Akkermansia Muciniphila Akk11 supplementation attenuates MPTP-induced neurodegeneration by inhibiting microglial NLRP3 inflammasome

Akkermansia Muciniphila Akk11 supplementation attenuates MPTP-induced neurodegeneration by inhibiting microglial NLRP3 inflammasome | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Akkermansia Muciniphila Akk11 supplementation attenuates MPTP-induced neurodegeneration by inhibiting microglial NLRP3 inflammasome Wei Wang, Ye Li, Mingyu Su, Shijie Shi, Xiaoyu Yao, Jiajun Jiang, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5388741/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 06 Mar, 2025 Read the published version in Probiotics and Antimicrobial Proteins → Version 1 posted 3 You are reading this latest preprint version Abstract The gut dysbiosis is associated with the progression of Parkinson's disease (PD). Probiotics have been demonstrated to impact disease progression via the gut-brain axis. This study aims to investigate the therapeutic potential of Akkermansia Muciniphila Akk11 (AKK11) in 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP)-induced PD mouse model. Our results indicated that AKK11 administration significantly improved the MPTP-induced behavioral abnormalities, reduced the loss of dopaminergic neurons, microglia activation, reversed the production of inflammatory cytokines, and colonic damage. Mechanistic studies showed that AKK11 administration suppressed inflammatory responses by inhibiting microglial NLRP3 inflammasome activation. In summary, AKK11 alleviated MPTP-induced motor deficits and neural damage by inhibiting microglial NLRP3 inflammasome. These findings suggest that AKK11 supplementation has therapeutic potential in treating PD through the gut-brain axis. Parkinson's disease Akkermansia Muciniphila inflammasome microglia Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Introduction Parkinson's disease (PD) is the second most common neurodegenerative disorder, and its incidence increases with the aging of the population. The typical pathological features of PD involve the degeneration and death of dopaminergic neurons in the substantia nigra pars compacta, leading to dysfunction in the nigrostriatal system. This causes motor impairments such as postural instability, bradykinesia, resting tremor, and rigidity 1 . Notably, PD patients also exhibit many non-motor symptoms, including olfactory dysfunction, constipation, sleep disturbances, depression, and cognitive impairment 2 . Gastrointestinal symptoms such as constipation and inflammatory bowel disease often precede motor dysfunction and may accelerate its progression 3 . Braak et.al proposed a theory suggesting that the deposition of α-synuclein in the gut may retrogradely transfer to the central nervous system and that α-synuclein accumulates in the colonic tissue of early and prodromal PD patients 4 . This body of evidence indicates that communication between the gut and the brain may contribute to the development and progression of PD. The gut microbiota plays a crucial role in coordinating communication between the gut and brain 5 . Changes in the gut microbiota can influence the immune system, the vagus nerve, the enteric nervous system (ENS), the neuroendocrine system, and the circulatory system, all of which may have profound effects on neurodegeneration 6 . The characteristics of gut microbiota dysbiosis in PD were elevated levels of potential pathogens, such as Shigella and Streptococcus 7 . These pathogens can disrupt the intestinal barrier, allowing harmful bacteria and toxins to cross the intestinal epithelium, which activates epithelial cells, immune cells, and enteric glial cells, ultimately promoting gut permeability and neuroinflammation 8 . Several studies have confirmed that correcting or restoring abnormal gut microbiota could have beneficial therapeutic effects for PD patients 9 . For instance, the consumption of probiotics such as Bifidobacterium has been shown to improve motor dysfunction, as assessed by the Movement Disorder Society-Unified Parkinson's Disease Rating Scale (MDS-UPDRS) 10 . Despite the significant potential of probiotics in regulating gut microbiota, research assessing the specific effects of individual probiotics on PD remains relatively limited. In this study, 16S rRNA sequencing analysis revealed a significant decreased in both α-diversity and β-diversity of the gut microbiota in PD mice, with a notable reduction in Akkermansia muciniphila . Akkermansia muciniphila has been shown to play a beneficial role in the microbiota-gut-brain axis by modulating the immune system and metabolites 11 . Here, we aim to evaluate the therapeutic potential of Akkermansia muciniphila in mitigating dopaminergic neuron degeneration and motor dysfunction in an MPTP-induced mouse model of PD. The strain Akkermansia muciniphila Akk11 (AKK11) used in this study was isolated from the feces of healthy infants in Hongyuan County, Sichuan, China, and is currently preserved at the German Collection of Microorganisms and Cell Cultures GmbH with the preservation number DSM 35205. Materials & methods Reagents MPTP (Sigma-Aldrich, M0896), Probenecid (MedChemExpress, HY-B0545), Polyvinylidene fluoride (PVDF) membranes (Millipore, ISEQ00010), Hieff UNICON qPCR SYBR green master mix (Shanghai YEASEN Biotech, 11198ES), Radioimmunoprecipitation assay (RIPA) buffer (Beyotime Biotechnology, P0013B), HiScript III first-strand cDNA synthesis kit (Vazyme Biotech, R312-02), β-actin (Proteintech, 60008-1-Ig), NLRP3 (AdipoGen, AG-20B-0014-C100), TH (Abcam, ab112), caspase-1 (Novus, NB100-56565), IL-1β (Proteintech, 26048-1-AP), Myd88 (Proteintech, 23230-1-AP), TLR4 (Proteintech,19811-1-AP), p65 (Cell Signaling Technology, 8242), IkB-α (Cell Signaling Technology, 4812), p-IkB-α (Cell Signaling Technology, 2859), Lamin B1 (Cell Signaling Technology, 13435), ZO-1 (Cell Signaling Technology, 13663), Occludin (Proteintech, 13409-1-AP), IBA-1 (Wako, 019-19741), Metronidazole (Sangon Biotech, A429689), Vancomycin (Sangon Biotech, A414413), Ampicillin (Sangon Biotech, A430258), Neomycin (Sangon Biotech, A430130), FastPure Cell/Tissue Total RNA Isolation Kit V2 (Vazyme, RC112-01), BIOG RNA Stool Kit, (Changzhou Bio-generating Biotechnology, 51035). Animals and experimental groups 8-week-old pathogen-free male C57BL/6 J mice were obtained from GemPharmatech Co., Ltd. (Nanjing, China). Mice were housed in a pathogen-free environment (12 h light/dark cycle) at room temperature (22 ± 1℃) and humidity (55 ± 5%). The animals were fed food pellets and water ad libitum. All animal procedures were carried out following the guidelines of the IACUC of Xuzhou Medical University (Experimental Animal Ethics No: 202209S042). Figure 1 A depicts the grouping and schedule for the animal experiments. Antibiotic treatment started when mice were five weeks old. An antibiotic cocktail was administered by oral gavage 200 µL for 7 consecutive days (1 g/L metronidazole, 0.5 g/L vancomycin, 1 g/L ampicillin, and 1 g/L neomycin). Mice were randomly assigned to 4 groups (n = 8 mice/group): NC (untreated control) group: received oral gavage of vehicle, MPTP group (received intraperitoneally MPTP (25mg/kg) and probenecid (250 mg/kg) and oral gavage of vehicle), MPTP + AKK11 group (received intraperitoneally MPTP (25mg/kg) and probenecid (250 mg/kg) and oral gavage of AKK11 (10 9 CFU/d)), AKK11 group (received oral gavage of AKK11 (10 9 CFU/d)). After 24 days of AKK11 treatment, the behavioral tests were conducted, and then the animals were sacrificed for subsequent analysis. AKK11 culture The AKK11 (CCTCC M2024119) was grown in brain heart infusion (BHI) broth (HB8297-4, Hopebio, China) under strict anaerobic conditions at 37°C. Then, cultures were centrifuged, washed, and diluted with anaerobic phosphate-buffered saline (PBS) containing 2.5% glycerol for oral administration in mice at a final concentration of 10 9 CFU/mL per 0.2 mL. Pole test Two days before the testing, all mice undergo acclimation training to familiarize themselves with the environment, thereby minimizing the impact of environmental changes on the experimental outcomes. During the formal test, mice are placed at the top of a vertical pole and are observed as they descend, with the time recorded until both forepaws touch the ground at the bottom. This process is repeated 3–5 times, with an interval of 5 minutes between each trial. The average time from the repeated trials is calculated for each mouse and subsequently subjected to statistical analysis. Rotor test The rotor test was used to assess motor coordination. Animals underwent three training sessions before the formal tests. Mice were trained at three incremental speeds (10, 20, 30 rpm) for 180 seconds per day for three days. For the formal experiment, the rotarod was set to 30 rpm, and the mice were placed on the rotarod. The latency time to fall was recorded. Open field test Two days before testing, the mice were acclimated to the environment to mitigate any stress associated with a new setting during the formal experiment. The open field consisted of a square arena measuring 50 cm × 50 cm with four walls, each 45 cm high. During the formal trial, the laboratory is maintained in a quiet and appropriately lit environment, with efforts made to minimize human intervention. Mice are gently placed in the center of the open field, and their behavior is recorded for a duration of 5 minutes. The total distance and entries in the center were recorded. Immunohistochemistry Brain tissue was sliced into 20 µm thick sections using a cryostat (CM1950, Leica, Wetzlar, Germany). The brain section was washed in PBS three times for 10 minutes each and then blocked with 0.5% bovine serum albumin for 2 h at room temperature. Next, the sections were incubated with primary antibodies: mouse anti-NLRP3 (1:1,000, AdipoGen), rabbit anti-TH (1:1,000, Abcam), and rabbit anti-Iba-1 (1: 10,000, Wako) overnight at 4℃. Subsequently, sections were washed with PBS and incubated with secondary antibodies: donkey anti-rabbit IgG H&L Alexa Fluor 594, goat anti-mouse IgG H&L Alexa Fluor 488, and goat anti-rabbit IgG H&L Alexa Fluor 488 for 2 h at room temperature. Following washing, brain sections were stained with DAPI and captured by microscope (Olympus, Tokyo, Japan). The images were analyzed using the ImageJ software. Quantitative Real-Time Polymerase Chain Reaction (RT-qPCR) Total RNA or DNA from tissue and faeces was extracted using a FastPure Cell/Tissue Total RNA Isolation Kit V2 (Vazyme) and Fast DNA Spin kit for soil (MP, USA) according to the manufacturer's instructions. The HiScript III first-strand cDNA synthesis kit was used for reverse transcription. Hieff UNICON qPCR SYBR Green Master Mix was used for qRT-PCR analysis on the Roche LightCycler 480 PCR System. The expression of the genes of interest was normalized to the levels of β-actin. The primers are described in Table 1 . Table 1 Primers information. Gene name Sequence Mouse β-actin Forward: TGTTACCAACTGGGACGACA Reverse: CTGGGTCATCTTTTCACGGT Mouse IL-10 Forward: CCCTTTGCTATGGTGTCCTT Reverse: TGTATTCCGTCTCCTTGGTTCA Mouse Arg-1 Forward: AAGCCAAGGTTAAAGCCACT Reverse: CGATTCACCTGAGCTTTGAT Mouse TGFβ Forward: TAGCAACAATTCCTGGCGTTAC Reverse: TGTATTCCGTCTCCTTGGTTCA Mouse IL-1β Forward: CTGAACTCAACTGTGAAATGC Reverse: TGATGTGCTGCTGCGAGA Mouse IL-6 Forward: CTCTGCAAGAGACTTCCATCCAGT Reverse: GAAGTAGGGAAGGCCGTGG Mouse TNF-α Forward: AGGGTCTGGGCCATAGAACT Reverse: CCACCACGCTCTTCTGTCTAC Akkermansia Muciniphila Forward: CAGCACGTGAAGGTGGGGAC Reverse: CCTTGCGGTTGGCTTCAGAT Hematoxylin and eosin (H&E) staining Hematoxylin and eosin (H&E) staining of colonic tissue was performed as previously reported. The colonic sections were captured by microscope (Olympus, Tokyo, Japan). Western Blot The mice colon and substantia nigra tissues were lysed using RIPA lysis buffer with protease inhibitor cocktail. Protein samples were separated using 10 ~ 12% SDS-PAGE and electrically transferred to polyvinylidene fluoride membranes. The membranes were blocked with 5% skimmed milk for 2 h at room temperature. Then the membranes were incubated overnight with primary antibodies for β-actin (1:3,000, Proteintech), NLRP3 (1: 1,000, AdipoGen), caspase-1 (1: 1,000, Novus), IL-1β (1: 1,000, Proteintech), Myd88 (1: 1,000, Proteintech), TLR4 (1: 1,000, Proteintech), p65 (1:1,000, Cell Signaling Technology), IkB-α (1:1,000, Cell Signaling Technology), p-IkB-α (1:1,000, Cell Signaling Technology), TH (1:1,000, Abcam), Lamin B1 (1:1,000, Cell Signaling Technology), ZO-1 (1:1,000, Cell Signaling Technology), Occludin (1:1,000, Proteintech) at 4℃ overnight. Then, the membranes were incubated with secondary antibodies for anti-mouse IRDye® 680RD-conjugated antibody and anti-rabbit IRDye® 800CW-conjugated antibody. The immunoblots were scan using the Odyssey dual-color infrared laser imaging scanner (Odyssey CLX, LI-COR, USA) and analyzed with Image J software. 16S rRNA sequencing Genomic DNA of MPTP and control mice fecal samples was extracted using the Fast DNA Spin kit for soil (MP, USA) following the manufacturer’s instructions. 16S rDNA gene sequencing was performed on the Illumina sequencing platform in LC-Bio Technology Co., Ltd. (Hangzhou, China). Rawdata was utilized overlap to merge paired-end data, followed by quality control and chimera filtering to obtain high-quality cleandata. DADA2 was used for quality control, and to generate OTU tables with 100% similarity (representative sequences with single-base resolution, significantly enhancing data accuracy and species resolution). ASVs (Amplicon Sequence Variants) are used to construct a class OTU (Operational Taxonomic Units) table, leading to the final ASV feature table and feature sequences for subsequent diversity analysis, species classification annotation, and differential analysis. Statistical analysis All data are presented as the mean ± standard error of the mean (SEM). The normality test was conducted by using the Shapiro-Wilk test. Comparison of two or multiple groups was performed using Student’s t-test or one-way ANOVA followed by Tukey’s multiple tests. For non-parametric distributions, the Kruskal-Wallis test was performed. P < 0.05 was considered statistically significant. All statistical analyses were performed using GraphPad Prism 8.0 and SPSS 22.0 statistical software. Results Alterations in the gut microbiota of PD mice Changes in the gut microbiota are significantly associated with the progression of neurodegenerative diseases. We first assessed the composition of the gut microbiota between PD and control mice. 16S rRNA sequencing analysis showed that as the sample size increased, the OTU curve gradually reached saturation, indicating sufficient sequencing depth ( Fig. 1 A and B) . The Venn diagram showed 2400 and 1280 unique OTUs detected in the PD and control groups, respectively ( Fig. 1 C ) . Compared to the control mice, the α-diversity of the gut microbiota in PD mice, including Chao 1 and observed_otus, was significantly reduced (Fig. 1 D). β-diversity, including Principal Coordinate Analysis (PCoA) and Non-metric Multidimensional Scaling (NMDS), showed significant differences in the gut microbiota structure between the PD and control mice ( Fig. 1 E and F) . Additionally, LEfSe analysis provided a more comprehensive comparison of the gut microbiota differences between the PD and control mice. The MPTP group showed a higher abundance of Muribaculaceae , Clostridiales , and Prevotellaceae compared to the control group ( Fig. 2 A). We then analyzed the impact of the gut microbiota abundance at the family and genus levels between the two groups. At these levels, we found that Akkermansia was the most differentially abundant bacterium between the two groups ( Fig. 2 B and C) . Furthermore, quantitative real-time PCR also demonstrated a significant reduction in the abundance of Akkermansia in the gut of PD mice (Fig. S1A) . These data suggested that the gut microbiota of PD mice undergoes significant alterations with a marked reduction in the abundance of Akkermansia . AKK11 alleviates MPTP-induced motor dysfunction To evaluate the neuroprotective effect of Akkermansia supplementation on MPTP-induced PD mice, we administered Akkermansia (AKK11) or Vehicle to mice via oral gavage following microbiota depletion using an antibiotic cocktail ( Fig. 3 A ) . RT-qPCR result showed a significant increase in Akkermansia colonization after oral supplementation (Fig. S1B) . Next, the OFT test, pole test, and rotarod test were used to assess the motor abilities of the mice in each group. The open field test results showed that the MPTP group performed worse in terms of total movement distance and the number of entries into the open area ( Fig. 3 C-D ) . In contrast, AKK11 supplementation significantly increased the total movement distance and the number of entries into the open area. The pole test results indicated that the MPTP mice took significantly longer to descend the pole compared to the NC group, whereas the MPTP + AKK11 group showed a significantly reduced descent time ( Fig. 3 E ) . The rotarod results demonstrated that the decreased time on the rotarod observed in MPTP mice was also ameliorated by AKK11 supplementation ( Fig. 3 F ) . These results indicated that AKK11 could improve MPTP-induced motor dysfunction in mice. AKK11 improves MPTP-induced dopaminergic neuron damage The main pathological feature of PD is the damage to dopaminergic neurons in the substantia nigra (SN), with TH being a rate-limiting enzyme involved in dopamine synthesis, and its immunoreactivity serving as an indicator of neuron survival. Therefore, we assessed the effect of AKK11 treatment on TH expression using immunofluorescence and immunoblotting. Compared to the control group, there was no significant difference in the number of TH neurons and TH protein expression in the AKK11 group. In contrast, MPTP-induced mice showed a reduction in TH-positive cells and TH protein expression compared to the control group ( Fig. 4 A and B) . However, in the MPTP + AKK11 group, the TH-positive cells and TH protein expression were significantly increased in the SN region ( Fig. 4 C and D) . These results suggested that AKK11 could significantly improve MPTP-induced loss of dopaminergic neurons. AKK11 reduces MPTP-induced microglial activation in mice Microglia are central mediators of immune responses, and their excessive activation can lead to neuroinflammation, ultimately exacerbating the progression of neurodegenerative diseases. To investigate the effect of AKK11 on MPTP-induced microglial activation in mice, we examined Iba-1-positive cell activation in the SN region using IHC. Compared to the NC group, MPTP treatment significantly increased the number of Iba-1 positive cells in the SN region, whereas the MPTP + AKK11 group showed a significant reduction in the number of Iba-1 positive cells ( Fig. 5 A and B) . Persistent microglial activation releases inflammatory cytokines, leading to neuronal damage. RT-qPCR showed that pro-inflammatory cytokines were significantly elevated and anti-inflammatory cytokines were decreased in the SN of MPTP-treated mice. AKK11 treatment significantly reduced the production of inflammatory cytokines in the SN of MPTP mice ( Fig. 5 C and D) . These results suggested that AKK11 reduced MPTP-induced microglial activation and inflammatory cytokine production, thereby alleviating the inflammatory response in mice. AKK11 inhibits NLRP3 inflammasome activation in the SN of PD mice The various endogenous signals or misfolded proteins can activate the NLRP3 inflammasome in microglia, and inflammasome activation-mediated neuroinflammatory responses play a significant role in the pathology of PD. Here, through immunofluorescence co-localization, the association between microglia and NLRP3 inflammasome in the SN can be observed. As shown in Fig. 6 , compared to the NC group, the NLRP3 inflammasome (green) is significantly activated in the microglial regions (green) in the MPTP group. After AKK11 treatment, the activation of microglia and the NLRP3 inflammasome is suppressed. Additionally, western blot also detected the expression of inflammasome-related proteins in the SN of mice. The results showed that, compared to the control group, the levels of NLRP3, ASC, pro-Caspase-1/Caspase-1 ratio, and pro-IL-1β/IL-1β ratio in the SN of MPTP mice were significantly elevated, while AKK11 supplementation significantly reversed the expression of these proteins ( Fig. 7 ) . These findings suggested that AKK11 inhibited the activation of the NLRP3 inflammasome in the SN of MPTP mice. AKK11 inhibits TLR4 signaling activation in the SN of PD mice Previous studies have shown that the TLR4/NF-κB signaling pathway is a key pathway for the activation of the NLRP3 inflammasome. Therefore, we investigated the effect of AKK11 on key molecules in the TLR4/NF-κB signaling pathway. Western blot results indicated that, compared to the NC group, the MPTP treatment promoted the protein expression of TLR4 and Myd88, and elevated the expression of p-IKBα, thereby weakening the inhibitory effect of IKBα on NF-κB, accelerating the expression of p65. In contrast, the MPTP + AKK11 group showed that AKK11 supplementation inhibited the expression of proteins related to the TLR4 pathway ( Fig. 8 A and B) . These results indicated that AKK11 supplementation inhibited the activation of the TLR4/NF-κB/NLRP3 inflammasome signaling pathway in the SN of MPTP mice. AKK11 alleviates MPTP-induced colonic damage and inflammatory response in mice A weakened intestinal barrier can lead to the translocation of bacteria and bacterial components, aggravating the progression of PD. Among them, the gut microbiota plays a crucial role in regulating and maintaining the integrity of the intestinal barrier. Therefore, we further investigated the effect of AKK11 on colonic damage and inflammatory responses in MPTP-induced mice. Our results indicated that, compared to the NC group, MPTP treatment led to impaired colonic integrity and increased infiltration of inflammatory cells, whereas, these effects were restored after the AKK11 intervention ( Fig. 9 A ) . We further examined the expression of key tight junction proteins (ZO-1, Occludin) in colon tissues. As shown in Fig. 9 B and C , compared to MPTP mice, after AKK11 intervention, the levels of ZO-1 and Occludin in the colons of MPTP mice were significantly increased. Moreover, RT-qPCR showed that pro-inflammatory factors were significantly elevated in the colons of the MPTP-treated group, while AKK11 treatment markedly reduced the colonic inflammatory response ( Fig. 9 C ) . These results indicated that AKK11 could alleviate colonic injury and suppress inflammatory responses in MPTP mice. Discussion The gut-microbiome-brain axis is a connection between the gastrointestinal tract, microbiota, and the central nervous system 12 . It's a complex communication network that influences gastrointestinal function, motor function, cognitive performance, and emotional controls 13 , 14 . Our findings indicated that the diversity and abundance of the gut microbiota in PD mice differ significantly from those in control mice, which consistent with previous research. Our results identified a significant reduction in Akkermansia muciniphila in PD mice. Akkermansia muciniphila has been shown to regulate the gut immune system and metabolites and is involved in the pathophysiology of various neuropsychiatric disorders. Therefore, this study aimed to evaluate the efficacy of oral Akkermansia muciniphila in the MPTP-induced mouse PD model. The results found that AKK11 administration alleviated motor deficits in MPTP mice and increased the number of dopaminergic neurons. Mennwhile, the extensive microglial activation and inflammatory factor expression observed in the SN of MPTP mice can be inhibited by AKK11. Mechanistically, AKK11 mitigated MPTP-induced dopaminergic neuronal damage by inhibiting microglial TLR4/NLRP3 inflammasome activation. Therefore, our results revealed that AKK11 supplementation may represent a novel therapeutic strategy for PD. Some studies have found that the abundance of Akkermansia muciniphila in the feces of PD patients is higher than in healthy participants, suggesting that Akkermansia muciniphila may be related to the pro-inflammatory state of PD 15 . A significant increase in the abundance of Akkermansia muciniphila was also found in the rotenone-induced PD model 16 . Interestingly, the abundance of Akkermansia muciniphila was reduced in MPTP mice in our study, which is consistent with other studies of MPTP mice 17 , 18 . The positive correlation between Akkermansia muciniphila and PD neuropathology may be attributed to its role in mucin degradation, as over-enrichment of Akkermansia muciniphila may alter the mucin degradation process, thereby impairing the intestinal barrier and inducing endotoxemia and systemic inflammation 19 , 20 . However, the mucin degradation by Akkermansia muciniphila may lead to a compensatory increase in mucin synthesis and exert anti-inflammatory effects in the host 21 , 22 . For example, during the fermentation of mucins, Akkermansia muciniphila produces short-chain fatty acids (SCFA) such as acetate and propionate, which improves intestinal integrity and reduces endotoxemia 23 , 24 . However, post-antibiotic Akkermansia supplementation exacerbated intestinal barrier damage and increased colonic and systemic inflammation, thereby interfering with the reestablishment of the gut microbiota and its metabolic function 25 . This may be attributed to after antibiotic intervention, the organism's microbiota was in a phase of dynamic remodeling, so there may be no benefit to intervening with probiotics 26 . In addition, Akkermansia muciniphila also exerts strain-specific physiological functions, as interspecific differences in Akkermansia muciniphila have been observed, which may explain the heterogeneity of the studies 27 . Different strains of the same species may show contradictory effects on the same disease, which demonstrates the importance of analyzing bacterial function at the strain level. Therefore, it is necessary to further investigate the efficacy of different sources of Akkermansia muciniphila to prove its efficacy and safety. The balance of the gut-brain axis primarily depends on the integrity of the intestinal barrier 28 . Our results showed that AKK11 intervention reduced intestinal damage and inhibited inflammatory responses in MPTP mice. To further understand how AKK11 intervention strengthens the intestinal barrier, we measured the expression of two different tight junction proteins (Occludin and ZO-1). The results indicated that the AKK11 supplement significantly increased the expression of Occludin and ZO-1, suggesting that AKK11 promotes intestinal barrier integrity by upregulating tight junction protein expression. Impaired intestinal permeability leads to the influx of harmful substances and disrupts intestinal homeostasis 29 . In PD mice, the dysbiosis of the gut microbiota and secretion of endotoxin, LPS, and pro-inflammatory factors activate systemic inflammatory response, which may further activate microglia in the brain 30 . Overactivation of microglia is associated with neuroinflammation and dopaminergic neurodegeneration in the pathogenesis of PD 31 . As a first-line host defense of microglia against pathogen invasion, TLR4 activates multiple downstream signaling pathways, such as the NF-κB signaling pathway. Activated NF-κB translocates to the nucleus, and induces pro-IL-1β and NLRP3 production, thereby triggering inflammation 32 . In this study, we found that AKK11 intervention could weaken the TLR4/NF-κB signaling pathway in the SN of MPTP mice, thereby inhibiting NLRP3 expression. Furthermore, we found that NLRP3 activation was reduced in microglia after AKK11 treatment. These results suggested that AKK11 could alleviate neuroinflammation induced by MPTP-induced PD mice. In the present study, we demonstrated for the first time that the anti-inflammatory effect of AKK11 may be related to its inhibition of TLR4/NF-κB/NLRP3 inflammasome activation in the SN region of PD mice. In conclusion, the present study provides evidence for the neuroprotective potential of AKK11 in the MPTP-induced PD mice model. AKK11 intervention attenuated MPTP-induced dopaminergic neuronal death, microglia activation, and motor deficits, and the underlying mechanism may involve the reduction of neuroinflammation through inhibition of TLR4/NF-κB/NLRP inflammasome activation. Our study may provide new insights into the use of probiotics to reduce neuronal damage in neurodegenerative diseases such as PD, which may serve as a potential therapeutic. Declarations Conflicts of interest The authors declare that there is no conflict of interest. Author contributions C.T., Z.W., and X.Q. conceived and designed the study. W.W., Y.L., S.S., X.Y., J.J., and W.Y. performed the experiments. analyzed the data. W.W., Y.L., C.T., and Z.W. wrote and revised the manuscript. All authors read and approved the final manuscript. Acknowledgments This work was funded by Research Foundation for Talented Scholars of Xuzhou Medical University (RC20552114, RC20552421) and Student Science and Technology Innovation Project (2024BMS09). Data availability The original contributions presented in the study are included in the article, further inquiries can be directed to the corresponding authors. References Ben-Shlomo Y, Darweesh S, Llibre-Guerra J, Marras C, San Luciano M, Tanner C (2024) The epidemiology of Parkinson's disease. Lancet 403:283–292 Kleiner G, Fernandez HH, Chou KL, Fasano A, Duque KR, Hengartner D, Law A, Margolius A, Poon YY, Saenz Farret M, Saleh P, Vizcarra JA, Stebbins GT (2021) Espay and P. S. G. N. S. Group, Non-Motor Fluctuations in Parkinson's Disease: Validation of the Non-Motor Fluctuation Assessment Questionnaire. Mov Disord 36:1392–1400 Chen Y, Wu W, Zhao S, Lv X, Hu J, Han C, Wang G, Wang S, Bo P, Zhang J, Gui W, Tang Q, Liu Q, Zhu S, Yu F (2021) Increased Accumulation of alpha-Synuclein in Inflamed Appendices of Parkinson's Disease Patients. Mov Disord 36:1911–1918 Wolters E, Braak H (2006) Parkinson's disease: premotor clinico-pathological correlations. J Neural Transm Suppl 309–319. 10.1007/978-3-211-45295-0_47 Robinson JM, Wissel EF, Breed MF (2024) Policy implications of the microbiota-gut-brain axis. Trends Microbiol 32:107–110 Zhuang M, Zhang X, Cai J (2024) Microbiota-gut-brain axis: interplay between microbiota, barrier function and lymphatic system. Gut Microbes 16:2387800 Li Z, Liang H, Hu Y, Lu L, Zheng C, Fan Y, Wu B, Zou T, Luo X, Zhang X, Zeng Y, Liu Z, Zhou Z, Yue Z, Ren Y, Li Z, Su Q, Xu P (2023) Gut bacterial profiles in Parkinson's disease: A systematic review. CNS Neurosci Ther 29:140–157 Cirstea MS, Yu AC, Golz E, Sundvick K, Kliger D, Radisavljevic N, Foulger LH, Mackenzie M, Huan T, Finlay BB (2020) Appel-Cresswell, Microbiota Composition and Metabolism Are Associated With Gut Function in Parkinson's Disease. Mov Disord 35:1208–1217 Kalyanaraman B, Cheng G, Hardy M (2024) Gut microbiome, short-chain fatty acids, alpha-synuclein, neuroinflammation, and ROS/RNS: Relevance to Parkinson's disease and therapeutic implications. Redox Biol 71:103092 Tamtaji OR, Taghizadeh M, Daneshvar Kakhaki R, Kouchaki E, Bahmani F, Borzabadi S, Oryan S, Mafi A, Asemi Z (2019) Clinical and metabolic response to probiotic administration in people with Parkinson's disease: A randomized, double-blind, placebo-controlled trial. Clin Nutr 38:1031–1035 Zhai Q, Feng S, Arjan N, Chen W (2019) A next generation probiotic, Akkermansia muciniphila. Crit Rev Food Sci Nutr 59:3227–3236 Osadchiy V, Martin CR, Mayer EA (2019) The Gut-Brain Axis and the Microbiome: Mechanisms and Clinical Implications. Clin Gastroenterol Hepatol 17:322–332 Liang X, Fu Y, Cao WT, Wang Z, Zhang K, Jiang Z, Jia X, Liu CY, Lin HR, Zhong H, Miao Z, Gou W, Shuai M, Huang Y, Chen S, Zhang B, Chen YM, Zheng JS (2022) Gut microbiome, cognitive function and brain structure: a multi-omics integration analysis. Transl Neurodegener 11:49 Liu L, Huh JR, Shah K (2022) Microbiota and the gut-brain-axis: Implications for new therapeutic design in the CNS. EBioMedicine 77:103908 Nie S, Wang J, Deng Y, Ye Z, Ge Y (2022) Inflammatory microbes and genes as potential biomarkers of Parkinson's disease. NPJ Biofilms Microbiomes 8:101 Chu C, Yu L, Li Y, Guo H, Zhai Q, Chen W, Tian F (2023) Lactobacillus plantarum CCFM405 against Rotenone-Induced Parkinson's Disease Mice via Regulating Gut Microbiota and Branched-Chain Amino Acids Biosynthesis. Nutrients, 15 Jeon H, Bae CH, Lee Y, Kim HY, Kim S (2021) Korean red ginseng suppresses 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine-induced inflammation in the substantia nigra and colon. Brain Behav Immun 94:410–423 Cui C, Shi Y, Hong H, Zhou Y, Qiao C, Zhao L, Jia X, Zhao W, Shen Y (2023) 5-HT4 Receptor is Protective for MPTP-induced Parkinson's Disease Mice Via Altering Gastrointestinal Motility or Gut Microbiota. J Neuroimmune Pharmacol 18:610–627 Seregin SS, Golovchenko N, Schaf B, Chen J, Pudlo NA, Mitchell J, Baxter NT, Zhao L, Schloss PD, Martens EC, Eaton KA, Chen GY (2017) Mice from Colitis by Limiting Colonization of Akkermansia muciniphila. Cell Rep 19:2174NLRP6 Protects Il10(-/- Khan S, Waliullah S, Godfrey V, Khan MAW, Ramachandran RA, Cantarel BL, Behrendt C, Peng L, Hooper LV, Zaki H (2020) Dietary simple sugars alter microbial ecology in the gut and promote colitis in mice. Sci Transl Med, 12 Meynier M, Daugey V, Mallaret G, Gervason S, Meleine M, Barbier J, Aissouni Y, Lolignier S, Bonnet M, Ardid D, De Vos WM, Van Hul M, Suenaert P, Brochot A, Cani PD, Carvalho FA (2024) Pasteurized akkermansia muciniphila improves irritable bowel syndrome-like symptoms and related behavioral disorders in mice. Gut Microbes 16:2298026 Daniel N, Gewirtz AT, Chassaing B (2023) Akkermansia muciniphila counteracts the deleterious effects of dietary emulsifiers on microbiota and host metabolism. Gut 72:906–917 Mo C, Lou X, Xue J, Shi Z, Zhao Y, Wang F, Chen G (2024) The influence of Akkermansia muciniphila on intestinal barrier function. Gut Pathog 16:41 He KY, Lei XY, Wu DH, Zhang L, Li JQ, Li QT, Yin WT, Zhao ZL, Liu H, Xiang XY, Zhu LJ, Cui CY, Wang KK, Wang JH, Lv L, Sun QH, Liu GL, Xu ZX, Jian YP (2023) Akkermansia muciniphila protects the intestine from irradiation-induced injury by secretion of propionic acid. Gut Microbes 15:2293312 Genua F, Raghunathan V, Jenab M, Gallagher WM, Hughes DJ (2021) The Role of Gut Barrier Dysfunction and Microbiome Dysbiosis in Colorectal Cancer Development. Front Oncol 11:626349 Jernberg C, Lofmark S, Edlund C, Jansson JK (2007) Long-term ecological impacts of antibiotic administration on the human intestinal microbiota. ISME J 1:56–66 Wu F, Guo X, Zhang M, Ou Z, Wu D, Deng L, Lu Z, Zhang J, Deng G, Chen S, Li S, Yi J, Peng Y (2020) An Akkermansia muciniphila subtype alleviates high-fat diet-induced metabolic disorders and inhibits the neurodegenerative process in mice. Anaerobe 61:102138 Parker A, Fonseca S, Carding SR (2020) Gut microbes and metabolites as modulators of blood-brain barrier integrity and brain health. Gut Microbes 11:135–157 Khan S, Luck H, Winer S, Winer DA (2021) Emerging concepts in intestinal immune control of obesity-related metabolic disease. Nat Commun 12:2598 Sampson TR, Debelius JW, Thron T, Janssen S, Shastri GG, Ilhan ZE, Challis C, Schretter CE, Rocha S, Gradinaru V, Chesselet MF, Keshavarzian A, Shannon KM, Krajmalnik-Brown R, Wittung-Stafshede P, Knight R, Mazmanian SK (2016) Gut Microbiota Regulate Motor Deficits and Neuroinflammation in a Model of Parkinson's Disease, Cell , 167, 1469–1480 e1412 Andersen MS, Bandres-Ciga S, Reynolds RH, Hardy J, Ryten M, Krohn L, Gan-Or Z, Holtman IR, Pihlstrom L (2021) International Parkinson's Disease Genomics, Heritability Enrichment Implicates Microglia in Parkinson's Disease Pathogenesis. Ann Neurol 89:942–951 Li Y, Chen X, Zhou M, Feng S, Peng X, Wang Y (2024) Microglial TLR4/NLRP3 Inflammasome Signaling in Alzheimer's Disease. J Alzheimers Dis 97:75–88 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 06 Mar, 2025 Read the published version in Probiotics and Antimicrobial Proteins → Version 1 posted Editor assigned by journal 05 Nov, 2024 Submission checks completed at journal 05 Nov, 2024 First submitted to journal 04 Nov, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5388741","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":374206145,"identity":"3a1a3205-d2a9-4692-a0c0-1cc7f4f11b3d","order_by":0,"name":"Wei Wang","email":"","orcid":"","institution":"Xuzhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"Wei","middleName":"","lastName":"Wang","suffix":""},{"id":374206146,"identity":"ad1b1249-a9fd-4ba5-af9f-4f4f8a06d31f","order_by":1,"name":"Ye Li","email":"","orcid":"","institution":"Xuzhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"Ye","middleName":"","lastName":"Li","suffix":""},{"id":374206148,"identity":"5c4fafd7-0ca9-4b46-8467-0733a1059b8d","order_by":2,"name":"Mingyu Su","email":"","orcid":"","institution":"Xuzhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"Mingyu","middleName":"","lastName":"Su","suffix":""},{"id":374206149,"identity":"c9ec301c-bc51-48a9-a8dc-cd1cb3408a84","order_by":3,"name":"Shijie Shi","email":"","orcid":"","institution":"Xuzhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"Shijie","middleName":"","lastName":"Shi","suffix":""},{"id":374206152,"identity":"fdbbe314-8b45-449e-83cc-53fca62504de","order_by":4,"name":"Xiaoyu Yao","email":"","orcid":"","institution":"Xuzhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"Xiaoyu","middleName":"","lastName":"Yao","suffix":""},{"id":374206160,"identity":"ae681416-b7e1-4d5c-ad13-58772754fd38","order_by":5,"name":"Jiajun Jiang","email":"","orcid":"","institution":"Wuxi School of Medicine，Jiangnan University","correspondingAuthor":false,"prefix":"","firstName":"Jiajun","middleName":"","lastName":"Jiang","suffix":""},{"id":374206163,"identity":"b12962cc-8201-4c07-b533-eda56e25f524","order_by":6,"name":"Wenxi Yao","email":"","orcid":"","institution":"Wuxi School of Medicine，Jiangnan University","correspondingAuthor":false,"prefix":"","firstName":"Wenxi","middleName":"","lastName":"Yao","suffix":""},{"id":374206164,"identity":"3a8d1c3f-5193-4265-93bc-f5af42311514","order_by":7,"name":"Xiaoling Qin","email":"","orcid":"","institution":"Shanghai Xuhui Central Hospital, Fudan University","correspondingAuthor":false,"prefix":"","firstName":"Xiaoling","middleName":"","lastName":"Qin","suffix":""},{"id":374206165,"identity":"4a311d84-8c38-4d86-81ae-0f2419fcc65a","order_by":8,"name":"Zhe Wang","email":"","orcid":"","institution":"Wecare Probiotics Co., Ltd","correspondingAuthor":false,"prefix":"","firstName":"Zhe","middleName":"","lastName":"Wang","suffix":""},{"id":374206166,"identity":"53aa5b9d-4306-4434-9dfb-cb22183891a8","order_by":9,"name":"Chuanxi Tang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA20lEQVRIiWNgGAWjYDACCQglx8DAA2YwNhChBazImHQtiQ1Ea+Gf3WP+4OeO2vQN588e3czDYCO74QDzswd4LblzLLGx98zx3JkN59Ju8zCkGW84wGZugE+LgUTywQbetmO5/Yw9ZkAthxM3HOBhk8CvJbGx8W/bsXQ2Zh6Qlv/EaEk+2MzbVpPAzwbWcoCwFokbaYmzZdsOGM7s4TG7Occg2XjmYTYzvFr4Z+QYfHzbVidvcP6M2Y03FXayfcebn+HVAgWHYe4EYmYi1ANBHXHKRsEoGAWjYGQCACPuSiD7wmqzAAAAAElFTkSuQmCC","orcid":"","institution":"Xuzhou Medical University","correspondingAuthor":true,"prefix":"","firstName":"Chuanxi","middleName":"","lastName":"Tang","suffix":""}],"badges":[],"createdAt":"2024-11-04 14:08:19","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5388741/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5388741/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s12602-025-10499-1","type":"published","date":"2025-03-06T15:56:58+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":69221374,"identity":"2f230fd3-89bf-450d-829f-9c57c9560a8f","added_by":"auto","created_at":"2024-11-18 07:13:06","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1650743,"visible":true,"origin":"","legend":"\u003cp\u003eComparison of gut microbiota diversity between PD and control mice. (A and B) Sparse curves based on the level of operational taxonomic unit (OTUs) of the gut flora; (C) Venn diagram representing OTUs among groups; (D) α diversity evaluation based on Chao1 and the observed_otus; (E) β diversity evaluation based on principal coordinates analysis (PCoA) and nonmetric multidimensional scaling (NMDS). Data represent the means ± SEM (n=6). ** P \u0026lt; 0.01.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-5388741/v1/3d875e10c6ccb863ab8185ca.png"},{"id":69220288,"identity":"a10d5494-b729-4580-ab02-dd5a7c7444c9","added_by":"auto","created_at":"2024-11-18 07:05:06","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1997285,"visible":true,"origin":"","legend":"\u003cp\u003eComparison of gut microbial composition between PD and control mice. (A) LEfSe analysis with LDA score representing statistical bacterial differences in gut microbiota between the PD and control mice; (B) Relative abundance of the gut microbiota at the species level. (C) Relative abundance of the gut microbiota at the genus level.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-5388741/v1/ba7aaca4149f3d85150b30ce.png"},{"id":69220295,"identity":"906ee31a-e71f-403a-abf8-5b626c719133","added_by":"auto","created_at":"2024-11-18 07:05:06","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":3332791,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of AKK11 on motor deficits in MPTP mice. (A) Flowchart of the experimental procedure; (B) Representative trajectory of the mice within the open field; (C)Total distance traveled and (D) entries in the center area in the open field; (E) Time spent from the top to the bottom of the pole; (F) Total time spent on the rotarod. Data represent the means ± SEM (n=6). *** P \u0026lt; 0.001, Control vs MPTP; ## P \u0026lt; 0.01, # P \u0026lt; 0.05, MPTP vs MPTP+AKK11.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-5388741/v1/891d375fe5ae5587f26817c4.png"},{"id":69221373,"identity":"7336978d-ad19-4402-b2ab-ef94163b35e2","added_by":"auto","created_at":"2024-11-18 07:13:06","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":9017602,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of AKK11 on dopaminergic neuron survival in the substantia nigra of MPTP mice.\u003c/p\u003e\n\u003cp\u003e(A) Representative immunofluorescence staining and (B) quantified number of TH+ cells in the substantia nigra; (C) Western blotting and (D) quantification of TH expression in the substantia nigra. Data represent the means ± SEM (n=4). *** P \u0026lt; 0.001, Control vs MPTP; ## P \u0026lt; 0.01 , MPTP vs MPTP+AKK11.\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-5388741/v1/9106e20a2f3504d7d8d63b6f.png"},{"id":69220290,"identity":"2a80ed2c-87b3-4c29-8c0c-c131f8362d70","added_by":"auto","created_at":"2024-11-18 07:05:06","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":4834588,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of AKK11 on microglia activation in the substantia nigra of MPTP mice.\u003c/p\u003e\n\u003cp\u003e(A) Representative immunofluorescence staining and (B) quantified number of Iba-1 cells in the substantia nigra; (C) Relative mRNA levels of the pro-inflammatory and anti-inflammatory cytokines in the substantia nigra. Data represent the means ± SEM (n=4). *** P \u0026lt; 0.001, Control vs MPTP; ## P \u0026lt; 0.01, # P \u0026lt; 0.05, MPTP vs MPTP+AKK11.\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-5388741/v1/a679288611bc4433afc42779.png"},{"id":69220291,"identity":"b8f233c1-8bbb-4ce9-92ce-d28a7455465d","added_by":"auto","created_at":"2024-11-18 07:05:06","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":4742291,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of AKK11 on microglia NLRP3 inflammasome activation in the substantia nigra of MPTP mice. Representative immunofluorescence staining of Iba-1 (red) and NLRP3 (green) in the substantia nigra.\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-5388741/v1/5ae7c21ae3e9da5446ecafc0.png"},{"id":69221375,"identity":"a979444b-0e2e-4bb6-94b5-91cebd210f45","added_by":"auto","created_at":"2024-11-18 07:13:06","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":1303781,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of AKK11 on NLRP3 inflammasome activation in the substantia nigra of MPTP mice. (A) Western blotting and (B) quantification NLRP3 inflammasome-related protein expression in the substantia nigra. Data represent the means ± SEM (n=4). *** P \u0026lt; 0.001, ** P \u0026lt; 0.01,Control vs MPTP; ## P \u0026lt; 0.01, # P \u0026lt; 0.05, MPTP vs MPTP+AKK11.\u003c/p\u003e","description":"","filename":"Figure7.png","url":"https://assets-eu.researchsquare.com/files/rs-5388741/v1/07d0a51ba10b27c7290af913.png"},{"id":69220296,"identity":"3618bfd4-1fe9-40e3-a2b6-9e6694c02ff6","added_by":"auto","created_at":"2024-11-18 07:05:06","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":1320254,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of AKK11 on TLR4/NF-κB signaling pathway activation in the substantia nigra of MPTP mice. (A) Western blotting and (B) quantification of TLR4, MyD88, IkBɑ, p-IkBɑ, and p65 protein expression. Data represent the means ± SEM (n=4). *** P \u0026lt; 0.001, * P \u0026lt; 0.05, Control vs MPTP; ### P \u0026lt; 0.001, # P \u0026lt; 0.05, MPTP vs MPTP+AKK11.\u003c/p\u003e","description":"","filename":"Figure8.png","url":"https://assets-eu.researchsquare.com/files/rs-5388741/v1/f065fa716fbc88518a1355fd.png"},{"id":69220294,"identity":"ef6f999f-08cd-4ab4-a15b-89fa08a01988","added_by":"auto","created_at":"2024-11-18 07:05:06","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":1906593,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of AKK11 on colonic damage in MPTP mice. (A) Representative hematoxylin-eosin staining images in the colon tissue; (B) Western blotting and (C) quantification of Occludin and ZO-1 protein expression in the colon tissue; (D) Relative mRNA levels of the pro-inflammatory and anti-inflammatory cytokines in the colon tissue. Data represent the means ± SEM (n=4). *** P \u0026lt; 0.001, ** P \u0026lt; 0.01, Control vs MPTP; ### P \u0026lt; 0.001, ## P \u0026lt; 0.01, # P \u0026lt; 0.05, MPTP vs MPTP+AKK11.\u003c/p\u003e","description":"","filename":"Figure9.png","url":"https://assets-eu.researchsquare.com/files/rs-5388741/v1/02218b5aa323b857e5333302.png"},{"id":78190981,"identity":"85a73df9-a211-4944-a773-2aba43a7c1c7","added_by":"auto","created_at":"2025-03-10 19:52:05","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":27497246,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5388741/v1/488b963f-ae51-42b4-91a8-1e4abb710b4c.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Akkermansia Muciniphila Akk11 supplementation attenuates MPTP-induced neurodegeneration by inhibiting microglial NLRP3 inflammasome","fulltext":[{"header":"Introduction","content":"\u003cp\u003eParkinson's disease (PD) is the second most common neurodegenerative disorder, and its incidence increases with the aging of the population. The typical pathological features of PD involve the degeneration and death of dopaminergic neurons in the substantia nigra pars compacta, leading to dysfunction in the nigrostriatal system. This causes motor impairments such as postural instability, bradykinesia, resting tremor, and rigidity\u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e. Notably, PD patients also exhibit many non-motor symptoms, including olfactory dysfunction, constipation, sleep disturbances, depression, and cognitive impairment\u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e. Gastrointestinal symptoms such as constipation and inflammatory bowel disease often precede motor dysfunction and may accelerate its progression\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e. Braak et.al proposed a theory suggesting that the deposition of α-synuclein in the gut may retrogradely transfer to the central nervous system and that α-synuclein accumulates in the colonic tissue of early and prodromal PD patients\u003csup\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e. This body of evidence indicates that communication between the gut and the brain may contribute to the development and progression of PD.\u003c/p\u003e \u003cp\u003eThe gut microbiota plays a crucial role in coordinating communication between the gut and brain\u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e. Changes in the gut microbiota can influence the immune system, the vagus nerve, the enteric nervous system (ENS), the neuroendocrine system, and the circulatory system, all of which may have profound effects on neurodegeneration\u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e. The characteristics of gut microbiota dysbiosis in PD were elevated levels of potential pathogens, such as \u003cem\u003eShigella\u003c/em\u003e and \u003cem\u003eStreptococcus\u003c/em\u003e\u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e. These pathogens can disrupt the intestinal barrier, allowing harmful bacteria and toxins to cross the intestinal epithelium, which activates epithelial cells, immune cells, and enteric glial cells, ultimately promoting gut permeability and neuroinflammation\u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e. Several studies have confirmed that correcting or restoring abnormal gut microbiota could have beneficial therapeutic effects for PD patients\u003csup\u003e\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003e. For instance, the consumption of probiotics such as \u003cem\u003eBifidobacterium\u003c/em\u003e has been shown to improve motor dysfunction, as assessed by the Movement Disorder Society-Unified Parkinson's Disease Rating Scale (MDS-UPDRS)\u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e. Despite the significant potential of probiotics in regulating gut microbiota, research assessing the specific effects of individual probiotics on PD remains relatively limited.\u003c/p\u003e \u003cp\u003eIn this study, 16S rRNA sequencing analysis revealed a significant decreased in both α-diversity and β-diversity of the gut microbiota in PD mice, with a notable reduction in \u003cem\u003eAkkermansia muciniphila\u003c/em\u003e. \u003cem\u003eAkkermansia muciniphila\u003c/em\u003e has been shown to play a beneficial role in the microbiota-gut-brain axis by modulating the immune system and metabolites\u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e. Here, we aim to evaluate the therapeutic potential of \u003cem\u003eAkkermansia muciniphila\u003c/em\u003e in mitigating dopaminergic neuron degeneration and motor dysfunction in an MPTP-induced mouse model of PD. The strain \u003cem\u003eAkkermansia muciniphila Akk11\u003c/em\u003e (AKK11) used in this study was isolated from the feces of healthy infants in Hongyuan County, Sichuan, China, and is currently preserved at the German Collection of Microorganisms and Cell Cultures GmbH with the preservation number DSM 35205.\u003c/p\u003e"},{"header":"Materials \u0026 methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eReagents\u003c/h2\u003e \u003cp\u003eMPTP (Sigma-Aldrich, M0896), Probenecid (MedChemExpress, HY-B0545), Polyvinylidene fluoride (PVDF) membranes (Millipore, ISEQ00010), Hieff UNICON qPCR SYBR green master mix (Shanghai YEASEN Biotech, 11198ES), Radioimmunoprecipitation assay (RIPA) buffer (Beyotime Biotechnology, P0013B), HiScript III first-strand cDNA synthesis kit (Vazyme Biotech, R312-02), β-actin (Proteintech, 60008-1-Ig), NLRP3 (AdipoGen, AG-20B-0014-C100), TH (Abcam, ab112), caspase-1 (Novus, NB100-56565), IL-1β (Proteintech, 26048-1-AP), Myd88 (Proteintech, 23230-1-AP), TLR4 (Proteintech,19811-1-AP), p65 (Cell Signaling Technology, 8242), IkB-α (Cell Signaling Technology, 4812), p-IkB-α (Cell Signaling Technology, 2859), Lamin B1 (Cell Signaling Technology, 13435), ZO-1 (Cell Signaling Technology, 13663), Occludin (Proteintech, 13409-1-AP), IBA-1 (Wako, 019-19741), Metronidazole (Sangon Biotech, A429689), Vancomycin (Sangon Biotech, A414413), Ampicillin (Sangon Biotech, A430258), Neomycin (Sangon Biotech, A430130), FastPure Cell/Tissue Total RNA Isolation Kit V2 (Vazyme, RC112-01), BIOG RNA Stool Kit, (Changzhou Bio-generating Biotechnology, 51035).\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eAnimals and experimental groups\u003c/h3\u003e\n\u003cp\u003e8-week-old pathogen-free male C57BL/6 J mice were obtained from GemPharmatech Co., Ltd. (Nanjing, China). Mice were housed in a pathogen-free environment (12 h light/dark cycle) at room temperature (22\u0026thinsp;\u0026plusmn;\u0026thinsp;1℃) and humidity (55\u0026thinsp;\u0026plusmn;\u0026thinsp;5%). The animals were fed food pellets and water ad libitum. All animal procedures were carried out following the guidelines of the IACUC of Xuzhou Medical University (Experimental Animal Ethics No: 202209S042). Figure\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA depicts the grouping and schedule for the animal experiments. Antibiotic treatment started when mice were five weeks old. An antibiotic cocktail was administered by oral gavage 200 \u0026micro;L for 7 consecutive days (1 g/L metronidazole, 0.5 g/L vancomycin, 1 g/L ampicillin, and 1 g/L neomycin). Mice were randomly assigned to 4 groups (n\u0026thinsp;=\u0026thinsp;8 mice/group): NC (untreated control) group: received oral gavage of vehicle, MPTP group (received intraperitoneally MPTP (25mg/kg) and probenecid (250 mg/kg) and oral gavage of vehicle), MPTP\u0026thinsp;+\u0026thinsp;AKK11 group (received intraperitoneally MPTP (25mg/kg) and probenecid (250 mg/kg) and oral gavage of AKK11 (10\u003csup\u003e9\u003c/sup\u003e CFU/d)), AKK11 group (received oral gavage of AKK11 (10\u003csup\u003e9\u003c/sup\u003e CFU/d)). After 24 days of AKK11 treatment, the behavioral tests were conducted, and then the animals were sacrificed for subsequent analysis.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e\n\u003ch3\u003eAKK11 culture\u003c/h3\u003e\n\u003cp\u003eThe AKK11 (CCTCC M2024119) was grown in brain heart infusion (BHI) broth (HB8297-4, Hopebio, China) under strict anaerobic conditions at 37\u0026deg;C. Then, cultures were centrifuged, washed, and diluted with anaerobic phosphate-buffered saline (PBS) containing 2.5% glycerol for oral administration in mice at a final concentration of 10\u003csup\u003e9\u003c/sup\u003e CFU/mL per 0.2 mL.\u003c/p\u003e\n\u003ch3\u003ePole test\u003c/h3\u003e\n\u003cp\u003eTwo days before the testing, all mice undergo acclimation training to familiarize themselves with the environment, thereby minimizing the impact of environmental changes on the experimental outcomes. During the formal test, mice are placed at the top of a vertical pole and are observed as they descend, with the time recorded until both forepaws touch the ground at the bottom. This process is repeated 3\u0026ndash;5 times, with an interval of 5 minutes between each trial. The average time from the repeated trials is calculated for each mouse and subsequently subjected to statistical analysis.\u003c/p\u003e\n\u003ch3\u003eRotor test\u003c/h3\u003e\n\u003cp\u003eThe rotor test was used to assess motor coordination. Animals underwent three training sessions before the formal tests. Mice were trained at three incremental speeds (10, 20, 30 rpm) for 180 seconds per day for three days. For the formal experiment, the rotarod was set to 30 rpm, and the mice were placed on the rotarod. The latency time to fall was recorded.\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eOpen field test\u003c/h2\u003e \u003cp\u003eTwo days before testing, the mice were acclimated to the environment to mitigate any stress associated with a new setting during the formal experiment. The open field consisted of a square arena measuring 50 cm \u0026times; 50 cm with four walls, each 45 cm high. During the formal trial, the laboratory is maintained in a quiet and appropriately lit environment, with efforts made to minimize human intervention. Mice are gently placed in the center of the open field, and their behavior is recorded for a duration of 5 minutes. The total distance and entries in the center were recorded.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eImmunohistochemistry\u003c/h3\u003e\n\u003cp\u003eBrain tissue was sliced into 20 \u0026micro;m thick sections using a cryostat (CM1950, Leica, Wetzlar, Germany). The brain section was washed in PBS three times for 10 minutes each and then blocked with 0.5% bovine serum albumin for 2 h at room temperature. Next, the sections were incubated with primary antibodies: mouse anti-NLRP3 (1:1,000, AdipoGen), rabbit anti-TH (1:1,000, Abcam), and rabbit anti-Iba-1 (1: 10,000, Wako) overnight at 4℃. Subsequently, sections were washed with PBS and incubated with secondary antibodies: donkey anti-rabbit IgG H\u0026amp;L Alexa Fluor 594, goat anti-mouse IgG H\u0026amp;L Alexa Fluor 488, and goat anti-rabbit IgG H\u0026amp;L Alexa Fluor 488 for 2 h at room temperature. Following washing, brain sections were stained with DAPI and captured by microscope (Olympus, Tokyo, Japan). The images were analyzed using the ImageJ software.\u003c/p\u003e\n\u003ch3\u003eQuantitative Real-Time Polymerase Chain Reaction (RT-qPCR)\u003c/h3\u003e\n\u003cp\u003eTotal RNA or DNA from tissue and faeces was extracted using a FastPure Cell/Tissue Total RNA Isolation Kit V2 (Vazyme) and Fast DNA Spin kit for soil (MP, USA) according to the manufacturer's instructions. The HiScript III first-strand cDNA synthesis kit was used for reverse transcription. Hieff UNICON qPCR SYBR Green Master Mix was used for qRT-PCR analysis on the Roche LightCycler 480 PCR System. The expression of the genes of interest was normalized to the levels of β-actin. The primers are described in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimers information.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequence\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eMouse β-actin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward: TGTTACCAACTGGGACGACA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse: CTGGGTCATCTTTTCACGGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eMouse IL-10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward: CCCTTTGCTATGGTGTCCTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse: TGTATTCCGTCTCCTTGGTTCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eMouse Arg-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward: AAGCCAAGGTTAAAGCCACT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse: CGATTCACCTGAGCTTTGAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eMouse TGFβ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward: TAGCAACAATTCCTGGCGTTAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse: TGTATTCCGTCTCCTTGGTTCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eMouse IL-1β\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward: CTGAACTCAACTGTGAAATGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse: TGATGTGCTGCTGCGAGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eMouse IL-6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward: CTCTGCAAGAGACTTCCATCCAGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse: GAAGTAGGGAAGGCCGTGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eMouse TNF-α\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward: AGGGTCTGGGCCATAGAACT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse: CCACCACGCTCTTCTGTCTAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eAkkermansia Muciniphila\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward: CAGCACGTGAAGGTGGGGAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse: CCTTGCGGTTGGCTTCAGAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eHematoxylin and eosin (H\u0026amp;E) staining\u003c/h2\u003e \u003cp\u003eHematoxylin and eosin (H\u0026amp;E) staining of colonic tissue was performed as previously reported.\u003c/p\u003e \u003cp\u003eThe colonic sections were captured by microscope (Olympus, Tokyo, Japan).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eWestern Blot\u003c/h2\u003e \u003cp\u003eThe mice colon and substantia nigra tissues were lysed using RIPA lysis buffer with protease inhibitor cocktail. Protein samples were separated using 10\u0026thinsp;~\u0026thinsp;12% SDS-PAGE and electrically transferred to polyvinylidene fluoride membranes. The membranes were blocked with 5% skimmed milk for 2 h at room temperature. Then the membranes were incubated overnight with primary antibodies for β-actin (1:3,000, Proteintech), NLRP3 (1: 1,000, AdipoGen), caspase-1 (1: 1,000, Novus), IL-1β (1: 1,000, Proteintech), Myd88 (1: 1,000, Proteintech), TLR4 (1: 1,000, Proteintech), p65 (1:1,000, Cell Signaling Technology), IkB-α (1:1,000, Cell Signaling Technology), p-IkB-α (1:1,000, Cell Signaling Technology), TH (1:1,000, Abcam), Lamin B1 (1:1,000, Cell Signaling Technology), ZO-1 (1:1,000, Cell Signaling Technology), Occludin (1:1,000, Proteintech) at 4℃ overnight. Then, the membranes were incubated with secondary antibodies for anti-mouse IRDye\u0026reg; 680RD-conjugated antibody and anti-rabbit IRDye\u0026reg; 800CW-conjugated antibody. The immunoblots were scan using the Odyssey dual-color infrared laser imaging scanner (Odyssey CLX, LI-COR, USA) and analyzed with Image J software.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e16S rRNA sequencing\u003c/h2\u003e \u003cp\u003eGenomic DNA of MPTP and control mice fecal samples was extracted using the Fast DNA Spin kit for soil (MP, USA) following the manufacturer\u0026rsquo;s instructions. 16S rDNA gene sequencing was performed on the Illumina sequencing platform in LC-Bio Technology Co., Ltd. (Hangzhou, China). Rawdata was utilized overlap to merge paired-end data, followed by quality control and chimera filtering to obtain high-quality cleandata. DADA2 was used for quality control, and to generate OTU tables with 100% similarity (representative sequences with single-base resolution, significantly enhancing data accuracy and species resolution). ASVs (Amplicon Sequence Variants) are used to construct a class OTU (Operational Taxonomic Units) table, leading to the final ASV feature table and feature sequences for subsequent diversity analysis, species classification annotation, and differential analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eAll data are presented as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard error of the mean (SEM). The normality test was conducted by using the Shapiro-Wilk test. Comparison of two or multiple groups was performed using Student\u0026rsquo;s t-test or one-way ANOVA followed by Tukey\u0026rsquo;s multiple tests. For non-parametric distributions, the Kruskal-Wallis test was performed. \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered statistically significant. All statistical analyses were performed using GraphPad Prism 8.0 and SPSS 22.0 statistical software.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eAlterations in the gut microbiota of PD mice\u003c/h2\u003e \u003cp\u003eChanges in the gut microbiota are significantly associated with the progression of neurodegenerative diseases. We first assessed the composition of the gut microbiota between PD and control mice. 16S rRNA sequencing analysis showed that as the sample size increased, the OTU curve gradually reached saturation, indicating sufficient sequencing depth \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA \u003cb\u003eand B)\u003c/b\u003e. The Venn diagram showed 2400 and 1280 unique OTUs detected in the PD and control groups, respectively \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC\u003cb\u003e)\u003c/b\u003e. Compared to the control mice, the α-diversity of the gut microbiota in PD mice, including Chao 1 and observed_otus, was significantly reduced (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). β-diversity, including Principal Coordinate Analysis (PCoA) and Non-metric Multidimensional Scaling (NMDS), showed significant differences in the gut microbiota structure between the PD and control mice \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE \u003cb\u003eand F)\u003c/b\u003e. Additionally, LEfSe analysis provided a more comprehensive comparison of the gut microbiota differences between the PD and control mice. The MPTP group showed a higher abundance of \u003cem\u003eMuribaculaceae\u003c/em\u003e, \u003cem\u003eClostridiales\u003c/em\u003e, and \u003cem\u003ePrevotellaceae\u003c/em\u003e compared to the control group \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). We then analyzed the impact of the gut microbiota abundance at the family and genus levels between the two groups. At these levels, we found that \u003cem\u003eAkkermansia\u003c/em\u003e was the most differentially abundant bacterium between the two groups \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB \u003cb\u003eand C)\u003c/b\u003e. Furthermore, quantitative real-time PCR also demonstrated a significant reduction in the abundance of Akkermansia in the gut of PD mice \u003cb\u003e(Fig. S1A)\u003c/b\u003e. These data suggested that the gut microbiota of PD mice undergoes significant alterations with a marked reduction in the abundance of \u003cem\u003eAkkermansia\u003c/em\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eAKK11 alleviates MPTP-induced motor dysfunction\u003c/h2\u003e \u003cp\u003eTo evaluate the neuroprotective effect of \u003cem\u003eAkkermansia\u003c/em\u003e supplementation on MPTP-induced PD mice, we administered \u003cem\u003eAkkermansia\u003c/em\u003e (AKK11) or Vehicle to mice via oral gavage following microbiota depletion using an antibiotic cocktail \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eA\u003cb\u003e)\u003c/b\u003e. RT-qPCR result showed a significant increase in Akkermansia colonization after oral supplementation \u003cb\u003e(Fig. S1B)\u003c/b\u003e. Next, the OFT test, pole test, and rotarod test were used to assess the motor abilities of the mice in each group. The open field test results showed that the MPTP group performed worse in terms of total movement distance and the number of entries into the open area \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eC-D\u003cb\u003e)\u003c/b\u003e. In contrast, AKK11 supplementation significantly increased the total movement distance and the number of entries into the open area. The pole test results indicated that the MPTP mice took significantly longer to descend the pole compared to the NC group, whereas the MPTP\u0026thinsp;+\u0026thinsp;AKK11 group showed a significantly reduced descent time \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eE\u003cb\u003e)\u003c/b\u003e. The rotarod results demonstrated that the decreased time on the rotarod observed in MPTP mice was also ameliorated by AKK11 supplementation \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eF\u003cb\u003e)\u003c/b\u003e. These results indicated that AKK11 could improve MPTP-induced motor dysfunction in mice.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eAKK11 improves MPTP-induced dopaminergic neuron damage\u003c/h2\u003e \u003cp\u003eThe main pathological feature of PD is the damage to dopaminergic neurons in the substantia nigra (SN), with TH being a rate-limiting enzyme involved in dopamine synthesis, and its immunoreactivity serving as an indicator of neuron survival. Therefore, we assessed the effect of AKK11 treatment on TH expression using immunofluorescence and immunoblotting. Compared to the control group, there was no significant difference in the number of TH neurons and TH protein expression in the AKK11 group. In contrast, MPTP-induced mice showed a reduction in TH-positive cells and TH protein expression compared to the control group \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003eA \u003cb\u003eand B)\u003c/b\u003e. However, in the MPTP\u0026thinsp;+\u0026thinsp;AKK11 group, the TH-positive cells and TH protein expression were significantly increased in the SN region \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003eC \u003cb\u003eand D)\u003c/b\u003e. These results suggested that AKK11 could significantly improve MPTP-induced loss of dopaminergic neurons.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eAKK11 reduces MPTP-induced microglial activation in mice\u003c/h2\u003e \u003cp\u003eMicroglia are central mediators of immune responses, and their excessive activation can lead to neuroinflammation, ultimately exacerbating the progression of neurodegenerative diseases. To investigate the effect of AKK11 on MPTP-induced microglial activation in mice, we examined Iba-1-positive cell activation in the SN region using IHC. Compared to the NC group, MPTP treatment significantly increased the number of Iba-1 positive cells in the SN region, whereas the MPTP\u0026thinsp;+\u0026thinsp;AKK11 group showed a significant reduction in the number of Iba-1 positive cells \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e5\u003c/span\u003eA \u003cb\u003eand B)\u003c/b\u003e. Persistent microglial activation releases inflammatory cytokines, leading to neuronal damage. RT-qPCR showed that pro-inflammatory cytokines were significantly elevated and anti-inflammatory cytokines were decreased in the SN of MPTP-treated mice. AKK11 treatment significantly reduced the production of inflammatory cytokines in the SN of MPTP mice \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e5\u003c/span\u003eC \u003cb\u003eand D)\u003c/b\u003e. These results suggested that AKK11 reduced MPTP-induced microglial activation and inflammatory cytokine production, thereby alleviating the inflammatory response in mice.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eAKK11 inhibits NLRP3 inflammasome activation in the SN of PD mice\u003c/h2\u003e \u003cp\u003eThe various endogenous signals or misfolded proteins can activate the NLRP3 inflammasome in microglia, and inflammasome activation-mediated neuroinflammatory responses play a significant role in the pathology of PD. Here, through immunofluorescence co-localization, the association between microglia and NLRP3 inflammasome in the SN can be observed. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e6\u003c/span\u003e, compared to the NC group, the NLRP3 inflammasome (green) is significantly activated in the microglial regions (green) in the MPTP group. After AKK11 treatment, the activation of microglia and the NLRP3 inflammasome is suppressed. Additionally, western blot also detected the expression of inflammasome-related proteins in the SN of mice. The results showed that, compared to the control group, the levels of NLRP3, ASC, pro-Caspase-1/Caspase-1 ratio, and pro-IL-1β/IL-1β ratio in the SN of MPTP mice were significantly elevated, while AKK11 supplementation significantly reversed the expression of these proteins \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e7\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e. These findings suggested that AKK11 inhibited the activation of the NLRP3 inflammasome in the SN of MPTP mice.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003eAKK11 inhibits TLR4 signaling activation in the SN of PD mice\u003c/h2\u003e \u003cp\u003ePrevious studies have shown that the TLR4/NF-κB signaling pathway is a key pathway for the activation of the NLRP3 inflammasome. Therefore, we investigated the effect of AKK11 on key molecules in the TLR4/NF-κB signaling pathway. Western blot results indicated that, compared to the NC group, the MPTP treatment promoted the protein expression of TLR4 and Myd88, and elevated the expression of p-IKBα, thereby weakening the inhibitory effect of IKBα on NF-κB, accelerating the expression of p65. In contrast, the MPTP\u0026thinsp;+\u0026thinsp;AKK11 group showed that AKK11 supplementation inhibited the expression of proteins related to the TLR4 pathway \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e8\u003c/span\u003eA \u003cb\u003eand B)\u003c/b\u003e. These results indicated that AKK11 supplementation inhibited the activation of the TLR4/NF-κB/NLRP3 inflammasome signaling pathway in the SN of MPTP mice.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003eAKK11 alleviates MPTP-induced colonic damage and inflammatory response in mice\u003c/h2\u003e \u003cp\u003eA weakened intestinal barrier can lead to the translocation of bacteria and bacterial components, aggravating the progression of PD. Among them, the gut microbiota plays a crucial role in regulating and maintaining the integrity of the intestinal barrier. Therefore, we further investigated the effect of AKK11 on colonic damage and inflammatory responses in MPTP-induced mice. Our results indicated that, compared to the NC group, MPTP treatment led to impaired colonic integrity and increased infiltration of inflammatory cells, whereas, these effects were restored after the AKK11 intervention \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e9\u003c/span\u003eA\u003cb\u003e)\u003c/b\u003e. We further examined the expression of key tight junction proteins (ZO-1, Occludin) in colon tissues. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e9\u003c/span\u003eB \u003cb\u003eand C\u003c/b\u003e, compared to MPTP mice, after AKK11 intervention, the levels of ZO-1 and Occludin in the colons of MPTP mice were significantly increased. Moreover, RT-qPCR showed that pro-inflammatory factors were significantly elevated in the colons of the MPTP-treated group, while AKK11 treatment markedly reduced the colonic inflammatory response \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e9\u003c/span\u003eC\u003cb\u003e)\u003c/b\u003e. These results indicated that AKK11 could alleviate colonic injury and suppress inflammatory responses in MPTP mice.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe gut-microbiome-brain axis is a connection between the gastrointestinal tract, microbiota, and the central nervous system\u003csup\u003e\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e. It's a complex communication network that influences gastrointestinal function, motor function, cognitive performance, and emotional controls\u003csup\u003e\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e. Our findings indicated that the diversity and abundance of the gut microbiota in PD mice differ significantly from those in control mice, which consistent with previous research. Our results identified a significant reduction in \u003cem\u003eAkkermansia muciniphila\u003c/em\u003e in PD mice. \u003cem\u003eAkkermansia muciniphila\u003c/em\u003e has been shown to regulate the gut immune system and metabolites and is involved in the pathophysiology of various neuropsychiatric disorders. Therefore, this study aimed to evaluate the efficacy of oral \u003cem\u003eAkkermansia muciniphila\u003c/em\u003e in the MPTP-induced mouse PD model. The results found that AKK11 administration alleviated motor deficits in MPTP mice and increased the number of dopaminergic neurons. Mennwhile, the extensive microglial activation and inflammatory factor expression observed in the SN of MPTP mice can be inhibited by AKK11. Mechanistically, AKK11 mitigated MPTP-induced dopaminergic neuronal damage by inhibiting microglial TLR4/NLRP3 inflammasome activation. Therefore, our results revealed that AKK11 supplementation may represent a novel therapeutic strategy for PD.\u003c/p\u003e \u003cp\u003eSome studies have found that the abundance of \u003cem\u003eAkkermansia muciniphila\u003c/em\u003e in the feces of PD patients is higher than in healthy participants, suggesting that \u003cem\u003eAkkermansia muciniphila\u003c/em\u003e may be related to the pro-inflammatory state of PD\u003csup\u003e\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u003c/sup\u003e. A significant increase in the abundance of \u003cem\u003eAkkermansia muciniphila\u003c/em\u003e was also found in the rotenone-induced PD model\u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e. Interestingly, the abundance of \u003cem\u003eAkkermansia muciniphila\u003c/em\u003e was reduced in MPTP mice in our study, which is consistent with other studies of MPTP mice\u003csup\u003e\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e. The positive correlation between \u003cem\u003eAkkermansia muciniphila\u003c/em\u003e and PD neuropathology may be attributed to its role in mucin degradation, as over-enrichment of \u003cem\u003eAkkermansia muciniphila\u003c/em\u003e may alter the mucin degradation process, thereby impairing the intestinal barrier and inducing endotoxemia and systemic inflammation\u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e. However, the mucin degradation by \u003cem\u003eAkkermansia muciniphila\u003c/em\u003e may lead to a compensatory increase in mucin synthesis and exert anti-inflammatory effects in the host\u003csup\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u003c/sup\u003e. For example, during the fermentation of mucins, \u003cem\u003eAkkermansia muciniphila\u003c/em\u003e produces short-chain fatty acids (SCFA) such as acetate and propionate, which improves intestinal integrity and reduces endotoxemia\u003csup\u003e\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e. However, post-antibiotic Akkermansia supplementation exacerbated intestinal barrier damage and increased colonic and systemic inflammation, thereby interfering with the reestablishment of the gut microbiota and its metabolic function\u003csup\u003e\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u003c/sup\u003e. This may be attributed to after antibiotic intervention, the organism's microbiota was in a phase of dynamic remodeling, so there may be no benefit to intervening with probiotics\u003csup\u003e\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/sup\u003e. In addition, \u003cem\u003eAkkermansia muciniphila\u003c/em\u003e also exerts strain-specific physiological functions, as interspecific differences in \u003cem\u003eAkkermansia muciniphila\u003c/em\u003e have been observed, which may explain the heterogeneity of the studies\u003csup\u003e\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e. Different strains of the same species may show contradictory effects on the same disease, which demonstrates the importance of analyzing bacterial function at the strain level. Therefore, it is necessary to further investigate the efficacy of different sources of \u003cem\u003eAkkermansia muciniphila\u003c/em\u003e to prove its efficacy and safety.\u003c/p\u003e \u003cp\u003eThe balance of the gut-brain axis primarily depends on the integrity of the intestinal barrier\u003csup\u003e\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/sup\u003e. Our results showed that AKK11 intervention reduced intestinal damage and inhibited inflammatory responses in MPTP mice. To further understand how AKK11 intervention strengthens the intestinal barrier, we measured the expression of two different tight junction proteins (Occludin and ZO-1). The results indicated that the AKK11 supplement significantly increased the expression of Occludin and ZO-1, suggesting that AKK11 promotes intestinal barrier integrity by upregulating tight junction protein expression. Impaired intestinal permeability leads to the influx of harmful substances and disrupts intestinal homeostasis\u003csup\u003e\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u003c/sup\u003e. In PD mice, the dysbiosis of the gut microbiota and secretion of endotoxin, LPS, and pro-inflammatory factors activate systemic inflammatory response, which may further activate microglia in the brain\u003csup\u003e\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u003c/sup\u003e. Overactivation of microglia is associated with neuroinflammation and dopaminergic neurodegeneration in the pathogenesis of PD\u003csup\u003e\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e. As a first-line host defense of microglia against pathogen invasion, TLR4 activates multiple downstream signaling pathways, such as the NF-κB signaling pathway. Activated NF-κB translocates to the nucleus, and induces pro-IL-1β and NLRP3 production, thereby triggering inflammation\u003csup\u003e\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u003c/sup\u003e. In this study, we found that AKK11 intervention could weaken the TLR4/NF-κB signaling pathway in the SN of MPTP mice, thereby inhibiting NLRP3 expression. Furthermore, we found that NLRP3 activation was reduced in microglia after AKK11 treatment. These results suggested that AKK11 could alleviate neuroinflammation induced by MPTP-induced PD mice. In the present study, we demonstrated for the first time that the anti-inflammatory effect of AKK11 may be related to its inhibition of TLR4/NF-κB/NLRP3 inflammasome activation in the SN region of PD mice.\u003c/p\u003e \u003cp\u003eIn conclusion, the present study provides evidence for the neuroprotective potential of AKK11 in the MPTP-induced PD mice model. AKK11 intervention attenuated MPTP-induced dopaminergic neuronal death, microglia activation, and motor deficits, and the underlying mechanism may involve the reduction of neuroinflammation through inhibition of TLR4/NF-κB/NLRP inflammasome activation. Our study may provide new insights into the use of probiotics to reduce neuronal damage in neurodegenerative diseases such as PD, which may serve as a potential therapeutic.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003ch2\u003eConflicts of interest\u003c/h2\u003e \u003cp\u003eThe authors declare that there is no conflict of interest.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eAuthor contributions\u003c/h2\u003e \u003cp\u003eC.T., Z.W., and X.Q. conceived and designed the study. W.W., Y.L., S.S., X.Y., J.J., and W.Y. performed the experiments. analyzed the data. W.W., Y.L., C.T., and Z.W. wrote and revised the manuscript. All authors read and approved the final manuscript.\u003c/p\u003e\u003ch2\u003eAcknowledgments\u003c/h2\u003e \u003cp\u003eThis work was funded by Research Foundation for Talented Scholars of Xuzhou Medical University (RC20552114, RC20552421) and Student Science and Technology Innovation Project (2024BMS09).\u003c/p\u003e\u003ch2\u003eData availability\u003c/h2\u003e \u003cp\u003eThe original contributions presented in the study are included in the article, further inquiries can be directed to the corresponding authors.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eBen-Shlomo Y, Darweesh S, Llibre-Guerra J, Marras C, San Luciano M, Tanner C (2024) The epidemiology of Parkinson's disease. Lancet 403:283\u0026ndash;292\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKleiner G, Fernandez HH, Chou KL, Fasano A, Duque KR, Hengartner D, Law A, Margolius A, Poon YY, Saenz Farret M, Saleh P, Vizcarra JA, Stebbins GT (2021) Espay and P. S. G. N. S. Group, Non-Motor Fluctuations in Parkinson's Disease: Validation of the Non-Motor Fluctuation Assessment Questionnaire. Mov Disord 36:1392\u0026ndash;1400\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen Y, Wu W, Zhao S, Lv X, Hu J, Han C, Wang G, Wang S, Bo P, Zhang J, Gui W, Tang Q, Liu Q, Zhu S, Yu F (2021) Increased Accumulation of alpha-Synuclein in Inflamed Appendices of Parkinson's Disease Patients. Mov Disord 36:1911\u0026ndash;1918\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWolters E, Braak H (2006) Parkinson's disease: premotor clinico-pathological correlations. J Neural Transm Suppl 309\u0026ndash;319. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/978-3-211-45295-0_47\u003c/span\u003e\u003cspan address=\"10.1007/978-3-211-45295-0_47\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRobinson JM, Wissel EF, Breed MF (2024) Policy implications of the microbiota-gut-brain axis. Trends Microbiol 32:107\u0026ndash;110\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhuang M, Zhang X, Cai J (2024) Microbiota-gut-brain axis: interplay between microbiota, barrier function and lymphatic system. Gut Microbes 16:2387800\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi Z, Liang H, Hu Y, Lu L, Zheng C, Fan Y, Wu B, Zou T, Luo X, Zhang X, Zeng Y, Liu Z, Zhou Z, Yue Z, Ren Y, Li Z, Su Q, Xu P (2023) Gut bacterial profiles in Parkinson's disease: A systematic review. CNS Neurosci Ther 29:140\u0026ndash;157\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCirstea MS, Yu AC, Golz E, Sundvick K, Kliger D, Radisavljevic N, Foulger LH, Mackenzie M, Huan T, Finlay BB (2020) Appel-Cresswell, Microbiota Composition and Metabolism Are Associated With Gut Function in Parkinson's Disease. Mov Disord 35:1208\u0026ndash;1217\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKalyanaraman B, Cheng G, Hardy M (2024) Gut microbiome, short-chain fatty acids, alpha-synuclein, neuroinflammation, and ROS/RNS: Relevance to Parkinson's disease and therapeutic implications. Redox Biol 71:103092\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTamtaji OR, Taghizadeh M, Daneshvar Kakhaki R, Kouchaki E, Bahmani F, Borzabadi S, Oryan S, Mafi A, Asemi Z (2019) Clinical and metabolic response to probiotic administration in people with Parkinson's disease: A randomized, double-blind, placebo-controlled trial. Clin Nutr 38:1031\u0026ndash;1035\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhai Q, Feng S, Arjan N, Chen W (2019) A next generation probiotic, Akkermansia muciniphila. Crit Rev Food Sci Nutr 59:3227\u0026ndash;3236\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOsadchiy V, Martin CR, Mayer EA (2019) The Gut-Brain Axis and the Microbiome: Mechanisms and Clinical Implications. Clin Gastroenterol Hepatol 17:322\u0026ndash;332\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiang X, Fu Y, Cao WT, Wang Z, Zhang K, Jiang Z, Jia X, Liu CY, Lin HR, Zhong H, Miao Z, Gou W, Shuai M, Huang Y, Chen S, Zhang B, Chen YM, Zheng JS (2022) Gut microbiome, cognitive function and brain structure: a multi-omics integration analysis. Transl Neurodegener 11:49\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu L, Huh JR, Shah K (2022) Microbiota and the gut-brain-axis: Implications for new therapeutic design in the CNS. EBioMedicine 77:103908\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNie S, Wang J, Deng Y, Ye Z, Ge Y (2022) Inflammatory microbes and genes as potential biomarkers of Parkinson's disease. NPJ Biofilms Microbiomes 8:101\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChu C, Yu L, Li Y, Guo H, Zhai Q, Chen W, Tian F (2023) Lactobacillus plantarum CCFM405 against Rotenone-Induced Parkinson's Disease Mice via Regulating Gut Microbiota and Branched-Chain Amino Acids Biosynthesis. Nutrients, 15\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJeon H, Bae CH, Lee Y, Kim HY, Kim S (2021) Korean red ginseng suppresses 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine-induced inflammation in the substantia nigra and colon. Brain Behav Immun 94:410\u0026ndash;423\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCui C, Shi Y, Hong H, Zhou Y, Qiao C, Zhao L, Jia X, Zhao W, Shen Y (2023) 5-HT4 Receptor is Protective for MPTP-induced Parkinson's Disease Mice Via Altering Gastrointestinal Motility or Gut Microbiota. J Neuroimmune Pharmacol 18:610\u0026ndash;627\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSeregin SS, Golovchenko N, Schaf B, Chen J, Pudlo NA, Mitchell J, Baxter NT, Zhao L, Schloss PD, Martens EC, Eaton KA, Chen GY (2017) Mice from Colitis by Limiting Colonization of Akkermansia muciniphila. Cell Rep 19:2174NLRP6 Protects Il10(-/-\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKhan S, Waliullah S, Godfrey V, Khan MAW, Ramachandran RA, Cantarel BL, Behrendt C, Peng L, Hooper LV, Zaki H (2020) Dietary simple sugars alter microbial ecology in the gut and promote colitis in mice. Sci Transl Med, 12\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMeynier M, Daugey V, Mallaret G, Gervason S, Meleine M, Barbier J, Aissouni Y, Lolignier S, Bonnet M, Ardid D, De Vos WM, Van Hul M, Suenaert P, Brochot A, Cani PD, Carvalho FA (2024) Pasteurized akkermansia muciniphila improves irritable bowel syndrome-like symptoms and related behavioral disorders in mice. Gut Microbes 16:2298026\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDaniel N, Gewirtz AT, Chassaing B (2023) Akkermansia muciniphila counteracts the deleterious effects of dietary emulsifiers on microbiota and host metabolism. Gut 72:906\u0026ndash;917\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMo C, Lou X, Xue J, Shi Z, Zhao Y, Wang F, Chen G (2024) The influence of Akkermansia muciniphila on intestinal barrier function. Gut Pathog 16:41\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHe KY, Lei XY, Wu DH, Zhang L, Li JQ, Li QT, Yin WT, Zhao ZL, Liu H, Xiang XY, Zhu LJ, Cui CY, Wang KK, Wang JH, Lv L, Sun QH, Liu GL, Xu ZX, Jian YP (2023) Akkermansia muciniphila protects the intestine from irradiation-induced injury by secretion of propionic acid. Gut Microbes 15:2293312\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGenua F, Raghunathan V, Jenab M, Gallagher WM, Hughes DJ (2021) The Role of Gut Barrier Dysfunction and Microbiome Dysbiosis in Colorectal Cancer Development. Front Oncol 11:626349\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJernberg C, Lofmark S, Edlund C, Jansson JK (2007) Long-term ecological impacts of antibiotic administration on the human intestinal microbiota. ISME J 1:56\u0026ndash;66\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu F, Guo X, Zhang M, Ou Z, Wu D, Deng L, Lu Z, Zhang J, Deng G, Chen S, Li S, Yi J, Peng Y (2020) An Akkermansia muciniphila subtype alleviates high-fat diet-induced metabolic disorders and inhibits the neurodegenerative process in mice. Anaerobe 61:102138\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eParker A, Fonseca S, Carding SR (2020) Gut microbes and metabolites as modulators of blood-brain barrier integrity and brain health. Gut Microbes 11:135\u0026ndash;157\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKhan S, Luck H, Winer S, Winer DA (2021) Emerging concepts in intestinal immune control of obesity-related metabolic disease. Nat Commun 12:2598\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSampson TR, Debelius JW, Thron T, Janssen S, Shastri GG, Ilhan ZE, Challis C, Schretter CE, Rocha S, Gradinaru V, Chesselet MF, Keshavarzian A, Shannon KM, Krajmalnik-Brown R, Wittung-Stafshede P, Knight R, Mazmanian SK (2016) Gut Microbiota Regulate Motor Deficits and Neuroinflammation in a Model of Parkinson's Disease, \u003cem\u003eCell\u003c/em\u003e, 167, 1469\u0026ndash;1480 e1412\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAndersen MS, Bandres-Ciga S, Reynolds RH, Hardy J, Ryten M, Krohn L, Gan-Or Z, Holtman IR, Pihlstrom L (2021) International Parkinson's Disease Genomics, Heritability Enrichment Implicates Microglia in Parkinson's Disease Pathogenesis. Ann Neurol 89:942\u0026ndash;951\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi Y, Chen X, Zhou M, Feng S, Peng X, Wang Y (2024) Microglial TLR4/NLRP3 Inflammasome Signaling in Alzheimer's Disease. J Alzheimers Dis 97:75\u0026ndash;88\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"probiotics-and-antimicrobial-proteins","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"paap","sideBox":"Learn more about [Probiotics and Antimicrobial Proteins](http://link.springer.com/journal/12601)","snPcode":"12602","submissionUrl":"https://submission.nature.com/new-submission/12602/3","title":"Probiotics and Antimicrobial Proteins","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Parkinson's disease, Akkermansia Muciniphila, inflammasome, microglia","lastPublishedDoi":"10.21203/rs.3.rs-5388741/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5388741/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThe gut dysbiosis is associated with the progression of Parkinson's disease (PD). Probiotics have been demonstrated to impact disease progression via the gut-brain axis. This study aims to investigate the therapeutic potential of \u003cem\u003eAkkermansia Muciniphila Akk11\u003c/em\u003e (AKK11) in 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP)-induced PD mouse model. Our results indicated that AKK11 administration significantly improved the MPTP-induced behavioral abnormalities, reduced the loss of dopaminergic neurons, microglia activation, reversed the production of inflammatory cytokines, and colonic damage. Mechanistic studies showed that AKK11 administration suppressed inflammatory responses by inhibiting microglial NLRP3 inflammasome activation. In summary, AKK11 alleviated MPTP-induced motor deficits and neural damage by inhibiting microglial NLRP3 inflammasome. These findings suggest that AKK11 supplementation has therapeutic potential in treating PD through the gut-brain axis.\u003c/p\u003e","manuscriptTitle":"Akkermansia Muciniphila Akk11 supplementation attenuates MPTP-induced neurodegeneration by inhibiting microglial NLRP3 inflammasome","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-11-18 07:05:01","doi":"10.21203/rs.3.rs-5388741/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"editorAssigned","content":"","date":"2024-11-05T06:54:03+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-11-05T06:50:52+00:00","index":"","fulltext":""},{"type":"submitted","content":"Probiotics and Antimicrobial Proteins","date":"2024-11-04T13:57:28+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"probiotics-and-antimicrobial-proteins","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"paap","sideBox":"Learn more about [Probiotics and Antimicrobial Proteins](http://link.springer.com/journal/12601)","snPcode":"12602","submissionUrl":"https://submission.nature.com/new-submission/12602/3","title":"Probiotics and Antimicrobial Proteins","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"65e8aa30-ebae-4c9a-ab30-10ca2d63720a","owner":[],"postedDate":"November 18th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-03-10T19:51:22+00:00","versionOfRecord":{"articleIdentity":"rs-5388741","link":"https://doi.org/10.1007/s12602-025-10499-1","journal":{"identity":"probiotics-and-antimicrobial-proteins","isVorOnly":false,"title":"Probiotics and Antimicrobial Proteins"},"publishedOn":"2025-03-06 15:56:58","publishedOnDateReadable":"March 6th, 2025"},"versionCreatedAt":"2024-11-18 07:05:01","video":"","vorDoi":"10.1007/s12602-025-10499-1","vorDoiUrl":"https://doi.org/10.1007/s12602-025-10499-1","workflowStages":[]},"version":"v1","identity":"rs-5388741","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5388741","identity":"rs-5388741","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}