, holds promise as a valuable tool for both diagnosing and predicting PE. Apoptosis, is a tightly controlled process involving both extrinsic and intrinsic (mitochondrial) pathways. These pathways play a crucial role in maintaining healthy development of trophoblast cells, the building blocks of the placenta, during pregnancy. However, excessive apoptosis of placental cells is a major contributor to placental dysfunction in PE. Maternal immune cells can overstimulate the mitochondrial apoptosis pathway in trophoblast cells, with the Bcl-2/Bax/Caspase3 pathway being a key regulatory mechanism(Raguema et al., 2020 ). Studies have shown that imbalances in this pathway, characterized by increased levels of pro-apoptotic proteins Bax and Caspase3 alongside decreased levels of the anti-apoptotic protein Bcl-2, can disrupt placental function(Kasture, Sundrani, Randhir, Wagh, & Joshi, 2021 ). Therefore, changes in the expression of these proteins directly reflect the level of trophoblast cell apoptosis in PE placentas(H. Wang et al., 2022 ). Our study investigated the effects of MET on this pathway. Interestingly, oral administration of MET in PE rats led to an upregulation of Bcl-2 and a downregulation of Bax and Caspase3 in the placenta, which aligns with previously observed protective effects of MET. While the precise mechanisms remain under investigation, existing research offers potential explanations. Growing evidence suggests that MET can counteract excessive apoptosis in kidney cells exposed to high glucose levels by regulating the miR-34a/SIRT1 axis(Zhuang et al., 2024 ). Additionally, Ni et al. demonstrated that MET can reverse mitochondrial dysfunction-induced apoptosis in sperm cells through the CREB/SIRT1/FOXO3 signaling pathway(Ni et al., 2024 ). However, Deng et al. reported that combining MET with gemcitabine enhances apoptosis in cholangiocarcinoma cells(Deng, Qian, Zhang, Yu, & Yang, 2024 ). These findings suggest that the beneficial effects of MET on trophoblast cells in PE rats may be linked to its influence on the mitochondrial apoptosis pathway via the Bcl-2/Bax/Caspase3 proteins. This study provides compelling evidence that MET can regulate the placental mitochondrial apoptosis pathway in a PE animal model. However, PE is a complex disease, and further research is necessary to elucidate other potential signaling pathways influenced by MET in the context of PE. In summary, our study suggests that MET could improve placental function in an L-NAME-induced PE rat model through its anti-inflammatory and anti-apoptotic effects. Additionally, MET can regulate factors like sFlt-1, PlGF, and sEng, potentially preventing or alleviating PE development. These findings offer promising targets for the development of novel PE treatment strategies. However, the underlying mechanisms require further investigation. Notably, this study was limited to animal models and has not yet been validated in human clinical trials. Conclusion This study demonstrates the potential of MET as a therapeutic or preventive intervention for PE. In a rat model of PE induced by L-NAME, MET treatment modulated the mitochondrial apoptosis pathway, reducing excessive trophoblast cell death in the placenta. This resulted in a reversal of hypertension and proteinuria in preeclamptic rats. By significantly reducing trophoblast cell apoptosis, MET alleviated the maternal burden and potentially improved fetal development. These findings provide valuable insights for further basic research and clinical exploration of MET as a treatment for PE. Declarations Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Funding This work was supported by the Shanxi Provincial Health Commission science and technology innovation base construction project (YDZJSX2022B010), National Clinical Key Specialty Construction Project (Y2022ZD001, Y2022ZD002) and Shanxi Medical University First Hospital Fund Project (YY2215). Author Contribution HN wrote the original draft; WF conceived and designed Methodology; JR and YM conduct data analysis; HL reviewed and edited the paper.All the authors read and approved the final manuscript. Availability of data and material The data and material used to support the fndings of this study are included within the article. References Akgul, C., Moulding, D. A., & Edwards, S. W. (2004). Alternative splicing of Bcl-2-related genes: functional consequences and potential therapeutic applications. Cell Mol Life Sci, 61 (17), 2189-2199. doi:10.1007/s00018-004-4001-7 Bahramzadeh, A., Samavarchi Tehrani, S., Goodarzi, G., Seyyedebrahimi, S., & Meshkani, R. (2024). Combination therapy of metformin and morin attenuates insulin resistance, inflammation, and oxidative stress in skeletal muscle of high-fat diet-fed mice. Phytother Res, 38 (2), 912-924. doi:10.1002/ptr.8086 Cubro, H., Kashyap, S., Nath, M. C., Ackerman, A. W., & Garovic, V. D. (2018). The Role of Interleukin-10 in the Pathophysiology of Preeclampsia. Curr Hypertens Rep, 20 (4), 36. doi:10.1007/s11906-018-0833-7 Cui, H., Liu, J., Vasileva, E. A., Mishchenko, N. P., Fedoreyev, S. A., Stonik, V. A., & Zhang, Y. (2022). Echinochrome A Reverses Kidney Abnormality and Reduces Blood Pressure in a Rat Model of Preeclampsia. Mar Drugs, 20 (11). doi:10.3390/md20110722 de Alwis, N., Binder, N. K., Beard, S., Mangwiro, Y. T., Kadife, E., Cuffe, J. S., . . . Hannan, N. J. (2022). The L-NAME mouse model of preeclampsia and impact to long-term maternal cardiovascular health. Life Sci Alliance, 5 (12). doi:10.26508/lsa.202201517 Deer, E., Herrock, O., Campbell, N., Cornelius, D., Fitzgerald, S., Amaral, L. M., & LaMarca, B. (2023). The role of immune cells and mediators in preeclampsia. Nat Rev Nephrol, 19 (4), 257-270. doi:10.1038/s41581-022-00670-0 Deng, H., Qian, X., Zhang, Y., Yu, W., & Yang, P. (2024). Metformin Increases the Response of Cholangiocarcinoma Cells to Gemcitabine by Suppressing Pyruvate Kinase M2 to Activate Mitochondrial Apoptosis. Dig Dis Sci, 69 (2), 476-490. doi:10.1007/s10620-023-08210-x Dimitriadis, E., Rolnik, D. L., Zhou, W., Estrada-Gutierrez, G., Koga, K., Francisco, R. P. V., . . . Menkhorst, E. (2023). Pre-eclampsia. Nat Rev Dis Primers, 9 (1), 8. doi:10.1038/s41572-023-00417-6 Gatford, K. L., Andraweera, P. H., Roberts, C. T., & Care, A. S. (2020). Animal Models of Preeclampsia: Causes, Consequences, and Interventions. Hypertension, 75 (6), 1363-1381. doi:10.1161/hypertensionaha.119.14598 He, L., Wu, X., Zhan, F., Li, X., & Wu, J. (2023). Protective role of metformin in preeclampsia via the regulation of NF-κB/sFlt-1 and Nrf2/HO-1 signaling pathways by activating AMPK. Placenta, 143 , 91-99. doi:10.1016/j.placenta.2023.10.003 Jena, M. K., Sharma, N. R., Petitt, M., Maulik, D., & Nayak, N. R. (2020). Pathogenesis of Preeclampsia and Therapeutic Approaches Targeting the Placenta. Biomolecules, 10 (6). doi:10.3390/biom10060953 Jiang, Z., Zou, Y., Ge, Z., Zuo, Q., Huang, S. Y., & Sun, L. (2015). A Role of sFlt-1 in Oxidative Stress and Apoptosis in Human and Mouse Pre-Eclamptic Trophoblasts. Biol Reprod, 93 (3), 73. doi:10.1095/biolreprod.114.126227 Kaitu'u-Lino, T. J., Brownfoot, F. C., Beard, S., Cannon, P., Hastie, R., Nguyen, T. V., . . . Hannan, N. J. (2018). Combining metformin and esomeprazole is additive in reducing sFlt-1 secretion and decreasing endothelial dysfunction - implications for treating preeclampsia. PLoS One, 13 (2), e0188845. doi:10.1371/journal.pone.0188845 Kasture, V., Sundrani, D., Randhir, K., Wagh, G., & Joshi, S. (2021). Placental apoptotic markers are associated with placental morphometry. Placenta, 115 , 1-11. doi:10.1016/j.placenta.2021.08.051 Kim, J., Lee, K. S., Kim, J. H., Lee, D. K., Park, M., Choi, S., . . . Kim, Y. M. (2017). Aspirin prevents TNF-α-induced endothelial cell dysfunction by regulating the NF-κB-dependent miR-155/eNOS pathway: Role of a miR-155/eNOS axis in preeclampsia. Free Radic Biol Med, 104 , 185-198. doi:10.1016/j.freeradbiomed.2017.01.010 Kozan, A., Kilic, N., Alacam, H., Guzel, A., Guvenc, T., & Acikgoz, M. (2016). The Effects of Dexamethasone and L-NAME on Acute Lung Injury in Rats with Lung Contusion. Inflammation, 39 (5), 1747-1756. doi:10.1007/s10753-016-0409-0 Kuusiniemi, E., Karihtala, P., Puistola, U., Ahtikoski, A., & Urpilainen, E. (2023). Oxidative Stress-regulating Enzymes and Endometrial Cancer Survival in Relation to Metformin Intake in Diabetic Patients. Anticancer Res, 43 (12), 5545-5554. doi:10.21873/anticanres.16756 LaMoia, T. E., & Shulman, G. I. (2021). Cellular and Molecular Mechanisms of Metformin Action. Endocr Rev, 42 (1), 77-96. doi:10.1210/endrev/bnaa023 Lankhorst, S., Danser, A. H., & van den Meiracker, A. H. (2016). Endothelin-1 and antiangiogenesis. Am J Physiol Regul Integr Comp Physiol, 310 (3), R230-234. doi:10.1152/ajpregu.00373.2015 Melchiorre, K., Giorgione, V., & Thilaganathan, B. (2022). The placenta and preeclampsia: villain or victim? Am J Obstet Gynecol, 226 (2s), S954-s962. doi:10.1016/j.ajog.2020.10.024 Ni, F., Wang, F., Li, J., Liu, Y., Sun, X., Chen, J., . . . Zhang, D. (2024). BNC1 deficiency induces mitochondrial dysfunction-triggered spermatogonia apoptosis through the CREB/SIRT1/FOXO3 pathway: the therapeutic potential of nicotinamide riboside and metformin†. Biol Reprod, 110 (3), 615-631. doi:10.1093/biolre/ioad168 Raguema, N., Moustadraf, S., & Bertagnolli, M. (2020). Immune and Apoptosis Mechanisms Regulating Placental Development and Vascularization in Preeclampsia. Front Physiol, 11 , 98. doi:10.3389/fphys.2020.00098 Rana, S., Burke, S. D., & Karumanchi, S. A. (2022). Imbalances in circulating angiogenic factors in the pathophysiology of preeclampsia and related disorders. Am J Obstet Gynecol, 226 (2s), S1019-s1034. doi:10.1016/j.ajog.2020.10.022 Rana, S., Lemoine, E., Granger, J. P., & Karumanchi, S. A. (2019). Preeclampsia: Pathophysiology, Challenges, and Perspectives. Circ Res, 124 (7), 1094-1112. doi:10.1161/circresaha.118.313276 Romero, R., Erez, O., Hüttemann, M., Maymon, E., Panaitescu, B., Conde-Agudelo, A., . . . Grossman, L. I. (2017). Metformin, the aspirin of the 21st century: its role in gestational diabetes mellitus, prevention of preeclampsia and cancer, and the promotion of longevity. Am J Obstet Gynecol, 217 (3), 282-302. doi:10.1016/j.ajog.2017.06.003 Tong, J., Niu, Y., Chen, Z. J., & Zhang, C. (2020). Comparison of the transcriptional profile in the decidua of early-onset and late-onset pre-eclampsia. J Obstet Gynaecol Res, 46 (7), 1055-1066. doi:10.1111/jog.14257 Verlohren, S., Brennecke, S. P., Galindo, A., Karumanchi, S. A., Mirkovic, L. B., Schlembach, D., . . . Rana, S. (2022). Clinical interpretation and implementation of the sFlt-1/PlGF ratio in the prediction, diagnosis and management of preeclampsia. Pregnancy Hypertens, 27 , 42-50. doi:10.1016/j.preghy.2021.12.003 Wang, G., Wang, Y., Yang, Q., Xu, C., Zheng, Y., Wang, L., . . . Luo, M. (2022). Metformin prevents methylglyoxal-induced apoptosis by suppressing oxidative stress in vitro and in vivo. Cell Death Dis, 13 (1), 29. doi:10.1038/s41419-021-04478-x Wang, H., Liu, M. L., Chu, C., Yu, S. J., Li, J., Shen, H. C., . . . Zhang, T. (2022). Paeonol alleviates placental inflammation and apoptosis in preeclampsia by inhibiting the JAK2/STAT3 signaling pathway. Kaohsiung J Med Sci, 38 (11), 1103-1112. doi:10.1002/kjm2.12585 Xu, Y., Sui, L., Qiu, B., Yin, X., Liu, J., & Zhang, X. (2019). ANXA4 promotes trophoblast invasion via the PI3K/Akt/eNOS pathway in preeclampsia. Am J Physiol Cell Physiol, 316 (4), C481-c491. doi:10.1152/ajpcell.00404.2018 Zhong, Q., Yao, C., & Zhong, W. (2023). Causal Relationship Between Inflammation and Preeclampsia: Genetic Evidence from a Mendelian Randomization Study. Twin Res Hum Genet, 26 (3), 231-235. doi:10.1017/thg.2023.27 Zhuang, X., Sun, Z., Du, H., Zhou, T., Zou, J., & Fu, W. (2024). Metformin inhibits high glucose-induced apoptosis of renal podocyte through regulating miR-34a/SIRT1 axis. Immun Inflamm Dis, 12 (1), e1053. doi:10.1002/iid3.1053 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4390427","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":305376112,"identity":"812cda09-b7a6-4996-8709-87a3fab1a89d","order_by":0,"name":"Huiniu HAO","email":"","orcid":"","institution":"The First Hospital of Shanxi Medical University (First Clinical Medicine College)","correspondingAuthor":false,"prefix":"","firstName":"Huiniu","middleName":"","lastName":"HAO","suffix":""},{"id":305376113,"identity":"d1961421-0cdd-402c-8096-cb2f9b07317f","order_by":1,"name":"Fang Wang","email":"","orcid":"","institution":"The First Hospital of Shanxi Medical University (First Clinical Medicine College)","correspondingAuthor":false,"prefix":"","firstName":"Fang","middleName":"","lastName":"Wang","suffix":""},{"id":305376114,"identity":"799e0c29-488e-4eb5-a43b-3f7ced762111","order_by":2,"name":"Ran Jia","email":"","orcid":"","institution":"The First Hospital of Shanxi Medical University (First Clinical Medicine College)","correspondingAuthor":false,"prefix":"","firstName":"Ran","middleName":"","lastName":"Jia","suffix":""},{"id":305376115,"identity":"73bbb551-aa22-484a-ac36-9655716f363b","order_by":3,"name":"Yinmin Chen","email":"","orcid":"","institution":"The First Hospital of Shanxi Medical University (First Clinical Medicine College)","correspondingAuthor":false,"prefix":"","firstName":"Yinmin","middleName":"","lastName":"Chen","suffix":""},{"id":305376116,"identity":"231bda0c-8460-493d-ad12-c44bc26f043f","order_by":4,"name":"Hailan Yang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAyUlEQVRIie3PsQrCMBCA4SuFZjntJikZ8grprvRVWlwd+gAOlULcnCsOvkokYB9CB4ugD1BwErEWXERI3Bzyz/dxdwAu1x9GCq/wQSgISAHKiqB6E1TWBMCH1zBNLQ9DUi7aPD/yYXRtdD4HHo4MyxB3JavEJZZsJnS1h3i9MaxLaCZ9FNrrCGgMIBUHA0He9CSRUX3S+LAh1OtJJikIPZA2BLOSdWQqsftlsKLmX5DUTYt3Pdku63OLtzEPmYF8Rn8bd7lcLtf3nrXdQBhFSBncAAAAAElFTkSuQmCC","orcid":"","institution":"The First Hospital of Shanxi Medical University (First Clinical Medicine College)","correspondingAuthor":true,"prefix":"","firstName":"Hailan","middleName":"","lastName":"Yang","suffix":""},{"id":305376117,"identity":"4a372938-a836-417d-bf20-cd26c3090a6f","order_by":5,"name":"Huijing Ma","email":"","orcid":"","institution":"The First Hospital of Shanxi Medical University (First Clinical Medicine College)","correspondingAuthor":false,"prefix":"","firstName":"Huijing","middleName":"","lastName":"Ma","suffix":""}],"badges":[],"createdAt":"2024-05-08 15:49:38","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4390427/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4390427/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":56989544,"identity":"1c9179ed-0bd0-4b6f-8d02-d0a751d7718f","added_by":"auto","created_at":"2024-05-23 05:59:44","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":317363,"visible":true,"origin":"","legend":"\u003cp\u003eEstablishment of the Preeclampsia Rat Model.\u003cstrong\u003e \u003c/strong\u003eNS group: Subcutaneous injection of saline (200mg/kg/day) from GD 14 to GD 18; PE group: Subcutaneous injection of L-NAME (200mg/kg/day) from GD 14 to GD 18 to induce preeclampsia; PE+MET group: Subcutaneous injection of L-NAME (200mg/kg/day) from GD 14 to GD 18 to induce preeclampsia, with simultaneous oral gavage of MET (200mg/kg/day) from GD 13 to GD 18 for intervention.\u003c/p\u003e","description":"","filename":"OnlineFigure1.png","url":"https://assets-eu.researchsquare.com/files/rs-4390427/v1/9ee25d959f95c2f6cbdc7140.png"},{"id":56989541,"identity":"13dae9a4-874b-412c-b550-91f2f5c55132","added_by":"auto","created_at":"2024-05-23 05:59:44","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":54210,"visible":true,"origin":"","legend":"\u003cp\u003eMET reduces systolic blood pressure and proteinuria in PE rats and restores placental and fetal indices close to the NS group. (A) Measurement of systolic blood pressure in the tail artery on GD0, GD6, GD12, GD15, GD17, and GD19; (B) Measurement of 24-hour proteinuria levels on GD12 and GD19; (C) Measurement of placental diameter; (D) Measurement of placental weight; (E) Measurement of fetal crown-rump length; (F) Measurement of fetal weight.\u003c/p\u003e","description":"","filename":"OnlineFigure2.png","url":"https://assets-eu.researchsquare.com/files/rs-4390427/v1/24310930e6e06a87dae5aa15.png"},{"id":56989543,"identity":"c55fcc8c-ea14-4fa6-b02c-04b02c4e338a","added_by":"auto","created_at":"2024-05-23 05:59:44","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":35463,"visible":true,"origin":"","legend":"\u003cp\u003eMET Suppresses the Levels of Pro-inflammatory Factors TNF-α and IL-6 in the Serum of PE Rats, and increases the Anti-inflammatory Factor IL-10 and eNOS. (A) Levels of TNF-α in the Serum; (B) Levels of IL-6 in the Serum; (C) Levels of IL-10 in the Serum; (D) Levels of eNOS in the Serum.\u003c/p\u003e","description":"","filename":"OnlineFigure3.png","url":"https://assets-eu.researchsquare.com/files/rs-4390427/v1/88e1ba8f842493982a368298.png"},{"id":56990157,"identity":"05bc25fb-762e-4adf-ba4c-e97a6882e9b1","added_by":"auto","created_at":"2024-05-23 06:07:44","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":35396,"visible":true,"origin":"","legend":"\u003cp\u003eThe effect of MET on the levels of sFlt-1, PlGF, and sEng in preeclampsia rat serum. (A) Levels of sFlt-1 in serum; (B) Levels of PlGF in serum; (C) Levels of sEng in serum; (D) sFlt-1/PlGF ratio in serum.\u003c/p\u003e","description":"","filename":"OnlineFigure4.png","url":"https://assets-eu.researchsquare.com/files/rs-4390427/v1/e3ddbb54f2912cb1638df354.png"},{"id":56989545,"identity":"2afa3a5e-307f-43e1-8efe-de31d144576b","added_by":"auto","created_at":"2024-05-23 05:59:44","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":62170,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eMET inhibits excessive apoptosis in preeclampsia rat placental tissue. (A) mRNA expression levels of Bcl-2 in placental tissue; (B) mRNA expression levels of Bax in placental tissue; (C) mRNA expression levels of Caspase3 in placental tissue; (D) Western blot bands of Bcl-2, Bax, and Caspase3 in rat placental tissue; (E) Protein expression levels of Bcl-2, Bax, and Caspase3 in rat placental tissue.\u003c/p\u003e","description":"","filename":"OnlineFigure5.png","url":"https://assets-eu.researchsquare.com/files/rs-4390427/v1/9f695e5902394fd004c4292b.png"},{"id":56990158,"identity":"4294f642-ccf9-4188-8148-d1af0c46d2f6","added_by":"auto","created_at":"2024-05-23 06:07:44","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":33900,"visible":true,"origin":"","legend":"\u003cp\u003eMET reverses the expression levels of Bcl-2, Bax, and Caspase3 in serum of preeclampsia rats. (A) Expression levels of Bcl-2 in serum; (B) Expression levels of Bax in serum; (C) Expression levels of Caspase3 in serum.\u003c/p\u003e","description":"","filename":"OnlineFigure6.png","url":"https://assets-eu.researchsquare.com/files/rs-4390427/v1/6ba7955bf34a14c23cf08883.png"},{"id":56989546,"identity":"66462bbd-0f83-41df-a33e-86e0a6f640d0","added_by":"auto","created_at":"2024-05-23 05:59:44","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":2747073,"visible":true,"origin":"","legend":"\u003cp\u003eMET inhibits excessive apoptosis of trophoblast cells. Immunohistochemistry was used to detect the expression of Bcl-2, Bax, and Caspase3 in trophoblast cells of rats from the NS group, PE group, and PE+MET group. \"→\" indicates trophoblast cells, scale bar = 20 μm.\u003c/p\u003e","description":"","filename":"OnlineFigure7.png","url":"https://assets-eu.researchsquare.com/files/rs-4390427/v1/b9c238213661853476c75918.png"},{"id":58784841,"identity":"9b4917d6-a163-4a0c-a15b-b5bbfd6ec6ce","added_by":"auto","created_at":"2024-06-21 05:53:33","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4642213,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4390427/v1/24106ddc-d204-46f0-97a3-f8877b156b13.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"The impact of metformin on the Bcl-2/Bax/Caspase3 signaling pathway in placental tissue of preeclampsia rats","fulltext":[{"header":"Introduction","content":"\u003cp\u003ePre-eclampsia (PE), a complication typically observed in pregnant women, is marked by elevated blood pressure (BP) and proteinuria, posing significant threats to maternal and neonatal health, and is a major contributor to increased maternal and neonatal mortality rates worldwide(Cui et al., \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; de Alwis et al., \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2022\u003c/span\u003e).\u003c/p\u003e \u003cp\u003ePE is a dynamic condition that can potentially lead to hepatic and renal dysfunction, thrombocytopenia, pulmonary edema, visual disturbances, or central nervous system abnormalities. In extreme cases, it may progress to eclampsia(Dimitriadis et al., \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). This multifactorial, multi-mechanistic, and multi-pathway disorder has growing evidence highlighting the placenta as its central pathological mechanism(Dimitriadis et al., \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Insufficient invasion of uterine trophoblast cells, inadequate remodeling of spiral arteries, and excessive apoptosis of placental trophoblast cells are key pathological features(Rana, Lemoine, Granger, \u0026amp; Karumanchi, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Recently, increasing attention has been focused on the excessive apoptosis of trophoblast layer cells in PE(Xu et al., \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2019\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn PE patients, inadequate remodeling of uterine spiral arteries results in decreased placental perfusion pressure. This leads to long-term ischemia-reperfusion injury to trophoblast layer cells, generating excessive reactive oxygen species (ROS) that disrupt the balance between inflammation and apoptosis, ultimately causing excessive apoptosis(G. Wang et al., \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Poor development of placental vasculature, resulting in diminished blood perfusion and a state of chronic oxygen deprivation, serve as the primary triggers for apoptosis within trophoblast layer cells(Melchiorre, Giorgione, \u0026amp; Thilaganathan, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Bcl-2, a pivotal protein within the Bcl-2 family known for its suppression of apoptosis, can alleviate mitochondria-dependent cell apoptosis(Akgul, Moulding, \u0026amp; Edwards, \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2004\u003c/span\u003e). Several studies have indicated decreased expression of Bcl-2 in PE(Tong, Niu, Chen, \u0026amp; Zhang, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Meanwhile, Bax, belonging to the Bcl-2 family, acts as a pro-apoptotic factor and promotes the release of cytochrome C (CytC) from mitochondria during stress, leading to the formation of apoptotic bodies with other apoptotic factors in the cytoplasm, activating pro-Caspase3 into its active form, thus causing cell death(Raguema, Moustadraf, \u0026amp; Bertagnolli, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2020\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eCurrently, treatment options for PE patients are limited, with delivery remaining the most effective approach. Metformin (MET), a medication commonly used orally for type 2 diabetes, has shown promise for both preventing and treating PE(Gatford, Andraweera, Roberts, \u0026amp; Care, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; LaMoia \u0026amp; Shulman, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). MET can inhibit cellular apoptosis induced by methylglyoxal (MGO) by suppressing oxidative stress both internally and externally(G. Wang et al., \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). This reduces the production of soluble FMS-like tyrosine kinase 1 (sFlt-1) and soluble endoglin (sEng), thereby improving endothelial dysfunction in PE(Kaitu'u-Lino et al., \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Additionally, MET can activate the AMPK pathway, which in turn modulates the NF-κB/sFlt-1 and Nrf2/HO-1 pathways, ultimately inhibiting apoptosis and inflammatory damage to human trophoblast cells (HTR-8/SVneo)(He, Wu, Zhan, Li, \u0026amp; Wu, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Compared to normal pregnancy, excessive activation of immune cells against the trophoblast layer, a key mechanism triggering trophoblast cell apoptosis in PE, primarily occurs within the mitochondria(Raguema et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). MET's low toxicity and minimal side effects make it a relatively safe option, and its small molecular weight allows for easy passage through the placenta(Romero et al., \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). However, research on the mechanism by which MET attenuates excessive apoptosis of trophoblast layer cells in PE placentas remains limited. Therefore, we sought to investigate the impact of MET on apoptosis in trophoblast layer cells in rat models of L-NAME-induced preeclampsia.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003ch4\u003ePreeclampsia Rat Model\u003c/h4\u003e\n\u003cp\u003eThis study utilized thirty female Sprague-Dawley rats aged 8-10 weeks and weighing between 220 and 260 grams. After mating with adult males, vaginal smears confirmed pregnancy on day zero (GD 0). Throughout the experiment, the rats lived in standard laboratory conditions with unrestricted access to food and water. Following random assignment, the pregnant rats were divided into three groups (\u003cstrong\u003eFig. 1\u003c/strong\u003e): The first group (NS, n=10) received daily subcutaneous saline injections (200mg/kg/d) from GD 14 to GD 18. The second group (PE, n=10) received daily L-NAME injections (200mg/kg/d) subcutaneously during the same period (GD 14 to GD 18). The third group (PE+MET, n=10) received both L-NAME injections (200mg/kg/d) subcutaneously and oral gavage of MET (200mg/kg/d) from GD 13 to GD 18. The study adhered to ethical guidelines established by the Ethics Committee of Experimental Animals at the First Hospital of Shanxi Medical University (DWLL-2024-0023) and the Institutional Animal Care and Use Committee of Shanxi Medical University Experimental Animal Center (licenses: Animal License: SYXK (Jin) 2019-0008, Animal Production License: SCXK (Jin) 2019-004).\u003c/p\u003e\n\u003ch4\u003eBlood Pressure and Proteinuria Measurement\u003c/h4\u003e\n\u003cp\u003eBlood Pressure Measurement: Tail artery BP \u0026nbsp;was assessed in the pregnant rats throughout gestation using a specialized non-invasive rodent BP measurement device (BW-NIBP1106, Nanjing Calvin). Measurements were taken on gestational days 0, 6, 12, 15, 17, and 19 (GD0, GD6, etc.). Prior to each measurement, the rats were gently restrained, and the device was pre-warmed to 36°C to ensure comfort. Three blood pressure readings were obtained for each rat, and the average value was recorded.\u003c/p\u003e\n\u003cp\u003e24-Hour Urinary Protein Determination: Pregnant rats were monitored for urine protein levels on GD12 and GD19. A method utilizing Coomassie Brilliant Blue reagent (A045-2-2, Nanjing Jiancheng) was employed to quantify protein concentration. Samples were thoroughly mixed with the reagent and incubated for 10 minutes. Following incubation, absorbance was measured at a wavelength of 595nm. The protein content within the 24-hour urine samples was then calculated based on the obtained absorbance values.\u003c/p\u003e\n\u003ch4\u003eSpecimen Collection\u003c/h4\u003e\n\u003cp\u003eOn GD20 of pregnancy, pregnant rats were anesthetized, followed by maternal blood collection. Fetal pups and placentas were then carefully separated. Placental diameter and weight were measured, along with the body weight and crown-rump length of the fetal pups. Some placental samples were stored in 4% paraformaldehyde, while the remainder was cryopreserved at -80°.\u003c/p\u003e\n\u003ch4\u003eRT-qPCR\u003c/h4\u003e\n\u003cp\u003eA homogenization technique was used to completely break down placental tissue with TRIzol reagent (15596026CN, Ambion) to isolate all the RNA content, and RNA purity was determined. Reverse transcription of RNA to cDNA was performed using the Mei5bio kit (MF-166, PolymerMei). Next, real-time quantitative PCR (RT-qPCR) was performed using the Mei5bio kit (MF787, PolymerMei) on a LightCycler System. The reaction conditions were as follows: an initial denaturation step at 95°C for 30 s, followed by 40 cycles of denaturation at 95°C for 5 s, annealing at 60°C for 20 s, and a final extension step at 65°C for 15 s. The relative expression levels of target mRNAs were calculated using the 2\u003csup\u003e-ΔΔCT\u003c/sup\u003e method using β-actin as the reference gene. The primers were：Bcl-2 (Forward): TGGAGAGCGTCAACAGGGAGATG, (Reverse): GGTGTGCAGATGCCGGTTCAG; Bax (Forward): GACGCATCCACCAAGAAGCTGAG, (Reverse): GCTGCCACACGGAAGAAGACC; Caspase3 (Forward): ACGAACGGACCTGTGGACCTG, (Reverse): AAGAGTTTCGGCTTTCCAGTCAGAC; β-actin (Forward): CGCTTCGGCAGCACATATAC, (Reverse): TTCACGAATTTGCGTGTCATC.\u003c/p\u003e\n\u003ch4\u003eWestern Blot\u003c/h4\u003e\n\u003cp\u003eProtein extraction and Western blot analysis were employed to investigate the expression levels of Bcl-2, Bax, Caspase3, and β-actin in placental tissue. Placental lysates were prepared using a commercially available protein lysis buffer (AR0102, Boster) supplemented with a protease inhibitor cocktail (AR1178, Boster) to prevent protein degradation. Protein concentration was then quantified with a BCA assay kit (AR0146, Boster). Equal amounts of protein (30 μg) were denatured by boiling with protein loading buffer (AR1112-10, Boster) for 5 minutes. Subsequently, proteins were separated by size using sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Following electrophoretic separation, proteins were transferred from the gel onto a polyvinylidene fluoride (PVDF) membrane. To minimize non-specific antibody binding, the membrane was blocked with 5% skim milk for 2 hours at room temperature. The blocked membrane was then incubated overnight at 4°C with primary antibodies specific for Bcl-2 (68103-1-Ig, Wuhan Sanying, 1:5000 dilution), Bax (60267-1-Ig, Wuhan Sanying, 1:5000 dilution), Caspase3 (CSB-PA423088, Chengdu Biosciences, 1:500 dilution), and β-actin (AC038, Abclonal, 1:10000 dilution). After washing away unbound primary antibodies, the membrane was probed with species-specific fluorescent secondary antibodies: donkey anti-mouse IgG (511103, Chengdu Biosciences, 1:10000 dilution) for Bcl-2 and Bax, and goat anti-rabbit IgG (AS014, Abclonal) for Caspase3, all at a 1:10000 dilution and incubated at room temperature for 2 hours. Finally, the membrane was washed extensively to remove unbound secondary antibodies and protein bands were visualized using the ECL chemiluminescence method. ImageJ software was utilized for protein grayscale analysis to quantify the relative expression levels of target proteins normalized to β-actin.\u003c/p\u003e\n\u003ch4\u003eELISA\u003c/h4\u003e\n\u003cp\u003eELISA kits were employed to quantify the expression levels of TNF-α (JM-01587, Jiangsu Jingmei), IL-6 (JM-01597, Jiangsu Jingmei), IL-10 (JM-01602, Jiangsu Jingmei), eNOs (JM-11856, Jiangsu Jingmei), sFlt-1 (JM-11256, Jiangsu Jingmei), sEng (JM-10493, Jiangsu Jingmei), PlGF (JM-01525, Jiangsu Jingmei), Bcl-2 (JM-01711, Jiangsu Jingmei), Bax (JM-10471, Jiangsu Jingmei), and Caspase3 (JM-10474, Jiangsu Jingmei) in the serum of three groups of rats.\u003c/p\u003e\n\u003ch4\u003eImmunohistochemistry\u003c/h4\u003e\n\u003cp\u003eParaffin-embedded tissue blocks, previously fixed in 4% paraformaldehyde, were sectioned to a fine thickness of 5 micrometers. These sections underwent deparaffinization in xylene, followed by dehydration with ethanol. To facilitate antibody binding, antigen retrieval was performed using a citrate buffer solution (ZLI-9065, Beijing Zhongshan Golden Bridge). After blocking with serum for 20 minutes to minimize nonspecific binding, the sections were incubated overnight at 4°C with primary antibodies targeting Bcl-2 (68103-1-Ig, Wuhan Sanying, 1:400 dilution), Bax (60267-1-Ig, Wuhan Sanying, 1:400 dilution), and Caspase3 (CSB-PA423088, Chengdu Biosciences, 1:100 dilution). The following day, the sections were thoroughly washed with PBS three times to remove unbound primary antibodies. Subsequently, incubation with species-specific secondary antibodies (PV-6000, Beijing Zhongshan Golden Bridge) was carried out at 37°C for 30 minutes. Visualization of the target proteins was achieved through DAB staining (ZLI-9019, Beijing Zhongshan Golden Bridge), followed by counterstaining with hematoxylin.\u003c/p\u003e\n\u003ch4\u003eData Analysis\u003c/h4\u003e\n\u003cp\u003eAll experimental data were quantitative and followed a normal distribution with homogeneous variances. Statistical analyses were performed using GraphPad Prism 9 software. To assess differences between groups, a one-way analysis of variance (ANOVA) was employed. Further post-hoc analysis using Tukey's test was conducted to identify specific group differences. A p-value less than 0.05 was statistically significant. Statistical significance was denoted relative to the NS group with asterisks (*\u003cem\u003ep\u003c/em\u003e=0.05, **\u003cem\u003ep=\u003c/em\u003e0.01, *\u003cem\u003ep=\u003c/em\u003e0.001) and relative to the PE group with number signs (\u003csup\u003e#\u003c/sup\u003e\u003cem\u003ep=\u003c/em\u003e0.05, \u003csup\u003e##\u003c/sup\u003e\u003cem\u003ep=\u003c/em\u003e0.01, \u003csup\u003e###\u003c/sup\u003e\u003cem\u003ep=\u003c/em\u003e0.001).\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003eMET attenuates L-NAME-induced preeclampsia in rats via reduced systolic blood pressure, decreased proteinuria, and improved pregnancy outcomes\u003c/p\u003e \u003cp\u003eSystolic blood pressure remained comparable between the NS and PE groups on GD0, GD6 and\u003c/p\u003e \u003cp\u003eGD12. However, on GD15, GD17, and GD19, the PE group exhibited a significant rise in systolic blood pressure compared to the NS group. Conversely, systolic blood pressure in the PE group treated with MET (PE\u0026thinsp;+\u0026thinsp;MET) was markedly lower compared to the untreated PE group (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). Similarly, proteinuria levels remained comparable across all groups on GD12. By GD19, the PE group displayed a significant increase in proteinuria compared to the NS group. However, MET administration in the PE\u0026thinsp;+\u0026thinsp;MET group resulted in a significant decrease in proteinuria (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). These observations suggest that subcutaneous L-NAME injections effectively established a PE model in pregnant rats, characterized by elevated systolic BP and proteinuria. Furthermore, MET treatment demonstrated efficacy in reducing both systolic BP and proteinuria in this PE rat model.\u003c/p\u003e \u003cp\u003eThe PE group exhibited significantly lower placental and fetal weights compared to the NS group. Additionally, placental diameter and fetal crown-rump length were markedly reduced in the PE group. Notably, the PE\u0026thinsp;+\u0026thinsp;MET group displayed a reversal trend in these developmental indices compared to the PE group, suggesting that MET treatment may counteract abnormal pregnancy outcomes in the PE rat model (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC\u003cb\u003e\u0026mdash;F\u003c/b\u003e). In summary, we successfully established a L-NAME-induced PE rat model, and MET administration influenced both the physiological characteristics and pregnancy outcomes associated with PE.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eMET Reduces Serum TNF-α and IL-6 Levels in L-NAME-induced PE Pregnant Rats while increasing IL-10 and eNOS Levels\u003c/p\u003e \u003cp\u003eBuilding upon prior studies that implicated inflammatory dysregulation in PE development, this investigation sought to evaluate the influence of MET on the inflammatory response in PE rats. Serum levels of key inflammatory factors were quantified across three pregnant rat groups. ELISA results demonstrated a marked elevation of pro-inflammatory cytokines TNF-α and IL-6 in the PE group compared to the control group. Conversely, the anti-inflammatory cytokine IL-10 displayed a significant decrease. Notably, MET administration resulted in a substantial reduction in TNF-α and IL-6 levels, accompanied by a significant rise in IL-10 levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA\u003cb\u003e\u0026mdash;C\u003c/b\u003e). These observations suggest that MET may exert a protective effect by mitigating the inflammatory imbalance observed in PE rats, highlighting its potential therapeutic role in PE.\u003c/p\u003e \u003cp\u003eEndothelial nitric oxide synthase (eNOS), a critical molecule for healthy blood vessel function, is known to be deficient in PE rats, contributing to damaged endothelial cells(Kozan et al., \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Lankhorst, Danser, \u0026amp; van den Meiracker, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Next, we examined eNOS levels in the serum of PE rats. As expected, PE rats had significantly lower eNOS levels compared to healthy pregnant rats. Interestingly, when treated with MET via intragastric administration, PE rats exhibited a notable increase in serum eNOS levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD). This suggests that MET may improve dysfunctional blood vessel linings in the placenta of PE rats by upregulating eNOS in the serum, which likely leads to increased production of nitric oxide.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eMET regulates the serum levels of sFlt-1, PlGF, and sEng in L-NAME-induced preeclampsia rat\u003c/p\u003e \u003cp\u003eSeveral proteins, including sFlt-1, sEng, and PlGF, are employed in clinical practice to evaluate the likelihood of developing PE. These proteins significantly influence vascular development regulation in PE, a critical process for PE onset and progression. Consequently, this study investigated and compared the serum levels of sFlt-1, sEng, and PlGF in three rat groups. ELISA results revealed a marked elevation of sFlt-1 and sEng in the PE group's pregnant rat serum, while PlGF levels were notably reduced. Conversely, MET intervention (PE\u0026thinsp;+\u0026thinsp;MET group) resulted in a significant decrease in sFlt-1 and sEng serum levels, accompanied by a significant increase in PlGF (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA\u003cb\u003e\u0026mdash;C\u003c/b\u003e).\u003c/p\u003e \u003cp\u003eClinicians additionally utilize the sFlt-1/PlGF ratio for risk assessment and management of PE in pregnant women(Verlohren et al., \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). The PE group displayed a significantly higher sFlt-1/PlGF ratio compared to the NS group. Conversely, the PE\u0026thinsp;+\u0026thinsp;MET group exhibited a significantly lower sFlt-1/PlGF ratio compared to the PE group (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). These findings collectively suggest that L-NAME disrupts the normal expression of sFlt-1, PlGF, and sEng, while MET treatment protects pregnant rats from PE by regulating these factors.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eMET ameliorates excessive apoptosis in L-NAME-induced preeclampsia rat placental tissue\u003c/p\u003e \u003cp\u003ePE is a pregnancy disorder likely caused by disruptions in multiple cellular signaling pathways. In PE, the placenta experiences prolonged periods of hypoxia, which triggers excessive apoptosis of trophoblast cells, which are vital for placental implantation and invasion into the uterus. The Bcl-2/Bax/Caspase3 pathway is a key regulator of trophoblast cell apoptosis. This study investigated the effect of MET on apoptosis in L-NAME-induced PE rats by examining the mRNA levels of Bcl-2, Bax, and Caspase3, which are markers of apoptosis. Compared to the NS group, PE rats displayed a decrease in Bcl-2 mRNA expression and an increase in Bax and Caspase3 mRNA expression, as measured by RT-qPCR (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA\u003cb\u003e\u0026mdash;C\u003c/b\u003e). Notably, MET treatment reversed these trends, restoring Bcl-2 expression and preventing the rise of Bax and Caspase3 expression induced by PE.\u003c/p\u003e \u003cp\u003eThe findings from Western blot analysis mirrored those of RT-qPCR. Placental tissue from the PE group exhibited a marked reduction in Bcl-2 protein levels, accompanied by a significant increase in Bax and Caspase3 protein expression, indicative of heightened placental cell apoptosis. Conversely, the PE\u0026thinsp;+\u0026thinsp;MET group displayed significantly higher Bcl-2 protein expression and demonstrably lower levels of Bax and Caspase3 compared to the PE group (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD \u003cb\u003eand E\u003c/b\u003e). These observations suggest a potential role for MET in mitigating L-NAME-induced preeclampsia by modulating the apoptotic pathways within placental tissue, potentially leading to improved maternal and fetal health outcomes.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eSerum levels of Bcl-2, Bax, and Caspase3 were further investigated using ELISA. Compared to the NS group, the PE group exhibited a decrease in Bcl-2 expression, while the PE\u0026thinsp;+\u0026thinsp;MET group showed an increase in Bax and Caspase3 expression relative to the PE group (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA\u003cb\u003e\u0026mdash;C\u003c/b\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eMET inhibits excessive apoptosis of trophoblast cells induced by L-NAME\u003c/p\u003e \u003cp\u003eTo investigate the effects of L-NAME and MET on apoptosis in placental tissue, researchers used immunohistochemistry to assess the expression of Bcl-2, Bax, and Caspase3. Compared to the control group (NS), the preeclampsia group exhibited a significant decrease in Bcl-2 staining intensity, indicating reduced levels of this anti-apoptotic protein. Conversely, staining intensity for the pro-apoptotic factors Bax and Caspase3 was markedly increased in the PE group, suggesting heightened apoptotic activity. This pattern was particularly evident in trophoblast cells, where Bcl-2 expression was lower and Bax and Caspase3 expression were higher in the PE group compared to the control group. Notably, MET treatment reversed these trends in the PE group. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e, MET restored Bcl-2 expression and normalized Bax and Caspase3 expression in placental tissue, particularly within trophoblast cells. These findings suggest that MET exerts its protective effects in PE by inhibiting excessive trophoblast cell apoptosis through modulation of the Bcl-2/Bax/Caspase3 pathway. This indicates that MET possesses anti-apoptotic properties, potentially improving trophoblast cell function in pregnant rats with preeclampsia.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eDespite established benefits of MET in various diseases, its role in PE remains less explored. This study provides compelling evidence that MET treatment effectively mitigates hypertension and reduces 24-hour proteinuria in pregnant rats with L-NAME-induced PE, additionally promoting recovery from placental and fetal injuries. Previous research suggests that PE patients experience a decline in functional eNOS, potentially limiting NO production and worsening endothelial dysfunction, a hallmark of PE(Kim et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Consistent with this, L-NAME, a compound that inhibits NOS activity, lowered serum eNOS levels in pregnant rats. Conversely, MET treatment increased serum eNOS levels, potentially restoring endothelial function in PE by promoting NO production.\u003c/p\u003e \u003cp\u003ePrior research has established the critical involvement of imbalanced immune cell activity in PE development(Deer et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Macrophages and natural killer (NK) cells exhibit abnormal secretion of chemotactic factors, fostering a pro-inflammatory environment. This inflammatory state is further fueled by elevated levels of pro-inflammatory cytokines like TNF-α and IL-6, which ultimately lead to increased C-reactive protein (CRP), a marker of inflammation, and contribute to PE development(Jena, Sharma, Petitt, Maulik, \u0026amp; Nayak, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Notably, excess TNF-α can specifically hinder trophoblast cell migration and integration, potentially playing a key role in PE progression(Zhong, Yao, \u0026amp; Zhong, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Our study corroborates these findings, demonstrating significantly higher levels of the inflammatory factors TNF-α and IL-6 in the serum of L-NAME-induced pregnant rats compared to the control group. Conversely, levels of IL-10, a crucial immune regulator, were likely insufficient. IL-10 not only maintains a balanced inflammatory state at the maternal-fetal interface but also offers benefits in endothelial dysfunction associated with PE(Cubro, Kashyap, Nath, Ackerman, \u0026amp; Garovic, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Kuusiniemi et al. demonstrated that MET can alleviate inflammation and oxidative stress in the skeletal muscles of mice fed a high-fat diet; other studies have found that MET can activate AMPK-regulated signaling pathways and inhibit inflammation(Bahramzadeh, Samavarchi Tehrani, Goodarzi, Seyyedebrahimi, \u0026amp; Meshkani, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Kuusiniemi, Karihtala, Puistola, Ahtikoski, \u0026amp; Urpilainen, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Our findings indicate that MET treatment in PE rats led to a reduction in pro-inflammatory factors TNF-α and IL-6 within the serum. This suppression may create an environment more conducive for the anti-inflammatory effects of IL-10, potentially offering a novel therapeutic approach for targeting the inflammatory pathways associated with PE.\u003c/p\u003e \u003cp\u003eEmerging evidence suggests a critical role for abnormal protein signaling in PE. Studies have shown that sFlt-1 can bind to PlGF, hindering its function(Verlohren et al., \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). This disrupts vascular function and prevents proper remodeling of spiral arteries in the uterus, ultimately leading to placental ischemia in PE pregnancies. Notably, sFlt-1 treatment in mice has been linked to mitochondrial swelling in placental tissues and increased markers of apoptosis(Jiang et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Furthermore, hypoxia in the placenta can trigger the release of another anti-angiogenic factor, sEng. Research by Karumanchi et al. has shed light on the role of these molecules in PE development, demonstrating that excessive production of sFlt-1 and sEng can induce dysfunction in the mother's endothelial cells(Rana, Burke, \u0026amp; Karumanchi, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Our study provides compelling evidence that MET intervention effectively reverses the rise in the sFlt-1/PlGF ratio observed in the serum of L-NAME-induced PE rats. Additionally, MET treatment suppressed the elevation of serum sFlt-1 and sEng levels, while promoting an increase in PlGF levels. PlGF plays a vital role in stimulating endothelial cell generation during pregnancy, thus contributing to improved function of the endothelium in both the mother and the placenta. Therefore, monitoring changes in factors like sFlt-1, PlGF, and sEng, along with the sFlt-1/PlGF ratio, holds promise as a valuable tool for both diagnosing and predicting PE.\u003c/p\u003e \u003cp\u003eApoptosis, is a tightly controlled process involving both extrinsic and intrinsic (mitochondrial) pathways. These pathways play a crucial role in maintaining healthy development of trophoblast cells, the building blocks of the placenta, during pregnancy. However, excessive apoptosis of placental cells is a major contributor to placental dysfunction in PE. Maternal immune cells can overstimulate the mitochondrial apoptosis pathway in trophoblast cells, with the Bcl-2/Bax/Caspase3 pathway being a key regulatory mechanism(Raguema et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Studies have shown that imbalances in this pathway, characterized by increased levels of pro-apoptotic proteins Bax and Caspase3 alongside decreased levels of the anti-apoptotic protein Bcl-2, can disrupt placental function(Kasture, Sundrani, Randhir, Wagh, \u0026amp; Joshi, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Therefore, changes in the expression of these proteins directly reflect the level of trophoblast cell apoptosis in PE placentas(H. Wang et al., \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Our study investigated the effects of MET on this pathway. Interestingly, oral administration of MET in PE rats led to an upregulation of Bcl-2 and a downregulation of Bax and Caspase3 in the placenta, which aligns with previously observed protective effects of MET. While the precise mechanisms remain under investigation, existing research offers potential explanations. Growing evidence suggests that MET can counteract excessive apoptosis in kidney cells exposed to high glucose levels by regulating the miR-34a/SIRT1 axis(Zhuang et al., \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Additionally, Ni et al. demonstrated that MET can reverse mitochondrial dysfunction-induced apoptosis in sperm cells through the CREB/SIRT1/FOXO3 signaling pathway(Ni et al., \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). However, Deng et al. reported that combining MET with gemcitabine enhances apoptosis in cholangiocarcinoma cells(Deng, Qian, Zhang, Yu, \u0026amp; Yang, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). These findings suggest that the beneficial effects of MET on trophoblast cells in PE rats may be linked to its influence on the mitochondrial apoptosis pathway via the Bcl-2/Bax/Caspase3 proteins. This study provides compelling evidence that MET can regulate the placental mitochondrial apoptosis pathway in a PE animal model. However, PE is a complex disease, and further research is necessary to elucidate other potential signaling pathways influenced by MET in the context of PE.\u003c/p\u003e \u003cp\u003eIn summary, our study suggests that MET could improve placental function in an L-NAME-induced PE rat model through its anti-inflammatory and anti-apoptotic effects. Additionally, MET can regulate factors like sFlt-1, PlGF, and sEng, potentially preventing or alleviating PE development. These findings offer promising targets for the development of novel PE treatment strategies. However, the underlying mechanisms require further investigation. Notably, this study was limited to animal models and has not yet been validated in human clinical trials.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThis study demonstrates the potential of MET as a therapeutic or preventive intervention for PE. In a rat model of PE induced by L-NAME, MET treatment modulated the mitochondrial apoptosis pathway, reducing excessive trophoblast cell death in the placenta. This resulted in a reversal of hypertension and proteinuria in preeclamptic rats. By significantly reducing trophoblast cell apoptosis, MET alleviated the maternal burden and potentially improved fetal development. These findings provide valuable insights for further basic research and clinical exploration of MET as a treatment for PE.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003ch2\u003eDeclaration of competing interest\u003c/h2\u003e \u003cp\u003eThe authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e \u003cp\u003eThis work was supported by the Shanxi Provincial Health Commission science and technology innovation base construction project (YDZJSX2022B010), National Clinical Key Specialty Construction Project (Y2022ZD001, Y2022ZD002) and Shanxi Medical University First Hospital Fund Project (YY2215).\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eHN wrote the original draft; WF conceived and designed Methodology; JR and YM conduct data analysis; HL reviewed and edited the paper.All the authors read and approved the final manuscript.\u003c/p\u003e\u003ch2\u003eAvailability of data and material\u003c/h2\u003e \u003cp\u003eThe data and material used to support the fndings of this study are included within the article.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eAkgul, C., Moulding, D. A., \u0026amp; Edwards, S. W. (2004). Alternative splicing of Bcl-2-related genes: functional consequences and potential therapeutic applications. \u003cem\u003eCell Mol Life Sci, 61\u003c/em\u003e(17), 2189-2199. doi:10.1007/s00018-004-4001-7\u003c/li\u003e\n \u003cli\u003eBahramzadeh, A., Samavarchi Tehrani, S., Goodarzi, G., Seyyedebrahimi, S., \u0026amp; Meshkani, R. (2024). Combination therapy of metformin and morin attenuates insulin resistance, inflammation, and oxidative stress in skeletal muscle of high-fat diet-fed mice. \u003cem\u003ePhytother Res, 38\u003c/em\u003e(2), 912-924. doi:10.1002/ptr.8086\u003c/li\u003e\n \u003cli\u003eCubro, H., Kashyap, S., Nath, M. C., Ackerman, A. W., \u0026amp; Garovic, V. D. (2018). The Role of Interleukin-10 in the Pathophysiology of Preeclampsia. \u003cem\u003eCurr Hypertens Rep, 20\u003c/em\u003e(4), 36. doi:10.1007/s11906-018-0833-7\u003c/li\u003e\n \u003cli\u003eCui, H., Liu, J., Vasileva, E. A., Mishchenko, N. P., Fedoreyev, S. A., Stonik, V. A., \u0026amp; Zhang, Y. (2022). Echinochrome A Reverses Kidney Abnormality and Reduces Blood Pressure in a Rat Model of Preeclampsia. \u003cem\u003eMar Drugs, 20\u003c/em\u003e(11). doi:10.3390/md20110722\u003c/li\u003e\n \u003cli\u003ede Alwis, N., Binder, N. K., Beard, S., Mangwiro, Y. T., Kadife, E., Cuffe, J. S., . . .\u0026nbsp;Hannan, N. J. (2022). The L-NAME mouse model of preeclampsia and impact to long-term maternal cardiovascular health. \u003cem\u003eLife Sci Alliance, 5\u003c/em\u003e(12). doi:10.26508/lsa.202201517\u003c/li\u003e\n \u003cli\u003eDeer, E., Herrock, O., Campbell, N., Cornelius, D., Fitzgerald, S., Amaral, L. M., \u0026amp; LaMarca, B. (2023). The role of immune cells and mediators in preeclampsia. \u003cem\u003eNat Rev Nephrol, 19\u003c/em\u003e(4), 257-270. doi:10.1038/s41581-022-00670-0\u003c/li\u003e\n \u003cli\u003eDeng, H., Qian, X., Zhang, Y., Yu, W., \u0026amp; Yang, P. (2024). Metformin Increases the Response of Cholangiocarcinoma Cells to Gemcitabine by Suppressing Pyruvate Kinase M2 to Activate Mitochondrial Apoptosis. \u003cem\u003eDig Dis Sci, 69\u003c/em\u003e(2), 476-490. doi:10.1007/s10620-023-08210-x\u003c/li\u003e\n \u003cli\u003eDimitriadis, E., Rolnik, D. L., Zhou, W., Estrada-Gutierrez, G., Koga, K., Francisco, R. P. V., . . .\u0026nbsp;Menkhorst, E. (2023). Pre-eclampsia. \u003cem\u003eNat Rev Dis Primers, 9\u003c/em\u003e(1), 8. doi:10.1038/s41572-023-00417-6\u003c/li\u003e\n \u003cli\u003eGatford, K. L., Andraweera, P. H., Roberts, C. T., \u0026amp; Care, A. S. (2020). Animal Models of Preeclampsia: Causes, Consequences, and Interventions. \u003cem\u003eHypertension, 75\u003c/em\u003e(6), 1363-1381. doi:10.1161/hypertensionaha.119.14598\u003c/li\u003e\n \u003cli\u003eHe, L., Wu, X., Zhan, F., Li, X., \u0026amp; Wu, J. (2023). Protective role of metformin in preeclampsia via the regulation of NF-\u0026kappa;B/sFlt-1 and Nrf2/HO-1 signaling pathways by activating AMPK. \u003cem\u003ePlacenta, 143\u003c/em\u003e, 91-99. doi:10.1016/j.placenta.2023.10.003\u003c/li\u003e\n \u003cli\u003eJena, M. K., Sharma, N. R., Petitt, M., Maulik, D., \u0026amp; Nayak, N. R. (2020).\u0026nbsp;Pathogenesis of Preeclampsia and Therapeutic Approaches Targeting the Placenta. \u003cem\u003eBiomolecules, 10\u003c/em\u003e(6). doi:10.3390/biom10060953\u003c/li\u003e\n \u003cli\u003eJiang, Z., Zou, Y., Ge, Z., Zuo, Q., Huang, S. Y., \u0026amp; Sun, L. (2015).\u0026nbsp;A Role of sFlt-1 in Oxidative Stress and Apoptosis in Human and Mouse Pre-Eclamptic Trophoblasts. \u003cem\u003eBiol Reprod, 93\u003c/em\u003e(3), 73. doi:10.1095/biolreprod.114.126227\u003c/li\u003e\n \u003cli\u003eKaitu\u0026apos;u-Lino, T. J., Brownfoot, F. C., Beard, S., Cannon, P., Hastie, R., Nguyen, T. V., . . . Hannan, N. J. (2018). Combining metformin and esomeprazole is additive in reducing sFlt-1 secretion and decreasing endothelial dysfunction - implications for treating preeclampsia. \u003cem\u003ePLoS One, 13\u003c/em\u003e(2), e0188845. doi:10.1371/journal.pone.0188845\u003c/li\u003e\n \u003cli\u003eKasture, V., Sundrani, D., Randhir, K., Wagh, G., \u0026amp; Joshi, S. (2021). Placental apoptotic markers are associated with placental morphometry. \u003cem\u003ePlacenta, 115\u003c/em\u003e, 1-11. doi:10.1016/j.placenta.2021.08.051\u003c/li\u003e\n \u003cli\u003eKim, J., Lee, K. S., Kim, J. H., Lee, D. K., Park, M., Choi, S., . . . Kim, Y. M. (2017). Aspirin prevents TNF-\u0026alpha;-induced endothelial cell dysfunction by regulating the NF-\u0026kappa;B-dependent miR-155/eNOS pathway: Role of a miR-155/eNOS axis in preeclampsia. \u003cem\u003eFree Radic Biol Med, 104\u003c/em\u003e, 185-198. doi:10.1016/j.freeradbiomed.2017.01.010\u003c/li\u003e\n \u003cli\u003eKozan, A., Kilic, N., Alacam, H., Guzel, A., Guvenc, T., \u0026amp; Acikgoz, M. (2016). The Effects of Dexamethasone and L-NAME on Acute Lung Injury in Rats with Lung Contusion. \u003cem\u003eInflammation, 39\u003c/em\u003e(5), 1747-1756. doi:10.1007/s10753-016-0409-0\u003c/li\u003e\n \u003cli\u003eKuusiniemi, E., Karihtala, P., Puistola, U., Ahtikoski, A., \u0026amp; Urpilainen, E. (2023). Oxidative Stress-regulating Enzymes and Endometrial Cancer Survival in Relation to Metformin Intake in Diabetic Patients. \u003cem\u003eAnticancer Res, 43\u003c/em\u003e(12), 5545-5554. doi:10.21873/anticanres.16756\u003c/li\u003e\n \u003cli\u003eLaMoia, T. E., \u0026amp; Shulman, G. I. (2021).\u0026nbsp;Cellular and Molecular Mechanisms of Metformin Action. \u003cem\u003eEndocr Rev, 42\u003c/em\u003e(1), 77-96. doi:10.1210/endrev/bnaa023\u003c/li\u003e\n \u003cli\u003eLankhorst, S., Danser, A. H., \u0026amp; van den Meiracker, A. H. (2016). Endothelin-1 and antiangiogenesis. \u003cem\u003eAm J Physiol Regul Integr Comp Physiol, 310\u003c/em\u003e(3), R230-234. doi:10.1152/ajpregu.00373.2015\u003c/li\u003e\n \u003cli\u003eMelchiorre, K., Giorgione, V., \u0026amp; Thilaganathan, B. (2022). The placenta and preeclampsia: villain or victim? \u003cem\u003eAm J Obstet Gynecol, 226\u003c/em\u003e(2s), S954-s962. doi:10.1016/j.ajog.2020.10.024\u003c/li\u003e\n \u003cli\u003eNi, F., Wang, F., Li, J., Liu, Y., Sun, X., Chen, J., . . . Zhang, D. (2024). BNC1 deficiency induces mitochondrial dysfunction-triggered spermatogonia apoptosis through the CREB/SIRT1/FOXO3 pathway: the therapeutic potential of nicotinamide riboside and metformin\u0026dagger;. \u003cem\u003eBiol Reprod, 110\u003c/em\u003e(3), 615-631. doi:10.1093/biolre/ioad168\u003c/li\u003e\n \u003cli\u003eRaguema, N., Moustadraf, S., \u0026amp; Bertagnolli, M. (2020). Immune and Apoptosis Mechanisms Regulating Placental Development and Vascularization in Preeclampsia. \u003cem\u003eFront Physiol, 11\u003c/em\u003e, 98. doi:10.3389/fphys.2020.00098\u003c/li\u003e\n \u003cli\u003eRana, S., Burke, S. D., \u0026amp; Karumanchi, S. A. (2022). Imbalances in circulating angiogenic factors in the pathophysiology of preeclampsia and related disorders. \u003cem\u003eAm J Obstet Gynecol, 226\u003c/em\u003e(2s), S1019-s1034. doi:10.1016/j.ajog.2020.10.022\u003c/li\u003e\n \u003cli\u003eRana, S., Lemoine, E., Granger, J. P., \u0026amp; Karumanchi, S. A. (2019). Preeclampsia: Pathophysiology, Challenges, and Perspectives. \u003cem\u003eCirc Res, 124\u003c/em\u003e(7), 1094-1112. doi:10.1161/circresaha.118.313276\u003c/li\u003e\n \u003cli\u003eRomero, R., Erez, O., H\u0026uuml;ttemann, M., Maymon, E., Panaitescu, B., Conde-Agudelo, A., . . . Grossman, L. I. (2017). Metformin, the aspirin of the 21st century: its role in gestational diabetes mellitus, prevention of preeclampsia and cancer, and the promotion of longevity. \u003cem\u003eAm J Obstet Gynecol, 217\u003c/em\u003e(3), 282-302. doi:10.1016/j.ajog.2017.06.003\u003c/li\u003e\n \u003cli\u003eTong, J., Niu, Y., Chen, Z. J., \u0026amp; Zhang, C. (2020). Comparison of the transcriptional profile in the decidua of early-onset and late-onset pre-eclampsia. \u003cem\u003eJ Obstet Gynaecol Res, 46\u003c/em\u003e(7), 1055-1066. doi:10.1111/jog.14257\u003c/li\u003e\n \u003cli\u003eVerlohren, S., Brennecke, S. P., Galindo, A., Karumanchi, S. A., Mirkovic, L. B., Schlembach, D., . . . Rana, S. (2022). Clinical interpretation and implementation of the sFlt-1/PlGF ratio in the prediction, diagnosis and management of preeclampsia. \u003cem\u003ePregnancy Hypertens, 27\u003c/em\u003e, 42-50. doi:10.1016/j.preghy.2021.12.003\u003c/li\u003e\n \u003cli\u003eWang, G., Wang, Y., Yang, Q., Xu, C., Zheng, Y., Wang, L., . . . Luo, M. (2022). Metformin prevents methylglyoxal-induced apoptosis by suppressing oxidative stress in vitro and in vivo. \u003cem\u003eCell Death Dis, 13\u003c/em\u003e(1), 29. doi:10.1038/s41419-021-04478-x\u003c/li\u003e\n \u003cli\u003eWang, H., Liu, M. L., Chu, C., Yu, S. J., Li, J., Shen, H. C., . . . Zhang, T. (2022). Paeonol alleviates placental inflammation and apoptosis in preeclampsia by inhibiting the JAK2/STAT3 signaling pathway. \u003cem\u003eKaohsiung J Med Sci, 38\u003c/em\u003e(11), 1103-1112. doi:10.1002/kjm2.12585\u003c/li\u003e\n \u003cli\u003eXu, Y., Sui, L., Qiu, B., Yin, X., Liu, J., \u0026amp; Zhang, X. (2019). ANXA4 promotes trophoblast invasion via the PI3K/Akt/eNOS pathway in preeclampsia. \u003cem\u003eAm J Physiol Cell Physiol, 316\u003c/em\u003e(4), C481-c491. doi:10.1152/ajpcell.00404.2018\u003c/li\u003e\n \u003cli\u003eZhong, Q., Yao, C., \u0026amp; Zhong, W. (2023). Causal Relationship Between Inflammation and Preeclampsia: Genetic Evidence from a Mendelian Randomization Study. \u003cem\u003eTwin Res Hum Genet, 26\u003c/em\u003e(3), 231-235. doi:10.1017/thg.2023.27\u003c/li\u003e\n \u003cli\u003eZhuang, X., Sun, Z., Du, H., Zhou, T., Zou, J., \u0026amp; Fu, W. (2024). Metformin inhibits high glucose-induced apoptosis of renal podocyte through regulating miR-34a/SIRT1 axis. \u003cem\u003eImmun Inflamm Dis, 12\u003c/em\u003e(1), e1053. doi:10.1002/iid3.1053\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Preeclampsia, Metformin, Bcl-2/Bax/Caspase3 pathway, Cell apoptosis, Inflammation","lastPublishedDoi":"10.21203/rs.3.rs-4390427/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4390427/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground:\u003c/strong\u003e Preeclampsia (PE) is one of the leading complications affecting pregnant women globally during the perinatal period, with excessive apoptosis of trophoblast cells playing a crucial role in its pathogenesis. While Metformin (MET) has shown promise in preventing or treating PE, its mechanisms remain unclear.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eObjective:\u003c/strong\u003e We sought to establish a PE rat model and evaluate MET's impact on the intrinsic (mitochondrial) apoptotic pathway (Bcl-2/Bax/Caspase3) in placental cells. We investigated whether MET could reduce excessive trophoblast cell apoptosis through this pathway, thereby improving pregnancy outcomes in PE rats.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethods:\u003c/strong\u003e Thirty successfully impregnated Sprague-Dawley (SD) rats were randomly divided into normal saline (NS), PE, and PE+MET groups. The NS group received physiological saline injections (200mg/kg/d) from gestational day 14 to gestational day 18 (GD14-GD18). The PE and PE+MET groups received L-NAME injections (200mg/kg/d) from gestational day 14 to 18 (GD14-GD18). The PE+MET group additionally received MET via gastric gavage from GD13 to GD18. Western blot, RT-qPCR, and immunohistochemistry were employed to assess the expression of Bcl-2, Bax, and Caspase3 in placental tissues. ELISA was used to measure the expression of Bcl-2, Bax, Caspase3, tumor necrosis factor-α (TNF-α), interleukin-6 (IL-6), interleukin-10 (IL-10), soluble FMS-like tyrosine kinase 1 (sFlt-1), soluble endoglin (sEng), placental growth factor (PlGF), and endothelial nitric oxide synthase (eNOS) in serum.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults:\u003c/strong\u003e MET treatment reduced blood pressure and proteinuria in PE rats and improved pregnancy outcomes. It lowered serum levels of pro-inflammatory cytokines (TNF-α, IL-6) and increased the anti-inflammatory cytokine IL-10 in PE rats. MET also restored the balance of angiogenic factors. Moreover, MET upregulated Bcl-2 expression and suppressed Bax and Caspase3 levels, suggesting its ability to suppress excessive trophoblast cell apoptosis.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusion:\u003c/strong\u003e MET effectively mitigated PE in L-NAME-induced rats by lowering blood pressure, proteinuria, inflammatory damage, and trophoblast cell death while improving pregnancy outcomes and restoring the balance of angiogenic factors. This effect appears to be mediated, at least partly, by modulating the Bcl-2/Bax/Caspase3 apoptotic pathway.\u003c/p\u003e","manuscriptTitle":"The impact of metformin on the Bcl-2/Bax/Caspase3 signaling pathway in placental tissue of preeclampsia rats","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-05-23 05:59:39","doi":"10.21203/rs.3.rs-4390427/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"027eaad4-d7f7-4136-aea7-f76a8d791819","owner":[],"postedDate":"May 23rd, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-06-21T05:45:20+00:00","versionOfRecord":[],"versionCreatedAt":"2024-05-23 05:59:39","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4390427","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4390427","identity":"rs-4390427","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}