Full text
67,016 characters
· extracted from
preprint-html
· click to expand
Functional analysis of a novel de novo variant in PPP5C associated with microcephaly, seizures, and developmental delay | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results Functional analysis of a novel de novo variant in PPP5C associated with microcephaly, seizures, and developmental delay Sara M. Fielder , Jill A. Rosenfeld , Lindsay C. Burrage , Lisa Emrick , Seema Lalani , Ruben Attali , Joshua N. Bembenek , Hieu Hoang , Dustin Baldridge , Gary A. Silverman , Undiagnosed Diseases Network , Tim Schedl , View ORCID Profile Stephen C. Pak doi: https://doi.org/10.1101/2022.02.02.478908 Sara M. Fielder 1 Department of Pediatrics, Washington University in St Louis School of Medicine , St Louis, MO 63110, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Jill A. Rosenfeld 2 Department of Molecular and Human Genetics, Baylor College of Medicine , Houston, TX 77030, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Lindsay C. Burrage 2 Department of Molecular and Human Genetics, Baylor College of Medicine , Houston, TX 77030, USA 3 Texas Children’s Hospital , Houston, TX 77030, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Lisa Emrick 2 Department of Molecular and Human Genetics, Baylor College of Medicine , Houston, TX 77030, USA 3 Texas Children’s Hospital , Houston, TX 77030, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Seema Lalani 2 Department of Molecular and Human Genetics, Baylor College of Medicine , Houston, TX 77030, USA 3 Texas Children’s Hospital , Houston, TX 77030, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Ruben Attali 4 Genomic Research Department, Emedgene Technologies , 67443 Tel Aviv, Israel Find this author on Google Scholar Find this author on PubMed Search for this author on this site Joshua N. Bembenek 5 Department of Obstetrics and Gynecology, C.S. Mott Center for Human Growth and Development, Wayne State University School of Medicine , Detroit, MI, 48201 Find this author on Google Scholar Find this author on PubMed Search for this author on this site Hieu Hoang 1 Department of Pediatrics, Washington University in St Louis School of Medicine , St Louis, MO 63110, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Dustin Baldridge 1 Department of Pediatrics, Washington University in St Louis School of Medicine , St Louis, MO 63110, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Gary A. Silverman 1 Department of Pediatrics, Washington University in St Louis School of Medicine , St Louis, MO 63110, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Tim Schedl 6 Department of Genetics, Washington University in St Louis School of Medicine , St Louis, MO 63110, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Stephen C. Pak 1 Department of Pediatrics, Washington University in St Louis School of Medicine , St Louis, MO 63110, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Stephen C. Pak For correspondence: stephen.pak{at}wustl.edu Abstract Full Text Info/History Metrics Supplementary material Preview PDF ABSTRACT We describe a proband evaluated through the Undiagnosed Diseases Network (UDN) who presented with microcephaly, developmental delay, and refractory epilepsy with a de novo p.Ala47Thr missense variant in the protein phosphatase gene, PPP5C . This gene has not previously been associated with a Mendelian disease, and based on the population database, gnomAD, the gene has a low tolerance for loss-of-function variants (pLI=1, o/e=0.07). We functionally evaluated the PPP5C variant in C. elegans by knocking the variant into the orthologous gene, pph-5, at the corresponding residue, Ala48Thr. We employed assays in three different biological processes where pph-5 was known to function through opposing the activity of genes, mec-15 and sep-1. We demonstrated that, in contrast to control animals, the pph-5 Ala48Thr variant suppresses the neurite growth phenotype and the GABA signaling defects of mec-15 mutants, and the embryonic lethality of sep-1 mutants. The Ala48Thr variant did not display dominance and behaved similarly to the reference pph-5 null, indicating that the variant is likely a strong hypomorph or complete loss-of-function. We conclude that pph-5 Ala48Thr is damaging in C. elegans. By extension in the proband, PPP5C p.Ala47Thr is likely damaging, the de novo dominant presentation is consistent with haplo-insufficiency, and the PPP5C variant is likely responsible for one or more of the proband’s phenotypes. INTRODUCTION Protein phosphatase 5, encoded by the PPP5C gene, is a serine/threonine phosphatase that participates in the modulation of protein function by removing phosphate groups at serine and threonine residues. PPP5C interacts with a wide range of proteins, including nuclear receptors, kinases and transcription factors, and plays an important role in the regulation of numerous cellular processes including cell growth and differentiation, migration, apoptosis, DNA damage response and regulation of circadian rhythm [ 1 – 8 ] (reviewed in [ 9 ]). PPP5C is expressed ubiquitously but is present in high levels in the mammalian brain [ 10 – 13 ], and altered phosphatase activity has been associated with disease. For example, elevated PPP5C expression was detected in tumors, but not in normal tissues taken from patients with prostate cancer [ 14 ]. Additionally, knock down of PPP5C caused a decrease in the proliferation of cultured prostate, lung and urinary bladder cancer cells [ 5 , 14 , 15 ]. In contrast, overexpression of PPP5C in a breast cancer cell line (MCF7) enabled estrogen-dependent cells to grow independently of estrogen [ 16 ]. PPP5C has also been shown to regulate ciliogenesis by dephosphorylating DVL2, a key mediator of WNT signaling, in mammalian cells [ 17 ]. PPP5C is known to physically interact with and dephosphorylate HSP90 and glucocorticoid receptors suggesting a role in metabolism, stress response, immune function, skeletal growth, reproduction and cognition [ 18 , 19 ]. HSP90 is a protein chaperone responsible for stabilizing many different proteins. For example, in conjunction with the TEL2-TTI1-TTI2 (TTT) complex, HSP90 stabilizes phosphatidylinositol 3-kinase related kinases (PIKKs), which in turn are responsible for regulating DNA damage responses, cell growth, and transcriptome surveillance (reviewed in [ 20 , 21 ]). Ppp5c homozygous knockout mice are viable and fertile, however, these mice have lower body weights as compared to their wild type littermates and do not gain weight when fed a high-fat diet [ 22 – 24 ]. In Drosophila, the PPP5C homolog (PpD3) is most highly expressed during embryonic development and has been implicated in centrosome separation during mitosis [ 25 , 26 ]. Ppt1p, the yeast homolog of PPP5C, shows peak expression during early log cell growth, suggesting that Ppt1p may be involved in cell growth similar to what has been reported in human cell culture [ 27 ]. Analogous to the mammalian PPP5C, the Caenorhabditis elegans ( C. elegans) ortholog PPH-5 is known to associate with the HSP90 and the glucocorticoid receptor complex [ 2 , 28 ]. While pph-5 null animals are superficially wild-type, genetic studies in C. elegans have revealed a role for pph-5 in the regulation of GABA signaling and in neurite growth by opposing the activity of the F-box protein, MEC-15 [ 28 ]. Similarly, numerous pph-5 loss-of-function mutants were identified in a genetic screen for interactors with separase ( sep-1 ), a cysteine protease that plays an important role in chromosome segregation during mitosis, cortical granule exocytosis, and eggshell formation [ 29 , 30 ]. In a sep-1 hypomorphic mutant that is unable to form an eggshell, loss-of-function mutations in pph-5 were found to rescue the embryonic lethality, suggesting a role for pph-5 in the regulation of exocytosis and eggshell formation. Here we present a proband accepted to the Undiagnosed Diseases Network (UDN) with a heterozygous, de novo missense variant (NM_006247.3, c.139G>A, p.Ala47Thr) in PPP5C. The proband’s main clinical features include microcephaly, epilepsy, and developmental delay. According to the population database, gnomAD v2.1.1 [ 31 ], PPP5C is highly constrained for loss-of-function variants (pLI=1.0, o/e=0.07). This gene has not previously been associated with a Mendelian disease. Therefore, we evaluated this gene-variant by performing in vivo functional analysis in the model organism C. elegans , as has been performed for other genes of uncertain significance [ 32 – 34 ]. We employed CRISPR-Cas9 to introduce the proband’s missense variant into pph-5, the C. elegans ortholog of PPP5C , and assessed the impact of pph-5 Ala48Thr, corresponding to human PPP5C p.Ala47Thr. We provide data showing that the pph-5 Ala48Thr variant alters neurite growth, GABA signaling, and eggshell formation, by acting as a strong hypomorph or loss-of-function allele. By extension, our data suggest that the human PPP5C p.Ala47Thr is damaging and likely responsible for one or more of the neurodevelopmental phenotypes in the proband. METHODS Proband evaluation and consent Informed consent was obtained from the proband’s parents as part of enrollment into the Undiagnosed Diseases Network study, which is overseen by the National Institutes of Health Institutional Review Board (protocol #15HG0130). Phenotypic evaluation was completed through review of medical records and in-person examination by physicians who are co-investigators on the study. Exome sequencing and variant analysis Clinical trio exome sequencing was performed clinically in a CLIA certified laboratory and the data was transferred for research analysis within the Undiagnosed Diseases Network. Codified Genomics ( www.codifiedgenomics.com ) and emedgene ( www.emedgene.com ) were used to prioritize novel, de novo variants that were not observed in gnomAD or in our database of over 1000 exomes and genomes (unless the phenotype of the probands matched) and biallelic variants in the coding region or near intron-exon boundaries with allele frequency of less than 1% and without homozygous entries in gnomAD [ 31 ] (Table S1). Variants of interest were confirmed using Sanger Sequencing within a CLIA certified laboratory. C. elegans strain and culture information C. elegans were grown on standard Nematode Growth Media (NGM) and fed OP50 E. coli [ 35 ]. As mec-15(u1042) phenotypes were previously reported to be more extreme at higher temperatures [ 28 ], strains used for aldicarb assay and PLM-anterior neurite length were grown at 25°C for at least two generations before analysis. Strains used in this paper include (TU5237) mec-15(u1042); uIs115 (a generous gift from the Chalfie lab), pph-5(ok3498), sep-1(e2406) and VC2010. Strains with pph-5(udn90-94) generated in this study are described below. A full list of strains used in this study is in Table S2. Some strains were provided by the CGC, which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440). CRISPR/Cas9-based gene editing pph-5(udn90-94) alleles were generated by injecting VC2010 1 day adults with Cas9 (IDT 1081060), tracrRNA (IDT 1072533), crRNA with the targeting sequence TGCAGATCAAGTGTACGACG (IDT Alt-R ® CRISPR-Cas9 sgRNA), pRF4 rol-6 plasmid as a positive injection marker, and single-stranded DNA oligonucleotide repair template (IDT) as previously described [ 32 , 33 ]. Repair templates were 100 bases in length, centering on the locus of the proband variant, and were used to destroy the PAM site to prevent further editing, add a silent AvaII (NEB R0153L) restriction site to aid in genotyping, and to introduce the proband variant. Control repair templates containing only the silent PAM site change and the silent AvaII sites were also used, to determine that any phenotypes observed in the proband variant lines were due to the proband variant alone and not due to any silent mutations. Complete sequences of the repair templates are shown in Table S3. Each edited line was Sanger sequence verified and backcrossed twice to VC2010 to remove any background mutations. A line was considered independent if obtained from a separate injected animal. Three variant Ala48Thr lines were initially generated, and as all three lines showed no statistical difference in a preliminary blinded aldicarb paralysis assay (Fig. S1), only two lines were used for further analysis. Additionally, two control Ala48Ala edit lines were initially generated, and as both showed no statistical difference from each other or to the corresponding background strains in a blinded aldicarb paralysis assay and in the sep-1 embryo lethality assay, only one control edit line was used for analysis. Aldicarb paralysis assay To make 0.25mM aldicarb plates, 22.5 μL of 100mM aldicarb (Sigma #33386) stock in 70% ethanol was spread onto each NGM plate and allowed to dry at room temperature for one hour. A drop of OP50 suspended in LB was added to the center of each plate to help keep animals concentrated in the middle of the plate. Plates were then allowed to dry at room temperature for an additional hour. Ten one-day-old adult animals were added to each plate, with three replicates per strain. Paralyzed animals, defined as those not independently moving following two gentle taps with a platinum pick, were counted every twenty minutes. Animals were scored every thirty minutes from t=30 minutes to 130 minutes. Each experiment was performed three times, and the experimenter was blinded to genotypes. Plates that had two or more animals crawl off the agar were discarded from analysis. Microscopy and neurite length measurement PLM a nterior n eurites (PLM-AN) tagged with RFP (uls115[Pmec-17::RFP]) were imaged with a Zeiss compound fluorescence microscope. Strains were grown at 25°C for several generations before this assay was performed. Larval stage L4 animals were grown at 25°C for 24 hours, then immobilized in 2.5 mg/mL levamisole on dried 2% agarose pads. Length of the PLM-AN that had grown past the center of the vulva was measured (recorded as positive values), or PLM-AN that had not grown past the vulva, the length from the PLM-AN terminal to the center of the vulva was measured (recorded as negative values) using ImageJ. If both the bilaterally symmetric left and right PLM-ANs in a single animal were clearly visible and differentiable, both were measured. At least 37 PLM-AN lengths were recorded per line, from at least 23 animals. Obtaining heterozygote animals for phenotyping To ensure heterozygous animals were generated, mec-15; uIs115 larval stage L4 animals were raised on fem-1 RNAi plates at 25°C, and females from the next generation were picked (i.e. 1 -day adults observed with stacked oocytes and no embryos that did not lay embryos for 4 hours). These females were mated to pph-5(xxx); mec-15; uIs115 males, and resulting cross progeny were analyzed as described above. At least 29 PLMAN lengths were recorded per line, from at least 15 animals. Quantification of embryo lethality in sep-1 mutant animals Embryo lethality in sep-1 separase and pph-5 mutant animals were quantified as previously described [ 30 ]. In brief, strains were maintained at 15°C to obtain gravid mutant adult animals as sep-1(e2406) mutants have elevated sterility at higher temperatures. A single hermaphrodite animal staged between L4 and young adult was plated to individual 35mm NGM plates for 24 to 30 hours at 20°C and allowed to lay embryos. Animals were removed from the plate and embryos were incubated at 20°C for another 24 hours to allow hatching to occur. Dead embryos and live young larvae were counted to determine embryo lethality. RESULTS Clinical presentation The proband was a 6-year-old girl with epilepsy, nystagmus, congenital microcephaly, and developmental delay ( Fig. 1 ). Brain MRI initially at 11 months old showed slightly incomplete myelination that improved on an updated brain MRI at 4 years old but still with diminutive cerebral white matter volume ( Fig. 1A-D ). Her head size at birth was at the 2 nd percentile (32cm); by 18 months her head size was at −5.5 standard deviations (SD) and has remained in the −5.5SD to −6SD range ( Fig. 1E ). Seizure onset was at 12-16 months of age with generalized seizures including tonic clonic and drop seizures that are medically refractory. EEG has shown recurrent spike and slow-wave activity independently and multifocal spikes. Monitoring at age 4 showed subtle seizures every 2-13 minutes. Developmentally, she rolled over at 8-9 months with therapies, sat up after age 1 year, and currently crawls and pulls to a stand but is unable to walk independently. She is nonverbal and uses an augmentative communication device. On physical exam, she is microcephalic and has synophrys. Neurological exam noted bilateral horizontal nystagmus with inconsistent tracking but able to reach for objects. She is nonverbal, has decreased axial tone with increased tone in the extremities with scissoring in her legs with symmetric strength and increased deep tendon reflexes 3+ bilaterally in biceps, patellae and ankle clonus. She does not have any tremors, titubations or dysmetria on exam. She was also noted to have failure to thrive ( Fig. 1F ) and anemia. An ophthalmologic exam was significant for pendular nystagmus and moderate myopia. Family history is significant for a brother who passed away at birth; his pregnancy was complicated by pre-eclampsia, but the cause of death is unknown, and samples were unavailable for sequencing. Clinical trio exome sequencing was non-diagnostic. However, research analysis of the trio exome sequencing revealed a heterozygous, de novo missense variant in PPP5C: NM_006247.3:c. 139G>A: p.Ala47Thr. The variant has a CADD score of 29.4, is not found in gnomAD v2.1.1 [ 31 ], and the gene has not yet been associated with disease apart from a possible association with autism [ 36 ]. The gene level scores, pLI = 1 and o/e = 0.07, suggest a haploinsufficiency model for the genetic mechanism in humans. Download figure Open in new tab Figure 1. Proband brain MRI and growth chart. (A) T1 axial and (B) sagittal brain MRI at 11 months showing microcephaly with mild delay in myelination and decreased amount of white matter. (C) T1 axial and (D) sagittal brain MRI at 49 months demonstrating microcephaly with further myelination but persistent overall decreased amount of white matter. Additional findings on sagittal image showing decreased cerebellar folia indicative of mild cerebellar atrophy (white arrow). (E) Head circumference for age Nellhaus Girls 2 to 18 years old chart showing head circumference well below 2 standard deviations (red bracket) between 2 and 4 years of age. (F) Weight for age CDC chart demonstrating failure to thrive between 2 and 6 years old. PPP5C is conserved in C. elegans To assess the effect of PPP5C p.Ala47Thr on in vivo function, we evaluated the impact of this gene variant in the model organism C. elegans. The ortholog of PPP5C in C. elegans is pph-5, which overall has an identity of 55.9% and a similarity of 72.3% to the human gene. In both organisms, PPP5C and pph-5 encode two large domains: a phosphatase domain, which shares 62.7% identity (77.8% similarity), and three tetratricopeptide repeats (TPR) that are responsible for autoinhibition of the phosphatase domain by physically blocking the active site [ 37 , 38 ]. The vast majority of mutations in C. elegans pph-5 were previously identified in a suppressor screen [ 30 ] and are conserved or moderately conserved in humans ( Table 1 ). The PPP5C p.Ala47Thr variant is located at the N-terminus of the protein in the TPR1 domain ( Fig. 2A ). The TPRs are highly conserved between C. elegans and humans, with PPH-5 and PPP5C sharing ~54% identity (72.5% similarity) in this domain ( Fig. 2B ). We therefore modeled the PPP5C p.Ala47Thr proband variant in the corresponding C. elegans residue (Ala48) of pph-5 using CRISPR/Cas9-based gene editing. In addition to the variant residue, we introduced synonymous changes to block Cas9 re-cleavage following homology-directed repair and a restriction enzyme cleavage site to aid in allele genotyping. As controls, we generated lines that contain only the synonymous changes, but not the proband’s variant. In total, we generated three independent variant (Ala48Thr) alleles and two independent control (Ala48Ala) alleles (Table S2). All the CRISPR-edited lines were superficially wild-type, similar to the pph-5(ok3498) null mutants (hereafter referred to as pph-5(null)) [ 29 ]. Download figure Open in new tab Figure 2. pph-5 is the C. elegans ortholog of PPP5C . (A) PPP5C domain map, with the locations of the proband variant Ala47Thr (red arrow) and C. elegans pph-5(null) allele (green line) indicated. (B) Alignment of H. sapiens and C. elegans Tetratricopeptide repeat 1 region. Proband variant residue location highlighted in red. View this table: View inline View popup Download powerpoint Table 1. pph-5 legacy missense alleles are experimental tests of yet to be observed PPP5C variants pph-5 Ala48Thr variant is defective in function and suppresses the touch receptor neuron neurite growth phenotype in mec-15 F-box protein mutants Since the pph-5 Ala48Thr proband variant and the pph-5 null mutants were superficially wild-type, we employed sensitized genetic backgrounds, the mec-15 null or the sep-1 hypomorph, where it is known that pph-5 acts to oppose the function of these genes. In C. elegans, pph-5 has previously been reported to have genetic interactions with mec-15 in regulating neurite growth [ 28 ]. MEC-15 is an F-box protein (orthologous to human FBXW9) that promotes touch receptor neurite growth by aiding degradation of DLK-1 (orthologous to human MAP3K12), an inhibitor of microtubule stability [ 28 , 39 ]. As a consequence, in mec-15(u1042) mutants, the microtubules are less stable, and the PLM anterior neurites (PLM-AN) are considerably shorter than those of wild-type animals. PPH-5 is part of the HSP90 chaperone complex, which aids in protein folding [ 40 , 41 ], including that of DLK-1 [ 28 ]. Thus, PPH-5 negatively regulates neurite growth by opposing the function of MEC-15. Loss-of-function alleles of pph-5, and other components of the HSP90 complex, therefore restore microtubule stability in mec-15(u1042) mutants, and suppress the short PLM-AN phenotype [ 28 ]. To examine the role of the PPH-5 Ala48Thr proband variant in neurite growth, we crossed the pph-5 variants into the mec-15(u1042) mutant background and measured PLM-AN neurite length. As previously reported, mec-15 mutants have significantly shorter PLM-AN neurites compared to wild-type animals ( Fig. 3A and B ). However, when combined with the proband variant, the short neurite phenotype was completely suppressed and neurite length was restored to that of the wildtype ( Fig. 3A and B ). In contrast, the pph-5 Ala48Ala control edited lines did not suppress the short neurite phenotype of mec-15(u1042) animals. These results indicate that pph-5 Ala48Thr is defective in function as a negative regulator of PLM-AN neurite length. Moreover, the extent of the suppression by the proband’s variant was similar to that of the reference null allele of pph-5, indicating that the pph-5 Ala48Thr variant is likely a strong hypomorph or a complete loss-of-function. Download figure Open in new tab Figure 3. Ala48Thr variant suppresses mec-15 PLM-anterior neurite growth defect. (A) Images of day 1 adult animals expressing pmec-17::RFP in the PLM neurons. The PLM-anterior neurite normally grows (PLMAN terminus blue arrow) past the vulva (red arrowhead). However, mec-15(u1042) animals have a PLM-AN that typically does not grow past the vulva. Two independently generated lines of pph-5[Ala48Thr]; mec-15 animals have neurites that grow past the vulva, while the control pph-5[Ala48Ala]; mec-15 mimics the mec-15 PLM-AN length. (B) Quantification of neurite termination in relation to the vulva of at least 37 neurites from at least 23 animals per genotype. Negative values indicate PLM-AN did not grow past the vulva, and indicate distance from PLM-AN terminus to vulva, while positive values indicate length the PLM-AN grew past the vulva in the anterior direction. Vulval location indicated by dashed vertical line. Mean and standard deviation plotted. Statistical significance indicated is genotype as compared to mec-15. (C) Quantification of at least 29 neurites from at least 15 heterozygous pph-5; homozygous mec-15(u1042) animals. Kruskall-Wallis ANOVA was performed, followed by post-hoc Dunn’s multiple comparisons tests in both B and C. (ns, **** p ≤ 0.0001). pph-5 Ala48Thr variant suppresses aldicarb-induced paralysis of mec-15 mutants In the C. elegans neuromuscular junction, opposing neurotransmitter signals regulate muscle contraction. Acetylcholine (ACh) provides the stimulatory signal for muscle contraction while gamma-aminobutyric acid (GABA) provides the inhibitory signal. ACh activity is regulated by acetylcholinesterase, an enzyme that degrades ACh in the neuromuscular junction. Inhibition of acetylcholinesterase by treatment with the drug aldicarb leads to ACh accumulation in the extracellular space and subsequent hypercontraction of the muscle and eventual paralysis (reviewed in [ 42 ]). MEC-15 promotes synaptic transmission in GABAergic motor neurons to inhibit muscle contraction [ 43 , 44 ]. Consequently, when exposed to aldicarb, mec-15(u1042) mutants release less GABA and reach paralysis at a faster rate than wild-type animals ( Fig. 4A ) [ 28 , 44 , 45 ]. This increased aldicarb sensitivity of mec-15 mutants can be suppressed by loss-of-function mutations in pph-5, indicating that PPH-5 negatively regulates the release of GABA [ 28 ]. Thus, we used an aldicarb sensitivity assay to assess the impact of pph-5 Ala48Thr on GABA signaling. Upon aldicarb treatment, the time taken for 50% of mec-15(u1042) animals to reach paralysis was 62 minutes, which was similar to that of the control edit pph-5 [Ala48Ala] ; mec-15(u1042) animals ( Fig. 4B ). In contrast, the pph-5 [Ala48Thr] ; mec-15(u1042) animals were less sensitive to aldicarb, and took 86 minutes to reach 50% paralysis. These results were indistinguishable to those obtained with the pph-5(null); mec-15(u1042) animals ( Fig. 4B ). Taken together, our aldicarb-sensitivity data provide additional evidence for pph-5 Ala48Thr variant being damaging to gene function and behaving similarly to the null allele. Download figure Open in new tab Figure 4. Ala48Thr variant suppresses known pph-5 interaction phenotypes. (A) A genetic model of PPH-5/MEC-15 interaction in GABA signaling, (B) Quantification of percent of animals paralyzed at the indicated time after the start of exposure to aldicarb. Statistical significance as compared to mec-15. t-tests (ns, **** p ≤ 0.0001). (C) Percent of embryos that hatched when pph-5 [Ala48Thr] or pph-5 [Ala48Ala] was combined with sep-1(e2406). pph-5 Ala48Thr variant suppresses embryonic lethality of sep-1 mutants As a final test of the proband’s variant function, we examined the role of PPH-5 Ala48Thr in embryogenesis. C. elegans sep-1 (orthologous to human ESPL1) encodes a cysteine protease required for the cleavage of cohesin complex subunits during mitosis, exocytosis of cortical granules and eggshell formation [ 46 , 47 ]. Consequently, sep-1(e2406) hypomorphic mutants do not form an eggshell, fail to hatch, and are embryonic lethal [ 47 ]. However, reduction of function mutations in pph-5, including mutations within the TPR domain, are known to suppress the embryonic lethality of sep-1 mutants, indicating that PPH-5 phosphatase activity has a role in negatively regulating both SEP-1 and eggshell formation [ 30 ]. Therefore, we used the suppression of embryonic lethality as a readout to assess the functionality of the proband’s variant. Consistent with previous results, we found sep-1 animals to be 100% embryonic lethal ( Fig. 4C ). When the control edit pph-5 Ala48Ala allele was combined with the sep-1 allele, the resulting animals were also 100% embryonic lethal as indicated by the lack of hatched embryos ( Fig. 4C ). In contrast, embryonic lethality was strongly suppressed by the pph-5 Ala48Thr variant and 89-96% of the embryos successfully hatched ( Fig. 4C ). The percent hatched values are similar to the previous data obtained for the pph-5(tm2979) null; sep-1(e2406) double mutant [ 30 ]. Combined, our results indicate that Ala48Thr variant leads to defective PPH-5 function with a severity that is similar to that of the pph-5 null alleles. pph-5 null and Ala48Thr variants behave recessively in C. elegans The underrepresentation of loss-of-function variants in the control human population (gnomAD v2.1.1, pLI=1, o/e = 0.07) suggests that PPP5C is a haploinsufficient gene. However, missense variants in haploinsufficient genes may act in a gain-of-function manner, for example, via a dominant negative or a hyperactive mechanism. We therefore used the PLM-AN neurite growth assay to compare heterozygous and homozygous phenotypes for the pph-5 null and Ala48Thr alleles. In the mec-15(u1042) mutant background, the pph-5 null and pph-5 Ala48Thr homozygous animals have normal PLM-AN neurite lengths ( Fig. 3B ), similar to wild-type animals indicating full suppression of mec-15 phenotype. In contrast, animals heterozygous for pph-5 Ala48Thr failed to suppress the mec-15 mutation and had similar short neurite lengths compared to the pph-5 Ala48Ala control edited animals (p=0.31) ( Fig. 3C ), suggesting that PPH-5 Ala48Thr does not have dominant gain-of-function activity. Similarly, animals heterozygous for pph-5 null also fail to suppress the mec-15 mutation, consistent with pph-5 not being a haploinsufficient gene in C. elegans . The absence of haploinsufficiency for pph-5 , compared to PPP5C , is not unexpected given that different species titrate gene expression differently and haploinsufficiency is thought to be rare in C. elegans (Hodgkin, 2005). pph-5 legacy mutations as functional tests of yet to be identified PPP5C missense variants A collection of 25 pph-5 missense mutations has been generated in C. elegans forward genetic screens [ 29 , 30 ]. The pph-5 mutations were isolated following chemical mutagenesis as recessive suppressors of the sep-1 separase embryonic lethality phenotype, analogous to the assay shown in Figure 4C . These pph-5 legacy mutations may have already been observed or have yet to be observed in the human ortholog and provide pre-existing experimental functional information about conserved residues and variants in PPP5C . We mapped the 25 legacy missense variants to the corresponding amino acid residues in PPP5C ( Table 1 ). All the mutations reside in the TRP repeats or phosphatase domain. The wild type residue of the pph-5 mutation is identical in PPP5C in 18 cases, while for the remaining seven, five contain conservative substitutions. From examination of the gnomAD population database, there are no examples of variants observed for 22 of the PPP5C residues, indicating that these residues show some level of constraint to variation. For two of the exceptions, PPP5C has conservative changes, and the variant residues are conservative substitutions. From the mutant screens, it was found that a modest reduction in PPH-5 function can suppress some sep-1 mutant phenotypes, indicating that the screen is very sensitive [ 30 ]. We therefore subdivided the pph-5 mutations into three categories based on the extent of suppression of sep-1 mutant embryonic lethality [ 29 , 30 ]: strong hypomorphs that are similar to null alleles (greater than 70% suppression); weak hypomorphs (between 30 – 70% suppression); and very weak hypomorphs (less than 30% suppression). Assuming haploinsufficiney for the PPP5C p.Ala47Thr dominant proband phenotypes, it is likely that the pph-5 weak and very weak mutations do not reduce gene function enough to achieve haploinsufficiency in PPP5C. Therefore, we only considered the strong hypomorph pph-5 mutations as sufficiently damaging to be similar to pph-5 Ala48Thr. This analysis yielded 10 legacy pph-5 strong hypomorphic mutations, where the residue is identical or a conservative substitution in PPP5C , and there are no variants in gnomAD ( Table 1 ). The C. elegans functional analysis indicates that these 10 variants are damaging and, by extension, if observed as PPP5C heterozygotes are likely to impact human phenotype. DISCUSSION In a pediatric proband with congenital microcephaly, epilepsy, and developmental delays, we identified a de novo heterozygous missense variant p.Ala47Thr in PPP5C , a gene not previously associated with Mendelian disease. By modeling the variant in the C. elegans ortholog, pph-5, we demonstrated that pph-5 Ala48Thr is damaging to function in vivo using three different biological assays. In addition, the proband variant behaved similarly to the pph-5 null allele indicating that pph-5 Ala48Thr, and by extension PPP5C p.Ala47Thr, likely acts as a strong hypomorph or complete loss-of-function. These functional data, combined with the in silico prediction of likely deleterious (CADD score 29.4), the intolerance of PPP5C to loss of function variants (pL1=1, o/e=0.07), the absence of variants at residue p.Ala48 in control population databases (gnomAD v2.1.1), and the dominant presentation of the proband are consistent with a haploinsufficient mechanism for the proband’s phenotypes. Although pph-5 null and Ala48Thr variant animals are superficially wild-type, the variant function could be assessed in C. elegans using sensitized genetic backgrounds. MEC-15 promotes PLM-AN neurite growth by regulating the degradation of a HSP90-client protein, DLK-1, and thus, mec-15 mutants have short neurites. Using the short PLM-AN neurite length of mec-15 mutants as our readout, we determined that pph-5 Ala48Thr is defective in its ability to negatively regulate touch receptor neurite growth ( Fig. 3 ). Using similar suppression assays, we showed that pph-5 Ala48Thr suppresses the aldicarb hypersensitivity of mec-15 mutants ( Fig. 4 ), indicating that the pph-5 variant is defective in inhibition of GABA signaling. These C. elegans nervous system functions of pph-5 are consistent with the neurodevelopmental phenotypes observed in the proband. A recent large-scale exome sequencing study of 11,986 individuals with autism spectrum disorder (ASD) identified PPP5C as one of 102 risk genes [ 36 ]. These three reported probands with autism have variants of uncertain significance in the C-terminus of PPP5C, as compared to the proband described here with a variant in the N-terminal TPR domain. However, functional data evaluating the role of PPP5C missense variants in ASD and/or other neurodevelopmental disorders is currently lacking. In vivo gene function studies in model organisms like C. elegans offer a fast, cost-effective and quantitative approach in assessing the biological effects of future de novo variants identified in PPP5C. The Ala47Thr variant is located in the TPR domain of PPP5C, which is thought to play an important role in the autoinhibition of the phosphatase activity through intramolecular interactions with the C-terminal domain that hinder substrate access to the phosphatase catalytic pocket [ 41 ]. The binding of HSP90 to the TPR domain of PPP5C relieves this autoinhibition and stimulates phosphatase activity. The Ala47Thr variant might disrupt binding with HSP90. The active phosphatase can subsequently activate one of several hundred known HSP90 client proteins [ 48 ]. One such client is ataxia and telangiectasia and Rad3 related (ATR), a kinase that activates DNA damage signaling response [ 48 , 49 ]. Mutations in ATR , and other ATR-mediated checkpoint response genes, MCPH1 and ATRIP, have been linked to microcephaly and specifically Seckel syndrome [ 50 ] (reviewed in [ 51 ]). This is thought to be because ATR has an important role in supporting the rapidly proliferating zones in the brains of mice [ 52 , 53 ]. ATR, as well as other PIKK genes, are stabilized by the Hsp90 complex, through interaction with the Tel2-Tti1-Tti2 (TTT) complex [ 49 , 54 , 55 ]. Compound heterozygous variants in TELO2 (the human homolog of yeast Tel2) have been identified in six probands, including three siblings and three unrelated individuals, with You-Hoover-Fong syndrome, which is characterized by microcephaly, movement disorder, and severely delayed development [ 56 ]. Recently, a proband with microcephaly was identified to have a homozygous missense variant in TTI2 , further implicating ATR, HSP90 and TTT complex in microcephaly [ 57 ]. Given that PPP5C is highly expressed in the mammalian brain, and overexpression and knockdown studies showed hyper- and hypo-cellular proliferation, respectively, it is tempting to hypothesize that a reduction of PPP5C function as seen with the variant Ala47Thr could lead to microcephaly and other neurodevelopmental abnormalities observed in the proband [ 5 , 14 ]. Moreover, it is also intriguing to note the parallel between the proband’s failure to thrive and the low body weight of Ppp5c -/- mice [ 23 ]. However, the Ppp5c knockout mouse is not a perfect model of human phenotypes as it does not have reported microcephaly or intellectual disabilities. It has been suggested that mouse models of microcephaly can have limits, as the human brain is much larger when compared to the body, and mice do not have structures such as gyri and encephalization [ 51 ]. Additionally, a recent study looked at the correlation of phenotypes between known human disease gene phenotypes and knockout mouse model phenotypes, of which 49.53% do not match [ 58 ]. A recent study also demonstrated that there are differences in gene expression during the developmental timeline of humans as compared to mice and other model organisms (with approximately 15% of genes expressed in the brain during development having different expression patterns between mice and humans), which could explain differences in phenotype between human patients and mouse models [ 59 ]. Numerous chemical mutagenesis screens have been performed in C. elegans and other model organisms generating large collections of historical or legacy missense mutations. These missense mutations, as they disrupt protein function, provide functional information for the corresponding variant in the human ortholog or homolog. For example, the myosin heavy chain mutation unc-54(st132) Glu524Lys, isolated as a dominant extragenic suppressor of the unc-22 (human titan ortholog) twitching phenotype [ 60 , 61 ] is at the same position and the same change in the myosin motor domain as MYH7 Glu525Lys, a pathogenic variant in dilated cardiomyopathy [ 62 ]. This unc-54 legacy mutation provides experimental support for the MYH7 variant being damaging, where the data were available more than 10 years before identification of the variant from nextgeneration sequencing of a patient cohort. We have examined a collection of 25 pph-5 legacy missense mutations identified from forward genetic screens [ 29 , 30 ]. For 10 of these the residue is identical or a conservative substitution in PPP5C, there are no instances of variants at these residues in gnomAD, and all the pph-5 mutations are strong hypomorphs or complete loss of function, and thus likely to contribute to human phenotype if observed in PPP5C, under a model of dominant presentation due to haploinsufficiency ( Table 1 ). The 10 variants have yet to be reported in the human population in ClinVar (search date 12/27/2021). These 10 legacy mutations provide functional data that the missense changes are damaging in C. elegans and, by extension, when observed in humans likely to contribute to disease. Given the potential utility of model organism legacy missense mutation findings to human gene-variant analysis, model organism databases (WormBase, FlyBase, Alliance of Genome Resources, etc.) should aggregate and display such data similar to that shown in Table 1 and make that information available to databases such as ClinVar and MARRVEL. In summary, PPP5C p.Ala47Thr, a de novo heterozygous missense gene-variant identified in a UDN proband, was modeled in C. elegans. In vivo functional analyses indicated that the pph-5 Ala48Thr variant is damaging, similar in extent to the complete pph-5 loss of function. By extension, our data suggest that PPP5C p.Ala47Thr is also damaging, likely resulting in a strong hypomorph or complete loss of function. Given that PPP5C, HSP90 and client proteins are important for the development of the brain, it is likely that the PPP5C p.Ala47Thr loss-of-function variant is responsible for one or more of the proband’s phenotypes, such as microcephaly and/or the other neurodevelopmental disorders. Author Contributions S.M.F., T.S., and S.C.P. designed research; S.M.F, J.N.B., and H.H. performed research; S.M.F., J.A.R., L.C.B., L.E., S.L., R.A., J.N.B., D.B., G.A.S., T.S., and S.C.P. analyzed data; and S.M.F, T.S., and S.C.P. wrote the paper. Competing Interest Statement The Department of Molecular and Human Genetics at Baylor College of Medicine receives revenue from clinical genetic testing conducted at Baylor Genetics Laboratories. CONSORTIA (Members of the Undiagnosed Diseases Network) Maria T. Acosta, Margaret Adam, David R. Adams, Justin Alvey, Laura Amendola, Ashley Andrews, Euan A. Ashley, Mahshid S. Azamian, Carlos A. Bacino, Guney Bademci, Ashok Balasubramanyam, Dustin Baldridge, Jim Bale, Michael Bamshad, Deborah Barbouth, Pinar Bayrak-Toydemir, Anita Beck, Alan H. Beggs, Edward Behrens, Gill Bejerano, Hugo Bellen, Jimmy Bennet, Beverly Berg-Rood, Jonathan A. Bernstein, Gerard T. Berry, Anna Bican, Stephanie Bivona, Elizabeth Blue, John Bohnsack, Devon Bonner, Lorenzo Botto, Brenna Boyd, Lauren C. Briere, Elly Brokamp, Gabrielle Brown, Elizabeth A. Burke, Lindsay C. Burrage, Manish J. Butte, Peter Byers, William E. Byrd, John Carey, Olveen Carrasquillo, Thomas Cassini, Ta Chen Peter Chang, Sirisak Chanprasert, Hsiao-Tuan Chao, Gary D. Clark, Terra R. Coakley, Laurel A. Cobban, Joy D. Cogan, Matthew Coggins, F. Sessions Cole, Heather A. Colley, Cynthia M. Cooper, Heidi Cope, William J. Craigen, Andrew B. Crouse, Michael Cunningham, Precilla D’Souza, Hongzheng Dai, Surendra Dasari, Joie Davis, Jyoti G. Dayal, Matthew Deardorff, Esteban C. Dell’Angelica, Katrina Dipple, Daniel Doherty, Naghmeh Dorrani, Argenia L. Doss, Emilie D. Douine, Laura Duncan, Dawn Earl, David J. Eckstein, Lisa T. Emrick, Christine M. Eng, Cecilia Esteves, Marni Falk, Liliana Fernandez, Elizabeth L. Fieg, Laurie C. Findley, Paul G. Fisher, Brent L. Fogel, Irman Forghani, William A. Gahl, Ian Glass, Bernadette Gochuico, Rena A. Godfrey, Katie Golden-Grant, Madison P. Goldrich, Alana Grajewski, Irma Gutierrez, Don Hadley, Sihoun Hahn, Rizwan Hamid, Kelly Hassey, Nichole Hayes, Frances High, Anne Hing, Fuki M. Hisama, Ingrid A. Holm, Jason Hom, Martha Horike-Pyne, Alden Huang, Yong Huang, Wendy Introne, Rosario Isasi, Kosuke Izumi, Fariha Jamal, Gail P. Jarvik, Jeffrey Jarvik, Suman Jayadev, Orpa Jean-Marie, Vaidehi Jobanputra, Lefkothea Karaviti, Jennifer Kennedy, Shamika Ketkar, Dana Kiley, Gonench Kilich, Shilpa N. Kobren, Isaac S. Kohane, Jennefer N. Kohler, Deborah Krakow, Donna M. Krasnewich, Elijah Kravets, Susan Korrick, Mary Koziura, Seema R. Lalani, Byron Lam, Christina Lam, Grace L. LaMoure, Brendan C. Lanpher, Ian R. Lanza, Kimberly LeBlanc, Brendan H. Lee, Hane Lee, Roy Levitt, Richard A. Lewis, Pengfei Liu, Xue Zhong Liu, Nicola Longo, Sandra K. Loo, Joseph Loscalzo, Richard L. Maas, Ellen F. Macnamara, Calum A. MacRae, Valerie V. Maduro, Rachel Mahoney, Bryan C. Mak, May Christine V. Malicdan, Laura A. Mamounas, Teri A. Manolio, Rong Mao, Kenneth Maravilla, Ronit Marom, Gabor Marth, Beth A. Martin, Martin G. Martin, Julian A. Martínez-Agosto, Shruti Marwaha, Jacob McCauley, Allyn McConkie-Rosell, Alexa T. McCray, Elisabeth McGee, Heather Mefford, J. Lawrence Merritt, Matthew Might, Ghayda Mirzaa, Eva Morava, Paolo M. Moretti, John J. Mulvihill, Mariko Nakano-Okuno, Stan F. Nelson, John H. Newman, Sarah K. Nicholas, Deborah Nickerson, Shirley Nieves-Rodriguez, Donna Novacic, Devin Oglesbee, James P. Orengo, Laura Pace, Stephen C. Pak, J. Carl Pallais, Christina GS. Palmer, Jeanette C. Papp, Neil H. Parker, John A. Phillips III, Jennifer E. Posey, Lorraine Potocki, Barbara N. Pusey, Aaron Quinlan, Wendy Raskind, Archana N. Raja, Deepak A. Rao, Anna Raper, Genecee Renteria, Chloe M. Reuter, Lynette Rives, Amy K. Robertson, Lance H. Rodan, Jill A. Rosenfeld, Natalie Rosenwasser, Francis Rossignol, Maura Ruzhnikov, Ralph Sacco, Jacinda B. Sampson, Mario Saporta, C. Ron Scott, Judy Schaechter, Timothy Schedl, Kelly Schoch, Daryl A. Scott, Vandana Shashi, Jimann Shin, Rebecca Signer, Edwin K. Silverman, Janet S. Sinsheimer, Kathy Sisco, Edward C. Smith, Kevin S. Smith, Emily Solem, Lilianna Solnica-Krezel, Ben Solomon, Rebecca C. Spillmann, Joan M. Stoler, Jennifer A. Sullivan, Kathleen Sullivan, Angela Sun, Shirley Sutton, David A. Sweetser, Virginia Sybert, Holly K. Tabor, Amelia L. M. Tan, Queenie K.-G. Tan, Mustafa Tekin, Fred Telischi, Willa Thorson, Cynthia J. Tifft, Camilo Toro, Alyssa A. Tran, Brianna M. Tucker, Tiina K. Urv, Adeline Vanderver, Matt Velinder, Dave Viskochil, Tiphanie P. Vogel, Colleen E. Wahl, Stephanie Wallace, Nicole M. Walley, Melissa Walker, Jennifer Wambach, Jijun Wan, Lee-kai Wang, Michael F. Wangler, Patricia A. Ward, Daniel Wegner, Monika Weisz-Hubshman, Mark Wener, Tara Wenger, Katherine Wesseling Perry, Monte Westerfield, Matthew T. Wheeler, Jordan Whitlock, Lynne A. Wolfe, Jeremy D. Woods, Kim Worley, Changrui Xiao, Shinya Yamamoto, John Yang, Diane B. Zastrow, Zhe Zhang, Chunli Zhao, Stephan Zuchner ACKNOWLEDGEMENTS Research reported in this manuscript was supported by the NIH Common Fund, through the Office of Strategic Coordination/Office of the NIH Director under Award Number U54 NS108251 (TS and Lila Solnica-Krezel) and U01HG007709. Funding was also provided by the National Institutes of Health (R01 GM11447, JNB), the Children’s Discovery Institute, St Louis Children’s Hospital Foundation (GAS and SCP). Some strains were provided by the CGC, which is funded by the NIH Office of Research Infrastructure Programs (P40 OD010440). The content of this manuscript is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health. Footnotes ↵ † These authors are joint senior authors A figure with MRIs, head circumference, and weight charts documenting the proband's microcephaly and failure to thrive is included in this revised manuscript. REFERENCES 1. ↵ Ali , A. , et al. , Requirement of protein phosphatase 5 in DNA-damage-induced ATM activation . Genes & development , 2004 . 18 ( 3 ): p. 249 – 254 . OpenUrl Abstract / FREE Full Text 2. ↵ Kaziales , A. , et al. , Glucocorticoid receptor complexes form cooperatively with the Hsp90 co-chaperones Pp5 and FKBPs . Scientific reports , 2020 . 10 ( 1 ): p. 1 – 16 . OpenUrl 3. Yong , W. , et al. , Mice lacking protein phosphatase 5 are defective in ataxia telangiectasia mutated (ATM)-mediated cell cycle arrest . Journal of Biological Chemistry , 2007 . 282 ( 20 ): p. 14690 – 14694 . OpenUrl Abstract / FREE Full Text 4. Zhang , J. , et al. , Protein phosphatase 5 is required for ATR-mediated checkpoint activation . Molecular and cellular biology , 2005 . 25 ( 22 ): p. 9910 – 9919 . OpenUrl Abstract / FREE Full Text 5. ↵ Zuo , Z. , N.M. Dean , and R.E. Honkanen , Serine/threonine protein phosphatase type 5 acts upstream of p53 to regulate the induction of p21WAF1/Cip1 and mediate growth arrest . Journal of Biological Chemistry , 1998 . 273 ( 20 ): p. 12250 – 12258 . OpenUrl Abstract / FREE Full Text 6. Wechsler , T. , et al. , DNA-PKcs function regulated specifically by protein phosphatase 5 . Proceedings of the National Academy of Sciences , 2004 . 101 ( 5 ): p. 1247 – 1252 . OpenUrl Abstract / FREE Full Text 7. Partch , C.L. , et al. , Posttranslational regulation of the mammalian circadian clock by cryptochrome and protein phosphatase 5 . Proceedings of the National Academy of Sciences , 2006 . 103 ( 27 ): p. 10467 – 10472 . OpenUrl Abstract / FREE Full Text 8. ↵ Liu , F. , et al. , Dephosphorylation of tau by protein phosphatase 5: impairment in Alzheimer’s disease . Journal of Biological Chemistry , 2005 . 280 ( 3 ): p. 1790 – 1796 . OpenUrl Abstract / FREE Full Text 9. ↵ Hinds Jr , T.D. and E.R. Sánchez , Protein phosphatase 5 . The international journal of biochemistry & cell biology , 2008 . 40 ( 11 ): p. 2358 – 2362 . OpenUrl 10. ↵ Bahl , R. , et al. , Localization of protein Ser/Thr phosphatase 5 in rat brain . Molecular brain research , 2001 . 90 ( 2 ): p. 101 – 109 . OpenUrl PubMed 11. Becker , W. , et al. , Distribution of the mRNA for protein phosphatase T in rat brain . Molecular brain research , 1996 . 36 ( 1 ): p. 23 – 28 . OpenUrl CrossRef PubMed 12. Becker , W. , et al. , Molecular cloning of a protein serine/threonine phosphatase containing a putative regulatory tetratricopeptide repeat domain . Journal of Biological Chemistry , 1994 . 269 ( 36 ): p. 22586 – 22592 . OpenUrl Abstract / FREE Full Text 13. ↵ Chinkers , M. , Targeting of a distinctive protein-serine phosphatase to the protein kinase-like domain of the atrial natriuretic peptide receptor . Proceedings of the National Academy of Sciences , 1994 . 91 ( 23 ): p. 11075 – 11079 . OpenUrl Abstract / FREE Full Text 14. ↵ Lv , J.-M. , et al. , PPP5C promotes cell proliferation and survival in human prostate cancer by regulating of the JNK and ERK1/2 phosphorylation . OncoTargets and therapy , 2018 . 11 : p. 5797 . OpenUrl 15. ↵ Chen , M. , et al. , Disruption of serine/threonine protein phosphatase 5 inhibits tumorigenesis of urinary bladder cancer cells . International journal of oncology , 2017 . 51 ( 1 ): p. 39 – 48 . OpenUrl 16. ↵ Urban , G. , et al. , Identification of an estrogen-inducible phosphatase (PP5) that converts MCF-7 human breast carcinoma cells into an estrogen-independent phenotype when expressed constitutively . Journal of Biological Chemistry , 2001 . 276 ( 29 ): p. 27638 – 27646 . OpenUrl Abstract / FREE Full Text 17. ↵ Xie , J. , et al. , PP5 (PPP5C) is a phosphatase of Dvl2 . Scientific reports , 2018 . 8 ( 1 ): p. 1 – 15 . OpenUrl 18. ↵ Barnes , P.J. , Anti-inflammatory actions of glucocorticoids: molecular mechanisms . Clinical science , 1998 . 94 ( 6 ): p. 557 – 572 . OpenUrl Abstract / FREE Full Text 19. ↵ Sapolsky , R.M. , L.M. Romero , and A.U. Munck , How do glucocorticoids influence stress responses? Integrating permissive, suppressive, stimulatory, and preparative actions . Endocrine reviews , 2000 . 21 ( 1 ): p. 55 – 89 . OpenUrl CrossRef PubMed Web of Science 20. ↵ Sugimoto , K. , Branching the Tel2 pathway for exact fit on phosphatidylinositol 3-kinase-related kinases . Current genetics , 2018 . 64 ( 5 ): p. 965 – 970 . OpenUrl CrossRef 21. ↵ Abraham , R.T. , PI 3-kinase related kinases:’big’players in stress-induced signaling pathways . DNA repair , 2004 . 3 ( 8-9 ): p. 883 – 887 . OpenUrl CrossRef PubMed 22. ↵ Amable , L. , et al. , Disruption of serine/threonine protein phosphatase 5 (PP5: PPP5c) in mice reveals a novel role for PP5 in the regulation of ultraviolet light-induced phosphorylation of serine/threonine protein kinase Chk1 (CHEK1) . Journal of Biological Chemistry , 2011 . 286 ( 47 ): p. 40413 – 40422 . OpenUrl Abstract / FREE Full Text 23. ↵ Grankvist , N. , et al. , Serine/threonine protein phosphatase 5 regulates glucose homeostasis in vivo and apoptosis signalling in mouse pancreatic islets and clonal MIN6 cells . Diabetologia , 2012 . 55 ( 7 ): p. 2005 – 2015 . OpenUrl CrossRef PubMed Web of Science 24. ↵ Grankvist , N. , et al. , Genetic disruption of protein phosphatase 5 in mice prevents high-fat diet feeding-induced weight gain . FEBS letters , 2013 . 587 ( 23 ): p. 3869 – 3874 . OpenUrl CrossRef PubMed Web of Science 25. ↵ Brown , L. , E.B. Borthwick , and P.T. Cohen , Drosophila protein phosphatase 5 is encoded by a single gene that is most highly expressed during embryonic development . Biochimica et Biophysica Acta (BBA)-Gene Structure and Expression , 2000 . 1492 ( 2-3 ): p. 470 – 476 . OpenUrl 26. ↵ Chen , F. , et al. , Multiple protein phosphatases are required for mitosis in Drosophila . Current Biology , 2007 . 17 ( 4 ): p. 293 – 303 . OpenUrl CrossRef PubMed Web of Science 27. ↵ Jeong , J.-Y. , et al. , Characterization of Saccharomyces cerevisiae protein Ser/Thr phosphatase T1 and comparison to its mammalian homolog PP5 . BMC Cell Biology , 2003 . 4 ( 1 ): p. 1 – 13 . OpenUrl CrossRef PubMed 28. ↵ Zheng , C. , et al. , Opposing effects of an F-box protein and the HSP90 chaperone network on microtubule stability and neurite growth in Caenorhabditis elegans . Development , 2020 . 147 ( 12 ): p. dev189886 . OpenUrl Abstract / FREE Full Text 29. ↵ Richie , C.T. , et al. , Protein phosphatase 5 is a negative regulator of separase function during cortical granule exocytosis in C. elegans . Journal of Cell Science , 2011 . 124 ( 17 ): p. 2903 – 2913 . OpenUrl Abstract / FREE Full Text 30. ↵ Melesse , M. , et al. , Genetic identification of separase regulators in Caenorhabditis elegans . G3: Genes, Genomes, Genetics , 2018 . 8 ( 2 ): p. 695 – 705 . OpenUrl 31. ↵ Karczewski , K.J. , et al. , The mutational constraint spectrum quantified from variation in 141,456 humans . Nature , 2020 . 581 ( 7809 ): p. 434 – 443 . OpenUrl CrossRef PubMed 32. ↵ Huang , H. , et al. , A dominant negative variant of RAB5B disrupts maturation of surfactant protein B and surfactant protein C . Proceedings of the National Academy of Sciences , 2022 . 119 ( 6 ). 33. ↵ Boulin , T. , et al. , Functional analysis of a de novo variant in the neurodevelopment and generalized epilepsy disease gene NBEA . Molecular Genetics and Metabolism , 2021 . 134 ( 1-2 ): p. 195 – 202 . OpenUrl 34. ↵ Suzuki , H. , et al. , Biallelic loss of OTUD7A causes severe muscular hypotonia, intellectual disability, and seizures . Am J Med Genet A , 2021 . 185 ( 4 ): p. 1182 – 1186 . OpenUrl 35. ↵ Brenner , S. , The genetics of Caenorhabditis elegans . Genetics , 1974 . 77 ( 1 ): p. 71 – 94 . OpenUrl Abstract / FREE Full Text 36. ↵ Satterstrom , F.K. , et al. , Large-scale exome sequencing study implicates both developmental and functional changes in the neurobiology of autism . Cell , 2020 . 180 ( 3 ): p. 568 – 584 . e23 . OpenUrl CrossRef PubMed 37. ↵ Chen , M.-S. , et al. , The tetratricopeptide repeat domain of protein phosphatase 5 mediates binding to glucocorticoid receptor heterocomplexes and acts as a dominant negative mutant . Journal of Biological Chemistry , 1996 . 271 ( 50 ): p. 32315 – 32320 . OpenUrl Abstract / FREE Full Text 38. ↵ Kang , H. , et al. , Identification of amino acids in the tetratricopeptide repeat and C-terminal domains of protein phosphatase 5 involved in autoinhibition and lipid activation . Biochemistry , 2001 . 40 ( 35 ): p. 10485 – 10490 . OpenUrl CrossRef PubMed 39. ↵ Karney-Grobe , S. , et al. , HSP90 is a chaperone for DLK and is required for axon injury signaling . Proceedings of the National Academy of Sciences , 2018 . 115 ( 42 ): p. E9899 – E9908 . OpenUrl Abstract / FREE Full Text 40. ↵ Vaughan , C.K. , et al. , Hsp90-dependent activation of protein kinases is regulated by chaperone-targeted dephosphorylation of Cdc37 . Molecular cell , 2008 . 31 ( 6 ): p. 886 – 895 . OpenUrl CrossRef PubMed Web of Science 41. ↵ Haslbeck , V. , et al. , The activity of protein phosphatase 5 towards native clients is modulated by the middle-and C-terminal domains of Hsp90 . Scientific reports , 2015 . 5 ( 1 ): p. 1 – 16 . OpenUrl 42. ↵ WormBook Rand , J. , Acetylcholine (January 30, 2007) , WormBook , ed. The C. elegans Research Community , WormBook , doi/ 10.1895/wormbook.1.131.1 . 2007 . OpenUrl CrossRef 43. ↵ Richmond , J.E. and E.M. Jorgensen , One GABA and two acetylcholine receptors function at the C. elegans neuromuscular junction . Nature neuroscience , 1999 . 2 ( 9 ): p. 791 – 797 . OpenUrl CrossRef PubMed Web of Science 44. ↵ Sun , Y. , et al. , The F-box protein MEC-15 (FBXW9) promotes synaptic transmission in GABAergic motor neurons in C. elegans . PloS one , 2013 . 8 ( 3 ): p. e59132 . OpenUrl CrossRef PubMed 45. ↵ Loria , P.M. , J. Hodgkin , and O. Hobert , A conserved postsynaptic transmembrane protein affecting neuromuscular signaling in Caenorhabditis elegans . Journal of Neuroscience , 2004 . 24 ( 9 ): p. 2191 – 2201 . OpenUrl Abstract / FREE Full Text 46. ↵ Siomos , M.F. , et al. , Separase is required for chromosome segregation during meiosis I in Caenorhabditis elegans . Current Biology , 2001 . 11 ( 23 ): p. 1825 – 1835 . OpenUrl CrossRef PubMed Web of Science 47. ↵ Bembenek , J.N. , et al. , Cortical granule exocytosis in C. elegans is regulated by cell cycle components including separase . 2007 . 48. ↵ Schopf , F.H. , M.M. Biebl , and J. Buchner , The HSP90 chaperone machinery . Nature reviews Molecular cell biology , 2017 . 18 ( 6 ): p. 345 – 360 . OpenUrl CrossRef PubMed 49. ↵ Takai , H. , et al. , Tel2 structure and function in the Hsp90-dependent maturation of mTOR and ATR complexes . Genes & development , 2010 . 24 ( 18 ): p. 2019 – 2030 . OpenUrl Abstract / FREE Full Text 50. ↵ O’Driscoll , M. , A. Jackson , and P.A. Jeggo , Microcephalin: a causal link between impaired damage response signalling and microcephaly . Cell cycle , 2006 . 5 ( 20 ): p. 2339 – 2344 . OpenUrl CrossRef PubMed Web of Science 51. ↵ O’Driscoll , M. and P.A. Jeggo , The role of the DNA damage response pathways in brain development and microcephaly: insight from human disorders . DNA repair , 2008 . 7 ( 7 ): p. 1039 – 1050 . OpenUrl CrossRef PubMed 52. ↵ Abner , C.W. and P.J. McKinnon , The DNA double-strand break response in the nervous system . DNA repair , 2004 . 3 ( 8-9 ): p. 1141 – 1147 . OpenUrl CrossRef PubMed 53. ↵ Orii , K.E. , et al. , Selective utilization of nonhomologous end-joining and homologous recombination DNA repair pathways during nervous system development . Proceedings of the National Academy of Sciences , 2006 . 103 ( 26 ): p. 10017 – 10022 . OpenUrl Abstract / FREE Full Text 54. ↵ Takai , H. , et al. , Tel2 regulates the stability of PI3K-related protein kinases . Cell , 2007 . 131 ( 7 ): p. 1248 – 1259 . OpenUrl CrossRef PubMed Web of Science 55. ↵ Hurov , K.E. , C. Cotta-Ramusino , and S.J. Elledge , A genetic screen identifies the Triple T complex required for DNA damage signaling and ATM and ATR stability . Genes & development , 2010 . 24 ( 17 ): p. 1939 – 1950 . OpenUrl Abstract / FREE Full Text 56. ↵ You , J. , et al. , A syndromic intellectual disability disorder caused by variants in TELO2, a gene encoding a component of the TTT complex . The American Journal of Human Genetics , 2016 . 98 ( 5 ): p. 909 – 918 . OpenUrl CrossRef 57. ↵ Picher-Martel , V. , et al. , Whole-exome sequencing identifies homozygous mutation in TTI2 in a child with primary microcephaly: a case report . BMC neurology , 2020 . 20 ( 1 ): p. 1 – 6 . OpenUrl 58. ↵ Cacheiro , P. , M.A. Haendel , and D. Smedley , New models for human disease from the International Mouse Phenotyping Consortium . Mammalian Genome , 2019 . 30 ( 5 ): p. 143 – 150 . OpenUrl 59. ↵ Cardoso-Moreira , M. , et al. , Developmental gene expression differences between humans and mammalian models . Cell reports , 2020 . 33 ( 4 ): p. 108308 . OpenUrl 60. ↵ Moerman , D.G. , et al. , Mutations in the unc-54 myosin heavy chain gene of Caenorhabditis elegans that alter contractility but not muscle structure . Cell , 1982 . 29 ( 3 ): p. 773 – 781 . OpenUrl CrossRef PubMed Web of Science 61. ↵ Moerman , D. , A. Fire , and D. In Riddle , C. elegans II . 1997 , Cold Spring Harbor Laboratory Press , New York . 62. ↵ Lakdawala , N.K. , et al. , Genetic testing for dilated cardiomyopathy in clinical practice . Journal of cardiac failure , 2012 . 18 ( 4 ): p. 296 – 303 . OpenUrl CrossRef PubMed Back to top Previous Next Posted February 10, 2022. Download PDF Supplementary Material Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following Functional analysis of a novel de novo variant in PPP5C associated with microcephaly, seizures, and developmental delay Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share Functional analysis of a novel de novo variant in PPP5C associated with microcephaly, seizures, and developmental delay Sara M. Fielder , Jill A. Rosenfeld , Lindsay C. Burrage , Lisa Emrick , Seema Lalani , Ruben Attali , Joshua N. Bembenek , Hieu Hoang , Dustin Baldridge , Gary A. Silverman , Undiagnosed Diseases Network , Tim Schedl , Stephen C. Pak bioRxiv 2022.02.02.478908; doi: https://doi.org/10.1101/2022.02.02.478908 Share This Article: Copy Citation Tools Functional analysis of a novel de novo variant in PPP5C associated with microcephaly, seizures, and developmental delay Sara M. Fielder , Jill A. Rosenfeld , Lindsay C. Burrage , Lisa Emrick , Seema Lalani , Ruben Attali , Joshua N. Bembenek , Hieu Hoang , Dustin Baldridge , Gary A. Silverman , Undiagnosed Diseases Network , Tim Schedl , Stephen C. Pak bioRxiv 2022.02.02.478908; doi: https://doi.org/10.1101/2022.02.02.478908 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Genetics Subject Areas All Articles Animal Behavior and Cognition (7969) Biochemistry (18633) Bioengineering (14770) Bioinformatics (44156) Biophysics (22458) Cancer Biology (19594) Cell Biology (26747) Clinical Trials (138) Developmental Biology (13903) Ecology (20890) Epidemiology (2067) Evolutionary Biology (25317) Genetics (16100) Genomics (23401) Immunology (18609) Microbiology (42209) Molecular Biology (17947) Neuroscience (92896) Paleontology (693) Pathology (2969) Pharmacology and Toxicology (5063) Physiology (8066) Plant Biology (15909) Scientific Communication and Education (2091) Synthetic Biology (4538) Systems Biology (10188) Zoology (2376) window.__CF$cv$params={r:'a37d1bf9192e8df8',t:'MTc4ODg2MTY1OQ==',u:'01a08076b8a677438233e0c89d0dd740',ut:'EP4K4mLtTeH0vmzPts2Eq9CUkOpCwg6A9eqF0f4p5So-1788861659-1.2.1.1-rKx1d1C3Casp6pJGfTCHNqJyp7ypCBqCxG0cuGXI_27qndwJLaj872qkv7RvFhQqlMWHihL7UMWZQdoVpOJwHJ4Npj5tBXL03jyAKCDBI.Q',i:60};(function(){if(!document.body)return;var s=document.createElement('script');s.src='/cdn-cgi/challenge-platform/scripts/precursor/main.js';document.head.appendChild(s);})();
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.