CAF-related miR-642a-3p supports the migration, invasion, and EMT of hepatocellular carcinoma by targeting SERPINE1

CAF-related miR-642a-3p supports the migration, invasion, and EMT of hepatocellular carcinoma by targeting SERPINE1 | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article CAF-related miR-642a-3p supports the migration, invasion, and EMT of hepatocellular carcinoma by targeting SERPINE1 Shuo Zhang, Gang Cao, Shuijie Shen, Yu Wu, Xiying Tan, Xiaoyan Jiang This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3571230/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Hepatocellular carcinoma (HCC) is one of the most deadly malignancies. Due to the late detection of HCC, the treatment are not satisfactory, accompanied by poor prognosis. Therefore, early detection has important value for HCC treatment. MicroRNAs (miRNAs), the intercellular communication in the tumor microenvironment, are widely accepted as molecular markers of HCC. However, there are few studies on miRNAs involved in the crosstalk between cancer-associated fibroblast (CAF) and HCC cells. In the study, transcriptome sequencing, siRNA, co-culture, reverse transcription quantitative real-time PCR (RT-qPCR), western blot, dual-luciferase reporter system, and xenograft tumor model, were used to explore the role of miR-642a-3p/SERPINE1 axis in HCC progression. The results showed that in co-culture with CAF, the expression of SERPINE1 mRNA decreased, whereas miR-642a-3p expression increased in Huh7 cells. SERPINE1 knockdown significantly enhanced the invasion ability and increased miR-642a-3p expression in Huh7 cells. Dual-luciferase reporter assay discovered that miR-642a-3p had a binding effect with SERPINE1, suggesting that SERPINE1 was a target of miR-642a-3p. In addition, miR-642a-3p mimics inhibited SERPINE1 expression and promoted the migration, invasion, and EMT of Huh7 cells, whereas miR-642a-3p inhibitor had the opposite effect. More importantly, miR-642a-3p knockdown inhibited the proliferation and spread of xenograft tumors in the liver. miR-642a-3p knockdown significantly inhibited epithelial-mesenchymal transition (EMT) in the liver. These findings reveal that the miR-642a-3p/SERPINE1 axis plays an important role in the invasion and metastasis of HCC, and can be used as a novel therapeutic target for HCC. Hepatocellular carcinoma miR-642a-3p SERPINE1 Invasion EMT Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction Liver cancer is one of the common malignant tumors and the 4th principal source of cancer deaths [ 1 ]. In 2020, the global rate of new liver cancer cases and deaths is 9.5 and 8.7 per 100,000 people, respectively, with increasing incidence year by year [ 2 ]. It is estimated that 1.4 million people may be diagnosed with liver cancer in 2040 [ 2 ]. Hepatocellular carcinoma (HCC) and cholangiocarcinoma are the main subtypes of liver cancer, of which HCC accounts for about 85%. There have been great advances in HCC treatment in recent decades. However, HCC is not easy to detect in its early stages, and more than 70% of patients are diagnosed in the middle and late stages of HCC, resulting in a very low 5-year survival rate after surgery [ 3 – 5 ]. Chemotherapy failure and frequent recurrence are also the main reasons for poor prognosis of HCC [ 4 , 6 ]. Therefore, it is of great significance to explore the biomarker of HCC occurrence and development for the prevention, diagnosis, treatment, and prognosis. In the process of cancer development, a variety of cell groups gather around cancer tissues to form a unique microenvironment, which is called tumor microenvironment (TME). These cells are recruited to perform pro-tumor functions, resulting in cancer cells that can evade detection by the immune system, establishing a tumor niche. Cancer-associated fibroblasts (CAF) is a major component of TME and account for approximately 70% of cells in tumor tissues. CAF has a variety of tumor-causing functions in tumor tissues, such as changing tumor metabolism and immune reprogramming, promoting immune escape of tumor, improving drug resistance, and changing TME [ 7 ]. CAF remodel extracellular matrix and TME via secreting growth factors, immunomodulators, and extracellular matrix proteins, which promotes metastasis, immune escape, and therapeutic resistance of tumor [ 8 – 12 ]. Therefore, CAF has become a target cell for clinical and preclinical studies. In HCC, activated CAF interacts with HCC cells to express a variety of pro-growth and pro-invasion factors, creating a favorable microenvironment for the proliferation, growth, invasion, and migration of HCC cells [ 13 , 14 ]. It has been reported that the characteristics of different CAF clusters can effectively predict the prognosis of HCC and provide a new method for the treatment of HCC [ 15 ]. MicroRNAs (miRNAs) are single-stranded non-coding RNAs composed of 20–22 nucleotides. miRNAs degradate target mRNAs or inhibit mRNAs translation by directly binding to mRNAs 3 'UTR. Each miRNA regulates multiple target genes to participate in the biological functions including differentiation, development, proliferation, migration, and apoptosis in cells. In recent years, miRNAs have been recognized as promising biomarkers for tumor diagnosis [ 16 – 18 ]. It has been reported that malignant progression and poor prognosis of HCC are related to the dysregulation of miRNAs, such as miR-21 [ 19 ], miR-155 [ 20 ], miR-541 [ 21 ], and miR-126 [ 22 ]. miRNAs have been identified to affect HCC processes, such as proliferation, apoptosis, metastasis, and drug resistance. Besides, miRNAs is also considered to be a signaling molecule for intercellular communication, which carries out information exchange and gene regulation between tumor cells and other cells, including CAF and immune cells, ultimately affecting the malignant progression of tumors [ 23 – 25 ]. It has been reported that the exosome miR-20a-5p released by CAF promotes HCC progression through the LIMA1-mediated β-Catenin pathway [ 23 ]. The CAF-derived exosome miR-1228-3p enhances the resistance of liver cancer cells to sorafenib [ 26 ]. Although some miRNAs have been found in HCC, there are still a large number of miRNAs that need to be explored for their role in the occurrence and development of HCC, especially the crosstalk between HCC and TME, so as to provide references for the complex mechanism research and clinical diagnosis and treatment of HCC. In this study, we explored the effects of CAF-conditioned medium (CAF-CM) on gene regulatory networks in Huh7 cells through high-throughput sequencing. Bioinformatics analysis showed that Serine protease inhibitor clade E member 1 (SERPINE1) was highly expressed in Huh7 cells cultured with CAF-CM. Co-culture and miRNA database (StarBase, miRwalk, TargetScan, and miRDB) were used to evaluate the miR-642a-3p/SERPINE1 axis involved in crosstalk between CAF and Huh7 cell. In addition, We explored the role of miR-642a-3p/SERPINE1 axis in the migration, invasion, and epithelial-mesenchymal transition (EMT) of HCC cell in vitro and in vivo , providing the new target for HCC. Materials and methods Cell culture Huh7 cells (Human hepatoma cell line) and CAF (human hepatocellular carcinoma associated fibroblasts) were purchased from KeyGEN BioTECH Co., Ltd. (KeyGEN, Nanjing, China) and Affandi (Shanghai, China), respectively. The cells were cultured in Dulbecco's modified Eagle's Medium (DMEM) (KeyGEN) containing 10% fetal bovine serum (FBS) (Gibco, USA) and 1% penicillin-streptomycin (P/S) (KeyGEN), in atmosphere of 5% CO 2 and 95% humidity at 37°C. When the fusion degree of CAF reached 70–80%, the cells was continued cultured with DMEM medium without FBS for 24 h. The cultured medium was collected and centrifuged at 3000 g to obtain CAF conditioned medium (CAF-CM). Huh7 cells were divided into two groups: Huh7 and Huh7-CM. The Huh7 group were cultured with DMEM for 24 h, but the Huh7-CM group were cultured with CAF-CM for 24 h. Transcriptome sequencing Total RNA in Huh7 cells from the Huh7 and Huh7-CM group was extracted using TRIzol Reagent (Invitrogen, USA) according to the manufacturer’s instructions. After purification and library construction of total RNA, these libraries were paired end (PE) sequenced using Next-Generation Sequencing (NGS) based on Illumina sequencing platform. The Raw Data was filtered, and the filtered high-quality sequence (Clean Data) was compared to the human reference genome (GRCh38). According to the comparison results, the expression level of each gene was calculated. On this basis, the date were further analyzed by differential expression analysis, enrichment analysis including GO, KEGG, and GSEA, and cluster analysis. Cell transfection Huh7 cells were transfected for 48 h with miR-642a-3p mimics or miR-642a-3p inhibitor or SERPINE1 siRNA (GENERAL BIOL, Anhui, China) using Lipofectamine™ 3000 transfection reagent (Invitrogen, USA) according to the manufacturer’s instruction. Meanwhile, the cells transfected with negative controls of mimics (mimics NC) or inhibitor (inhibitor NC) or SERPINE1 siRNA (si-NC) served as the control groups. The sequences of the miR-381-3p mimics, inhibitor, SERPINE1 siRNA, and respective NCs were listed in Table 1 . Table 1 The sequences of the miR-642a-3p mimics, inhibitor, SERPINE1 siRNA, and respective NCs. Name sequence(5'→3') miR-642a-3p mimics F: UAUACAAGGGCAAGCUCUCUGU R: ACAGAGAGCUUGCCCUUGUAUA mimics NC F: UCACAACCUCCUAGAAAGAGUAGA R: UCUACUCUUUCUAGGAGGUUGUGA miR-642a-3p inhibitor ACAGAGAGCUUGCCCUUGUAUA inhibitor NC UCUACUCUUUCUAGGAGGUUGUGA SERPINE1 siRNA#1 F: GGAAAGGAGCCGUGGACCATT R: UGGUCCACGGCUCCUUUCCTT SERPINE1 siRNA#2 F: CGACAUGUUCAGACAGUUUTT R: AAACUGUCUGAACAUGUCGTT SERPINE1 siRNA#3 F: GGCCAUGGAACAAGGAUGATT R: UCAUCCUUGUUCCAUGGCCTT siRNA NC F: UUCUCCGAACGUGUCACGUTT R: ACGUGACACGUUCGGAGAATT Wound healing assay Huh7 cells were inoculated into the 6-well cell culture plate at a density of 1×10 5 cells /mL and cultured overnight. A sterile pipette tip was used to draw a straight lines per well to creat the scratch. The floating cells were washed away with 1×PBS, and then old culture medium was replaced with the fresh as well as the cells were transfected at the same time. After 48 h of the culture, the cells were photographed with ×200 magnification using an IX51 microscope (OLYMPUS, Japan) and the wound width was measured at 0 h (a) and 48 h (b). The wound healing ratio [(a − b)/a×100%] was used to evaluate the migratory capacity. Transwell assay The transwell 24-well chamber (Corning Incorporated, USA) was used to measure the invasion of Huh7 cells. The cells were inoculated into the transwell chamber covered in Matrigel (BD, USA) at a density of 1×10 5 cells/mL. 500 µL DMEM medium containing 10% FBS was added to per well in the 24-well cell culture plate (Corning Incorporated, USA). After cultured for 48 h, The upper cells of the microporous membrane in the transwell chamber were removed with cotton swabs. Then, the lower cells of the membrane were incubated with 0.1% crystal violet (Sigma, USA) at 37℃ for 30 min, cleaned twice with 1×PBS, photographed, and counted under an IX51 microscope (OLYMPUS, Japan). Total RNA extraction and reverse transcription quantitative real-time PCR (RT-qPCR) Total RNA was extracted using TRIzol Reagent (Invitrogen, USA) according to the manufacturer’s instructions. The integrity of the RNA was measured using agarose gel electrophoresis, and the concentration and purity were determined by a Nano-100 spectrophotometer (Allsheng, Hangzhou, China). Total RNA was reverse transcribed into first strand cDNA served as a template for RT-qPCR using the PrimeScript™ RT reagent Kit (Takara, Japan). For miRNA expression, reversetranscription experiments were performed with Bulge-LoopTM miRNA RT-PCR Starter Kit (RiboBio). GAPDH or U6 were used as internal reference genes. SYBR Green PCR Mix (Takara) was used for quantitative assays with a StepOnePlus Real-Time PCR System (ABI, USA). The 2 −ΔΔCt method was used to calculate the relative mRNA and miRNA expression levels. The primer sequences of the genes were shown in Table 2 . Table 2 The primer sequences of the genes. Name Sequence(5'→3') miR-449b-5p F: ACACTCCAGCTGGGAGGCAGTGTATTGTTA R: TGGTGTCGTGGAGTCG miR-544b F: ACACTCCAGCTGGGACCTGAGGTTGTGCAT R: TGGTGTCGTGGAGTCG miR-642a-3p F: ACACTCCAGCTGGGAGACACATTTGGAGAG R: TGGTGTCGTGGAGTCG miR-2116-3p F: ACACTCCAGCTGGGCCTCCCATGCCAAGA R: TGGTGTCGTGGAGTCG miR-3135a F: ACACTCCAGCTGGGTGCCTAGGCTGAGACT R: TGGTGTCGTGGAGTCG SERPINE1 F: GGTGCTGGTGAATGCCCTCTAC R: TGCTGCCGTCTGATTTGTGGAA GAPDH F: AGATCATCAGCAATGCCTCCT R: TGAGTCCTTCCACGATACCAA U6 F: CTCGCTTCGGCAGCACA R: AACGCTTCACGAATTTGCGT Western blot Total proteins were extracted and quantified using total protein extraction kit (KeyGEN BioTECH) and BCA protein content detection kit (KeyGEN BioTECH) according to manufacturer's instructions, respectively. Total proteins were separated by the sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to polyvinylidene fluoride (PVDF) membranes. Subsequently, PVDF membranes were incubated with the primary antibodies and secondary antibody, respectively. The primary antibodies included SERPINE1 (ab222754, Abcam, 1:1000), E-cadherin (ab76055, Abcam, 1:1000), N-cadherin (66219-1-Ig, Proteintech, 1:2000), Vimentin (bsm-33170m, Bioss, 1:1000) and GAPDH (ab9485, Abcam, 1:2000), and secondary antibody was anti-rabbit IgG H&L (HRP) (ab6721, Abcam, 1:5000). Then, the combined signals were detected by the ECL Detection Kit (KeyGEN) and the ChemiDoc Touch 1708370 (Bio-Rad, USA), followed by data analysis through ImageJ software. Dual-luciferase reporter assay 293T cells were inoculated in 12-well plates. When the cell aggregation degree reaches about 50%, pmirGLO-SERPINE1-wt or pmirGLO-SERPINE1-mut was cotransfected with miR-642a-3p mimics or NC into 293T cells by Lipofectamine™ 3000 transfection reagent (Invitrogen, US). After transfection for 48 h, 50 µl of lysed cells were added to each hole of the 96-well black plate. Then, Dual-Glo® Luciferase Reagent (Promega, USA) was added, and the fluorescence intensity of firefly was detected by a Tecan Spark microplate reader (Switzerland). Finally, 100 µl Dual-Glo® Stop & Glo® Reagent (Promega, USA) was added to each well to detect the fluorescence intensity of Renilla. The relative luciferase activity was normalized to Renilla luciferase activity. Animal experiments 4–6 week-old male BALB/c nude mice were obtained from Shanghai Lingchang Biotechnology Co., LTD. The mice were divided into 2 groups: NC and shmiR-642a-3p (n = 5). The nude mice were put under abdominal anesthesia, fixed in supine position, and the skin was disinfected. Open the abdominal cavity along the midabdominal line, expose the liver, and pull the liver leaf outside the incision with a cotton swab. The needle was inserted into the liver about 3 mm and slowly pushed into the tumor cells. Each nude mouse was injected with 100 µL Huh7-luc cells (Shanghai Zhong Qiao Xin Zhou Biotechnology Co., Ltd., China) at a density of 2×10 8 cells/mL. Next, the liver was put back into the abdominal cavity, and the abdomen was closed layer by layer. After one week of inoculation, each mouse in the NC and shmiR-642a-3p groups was intraperitoneally injected with 2*10^11 vg AAV-vector and AAV-shmiR-642a-3p, respectively. At the 8th week, tumor metastasis was monitored using an IVIS Imaging System. At 10 minutes prior to in vivo imaging, mice were anesthesized with 1.5% isoflurane and were intraperitoneally injected with luciferin (150 mg/kg). Images and measurements of luciferase signals were analyzed using Living Image Software (Xenogen). After the imaging, the mice were dissected, and the tissues of livers and lungs were observed to evaluate the tumor growth. The animal experiment was approved by the Institutional Animal Care and Use Committee of Nanjing Ramda Pharmaceutical Co., Ltd. Hematoxylin-eosin (HE) staining The livers and lungs were fixed in 4% polyformaldehyde solution and then embedded in paraffin. Tissue sections were carried out on 4 µm thick and stained with HE staining. The histomorphology of the livers and lungs was observed utilizing the SLIDEVIEW VS200 research slide scanner (OLYMPUS, Japan). Immunohistochemistry (IHC) assay The livers were immediately placed into a 4% paraformaldehyde solution and fixed overnight. Parafin blocks were sectioned into a 4 µm thickness. The EnVision two-step immunohistochemical staining technique was used to detect the expression of Ki67 in the livers. Rabbit anti-Ki67 (ab16667, Abcam, 1:50) was used as the primary antibody. Subsequently, the indicated HRP-conjugated secondary antibody (MXB Biotechnologies, Fuzhou, China) was used in incubating the slice. The slice was stained with diaminobenzidine (DAB) solution (MXB Biotechnologies) and hematoxylin (Nanjing Jiancheng Bioengineering Institute, Nanjing, China). The Ki67 expressions of the livers were observed utilizing the SLIDEVIEW VS200 research slide scanner (OLYMPUS, Japan). Statistical analyses The data were statistically analyzed using the SPSS 21.0, and one-way analysis of variance (ANOVA) was used to determine the differences between the groups, following the Tukey method for post hoc comparisons. All data are presented as the mean ± standard error (SE). P < 0.05 was used to determine the statistical significance. Results SERPINE1 knockdown promoted proliferation and invasion of Huh7 cells CAF are important participants in tumor progression, performing functions ranging from collagen deposition to immunosuppression. During the cancer process, CAF are recruited into tumor tissues and then activated. Activated CAF directly affect various physiological processes of cancer cells, such as proliferation, migration, metabolism, and drug resistance. In previous studies, we found that CAF promoted proliferation and migration of Huh7 cells. In order to explore the regulatory network of CAF on the proliferation and migration of Huh7 cells, transcriptomics was used to explore the genes of CAF-CM affecting the progression of Huh7 cells. Bioinformatics analysis revealed that compared with the Huh7 group, there were 295 differential genes in the Huh7-CM group, of which 177 genes were up-regulated and 118 genes were down-regulated (Fig. 1 a and 1 b, Supplementary Table 1). KEGG enrichment analysis found that the top20 of differential genes were mainly enriched in metabolic pathways, cytokine-cytokine receptor interaction, axon guidance, HIF-1 signaling pathway, etc (Fig. 1 c). GSEA enrichment analysis showed that HIF-1 signaling pathway was enhanced in Huh7-CM group (Fig. 1 d). As a member of HIF-1 signaling pathway, SERPINE1 gene was significantly upexpressed in the Huh7-CM group. Besides, the expression levels of SERPINE1 gene were higher and significantly different between the two groups, compared with other differential genes (Supplementary Table 2). This suggests that SERPINE1 may be a key target for CAF-CM to promote proliferation and migration of Huh7 cells. However, RT-qPCR verification showed that SERPINE1 mRNA expression decreased significantly in the Huh7-CM group (Fig. 1 e). SERPINE1 knockdown significantly promoted the proliferation and invasion of Huh7 cells ( P < 0.001) (Fig. 1 f-h), indicating that SERPINE1 may be a suppressor gene for Huh7 cells. According to the TCGA database, SERPINE1 is significantly low expressed in liver cancer, but low expression of SERPINE1 can improve the survival of patients (Supplementary Fig. 1). miRNAs regulating SERPINE1 expression As an intercellular communication mode, miRNAs carry information between different cells, tissues and organs. In the TME, miRNAs participate in the occurrence and development of tumors via regulating the dysregulation of target genes. In order to further explore whether CAF-CM affects SERPINE1 expression in Huh7 cells through miRNAs, multiple miRNA databases (StarBase, miRwalk, TargetScan, and miRDB) were used to predict the miRNAs binding to SERPINE1 3' UTR. We screened five miRNA that had not been studied in liver cancer (Fig. 2 a and Supplementary Table 2). The results showed that the expression levels of miR-642a-3p, miR-3135a, and miR-449b-5p in the Huh7-CM group were significantly higher than those in the Huh7 group ( P 0.05) (Fig. 2 b-f). It was further found that the expression levels of miR-642a-3p and miR-3135a in Huh7 cells with SERPINE1 knockdown significantly increased ( P < 0.01), and the expression level of miR-642a-3p was more different between the two groups (Figrue 2g and h). These suggested that CAF-CM may inhibited the expression of SERPINE1 in Huh7 cells through miR-642a-3p. CAF-related miR-642a-3p promoted the migration, invasion, and EMT of Huh7 cells by inhibiting SERPINE1 Dual-Luciferase reporter assay showed that miR-642a-3p mimics significantly decreased the fluorescence activity in the WT group ( P 0.05) (Fig. 3 a and b). miR-642a-3p mimics significantly promoted the expression of miR-642a-3p and inhibited the expression of SERPINE1 gene ( P < 0.001), whereas miR-642a-3p inhibitor had the opposite effect (Fig. 3 c and d). Further study discovered that miR-642a-3p mimics significantly improved the migration and invasion ability of Huh7 cells, whereas miR-642a-3p inhibitor significantly inhibited the migration and invasion of Huh7 cells (Fig. 3 e and f). EMT is an important feature of tumor metastasis. In our study, miR-642a-3p mimics significantly increased the expression of N-cadherin and Vimentin proteins and decreased E-cadherin protein expression in Huh7 cells ( P < 0.001) (Fig. 3 g). On the contrary, miR-642a-3p inhibitor significantly increased the expression of E-cadherin protein and inhibited the expression of N-cadherin and Vimentin proteins ( P < 0.001) (Fig. 3 g), indicating that miR-642a-3p promoted EMT process of Huh7 cells via regulating SERPINE1 expression. miR-642a-3p knockdown inhibited proliferation and EMT of xenograft tumor in vivo In order to investigate the effect of miR-642a-3p on tumor metastasis in vivo , we constructed an in-situ liver tumor model by injecting Huh7-luc cells into the liver of nude mice. Preliminary experiment in vivo imaging showed that the tumor spread was significantly observed in the NC group at the 8th week after inoculation of Huh7-luc cells, whereas the tumor spread was smaller in the shmiR-642a-3p group (Supplementary Fig. 2a). Unfortunately, the luc fluorescence was quenched for unknown reasons during the formal experiment. According to the pre-experiment results, one nude mouse was selected and dissected for each group in the 8th week, and then the remaining 4 mice in each group were dissected (Fig. 4 a and Supplementary Fig. 2b). As shown in Fig. 4 a and 2 b, the tumor were evidently observed in the NC group, but not in the shmiR-642a-3p group. There was no difference in weight between the two groups, but the shmiR-642a-3p group was slightly higher than the NC group (Fig. 4 b). Histopathological analysis showed that in the NC group, tumor lesions were visible and invaded into the hepatic parenchyma with a larger invasion area, whereas the invasion area was reduced in the shmiR-642a-3p group (Fig. 4 c and d). In addition, miR-642a-3p knockdown significantly inhibited the expression of miR-642a-3p and promoted the expression of SERPINE1 (Fig. 4 e). miR-642a-3p knockdown increased SERPINE1 and E-cadherin proteins expressions, and decreased N-cadherin and Vimentin proteins expressions (Fig. 4 f). Unfortunately, no lung metastasis was found (Supplementary Fig. 2c-d), which was possibly because the tumors in the 8th week not reached the time for distant metastases and were still spreading in the liver. Discussion TME plays a central role in the development and progression of cancer. More than 80% of hepatocellular carcinomas (HCC) are characterized by the activation, proliferation, and accumulation of CAF [ 27 ]. In the TME, a large number of CAF are recruited, thus affecting the progression of HCC. It have been reported that CAF regulate HCC progression through a variety of mechanisms, including the secretion of soluble factors, exosomes, and extracellular matrix (ECM) remodeling [ 28 – 30 ]. HCC-recruited CAF can not only enhance the malignancy of tumor cells, but also recruit immune cells, such as neutrophils, monocytes and dendritic cells, to promote the acquisition of immunosuppressive phenotypes, thereby mediating immune escape of tumor [ 31 , 32 ]. Based on transcriptome sequencing, we found that CAF-CM enhances HIF-1 signaling pathway in Huh7 cells. SERPINE1, as a member of HIF-1 signaling pathway, was significantly overexpressed in Huh7-CM group. In fact, however, SERPINE1 mRNA expression in Huh7 cells significantly decreased via co-culturing CAF cells with Huh7 cells. The large contrast in SERPINE1 expression levels led us to be interested in the function of SERPINE1 in HCC. SERPINE1, a member of the serine protease inhibitor family, is an important regulator of extracellular matrix remodeling. SERPINE1 is also an inhibitor of plasminogen activator, regulating the plasminogen/plasminase system [ 33 , 34 ]. SERPINE1 is involved in various physiological processes, including metabolism, inflammation, angiogenesis, cancer, and aging [ 35 , 36 ]. SERPINE1 interacts with biological ligands including vitronectin and cell surface receptors to participate in pericellular proteolysis, tissue remodeling, and cell migration [ 35 ]. It has been reported that SERPINE1 plays multiple roles in cancer progression, such as proliferation, migration, invasion, EMT, angiogenesis, and drug resistance [ 37 – 39 ]. As a pan-oncogene, SERPINE1 is highly expressed in a variety of cancers and is associated with poor prognosis, such as gastric cancer [ 34 ], lung cancer [ 38 ], and colon cancer [ 40 ]. In gastric cancer, SERPINE1 knockdown significantly inhibits the proliferation, migration, and invasion of gastric cancer cells, as well as the growth of xenograft tumor [ 34 ]. In head and neck squamous cell carcinoma, SERPINE1 is directly associated with EMT, tumor cells stemness, and resistance to antitumor drugs [ 41 ]. Overexpression of SERPINE1 increased the risk of metastasis of head and neck squamous cell carcinoma [ 41 ]. Interestingly, SERPINE1 promotes senescence of lung cancer cells (A549 and H1299 cells) to inhibits tumor progression [ 36 ]. However, other study have suggested that SERPINE1 expression is up-regulated and promotes lung cancer cell invasion [ 42 ]. In HCC, CAF-CM promotes SERPINE1 expression in tumor-associated macrophages (TAM), thus promoting malignant progression of HCC cells through EMT [ 43 ]. However, the biological role of SERPINE1 in HCC remains controversial. Jin et al. confirmed that the expression of SERPINE1 in HCC tissues was significantly higher than that in the paracancer tissue, and its expression was negatively correlated with overall survival, suggesting that high expression of SERPINE1 could predict poor prognosis of HCC [ 44 ]. On the contrary, SERPINE1 expression is underexpressed in the patients with liver cancer according to the TCGA database. In this study, SERPINE1 knockdown significantly promoted the proliferation and invasion of Huh7 cell. These indicate that SERPINE1 is heterogeneous in expression and function in tumors, but it is certain that SERPINE1 is a tumor suppressor gene in Huh7 cells. Based on predictions from multiple miRNA online databases, we found that SERPINE1 may be a target of miR-642a-3p. After co-culture with CAF, the expression of miR-642a-3p in Huh7 cells significantly increased. SERPINE1 knockdown increased the expression of miR-642a-3p in Huh7 cells, suggesting that miR-642a-3p may target the regulation of SERPINE1 expression. At present, studies on miR-642a-3p in cancers are scarce, with only a few reports that miR-642a-3p promotes invasion and metastasis of tumor [ 45 , 46 ] and is related to tumor drug resistance [ 47 , 48 ]. Our study showed that miR-642a-3p had binding effect with SERPINE1 mRNA 3' UTR. miR-642a-3p mimics and inhibitor inhibited and promoted the expression of SERPINE1 gene and protein, respectively. More importantly, miR-642a-3p mimics promoted the migration, invasion, and EMT of Huh7 cells, whereas miR-642a-3p inhibitor had the opposite effect. In vivo study discovered that miR-642a-3p knockdown significantly inhibited tumor proliferation and spread in the liver. Unfortunately, the effect of miR-642a-3p on tumor metastasis could not be evaluated as the organ metastasis of the tumor was not observed. miR-642a-3p knockdown inhibited EMT in the livers, indirectly reflecting that miR-642a-3p may inhibit the invasion and metastasis of HCC. In short, miR-642a-3p/SERPINE1 axis can be used as the new molecular marker for HCC. However, due to the lack of clinical samples, the effect of miR-642a-3p on HCC staging and prognosis remains to be further studied. Declarations Funding This work was supported by the National Natural Science Foundation of China (No. 82104408, No. 82003961) and Scientific Research Project of Jiangsu Provincial Health Commission (No. Z2021081). Data availability The data underlying this article will be shared on reasonable request to the corresponding author. Authors' contributions SZ and GC designed study, interpreted the data and wrote the manuscript. SZ, GC, SS, and YW performed experiments and analyzed data. XT provided experimental design ideas and funding. All authors contributed to and approved the final manuscript. Ethics approval and consent to participate Animal experiment was approved by the Institutional Animal Care and Use Committee of Nanjing Ramda Pharmaceutical Co., Ltd. (No. IACUC-20230505) and was performed per the Animal Care Committee. The study was reported in accordance with ARRIVE guidelines (https://arriveguidelines.org). Consent for publication Not applicable. Competing interests The authors declare that they have no competing interests. References Ghafouri-Fard S, Honarmand Tamizkar K, Hussen BM, Taheri M. MicroRNA signature in liver cancer. Pathol Res Pract. 2021;219:153369. Rumgay H, Arnold M, Ferlay J, Lesi O, Cabasag CJ, Vignat J, Laversanne M, McGlynn KA, Soerjomataram I. Global burden of primary liver cancer in 2020 and predictions to 2040. J Hepatol. 2022;77(6):1598–606. Vogel A, Meyer T, Sapisochin G, Salem R, Saborowski A. Hepatocellular carcinoma. Lancet (London England). 2022;400(10360):1345–62. Hou Z, Liu J, Jin Z, Qiu G, Xie Q, Mi S, Huang J. Use of chemotherapy to treat hepatocellular carcinoma. Biosci Trends. 2022;16(1):31–45. Zhou H, Song T. Conversion therapy and maintenance therapy for primary hepatocellular carcinoma. Biosci Trends. 2021;15(3):155–60. Ganesan P, Kulik LM. Hepatocellular Carcinoma: New Developments. Clin Liver Dis. 2023;27(1):85–102. Kalluri R. The biology and function of fibroblasts in cancer. Nat Rev Cancer. 2016;16(9):582–98. Biffi G, Tuveson DA. Diversity and Biology of Cancer-Associated Fibroblasts. Physiol Rev. 2021;101(1):147–76. Miyai Y, Esaki N, Takahashi M, Enomoto A. Cancer-associated fibroblasts that restrain cancer progression: Hypotheses and perspectives. Cancer Sci. 2020;111(4):1047–57. Fiori ME, Di Franco S, Villanova L, Bianca P, Stassi G, De Maria R. Cancer-associated fibroblasts as abettors of tumor progression at the crossroads of EMT and therapy resistance. Mol Cancer. 2019;18(1):70. Kobayashi H, Enomoto A, Woods SL, Burt AD, Takahashi M, Worthley DL. Cancer-associated fibroblasts in gastrointestinal cancer. Nat reviews Gastroenterol Hepatol. 2019;16(5):282–95. Helms E, Onate MK, Sherman MH. Fibroblast Heterogeneity in the Pancreatic Tumor Microenvironment. Cancer Discov. 2020;10(5):648–56. Liu J, Li P, Wang L, et al. Cancer-Associated Fibroblasts Provide a Stromal Niche for Liver Cancer Organoids That Confers Trophic Effects and Therapy Resistance. Cell Mol Gastroenterol Hepatol. 2021;11(2):407–31. Song M, He J, Pan QZ, et al. Cancer-Associated Fibroblast-Mediated Cellular Crosstalk Supports Hepatocellular Carcinoma Progression. Hepatology (Baltimore MD). 2021;73(5):1717–35. Yu L, Shen N, Shi Y, Shi X, Fu X, Li S, Zhu B, Yu W, Zhang Y. Characterization of cancer-related fibroblasts (CAF) in hepatocellular carcinoma and construction of CAF-based risk signature based on single-cell RNA-seq and bulk RNA-seq data. Front Immunol. 2022;13:1009789. Li D, Zhang J, Li J. Role of miRNA sponges in hepatocellular carcinoma. Clin Chim Acta. 2020;500:10–9. He B, Zhao Z, Cai Q, et al. miRNA-based biomarkers, therapies, and resistance in Cancer. Int J Biol Sci. 2020;16(14):2628–47. Li B, Cao Y, Sun M, Feng H. Expression, regulation, and function of exosome-derived miRNAs in cancer progression and therapy. FASEB journal: official publication of the Federation of American Societies for Experimental Biology. 2021;35(10):e21916. Zhu Q, Wang Z, Hu Y, Li J, Li X, Zhou L, Huang Y. miR-21 promotes migration and invasion by the miR-21-PDCD4-AP-1 feedback loop in human hepatocellular carcinoma. Oncol Rep. 2012;27(5):1660–8. Han ZB, Chen HY, Fan JW, Wu JY, Tang HM, Peng ZH. Up-regulation of microRNA-155 promotes cancer cell invasion and predicts poor survival of hepatocellular carcinoma following liver transplantation. J Cancer Res Clin Oncol. 2012;138(1):153–61. Xu WP, Liu JP, Feng JF, et al. miR-541 potentiates the response of human hepatocellular carcinoma to sorafenib treatment by inhibiting autophagy. Gut. 2020;69(7):1309–21. Zailaie SA, Sergi CM. MiR-126 in Hepatocellular Carcinoma and Cholangiocellular Carcinoma: A Reappraisal with an in situ Detection of miR-126. Ann Clin Lab Sci. 2022;52(1):73–85. Qi Y, Wang H, Zhang Q, Liu Z, Wang T, Wu Z, Wu W. CAF-Released Exosomal miR-20a-5p Facilitates HCC Progression via the LIMA1-Mediated β-Catenin Pathway. Cells. 2022;11(23). Barrera LN, Ridley PM, Bermejo-Rodriguez C, Costello E, Perez-Mancera PA. The role of microRNAs in the modulation of cancer-associated fibroblasts activity during pancreatic cancer pathogenesis. J Physiol Biochem. 2023;79(1):193–204. Salah RA, Nasr MA, El-Derby AM, et al. Hepatocellular carcinoma cell line-microenvironment induced cancer-associated phenotype, genotype and functionality in mesenchymal stem cells. Life Sci. 2022;288:120168. Zhang Y, Pan Q, Shao Z. Extracellular vesicles derived from cancer-associated fibroblasts carry tumor-promotive microRNA-1228-3p to enhance the resistance of hepatocellular carcinoma cells to sorafenib. Hum Cell. 2023;36(1):296–311. Affo S, Yu LX, Schwabe RF. The Role of Cancer-Associated Fibroblasts and Fibrosis in Liver Cancer. Annu Rev Pathol. 2017;12:153–86. Yin Z, Dong C, Jiang K, Xu Z, Li R, Guo K, Shao S, Wang L. Heterogeneity of cancer-associated fibroblasts and roles in the progression, prognosis, and therapy of hepatocellular carcinoma. J Hematol Oncol. 2019;12(1):101. Ying F, Chan MSM, Lee TKW. Cancer-Associated Fibroblasts in Hepatocellular Carcinoma and Cholangiocarcinoma. Cell Mol Gastroenterol Hepatol. 2023;15(4):985–99. Li Y, Wang R, Xiong S, Wang X, Zhao Z, Bai S, Wang Y, Zhao Y, Cheng B. Cancer-associated fibroblasts promote the stemness of CD24(+) liver cells via paracrine signaling. J Mol Med. 2019;97(2):243–55. Cheng Y, Li H, Deng Y, Tai Y, Zeng K, Zhang Y, Liu W, Zhang Q, Yang Y. Cancer-associated fibroblasts induce PDL1 + neutrophils through the IL6-STAT3 pathway that foster immune suppression in hepatocellular carcinoma. Cell Death Dis. 2018;9(4):422. Deng Y, Cheng J, Fu B, Liu W, Chen G, Zhang Q, Yang Y. Hepatic carcinoma-associated fibroblasts enhance immune suppression by facilitating the generation of myeloid-derived suppressor cells. Oncogene. 2017;36(8):1090–101. Balsara RD, Ploplis VA. Plasminogen activator inhibitor-1: the double-edged sword in apoptosis. Thromb Haemost. 2008;100(6):1029–36. Chen S, Li Y, Zhu Y, Fei J, Song L, Sun G, Guo L, Li X. SERPINE1 Overexpression Promotes Malignant Progression and Poor Prognosis of Gastric Cancer. J Oncol. 2022;2022:2647825. Sillen M, Declerck PJ. A Narrative Review on Plasminogen Activator Inhibitor-1 and Its (Patho)Physiological Role: To Target or Not to Target? Int J Mol Sci. 2021;22(5). Wang L, Zhang X, Sheng J, et al. RBM4 regulates cellular senescence via miR1244/SERPINE1 axis. Cell Death Dis. 2023;14(1):27. Nagy Á, Munkácsy G, Győrffy B. Pancancer survival analysis of cancer hallmark genes. Sci Rep. 2021;11(1):6047. Hong CL, Yu IS, Pai CH, Chen JS, Hsieh MS, Wu HL, Lin SW, Huang HP. CD248 Regulates Wnt Signaling in Pericytes to Promote Angiogenesis and Tumor Growth in Lung Cancer. Cancer Res. 2022;82(20):3734–50. Teng F, Zhang JX, Chen Y, et al. LncRNA NKX2-1-AS1 promotes tumor progression and angiogenesis via upregulation of SERPINE1 expression and activation of the VEGFR-2 signaling pathway in gastric cancer. Mol Oncol. 2021;15(4):1234–55. Wang Y, Wang J, Gao J, Ding M, Li H. The expression of SERPINE1 in colon cancer and its regulatory network and prognostic value. BMC Gastroenterol. 2023;23(1):33. Pavón MA, Arroyo-Solera I, Céspedes MV, Casanova I, León X, Mangues R. uPA/uPAR and SERPINE1 in head and neck cancer: role in tumor resistance, metastasis, prognosis and therapy. Oncotarget. 2016;7(35):57351–66. Kong HJ, Kwon EJ, Kwon OS, Lee H, Choi JY, Kim YJ, Kim W, Cha HJ. Crosstalk between YAP and TGFβ regulates SERPINE1 expression in mesenchymal lung cancer cells. Int J Oncol. 2021;58(1):111–21. Chen S, Morine Y, Tokuda K, Yamada S, Saito Y, Nishi M, Ikemoto T, Shimada M. Cancer–associated fibroblast–induced M2–polarized macrophages promote hepatocellular carcinoma progression via the plasminogen activator inhibitor–1 pathway. Int J Oncol. 2021;59(2). Jin Y, Liang ZY, Zhou WX, Zhou L. Expression, clinicopathologic and prognostic significance of plasminogen activator inhibitor 1 in hepatocellular carcinoma. Cancer Biomark A. 2020;27(3):285–93. Cao J, Shao H, Hu J, et al. Identification of invasion-metastasis associated MiRNAs in gallbladder cancer by bioinformatics and experimental validation. J translational Med. 2022;20(1):188. Zhang L, Zhang Y, Zhou J, Wang Y, Wang H, Huang M, Yu Q, Qi S. LncRNA NR2F1-AS1 Inhibits the Malignant Properties of Cervical Cancer Cells via Targeting miR-642a-3p/NR2F1 Axis. del Hosp de Enfermedades de la Nutricion. 2022;74(4):181–92. Revista de investigacion clinica; organo. Yu C, Chen DQ, Liu HX, Li WB, Lu JW, Feng JF. Rosmarinic acid reduces the resistance of gastric carcinoma cells to 5-fluorouracil by downregulating FOXO4-targeting miR-6785-5p. Biomed pharmacotherapy = Biomedecine pharmacotherapie. 2019;109:2327–34. Qin X, Yu S, Xu X, Shen B, Feng J. Comparative analysis of microRNA expression profiles between A549, A549/DDP and their respective exosomes. Oncotarget. 2017;8(26):42125–35. Additional Declarations No competing interests reported. Supplementary Files SupplementaryFigures.docx TableS1.docx TableS2.xlsx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3571230","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":256453348,"identity":"1b425642-a09d-4034-91a9-48fec890d0fc","order_by":0,"name":"Shuo Zhang","email":"","orcid":"","institution":"Nantong Hospital of Traditional Chinese Medicine","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Shuo","middleName":"","lastName":"Zhang","suffix":""},{"id":256453349,"identity":"287a838b-3780-4b5a-931b-72bc78d7350b","order_by":1,"name":"Gang Cao","email":"","orcid":"","institution":"Nantong Maternal and Child Health Care Hospital","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Gang","middleName":"","lastName":"Cao","suffix":""},{"id":256453351,"identity":"f0c8a730-2df4-48b9-b7d1-8e284d2fe559","order_by":2,"name":"Shuijie Shen","email":"","orcid":"","institution":"Nantong Hospital of Traditional Chinese Medicine","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Shuijie","middleName":"","lastName":"Shen","suffix":""},{"id":256453352,"identity":"079b6d61-0afc-4558-ab4c-fa95e9d6de66","order_by":3,"name":"Yu Wu","email":"","orcid":"","institution":"Nantong Hospital of Traditional Chinese Medicine","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Yu","middleName":"","lastName":"Wu","suffix":""},{"id":256453354,"identity":"ad793aec-adf9-406c-942a-11610efb68d8","order_by":4,"name":"Xiying Tan","email":"","orcid":"","institution":"Jiangsu Province Hospital of Chinese Medicine","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Xiying","middleName":"","lastName":"Tan","suffix":""},{"id":256453355,"identity":"078e14c6-18ea-4c21-b370-4d9bb3c52bf4","order_by":5,"name":"Xiaoyan Jiang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA7klEQVRIie3PMWvCQBTA8ScHZ4eH6XiHoX6FJ0ImoV/ljoCTgtAlQ4aIYgbjHr9Ft3ZMEG667o5x6qqbkxTHLrmMhd5vOo735+4BeN4f1Mug16gkxWD0XT8OnRJGF2tCmc1jaqzp9BCXhy2bUqUied4w9zwr5zREzpGqapbojEOQ71T7xwpLE8QQZb0yJ/0ZgrBf7+1JXlCMguPgCLOTthxILBzJGumIxBAMREu9ZR2SvBivSsXw2UIE3ZLCvMGlMihLjIWyBp27jMv446bv6Wsg+vX1lqQvQb53JNkT/brA1vGHEfQb55Dned4/9wNQ50prtpsbJAAAAABJRU5ErkJggg==","orcid":"","institution":"Nantong Hospital of Traditional Chinese Medicine","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Xiaoyan","middleName":"","lastName":"Jiang","suffix":""}],"badges":[],"createdAt":"2023-11-07 02:29:21","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3571230/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3571230/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":47802237,"identity":"5b32c0cb-3252-4e30-ab59-fe8fc3b599f8","added_by":"auto","created_at":"2023-12-07 15:41:16","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":860335,"visible":true,"origin":"","legend":"\u003cp\u003eTranscriptome profiling of CAF-CM on Huh7 cells and function of SERPINE1 gene on Huh7 cells. \u003cstrong\u003e(a)\u003c/strong\u003e Volcano map. \u003cstrong\u003e(b)\u003c/strong\u003e Heat map. \u003cstrong\u003e(c)\u003c/strong\u003eKEGG enrichment analysis. \u003cstrong\u003e(d)\u003c/strong\u003e GSEA enrichment analysis. \u003cstrong\u003e(e)\u003c/strong\u003e The consistency of SERPINE1 expression was compared between RT-qPCR and RNA-seq. \u003cstrong\u003e(f)\u003c/strong\u003eThe siRNA efficiency of SERPINE1 gene was detected by RT-qPCR. \u003cstrong\u003e(g)\u003c/strong\u003e The proliferation of Huh7 cells after SERPINE1 knockdown was detected by CCK-8. \u003cstrong\u003e(h)\u003c/strong\u003eThe invasion of Huh7 cells was detected by transwell chamber. Huh7-CM: Huh7 cells were cultured with CAF conditioned medium. Huh7: Huh7 cells were cultured with normal medium. Data were presented as the mean ± SE (n=3). *\u003cem\u003eP \u003c/em\u003e\u0026lt; 0.05, **\u003cem\u003eP \u003c/em\u003e\u0026lt; 0.01, and ***\u003cem\u003eP \u003c/em\u003e\u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-3571230/v1/3ee021be6984fcd7f2c54db0.png"},{"id":47802257,"identity":"8542b42d-afe2-4fa8-a7f7-86269a93029b","added_by":"auto","created_at":"2023-12-07 15:41:17","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":3271343,"visible":true,"origin":"","legend":"\u003cp\u003emiRNAs profile regulating SERPINE1 expression. \u003cstrong\u003e(a)\u003c/strong\u003e Predicted miRNA binding to SERPINE1 3' UTR through multiple miRNA databases including StarBase, miRwalk, TargetScan, and miRDB. \u003cstrong\u003e(b-f)\u003c/strong\u003e miRNA expression levels in the Huh7-CM and Huh7 groups were measured by RT-qPCR. \u003cstrong\u003e(g)\u003c/strong\u003e miR-642a-3p expression in Huh7 cells with SERPINE1 knockdown. \u003cstrong\u003e(h)\u003c/strong\u003e miR-3135a expression in Huh7 cells with SERPINE1 knockdown. Data were presented as the mean ± SE (n=3). *\u003cem\u003eP \u003c/em\u003e\u0026lt; 0.05, **\u003cem\u003eP \u003c/em\u003e\u0026lt; 0.01, and ***\u003cem\u003eP \u003c/em\u003e\u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-3571230/v1/786320c2dae343663a734939.png"},{"id":47802258,"identity":"c54272b4-fe4b-473c-917d-e056d1c43ca2","added_by":"auto","created_at":"2023-12-07 15:41:17","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":46064826,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of miR-642a-3p on migration, invasion, and EMT of Huh7 cells. \u003cstrong\u003e(a)\u003c/strong\u003ePredicted binding sites in miR-642a-3p and SERPINE1 3' UTR. \u003cstrong\u003e(b)\u003c/strong\u003e The binding effect of miR-642a-3p with SERPINE1 3' UTR were detected by dual-Luciferase reporter assay. \u003cstrong\u003e(c)\u003c/strong\u003e miR-642a-3p expression levels. \u003cstrong\u003e(d)\u003c/strong\u003e SERPINE1 gene expression levels. \u003cstrong\u003e(e)\u003c/strong\u003eCell migration ratio was measured by wound healing assay. \u003cstrong\u003e(f)\u003c/strong\u003e Invasion of Huh7 cells was detected by transwell chamber and crystal violet staining. \u003cstrong\u003e(g)\u003c/strong\u003e Proteins expressions were examined by western blot. Original blots/gels were presented in Supplementary Figure 2a. Data were presented as the mean ± SE (n=3). *\u003cem\u003eP \u003c/em\u003e\u0026lt; 0.05, **\u003cem\u003eP \u003c/em\u003e\u0026lt; 0.01, and ***\u003cem\u003eP \u003c/em\u003e\u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-3571230/v1/2000d2833834e757ad483590.png"},{"id":47802259,"identity":"b988600e-22b6-45f0-9b33-512f1e191e68","added_by":"auto","created_at":"2023-12-07 15:41:17","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":41143870,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of miR-642a-3p knockdown on tumor growth\u003cem\u003ein vivo.\u003c/em\u003e \u003cstrong\u003e(a)\u003c/strong\u003e nude mice and liver tissues in the NC and\u003cem\u003e \u003c/em\u003eshmiR-642a-3p groups (n=5). \u003cstrong\u003e(b)\u003c/strong\u003e Growth curve of the nude mice. \u003cstrong\u003e(c)\u003c/strong\u003e The structures of the liver tissues were observed by HE staining. \u003cstrong\u003e(d)\u003c/strong\u003e Ki67 expressions were examined by IHC. \u003cstrong\u003e(e)\u003c/strong\u003eExpression levels of miR-642a-3p and SERPINE1 gene were detected by RT-qPCR. \u003cstrong\u003e(f)\u003c/strong\u003eProteins expressions were analyzed by western blot. Original blots/gels are presented in Supplementary Figure 2b. Data were presented as the mean ± SE. *\u003cem\u003eP \u003c/em\u003e\u0026lt; 0.05, **\u003cem\u003eP \u003c/em\u003e\u0026lt; 0.01, and ***\u003cem\u003eP \u003c/em\u003e\u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-3571230/v1/c7ba3abab21171cba02ebba6.png"},{"id":49368161,"identity":"efa70968-017b-4b89-aa2a-e42a2031ac4b","added_by":"auto","created_at":"2024-01-09 12:52:18","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2811884,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3571230/v1/36a578c5-f8d3-40e7-bf42-f06ddf3d57a1.pdf"},{"id":47802251,"identity":"36bad86f-c30c-4861-9529-26f813a1642c","added_by":"auto","created_at":"2023-12-07 15:41:17","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":3684298,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryFigures.docx","url":"https://assets-eu.researchsquare.com/files/rs-3571230/v1/86c17e3eb92168553c5159e4.docx"},{"id":47803681,"identity":"2e9173bd-807d-4485-baa9-aff535fad3bf","added_by":"auto","created_at":"2023-12-07 15:49:16","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":40952,"visible":true,"origin":"","legend":"","description":"","filename":"TableS1.docx","url":"https://assets-eu.researchsquare.com/files/rs-3571230/v1/f5de7f4a7cbbc20da4e574ca.docx"},{"id":47802240,"identity":"a5c3cb87-5ec4-4481-b680-1b6e87d52bf3","added_by":"auto","created_at":"2023-12-07 15:41:16","extension":"xlsx","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":32242,"visible":true,"origin":"","legend":"","description":"","filename":"TableS2.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-3571230/v1/d243df54206db2445b4e2195.xlsx"}],"financialInterests":"No competing interests reported.","formattedTitle":"CAF-related miR-642a-3p supports the migration, invasion, and EMT of hepatocellular carcinoma by targeting SERPINE1","fulltext":[{"header":"Introduction","content":"\u003cp\u003eLiver cancer is one of the common malignant tumors and the 4th principal source of cancer deaths [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. In 2020, the global rate of new liver cancer cases and deaths is 9.5 and 8.7 per 100,000 people, respectively, with increasing incidence year by year [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. It is estimated that 1.4\u0026nbsp;million people may be diagnosed with liver cancer in 2040 [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Hepatocellular carcinoma (HCC) and cholangiocarcinoma are the main subtypes of liver cancer, of which HCC accounts for about 85%. There have been great advances in HCC treatment in recent decades. However, HCC is not easy to detect in its early stages, and more than 70% of patients are diagnosed in the middle and late stages of HCC, resulting in a very low 5-year survival rate after surgery [\u003cspan additionalcitationids=\"CR4\" citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Chemotherapy failure and frequent recurrence are also the main reasons for poor prognosis of HCC [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Therefore, it is of great significance to explore the biomarker of HCC occurrence and development for the prevention, diagnosis, treatment, and prognosis.\u003c/p\u003e \u003cp\u003eIn the process of cancer development, a variety of cell groups gather around cancer tissues to form a unique microenvironment, which is called tumor microenvironment (TME). These cells are recruited to perform pro-tumor functions, resulting in cancer cells that can evade detection by the immune system, establishing a tumor niche. Cancer-associated fibroblasts (CAF) is a major component of TME and account for approximately 70% of cells in tumor tissues. CAF has a variety of tumor-causing functions in tumor tissues, such as changing tumor metabolism and immune reprogramming, promoting immune escape of tumor, improving drug resistance, and changing TME [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. CAF remodel extracellular matrix and TME via secreting growth factors, immunomodulators, and extracellular matrix proteins, which promotes metastasis, immune escape, and therapeutic resistance of tumor [\u003cspan additionalcitationids=\"CR9 CR10 CR11\" citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Therefore, CAF has become a target cell for clinical and preclinical studies. In HCC, activated CAF interacts with HCC cells to express a variety of pro-growth and pro-invasion factors, creating a favorable microenvironment for the proliferation, growth, invasion, and migration of HCC cells [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. It has been reported that the characteristics of different CAF clusters can effectively predict the prognosis of HCC and provide a new method for the treatment of HCC [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eMicroRNAs (miRNAs) are single-stranded non-coding RNAs composed of 20\u0026ndash;22 nucleotides. miRNAs degradate target mRNAs or inhibit mRNAs translation by directly binding to mRNAs 3 'UTR. Each miRNA regulates multiple target genes to participate in the biological functions including differentiation, development, proliferation, migration, and apoptosis in cells. In recent years, miRNAs have been recognized as promising biomarkers for tumor diagnosis [\u003cspan additionalcitationids=\"CR17\" citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. It has been reported that malignant progression and poor prognosis of HCC are related to the dysregulation of miRNAs, such as miR-21 [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e], miR-155 [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e], miR-541 [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e], and miR-126 [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. miRNAs have been identified to affect HCC processes, such as proliferation, apoptosis, metastasis, and drug resistance. Besides, miRNAs is also considered to be a signaling molecule for intercellular communication, which carries out information exchange and gene regulation between tumor cells and other cells, including CAF and immune cells, ultimately affecting the malignant progression of tumors [\u003cspan additionalcitationids=\"CR24\" citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. It has been reported that the exosome miR-20a-5p released by CAF promotes HCC progression through the LIMA1-mediated β-Catenin pathway [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. The CAF-derived exosome miR-1228-3p enhances the resistance of liver cancer cells to sorafenib [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Although some miRNAs have been found in HCC, there are still a large number of miRNAs that need to be explored for their role in the occurrence and development of HCC, especially the crosstalk between HCC and TME, so as to provide references for the complex mechanism research and clinical diagnosis and treatment of HCC.\u003c/p\u003e \u003cp\u003eIn this study, we explored the effects of CAF-conditioned medium (CAF-CM) on gene regulatory networks in Huh7 cells through high-throughput sequencing. Bioinformatics analysis showed that Serine protease inhibitor clade E member 1 (SERPINE1) was highly expressed in Huh7 cells cultured with CAF-CM. Co-culture and miRNA database (StarBase, miRwalk, TargetScan, and miRDB) were used to evaluate the miR-642a-3p/SERPINE1 axis involved in crosstalk between CAF and Huh7 cell. In addition, We explored the role of miR-642a-3p/SERPINE1 axis in the migration, invasion, and epithelial-mesenchymal transition (EMT) of HCC cell \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e, providing the new target for HCC.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eCell culture\u003c/h2\u003e \u003cp\u003eHuh7 cells (Human hepatoma cell line) and CAF (human hepatocellular carcinoma associated fibroblasts) were purchased from KeyGEN BioTECH Co., Ltd. (KeyGEN, Nanjing, China) and Affandi (Shanghai, China), respectively. The cells were cultured in Dulbecco's modified Eagle's Medium (DMEM) (KeyGEN) containing 10% fetal bovine serum (FBS) (Gibco, USA) and 1% penicillin-streptomycin (P/S) (KeyGEN), in atmosphere of 5% CO\u003csub\u003e2\u003c/sub\u003e and 95% humidity at 37\u0026deg;C.\u003c/p\u003e \u003cp\u003eWhen the fusion degree of CAF reached 70\u0026ndash;80%, the cells was continued cultured with DMEM medium without FBS for 24 h. The cultured medium was collected and centrifuged at 3000 g to obtain CAF conditioned medium (CAF-CM). Huh7 cells were divided into two groups: Huh7 and Huh7-CM. The Huh7 group were cultured with DMEM for 24 h, but the Huh7-CM group were cultured with CAF-CM for 24 h.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eTranscriptome sequencing\u003c/h2\u003e \u003cp\u003eTotal RNA in Huh7 cells from the Huh7 and Huh7-CM group was extracted using TRIzol Reagent (Invitrogen, USA) according to the manufacturer\u0026rsquo;s instructions. After purification and library construction of total RNA, these libraries were paired end (PE) sequenced using Next-Generation Sequencing (NGS) based on Illumina sequencing platform. The Raw Data was filtered, and the filtered high-quality sequence (Clean Data) was compared to the human reference genome (GRCh38). According to the comparison results, the expression level of each gene was calculated. On this basis, the date were further analyzed by differential expression analysis, enrichment analysis including GO, KEGG, and GSEA, and cluster analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eCell transfection\u003c/h2\u003e \u003cp\u003eHuh7 cells were transfected for 48 h with miR-642a-3p mimics or miR-642a-3p inhibitor or SERPINE1 siRNA (GENERAL BIOL, Anhui, China) using Lipofectamine\u0026trade; 3000 transfection reagent (Invitrogen, USA) according to the manufacturer\u0026rsquo;s instruction. Meanwhile, the cells transfected with negative controls of mimics (mimics NC) or inhibitor (inhibitor NC) or SERPINE1 siRNA (si-NC) served as the control groups. The sequences of the miR-381-3p mimics, inhibitor, SERPINE1 siRNA, and respective NCs were listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe sequences of the miR-642a-3p mimics, inhibitor, SERPINE1 siRNA, and respective NCs.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eName\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003esequence(5'\u0026rarr;3')\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003emiR-642a-3p mimics\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: UAUACAAGGGCAAGCUCUCUGU\u003c/p\u003e \u003cp\u003eR: ACAGAGAGCUUGCCCUUGUAUA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003emimics NC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: UCACAACCUCCUAGAAAGAGUAGA\u003c/p\u003e \u003cp\u003eR: UCUACUCUUUCUAGGAGGUUGUGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003emiR-642a-3p inhibitor\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACAGAGAGCUUGCCCUUGUAUA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003einhibitor NC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eUCUACUCUUUCUAGGAGGUUGUGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSERPINE1 siRNA#1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: GGAAAGGAGCCGUGGACCATT\u003c/p\u003e \u003cp\u003eR: UGGUCCACGGCUCCUUUCCTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSERPINE1 siRNA#2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: CGACAUGUUCAGACAGUUUTT\u003c/p\u003e \u003cp\u003eR: AAACUGUCUGAACAUGUCGTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSERPINE1 siRNA#3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: GGCCAUGGAACAAGGAUGATT\u003c/p\u003e \u003cp\u003eR: UCAUCCUUGUUCCAUGGCCTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003esiRNA NC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: UUCUCCGAACGUGUCACGUTT\u003c/p\u003e \u003cp\u003eR: ACGUGACACGUUCGGAGAATT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eWound healing assay\u003c/h2\u003e \u003cp\u003eHuh7 cells were inoculated into the 6-well cell culture plate at a density of 1\u0026times;10\u003csup\u003e5\u003c/sup\u003e cells /mL and cultured overnight. A sterile pipette tip was used to draw a straight lines per well to creat the scratch. The floating cells were washed away with 1\u0026times;PBS, and then old culture medium was replaced with the fresh as well as the cells were transfected at the same time. After 48 h of the culture, the cells were photographed with \u0026times;200 magnification using an IX51 microscope (OLYMPUS, Japan) and the wound width was measured at 0 h (a) and 48 h (b). The wound healing ratio [(a\u0026thinsp;\u0026minus;\u0026thinsp;b)/a\u0026times;100%] was used to evaluate the migratory capacity.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eTranswell assay\u003c/h2\u003e \u003cp\u003eThe transwell 24-well chamber (Corning Incorporated, USA) was used to measure the invasion of Huh7 cells. The cells were inoculated into the transwell chamber covered in Matrigel (BD, USA) at a density of 1\u0026times;10\u003csup\u003e5\u003c/sup\u003e cells/mL. 500 \u0026micro;L DMEM medium containing 10% FBS was added to per well in the 24-well cell culture plate (Corning Incorporated, USA). After cultured for 48 h, The upper cells of the microporous membrane in the transwell chamber were removed with cotton swabs. Then, the lower cells of the membrane were incubated with 0.1% crystal violet (Sigma, USA) at 37℃ for 30 min, cleaned twice with 1\u0026times;PBS, photographed, and counted under an IX51 microscope (OLYMPUS, Japan).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eTotal RNA extraction and reverse transcription quantitative real-time PCR (RT-qPCR)\u003c/h2\u003e \u003cp\u003eTotal RNA was extracted using TRIzol Reagent (Invitrogen, USA) according to the manufacturer\u0026rsquo;s instructions. The integrity of the RNA was measured using agarose gel electrophoresis, and the concentration and purity were determined by a Nano-100 spectrophotometer (Allsheng, Hangzhou, China). Total RNA was reverse transcribed into first strand cDNA served as a template for RT-qPCR using the PrimeScript\u0026trade; RT reagent Kit (Takara, Japan). For miRNA expression, reversetranscription experiments were performed with Bulge-LoopTM miRNA RT-PCR Starter Kit (RiboBio). GAPDH or U6 were used as internal reference genes. SYBR Green PCR Mix (Takara) was used for quantitative assays with a StepOnePlus Real-Time PCR System (ABI, USA). The 2\u003csup\u003e\u0026minus;ΔΔCt\u003c/sup\u003e method was used to calculate the relative mRNA and miRNA expression levels. The primer sequences of the genes were shown in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe primer sequences of the genes.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eName\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequence(5'\u0026rarr;3')\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003emiR-449b-5p\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: ACACTCCAGCTGGGAGGCAGTGTATTGTTA\u003c/p\u003e \u003cp\u003eR: TGGTGTCGTGGAGTCG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003emiR-544b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: ACACTCCAGCTGGGACCTGAGGTTGTGCAT\u003c/p\u003e \u003cp\u003eR: TGGTGTCGTGGAGTCG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003emiR-642a-3p\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: ACACTCCAGCTGGGAGACACATTTGGAGAG\u003c/p\u003e \u003cp\u003eR: TGGTGTCGTGGAGTCG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003emiR-2116-3p\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: ACACTCCAGCTGGGCCTCCCATGCCAAGA\u003c/p\u003e \u003cp\u003eR: TGGTGTCGTGGAGTCG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003emiR-3135a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: ACACTCCAGCTGGGTGCCTAGGCTGAGACT\u003c/p\u003e \u003cp\u003eR: TGGTGTCGTGGAGTCG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSERPINE1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: GGTGCTGGTGAATGCCCTCTAC\u003c/p\u003e \u003cp\u003eR: TGCTGCCGTCTGATTTGTGGAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: AGATCATCAGCAATGCCTCCT\u003c/p\u003e \u003cp\u003eR: TGAGTCCTTCCACGATACCAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eU6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: CTCGCTTCGGCAGCACA\u003c/p\u003e \u003cp\u003eR: AACGCTTCACGAATTTGCGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eWestern blot\u003c/h2\u003e \u003cp\u003e Total proteins were extracted and quantified using total protein extraction kit (KeyGEN BioTECH) and BCA protein content detection kit (KeyGEN BioTECH) according to manufacturer's instructions, respectively. Total proteins were separated by the sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to polyvinylidene fluoride (PVDF) membranes. Subsequently, PVDF membranes were incubated with the primary antibodies and secondary antibody, respectively. The primary antibodies included SERPINE1 (ab222754, Abcam, 1:1000), E-cadherin (ab76055, Abcam, 1:1000), N-cadherin (66219-1-Ig, Proteintech, 1:2000), Vimentin (bsm-33170m, Bioss, 1:1000) and GAPDH (ab9485, Abcam, 1:2000), and secondary antibody was anti-rabbit IgG H\u0026amp;L (HRP) (ab6721, Abcam, 1:5000). Then, the combined signals were detected by the ECL Detection Kit (KeyGEN) and the ChemiDoc Touch 1708370 (Bio-Rad, USA), followed by data analysis through ImageJ software.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eDual-luciferase reporter assay\u003c/h2\u003e \u003cp\u003e293T cells were inoculated in 12-well plates. When the cell aggregation degree reaches about 50%, pmirGLO-SERPINE1-wt or pmirGLO-SERPINE1-mut was cotransfected with miR-642a-3p mimics or NC into 293T cells by Lipofectamine\u0026trade; 3000 transfection reagent (Invitrogen, US). After transfection for 48 h, 50 \u0026micro;l of lysed cells were added to each hole of the 96-well black plate. Then, Dual-Glo\u0026reg; Luciferase Reagent (Promega, USA) was added, and the fluorescence intensity of firefly was detected by a Tecan Spark microplate reader (Switzerland). Finally, 100 \u0026micro;l Dual-Glo\u0026reg; Stop \u0026amp; Glo\u0026reg; Reagent (Promega, USA) was added to each well to detect the fluorescence intensity of Renilla. The relative luciferase activity was normalized to Renilla luciferase activity.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eAnimal experiments\u003c/h2\u003e \u003cp\u003e4\u0026ndash;6 week-old male BALB/c nude mice were obtained from Shanghai Lingchang Biotechnology Co., LTD. The mice were divided into 2 groups: NC and shmiR-642a-3p (n\u0026thinsp;=\u0026thinsp;5). The nude mice were put under abdominal anesthesia, fixed in supine position, and the skin was disinfected. Open the abdominal cavity along the midabdominal line, expose the liver, and pull the liver leaf outside the incision with a cotton swab. The needle was inserted into the liver about 3 mm and slowly pushed into the tumor cells. Each nude mouse was injected with 100 \u0026micro;L Huh7-luc cells (Shanghai Zhong Qiao Xin Zhou Biotechnology Co., Ltd., China) at a density of 2\u0026times;10\u003csup\u003e8\u003c/sup\u003e cells/mL. Next, the liver was put back into the abdominal cavity, and the abdomen was closed layer by layer. After one week of inoculation, each mouse in the NC and shmiR-642a-3p groups was intraperitoneally injected with 2*10^11 vg AAV-vector and AAV-shmiR-642a-3p, respectively. At the 8th week, tumor metastasis was monitored using an IVIS Imaging System. At 10 minutes prior to \u003cem\u003ein vivo\u003c/em\u003e imaging, mice were anesthesized with 1.5% isoflurane and were intraperitoneally injected with luciferin (150 mg/kg). Images and measurements of luciferase signals were analyzed using Living Image Software (Xenogen). After the imaging, the mice were dissected, and the tissues of livers and lungs were observed to evaluate the tumor growth. The animal experiment was approved by the Institutional Animal Care and Use Committee of Nanjing Ramda Pharmaceutical Co., Ltd.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eHematoxylin-eosin (HE) staining\u003c/h2\u003e \u003cp\u003eThe livers and lungs were fixed in 4% polyformaldehyde solution and then embedded in paraffin. Tissue sections were carried out on 4 \u0026micro;m thick and stained with HE staining. The histomorphology of the livers and lungs was observed utilizing the SLIDEVIEW VS200 research slide scanner (OLYMPUS, Japan).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eImmunohistochemistry (IHC) assay\u003c/h2\u003e \u003cp\u003eThe livers were immediately placed into a 4% paraformaldehyde solution and fixed overnight. Parafin blocks were sectioned into a 4 \u0026micro;m thickness. The EnVision two-step immunohistochemical staining technique was used to detect the expression of Ki67 in the livers. Rabbit anti-Ki67 (ab16667, Abcam, 1:50) was used as the primary antibody. Subsequently, the indicated HRP-conjugated secondary antibody (MXB Biotechnologies, Fuzhou, China) was used in incubating the slice. The slice was stained with diaminobenzidine (DAB) solution (MXB Biotechnologies) and hematoxylin (Nanjing Jiancheng Bioengineering Institute, Nanjing, China). The Ki67 expressions of the livers were observed utilizing the SLIDEVIEW VS200 research slide scanner (OLYMPUS, Japan).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analyses\u003c/h2\u003e \u003cp\u003eThe data were statistically analyzed using the SPSS 21.0, and one-way analysis of variance (ANOVA) was used to determine the differences between the groups, following the Tukey method for post hoc comparisons. All data are presented as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard error (SE). \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was used to determine the statistical significance.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eSERPINE1 knockdown promoted proliferation and invasion of Huh7 cells\u003c/h2\u003e \u003cp\u003eCAF are important participants in tumor progression, performing functions ranging from collagen deposition to immunosuppression. During the cancer process, CAF are recruited into tumor tissues and then activated. Activated CAF directly affect various physiological processes of cancer cells, such as proliferation, migration, metabolism, and drug resistance. In previous studies, we found that CAF promoted proliferation and migration of Huh7 cells. In order to explore the regulatory network of CAF on the proliferation and migration of Huh7 cells, transcriptomics was used to explore the genes of CAF-CM affecting the progression of Huh7 cells. Bioinformatics analysis revealed that compared with the Huh7 group, there were 295 differential genes in the Huh7-CM group, of which 177 genes were up-regulated and 118 genes were down-regulated (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea and \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eb, Supplementary Table\u0026nbsp;1). KEGG enrichment analysis found that the top20 of differential genes were mainly enriched in metabolic pathways, cytokine-cytokine receptor interaction, axon guidance, HIF-1 signaling pathway, etc (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ec). GSEA enrichment analysis showed that HIF-1 signaling pathway was enhanced in Huh7-CM group (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ed). As a member of HIF-1 signaling pathway, SERPINE1 gene was significantly upexpressed in the Huh7-CM group. Besides, the expression levels of SERPINE1 gene were higher and significantly different between the two groups, compared with other differential genes (Supplementary Table\u0026nbsp;2). This suggests that SERPINE1 may be a key target for CAF-CM to promote proliferation and migration of Huh7 cells. However, RT-qPCR verification showed that SERPINE1 mRNA expression decreased significantly in the Huh7-CM group (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ee). SERPINE1 knockdown significantly promoted the proliferation and invasion of Huh7 cells (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ef-h), indicating that SERPINE1 may be a suppressor gene for Huh7 cells. According to the TCGA database, SERPINE1 is significantly low expressed in liver cancer, but low expression of SERPINE1 can improve the survival of patients (Supplementary Fig.\u0026nbsp;1).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003emiRNAs regulating SERPINE1 expression\u003c/h2\u003e \u003cp\u003eAs an intercellular communication mode, miRNAs carry information between different cells, tissues and organs. In the TME, miRNAs participate in the occurrence and development of tumors via regulating the dysregulation of target genes. In order to further explore whether CAF-CM affects SERPINE1 expression in Huh7 cells through miRNAs, multiple miRNA databases (StarBase, miRwalk, TargetScan, and miRDB) were used to predict the miRNAs binding to SERPINE1 3' UTR. We screened five miRNA that had not been studied in liver cancer (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea and Supplementary Table\u0026nbsp;2). The results showed that the expression levels of miR-642a-3p, miR-3135a, and miR-449b-5p in the Huh7-CM group were significantly higher than those in the Huh7 group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), whereas miR-544b and miR-2116-3p expressions were not significantly different between the two groups (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb-f). It was further found that the expression levels of miR-642a-3p and miR-3135a in Huh7 cells with SERPINE1 knockdown significantly increased (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01), and the expression level of miR-642a-3p was more different between the two groups (Figrue 2g and h). These suggested that CAF-CM may inhibited the expression of SERPINE1 in Huh7 cells through miR-642a-3p.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eCAF-related miR-642a-3p promoted the migration, invasion, and EMT of Huh7 cells by inhibiting SERPINE1\u003c/h2\u003e \u003cp\u003eDual-Luciferase reporter assay showed that miR-642a-3p mimics significantly decreased the fluorescence activity in the WT group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), but had no effect in MUT group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea and b). miR-642a-3p mimics significantly promoted the expression of miR-642a-3p and inhibited the expression of SERPINE1 gene (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001), whereas miR-642a-3p inhibitor had the opposite effect (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ec and d). Further study discovered that miR-642a-3p mimics significantly improved the migration and invasion ability of Huh7 cells, whereas miR-642a-3p inhibitor significantly inhibited the migration and invasion of Huh7 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ee and f). EMT is an important feature of tumor metastasis. In our study, miR-642a-3p mimics significantly increased the expression of N-cadherin and Vimentin proteins and decreased E-cadherin protein expression in Huh7 cells (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eg). On the contrary, miR-642a-3p inhibitor significantly increased the expression of E-cadherin protein and inhibited the expression of N-cadherin and Vimentin proteins (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eg), indicating that miR-642a-3p promoted EMT process of Huh7 cells via regulating SERPINE1 expression.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003emiR-642a-3p knockdown inhibited proliferation and EMT of xenograft tumor\u003c/b\u003e \u003cb\u003ein vivo\u003c/b\u003e\u003c/p\u003e \u003cp\u003eIn order to investigate the effect of miR-642a-3p on tumor metastasis \u003cem\u003ein vivo\u003c/em\u003e, we constructed an in-situ liver tumor model by injecting Huh7-luc cells into the liver of nude mice. Preliminary experiment \u003cem\u003ein vivo\u003c/em\u003e imaging showed that the tumor spread was significantly observed in the NC group at the 8th week after inoculation of Huh7-luc cells, whereas the tumor spread was smaller in the shmiR-642a-3p group (Supplementary Fig.\u0026nbsp;2a). Unfortunately, the luc fluorescence was quenched for unknown reasons during the formal experiment. According to the pre-experiment results, one nude mouse was selected and dissected for each group in the 8th week, and then the remaining 4 mice in each group were dissected (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea and Supplementary Fig.\u0026nbsp;2b). As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea and \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb, the tumor were evidently observed in the NC group, but not in the shmiR-642a-3p group. There was no difference in weight between the two groups, but the shmiR-642a-3p group was slightly higher than the NC group (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eb). Histopathological analysis showed that in the NC group, tumor lesions were visible and invaded into the hepatic parenchyma with a larger invasion area, whereas the invasion area was reduced in the shmiR-642a-3p group (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ec and d). In addition, miR-642a-3p knockdown significantly inhibited the expression of miR-642a-3p and promoted the expression of SERPINE1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ee). miR-642a-3p knockdown increased SERPINE1 and E-cadherin proteins expressions, and decreased N-cadherin and Vimentin proteins expressions (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ef). Unfortunately, no lung metastasis was found (Supplementary Fig.\u0026nbsp;2c-d), which was possibly because the tumors in the 8th week not reached the time for distant metastases and were still spreading in the liver.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eTME plays a central role in the development and progression of cancer. More than 80% of hepatocellular carcinomas (HCC) are characterized by the activation, proliferation, and accumulation of CAF [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. In the TME, a large number of CAF are recruited, thus affecting the progression of HCC. It have been reported that CAF regulate HCC progression through a variety of mechanisms, including the secretion of soluble factors, exosomes, and extracellular matrix (ECM) remodeling [\u003cspan additionalcitationids=\"CR29\" citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. HCC-recruited CAF can not only enhance the malignancy of tumor cells, but also recruit immune cells, such as neutrophils, monocytes and dendritic cells, to promote the acquisition of immunosuppressive phenotypes, thereby mediating immune escape of tumor [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. Based on transcriptome sequencing, we found that CAF-CM enhances HIF-1 signaling pathway in Huh7 cells. SERPINE1, as a member of HIF-1 signaling pathway, was significantly overexpressed in Huh7-CM group. In fact, however, SERPINE1 mRNA expression in Huh7 cells significantly decreased via co-culturing CAF cells with Huh7 cells. The large contrast in SERPINE1 expression levels led us to be interested in the function of SERPINE1 in HCC.\u003c/p\u003e \u003cp\u003eSERPINE1, a member of the serine protease inhibitor family, is an important regulator of extracellular matrix remodeling. SERPINE1 is also an inhibitor of plasminogen activator, regulating the plasminogen/plasminase system [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. SERPINE1 is involved in various physiological processes, including metabolism, inflammation, angiogenesis, cancer, and aging [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. SERPINE1 interacts with biological ligands including vitronectin and cell surface receptors to participate in pericellular proteolysis, tissue remodeling, and cell migration [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. It has been reported that SERPINE1 plays multiple roles in cancer progression, such as proliferation, migration, invasion, EMT, angiogenesis, and drug resistance [\u003cspan additionalcitationids=\"CR38\" citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. As a pan-oncogene, SERPINE1 is highly expressed in a variety of cancers and is associated with poor prognosis, such as gastric cancer [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e], lung cancer [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e], and colon cancer [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. In gastric cancer, SERPINE1 knockdown significantly inhibits the proliferation, migration, and invasion of gastric cancer cells, as well as the growth of xenograft tumor [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. In head and neck squamous cell carcinoma, SERPINE1 is directly associated with EMT, tumor cells stemness, and resistance to antitumor drugs [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. Overexpression of SERPINE1 increased the risk of metastasis of head and neck squamous cell carcinoma [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eInterestingly, SERPINE1 promotes senescence of lung cancer cells (A549 and H1299 cells) to inhibits tumor progression [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. However, other study have suggested that SERPINE1 expression is up-regulated and promotes lung cancer cell invasion [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. In HCC, CAF-CM promotes SERPINE1 expression in tumor-associated macrophages (TAM), thus promoting malignant progression of HCC cells through EMT [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. However, the biological role of SERPINE1 in HCC remains controversial. Jin et al. confirmed that the expression of SERPINE1 in HCC tissues was significantly higher than that in the paracancer tissue, and its expression was negatively correlated with overall survival, suggesting that high expression of SERPINE1 could predict poor prognosis of HCC [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. On the contrary, SERPINE1 expression is underexpressed in the patients with liver cancer according to the TCGA database. In this study, SERPINE1 knockdown significantly promoted the proliferation and invasion of Huh7 cell. These indicate that SERPINE1 is heterogeneous in expression and function in tumors, but it is certain that SERPINE1 is a tumor suppressor gene in Huh7 cells.\u003c/p\u003e \u003cp\u003eBased on predictions from multiple miRNA online databases, we found that SERPINE1 may be a target of miR-642a-3p. After co-culture with CAF, the expression of miR-642a-3p in Huh7 cells significantly increased. SERPINE1 knockdown increased the expression of miR-642a-3p in Huh7 cells, suggesting that miR-642a-3p may target the regulation of SERPINE1 expression. At present, studies on miR-642a-3p in cancers are scarce, with only a few reports that miR-642a-3p promotes invasion and metastasis of tumor [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e, \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e] and is related to tumor drug resistance [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e, \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]. Our study showed that miR-642a-3p had binding effect with SERPINE1 mRNA 3' UTR. miR-642a-3p mimics and inhibitor inhibited and promoted the expression of SERPINE1 gene and protein, respectively. More importantly, miR-642a-3p mimics promoted the migration, invasion, and EMT of Huh7 cells, whereas miR-642a-3p inhibitor had the opposite effect. \u003cem\u003eIn vivo\u003c/em\u003e study discovered that miR-642a-3p knockdown significantly inhibited tumor proliferation and spread in the liver. Unfortunately, the effect of miR-642a-3p on tumor metastasis could not be evaluated as the organ metastasis of the tumor was not observed. miR-642a-3p knockdown inhibited EMT in the livers, indirectly reflecting that miR-642a-3p may inhibit the invasion and metastasis of HCC.\u003c/p\u003e \u003cp\u003eIn short, miR-642a-3p/SERPINE1 axis can be used as the new molecular marker for HCC. However, due to the lack of clinical samples, the effect of miR-642a-3p on HCC staging and prognosis remains to be further studied.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the National Natural Science Foundation of China (No. 82104408, No. 82003961) and Scientific Research Project of Jiangsu Provincial Health Commission (No. Z2021081).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data underlying this article will be shared on reasonable request to the corresponding author.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026apos; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSZ and GC designed study, interpreted the data and wrote the manuscript. SZ, GC, SS, and YW performed experiments and analyzed data. XT provided experimental design ideas and funding. All authors contributed to and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAnimal experiment was approved by the Institutional Animal Care and Use Committee of Nanjing Ramda Pharmaceutical Co., Ltd.\u0026nbsp;(No. IACUC-20230505) and was performed per the Animal Care Committee. The study was reported in accordance with ARRIVE guidelines (https://arriveguidelines.org).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eGhafouri-Fard S, Honarmand Tamizkar K, Hussen BM, Taheri M. MicroRNA signature in liver cancer. Pathol Res Pract. 2021;219:153369.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRumgay H, Arnold M, Ferlay J, Lesi O, Cabasag CJ, Vignat J, Laversanne M, McGlynn KA, Soerjomataram I. Global burden of primary liver cancer in 2020 and predictions to 2040. J Hepatol. 2022;77(6):1598\u0026ndash;606.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVogel A, Meyer T, Sapisochin G, Salem R, Saborowski A. Hepatocellular carcinoma. Lancet (London England). 2022;400(10360):1345\u0026ndash;62.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHou Z, Liu J, Jin Z, Qiu G, Xie Q, Mi S, Huang J. Use of chemotherapy to treat hepatocellular carcinoma. Biosci Trends. 2022;16(1):31\u0026ndash;45.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou H, Song T. Conversion therapy and maintenance therapy for primary hepatocellular carcinoma. Biosci Trends. 2021;15(3):155\u0026ndash;60.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGanesan P, Kulik LM. Hepatocellular Carcinoma: New Developments. Clin Liver Dis. 2023;27(1):85\u0026ndash;102.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKalluri R. The biology and function of fibroblasts in cancer. Nat Rev Cancer. 2016;16(9):582\u0026ndash;98.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBiffi G, Tuveson DA. Diversity and Biology of Cancer-Associated Fibroblasts. Physiol Rev. 2021;101(1):147\u0026ndash;76.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMiyai Y, Esaki N, Takahashi M, Enomoto A. Cancer-associated fibroblasts that restrain cancer progression: Hypotheses and perspectives. Cancer Sci. 2020;111(4):1047\u0026ndash;57.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFiori ME, Di Franco S, Villanova L, Bianca P, Stassi G, De Maria R. Cancer-associated fibroblasts as abettors of tumor progression at the crossroads of EMT and therapy resistance. Mol Cancer. 2019;18(1):70.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKobayashi H, Enomoto A, Woods SL, Burt AD, Takahashi M, Worthley DL. Cancer-associated fibroblasts in gastrointestinal cancer. Nat reviews Gastroenterol Hepatol. 2019;16(5):282\u0026ndash;95.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHelms E, Onate MK, Sherman MH. Fibroblast Heterogeneity in the Pancreatic Tumor Microenvironment. Cancer Discov. 2020;10(5):648\u0026ndash;56.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu J, Li P, Wang L, et al. Cancer-Associated Fibroblasts Provide a Stromal Niche for Liver Cancer Organoids That Confers Trophic Effects and Therapy Resistance. Cell Mol Gastroenterol Hepatol. 2021;11(2):407\u0026ndash;31.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSong M, He J, Pan QZ, et al. Cancer-Associated Fibroblast-Mediated Cellular Crosstalk Supports Hepatocellular Carcinoma Progression. Hepatology (Baltimore MD). 2021;73(5):1717\u0026ndash;35.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYu L, Shen N, Shi Y, Shi X, Fu X, Li S, Zhu B, Yu W, Zhang Y. Characterization of cancer-related fibroblasts (CAF) in hepatocellular carcinoma and construction of CAF-based risk signature based on single-cell RNA-seq and bulk RNA-seq data. Front Immunol. 2022;13:1009789.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi D, Zhang J, Li J. Role of miRNA sponges in hepatocellular carcinoma. Clin Chim Acta. 2020;500:10\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHe B, Zhao Z, Cai Q, et al. miRNA-based biomarkers, therapies, and resistance in Cancer. Int J Biol Sci. 2020;16(14):2628\u0026ndash;47.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi B, Cao Y, Sun M, Feng H. Expression, regulation, and function of exosome-derived miRNAs in cancer progression and therapy. FASEB journal: official publication of the Federation of American Societies for Experimental Biology. 2021;35(10):e21916.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhu Q, Wang Z, Hu Y, Li J, Li X, Zhou L, Huang Y. miR-21 promotes migration and invasion by the miR-21-PDCD4-AP-1 feedback loop in human hepatocellular carcinoma. Oncol Rep. 2012;27(5):1660\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHan ZB, Chen HY, Fan JW, Wu JY, Tang HM, Peng ZH. Up-regulation of microRNA-155 promotes cancer cell invasion and predicts poor survival of hepatocellular carcinoma following liver transplantation. J Cancer Res Clin Oncol. 2012;138(1):153\u0026ndash;61.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXu WP, Liu JP, Feng JF, et al. miR-541 potentiates the response of human hepatocellular carcinoma to sorafenib treatment by inhibiting autophagy. Gut. 2020;69(7):1309\u0026ndash;21.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZailaie SA, Sergi CM. MiR-126 in Hepatocellular Carcinoma and Cholangiocellular Carcinoma: A Reappraisal with an in situ Detection of miR-126. Ann Clin Lab Sci. 2022;52(1):73\u0026ndash;85.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQi Y, Wang H, Zhang Q, Liu Z, Wang T, Wu Z, Wu W. CAF-Released Exosomal miR-20a-5p Facilitates HCC Progression via the LIMA1-Mediated β-Catenin Pathway. Cells. 2022;11(23).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBarrera LN, Ridley PM, Bermejo-Rodriguez C, Costello E, Perez-Mancera PA. The role of microRNAs in the modulation of cancer-associated fibroblasts activity during pancreatic cancer pathogenesis. J Physiol Biochem. 2023;79(1):193\u0026ndash;204.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSalah RA, Nasr MA, El-Derby AM, et al. Hepatocellular carcinoma cell line-microenvironment induced cancer-associated phenotype, genotype and functionality in mesenchymal stem cells. Life Sci. 2022;288:120168.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang Y, Pan Q, Shao Z. Extracellular vesicles derived from cancer-associated fibroblasts carry tumor-promotive microRNA-1228-3p to enhance the resistance of hepatocellular carcinoma cells to sorafenib. Hum Cell. 2023;36(1):296\u0026ndash;311.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAffo S, Yu LX, Schwabe RF. The Role of Cancer-Associated Fibroblasts and Fibrosis in Liver Cancer. Annu Rev Pathol. 2017;12:153\u0026ndash;86.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYin Z, Dong C, Jiang K, Xu Z, Li R, Guo K, Shao S, Wang L. Heterogeneity of cancer-associated fibroblasts and roles in the progression, prognosis, and therapy of hepatocellular carcinoma. J Hematol Oncol. 2019;12(1):101.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYing F, Chan MSM, Lee TKW. Cancer-Associated Fibroblasts in Hepatocellular Carcinoma and Cholangiocarcinoma. Cell Mol Gastroenterol Hepatol. 2023;15(4):985\u0026ndash;99.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi Y, Wang R, Xiong S, Wang X, Zhao Z, Bai S, Wang Y, Zhao Y, Cheng B. Cancer-associated fibroblasts promote the stemness of CD24(+) liver cells via paracrine signaling. J Mol Med. 2019;97(2):243\u0026ndash;55.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCheng Y, Li H, Deng Y, Tai Y, Zeng K, Zhang Y, Liu W, Zhang Q, Yang Y. Cancer-associated fibroblasts induce PDL1\u0026thinsp;+\u0026thinsp;neutrophils through the IL6-STAT3 pathway that foster immune suppression in hepatocellular carcinoma. Cell Death Dis. 2018;9(4):422.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDeng Y, Cheng J, Fu B, Liu W, Chen G, Zhang Q, Yang Y. Hepatic carcinoma-associated fibroblasts enhance immune suppression by facilitating the generation of myeloid-derived suppressor cells. Oncogene. 2017;36(8):1090\u0026ndash;101.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBalsara RD, Ploplis VA. Plasminogen activator inhibitor-1: the double-edged sword in apoptosis. Thromb Haemost. 2008;100(6):1029\u0026ndash;36.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen S, Li Y, Zhu Y, Fei J, Song L, Sun G, Guo L, Li X. SERPINE1 Overexpression Promotes Malignant Progression and Poor Prognosis of Gastric Cancer. J Oncol. 2022;2022:2647825.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSillen M, Declerck PJ. A Narrative Review on Plasminogen Activator Inhibitor-1 and Its (Patho)Physiological Role: To Target or Not to Target? Int J Mol Sci. 2021;22(5).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang L, Zhang X, Sheng J, et al. RBM4 regulates cellular senescence via miR1244/SERPINE1 axis. Cell Death Dis. 2023;14(1):27.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNagy \u0026Aacute;, Munk\u0026aacute;csy G, Győrffy B. Pancancer survival analysis of cancer hallmark genes. Sci Rep. 2021;11(1):6047.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHong CL, Yu IS, Pai CH, Chen JS, Hsieh MS, Wu HL, Lin SW, Huang HP. CD248 Regulates Wnt Signaling in Pericytes to Promote Angiogenesis and Tumor Growth in Lung Cancer. Cancer Res. 2022;82(20):3734\u0026ndash;50.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTeng F, Zhang JX, Chen Y, et al. LncRNA NKX2-1-AS1 promotes tumor progression and angiogenesis via upregulation of SERPINE1 expression and activation of the VEGFR-2 signaling pathway in gastric cancer. Mol Oncol. 2021;15(4):1234\u0026ndash;55.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang Y, Wang J, Gao J, Ding M, Li H. The expression of SERPINE1 in colon cancer and its regulatory network and prognostic value. BMC Gastroenterol. 2023;23(1):33.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePav\u0026oacute;n MA, Arroyo-Solera I, C\u0026eacute;spedes MV, Casanova I, Le\u0026oacute;n X, Mangues R. uPA/uPAR and SERPINE1 in head and neck cancer: role in tumor resistance, metastasis, prognosis and therapy. Oncotarget. 2016;7(35):57351\u0026ndash;66.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKong HJ, Kwon EJ, Kwon OS, Lee H, Choi JY, Kim YJ, Kim W, Cha HJ. Crosstalk between YAP and TGFβ regulates SERPINE1 expression in mesenchymal lung cancer cells. Int J Oncol. 2021;58(1):111\u0026ndash;21.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen S, Morine Y, Tokuda K, Yamada S, Saito Y, Nishi M, Ikemoto T, Shimada M. Cancer\u0026ndash;associated fibroblast\u0026ndash;induced M2\u0026ndash;polarized macrophages promote hepatocellular carcinoma progression via the plasminogen activator inhibitor\u0026ndash;1 pathway. Int J Oncol. 2021;59(2).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJin Y, Liang ZY, Zhou WX, Zhou L. Expression, clinicopathologic and prognostic significance of plasminogen activator inhibitor 1 in hepatocellular carcinoma. Cancer Biomark A. 2020;27(3):285\u0026ndash;93.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCao J, Shao H, Hu J, et al. Identification of invasion-metastasis associated MiRNAs in gallbladder cancer by bioinformatics and experimental validation. J translational Med. 2022;20(1):188.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang L, Zhang Y, Zhou J, Wang Y, Wang H, Huang M, Yu Q, Qi S. LncRNA NR2F1-AS1 Inhibits the Malignant Properties of Cervical Cancer Cells via Targeting miR-642a-3p/NR2F1 Axis. del Hosp de Enfermedades de la Nutricion. 2022;74(4):181\u0026ndash;92. Revista de investigacion clinica; organo.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYu C, Chen DQ, Liu HX, Li WB, Lu JW, Feng JF. Rosmarinic acid reduces the resistance of gastric carcinoma cells to 5-fluorouracil by downregulating FOXO4-targeting miR-6785-5p. Biomed pharmacotherapy = Biomedecine pharmacotherapie. 2019;109:2327\u0026ndash;34.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQin X, Yu S, Xu X, Shen B, Feng J. Comparative analysis of microRNA expression profiles between A549, A549/DDP and their respective exosomes. Oncotarget. 2017;8(26):42125\u0026ndash;35.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Hepatocellular carcinoma, miR-642a-3p, SERPINE1, Invasion, EMT","lastPublishedDoi":"10.21203/rs.3.rs-3571230/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3571230/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eHepatocellular carcinoma (HCC) is one of the most deadly malignancies. Due to the late detection of HCC, the treatment are not satisfactory, accompanied by poor prognosis. Therefore, early detection has important value for HCC treatment. MicroRNAs (miRNAs), the intercellular communication in the tumor microenvironment, are widely accepted as molecular markers of HCC. However, there are few studies on miRNAs involved in the crosstalk between cancer-associated fibroblast (CAF) and HCC cells. In the study, transcriptome sequencing, siRNA, co-culture, reverse transcription quantitative real-time PCR (RT-qPCR), western blot, dual-luciferase reporter system, and xenograft tumor model, were used to explore the role of miR-642a-3p/SERPINE1 axis in HCC progression. The results showed that in co-culture with CAF, the expression of SERPINE1 mRNA decreased, whereas miR-642a-3p expression increased in Huh7 cells. SERPINE1 knockdown significantly enhanced the invasion ability and increased miR-642a-3p expression in Huh7 cells. Dual-luciferase reporter assay discovered that miR-642a-3p had a binding effect with SERPINE1, suggesting that SERPINE1 was a target of miR-642a-3p. In addition, miR-642a-3p mimics inhibited SERPINE1 expression and promoted the migration, invasion, and EMT of Huh7 cells, whereas miR-642a-3p inhibitor had the opposite effect. More importantly, miR-642a-3p knockdown inhibited the proliferation and spread of xenograft tumors in the liver. miR-642a-3p knockdown significantly inhibited epithelial-mesenchymal transition (EMT) in the liver. These findings reveal that the miR-642a-3p/SERPINE1 axis plays an important role in the invasion and metastasis of HCC, and can be used as a novel therapeutic target for HCC.\u003c/p\u003e","manuscriptTitle":"CAF-related miR-642a-3p supports the migration, invasion, and EMT of hepatocellular carcinoma by targeting SERPINE1","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2023-12-07 15:41:11","doi":"10.21203/rs.3.rs-3571230/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"8c6389e0-7fa9-452f-a477-0141406e4f20","owner":[],"postedDate":"December 7th, 2023","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-01-09T12:44:10+00:00","versionOfRecord":[],"versionCreatedAt":"2023-12-07 15:41:11","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3571230","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3571230","identity":"rs-3571230","version":["v1"]},"buildId":"WrCJVZZCHTDjtuVLN7oU0","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}