Ca2+ depletion in the ER causes store-operated Ca2+ entry via the TRPC6 channel in mouse brown adipocytes

Ca2+ depletion in the ER causes store-operated Ca2+ entry via the TRPC6 channel in mouse brown adipocytes | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Ca2+ depletion in the ER causes store-operated Ca2+ entry via the TRPC6 channel in mouse brown adipocytes Ryotaro Hayato, Takaya Matsumoto This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-2151625/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Mitochondrial uncoupling by β 3 -adrenergic activation or an uncoupler (FCCP) causes Ca 2+ release from the mitochondria and subsequent Ca 2+ release from the endoplasmic reticulum (ER), evoking store-operated Ca 2+ entry (SOCE) due to Ca 2+ depletion from the ER in rodent brown adipocytes. In this study, we investigated how Ca 2+ depletion from the ER elicits SOCE in mouse brown adipocytes using fluorometry of intracellular Ca 2+ concentration ([Ca 2+ ] i ). The application of cyclopiazonic acid (CPA), a reversible sarcoplasmic/endoplasmic reticulum calcium ATPase (SERCA) pump blocker in the ER, caused an increase in [Ca 2+ ] i . Moreover, CPA-induced SOCE was suppressed by the application of a Ca 2+ -free Krebs solution and the transient receptor potential canonical 6 (TRPC6) blockers, which were 2-aminoethoxydiphenyl borate (2-APB), ML-9, and GsMTx-4. Application of TRPC6 channel analog 1-oleoyl-2-acetyl-sn-glycerol (OAG) and flufenamic acid elicited Ca 2+ entry. Moreover, our RT-PCR analyses detected mRNAs for TRPC6, STIM1, and Orai1 in brown adipose tissues. In addition, western blot analyses showed the expression of the TRPC6 protein. Thus, TRPC6 is one of the Ca 2+ pathways involved in SOCE, and Ca 2+ entry is directly linked to mitochondrial uncoupling, which is involved in the late phase of β 3 -adrenergic or FCCP-induced [Ca 2+ ] i increases. These modes of Ca 2+ entry provide the basis for heat production via activation of Ca 2+ -dependent dehydrogenase and the expression of uncoupling protein 1 (UCP1) proteins. Enhancing thermogenic metabolism in brown adipocytes may serve as broad therapeutic utility to reduce obesity and metabolic syndrome. brown adipocytes endoplasmic reticulum mitochondria transient receptor potential canonical 6 (TRPC6) Ca2+ signaling thermogenesis Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 1. Introduction Mitochondria and the endoplasmic reticulum (ER) operate as a Ca 2+ source in intracellular Ca 2+ dynamics, playing various roles in cell signal transduction systems [ 1 ]. The ER accumulates Ca 2+ via sarcoplasmic/endoplasmic reticulum Ca 2+ ATPase (SERCA) pumps and releases Ca 2+ through inositol 1,4,5-trisphosphate (IP 3 ) receptors in response to physiological stimulation [ 2 ]. Depletion of Ca 2+ in the ER due to released Ca 2+ through IP 3 receptors activates store-operated Ca 2+ entry (SOCE) [ 3 – 5 ]. Thus, the ER regulates the intracellular Ca 2+ concentration ([Ca 2+ ] i ) via Ca 2+ uptake, release, and entry. We have recently found that mitochondrial Ca 2+ released by the activation of β-adrenergic receptor activates Ca 2+ -induced Ca 2+ release (CICR) at the ER under the activation of phospholipase C (PLC) and subsequently elicits Ca 2+ entry into brown adipocytes [ 6 ]. Brown adipocytes comprise a thermogenic organ. In low-temperature environments, sympathetic nerves release noradrenaline and activate β 3 -adrenergic receptors on brown adipocytes. This activation enhances the hydrolysis of triglycerides via the production of cyclic adenosine monophosphate (cAMP) and activation of protein kinase A (PKA) and hormone-dependent lipase [ 7 , 8 , 9 ]. This enhances the tricarboxylic acid (TCA) cycle and electron transfer chains at the inner mitochondrial membrane, increasing the electrochemical potential for H + [ 9 , 10 ], while free fatty acids (FFA) are produced by the activation of uncoupling protein type 1 (UCP1) [ 11 ]. This uncouples oxidative phosphorylation and leads to heat production [ 12 , 13 ]. Conversely, noradrenaline released from the sympathetic nerve activates the α 1A -adrenergic receptor and elicits a large phasic rise in [Ca 2+ ] i via Ca 2+ release from the ER through the IP 3 receptor [ 14 – 15 ]. This leads to the activation of SOCE [ 6 , 16 – 17 ]. The increase in [Ca 2+ ] i during adrenergic stimulation directly interacts with mitochondria and stimulates the rate of heat production [ 18 – 19 ]. A variety of Ca 2+ -elevating pathways have been proposed to contribute to Ca 2+ homeostasis in brown adipocytes. However, the most important Ca 2+ influx pathway, coupled with Ca 2+ loss from the ER, is most likely SOCE. The SOCE pathway has been identified as a Ca 2+ influx pathway in various tissues, where it regulates several important physiological functions. These include cell proliferation, secretion, migration of endothelial cells, activation of T cells, and mast cell degranulation [ 20 – 27 ]. The mechanism mediating SOCE is multifaceted and involves a plasma membrane-resident Ca 2+ channel called Orai1 and an ER membrane-spanning Ca 2+ -sensing protein called stromal interaction molecule (STIM) [ 28 – 36 ]. The latter detects decreases in Ca 2+ concentration in the ER ([Ca 2+ ] ER ), which induces the oligomerization and translocation of STIM to a region near the plasma membrane where it interacts with Orai1 to generate Ca 2+ influx. Therefore, SOCE appears to be an appropriate Ca 2+ influx pathway that can be readily coupled to the decrease in [Ca 2+ ] ER that occurs during noradrenaline-induced or mitochondrial uncoupling-induced rise in Ca 2+ levels in mouse brown adipocytes [ 6 , 17 ]. The search for channels mediating SOCE led to the identification of mammalian transient receptor potential (TRP) channels, which are non-selective cation channels that are highly permeable to Ca 2+ . In mammals, there are seven TRP families: TRPC (canonical), TRPV (vanilloid), TRPM (melastatin), TRPA (ankyrin), TRPP (polycystin), TRPML (mucolipin), and TRPN (Drosophila NOMPC). Among them, TRPC channels have been suggested as potential candidates for mediating SOCE in various tissues [ 37 – 39 ]. Therefore, we aimed to determine whether activation or inhibition of TRPC channels affects SOCE and the expression of TRPC mRNA and proteins in mouse brown adipocytes. In this study, we found that SOCE in mouse brown adipocytes due to Ca 2+ depletion in the ER was elicited by the activation of TRPC6 channels. We discuss the underlying mechanism that allows TRPC6 to elicit Ca 2+ entry and the role of TRPC6 in thermogenesis. 2. Materials And Methods 2.1. Drugs Collagenase type-2 (class 2) was obtained from Worthington Biochemical (New Jersey, USA), and DNase-I was obtained from Roche Diagnostics (Indiana, USA). Dulbecco's Modified Eagle Medium (DMEM) (low glucose type, 11885-084), penicillin, and streptomycin were purchased from Applied Biosystems, Inc. (California, USA). Fetal bovine serum (FBS) was obtained from Thermo Fisher Scientific (Melbourne, Australia). Cyclopiazonic acid (CPA), ML-9, and bovine serum albumin (BSA) were obtained from Sigma-Aldrich (St. Louis, MO, USA); 2-aminoethoxydiphenyl borate (2-APB) and Flufenamic acid were purchased from Wako Pure Chemical Industries, Ltd. (Saitama, Japan); 1-oleoyl-2-acetyl-sn-glycerol (OAG) was purchased from Funakoshi Co. Ltd. (Tokyo, Japan). Primers for RT-PCR were obtained from Eurofins Genomics, Inc. (Tokyo, Japan). Fura-2 acetoxymethyl ester (Fura-2 AM) was purchased from Molecular Probes Inc. (Oregon, USA). Anti-TRPC6 antibodies and their blocking peptides were purchased from Alomone Laboratories (Jerusalem, Israel). 2.2. Solutions The control Krebs Ringer solution comprised 150 mM NaCl, 5 mM KCl, 2 mM CaC1 2 , 0.5 mM MgCl 2 , 10 mM HEPES, and 5 mM glucose (pH 7.4, adjusted with NaOH). The Ca 2+ -free Krebs solution was prepared using isomolar Na + in the control Krebs–Ringer solution. Drugs were applied by substituting the perfusing solution with a solution containing the drug(s). 2.3. Animals Four-week-old male C57BL/6J mice were obtained from SLC Japan (headquarters) and were kept at 25–27°C with free access to food and water for 3–5 h. At the end of the experiment, they were anesthetized with isoflurane and killed by cervical dislocation, and the interscapular brown adipose tissues were isolated. 2.4. Cell isolation and primary culture The preparations and solutions were mostly similar to those described in a previous study [ 6 , 16 ]. Brown adipocytes were isolated by treating adipose tissues with collagenase type-2 and DNase I. The isolated adipocytes were cultured for 3–5 days, supplemented with 10% FBS (Thermo Fisher Scientific), and 1% penicillin-streptomycin (GibcoTM), at 37°C in a humidified CO 2 incubator. After culturing, the adipocytes were used for Ca 2+ imaging. 2.5. Ca 2+ imaging and the analysis of [Ca 2+ ] i Cultured mouse brown adipocytes were loaded with Fura-2 AM (5 µM) and incubated for 45 min at 37°C. Changes in [Ca 2+ ] i in adipocytes were measured using a conventional Ca 2+ -imaging system (CCD camera, ORCA-Spark, Hamamatsu photonics, Shizuoka, Japan) set on an inverted microscope (ECLIPSE Ti with an objective, 40 × water, numerical aperture 1.15, NIKON, Tokyo, Japan). Fura-2-stained brown adipocytes were excited alternatively at 340 nm and 380 nm using an illumination system pE-300ultra (CoolLED Limited, Andover, UK) for the inverted microscope. Fura-2 fluorescence was recorded using a bandpass filter (D535/30, Chroma Technology Corp.). The fluorescence intensity was averaged over the contour of each cell using image acquisition and analysis software (HCImage, Hamamatsu Photonics) in single-cell culture experiments. The ratio of fluorescence excited at 340 nm to that at 380 nm (F340/380) was converted to the [Ca 2+ ] i value using a dissociation constant of 145 nM, the ratio of the maximum F340/F380 to the minimum (14.1), and the fluorescence ratio of the free to the Ca-bound form (9.59). 2.6. RNA isolation and RT-PCR Total RNA was extracted from brown adipose tissues isolated from 4-week-old mice under anesthesia, using the RNeasy Lipid Tissue mini kit (Qiagen, Germany). Samples were homogenized in 1 mL QIAzol (Qiagen, Germany) at 20,000 rpm using an ultrasonic homogenizer (DIAX 100, Heidolph, Germany). Next, the samples were incubated at room temperature for 5 min, 0.2 mL chloroform was added, and the samples were vortexed for 15 s. Next, the samples were centrifuged at 12,000 rpm and 4°C for 15 min. The upper aqueous phase was mixed with 70% ethanol and centrifuged in an RNeasy Min Spin Column (Qiagen, Germany) at 12,000 rpm and 20°C for 15 s to allow RNA adsorption onto the silica gel membrane. After the addition of 350 µL RW1 buffer, the column was centrifuged as before. DNase I (10 µL) was then added to the membrane to eliminate DNA contamination. The column was washed with 350 µL RW1 buffer and centrifuged as before. Next, the column was washed twice with 500 µL and finally centrifuged at 15,000 rpm for 1 min to dry the membrane. To elute the RNA, 20 µL RNase-free water was added to the membrane, left to stand for 2 min, and centrifuged at 15,000 rpm for 1 min. The elution step was repeated twice, the collected RNA was combined, and the samples were stored at -80°C. Reverse transcription was performed using the First-Strand cDNA Synthesis kit (SuperScript III Cells Direct cDNA Synthesis System, Invitrogen, USA) according to the manufacturer’s recommendations. The resulting cDNA was stored at -20°C and used for standard RT-PCR. Here, 0.5 µL of the cDNA reaction mixture was added to a 49.5 µL of the PCR reaction mixture consisting of 0.5 µM of each primer, PCR buffer, 2 mM MgCl 2 , 200 µM dNTP mix, and 1.25 units Taq DNA polymerase. The sense and antisense oligonucleotide primers specific for different TRPC channel subtypes are listed in Table 1 . Each cDNA fragment was amplified in a DNA thermal cycler (iCycler 96 well reaction module, Bio-Rad, Hercules, California, USA). The RT-PCR conditions were as follows: initial denaturation at 94°C for 10 min, followed by 40 cycles of denaturation at 94°C for 30 s, annealing at 58°C for 1 min, extension at 72°C for 30 s, and a final extension at 72°C for 2 min. The PCR products were electrophoresed on a 2% (w/v) agarose gel, stained with ethidium bromide (0.1 µg/mL), and visualized under ultraviolet illumination. Table 1 Sequences of the primer sets used for RT-PCR Protein Forward primer 5ʹ-3ʹ Reverse primer 5ʹ-3ʹ Product size (bp) TRPC1 CAAGATTTTGGGAAATTTCTGG TTTATCCTCATGATTTGCTAT 372 TRPC2 GATCCGGTTCATGTTCATCCT GAGCGAGCAAACTTCCACTC 327 TRPC3 TGACTTCTGTTGTCCTCAAATATG CCTTCTGCAGTCTTCTCCTCCTGC 318 TRPC4 TCTGCAGATATCTCTGGGAAGGATGC AAGCTTTGTTCGAGCAAATTTCCATTC 415 TRPC5 ATCTACTGCCTAGTACTACTGGCT CAGCATGATCGGCAATGAGCTG 340 TRPC6 AAAGATATCTTCAAATTCATGGTC CACGTCCGCATCATCCTCAATTTC 327 TRPC7 CGTGCTGTATGGGGTTTATTATG GCTTTGGAATGCTGTTAGAC 693 STIM1 TGCCAAGGCTAGCTGTAACAA TCAGGTGATTGTGGCGAGTC 144 Orai1 AGGTGATGAGCCTCAACGAG TAACCCTGGCGGGTAGTCAT 173 β-actin GGCTGTATTCCCCTCCATCG CCAGTTGGTAACAATGCCATGT 154 2.7. Protein isolation and western blot analysis Brown adipose tissues were homogenized in 20 mM Tris buffer (pH 7.4) containing 1 mM ethylene glycol-bis(2-aminoethylether)-N,N,N,N’-tetraacetic acid (EGTA) and protease inhibitors (Roche Diagnostics, Indiana, USA) using a homogenizer (DIAX 100, Heidolph, Germany) at 15,000 rpm and 4°C for 1 min. Next, the samples were centrifuged at 25,000 rpm and 4°C for 60 min. After removing the supernatant, including the lipid fraction, the precipitate was placed in 1 mL Tris-EDTA (TE) buffer. Precipitated fractions were denatured, separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), and calibrated with pre-stained protein molecular weight markers (Bio-Rad, California, USA). The separated proteins were transferred onto nitrocellulose membranes (Hybond-C, Bio-Rad) and blocked with 5% (w/v) BSA in Tris-buffered saline (TBS) and 0.1% Tween-20 (Sigma-Aldrich, St. Louis, Missouri, USA). The nitrocellulose membranes were stained with affinity-purified rabbit polyclonal antibodies (1:500) specific for TRPC6 (Alomone Labs, Jerusalem, Israel) at 20°C for 1 h and then at 4°C overnight. After washing twice with TBS for 10 min, the membranes were stained with anti-rabbit horseradish peroxidase (HRP)-conjugated IgG (1:10,000) for 1 h. The presence of TRPC6 channel proteins was detected using an enhanced luminol-linked chemical luminescence detection system (Amersham, New Jersey, USA). 2.8. Statistical analyses Data are presented as the mean ± standard error of the mean (SEM). The statistical significance of differences between the mean values was assessed using Student’s t-test. Differences were considered statistically significant for p < 0.05 (*), p < 0.01 (**), or p < 0.001 (***). 3. Results 3.1. Ca 2+ liberation from the ER by blocking the Ca 2+ pump activates Ca 2+ entry Application of cyclopiazonic acid (CPA) (a reversible ER Ca 2+ pump blocker) for 1 min caused an increase in [Ca 2+ ] i (Figure. 1). The increase in [Ca 2+ ] i reached a plateau of 198.2 ± 8.1 nM (n = 67). The sustained high level of [Ca 2+ ] i during the plateau could be caused by an increase in Ca 2+ entry into the cell membrane or a decrease in Ca 2+ extrusion. To identify the sources of Ca 2+ in CPA-induced [Ca 2+ ] i increase, the effects of Ca 2+ -free Krebs solution on CPA-induced increases in [Ca 2+ ] i were observed. When extracellular Ca 2+ was removed during the CPA-induced [Ca 2+ ] i rise, the elevated level of [Ca 2+ ] i was quickly and reversibly depressed and was much lower than the initial basal level (Figure. 1), indicating the presence of a Ca 2+ -entry component. The magnitude of the net reduction of the [Ca 2+ ] i level was 216.2 ± 17.2 nM (n = 67) from the level before perfusion of the Ca 2+ -free Krebs solution in mouse brown adipocytes. 3.2. Involvement of the activation of TRP channels in the CPA-induced Ca 2+ rise To test the involvement of TRP channel activation in CPA-induced Ca 2+ entry, we recorded the effects of TRP channel blockers on the Ca 2+ level rise. TRP channel modulation by the application of 2-aminoethoxydiphenyl borate (2-APB) includes activation of TRPV1, TRPV2, TRPV3, TRPA1, and TRPM6 and/or inhibition of TRPM2, TRPM7, TRPC1, TRPC3, TRPC5, TRPC6, and TRPC7 [ 40 – 45 ]. The application of 30 µM 2-APB inhibited the Ca 2+ entry evoked by 10 µM CPA (Fig. 2 ). The magnitude of the net reduction in the [Ca 2+ ] i level was 157.9 ± 10.3 nM (n = 117) from the level before perfusion of the 2-APB solution. Interestingly, in a subset of mouse brown adipocytes, we recorded the enhancement of Ca 2+ entry by the application of 30 µM 2-APB among CPA-induced Ca 2+ rises (Fig. 2 , black arrowhead). The magnitude of net elevation of the [Ca 2+ ] i level was 50.5 ± 3.2 nM (n = 83). To further investigate which TRP channel is related to SOCE in mouse adipocytes, we examined the effects of two specific TRPC6 channel blockers, ML-9 and GsMTx-4. The ML-9 blocker is known to rapidly inhibit the TRPC6 channel and enhance the TRPC7 channel [ 46 ]. The peptide GsMTx-4, isolated from the venom of the tarantula Grammostola spatulata , is a selective inhibitor of stretch-activated cation channels and TRPC6 [ 47 ]. As demonstrated in Fig. 3 , external application of 30 µM ML-9 or 10 µM GsMTx-4 reduced the amplitude of CPA-evoked Ca 2+ increases. The magnitude of the net reduction of the [Ca 2+ ] i level due to the application of 30 µM ML-9 solution was 140.9 ± 9.3 nM (n = 75; Fig. 3 a), while that due to the application of 10 µM GsMTx-4 solution was 61.6 ± 4.1 nM (n = 49; Fig. 3 b). 3.3. TRPC6 channel analog activated Ca 2+ rises in mouse brown adipocytes CPA causes Ca 2+ entry via TRPC6 channels due to Ca 2+ depletion in the ER. Hence, direct activation of TRPC6 should elevate [Ca 2+ ] i in mouse brown adipocytes. Therefore, we examined the effects of the TRPC6 channel analog, OAG, and whether TRPC6 channels are components of the CPA-induced [Ca 2+ ] i increases. The OAG analog is a membrane-permeable diacylglycerol (DAG) derivative [ 48 ]. The extracellular application of 100 µM OAG induced an increase in [Ca 2+ ] i (Fig. 4 a). The magnitude of the net elevation of [Ca 2+ ] i was 167.7 ± 15.1 nM (n = 60) from the basal level. These elevations in [Ca 2+ ] i levels due to the application of OAG were inhibited by the application of the Ca 2+ -free Krebs solution (Fig. 4 b). Next, we carried out experiments using the pharmacological agent flufenamic acid, which has been shown to affect the TRPC6 channel protein [ 49 ]. The application of 100 µM flufenamic acid induced an increase in [Ca 2+ ] i (Fig. 5 ). The magnitude of the net elevation of the [Ca 2+ ] i level was 95.6 ± 6.2 nM (n = 46) from the basal level. 3.4. H + inhibition of SOCE in mouse brown adipocytes It is known that TRPC6 channel permeability is inhibited by low-pH conditions and enhanced by high-pH conditions [ 50 ]. Next, we tested the effects of Krebs solution on Ca 2+ entry mediated by store depletion in mouse brown adipocytes. Thapsigargin (1 µM, a non-competitive blocker of the ER Ca 2+ pump) applied for 5 min caused a mono- or biphasic rise in [Ca 2+ ] i levels (Fig. 6 a). The increased [Ca 2+ ] i levels reached a peak within 10 min and slowly declined over several tens of minutes to a plateau. These increases were inhibited by bath application of a low-pH Krebs solution. Decreasing the extracellular pH from 7.4 to 6.8 or 7.2 during Ca 2+ entry elicited by thapsigargin led to significant decreases. Responses occurred immediately after changing the extracellular pH, and reversibly upon returning to the standard Krebs solution (pH 7.4). Next, we examined intermediate pH values between pH 6.8 and 7.6. The data are summarized in Fig. 6 b. The [Ca 2+ ] i under the application of thapsigargin were 346.0 ± 5.6 nM at pH 7.4 (n = 247), 219.1 ± 12.2 nM at pH 6.8 (n = 23, p < 0.001 compared with pH 7.4), 247.4 ± 6.0 nM at pH 7.0 (n = 119, p < 0.001 compared with pH 7.4), 281.0 ± 7.6 nM at pH 7.2 (n = 98, p < 0.01 compared with pH 7.4), and 370.3 ± 9.7 nM at pH 7.6 (n = 65, p < 0.05 compared with pH 7.4). Decreasing the extracellular pH from 7.4 to 6.8–7.2 led to the inhibition of Ca 2+ entry elicited by the application of thapsigargin in a pH-dependent manner. 3.5. Expression of TRPC family members Further experiments were conducted to confirm which TRPC channels were expressed in brown adipocytes. We classified TRPC subtypes expressed on mouse brown adipocytes using excised brown fat tissue to eliminate other tissues such as muscle and neurons by RT-PCR. Four of the seven TRPC subtypes were successfully amplified from the cDNA using the primer sets (Fig. 7 ). These subtypes expressed were TRPC1 , TRPC2 , TRPC3 , and TRPC6 . The detection of the TRPC6 subtype mRNA in brown adipocytes agreed with our Ca 2+ imaging analysis. Moreover, we detected the expression of STIM1 and Orai1 (Fig. 7 ). Western blotting results revealed the presence of TRPC6 in the mouse brown adipocytes (Fig. 8 ). To determine whether these bands were specific, blocking experiments were performed using control antigen peptides. Before proceeding with the staining protocol, the antibody specific for TRPC6 was incubated with an excess of the control antigen peptide that corresponded to the epitope recognized by the antibody. The antibody bound to the control antigen peptide was not available to bind to the epitope present in the TRPC6 channel protein by western blotting (data not shown). 4. Discussion The present study shows that mouse brown adipocytes functionally express TRPC6 and partake in SOCE. In Ca 2+ -imaging studies, CPA evoked Ca 2+ rises, and the removal of external Ca 2+ by the application of Ca 2+ -free Krebs solution completely inhibited Ca 2+ entry elicited by CPA. These results indicate that brown adipocytes have a mechanism for SOCE. These results agree with those of previous studies [ 6 , 16 – 17 ]. Here, we showed that the Ca 2+ rise elicited by CPA was initially enhanced by the application of 2-APB, after which the continuous application of 2-APB reduced the Ca 2+ rise (Fig. 2 ). We observed two types of reactions by the application of 2-APB: the components of Ca 2+ increase and decrease; 2-APB is known not only as a blocker of TRPM2, TRPM7, TRPC1, TRPC3, TRPC5, TRPC6, and TRPC7, but also as an activator of TRPA1, TRPV1, TRPV2, and TRPV3 channels [ 40 – 45 ]. These results suggest that mouse brown adipocytes express at least two types of TRP channels. Bishnoi et al. (2013), Sun et al. (2016) and Uchida et al. (2017) reported that TRPV2 expressed in brown adipocytes contributed to differentiation and thermogenesis [ 55 – 58 ]. The components of Ca 2+ rise elicited by 2-APB may consist of the activation of TRPV2 and the components of reduction elicited by 2-APB consist of the activation of TRPC6. Ca 2+ imaging also showed that the application of OAG, a DAG analog, evoked Ca 2+ increases in mouse brown adipocytes. It is known that mouse brown adipocytes express the α 1A -adrenergic receptor, which couples with the Gq protein. The activation of the Gq protein promotes phospholipase C (PLC) activity, which in turn generates DAG and IP 3 . The latter mobilizes Ca 2+ from the ER, leading to Ca 2+ loss in the ER and the activation of TRPC6 and Ca 2+ entry. Simultaneously, DAG produced by PLC activation can directly gate TRPC6. The results shown in this experiment indicate that TRPC6 functions not only as a SOCE channel but also as a non-capacitive Ca 2+ entry channel. RT-PCR and western blotting experiments revealed the expression of TRPC6 in mouse brown adipocytes. These results agree with those of the Ca 2+ -imaging studies. The RT-PCR results also showed the expression of TRPC1 , TRPC2 , and TRPC3 suggesting the expression of other TRPC channel subtypes. Wolfrum et al. (2018) showed that TRPC1 was expressed in cultured brown adipocytes, which led to the downregulation of several metabolic genes, including UCP1 and PPARγ , as well as upregulation of the BAT-specific thermosensitive channel TRPV2 , ultimately resulting in impaired respiratory function [ 59 ]. TRPC1 activation may also induce Ca 2+ entry into mouse brown adipocytes. RT-PCR results also revealed the expression of STIM1 and Orai1 in mouse brown adipocytes. The Orai1 protein is located in the plasma membrane that forms an ion-conducting pore. Orai1 channels are activated by STIM 1 and STIM2 located in the ER when Ca 2+ ions are depleted in the ER. Orai1 may also function as a SOCE channel activated by the depletion of Ca 2+ in the ER of mouse brown adipocytes. Further studies are required to confirm the expression and function of these genes. Figure 9 illustrates the likely mechanism of the Ca 2+ response by the activation of TRPC6 under physiological conditions. Under cold exposure, noradrenaline released from sympathetic nerves activates the α 1A adrenoreceptor, which elicits a large phasic rise in [Ca 2+ ] i via Ca 2+ release from the ER through the IP 3 receptors. In addition, noradrenaline released from the sympathetic nerves activates the β 3 subtypes of the adrenergic receptors. The activation of β 3 -adrenoreceptor by noradrenaline leads to lipid hydrolysis by the activation of hormone-dependent lipase via the activation of PKA. β-oxidation of free fatty acids enhances the TCA cycle and the electrochemical potential for H + across the inner mitochondrial membrane by the production of NADH and FADH 2 via the activation of Ca 2+ -dependent dehydrogenases. However, the activation of UCP1 by free fatty acids forms proton pathways that lead to the collapse of mitochondrial membrane potential and an increase in Ca 2+ concentrations in the mitochondria via matrix acidification. This causes mitochondrial Ca 2+ release [ 6 ]. The Ca 2+ released from the mitochondria further elicits Ca 2+ -induced Ca 2+ -release from the ER via IP 3 receptor under the action of IP 3 produced by PLC activation and subsequently activates SOCE via TRPC6. Thus, brown adipocytes would be enabled to sustain long-lasting [Ca 2+ ] i rises due to these modes of sequential activation of Ca 2+ releases from the mitochondria and the ER and Ca 2+ entries elicited by adrenergic activation. It is known that intracellular Ca 2+ enhances thermogenesis and oxygen consumption in brown adipocytes [ 18 , 19 ]. In this study, we demonstrated Ca 2+ responses by the activation of TRPC6. Interestingly, TRPC6 channels are known to be mechano-sensitive [ 60 ]. Indeed, we observe that the [Ca 2+ ] i rises, in response to mechanical stimulation by the water pressure application of normal Krebs solution on cultured mouse brown adipocytes (unpublished observation). These results indicate that TRPC6 channels may be involved in not only non-shivering but also shivering thermogenesis in brown adipocyte. We assume that Ca 2+ entry via TRPC6 contributes to heat production in mouse brown adipocytes. On this basis, future efforts should be taken to characterize TRPC6 channels as a mechanical sensor and to study it’s contributes in the thermogenesis of the mouse brown adipocytes. Declarations Conflict of Interest The authors have no conflicts of interest directly relevant to the content of this article. Acknowledgements We thank M. Ishikawa, Y Sakagami, S. Sasaki, A. Takao, E. Tachi, S. Nakao, H. Nakanishi, and C. Yoshimura for their assistance with the experiments. Author Contributions All authors contributed to the study conception and design. Material preparation, data collection and analysis were performed by Ryotaro Hayato and Takaya Matsumoto. The first draft of the manuscript was written by Ryotaro Hayato, and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript. Ethical Approval All experiments were performed following the guiding principles for the care and use of Animals in the Field of Physiological Sciences and were approved by the Council of the Physiological Society of Japan and the Animal Institutional Review Board of Nagoya University of Arts and Sciences (Approval Code Number: No. 82 ). Funding This work was supported by JSPS KAKENHI Grant Number 21K12674 awarded to Ryotaro Hayato. Availability of data and materials The data that support the findings of this study are available on request from the corresponding author. The data are not publicly available due to the large amount of data. References Carafoli E (1987) Intracellular calcium homeostasis. Annu Rev Biochem 56: 395–433. doi: 10.1146/annurev.bi.56.070187.002143 Berridge MJ (1993) Inositol trisphophate and calcium signalling. Nature 361: 315–325. doi: 10.1038/361315a0 Hoth M, Penner R (1992) Depletion of intracellular calcium stores activates a calcium current in mast cells. Nature 355: 353–356. doi: 10.1038/355353a0 Parekh AB (2003) Store-operated Ca 2+ entry: dynamic interplay between endoplasmic reticulum, mitochondria, and plasma membrane. J Physiol 547: 333–348. doi: 10.1113/jphysiol.2002.034140 Putney Jr JW (1986) A model for receptor-regulated calcium entry. Cell Calcium 7: 1–12. doi: 10.1016/0143-4160(86)90026-6 Hayato R, Higure Y, Kuba M, Nagai H, Yamashita H, Kuba K (2011) b3-Adrenergic activation of sequential Ca 2+ release from mitochondria and the endoplasmic reticulum and the subsequent Ca 2+ entry in rodent brown adipocytes. Cell Calcium 49:400–414. doi: 10.1016/j.ceca.2011.02.011. Zhao J, Cannon B, Nedergaard J (1998) Thermogenesis is b3- but not b1-adrenergically mediated in rat brown fat cells, even after cold acclimation. Am J Physiol Regul Integr Comp Physiol 275: R2002–R2011. doi: 10.1152/ajpregu.1998.275.6.R2002. Granneman JG (1990) Norepinephrine and BRL37344 stimulate adenylate cyclase by different receptors in rat brown adipose tissue. J Pharmacol Exp Ther 254:508–513. Nicholls DG, Locke RM (1984) Thermogenic mechanisms in brown fat. Physiol Rev 64:1–64. doi: 10.1152/physrev.1984.64.1.1. Trayhurn P (1989) Brown adipose tissue and nutritional energetics - where are we now? Proc Nutr Soc 48:165–175. doi: 10.1079/pns19890026. Klingenberg M, Huang SG (1999) Structure and function of the uncoupling protein from brown adipose tissue. Biochim. Biophys. Acta 1415:271–296. doi: 10.1016/s0005-2736(98)00232-6. Lowell BB, Spiegelman BM (2000) Towards a molecular understanding of adaptive thermogenesis. Nature 404:652–660. doi: 10.1038/35007527. Ricquier D, Bouillaud F (2000) Mitochondrial uncoupling proteins: from mitochondria to the regulation of energy balance. J. Physiol. 529: 3–10. doi: 10.1111/j.1469-7793.2000.00003.x. Lee SC, Nuccitelli R, Pappone PA (1993) Adrenergically activated Ca 2+ increases in brown fat cells: effects of Ca 2+ , K + , and K channel block. Am J Physiol 264:C217–C228. doi: 10.1152/ajpcell.1993.264.1.C217. Nånberg E, Putney J Jr (1986) Alpha1-adrenergic activation of brown adipocytes leads to an increased formation of inositol polyphosphates. FEBS Lett. 195:319–322. doi: 10.1016/0014-5793(86)80185-5. Omatsu-Kanbe M, Matsuura H (1999) Inhibition of store-operated Ca 2+ entry by extracellular ATP in rat brown adipocytes. J Physiol 521:601–615. doi: 10.1111/j.1469-7793.1999.00601.x. Kuba M, Higure Y, Susaki H, Hayato R, Kuba K (2007) Bidirectional Ca 2+ coupling of mitochondria with the endoplasmic reticulum and regulation of multimodal Ca 2+ entries in rat brown adipocytes. Am J Physiol Cell Physiol 292:C896–C908. doi: 10.1152/ajpcell.00649.2005. de Meis L, Ketzer LA, da Costa RM, de Andrade IR, Marlene Benchimol M. (2010) Fusion of the endoplasmic reticulum and mitochondrial outer membrane in rats brown adipose tissue: activation of thermogenesis by Ca 2+ PLoS One 5:e9439. doi: 10.1371/journal.pone.0009439. Guarnieri AR, Benson TW, Tranter M. (2022) Calcium cycling as a mediator of thermogenic metabolism in adipose tissue. Mol Pharmacol 102:51–59. doi: 10.1124/molpharm.121.000465. Chen YW, Smith ML, Chiou GX, Ballaron S, Sheets MP, Gubbins E, Warrior U, Wilkins J, Surowy C, Nakane M, Carter GW, Trevillyan JM, Mollison K, Djuric SW (2002) TH1 and TH2 cytokine inhibition by 3,5-bis(trifluoromethyl)pyrazoles, a novel class of immunomodulators. Cell Immunol 220:134–142. doi: 10.1016/s0008-8749(03)00005-4. Yang S, Zhang JJ, Huang XY (2009) Orai1 and STIM1 are critical for breast tumor cell migration and metastasis. Cancer Cell 15:124–134. doi: 10.1016/j.ccr.2008.12.019. Matthews G, Neher E, Penner R (1989) Second messenger-activated calcium influx in rat peritoneal mast cells. J Physiol 418:105–130. doi: 10.1113/jphysiol.1989.sp017830. Penner R, Matthews G, Neher E (1988) Regulation of calcium influx by second messengers in rat mast cells. Nature 334:499–504. doi: 10.1038/334499a0. Baba Y, Nishida K, Fujii Y, Hirano T, Hikida M, Kurosaki T (2008) Essential function for the calcium sensor STIM1 in mast cell activation and anaphylactic responses. Nat Immunol 9:81–88. doi: 10.1038/ni1546. Beyersdorf N, Braun A, Vögtle T, Varga-Szabo D, Galdos RR, Kissler S, Kerkau T, Nieswandt B (2009) STIM1-independent T cell development and effector function in vivo . J Immunol 182:3390–3397. doi: 10.4049/jimmunol.0802888. Braun A, Gessner JE, Varga-Szabo D, Syed SN, Konrad S, Stegner D, Vögtle T, Schmidt RE, Nieswandt B (2009) STIM1 is essential for Fcgamma receptor activation and autoimmune inflammation. Blood 113:1097–1104. doi: 10.1182/blood-2008-05-158477. Oh-Hora M, Yamashita M, Hogan PG, Sharma S, Lamperti E, Chung W, Prakriya M, Feske S, Rao A (2008) Dual functions for the endoplasmic reticulum calcium sensors STIM1 and STIM2 in T cell activation and tolerance. Nat Immunol 9:432–443. doi: 10.1038/ni1574. Liou J, Kim ML, Heo WD, Jones JT, Myers JW, Ferrell JE & Meyer T (2005) STIM is a Ca 2+ sensor essential for Ca 2+ -store-depletion-triggered Ca 2+ influx. Curr Biol 15:1235–1241. doi: 10.1016/j.cub.2005.05.055. Roos J, DiGregorio PJ, Yeromin AV, Ohlsen K, Lioudyno M, Zhang S, Safrina O, Kozak JA, Wagner SL, Cahalan MD, Veliçelebi G, Stauderman KA (2005) STIM1, an essential and conserved component of store-operated Ca 2+ channel function. J Cell Biol 169:435–445. doi: 10.1083/jcb.200502019 Feske S, Gwack Y, Prakriya M, Srikanth S, Puppel SH, Tanasa B, Hogan PG, Lewis RS, Daly M, Rao A. (2006) A mutation in Orai1 causes immune deficiency by abrogating CRAC channel function. Nature 441:179–185. doi: 10.1038/nature04702. Soboloff J, Rothberg BS, Madesh M & Gill DL (2012) STIM proteins: dynamic calcium signal transducers. Nat Rev Mol Cell Biol 13:549–565. doi: 10.1038/nrm3414. Jairaman A, Prakriya M (2013) Molecular pharmacology of store-operated CRAC channels. Channels (Austin) 7:402–414. doi: 10.4161/chan.25292. Baba Y, Matsumoto M & Kurosaki T (2014) Calcium signaling in B cells: regulation of cytosolic Ca 2+ increase and its sensor molecules, STIM1 and STIM2. Mol Immunol 62:339–343. doi: 10.1016/j.molimm.2013.10.006. Prakriya M, Lewis RS (2015) Store-operated calcium channels. Physiol Rev 95:1383–1436. Steinckwich N, Myers P, Janardhan KS, Flagler ND, King D, Petranka JG, Putney JW (2015) Role of the store-operated calcium entry protein, STIM1, in neutrophil chemotaxis and infiltration into a murine model of psoriasis-inflamed skin. FASEB J 29:3003–3013. doi: 10.1096/fj.14-265215. Lewis RS (2007) The molecular choreography of a store-operated calcium channel. Nature 446:284–287. doi: 10.1038/nature05637. Lu W, Wang J, Shimoda LA, Sylvester JT (2008) Differences in STIM1 and TRPC expression in proximal and distal pulmonary arterial smooth muscle are associated with differences in Ca 2+ responses to hypoxia. Am J Physiol Lung Cell Mol Physiol 295:L104–L113. doi: 10.1152/ajplung.00058.2008. Wang J, Weigand L, Lu W, Sylvester JT, Semenza GL, Shimoda LA (2006) Hypoxia inducible factor 1 mediates hypoxia-induced TRPC expression and elevated intracellular Ca 2+ in pulmonary arterial smooth muscle cells. Circ Res 98:1528– 1537. doi: 10.1161/01.RES.0000227551.68124.98. Trebak M, Bird GS, McKay RR, Putney JW Jr (2002) Comparison of human TRPC3 channels in receptor-activated and store-operated modes. Differential sensitivity to channel blockers suggests fundamental differences in channel composition. J Biol Chem 277:21617–21623. doi: 10.1074/jbc.M202549200. Hu HZ, Gu Q, Wang C, Colton CK, Tang J, Kinoshita-Kawada M, Lee LY, Wood JD, Zhu MX (2004) 2-aminoethoxydiphenyl borate is a common activator of TRPV1, TRPV2, and TRPV3. J Biol Chem 279:35741–35748. doi: 10.1074/jbc.M404164200. Chung MK, Lee H, Mizuno A, Suzuki M, Caterina MJ (2004) 2-aminoethoxydiphenyl borate activates and sensitizes the heat-gated ion channel TRPV3. J Neurosci 24:5177–5182. doi: 10.1523/JNEUROSCI.0934-04.2004. Togashi K, Inada H, Tominaga M (2008) Inhibition of the transient receptor potential cation channel TRPM2 by 2-aminoethoxydiphenyl borate (2-APB). Br J Pharmacol 153:1324–1330. doi: 10.1038/sj.bjp.0707675. Chokshi R, Fruasaha P, Kozak JA (2012) 2-Aminoethyl diphenyl borinate (2-APB) inhibits TRPM7 channels through an intracellular acidification mechanism. Channels. 6:362–369. doi: 10.4161/chan.21628. Lievremont JP, Bird GS, Putney JW Jr (2005) Mechanism of inhibition of TRPC cation channels by 2-aminoethoxydiphenylborane. Mol Pharmacol. 68:758–762. doi: 10.1124/mol.105.012856. Xu SZ, Zeng F, Boulay G, Grimm C, Harteneck C, Beech DJ (2005) Block of TRPC5 channels by 2-aminoethoxydiphenyl borate: a differential, extracellular and voltage-dependent effect. Br J Pharmacol 145:405–414. doi: 10.1038/sj.bjp.0706197. J Shi J, Takahashi S, X-H Jin XH, Li YQ, Ito Y, Mori Y, Inoue R (2007) Myosin light chain kinase-independent inhibition by ML-9 of murine TRPC6 channels expressed in HEK293 cells. Br J Pharmacol 152:122–131. doi: 10.1038/sj.bjp.0707368. Spassova MA, Hewavitharana T, Xu W, Soboloff J, Gill DL (2006) A common mechanism underlies stretch activation and receptor activation of TRPC6 channels. Proc Natl Acad Sci USA 103:16586–16591. doi: 10.1073/pnas.0606894103. Hofmann T, Obukhov AG, Schaefer M, Harteneck C, Gudermann T, Schultz G (1999) Direct activation of human TRPC6 and TRPC3 channels by diacylglycerol. Nature 397:259–263. doi: 10.1038/16711. Inoue R, Okada T, Onoue H, Hara Y, Shimizu S, Naitoh S, Ito Y, Mori Y (2001) The Transient Receptor Potential Protein Homologue TRP6 Is the Essential Component of Vascular alpha1-adrenoceptor–activated Ca 2+ -Permeable Cation Channel. Circ Res 88:325–332. doi: 10.1161/01.res.88.3.325. Semtner S, Schaefer M, Pinkenburg O, Plant TD (2007) Potentiation of TRPC5 by protons. J Biol Chem 282:33868–33878. doi: 10.1074/jbc.M702577200. Yeromin AV, Zhang SL, Jiang W, Yu Y, Safrina O, Cahalan MD (2006) Molecular identification of the CRAC channel by altered ion selectivity in a mutant of Orai. Nature 443:226–229. doi: 10.1038/nature05108. Luik RM, Wu MM, Buchanan J, Lewis RS (2006) The elementary unit of store-operated Ca 2+ entry: Local activation of CRAC channels by STIM1 at ER-plasma membrane junctions. J Cell Biol 174:815–825. doi: 10.1083/jcb.200604015. Vig M, Beck A, Billingsley JM, Lis A, Parvez S, Peinelt C, Koomoa DL, Sobolo J, Gill DL, Fleig A, Kinet JP, Pnner R (2006) CRACM1 multimers form the ion-selective pore of the CRAC channel. Curr Biol 16:2073–2079. doi: 10.1016/j.cub.2006.08.085. Prakriya M, Feske S, Gwack Y, Srikanth S, Rao A, Hogan PG (2006) Orai1 is an essential pore subunit of the CRAC channel. Nature 443:230–233. doi: 10.1038/nature05122. Bishnoi M, Kondepudi KK, Gupta A, Karmase A, Boparai RK (2013) Expression of multiple Transient Receptor Potential channel genes in murine 3T3-L1 cell lines and adipose tissue. Pharmacol Rep 65:751–755. doi: 10.1016/s1734-1140(13)71055-7. Sun W, Uchida K, Suzuki Y, Zhou Y, Kim M, Takayama Y, Takahashi N, Goto T, Wakabayashi S, Kawada T, Iwata Y, Tominaga M (2016) Lack of TRPV2 impairs thermogenesis in mouse brown adipose tissue. EMBO Rep 17:383–399. doi: 10.15252/embr.201540819. Sun W, Uchida K, Takahashi N, Iwata Y, Wakabayashi S, Goto T, Kawada T, Tominaga M (2016) Activation of TRPV2 negatively regulates the differentiation of mouse brown adipocytes. Pflugers Arch. 468:1527–1540. doi: 10.1007/s00424-016-1846-1. Uchida K, Dezaki K, Yoneshiro T, Watanabe T, Yamazaki T, Saito M, Yoda T, Tominaga M, Iwasaki Y (2017) Involvement of thermosensitive TRP channels in energy metabolism. J Physiol Sci 67:549–560. doi: 10.1007/s12576-017-0552-x. Wolfrum C, Kiehlmann E, Pelczar P (2018) TRPC1 regulates brown adipose tissue activity in a PPARγ-dependent manner. Am J Physiol Endocrinol Metab 315:E825–E832. doi: 10.1152/ajpendo.00170.2017. Gottlieb P, Folgering J, Maroto R, Raso A, Wood TG, Kurosky A, Bowman C, Bichet D, Patel A, Sachs F, Martinac B, Hamill OP, Honoré E (2008) Revisiting TRPC1 and TRPC6 mechanosensitivity. Pflügers Archiv-Eur. J. Physiol 455:1097–1103. doi: 10.1007/s00424-007-0359-3 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-2151625","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":143580591,"identity":"f646635b-218d-4962-8177-e5159ddefa0d","order_by":0,"name":"Ryotaro Hayato","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAzUlEQVRIiWNgGAWjYBACAwhlAxdgJk7LAYY00rUcJsFh5uxnDD9/qDifZ3D8+AOGHzUM7OaEtFj25BhLHDhzu9jgTI4BY88xBmbLBkIOO5BjIHGw7XbihgM5DAy8DQzMBgcIaTn/xvjHwbZziRvOP3/A+JcoLTdyzIC2HEjccCPBgJk4W248K7M4cyY5ceaNNwaHZY5JEOGX88mbb1RU2CX2nU9/+PBNjU0ywRBjYOAwgDOBTpJINsCtFAbYH6Bw7YjQMgpGwSgYBSMMAADbDUZddUC2AAAAAABJRU5ErkJggg==","orcid":"","institution":"Nagoya University of Arts and Sciences","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Ryotaro","middleName":"","lastName":"Hayato","suffix":""},{"id":143580592,"identity":"c7919578-f038-4ffc-b363-5f164df7ed7e","order_by":1,"name":"Takaya Matsumoto","email":"","orcid":"","institution":"Nagoya Bunri University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Takaya","middleName":"","lastName":"Matsumoto","suffix":""}],"badges":[],"createdAt":"2022-10-10 15:29:13","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-2151625/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-2151625/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":27795219,"identity":"31a63ab7-75c8-4427-8a50-80d4da67bf82","added_by":"auto","created_at":"2022-10-14 18:48:51","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":118453,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCa\u003c/strong\u003e\u003csup\u003e\u003cstrong\u003e2+\u003c/strong\u003e\u003c/sup\u003e\u003cstrong\u003e liberation from the ER by blocking Ca\u003c/strong\u003e\u003csup\u003e\u003cstrong\u003e2+\u003c/strong\u003e\u003c/sup\u003e\u003cstrong\u003e pump activates Ca\u003c/strong\u003e\u003csup\u003e\u003cstrong\u003e2+\u003c/strong\u003e\u003c/sup\u003e\u003cstrong\u003e entry\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe application of CPA, a reversible ER Ca\u003csup\u003e2+\u003c/sup\u003e pump blocker, caused an increase in [Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e (black horizontal bar). Removal of external Ca\u003csup\u003e2+\u003c/sup\u003e quickly and reversibly reduced CPA-induced [Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e increase to a level lower than the initial basal level (gray horizontal bar). These results indicate that blocking the Ca\u003csup\u003e2+\u003c/sup\u003e pump of the ER membrane liberates Ca\u003csup\u003e2+\u003c/sup\u003e from the ER and activates Ca\u003csup\u003e2+\u003c/sup\u003e entry into the extracellular space. Abbreviations: ER: endoplasmic reticulum; CPA: cyclopiazonic acid\u003c/p\u003e","description":"","filename":"Figure01.png","url":"https://assets-eu.researchsquare.com/files/rs-2151625/v1/996ca279344ca616d8e1fdf0.png"},{"id":27795699,"identity":"5210f72b-4815-44b6-8ce5-2bcc1eb550c8","added_by":"auto","created_at":"2022-10-14 18:53:51","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":123955,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffects of 2-APB on CPA-induced rises in [Ca\u003c/strong\u003e\u003csup\u003e\u003cstrong\u003e2+\u003c/strong\u003e\u003c/sup\u003e\u003cstrong\u003e]\u003c/strong\u003e\u003csub\u003e\u003cstrong\u003ei\u003c/strong\u003e\u003c/sub\u003e\u003c/p\u003e\n\u003cp\u003eThe CPA-induced [Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e increase was suppressed by 2-APB, a blocker of TRPM2, TRPM7, TRPC1, TRPC3, TRPC5, TRPC6, and TRPC7. 2-APB also functions as an activator of TRPV1, TRPV2, TRPV3, TRPA1, and TRPM6. These results suggest that mouse brown adipocytes express not only TRPM2, TRPM7, TRPC1, TRPC3, TRPC5, TRPC6, and TRPC7, but also TRPV1, TRPV2, TRPV3, TRPA1, and/or TRPM6. CPA (10 mM) was applied during the period indicated by a black horizontal bar and 2-APB (30 mM) during the period indicated by a gray horizontal bar. The black arrow indicates the component of Ca\u003csup\u003e2+\u003c/sup\u003e increase due to the application of 2-APB. Abbreviations: CPA: cyclopiazonic acid; 2-APB: 2-aminoethoxydiphenyl borate; TRPM: transient receptor potential melastatin; TRPV: transient receptor potential vanilloid; TRPA: transient receptor potential ankyrin\u003c/p\u003e","description":"","filename":"Figure02.png","url":"https://assets-eu.researchsquare.com/files/rs-2151625/v1/013831c6f6402acdccbaacb9.png"},{"id":27796258,"identity":"2a954aa4-afee-4f8f-9c6c-9b4907f4eaf9","added_by":"auto","created_at":"2022-10-14 19:03:51","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":228405,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDepression of CPA-induced [Ca\u003c/strong\u003e\u003csup\u003e\u003cstrong\u003e2+\u003c/strong\u003e\u003c/sup\u003e\u003cstrong\u003e]\u003c/strong\u003e\u003csub\u003e\u003cstrong\u003ei\u003c/strong\u003e\u003c/sub\u003e\u003cstrong\u003e is alleviated by ML-9 and GsMTx-4\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe CPA-induced [Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e increase was suppressed by 30 mM ML-9 or 10 mM GsMTx-4, blockers of TRPC6. (a) The Ca\u003csup\u003e2+\u003c/sup\u003e increase induced by the application of CPA was inhibited by ML-9. These results suggest that mouse brown adipocytes functionally express TRPC6. CPA (10 mM) was applied during the period indicated by a black horizontal bar, and ML-9 (30 mM) was applied during the period indicated by a gray horizontal bar. (b) These results also suggest that mouse brown adipocytes express TRPC6. CPA (10 mM) was applied during the period indicated by a black horizontal bar and GsMTx-4 (10 mM) was applied during the period indicated by a gray horizontal bar. Abbreviations: CPA: cyclopiazonic acid\u003c/p\u003e","description":"","filename":"Figure03.png","url":"https://assets-eu.researchsquare.com/files/rs-2151625/v1/ebc025c58427466824e6cddb.png"},{"id":27795800,"identity":"34ace36b-c042-4848-8060-5611a4025ebc","added_by":"auto","created_at":"2022-10-14 18:58:51","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":196912,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003e[Ca\u003c/strong\u003e\u003csup\u003e\u003cstrong\u003e2+\u003c/strong\u003e\u003c/sup\u003e\u003cstrong\u003e]\u003c/strong\u003e\u003csub\u003e\u003cstrong\u003ei\u003c/strong\u003e\u003c/sub\u003e\u003cstrong\u003e rises are induced by OAG and blocked by the removal of the extracellular Ca\u003c/strong\u003e\u003csup\u003e\u003cstrong\u003e2+\u003c/strong\u003e\u003c/sup\u003e\u003c/p\u003e\n\u003cp\u003eA TRPC6 activator OAG (1-oleoyl-2-acetyl-sn-glycerol) elicits [Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e increases in mouse brown adipocytes. [Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e increases are depressed by removing extracellular Ca\u003csup\u003e2+\u003c/sup\u003e. (a) Ca\u003csup\u003e2+\u003c/sup\u003e increase induced by OAG (100 mM) application during the period indicated by the black horizontal bars. (b) Application of OAG caused an increase in [Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e. Removal of external Ca\u003csup\u003e2+\u003c/sup\u003e quickly and reversibly reduced CPA-induced [Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e increase to a level lower than the initial basal level (gray horizontal bar). These results also suggested that mouse brown adipocytes functionally express TRPC6. OAG: 1-oleoyl-2-acetyl-sn-glycerol; CPA: cyclopiazonic acid\u003c/p\u003e","description":"","filename":"Figure04.png","url":"https://assets-eu.researchsquare.com/files/rs-2151625/v1/0d28743040bc879524a32b47.png"},{"id":27795226,"identity":"de72252e-b825-4cbb-a8f1-5eb788363076","added_by":"auto","created_at":"2022-10-14 18:48:51","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":98725,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003e[Ca\u003c/strong\u003e\u003csup\u003e\u003cstrong\u003e2+\u003c/strong\u003e\u003c/sup\u003e\u003cstrong\u003e]\u003c/strong\u003e\u003csub\u003e\u003cstrong\u003ei\u003c/strong\u003e\u003c/sub\u003e\u003cstrong\u003e rises are induced by flufenamic acid\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe TRPC6 activator flufenamic acid elicits an increase in [Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e in mouse brown adipocytes. Flufenamic acid (100 mM) was applied during the period indicated by the black horizontal bars\u003c/p\u003e","description":"","filename":"Figure05.png","url":"https://assets-eu.researchsquare.com/files/rs-2151625/v1/30bc62a58b1592f7737559fa.png"},{"id":27795701,"identity":"ce4930c4-93f5-4254-a16f-7ce93e69a010","added_by":"auto","created_at":"2022-10-14 18:53:51","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":307080,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe pH dependence of [Ca\u003c/strong\u003e\u003csup\u003e\u003cstrong\u003e2+\u003c/strong\u003e\u003c/sup\u003e\u003cstrong\u003e]\u003c/strong\u003e\u003csub\u003e\u003cstrong\u003ei\u003c/strong\u003e\u003c/sub\u003e\u003cstrong\u003e rises elicited by thapsigargin\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe pH dependence of SOCE by the application of 1 mM thapsigargin. (a) A reduction in pH from 7.4 to 6.8 or 7.2 led to a decrease in [Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e increase in response to 1 mM thapsigargin. (b) The effects of pH on [Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e increase due to calcium depletion in the ER. The reduction in [Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e increases proportionally to the [H\u003csup\u003e+\u003c/sup\u003e] increase in the Krebs solution. On the contrary, the application of alkaline Krebs solution at pH 7.4 enhanced [Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e and increases by the application of 1 mM thapsigargin. The abscissa is the pH of the Krebs solution, while the ordinate is [Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e in response to thapsigargin (nM). The numbers in parentheses represent the number of examples, and error bars indicate the standard error (mean ± SEM, n = 23–247). SOCE: store-operated Ca\u003csup\u003e2+\u003c/sup\u003e entry; ER: endoplasmic reticulum\u003c/p\u003e","description":"","filename":"Figure06.png","url":"https://assets-eu.researchsquare.com/files/rs-2151625/v1/dbe6f5508988992ae49be59c.png"},{"id":27795221,"identity":"b39d3911-9ca3-4996-93f2-bdf0925cdbe0","added_by":"auto","created_at":"2022-10-14 18:48:51","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":508069,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePCR-amplified products from cDNA reverse-transcribed from mRNA isolated from mouse brown adipocytes\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eOligonucleotide primers specific for seven different \u003cem\u003eTRPC\u003c/em\u003e channel subtypes in addition to \u003cem\u003eSTIM1\u003c/em\u003e and \u003cem\u003eOrai1\u003c/em\u003e were run in separate reactions, and the products were separated using agarose gel electrophoresis. The numerals on each line indicate the expected product size. Oligonucleotide primers specific for \u003cem\u003eβ-actin\u003c/em\u003ewere used as positive controls\u003c/p\u003e","description":"","filename":"Figure07.png","url":"https://assets-eu.researchsquare.com/files/rs-2151625/v1/8b6fa60728b6a99239a1043b.png"},{"id":27795700,"identity":"782fb2e8-dc04-4f19-93a2-26a4e86ed7ac","added_by":"auto","created_at":"2022-10-14 18:53:51","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":52152,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eWestern blotting analysis of the TRPC6 channel protein in mouse brown adipocyte and brain tissues\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTRPC6 channel proteins were detected in mouse brown adipocytes\u003c/p\u003e","description":"","filename":"Figure08.png","url":"https://assets-eu.researchsquare.com/files/rs-2151625/v1/5a8702eec5f0ca2dc68abf6b.png"},{"id":27795227,"identity":"22ca526b-0a51-4661-9f9d-eb0b1338509e","added_by":"auto","created_at":"2022-10-14 18:48:51","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":83967,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTRPC6 channel-activated signaling pathways and their interactions in mouse brown adipocytes\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe pathways indicated by black line arrows represent the processes directly involved in a rise in [Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e. The pathways indicated by dotted line arrows represent those that activate the processes leading to a rise in [Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e due to Ca\u003csup\u003e2+\u003c/sup\u003e depletion in the ER. Abbreviations: ER: endoplasmic reticulum; AR: adrenergic receptor; AC: adenylate cyclase; PKA: protein kinase A; cAMP: cyclic adenosine monophosphate; TG: triacylglycerol; FFA: free fatty acid; PLC: phospholipase C; DAG: diacylglycerol; IP\u003csub\u003e3\u003c/sub\u003eR: IP\u003csub\u003e3\u003c/sub\u003e receptors\u003c/p\u003e","description":"","filename":"Figure09.png","url":"https://assets-eu.researchsquare.com/files/rs-2151625/v1/4018efa090dc1e030981edfd.png"},{"id":28584714,"identity":"02472462-8b48-4939-8f92-3ff3edc29fd5","added_by":"auto","created_at":"2022-11-03 01:44:19","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1481366,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-2151625/v1/8b415e85-40e3-40ac-a29d-f39acb996a55.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Ca2+ depletion in the ER causes store-operated Ca2+ entry via the TRPC6 channel in mouse brown adipocytes","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eMitochondria and the endoplasmic reticulum (ER) operate as a Ca\u003csup\u003e2+\u003c/sup\u003e source in intracellular Ca\u003csup\u003e2+\u003c/sup\u003e dynamics, playing various roles in cell signal transduction systems [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. The ER accumulates Ca\u003csup\u003e2+\u003c/sup\u003e via sarcoplasmic/endoplasmic reticulum Ca\u003csup\u003e2+\u003c/sup\u003e ATPase (SERCA) pumps and releases Ca\u003csup\u003e2+\u003c/sup\u003e through inositol 1,4,5-trisphosphate (IP\u003csub\u003e3\u003c/sub\u003e) receptors in response to physiological stimulation [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Depletion of Ca\u003csup\u003e2+\u003c/sup\u003e in the ER due to released Ca\u003csup\u003e2+\u003c/sup\u003e through IP\u003csub\u003e3\u003c/sub\u003e receptors activates store-operated Ca\u003csup\u003e2+\u003c/sup\u003e entry (SOCE) [\u003cspan additionalcitationids=\"CR4\" citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Thus, the ER regulates the intracellular Ca\u003csup\u003e2+\u003c/sup\u003e concentration ([Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e) via Ca\u003csup\u003e2+\u003c/sup\u003e uptake, release, and entry. We have recently found that mitochondrial Ca\u003csup\u003e2+\u003c/sup\u003e released by the activation of β-adrenergic receptor activates Ca\u003csup\u003e2+\u003c/sup\u003e-induced Ca\u003csup\u003e2+\u003c/sup\u003e release (CICR) at the ER under the activation of phospholipase C (PLC) and subsequently elicits Ca\u003csup\u003e2+\u003c/sup\u003e entry into brown adipocytes [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eBrown adipocytes comprise a thermogenic organ. In low-temperature environments, sympathetic nerves release noradrenaline and activate β\u003csub\u003e3\u003c/sub\u003e-adrenergic receptors on brown adipocytes. This activation enhances the hydrolysis of triglycerides via the production of cyclic adenosine monophosphate (cAMP) and activation of protein kinase A (PKA) and hormone-dependent lipase [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. This enhances the tricarboxylic acid (TCA) cycle and electron transfer chains at the inner mitochondrial membrane, increasing the electrochemical potential for H\u003csup\u003e+\u003c/sup\u003e [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e], while free fatty acids (FFA) are produced by the activation of uncoupling protein type 1 (UCP1) [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. This uncouples oxidative phosphorylation and leads to heat production [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Conversely, noradrenaline released from the sympathetic nerve activates the α\u003csub\u003e1A\u003c/sub\u003e-adrenergic receptor and elicits a large phasic rise in [Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e via Ca\u003csup\u003e2+\u003c/sup\u003e release from the ER through the IP\u003csub\u003e3\u003c/sub\u003e receptor [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. This leads to the activation of SOCE [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. The increase in [Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e during adrenergic stimulation directly interacts with mitochondria and stimulates the rate of heat production [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eA variety of Ca\u003csup\u003e2+\u003c/sup\u003e-elevating pathways have been proposed to contribute to Ca\u003csup\u003e2+\u003c/sup\u003e homeostasis in brown adipocytes. However, the most important Ca\u003csup\u003e2+\u003c/sup\u003e influx pathway, coupled with Ca\u003csup\u003e2+\u003c/sup\u003e loss from the ER, is most likely SOCE. The SOCE pathway has been identified as a Ca\u003csup\u003e2+\u003c/sup\u003e influx pathway in various tissues, where it regulates several important physiological functions. These include cell proliferation, secretion, migration of endothelial cells, activation of T cells, and mast cell degranulation [\u003cspan additionalcitationids=\"CR21 CR22 CR23 CR24 CR25 CR26\" citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. The mechanism mediating SOCE is multifaceted and involves a plasma membrane-resident Ca\u003csup\u003e2+\u003c/sup\u003e channel called Orai1 and an ER membrane-spanning Ca\u003csup\u003e2+\u003c/sup\u003e-sensing protein called stromal interaction molecule (STIM) [\u003cspan additionalcitationids=\"CR29 CR30 CR31 CR32 CR33 CR34 CR35\" citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. The latter detects decreases in Ca\u003csup\u003e2+\u003c/sup\u003e concentration in the ER ([Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003eER\u003c/sub\u003e), which induces the oligomerization and translocation of STIM to a region near the plasma membrane where it interacts with Orai1 to generate Ca\u003csup\u003e2+\u003c/sup\u003e influx. Therefore, SOCE appears to be an appropriate Ca\u003csup\u003e2+\u003c/sup\u003e influx pathway that can be readily coupled to the decrease in [Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003eER\u003c/sub\u003e that occurs during noradrenaline-induced or mitochondrial uncoupling-induced rise in Ca\u003csup\u003e2+\u003c/sup\u003e levels in mouse brown adipocytes [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe search for channels mediating SOCE led to the identification of mammalian transient receptor potential (TRP) channels, which are non-selective cation channels that are highly permeable to Ca\u003csup\u003e2+\u003c/sup\u003e. In mammals, there are seven TRP families: TRPC (canonical), TRPV (vanilloid), TRPM (melastatin), TRPA (ankyrin), TRPP (polycystin), TRPML (mucolipin), and TRPN (Drosophila NOMPC). Among them, TRPC channels have been suggested as potential candidates for mediating SOCE in various tissues [\u003cspan additionalcitationids=\"CR38\" citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. Therefore, we aimed to determine whether activation or inhibition of TRPC channels affects SOCE and the expression of TRPC mRNA and proteins in mouse brown adipocytes. In this study, we found that SOCE in mouse brown adipocytes due to Ca\u003csup\u003e2+\u003c/sup\u003e depletion in the ER was elicited by the activation of TRPC6 channels. We discuss the underlying mechanism that allows TRPC6 to elicit Ca\u003csup\u003e2+\u003c/sup\u003e entry and the role of TRPC6 in thermogenesis.\u003c/p\u003e"},{"header":"2. Materials And Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1. Drugs\u003c/h2\u003e \u003cp\u003eCollagenase type-2 (class 2) was obtained from Worthington Biochemical (New Jersey, USA), and DNase-I was obtained from Roche Diagnostics (Indiana, USA). Dulbecco's Modified Eagle Medium (DMEM) (low glucose type, 11885-084), penicillin, and streptomycin were purchased from Applied Biosystems, Inc. (California, USA). Fetal bovine serum (FBS) was obtained from Thermo Fisher Scientific (Melbourne, Australia). Cyclopiazonic acid (CPA), ML-9, and bovine serum albumin (BSA) were obtained from Sigma-Aldrich (St. Louis, MO, USA); 2-aminoethoxydiphenyl borate (2-APB) and Flufenamic acid were purchased from Wako Pure Chemical Industries, Ltd. (Saitama, Japan); 1-oleoyl-2-acetyl-sn-glycerol (OAG) was purchased from Funakoshi Co. Ltd. (Tokyo, Japan). Primers for RT-PCR were obtained from Eurofins Genomics, Inc. (Tokyo, Japan). Fura-2 acetoxymethyl ester (Fura-2 AM) was purchased from Molecular Probes Inc. (Oregon, USA). Anti-TRPC6 antibodies and their blocking peptides were purchased from Alomone Laboratories (Jerusalem, Israel).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2. Solutions\u003c/h2\u003e \u003cp\u003eThe control Krebs Ringer solution comprised 150 mM NaCl, 5 mM KCl, 2 mM CaC1\u003csub\u003e2\u003c/sub\u003e, 0.5 mM MgCl\u003csub\u003e2\u003c/sub\u003e, 10 mM HEPES, and 5 mM glucose (pH 7.4, adjusted with NaOH). The Ca\u003csup\u003e2+\u003c/sup\u003e-free Krebs solution was prepared using isomolar Na\u003csup\u003e+\u003c/sup\u003e in the control Krebs\u0026ndash;Ringer solution. Drugs were applied by substituting the perfusing solution with a solution containing the drug(s).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3. Animals\u003c/h2\u003e \u003cp\u003eFour-week-old male C57BL/6J mice were obtained from SLC Japan (headquarters) and were kept at 25\u0026ndash;27\u0026deg;C with free access to food and water for 3\u0026ndash;5 h. At the end of the experiment, they were anesthetized with isoflurane and killed by cervical dislocation, and the interscapular brown adipose tissues were isolated.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4. Cell isolation and primary culture\u003c/h2\u003e \u003cp\u003eThe preparations and solutions were mostly similar to those described in a previous study [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Brown adipocytes were isolated by treating adipose tissues with collagenase type-2 and DNase I. The isolated adipocytes were cultured for 3\u0026ndash;5 days, supplemented with 10% FBS (Thermo Fisher Scientific), and 1% penicillin-streptomycin (GibcoTM), at 37\u0026deg;C in a humidified CO\u003csub\u003e2\u003c/sub\u003e incubator. After culturing, the adipocytes were used for Ca\u003csup\u003e2+\u003c/sup\u003e imaging.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5. Ca\u003csup\u003e2+\u003c/sup\u003e imaging and the analysis of [Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e\u003c/h2\u003e \u003cp\u003eCultured mouse brown adipocytes were loaded with Fura-2 AM (5 \u0026micro;M) and incubated for 45 min at 37\u0026deg;C. Changes in [Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e in adipocytes were measured using a conventional Ca\u003csup\u003e2+\u003c/sup\u003e-imaging system (CCD camera, ORCA-Spark, Hamamatsu photonics, Shizuoka, Japan) set on an inverted microscope (ECLIPSE Ti with an objective, 40 \u0026times; water, numerical aperture 1.15, NIKON, Tokyo, Japan). Fura-2-stained brown adipocytes were excited alternatively at 340 nm and 380 nm using an illumination system pE-300ultra (CoolLED Limited, Andover, UK) for the inverted microscope. Fura-2 fluorescence was recorded using a bandpass filter (D535/30, Chroma Technology Corp.). The fluorescence intensity was averaged over the contour of each cell using image acquisition and analysis software (HCImage, Hamamatsu Photonics) in single-cell culture experiments. The ratio of fluorescence excited at 340 nm to that at 380 nm (F340/380) was converted to the [Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e value using a dissociation constant of 145 nM, the ratio of the maximum F340/F380 to the minimum (14.1), and the fluorescence ratio of the free to the Ca-bound form (9.59).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6. RNA isolation and RT-PCR\u003c/h2\u003e \u003cp\u003eTotal RNA was extracted from brown adipose tissues isolated from 4-week-old mice under anesthesia, using the RNeasy Lipid Tissue mini kit (Qiagen, Germany). Samples were homogenized in 1 mL QIAzol (Qiagen, Germany) at 20,000 rpm using an ultrasonic homogenizer (DIAX 100, Heidolph, Germany). Next, the samples were incubated at room temperature for 5 min, 0.2 mL chloroform was added, and the samples were vortexed for 15 s. Next, the samples were centrifuged at 12,000 rpm and 4\u0026deg;C for 15 min. The upper aqueous phase was mixed with 70% ethanol and centrifuged in an RNeasy Min Spin Column (Qiagen, Germany) at 12,000 rpm and 20\u0026deg;C for 15 s to allow RNA adsorption onto the silica gel membrane. After the addition of 350 \u0026micro;L RW1 buffer, the column was centrifuged as before. DNase I (10 \u0026micro;L) was then added to the membrane to eliminate DNA contamination. The column was washed with 350 \u0026micro;L RW1 buffer and centrifuged as before. Next, the column was washed twice with 500 \u0026micro;L and finally centrifuged at 15,000 rpm for 1 min to dry the membrane. To elute the RNA, 20 \u0026micro;L RNase-free water was added to the membrane, left to stand for 2 min, and centrifuged at 15,000 rpm for 1 min. The elution step was repeated twice, the collected RNA was combined, and the samples were stored at -80\u0026deg;C.\u003c/p\u003e \u003cp\u003eReverse transcription was performed using the First-Strand cDNA Synthesis kit (SuperScript III Cells Direct cDNA Synthesis System, Invitrogen, USA) according to the manufacturer\u0026rsquo;s recommendations. The resulting cDNA was stored at -20\u0026deg;C and used for standard RT-PCR. Here, 0.5 \u0026micro;L of the cDNA reaction mixture was added to a 49.5 \u0026micro;L of the PCR reaction mixture consisting of 0.5 \u0026micro;M of each primer, PCR buffer, 2 mM MgCl\u003csub\u003e2\u003c/sub\u003e, 200 \u0026micro;M dNTP mix, and 1.25 units Taq DNA polymerase. The sense and antisense oligonucleotide primers specific for different TRPC channel subtypes are listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. Each cDNA fragment was amplified in a DNA thermal cycler (iCycler 96 well reaction module, Bio-Rad, Hercules, California, USA). The RT-PCR conditions were as follows: initial denaturation at 94\u0026deg;C for 10 min, followed by 40 cycles of denaturation at 94\u0026deg;C for 30 s, annealing at 58\u0026deg;C for 1 min, extension at 72\u0026deg;C for 30 s, and a final extension at 72\u0026deg;C for 2 min. The PCR products were electrophoresed on a 2% (w/v) agarose gel, stained with ethidium bromide (0.1 \u0026micro;g/mL), and visualized under ultraviolet illumination.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eSequences of the primer sets used for RT-PCR\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eProtein\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward primer 5ʹ-3ʹ\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse primer 5ʹ-3ʹ\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eProduct size (bp)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTRPC1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAAGATTTTGGGAAATTTCTGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTTATCCTCATGATTTGCTAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e372\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTRPC2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGATCCGGTTCATGTTCATCCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGAGCGAGCAAACTTCCACTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e327\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTRPC3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGACTTCTGTTGTCCTCAAATATG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCTTCTGCAGTCTTCTCCTCCTGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e318\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTRPC4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCTGCAGATATCTCTGGGAAGGATGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAAGCTTTGTTCGAGCAAATTTCCATTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e415\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTRPC5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATCTACTGCCTAGTACTACTGGCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCAGCATGATCGGCAATGAGCTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e340\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTRPC6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAAAGATATCTTCAAATTCATGGTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCACGTCCGCATCATCCTCAATTTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e327\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTRPC7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCGTGCTGTATGGGGTTTATTATG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCTTTGGAATGCTGTTAGAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e693\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSTIM1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGCCAAGGCTAGCTGTAACAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCAGGTGATTGTGGCGAGTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e144\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOrai1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGGTGATGAGCCTCAACGAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTAACCCTGGCGGGTAGTCAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e173\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eβ-actin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGCTGTATTCCCCTCCATCG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCAGTTGGTAACAATGCCATGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e154\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.7. Protein isolation and western blot analysis\u003c/h2\u003e \u003cp\u003eBrown adipose tissues were homogenized in 20 mM Tris buffer (pH 7.4) containing 1 mM ethylene glycol-bis(2-aminoethylether)-N,N,N,N\u0026rsquo;-tetraacetic acid (EGTA) and protease inhibitors (Roche Diagnostics, Indiana, USA) using a homogenizer (DIAX 100, Heidolph, Germany) at 15,000 rpm and 4\u0026deg;C for 1 min. Next, the samples were centrifuged at 25,000 rpm and 4\u0026deg;C for 60 min. After removing the supernatant, including the lipid fraction, the precipitate was placed in 1 mL Tris-EDTA (TE) buffer. Precipitated fractions were denatured, separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), and calibrated with pre-stained protein molecular weight markers (Bio-Rad, California, USA). The separated proteins were transferred onto nitrocellulose membranes (Hybond-C, Bio-Rad) and blocked with 5% (w/v) BSA in Tris-buffered saline (TBS) and 0.1% Tween-20 (Sigma-Aldrich, St. Louis, Missouri, USA). The nitrocellulose membranes were stained with affinity-purified rabbit polyclonal antibodies (1:500) specific for TRPC6 (Alomone Labs, Jerusalem, Israel) at 20\u0026deg;C for 1 h and then at 4\u0026deg;C overnight. After washing twice with TBS for 10 min, the membranes were stained with anti-rabbit horseradish peroxidase (HRP)-conjugated IgG (1:10,000) for 1 h. The presence of TRPC6 channel proteins was detected using an enhanced luminol-linked chemical luminescence detection system (Amersham, New Jersey, USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.8. Statistical analyses\u003c/h2\u003e \u003cp\u003eData are presented as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard error of the mean (SEM). The statistical significance of differences between the mean values was assessed using Student\u0026rsquo;s t-test. Differences were considered statistically significant for p\u0026thinsp;\u0026lt;\u0026thinsp;0.05 (*), p\u0026thinsp;\u0026lt;\u0026thinsp;0.01 (**), or p\u0026thinsp;\u0026lt;\u0026thinsp;0.001 (***).\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e3.1. Ca\u003csup\u003e2+\u003c/sup\u003e liberation from the ER by blocking the Ca\u003csup\u003e2+\u003c/sup\u003e pump activates Ca\u003csup\u003e2+\u003c/sup\u003e entry\u003c/h2\u003e \u003cp\u003eApplication of cyclopiazonic acid (CPA) (a reversible ER Ca\u003csup\u003e2+\u003c/sup\u003e pump blocker) for 1 min caused an increase in [Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e (Figure. 1). The increase in [Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e reached a plateau of 198.2\u0026thinsp;\u0026plusmn;\u0026thinsp;8.1 nM (n\u0026thinsp;=\u0026thinsp;67). The sustained high level of [Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e during the plateau could be caused by an increase in Ca\u003csup\u003e2+\u003c/sup\u003e entry into the cell membrane or a decrease in Ca\u003csup\u003e2+\u003c/sup\u003e extrusion. To identify the sources of Ca\u003csup\u003e2+\u003c/sup\u003e in CPA-induced [Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e increase, the effects of Ca\u003csup\u003e2+\u003c/sup\u003e-free Krebs solution on CPA-induced increases in [Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e were observed. When extracellular Ca\u003csup\u003e2+\u003c/sup\u003e was removed during the CPA-induced [Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e rise, the elevated level of [Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e was quickly and reversibly depressed and was much lower than the initial basal level (Figure. 1), indicating the presence of a Ca\u003csup\u003e2+\u003c/sup\u003e-entry component. The magnitude of the net reduction of the [Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e level was 216.2\u0026thinsp;\u0026plusmn;\u0026thinsp;17.2 nM (n\u0026thinsp;=\u0026thinsp;67) from the level before perfusion of the Ca\u003csup\u003e2+\u003c/sup\u003e-free Krebs solution in mouse brown adipocytes.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e3.2. Involvement of the activation of TRP channels in the CPA-induced Ca\u003csup\u003e2+\u003c/sup\u003e rise\u003c/h2\u003e \u003cp\u003eTo test the involvement of TRP channel activation in CPA-induced Ca\u003csup\u003e2+\u003c/sup\u003e entry, we recorded the effects of TRP channel blockers on the Ca\u003csup\u003e2+\u003c/sup\u003e level rise. TRP channel modulation by the application of 2-aminoethoxydiphenyl borate (2-APB) includes activation of TRPV1, TRPV2, TRPV3, TRPA1, and TRPM6 and/or inhibition of TRPM2, TRPM7, TRPC1, TRPC3, TRPC5, TRPC6, and TRPC7 [\u003cspan additionalcitationids=\"CR41 CR42 CR43 CR44\" citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. The application of 30 \u0026micro;M 2-APB inhibited the Ca\u003csup\u003e2+\u003c/sup\u003e entry evoked by 10 \u0026micro;M CPA (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). The magnitude of the net reduction in the [Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e level was 157.9\u0026thinsp;\u0026plusmn;\u0026thinsp;10.3 nM (n\u0026thinsp;=\u0026thinsp;117) from the level before perfusion of the 2-APB solution. Interestingly, in a subset of mouse brown adipocytes, we recorded the enhancement of Ca\u003csup\u003e2+\u003c/sup\u003e entry by the application of 30 \u0026micro;M 2-APB among CPA-induced Ca\u003csup\u003e2+\u003c/sup\u003e rises (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, black arrowhead). The magnitude of net elevation of the [Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e level was 50.5\u0026thinsp;\u0026plusmn;\u0026thinsp;3.2 nM (n\u0026thinsp;=\u0026thinsp;83). To further investigate which TRP channel is related to SOCE in mouse adipocytes, we examined the effects of two specific TRPC6 channel blockers, ML-9 and GsMTx-4. The ML-9 blocker is known to rapidly inhibit the TRPC6 channel and enhance the TRPC7 channel [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. The peptide GsMTx-4, isolated from the venom of the tarantula \u003cem\u003eGrammostola spatulata\u003c/em\u003e, is a selective inhibitor of stretch-activated cation channels and TRPC6 [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]. As demonstrated in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e, external application of 30 \u0026micro;M ML-9 or 10 \u0026micro;M GsMTx-4 reduced the amplitude of CPA-evoked Ca\u003csup\u003e2+\u003c/sup\u003e increases. The magnitude of the net reduction of the [Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e level due to the application of 30 \u0026micro;M ML-9 solution was 140.9\u0026thinsp;\u0026plusmn;\u0026thinsp;9.3 nM (n\u0026thinsp;=\u0026thinsp;75; Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea), while that due to the application of 10 \u0026micro;M GsMTx-4 solution was 61.6\u0026thinsp;\u0026plusmn;\u0026thinsp;4.1 nM (n\u0026thinsp;=\u0026thinsp;49; Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eb).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e3.3. TRPC6 channel analog activated Ca\u003csup\u003e2+\u003c/sup\u003e rises in mouse brown adipocytes\u003c/h2\u003e \u003cp\u003eCPA causes Ca\u003csup\u003e2+\u003c/sup\u003e entry via TRPC6 channels due to Ca\u003csup\u003e2+\u003c/sup\u003e depletion in the ER. Hence, direct activation of TRPC6 should elevate [Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e in mouse brown adipocytes. Therefore, we examined the effects of the TRPC6 channel analog, OAG, and whether TRPC6 channels are components of the CPA-induced [Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e increases. The OAG analog is a membrane-permeable diacylglycerol (DAG) derivative [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]. The extracellular application of 100 \u0026micro;M OAG induced an increase in [Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea). The magnitude of the net elevation of [Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e was 167.7\u0026thinsp;\u0026plusmn;\u0026thinsp;15.1 nM (n\u0026thinsp;=\u0026thinsp;60) from the basal level. These elevations in [Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e levels due to the application of OAG were inhibited by the application of the Ca\u003csup\u003e2+\u003c/sup\u003e-free Krebs solution (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eb). Next, we carried out experiments using the pharmacological agent flufenamic acid, which has been shown to affect the TRPC6 channel protein [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. The application of 100 \u0026micro;M flufenamic acid induced an increase in [Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). The magnitude of the net elevation of the [Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e level was 95.6\u0026thinsp;\u0026plusmn;\u0026thinsp;6.2 nM (n\u0026thinsp;=\u0026thinsp;46) from the basal level.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e3.4. H\u003csup\u003e+\u003c/sup\u003e inhibition of SOCE in mouse brown adipocytes\u003c/h2\u003e \u003cp\u003eIt is known that TRPC6 channel permeability is inhibited by low-pH conditions and enhanced by high-pH conditions [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]. Next, we tested the effects of Krebs solution on Ca\u003csup\u003e2+\u003c/sup\u003e entry mediated by store depletion in mouse brown adipocytes. Thapsigargin (1 \u0026micro;M, a non-competitive blocker of the ER Ca\u003csup\u003e2+\u003c/sup\u003e pump) applied for 5 min caused a mono- or biphasic rise in [Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ea). The increased [Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e levels reached a peak within 10 min and slowly declined over several tens of minutes to a plateau. These increases were inhibited by bath application of a low-pH Krebs solution. Decreasing the extracellular pH from 7.4 to 6.8 or 7.2 during Ca\u003csup\u003e2+\u003c/sup\u003e entry elicited by thapsigargin led to significant decreases. Responses occurred immediately after changing the extracellular pH, and reversibly upon returning to the standard Krebs solution (pH 7.4). Next, we examined intermediate pH values between pH 6.8 and 7.6. The data are summarized in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eb. The [Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e under the application of thapsigargin were 346.0\u0026thinsp;\u0026plusmn;\u0026thinsp;5.6 nM at pH 7.4 (n\u0026thinsp;=\u0026thinsp;247), 219.1\u0026thinsp;\u0026plusmn;\u0026thinsp;12.2 nM at pH 6.8 (n\u0026thinsp;=\u0026thinsp;23, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001 compared with pH 7.4), 247.4\u0026thinsp;\u0026plusmn;\u0026thinsp;6.0 nM at pH 7.0 (n\u0026thinsp;=\u0026thinsp;119, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001 compared with pH 7.4), 281.0\u0026thinsp;\u0026plusmn;\u0026thinsp;7.6 nM at pH 7.2 (n\u0026thinsp;=\u0026thinsp;98, p\u0026thinsp;\u0026lt;\u0026thinsp;0.01 compared with pH 7.4), and 370.3\u0026thinsp;\u0026plusmn;\u0026thinsp;9.7 nM at pH 7.6 (n\u0026thinsp;=\u0026thinsp;65, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05 compared with pH 7.4). Decreasing the extracellular pH from 7.4 to 6.8\u0026ndash;7.2 led to the inhibition of Ca\u003csup\u003e2+\u003c/sup\u003e entry elicited by the application of thapsigargin in a pH-dependent manner.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e3.5. Expression of TRPC family members\u003c/h2\u003e \u003cp\u003eFurther experiments were conducted to confirm which TRPC channels were expressed in brown adipocytes. We classified TRPC subtypes expressed on mouse brown adipocytes using excised brown fat tissue to eliminate other tissues such as muscle and neurons by RT-PCR. Four of the seven TRPC subtypes were successfully amplified from the cDNA using the primer sets (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e). These subtypes expressed were \u003cem\u003eTRPC1\u003c/em\u003e, \u003cem\u003eTRPC2\u003c/em\u003e, \u003cem\u003eTRPC3\u003c/em\u003e, and \u003cem\u003eTRPC6\u003c/em\u003e. The detection of the \u003cem\u003eTRPC6\u003c/em\u003e subtype mRNA in brown adipocytes agreed with our Ca\u003csup\u003e2+\u003c/sup\u003e imaging analysis. Moreover, we detected the expression of \u003cem\u003eSTIM1\u003c/em\u003e and \u003cem\u003eOrai1\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eWestern blotting results revealed the presence of TRPC6 in the mouse brown adipocytes (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e). To determine whether these bands were specific, blocking experiments were performed using control antigen peptides. Before proceeding with the staining protocol, the antibody specific for TRPC6 was incubated with an excess of the control antigen peptide that corresponded to the epitope recognized by the antibody. The antibody bound to the control antigen peptide was not available to bind to the epitope present in the TRPC6 channel protein by western blotting (data not shown).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eThe present study shows that mouse brown adipocytes functionally express TRPC6 and partake in SOCE. In Ca\u003csup\u003e2+\u003c/sup\u003e-imaging studies, CPA evoked Ca\u003csup\u003e2+\u003c/sup\u003e rises, and the removal of external Ca\u003csup\u003e2+\u003c/sup\u003e by the application of Ca\u003csup\u003e2+\u003c/sup\u003e-free Krebs solution completely inhibited Ca\u003csup\u003e2+\u003c/sup\u003e entry elicited by CPA. These results indicate that brown adipocytes have a mechanism for SOCE. These results agree with those of previous studies [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Here, we showed that the Ca\u003csup\u003e2+\u003c/sup\u003e rise elicited by CPA was initially enhanced by the application of 2-APB, after which the continuous application of 2-APB reduced the Ca\u003csup\u003e2+\u003c/sup\u003e rise (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). We observed two types of reactions by the application of 2-APB: the components of Ca\u003csup\u003e2+\u003c/sup\u003e increase and decrease; 2-APB is known not only as a blocker of TRPM2, TRPM7, TRPC1, TRPC3, TRPC5, TRPC6, and TRPC7, but also as an activator of TRPA1, TRPV1, TRPV2, and TRPV3 channels [\u003cspan additionalcitationids=\"CR41 CR42 CR43 CR44\" citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. These results suggest that mouse brown adipocytes express at least two types of TRP channels. Bishnoi et al. (2013), Sun et al. (2016) and Uchida et al. (2017) reported that TRPV2 expressed in brown adipocytes contributed to differentiation and thermogenesis [\u003cspan additionalcitationids=\"CR56 CR57\" citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e]. The components of Ca\u003csup\u003e2+\u003c/sup\u003e rise elicited by 2-APB may consist of the activation of TRPV2 and the components of reduction elicited by 2-APB consist of the activation of TRPC6.\u003c/p\u003e \u003cp\u003eCa\u003csup\u003e2+\u003c/sup\u003e imaging also showed that the application of OAG, a DAG analog, evoked Ca\u003csup\u003e2+\u003c/sup\u003e increases in mouse brown adipocytes. It is known that mouse brown adipocytes express the α\u003csub\u003e1A\u003c/sub\u003e-adrenergic receptor, which couples with the Gq protein. The activation of the Gq protein promotes phospholipase C (PLC) activity, which in turn generates DAG and IP\u003csub\u003e3\u003c/sub\u003e. The latter mobilizes Ca\u003csup\u003e2+\u003c/sup\u003e from the ER, leading to Ca\u003csup\u003e2+\u003c/sup\u003e loss in the ER and the activation of TRPC6 and Ca\u003csup\u003e2+\u003c/sup\u003e entry. Simultaneously, DAG produced by PLC activation can directly gate TRPC6. The results shown in this experiment indicate that TRPC6 functions not only as a SOCE channel but also as a non-capacitive Ca\u003csup\u003e2+\u003c/sup\u003e entry channel.\u003c/p\u003e \u003cp\u003eRT-PCR and western blotting experiments revealed the expression of TRPC6 in mouse brown adipocytes. These results agree with those of the Ca\u003csup\u003e2+\u003c/sup\u003e-imaging studies. The RT-PCR results also showed the expression of \u003cem\u003eTRPC1\u003c/em\u003e, \u003cem\u003eTRPC2\u003c/em\u003e, and \u003cem\u003eTRPC3\u003c/em\u003e suggesting the expression of other TRPC channel subtypes. Wolfrum et al. (2018) showed that TRPC1 was expressed in cultured brown adipocytes, which led to the downregulation of several metabolic genes, including \u003cem\u003eUCP1\u003c/em\u003e and \u003cem\u003ePPARγ\u003c/em\u003e, as well as upregulation of the BAT-specific thermosensitive channel \u003cem\u003eTRPV2\u003c/em\u003e, ultimately resulting in impaired respiratory function [\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e]. TRPC1 activation may also induce Ca\u003csup\u003e2+\u003c/sup\u003e entry into mouse brown adipocytes. RT-PCR results also revealed the expression of \u003cem\u003eSTIM1\u003c/em\u003e and \u003cem\u003eOrai1\u003c/em\u003e in mouse brown adipocytes. The Orai1 protein is located in the plasma membrane that forms an ion-conducting pore. Orai1 channels are activated by STIM 1 and STIM2 located in the ER when Ca\u003csup\u003e2+\u003c/sup\u003e ions are depleted in the ER. Orai1 may also function as a SOCE channel activated by the depletion of Ca\u003csup\u003e2+\u003c/sup\u003e in the ER of mouse brown adipocytes. Further studies are required to confirm the expression and function of these genes.\u003c/p\u003e \u003cp\u003eFigure \u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003e illustrates the likely mechanism of the Ca\u003csup\u003e2+\u003c/sup\u003e response by the activation of TRPC6 under physiological conditions. Under cold exposure, noradrenaline released from sympathetic nerves activates the α\u003csub\u003e1A\u003c/sub\u003e adrenoreceptor, which elicits a large phasic rise in [Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e via Ca\u003csup\u003e2+\u003c/sup\u003e release from the ER through the IP\u003csub\u003e3\u003c/sub\u003e receptors. In addition, noradrenaline released from the sympathetic nerves activates the β\u003csub\u003e3\u003c/sub\u003e subtypes of the adrenergic receptors. The activation of β\u003csub\u003e3\u003c/sub\u003e-adrenoreceptor by noradrenaline leads to lipid hydrolysis by the activation of hormone-dependent lipase via the activation of PKA. β-oxidation of free fatty acids enhances the TCA cycle and the electrochemical potential for H\u003csup\u003e+\u003c/sup\u003e across the inner mitochondrial membrane by the production of NADH and FADH\u003csub\u003e2\u003c/sub\u003e via the activation of Ca\u003csup\u003e2+\u003c/sup\u003e-dependent dehydrogenases. However, the activation of UCP1 by free fatty acids forms proton pathways that lead to the collapse of mitochondrial membrane potential and an increase in Ca\u003csup\u003e2+\u003c/sup\u003e concentrations in the mitochondria via matrix acidification. This causes mitochondrial Ca\u003csup\u003e2+\u003c/sup\u003e release [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. The Ca\u003csup\u003e2+\u003c/sup\u003e released from the mitochondria further elicits Ca\u003csup\u003e2+\u003c/sup\u003e-induced Ca\u003csup\u003e2+\u003c/sup\u003e-release from the ER via IP\u003csub\u003e3\u003c/sub\u003e receptor under the action of IP\u003csub\u003e3\u003c/sub\u003e produced by PLC activation and subsequently activates SOCE via TRPC6. Thus, brown adipocytes would be enabled to sustain long-lasting [Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e rises due to these modes of sequential activation of Ca\u003csup\u003e2+\u003c/sup\u003e releases from the mitochondria and the ER and Ca\u003csup\u003e2+\u003c/sup\u003e entries elicited by adrenergic activation.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eIt is known that intracellular Ca\u003csup\u003e2+\u003c/sup\u003e enhances thermogenesis and oxygen consumption in brown adipocytes [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. In this study, we demonstrated Ca\u003csup\u003e2+\u003c/sup\u003e responses by the activation of TRPC6. Interestingly, TRPC6 channels are known to be mechano-sensitive [\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e]. Indeed, we observe that the [Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e rises, in response to mechanical stimulation by the water pressure application of normal Krebs solution on cultured mouse brown adipocytes (unpublished observation). These results indicate that TRPC6 channels may be involved in not only non-shivering but also shivering thermogenesis in brown adipocyte. We assume that Ca\u003csup\u003e2+\u003c/sup\u003e entry via TRPC6 contributes to heat production in mouse brown adipocytes. On this basis, future efforts should be taken to characterize TRPC6 channels as a mechanical sensor and to study it\u0026rsquo;s contributes in the thermogenesis of the mouse brown adipocytes.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eConflict of Interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors have no conflicts of interest directly relevant to the content of this article.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe thank M. Ishikawa, Y Sakagami, S. Sasaki, A. Takao, E. Tachi, S. Nakao, H. Nakanishi, and C. Yoshimura for their assistance with the experiments.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors contributed to the study conception and design. Material preparation, data collection and analysis were performed by Ryotaro Hayato and Takaya Matsumoto. The first draft of the manuscript was written by Ryotaro Hayato, and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthical Approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll experiments were performed following the guiding principles for the care and use of Animals in the Field of Physiological Sciences and were approved by the Council of the Physiological Society of Japan and the Animal Institutional Review Board of Nagoya University of Arts and Sciences (Approval Code Number: No. 82\u003cstrong\u003e).\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by JSPS KAKENHI Grant Number 21K12674 awarded to Ryotaro Hayato.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data that support the findings of this study are available on request from the corresponding author. The data are not publicly available due to the large amount of data.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eCarafoli E (1987) Intracellular calcium homeostasis. Annu Rev Biochem 56: 395\u0026ndash;433. doi: 10.1146/annurev.bi.56.070187.002143\u003c/li\u003e\n\u003cli\u003eBerridge MJ (1993) Inositol trisphophate and calcium signalling. Nature 361: 315\u0026ndash;325. doi: 10.1038/361315a0\u003c/li\u003e\n\u003cli\u003eHoth M, Penner R (1992) Depletion of intracellular calcium stores activates a calcium current in mast cells. Nature 355: 353\u0026ndash;356. doi: 10.1038/355353a0\u003c/li\u003e\n\u003cli\u003eParekh AB (2003) Store-operated Ca\u003csup\u003e2+\u003c/sup\u003e entry: dynamic interplay between endoplasmic reticulum, mitochondria, and plasma membrane. J Physiol 547: 333\u0026ndash;348. doi: 10.1113/jphysiol.2002.034140\u003c/li\u003e\n\u003cli\u003ePutney Jr JW (1986) A model for receptor-regulated calcium entry. Cell Calcium 7: 1\u0026ndash;12. doi: 10.1016/0143-4160(86)90026-6\u003c/li\u003e\n\u003cli\u003eHayato R, Higure Y, Kuba M, Nagai H, Yamashita H, Kuba K (2011) b3-Adrenergic activation of sequential Ca\u003csup\u003e2+\u003c/sup\u003e release from mitochondria and the endoplasmic reticulum and the subsequent Ca\u003csup\u003e2+\u003c/sup\u003e entry in rodent brown adipocytes. Cell Calcium 49:400\u0026ndash;414. doi: 10.1016/j.ceca.2011.02.011.\u003c/li\u003e\n\u003cli\u003eZhao J, Cannon B, Nedergaard J (1998) Thermogenesis is b3- but not b1-adrenergically mediated in rat brown fat cells, even after cold acclimation. Am J Physiol Regul Integr Comp Physiol 275: R2002\u0026ndash;R2011. doi: 10.1152/ajpregu.1998.275.6.R2002.\u003c/li\u003e\n\u003cli\u003eGranneman JG (1990) Norepinephrine and BRL37344 stimulate adenylate cyclase by different receptors in rat brown adipose tissue. J Pharmacol Exp Ther 254:508\u0026ndash;513. \u003c/li\u003e\n\u003cli\u003eNicholls DG, Locke RM (1984) Thermogenic mechanisms in brown fat. Physiol Rev 64:1\u0026ndash;64. doi: 10.1152/physrev.1984.64.1.1.\u003c/li\u003e\n\u003cli\u003eTrayhurn P (1989) Brown adipose tissue and nutritional energetics - where are we now? Proc Nutr Soc 48:165\u0026ndash;175. doi: 10.1079/pns19890026.\u003c/li\u003e\n\u003cli\u003eKlingenberg M, Huang SG (1999) Structure and function of the uncoupling protein from brown adipose tissue. Biochim. Biophys. Acta 1415:271\u0026ndash;296. doi: 10.1016/s0005-2736(98)00232-6.\u003c/li\u003e\n\u003cli\u003eLowell BB, Spiegelman BM (2000) Towards a molecular understanding of adaptive thermogenesis. Nature 404:652\u0026ndash;660. doi: 10.1038/35007527.\u003c/li\u003e\n\u003cli\u003eRicquier D, Bouillaud F (2000) Mitochondrial uncoupling proteins: from mitochondria to the regulation of energy balance. J. Physiol. 529: 3\u0026ndash;10. doi: 10.1111/j.1469-7793.2000.00003.x.\u003c/li\u003e\n\u003cli\u003eLee SC, Nuccitelli R, Pappone PA (1993) Adrenergically activated Ca\u003csup\u003e2+\u003c/sup\u003e increases in brown fat cells: effects of Ca\u003csup\u003e2+\u003c/sup\u003e, K\u003csup\u003e+\u003c/sup\u003e, and K channel block. Am J Physiol 264:C217\u0026ndash;C228. doi: 10.1152/ajpcell.1993.264.1.C217.\u003c/li\u003e\n\u003cli\u003eN\u0026aring;nberg E, Putney J Jr (1986) Alpha1-adrenergic activation of brown adipocytes leads to an increased formation of inositol polyphosphates. FEBS Lett. 195:319\u0026ndash;322. doi: 10.1016/0014-5793(86)80185-5.\u003c/li\u003e\n\u003cli\u003eOmatsu-Kanbe M, Matsuura H (1999) Inhibition of store-operated Ca\u003csup\u003e2+\u003c/sup\u003e entry by extracellular ATP in rat brown adipocytes. J Physiol 521:601\u0026ndash;615. doi: 10.1111/j.1469-7793.1999.00601.x.\u003c/li\u003e\n\u003cli\u003eKuba M, Higure Y, Susaki H, Hayato R, Kuba K (2007) Bidirectional Ca\u003csup\u003e2+\u003c/sup\u003e coupling of mitochondria with the endoplasmic reticulum and regulation of multimodal Ca\u003csup\u003e2+\u003c/sup\u003e entries in rat brown adipocytes. Am J Physiol Cell Physiol 292:C896\u0026ndash;C908. doi: 10.1152/ajpcell.00649.2005.\u003c/li\u003e\n\u003cli\u003ede Meis L, Ketzer LA, da Costa RM, de Andrade IR, Marlene Benchimol M. (2010) Fusion of the endoplasmic reticulum and mitochondrial outer membrane in rats brown adipose tissue: activation of thermogenesis by Ca\u003csup\u003e2+\u003c/sup\u003e PLoS One 5:e9439. doi: 10.1371/journal.pone.0009439.\u003c/li\u003e\n\u003cli\u003eGuarnieri AR, Benson TW, Tranter M. (2022) Calcium cycling as a mediator of thermogenic metabolism in adipose tissue. Mol Pharmacol 102:51\u0026ndash;59. doi: 10.1124/molpharm.121.000465.\u003c/li\u003e\n\u003cli\u003eChen YW, Smith ML, Chiou GX, Ballaron S, Sheets MP, Gubbins E, Warrior U, Wilkins J, Surowy C, Nakane M, Carter GW, Trevillyan JM, Mollison K, Djuric SW (2002) TH1 and TH2 cytokine inhibition by 3,5-bis(trifluoromethyl)pyrazoles, a novel class of immunomodulators. Cell Immunol 220:134\u0026ndash;142. doi: 10.1016/s0008-8749(03)00005-4.\u003c/li\u003e\n\u003cli\u003eYang S, Zhang JJ, Huang XY (2009) Orai1 and STIM1 are critical for breast tumor cell migration and metastasis. Cancer Cell 15:124\u0026ndash;134. doi: 10.1016/j.ccr.2008.12.019.\u003c/li\u003e\n\u003cli\u003eMatthews G, Neher E, Penner R (1989) Second messenger-activated calcium influx in rat peritoneal mast cells. J Physiol 418:105\u0026ndash;130. doi: 10.1113/jphysiol.1989.sp017830.\u003c/li\u003e\n\u003cli\u003ePenner R, Matthews G, Neher E (1988) Regulation of calcium influx by second messengers in rat mast cells. Nature 334:499\u0026ndash;504. doi: 10.1038/334499a0.\u003c/li\u003e\n\u003cli\u003eBaba Y, Nishida K, Fujii Y, Hirano T, Hikida M, Kurosaki T (2008) Essential function for the calcium sensor STIM1 in mast cell activation and anaphylactic responses. Nat Immunol 9:81\u0026ndash;88. doi: 10.1038/ni1546.\u003c/li\u003e\n\u003cli\u003eBeyersdorf N, Braun A, V\u0026ouml;gtle T, Varga-Szabo D, Galdos RR, Kissler S, Kerkau T, Nieswandt B (2009) STIM1-independent T cell development and effector function \u003cem\u003ein vivo\u003c/em\u003e. J Immunol 182:3390\u0026ndash;3397. doi: 10.4049/jimmunol.0802888.\u003c/li\u003e\n\u003cli\u003eBraun A, Gessner JE, Varga-Szabo D, Syed SN, Konrad S, Stegner D, V\u0026ouml;gtle T, Schmidt RE, Nieswandt B (2009) STIM1 is essential for Fcgamma receptor activation and autoimmune inflammation. Blood 113:1097\u0026ndash;1104. doi: 10.1182/blood-2008-05-158477.\u003c/li\u003e\n\u003cli\u003eOh-Hora M, Yamashita M, Hogan PG, Sharma S, Lamperti E, Chung W, Prakriya M, Feske S, Rao A (2008) Dual functions for the endoplasmic reticulum calcium sensors STIM1 and STIM2 in T cell activation and tolerance. Nat Immunol 9:432\u0026ndash;443. doi: 10.1038/ni1574. \u003c/li\u003e\n\u003cli\u003eLiou J, Kim ML, Heo WD, Jones JT, Myers JW, Ferrell JE \u0026amp; Meyer T (2005) STIM is a Ca\u003csup\u003e2+\u003c/sup\u003e sensor essential for Ca\u003csup\u003e2+\u003c/sup\u003e-store-depletion-triggered Ca\u003csup\u003e2+\u003c/sup\u003e influx. Curr Biol 15:1235\u0026ndash;1241. doi: 10.1016/j.cub.2005.05.055.\u003c/li\u003e\n\u003cli\u003eRoos J, DiGregorio PJ, Yeromin AV, Ohlsen K, Lioudyno M, Zhang S, Safrina O, Kozak JA, Wagner SL, Cahalan MD, Veli\u0026ccedil;elebi G, Stauderman KA (2005) STIM1, an essential and conserved component of store-operated Ca\u003csup\u003e2+\u003c/sup\u003e channel function. J Cell Biol 169:435\u0026ndash;445. doi: 10.1083/jcb.200502019\u003c/li\u003e\n\u003cli\u003eFeske S, Gwack Y, Prakriya M, Srikanth S, Puppel SH, Tanasa B, Hogan PG, Lewis RS, Daly M, Rao A. (2006) A mutation in Orai1 causes immune deficiency by abrogating CRAC channel function. Nature 441:179\u0026ndash;185. doi: 10.1038/nature04702.\u003c/li\u003e\n\u003cli\u003eSoboloff J, Rothberg BS, Madesh M \u0026amp; Gill DL (2012) STIM proteins: dynamic calcium signal transducers. Nat Rev Mol Cell Biol 13:549\u0026ndash;565. doi: 10.1038/nrm3414.\u003c/li\u003e\n\u003cli\u003eJairaman A, Prakriya M (2013) Molecular pharmacology of store-operated CRAC channels. Channels (Austin) 7:402\u0026ndash;414. doi: 10.4161/chan.25292.\u003c/li\u003e\n\u003cli\u003eBaba Y, Matsumoto M \u0026amp; Kurosaki T (2014) Calcium signaling in B cells: regulation of cytosolic Ca\u003csup\u003e2+\u003c/sup\u003e increase and its sensor molecules, STIM1 and STIM2. Mol Immunol 62:339\u0026ndash;343. doi: 10.1016/j.molimm.2013.10.006.\u003c/li\u003e\n\u003cli\u003ePrakriya M, Lewis RS (2015) Store-operated calcium channels. Physiol Rev 95:1383\u0026ndash;1436.\u003c/li\u003e\n\u003cli\u003eSteinckwich N, Myers P, Janardhan KS, Flagler ND, King D, Petranka JG, Putney JW (2015) Role of the store-operated calcium entry protein, STIM1, in neutrophil chemotaxis and infiltration into a murine model of psoriasis-inflamed skin. FASEB J 29:3003\u0026ndash;3013. doi: 10.1096/fj.14-265215.\u003c/li\u003e\n\u003cli\u003eLewis RS (2007) The molecular choreography of a store-operated calcium channel. Nature 446:284\u0026ndash;287. doi: 10.1038/nature05637.\u003c/li\u003e\n\u003cli\u003eLu W, Wang J, Shimoda LA, Sylvester JT (2008) Differences in STIM1 and TRPC expression in proximal and distal pulmonary arterial smooth muscle are associated with differences in Ca\u003csup\u003e2+\u003c/sup\u003e responses to hypoxia. Am J Physiol Lung Cell Mol Physiol 295:L104\u0026ndash;L113. doi: 10.1152/ajplung.00058.2008.\u003c/li\u003e\n\u003cli\u003eWang J, Weigand L, Lu W, Sylvester JT, Semenza GL, Shimoda LA (2006) Hypoxia inducible factor 1 mediates hypoxia-induced TRPC expression and elevated intracellular Ca\u003csup\u003e2+\u003c/sup\u003e in pulmonary arterial smooth muscle cells. Circ Res 98:1528\u0026ndash; 1537. doi: 10.1161/01.RES.0000227551.68124.98.\u003c/li\u003e\n\u003cli\u003eTrebak M, Bird GS, McKay RR, Putney JW Jr (2002) Comparison of human TRPC3 channels in receptor-activated and store-operated modes. Differential sensitivity to channel blockers suggests fundamental differences in channel composition. J Biol Chem 277:21617\u0026ndash;21623. doi: 10.1074/jbc.M202549200.\u003c/li\u003e\n\u003cli\u003eHu HZ, Gu Q, Wang C, Colton CK, Tang J, Kinoshita-Kawada M, Lee LY, Wood JD, Zhu MX (2004) 2-aminoethoxydiphenyl borate is a common activator of TRPV1, TRPV2, and TRPV3. J Biol Chem 279:35741\u0026ndash;35748. doi: 10.1074/jbc.M404164200.\u003c/li\u003e\n\u003cli\u003eChung MK, Lee H, Mizuno A, Suzuki M, Caterina MJ (2004) 2-aminoethoxydiphenyl borate activates and sensitizes the heat-gated ion channel TRPV3. J Neurosci 24:5177\u0026ndash;5182. doi: 10.1523/JNEUROSCI.0934-04.2004.\u003c/li\u003e\n\u003cli\u003eTogashi K, Inada H, Tominaga M (2008) Inhibition of the transient receptor potential cation channel TRPM2 by 2-aminoethoxydiphenyl borate (2-APB). Br J Pharmacol 153:1324\u0026ndash;1330. doi: 10.1038/sj.bjp.0707675.\u003c/li\u003e\n\u003cli\u003eChokshi R, Fruasaha P, Kozak JA (2012) 2-Aminoethyl diphenyl borinate (2-APB) inhibits TRPM7 channels through an intracellular acidification mechanism. Channels. 6:362\u0026ndash;369. doi: 10.4161/chan.21628.\u003c/li\u003e\n\u003cli\u003eLievremont JP, Bird GS, Putney JW Jr (2005) Mechanism of inhibition of TRPC cation channels by 2-aminoethoxydiphenylborane. Mol Pharmacol. 68:758\u0026ndash;762. doi: 10.1124/mol.105.012856.\u003c/li\u003e\n\u003cli\u003eXu SZ, Zeng F, Boulay G, Grimm C, Harteneck C, Beech DJ (2005) Block of TRPC5 channels by 2-aminoethoxydiphenyl borate: a differential, extracellular and voltage-dependent effect. Br J Pharmacol 145:405\u0026ndash;414. doi: 10.1038/sj.bjp.0706197.\u003c/li\u003e\n\u003cli\u003eJ Shi J, Takahashi S, X-H Jin XH, Li YQ, Ito Y, Mori Y, Inoue R (2007) Myosin light chain kinase-independent inhibition by ML-9 of murine TRPC6 channels expressed in HEK293 cells. Br J Pharmacol 152:122\u0026ndash;131. doi: 10.1038/sj.bjp.0707368.\u003c/li\u003e\n\u003cli\u003eSpassova MA, Hewavitharana T, Xu W, Soboloff J, Gill DL (2006) A common mechanism underlies stretch activation and receptor activation of TRPC6 channels. Proc Natl Acad Sci USA 103:16586\u0026ndash;16591. doi: 10.1073/pnas.0606894103.\u003c/li\u003e\n\u003cli\u003eHofmann T, Obukhov AG, Schaefer M, Harteneck C, Gudermann T, Schultz G (1999) Direct activation of human TRPC6 and TRPC3 channels by diacylglycerol. Nature 397:259\u0026ndash;263. doi: 10.1038/16711.\u003c/li\u003e\n\u003cli\u003eInoue R, Okada T, Onoue H, Hara Y, Shimizu S, Naitoh S, Ito Y, Mori Y (2001) The Transient Receptor Potential Protein Homologue TRP6 Is the Essential Component of Vascular alpha1-adrenoceptor\u0026ndash;activated Ca\u003csup\u003e2+\u003c/sup\u003e-Permeable Cation Channel. Circ Res 88:325\u0026ndash;332. doi: 10.1161/01.res.88.3.325.\u003c/li\u003e\n\u003cli\u003eSemtner S, Schaefer M, Pinkenburg O, Plant TD (2007) Potentiation of TRPC5 by protons. J Biol Chem 282:33868\u0026ndash;33878. doi: 10.1074/jbc.M702577200.\u003c/li\u003e\n\u003cli\u003eYeromin AV, Zhang SL, Jiang W, Yu Y, Safrina O, Cahalan MD (2006) Molecular identification of the CRAC channel by altered ion selectivity in a mutant of Orai. Nature 443:226\u0026ndash;229. doi: 10.1038/nature05108. \u003c/li\u003e\n\u003cli\u003eLuik RM, Wu MM, Buchanan J, Lewis RS (2006) The elementary unit of store-operated Ca\u003csup\u003e2+\u003c/sup\u003e entry: Local activation of CRAC channels by STIM1 at ER-plasma membrane junctions. J Cell Biol 174:815\u0026ndash;825. doi: 10.1083/jcb.200604015.\u003c/li\u003e\n\u003cli\u003eVig M, Beck A, Billingsley JM, Lis A, Parvez S, Peinelt C, Koomoa DL, Sobolo J, Gill DL, Fleig A, Kinet JP, Pnner R (2006) CRACM1 multimers form the ion-selective pore of the CRAC channel. Curr Biol 16:2073\u0026ndash;2079. doi: 10.1016/j.cub.2006.08.085.\u003c/li\u003e\n\u003cli\u003ePrakriya M, Feske S, Gwack Y, Srikanth S, Rao A, Hogan PG (2006) Orai1 is an essential pore subunit of the CRAC channel. Nature 443:230\u0026ndash;233. doi: 10.1038/nature05122.\u003c/li\u003e\n\u003cli\u003eBishnoi M, Kondepudi KK, Gupta A, Karmase A, Boparai RK (2013) Expression of multiple Transient Receptor Potential channel genes in murine 3T3-L1 cell lines and adipose tissue. Pharmacol Rep 65:751\u0026ndash;755. doi: 10.1016/s1734-1140(13)71055-7.\u003c/li\u003e\n\u003cli\u003eSun W, Uchida K, Suzuki Y, Zhou Y, Kim M, Takayama Y, Takahashi N, Goto T, Wakabayashi S, Kawada T, Iwata Y, Tominaga M (2016) Lack of TRPV2 impairs thermogenesis in mouse brown adipose tissue. EMBO Rep 17:383\u0026ndash;399. doi: 10.15252/embr.201540819.\u003c/li\u003e\n\u003cli\u003eSun W, Uchida K, Takahashi N, Iwata Y, Wakabayashi S, Goto T, Kawada T, Tominaga M (2016) Activation of TRPV2 negatively regulates the differentiation of mouse brown adipocytes. Pflugers Arch. 468:1527\u0026ndash;1540. doi: 10.1007/s00424-016-1846-1.\u003c/li\u003e\n\u003cli\u003eUchida K, Dezaki K, Yoneshiro T, Watanabe T, Yamazaki T, Saito M, Yoda T, Tominaga M, Iwasaki Y (2017) Involvement of thermosensitive TRP channels in energy metabolism. J Physiol Sci 67:549\u0026ndash;560. doi: 10.1007/s12576-017-0552-x.\u003c/li\u003e\n\u003cli\u003eWolfrum C, Kiehlmann E, Pelczar P (2018) TRPC1 regulates brown adipose tissue activity in a PPAR\u0026gamma;-dependent manner. Am J Physiol Endocrinol Metab 315:E825\u0026ndash;E832. doi: 10.1152/ajpendo.00170.2017.\u003c/li\u003e\n\u003cli\u003eGottlieb P, Folgering J, Maroto R, Raso A, Wood TG, Kurosky A, Bowman C, Bichet D, Patel A, Sachs F, Martinac B, Hamill OP, Honor\u0026eacute; E (2008) Revisiting TRPC1 and TRPC6 mechanosensitivity. Pfl\u0026uuml;gers Archiv-Eur. J. Physiol 455:1097\u0026ndash;1103. doi: 10.1007/s00424-007-0359-3\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"brown adipocytes, endoplasmic reticulum, mitochondria, transient receptor potential canonical 6 (TRPC6), Ca2+ signaling, thermogenesis","lastPublishedDoi":"10.21203/rs.3.rs-2151625/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-2151625/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eMitochondrial uncoupling by β\u003csub\u003e3\u003c/sub\u003e-adrenergic activation or an uncoupler (FCCP) causes Ca\u003csup\u003e2+\u003c/sup\u003e release from the mitochondria and subsequent Ca\u003csup\u003e2+\u003c/sup\u003e release from the endoplasmic reticulum (ER), evoking store-operated Ca\u003csup\u003e2+\u003c/sup\u003e entry (SOCE) due to Ca\u003csup\u003e2+\u003c/sup\u003e depletion from the ER in rodent brown adipocytes. In this study, we investigated how Ca\u003csup\u003e2+\u003c/sup\u003e depletion from the ER elicits SOCE in mouse brown adipocytes using fluorometry of intracellular Ca\u003csup\u003e2+\u003c/sup\u003e concentration ([Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e). The application of cyclopiazonic acid (CPA), a reversible sarcoplasmic/endoplasmic reticulum calcium ATPase (SERCA) pump blocker in the ER, caused an increase in [Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e. Moreover, CPA-induced SOCE was suppressed by the application of a Ca\u003csup\u003e2+\u003c/sup\u003e-free Krebs solution and the transient receptor potential canonical 6 (TRPC6) blockers, which were 2-aminoethoxydiphenyl borate (2-APB), ML-9, and GsMTx-4. Application of TRPC6 channel analog 1-oleoyl-2-acetyl-sn-glycerol (OAG) and flufenamic acid elicited Ca\u003csup\u003e2+\u003c/sup\u003e entry. Moreover, our RT-PCR analyses detected mRNAs for TRPC6, STIM1, and Orai1 in brown adipose tissues. In addition, western blot analyses showed the expression of the TRPC6 protein. Thus, TRPC6 is one of the Ca\u003csup\u003e2+\u003c/sup\u003e pathways involved in SOCE, and Ca\u003csup\u003e2+\u003c/sup\u003e entry is directly linked to mitochondrial uncoupling, which is involved in the late phase of β\u003csub\u003e3\u003c/sub\u003e-adrenergic or FCCP-induced [Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e increases. These modes of Ca\u003csup\u003e2+\u003c/sup\u003e entry provide the basis for heat production via activation of Ca\u003csup\u003e2+\u003c/sup\u003e-dependent dehydrogenase and the expression of uncoupling protein 1 (UCP1) proteins. Enhancing thermogenic metabolism in brown adipocytes may serve as broad therapeutic utility to reduce obesity and metabolic syndrome.\u003c/p\u003e","manuscriptTitle":"Ca2+ depletion in the ER causes store-operated Ca2+ entry via the TRPC6 channel in mouse brown adipocytes","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2022-10-14 18:48:49","doi":"10.21203/rs.3.rs-2151625/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"f26d663c-d39a-4fc4-9a8c-45093aa49164","owner":[],"postedDate":"October 14th, 2022","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2022-11-03T01:44:11+00:00","versionOfRecord":[],"versionCreatedAt":"2022-10-14 18:48:49","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-2151625","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-2151625","identity":"rs-2151625","version":["v1"]},"buildId":"7rjqhiLT3MXkJMwkYKINL","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}