Exposure to a glyphosate-based herbicide does not alter maternal care and offspring quality in the European earwig | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Exposure to a glyphosate-based herbicide does not alter maternal care and offspring quality in the European earwig Laura Pasquier, Julie Groutsch, Maïlys Verger, Violette Wallart, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5004621/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 25 Jun, 2025 Read the published version in Ecotoxicology → Version 1 posted 10 You are reading this latest preprint version Abstract Sublethal exposure to pesticides can affect the reproduction and population dynamics of many non-target organisms, such as insects. Among these pesticides, glyphosate-based herbicides (GBHs) were long thought to have no effect on insects because their active compounds can only affect plants and microorganisms. However, a growing body of evidence suggests that GBH can directly or indirectly alter a wide range of fitness-related traits in insects. In this study, we tested whether exposure to the GBH Roundup© affects maternal care behaviour and juvenile development, locomotion and immunity in the European earwig, an insect commonly found in vineyards and orchards. First, we exposed female earwigs to Roundup at concentrations ten times below, equal to and ten times above the normal application rate (NAR) and then measured the expression of maternal care in terms of egg collection, egg and juvenile care, and egg and juvenile defense. We also measured maternal self-grooming and locomotor activity, and the development time, weight and size of newly produced juveniles. In a second experiment, we exposed earwig juveniles to a control solution or to Roundup and then measured their locomotion, the expression of genes involved in their development (the juveniles hormone pathway), and their survival after exposure to a fungal pathogen. Overall, our results showed no significant effect of Roundup on any of the parameters measured. This finding suggests that direct exposure to a GBH may not necessarily induce behavioural, physiological and developmental alteration in this species. It also calls for future studies to explore the underlying mechanisms behind this apparent lack of sensibility. More generally, these results highlight the importance of assessing the impact of pesticide use and the factors driving potential resilience across a wide range of non-target organisms to ensure sustainable agricultural practices. Forficula auricularia Maternal care Pesticide Pest control Larvae Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction Glyphosate, or N-(phosphonomethyl) glycine, is the active ingredient in Roundup, one of the world’s most widely used herbicides in small and large scale crop production (Benbrook, 2016 ). This molecule typically acts by inhibiting the 5-enolpyruvyl shikimate-3-phosphate synthase (EPSPS), an enzyme that enables the biosynthesis of aromatic amino acids in plants, fungi and bacteria (Duke and Powles, 2008 ). Because this enzyme is not present in animals, it was long thought that exposure to glyphosate-based herbicide (GBH) would have no effect on mammals, birds and arthropods. However, a growing body of evidence indicates that this is not necessarily the case. In a taxonomically large number of species, exposure to GBH has been shown to alter fitness-related traits such as behaviour, development, and immunity (for review de Brito Rodrigues et al. 2017; Battisti et al. 2021; Talyn et al. 2023). For example, GBH exposure modifies locomotor activity in termites, cockroaches and in rats (Ekaye et al., 2022 ; Kanabar et al., 2021 ; Rocha et al., 2019 ), alters the moulting and metamorphosis process in juveniles of Spodoptera littoralis , Spodoptera frugiperda and honey bees (El-Sheikh et al., 2016 ; Vázquez et al., 2018 ), reduces immunocompetence and immunity in silkworms (Feng et al., 2023 ), as well as impairs reproduction in the mallard duck (Oliveira et al., 2007 ) and other birds population in wetlands (Linz et al., 1996 ; Santillo et al., 1989 ). The mechanisms driving these alterations remain unclear and are often attributed to the toxic impact of adjuvants present in GBHs (Defarge et al., 2018 ), GBH-induced changes in the host microbiota (Cullen et al., 2023 ; Vázquez et al., 2018 ), and/or endocrine disruptor properties of GBH (for reviews see Kalofiri et al., 2021 ; Levine et al., 2020 ; Muñoz et al., 2021 ). They may also involve other physiological parameters of the hosts, as suggested by the age-specific effects of GBH – stronger effects in juveniles than adults - reported in some mammals (Pope and Liu, 1997 ) and insects (Fogel et al., 2016 ; Stuijfzand et al., 2000 ). In addition to the host traits detailed above, recent data indicate that GBHs may also alter the expression of social behaviours, such as maternal care, which have major implications for individual fitness and population dynamics (Cummings et al., 2010 ; Fong-McMaster et al., 2020 ). For instance, GBH exposure decreases the amount of time mothers spend caring for their offspring in rats (Dechartres et al., 2019 ) and reduces the expression of maternal defensive and grooming behaviours in rats and mice (Ait-Bali et al., 2020 ; Rocha et al., 2019 ). However, these data are mostly from studies in mammals, raising questions about the effect of GBH exposure on the expression of parental care in other animals, including insects. This lack of data on insects is surprising for three main reasons. First, parental care is a taxonomically widespread phenomenon in arthropods (Machado and Trumbo, 2018 ; Meunier et al., 2022 ), in which it is well documented that even subtle changes in the expression of this behaviour can dramatically affect reproduction and population dynamics, with major consequences for terrestrial ecosystems functioning, biodiversity maintenance, and crop protection (Schowalter et al., 2018 ). Second, studies suggest that exposure to various pesticides and chemical pollutants can alter insect parental care, opening the possibility of an effect of GBHs on this trait (de Oliveira et al., 2022 ; Gallegos et al., 2016 ). Finally, insects are frequently exposed to GBHs in crops and gardens (Mazzia et al., 2015 ). Studying their effects is, therefore, biologically relevant and timely, as it could enhance our understanding of the maintenance and population dynamics of many species that play crucial role in current agroecosystems. The European earwig is an ideal species to study the effect of GBH on maternal care, as it is well known for the extensive care that mothers give to their eggs and newly hatched juveniles, and its ubiquity in multiple agricultural areas worldwide (Honorio et al., 2024 ; Meunier, 2024 ; Orpet et al., 2019 ). Earwig mothers typically care for their egg during 50 days, during which they regularly groom, clean and move their eggs during development (Koch and Meunier, 2014 ; Thesing et al., 2015 ). They then care for their juveniles (called nymphs) for two weeks, providing them with food, protecting them against pathogens and defending them against predators (Kölliker, 2007 ; Lamb, 1976 ). Unlike egg care, post-hatching care is facultative in this species, as newly hatched nymphs quickly become mobile and able to forage independently (Wong and Kölliker, 2012 ). Regardless of its maternal care, the European earwig is widespread in vineyards and orchards, where a wide variety of pesticides and herbicides are frequently used (Malagnoux et al., 2015b ). This species is considered a crop auxiliary in pip-fruit orchards, where it feeds on aphids, moths and psyllids without eating the fruit, while it is considered a pest in stone fruit orchards, where it also feeds on leaves and fruit (Alins et al., 2023 ; Dib et al., 2011 ; Orpet et al., 2019 ). Previous studies have shown that exposure of earwig females to pesticides such as deltamethrin reduces the expression of maternal care and increases their investment in future reproduction (Mauduit et al., 2021a ; Meunier et al., 2020 ). Similarly, a recent study showed that direct exposure of males to the GBH Roundup© altered their locomotor activity, but not their boldness, aggregation level or immunity (Pasquier et al., 2024 ). In contrast, female exposure to other chemicals such as cadmium, an heavy metal pollutant, and pyriproxyfen, another pesticide, does not alter the expression of maternal care (Honorio et al., 2023a , 2023b ; Merleau et al., 2022 ). In this study, we conducted two experiments in the European earwig to investigate the effects of (1) direct exposure of females to GBH on the expression of maternal care and the associated clutch fate, and (2) direct exposure of juveniles to GBH on their behaviour, pathogen resistance and expression of genes involved in the development. In the first experiment, we exposed 239 females to one of four solutions of a glyphosate formulation commonly used in domestic gardens (RoundUp GT Max®, Scotts France SAS) and then measured the expression of six classical forms of egg and nymph care, as well as the development time and hatching rate of their eggs, and the size and weight of newly hatched nymphs. In the second experiment, we exposed 282 nymphs to either a control solution or a solution containing the highest concentration of the same glyphosate formulation (detailed above) and then measured their general activity, the expression of genes involved in their development (JH pathway) and their survival after infection with the common entomopathogenic fungus Metarhizium brunneum . Overall, we predicted that female exposure to GBH induces changes in their expression of maternal care and the development/quality of their resulting nymphs, and that juvenile exposure to GBH alters their behaviour, gene expression of JH production and survival to pathogen infection. Materials and methods 2.1 Animal breeding and overview of experiments 1 and 2 The two experiments involved 239 field-sampled females and 282 of their first generation laboratory-born nymphs. All these individuals belonged to Forficula auricularia Linneaus, 1758, also called Forficula auricularia clade A (González-Miguéns et al., 2020 ). We collected the females in July 2022 in an organic peach orchard near Valence, France (Lat 44.978526, Long 4.926383). We then maintained them under standard laboratory conditions until oviposition, which occurred in December 2022 (Mauduit et al., 2021b ; Merleau et al., 2022 ). The first experiment started 16 days after oviposition. On that day, we counted and trimmed the number of eggs produced by each mother to 25 to standardise the amount of care subsequently required by the clutch. We then exposed each mother to one of three doses of glyphosate formulation or a control solution and subsequently used standard protocols to measure the expression of care and non-care behaviours, as well as the clutch fate (see details below). The second experiment started nine days after egg hatching. On that day, we isolated 235 nymphs from 56 control clutches (4 ± 2 nymphs per clutch), exposed each of them to either a high dose of glyphosate formulation or a control solution and then used standard protocols to measure their locomotor activity and immune competence and for gene expression, we isolated 47 nymphs from 24 control clutches of the 56 previous clutches (2 ± 1 nymphs per clutch) using the same protocol (see details below). Throughout the two experiments, females, eggs and nymphs were maintained under standard laboratory conditions (Meunier et al., 2012 ). From oviposition to hatching, each female and her eggs were kept in small Petri dishes (diameter 5 cm) at a constant 10°C in the dark. From hatching, each female and her nymphs were maintained in large Petri dishes (diameter 9 cm) under 12:12 light:dark cycle at 20:18°C, respectively. Each Petri dish was lined with moist sand. Before oviposition and after egg hatching, each female (and her nymphs) was fed with laboratory prepared diet consisting mainly of a mixture of pollen, cat food and bird seed (details in Kramer, Thesing, et Meunier 2015). The food was changed once a week. We did not provide food to the mothers between oviposition and egg hatching, as females typically stop their foraging activity during this period (Kölliker, 2007 ). 2.2 Exposures of mothers and nymphs to glyphosate-based herbicide In the first experiment, we exposed 239 females to one of four doses of the glyphosate formulation. For this exposure, we used RoundUp GT Max® (Scotts France SAS) and followed a standard protocol that mimics earwig exposure to pesticides (including RoundUp GT Max®) through contact with a contaminated surface (Malagnoux et al., 2015a ; Meunier et al., 2020 ; Pasquier et al., 2024 ). Following (Pasquier et al., 2024 ), we prepared four GBH solutions by diluting RoundUp GT Max in milliQ water at concentrations equal to the Normal Application Rate (NAR) (240mg/m²; N = 60), 10 times lower than NAR (24mg/m²; N = 60), 10 times higher than NAR (2400mg/m²; N = 59), or to a control solution (0mg/m²; N = 60). As an indication, French tree growers use an average of 1,500g/ha (= 150 mg/m²) of GBH in their crops (ANSES, 2020 ). We applied 200µL of each of these solutions evenly to filter papers (VWR 516–0812; diameter 5.5 cm) previously placed in individual Petri dishes and allowed them to dry for a few minutes under a hood. We subsequently placed each female in these Petri dishes and allowed them to walk on the filter paper for four hours at room temperature (Mauduit et al., 2021b ; Merleau et al., 2022 ). Once this delay is over, we returned each mother to her initial Petri dish with her eggs. In the second experiment, we randomly selected 6 ± 2 nymphs per family and exposed three of them to the formulated GBH solution at 10 times the NAR (2400 mg/m², N = 121) and the three others to the control milliQ water solution (N = 137). The exposure was done on single individuals. We used the same protocol as described above to prepare the solutions and do the exposure. After exposure, we transferred each nymph to new petri dishes until their use for subsequent measurements. 2.3 Measurement of pre- and post-hatching maternal care (experiment 1) We first tested whether the exposure of the 239 mothers to GBH affects their expression egg care in terms of egg collection, frequency of maternal contact with the eggs, egg defence and egg retrieval after abandonment (Merleau et al., 2022 ; Meunier et al., 2020 ). (1) Egg collection shows the extent to which mothers actively collect their eggs after the clutch has been experimentally dispersed (Merleau et al., 2022 ). For this measurement, we randomly scattered the 25 eggs from each female in the Petri dish while the females were isolated for GBH exposure. At the end of the exposure period, we replaced each female in the centre of her petri dish and recorded the number of eggs gathered within a 1 cm circle 2h post-exposure. (2) The frequency of contact between mothers and eggs reflects the number of observations during which a mother was in contact with its eggs over 30 min of observation (Boos et al., 2014 ). Twenty-four hours after exposure of the females, we used a scan sampling procedure by direct observation through the lids of the Petri dishes. We recorded every minute whether the females were touching/cleaning the eggs with their mouthparts (i.e. grooming) and/or with antennae (i.e. antennation). (3) Just after measuring the frequency of the contact between mother and eggs, we measured the level of egg defence, which shows females’ willingness to protect their eggs from a simulated predator attack. We gently opened each Petri dish, standardly poked each female on the pronotum with a glass capillary (1 poke / sec) and recorded the number of pokes required until they moved more than 1 body length away from the clutch. High values of egg defence (poke number) show high maternal investment in egg care and vice versa. Finally, (4) the delay of egg retrieval shows the delay after which a female returns to its eggs after being chased away by a simulated predator attack (Thesing et al., 2015 ). Immediately after the measurement of egg defence, we recorded the number of seconds it took for each female to touch one of her eggs again. We stopped recordings after 600s (10 min). Long delays of egg retrieval indicate low maternal egg care and vice versa. After this last measurement, we maintained each female under the standard conditions described above until egg hatching. We then tested whether maternal exposure to GBH before the eggs hatched later affects their expression of care for the nymphs (Meunier et al., 2012 ; Thesing et al., 2015 ). Eight days after hatching, we measured two forms of post-hatching maternal care in the 205 females whose eggs had hatched (D0: N = 53, D24: N = 50, D240: N = 52 and D2400: N = 50). These forms of care were (1) the frequency of maternal contact with the clutch of nymphs and then, (2) the level of nymph defence against a simulated predator attack. We performed these measurements using the same procedures described above. In brief, we used the scan sampling technique to record whether females actively touched the nymphs with their mouthparts/antennas and then, to record the number of pokes required to move a mother away from her clutch. 2.4 Measurement of non-care behaviours by mothers (experiment 1) We also used the females exposed to GBH to measure two behaviours that were not associated with care. The first one was (1) the frequency of self-grooming, an important behaviour allowing insects to remove dirt and pathogens, to apply self-secreted chemicals on the cuticle to enhance protection against desiccation and to mediate communication with conspecifics (Blomquist and Bagnères, 2010 ; Boos et al., 2014 ; Weiß et al., 2014 ). We measured the frequency of self-grooming both during egg care and during nymph care. This occurred during the 30 min of scan sampling where we recorded the frequencies of mother-egg and mother-nymph interactions (see above). We defined self-grooming as when a female touched or scratched any part of her body (i.e., antennae, legs, abdomen, cerci) with her mouthparts and/or legs. The second behaviour was (2) the locomotor activity of females in absence of eggs (Merleau et al., 2022 ). On day 55 after exposure, we gently transferred each female to an empty circular arena (diameter 18 cm) held between two glass plates on an infrared light table. We then video recorded females for 20 min under darkness with infrared light (BASLER BCA 1300, Germany; Media Recorder v4.0, Noldus Information Systems, the Netherlands) and defined its locomotor activity as the total distance walked by the female during this time. This distance was automatically extracted from the videos using the software EthoVision XT 16 (Noldus Information Technology©, Wageningen, Netherlands). 2.5 Measurement of offspring development and quality (experiment 1) In addition to maternal behaviours, we also tested the effect of female exposure to GBH on their clutch fate in terms of egg development time, hatching rate, nymph weight at hatching, nymph size and nymph survival rate during the first eight days of family life. (1) We defined egg development time as the number of days between oviposition and hatching. (2) We defined egg hatching rate as the number of newly hatched nymphs divided by the number of eggs present with the female on the day of exposure, i.e. day 25 after oviposition. (3) We measured the mean weight of newly hatched nymphs by weighing a random group of ten nymphs per clutch (or the total number of nymphs available if less than ten) to the nearest 0.01 mg using a microbalance (OHAUS© Discovery DV215CD). (4) As a proxy of body size, we measured the minimum inter-ocular distance of one random 2-days old nymph per family using a binocular scope (Leica M80 ® ) and ImageJ version 1.54d software. Finally, we (5) defined nymph survival during the first eight days of family life as the number of nymphs still alive on the eighth day of family life divided by the number of nymphs initially present in the clutch. 2.6 Measurement of nymph locomotion, pathogen resistance and gene expression (experiment 2) In the second experiment, we tested the effects of nymph exposure to GBH or control solution on their locomotor activity (2 nymphs per family), pathogen resistance (2 other nymphs per family + the 2 nymphs used for locomotor activity), and gene expression (2 other nymphs per family). We conducted all these measurements one day after GBH exposure (ie 10 days after hatching). (1) We measured locomotor activity using the same protocol as described above for mothers. It was defined as the total distance a nymph walked in an open arena 3.75 cm in diameter for 20 minutes. (2) We measured pathogen resistance as the survival rate of nymphs after exposure to spores of the entomopathogenic fungus M. brunneum. M. brunneum is a common, natural and lethal pathogen of F. auricularia (Kohlmeier et al., 2016 ). We individually placed each nymph on a filter paper and then covered them with 100µL of either a solution of M. brunneum spores (3.10 8 spores/mL, diluted with 70% water and 30% humectant in 0.01% Tween 80 – Mycelia #04-21-5000SPW) or to a control solution (milliQ water). We allowed the nymphs to rest on the filter paper for five seconds and then transferred them to a new Petri dish (diameter 5.5). This Petri dish contained a layer of moist sand and was kept under a 12:12 light:dark cycle at 20:18°C and received the laboratory prepared food that was changed once a week. We then checked each Petri dish daily to record whether the nymphs were dead or alive for the next 21 days. Overall, this provided us with a total of 67 nymphs exposed to both GBH and M. brunneum , 53 nymphs exposed to GBH only, 59 nymphs exposed to M. brunneum only and 56 nymphs exposed to neither GBH nor M. brunneum. (3) We used RT-qPCR to measure the expression of four genes involved in the juvenile hormone pathway in nymphs (Table 2). Juvenile hormone is one of the main hormones involved in metamorphosis regulation in insects (Riddiford, 1994 ). These genes were JHAMT, which catalyses one of the last steps in juvenile hormone synthesis (Riddiford, 1994 ), Kr-h1 which encodes a transcription factor in the juvenile hormone signalling pathway (Shinoda and Itoyama, 2003 ), and JHE (JH esterase) and JHEH (JH epoxyde hydrolase) which encode for enzymes breaking down juvenile hormone (Li et al., 2022 ). We performed RNA extraction using NucleoSpin ® RNA kit (Macherey Nagel, Düren, Germany), according to the manufacturer's instructions. In brief, cells were lysed by mechanical grinding with Tissue Lyser (Qiagen, Hilden, Germany) and 2 Tungsten beads (Qiagen, Hilden, Germany) in buffer containing β-mercaptoethanol. After filtration of the lysate, nucleic acids were retained on a silica column in a salt-rich medium. The membrane was washed with 70% ethanol, and the DNA digested by rDNase. Finally, the RNA was eluted in 40µL of water. The extracted RNA was quantified using the Qubit ® 2.0 flowmeter (Invitrogen, Eugene, USA) and the Qubit TM HS RNA Assay kit (Invitrogen, Eugene, USA). Reverse transcription was performed on 750ng of RNA using the QuantiTect kit Reverse Transcription Kit (Qiagen, Hilden, Germany) according to the manufacturer's instructions. Genomic DNA removal was performed prior to the reverse transcription at 42°C for 2 min in a volume of 14µL. The reverse transcription was performed at 42°C for 15 min and 3 min at 95°C. The cDNAs obtained from the earwigs’ RNA were stored at -20°C and diluted 1:10 prior to use in qPCR. Real-time PCR was performed in a final volume of 13µL using SYBR 1X (i.e. 6.25µL MESA Blue qPCR TM Mastermix Plus for SYBR®Assay, (EurogenTech, Seraing, Belgium), primers at 3.125µM final (1.2µL forward and reverse primer mix) and cDNA (3µL, i.e. 11.25ng RNA equivalent per well). Samples (triplicates for housekeeping genes, Krh1 and JHAMT and duplicates for JHEH and JH esterase) were distributed in a 384-well plate (4309849, Applied Biosystems TM, Waltham, USA) using the EpMotion5070 robot (Eppendorf, Montesson, France). QPCR was performed using the QuantStudio TM 6Flex machine (Thermo Fisher, Waltham, USA) and associated software. The primers used are shown in Table 1 . We used Actin and Mnf as housekeeping genes, which are reference genes in the European earwig (Roulin et al., 2014 ). The relative gene expression quantification was calculated according to the 2 − ΔΔCT method (Livak and Schmittgen, 2001 ) with ΔCt = Ct target gene - Ct housekeeping genes and ΔΔCt = ΔCt sample - ΔCt D0. Table 1 Primers pairs used in RT-qPCR Primer name Gene name GenBank ref (TSA) Amplified fragment length (bp) Sequence (5' − 3') 2062.Fa.Kr-h1.F4 Kr-h1 GAYQ02035509.1 165 CCTGTATGGGTGCGTGTATG 2063.Fa.Kr-h1.R4 GAGGCCTCACAAATGCTCAG 2022.Fa.JHEH.F2 JHEH GAYQ02037617.1 204 ATGCTAAACCGCCACCTAGT 2023.Fa.JHEH.R2 CCCCGAGTCCAGGTTTAGTT 2240.Fa.JH_esterase.F3 JHE GAYQ02037746.1 173 TGCTGCTTTTGGTGGGAATC 2241.Fa.JH_esterase.R3 TTTCACGTGCTGCTTTCTGG 2056.Fa.JHAMT.F3 JHAMT GAYQ02029801.1 168 CAAGGCGATATTGGAGCACC 2057.Fa.JHAMT. R3 GGGACAATAGGCAAGGAAAGC 2130.Fa.Actin.F6 actin GAYQ02043878.1 247 CACCCCGTTTTACTGACGGA 2131.Fa.Actin.R6 GACCAGCAAGGTCAAGACGA 2126.Fa.mnf.F4 mnf GAYQ02036296.1 178 GAAACCCCTCTTTGGCGAC 2127.Fa.mnf.R4 CCGCTGATAAAGGATGGCAG 2.7 Statistical analysis We conducted all statistical analyses using the software R v4.1.1 ( https://www.r- project. Org/) loaded with the packages car (Fox and Weisberg, 2023), DHARMa (Hartig, 2020 ), emmeans (Lenth et al., 2023 ) and survival (Therneau, 2015 ). We analysed the egg grooming, the self-grooming, the number of pokes for eggs and juveniles, the delay of maternal return for eggs, the activity of the females, the egg development, the number of newly hatched juveniles, the weight of juveniles at hatching and the size of the juveniles using ten linear models ( lm function R). We analysed the egg gathering (proportion of females with gathered clutch after 2h) and the ratio of full clutch failure (proportion of clutch failure) using two generalized linear models ( glm function R) with binomial error distribution and balanced using the cloglog function for the ratio of full clutch failure. We analysed the number of contacts from mothers to juveniles using a generalized linear model ( glm function R) with poisson error distribution. For the analyses of gene expression (JHEH, JHAMT, Krh1 and JH esterase) and for the activity of the juveniles we used five linear mixed models ( lmer function R). Finally, we analysed the survival of juveniles after pathogen infection using a Cox proportional hazard regression model allowing for censored data to account for juveniles still alive at the end of the observation time. In each of these models, we entered as response variables the type of exposure (GBH alone, Metarhizium alone, GBH + Metarhizium and control categorical). We checked that all model assumptions were met using the DHARMa R package and transformed the response variable where it was required. In particular, we used log + 20 transformation for the activity of the females, log + 1 transformation for the egg grooming, the self-grooming, the number of pokes for juveniles, and the activity of the juveniles, log transformation for the egg development and the weight of juveniles, log + 0.1 transformation for the number of pokes for eggs, and squared transformation for the number of newly hatched juveniles. Statistical values were obtained using Type II ANOVA ( Anova function in the car package in R), where the effect of each variable is corrected by the variance explained by the other variables. Finally, we conducted pairwise comparisons using estimated marginal means of the models with P-values corrected for multiple testing using Tukey methods ( emmeans package). Results Experiment 1 - Maternal exposure to GBH Maternal exposure to GBH had no effect on the expression of maternal care and non-care behaviours, as well as no effect on the fate of their clutch. GBH exposure did not affect the likelihood of egg collection by mothers after dispersal (Fig. 1 a; LR χ 2 3 = 4.69, P = 0.196), the frequency of egg grooming behaviour (Fig. 1b; F 3,235 = 0.38, P = 0.765), the level of egg defence (Fig. 1c; F 3,233 = 0.84, P = 0.471), the time taken by mothers to return to their clutch of eggs (Fig. 1 d; LR χ 2 3 = 2.30, P = 0.512), the frequency of mother-nymph contacts (Fig. 1 e; LR χ 2 3 = 3.01, P = 0.390) and the level of nymph defence ( Fig. 1f; F 3,148 = 2.01, P = 0.115). It also had no effect on the frequency of self-grooming during both egg care and nymph care (F 3,235 = 0.69, P = 0.560 and F 3,153 = 0.53, P = 0.665 respectively), and on the general locomotor activity of the exposed females (F 3,74 = 1.35, P = 0.264). Finally, GBH exposure did not affect egg development (Fig. 2a; F 3,200 = 0.24, P = 0.867), the probability of total clutch failure (Fig. 2 b; LR χ 2 3 = 0.71, P = 0.871), hatching rate (Fig. 2c; F 3,196 = 0.77, P = 0.512), fresh weight of newly hatched nymphs (Fig. 2d; F 3,195 = 0.84, P = 0.472), the size of these nymphs (Fig. 2e; F 3,135 = 0.91, P = 0.437) and the nymph survival during the first eight days of family life (Fig. 2 f; LR χ 2 3 = 2.63, P = 0.452). Experiment 2 – Nymph exposure to GBH As in the mothers, exposure of nymphs to GBH had no effect on their locomotor activity (Fig. 3 a; LR χ 2 1 = 0.56, P = 0.455), their resistance to pathogens (Fig. 3 b; LR χ 2 1 = 0.16, P = 0.691) and the expression of the four genes of the juvenile hormone pathway (Fig. 4 ; JHAMT: LR χ 2 1 = 0.01, P = 0.918, Krh1: LR χ 2 1 = 0.15, P = 0.702, JHEH: LR χ 2 1 = 1.03, P = 0.306 and JH esterase: LR χ 2 1 = 0.07, P = 0.797). Contact with the fungal pathogen reduced nymph survival rate overall (Fig. 3 b; LR χ 2 1 = 12.04, P < 0.005), but this effect was independent of GBH exposure (LR χ 2 1 = 0.02, P = 0.899). Discussion A growing body of research suggests that exposure to glyphosate-based herbicides (GBH) can affect the survival and reproduction of non-target animals ranging from mammals to arthropods (Defarge et al., 2018 ; Motta and Moran, 2020 ; Pereira et al., 2018 ). Our data on the European earwig do not align with these findings. We found that direct exposure to Roundup, even at doses 10 times higher than those authorized in French orchards, did not alter the behaviour, physiology, gene expression or immune competence of either female or juvenile earwigs. Given that exposure to Roundup using the same doses and methods significantly altered the activity of male earwigs (Pasquier et al., 2024 ), the present results suggest that tolerance and/or resistance of the European earwig to GBH exposure could be trait, sex and stage specific. A sex-specific effect of GBH would be consistent with previous results showing that exposure to the three pesticides spinosad, acetamiprid, and chlorpyrifos-ethyl altered the predatory behaviour of female but not male European earwigs (Malagnoux et al., 2015a ). Contrary to what has been shown in several rodents (Ait-Bali et al., 2020 ; Dechartres et al., 2019 ; Rocha et al., 2019 ), we found that direct exposure to roundup does not alter the expression of maternal care in the European earwig. The apparent absence of effect in the European earwig suggests that the genetic, physiological and/or hormonal mechanisms regulating parental care differ between mammals and insects. This could mean that insects, such as the European earwig, might be less susceptible to disruption by exogenous chemical compounds. Unfortunately, our current knowledge of these regulatory mechanisms is very limited in insects (Trumbo, 2019 ; .Trumbo, 2018 ; Wu et al., 2020 ), in contrast to mammals (for review Keller et al., 2019 ). Therefore, future studies are needed to describe their nature and explain whether they could explain this apparent resilience to GBH. Notwithstanding the mechanisms involved, our results show that the risk of GBH for the expression of maternal care is limited in the European earwig. In addition to maternal care, we detected no effect of Roundup on the juveniles in terms of general activity, expression of JH pathway genes and survival after a fungal infection. These findings contrast with results showing that GBHs exposure alters larvae development, behaviour and immunity in various species, including honeybees, amphipods, mosquitoes, damselflies, and lacewings (Baglan et al., 2018 ; Du et al., 2024 ; Feng et al., 2022 ; Gauthier et al., 2023 ; Janssens and Stoks, 2017 ; Lajmanovich et al., 2003 ; Vazquez et al., 2020 ). However, they are in line with previous results in earwigs showing that direct exposure to a chemical pollutant does not alter nymph survival and weight change during development (Honorio et al., 2023b ). Interestingly, the fact that Roundup exposure does not alter the expression of JH pathway genes in juveniles suggest that it may lack endocrine-disrupting effects in insects, contrary to the effect commonly observed in mammals (for reviews see Kalofiri et al., 2021 ; Levine et al., 2020 ; Muñoz et al., 2021 ). However, additional support in other insect species is required to confirm this hypothesis. Overall, there could be three main explanations for the apparent lack of effect of direct exposure to GBH on earwig females and juveniles. First, our exposure methods could be ineffective. However, this is unlikely to explain our results. The use of identical methods and dose ranges allowed us to detect an effect of roundup exposure on male earwig activity (Pasquier et al., 2024 ). Similarly, a previous study using the same methods and doses found effects of this GBH in wolf spiders (Lacava et al., 2021 ). Finally, our methods have proven effective in detecting the effects of various pesticides, such as deltamethrin, spinosad, acetamiprid, and chlorpyrifos-ethyl, on earwigs (Mauduit et al., 2021b ; Meunier et al., 2020 ; Malagnoux et al., 2015a ). Second, the European earwig may not be sensitive to GBH because GBH acts on parameters that are not involved in the regulation of its physiology, behaviour or immunity. For example, glyphosate's mode of action makes it possible to alter the host microbiota (Vázquez et al., 2018 ), where even subtle changes are increasingly known to have profound effects on many host functions, including metabolism, development, cognition, nutrition and immunity (Engel et al., 2016 ; Girard et al., 2023 ; Liberti and Engel, 2020 ). However, recent data show that the gut microbiota of the European earwig may not be an important driver of its biological functions (Cheutin et al., 2024 ; Van Meyel et al., 2021 ), which would render this effect of GBH inoperative in this species. A third hypothesis is that the European earwig is not sensitive to GBH because it possesses efficient detoxification mechanisms that act before GBH can have an effect. In line with this hypothesis, the expression of detoxification enzymes is generally higher in earwigs exposed to several pesticides compared to non-exposed ones (Fricaux et al., 2023 ), and this species has acquired resistance to insecticides like chlorpyrifos (Le Navenant et al., 2019 ). However, whether and how this detoxification applies to GBH remains to be further investigated. Overall, the fact that we did not detect an effect of GBH on the traits measured in earwig females and juveniles calls for future studies to explore the physiological mechanisms at play in this species and to conduct longitudinal studies to monitor the apparent lack of effects of GBH over several generations (e.g., Arreguin-Rebolledo et al., 2023 ; Kubsad et al., 2019 ; Le Du-Carrée et al., 2021 ; Milesi et al., 2021 ). In conclusion, the data presented in this study show no effect of direct exposure to a formulated glyphosate solution on females and juveniles of the European earwig, even at high concentrations. This apparent lack of effect can be surprising, as this GBH is known to alter life history traits ranging from behaviour, to development and immunity in a broad range of animals (for review de Brito Rodrigues et al. 2017; Battisti et al. 2021; Talyn et al. 2023). However, it is consistent with recent studies suggesting that the European earwig (particularly females) is only poorly affected by direct exposure to various pesticides and chemical pollutants (Honorio et al., 2023a , 2023b ; Le Navenant et al., 2019 ; Malagnoux et al., 2015a ; Merleau et al., 2022 ) (but see (Mauduit et al., 2021b )). These results highlight the variable sensitivity of animal species to chemical contaminants and open the way for future work to explore the underlying mechanisms that explain this variation and its implications for the evolution of these species in contaminated areas, as well as their conservation and population dynamics in and around agrosystems. Declarations FUNDING This action was led by the Ministries for Agriculture and Food Sovereignty, for an Ecological Transition and Territorial Cohesion, for Health and Prevention, and of Higher Education and Research, with the financial support of the French Office for Biodiversity, as part of “the national call for projects on the Ecophyto II+ plan, part 2, years 2020-2021”, with the fees for diffuse pollution coming from the Ecophyto II+ plan (project BioIndicFin ). This study was also supported by the Centre-Val de Loire region (APR-IA DisruptCare ). AUTHOR INFORMATION AUTHORS AND AFFILIATIONS Institut de Recherche sur la Biologie de l’Insecte, UMR 7261, CNRS, University of Tours, Tours, France Laura Pasquier, Julie Groutsch, Maïlys Verger, Violette Wallart, Joël Meunier, Charlotte Lécureuil CORRESPONDING AUTHOR Correspondence to L Pasquier, [email protected] ETHICS DECLARATIONS ETHICAL APPROVAL Not applicable CONSENT TO PARTICIPATE Not applicable CONSENT TO PUBLISH All authors approved the final version to be submitted for publication. COMPETING INTERESTS The authors have no relevant financial or non-financial interests to disclose. DATA AVAILABILITY Data can be provided on request if necessary by contacting us. Author Contribution All authors contributed to the study conception and design. Material preparation and data collection were performed by JG, MV, LP, VW, JM and CL and statistical analysis were performed by JG, LP and JM. The first draft of the manuscript was written by LP and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript. Acknowledgement The authors would like to thank Romain Honorio for his help in collecting earwigs. References Ait-Bali, Y., Ba-M’hamed, S., Gambarotta, G., Sassoè-Pognetto, M., Giustetto, M., Bennis, M., 2020. Pre- and postnatal exposure to glyphosate-based herbicide causes behavioral and cognitive impairments in adult mice: evidence of cortical ad hippocampal dysfunction. Arch Toxicol 94, 1703–1723. https://doi.org/10.1007/s00204-020-02677-7 Alins, G., Lordan, J., Rodríguez-Gasol, N., Arnó, J., Peñalver-Cruz, A., 2023. Earwig releases provide accumulative biological control of the woolly apple aphid over the years. Insects 14, 890. https://doi.org/10.3390/insects14110890 ANSES, 2020. Rapport d’évaluation comparative - Cas de produits à base de glyphosate - Examen des alternatives en arboriculture [WWW Document]. Anses - Agence nationale de sécurité sanitaire de l’alimentation, de l’environnement et du travail. URL https://www.anses.fr/fr/content/rapport-d%E2%80%99%C3%A9valuation-comparative-cas-de-produits-%C3%A0-base-de-glyphosate-examen-des (accessed 8.8.23). Arreguin-Rebolledo, U., Páez-Osuna, F., Betancourt-Lozano, M., Rico-Martínez, R., 2023. Effets synergiques multi-et transgénérationnels du glyphosate et du chlorpyrifos à des concentrations pertinentes pour l’environnement chez le rotifère estuarien Proales similis . Environmental Pollution 318, 120708. https://doi.org/10.1016/j.envpol.2022.120708 Baglan, H., Lazzari, C.R., Guerrieri, F.J., 2018. Glyphosate impairs learning in Aedes aegypti mosquito larvae at field-realistic doses. Journal of Experimental Biology 221, jeb187518. https://doi.org/10.1242/jeb.187518 Benbrook, C.M., 2016. Trends in glyphosate herbicide use in the United States and globally. Environ Sci Eur 28, 3. https://doi.org/10.1186/s12302-016-0070-0 Blomquist, G., Bagnères, A.-G., 2010. Insect hydrocarbons: biology, biochemistry and chemical ecology. Cambridge University Press, Cambridge. Boos, S., Meunier, J., Pichon, S., Kölliker, M., 2014. Maternal care provides antifungal protection to eggs in the European earwig. Behavioral Ecology 25, 754–761. https://doi.org/10.1093/beheco/aru046 Cheutin, M.-C., Leclerc, B., Meunier, J., 2024. With or without you: Gut microbiota does not predict aggregation behavior in European earwig females. Behavioral Ecology. https://doi.org/10.1093/beheco/arae022 Cullen, M.G., Bliss, L., Stanley, D.A., Carolan, J.C., 2023. Investigating the effects of glyphosate on the bumblebee proteome and microbiota. Science of The Total Environment 864, 161074. https://doi.org/10.1016/j.scitotenv.2022.161074 Cummings, J.A., Clemens, L.G., Nunez, A.A., 2010. Mother counts: how effects of environmental contaminants on maternal care could affect the offspring and future generations. Front Neuroendocrinol 31, 440–451. https://doi.org/10.1016/j.yfrne.2010.05.004 de Oliveira, M.A.L., Rojas, V.C.T., de Sá, J.C., de Novais, C.O., Silva, M.S., de Almeida Paula, H.A., Kirsten, T.B., Bernardi, M.M., Pinheiro, L.C., Giusti-Paiva, A., Vilela, F.C., 2022. Perinatal exposure to glyphosate-based herbicides induced neurodevelopmental behaviors impairments and increased oxidative stress in the prefrontal cortex and hippocampus in offspring. International Journal of Developmental Neuroscience 82, 528–538. https://doi.org/10.1002/jdn.10207 Dechartres, J., Pawluski, J.L., Gueguen, M., Jablaoui, A., Maguin, E., Rhimi, M., Charlier, T.D., 2019. Glyphosate and glyphosate‐based herbicide exposure during the peripartum period affects maternal brain plasticity, maternal behaviour and microbiome. J Neuroendocrinol 31. https://doi.org/10.1111/jne.12731 Defarge, N., Spiroux de Vendômois, J., Séralini, G.E., 2018. Toxicity of formulants and heavy metals in glyphosate-based herbicides and other pesticides. Toxicology Reports 5, 156–163. https://doi.org/10.1016/j.toxrep.2017.12.025 Dib, H., Jamont, M., Sauphanor, B., Capowiez, Y., 2011. Predation potency and intraguild interactions between generalist ( Forficula auricularia ) and specialist ( Episyrphus balteatus ) predators of the rosy apple aphid ( Dysaphis plantaginea ). Biological Control 59, 90–97. https://doi.org/10.1016/j.biocontrol.2011.07.012 Du, Q., Ren, X., Ma, X., Wang, D., Song, X., Hu, H., Wu, C., Shan, Y., Ma, Yajie, Ma, Yan, 2024. Impact of a glyphosate-based herbicide on the longevity, fertility, and transgenerational effects on Chrysopa pallens (Rambur) (Neuroptera: Chrysopidae). Environ Sci Pollut Res 31, 21845–21856. https://doi.org/10.1007/s11356-024-32601-w Duke, S.O., Powles, S.B., 2008. Glyphosate: a once-in-a-century herbicide. Pest Management Science 64, 319–325. https://doi.org/10.1002/ps.1518 Ekaye, S.-O., Uyi, O., Ezugwu, C.H., 2022. High mortality and impaired locomotor response of organophosphates herbicide, glyphosate on the african mound termite, Macrotermes bellicosus workers. European Journal of Science, Innovation and Technology 2, 149–159. El-Sheikh, E.-S.A., Kamita, S.G., Hammock, B.D., 2016. Effects of juvenile hormone (JH) analog insecticides on larval development and JH esterase activity in two spodopterans. Pesticide Biochemistry and Physiology 128, 30–36. https://doi.org/10.1016/j.pestbp.2015.10.008 Engel, K.C., Stökl, J., Schweizer, R., Vogel, H., Ayasse, M., Ruther, J., Steiger, S., 2016. A hormone-related female anti-aphrodisiac signals temporary infertility and causes sexual abstinence to synchronize parental care. Nat Commun 7, 11035. https://doi.org/10.1038/ncomms11035 Feng, P., Dai, M., Yang, J., Wang, Y., Mao, T., Su, W., Li, F., Sun, H., Wei, J., Li, B., 2022. Effects of glyphosate on the growth, development, and physiological functions of silkworm, Bombyx mori. Archives of Insect Biochemistry and Physiology 111, e21919. https://doi.org/10.1002/arch.21919 Feng, P., Wang, Y., Zou, H., Zhu, Q., Ren, Y., Shu, Q., Su, W., Liu, W., Hu, Y., Li, B., 2023. The effects of glyphosate exposure on gene transcription and immune function of the silkworm, Bombyx mori . Archives of Insect Biochemistry and Physiology 112, e21990. https://doi.org/10.1002/arch.21990 Fogel, M.N., Schneider, M.I., Rimoldi, F., Ladux, L.S., Desneux, N., Ronco, A.E., 2016. Toxicity assessment of four insecticides with different modes of action on pupae and adults of Eriopis connexa (Coleoptera: Coccinellidae), a relevant predator of the Neotropical Region. Environ Sci Pollut Res Int 23, 14918–14926. https://doi.org/10.1007/s11356-016-6654-9 Fong-McMaster, C., Konji, S., Nitschke, A., Konkle, A.T., 2020. Canadian Arctic Contaminants and Their Effects on the Maternal Brain and Behaviour: A Scoping Review of the Animal Literature. International Journal of Environmental Research and Public Health 17, 926. https://doi.org/10.3390/ijerph17030926 Fox, Weisberg, 2023. An R companion to applied regression [WWW Document]. SAGE Publications Inc. URL https://us.sagepub.com/en-us/nam/an-r-companion-to-applied-regression/book246125 (accessed 11.23.23). Fricaux, T., Le Navenant, A., Siegwart, M., Rault, M., Coustau, C., Le Goff, G., 2023. The Molecular Resistance Mechanisms of European Earwigs from Apple Orchards Subjected to Different Management Strategies. Insects 14, 944. https://doi.org/10.3390/insects14120944 Gallegos, C.E., Bartos, M., Bras, C., Gumilar, F., Antonelli, M.C., Minetti, A., 2016. Exposure to a glyphosate-based herbicide during pregnancy and lactation induces neurobehavioral alterations in rat offspring. NeuroToxicology 53, 20–28. https://doi.org/10.1016/j.neuro.2015.11.015 Gauthier, M., Defrance, J., Jumarie, C., Vulliet, E., Garric, J., Boily, M., Geffard, O., 2023. Disruption of oogenesis and molting by methoprene and glyphosate in Gammarus fossarum: involvement of retinoic acid? Environ Sci Pollut Res 30, 86060–86071. https://doi.org/10.1007/s11356-023-28327-w Girard, M., Luis, P., Moro, C.V., Minard, G., 2023. Crosstalk between the microbiota and insect postembryonic development. Trends in Microbiology 31, 181–196. https://doi.org/10.1016/j.tim.2022.08.013 González-Miguéns, R., Muñoz-Nozal, E., Jiménez-Ruiz, Y., Mas-Peinado, P., Ghanavi, H.R., García-París, M., 2020. Speciation patterns in the Forficula auricularia species complex: cryptic and not so cryptic taxa across the western Palaearctic region. Zoological Journal of the Linnean Society 190, 788–823. https://doi.org/10.1093/zoolinnean/zlaa070 Hartig, F., 2020. DHARMa: Residual diagnostic for hierarchical (Multi-level / mixed) regression models. Honorio, R., Cheutin, M. –C., Pasquier, L., De Wever, S., Perdereau, E., Villalta, I., Lécureuil, C., Meunier, J., 2024. The European earwig: a model species for studying the (early) evolution of social life. Insect. Soc. https://doi.org/10.1007/s00040-024-00985-0 Honorio, R., Depierrefixe, P., Devers, S., Rouelle, M., Meunier, J., Lécureuil, C., 2023a. Effects of cadmium ingestion on reproduction and maternal egg care in the European earwig. Animal Behaviour 195, 1–8. https://doi.org/10.1016/j.anbehav.2022.10.008 Honorio, R., Moreau, S., Lécureuil, C., Meunier, J., 2023b. Cadmium does not affect post-hatching maternal care or early offspring development in earwigs. Behavioral Ecology 34, 399–407. https://doi.org/10.1093/beheco/arad011 Janssens, L., Stoks, R., 2017. Stronger effects of Roundup than its active ingredient glyphosate in damselfly larvae. Aquatic Toxicology 193, 210–216. https://doi.org/10.1016/j.aquatox.2017.10.028 Kalofiri, P., Balias, G., Tekos, F., 2021. The EU endocrine disruptors’ regulation and the glyphosate controversy. Toxicology Reports 8, 1193–1199. https://doi.org/10.1016/j.toxrep.2021.05.013 Kanabar, M., Bauer, S., Ezedum, Z.M., Dwyer, I.P., Moore, W.S., Rodriguez, G., Mall, A., Littleton, A.T., Yudell, M., Kanabar, J., Tucker, W.J., Daniels, E.R., Iqbal, M., Khan, H., Mirza, A., Yu, J.C., O’Neal, M., Volkenborn, N., Pochron, S.T., 2021. Roundup negatively impacts the behavior and nerve function of the Madagascar hissing cockroach ( Gromphadorhina portentosa ). Environmental Science and Pollution Research 28, 32933–32944. https://doi.org/10.1007/s11356-021-13021-6 Keller, M., Vandenberg, L.N., Charlier, T.D., 2019. The parental brain and behavior: A target for endocrine disruption. Frontiers in Neuroendocrinology 54, 100765. https://doi.org/10.1016/j.yfrne.2019.100765 Koch, L.K., Meunier, J., 2014. Mother and offspring fitness in an insect with maternal care: phenotypic trade-offs between egg number, egg mass and egg care. BMC Evolutionary Biology 14, 125. https://doi.org/10.1186/1471-2148-14-125 Kohlmeier, P., Holländer, K., Meunier, J., 2016. Survival after pathogen exposure in group-living insects: don’t forget the stress of social isolation! Journal of Evolutionary Biology 29, 1867–1872. https://doi.org/10.1111/jeb.12916 Kölliker, M., 2007. Benefits and costs of earwig (Forficula auricularia) family life. Behav Ecol Sociobiol 61, 1489–1497. https://doi.org/10.1007/s00265-007-0381-7 Kramer, J., Thesing, J., Meunier, J., 2015. Negative association between parental care and sibling cooperation in earwigs: a new perspective on the early evolution of family life? Journal of Evolutionary Biology 28, 1299–1308. https://doi.org/10.1111/jeb.12655 Kubsad, D., Nilsson, E.E., King, S.E., Sadler-Riggleman, I., Beck, D., Skinner, M.K., 2019. Assessment of Glyphosate Induced Epigenetic Transgenerational Inheritance of Pathologies and Sperm Epimutations: Generational Toxicology. Sci Rep 9, 6372. https://doi.org/10.1038/s41598-019-42860-0 Lacava, M., García, L.F., Viera, C., Michalko, R., 2021. The pest-specific effects of glyphosate on functional response of a wolf spider. Chemosphere 262, 127785. https://doi.org/10.1016/j.chemosphere.2020.127785 Lajmanovich, R.C., Sandoval, M.T., Peltzer, P.M., 2003. Induction of Mortality and Malformation in Scinax nasicus Tadpoles Exposed to Glyphosate Formulations. Bulletin of Environmental Contamination and Toxicology 70, 612–618. https://doi.org/10.1007/s00128-003-0029-x Lamb, R.J., 1976. PARENTAL BEHAVIOR IN THE DERMAPTERA WITH SPECIAL REFERENCE TO FORFICULA AURICULARIA (DERMAPTERA: FORFICULIDAE). Can Entomol 108, 609–619. https://doi.org/10.4039/Ent108609-6 Le Du-Carrée, J., Boukhari, R., Cachot, J., Cabon, J., Louboutin, L., Morin, T., Danion, M., 2021. Effets générationnels d’une exposition chronique à une faible concentration de glyphosate pertinente pour l’environnement sur la truite arc-en-ciel, Oncorhynchus mykiss . Science of The Total Environment 801, 149462. https://doi.org/10.1016/j.scitotenv.2021.149462 Le Navenant, A., Siegwart, M., Maugin, S., Capowiez, Y., Rault, M., 2019. Metabolic mechanisms and acetylcholinesterase sensitivity involved in tolerance to chlorpyrifos-ethyl in the earwig Forficula auricularia . Chemosphere 227, 416–424. https://doi.org/10.1016/j.chemosphere.2019.04.065 Lenth, R.V., Bolker, B., Buerkner, P., Giné-Vázquez, I., Herve, M., Jung, M., Love, J., Miguez, F., Riebl, H., Singmann, H., 2023. emmeans: estimated marginal means, aka least-squares means. Levine, S.L., Webb, E.G., Saltmiras, D.A., 2020. Review and analysis of the potential for glyphosate to interact with the estrogen, androgen and thyroid pathways. Pest Management Science 76, 2886–2906. https://doi.org/10.1002/ps.5983 Li, Y.-Y., Chen, J.-J., Liu, M.-Y., He, W.-W., Reynolds, J.A., Wang, Y.-N., Wang, M.-Q., Zhang, L.-S., 2022. Enhanced Degradation of Juvenile Hormone Promotes Reproductive Diapause in the Predatory Ladybeetle Coccinella Septempunctata. Front Physiol 13, 877153. https://doi.org/10.3389/fphys.2022.877153 Liberti, J., Engel, 2020. The gut microbiota — brain axis of insects. Current Opinion in Insect Science 39, 6–13. https://doi.org/10.1016/j.cois.2020.01.004 Linz, G.M., Blixt, D.C., Bergman, D.L., Bleier, W.J., 1996. Responses of Red-Winged Blackbirds, Yellow-Headed Blackbirds and Marsh Wrens to Glyphosate-Induced Alterations in Cattail Density (Respuesta de Agelaius phoeniceus, Xanthocephalus xanthocephalus y Cistothorus palustris a Alteración en la Densidad de Eneas Tratadas con Yerbicidas. Journal of Field Ornithology 67, 167–176. Livak, K.J., Schmittgen, T.D., 2001. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 25, 402–408. https://doi.org/10.1006/meth.2001.1262 Machado, G., Trumbo, S., 2018. Parental care. In: Cordoba-aguilar A, Gonzalez-Tokman D, Gonzalez-santoyo I (eds) Insect behavior: from mechanisms to ecological and evolutionary consequences. Oxford University Press, Oxford. Malagnoux, L., Capowiez, Y., Rault, M., 2015a. Impact of insecticide exposure on the predation activity of the European earwig Forficula auricularia . Environmental Science and Pollution Research 22, 14116–14126. https://doi.org/10.1007/s11356-015-4520-9 Malagnoux, L., Marliac, G., Simon, S., Rault, M., Capowiez, Y., 2015b. Management strategies in apple orchards influence earwig community. Chemosphere 124, 156–162. https://doi.org/10.1016/j.chemosphere.2014.12.024 Matsuura, I., Saitoh, T., Tani, E., Wako, Y., Iwata, H., Toyota, N., Ishizuka, Y., Namiki, M., Hoshino, N., Tsuchitani, M., Ikeda, Y., 2005. Evaluation of a Two-Generation Reproduction Toxicity Study Adding Endopoints to Detect Endocrine Disrupting Activity Using Lindane. The Journal of Toxicological Sciences 30, S135-161. https://doi.org/10.2131/jts.30.S135 Mauduit, E., Lécureuil, C., Meunier, J., 2021a. Sublethal exposure to deltamethrin stimulates reproduction and has limited effects on post-hatching maternal care in the European earwig. Environmental Science and Pollution Research 28, 39501–39512. https://doi.org/10.1007/s11356-021-13511-7 Mauduit, E., Lécureuil, C., Meunier, J., 2021b. Sublethal exposure to deltamethrin stimulates reproduction and has limited effects on post-hatching maternal care in the European earwig. Environmental Science and Pollution Research 28, 39501–39512. https://doi.org/10.1007/s11356-021-13511-7 Mazzia, C., Pasquet, A., Caro, G., Thénard, J., Cornic, J.-F., Hedde, M., Capowiez, Y., 2015. The impact of management strategies in apple orchards on the structural and functional diversity of epigeal spiders. Ecotoxicology 24, 616–625. https://doi.org/10.1007/s10646-014-1409-1 Merleau, L.-A., Larrigaldie, I., Bousquet, O., Devers, S., Keller, M., Lécureuil, C., Meunier, J., 2022. Exposure to pyriproxyfen (juvenile hormone agonist) does not alter maternal care and reproduction in the European earwig. Environmental Science and Pollution Research International 29, 72729–72746. https://doi.org/10.1007/s11356-022-20970-z Meunier, J., 2024. The biology and social life of earwigs (Dermaptera). Annual Review of Entomology 69. https://doi.org/10.1146/annurev-ento-013023-015632 Meunier, J., Dufour, J., Van Meyel, S., Rault, M., Lécureuil, C., 2020. Sublethal exposure to deltamethrin impairs maternal egg care in the European earwig Forficula auricularia . Chemosphere 258, 127383. https://doi.org/10.1016/j.chemosphere.2020.127383 Meunier, J., Körner, M., Kramer, J., 2022. Reproductive Strategies in Insects, 1st ed. CRC Press, Boca Raton. https://doi.org/10.1201/9781003043195 Meunier, J., Wong, J.W.Y., Gómez, Y., Kuttler, S., Röllin, L., Stucki, D., Kölliker, M., 2012. One clutch or two clutches? Fitness correlates of coexisting alternative female life-histories in the European earwig. Evol Ecol 26, 669–682. https://doi.org/10.1007/s10682-011-9510-x Milesi, M.M., Lorenz, V., Durando, M., Rossetti, M.F., Varayoud, J., 2021. Glyphosate Herbicide: Reproductive Outcomes and Multigenerational Effects. Front. Endocrinol. 12. https://doi.org/10.3389/fendo.2021.672532 Motta, E.V.S., Moran, N.A., 2020. Impact of glyphosate on the honey bee gut microbiota: effects of intensity, duration, and timing of exposure. mSystems 5, e00268-20. https://doi.org/10.1128/mSystems.00268-20 Muñoz, J.P., Bleak, T.C., Calaf, G.M., 2021. Glyphosate and the key characteristics of an endocrine disruptor: A review. Chemosphere 270, 128619. https://doi.org/10.1016/j.chemosphere.2020.128619 Oliveira, A.G., Telles, L.F., Hess, R.A., Mahecha, G.A.B., Oliveira, C.A., 2007. Effects of the herbicide Roundup on the epididymal region of drakes Anas platyrhynchos . Reproductive Toxicology 23, 182–191. https://doi.org/10.1016/j.reprotox.2006.11.004 Orpet, R.J., Crowder, D.W., Jones, V.P., 2019. Biology and management of European earwig in orchards and vineyards. Journal of Integrated Pest Management 10, 21. https://doi.org/10.1093/jipm/pmz019 Palanza, P., Morellini, F., Parmigiani, S., vom Saal, F.S., 2002. Ethological methods to study the effects of maternal exposure to estrogenic endocrine disrupters: A study with methoxychlor. Neurotoxicology and Teratology, Effects of Estrogen-like Endocrine Disrupters on Development of Brain and Behaviour 24, 55–69. https://doi.org/10.1016/S0892-0362(01)00191-X Pasquier, L., Lécureuil, C., Meunier, J., 2024. Limited effects of glyphosate on the behaviour and immunity of males from six populations of the European earwig [WWW Document]. https://doi.org/10.21203/rs.3.rs-3742095/v1 Pereira, J.L., Galdino, T.V.S., Silva, G.A.R., Picanço, M.C., Silva, A.A., Corrêa, A.S., Martins, J.C., 2018. Effects of glyphosate on the non-target leaf beetle Cerotoma arcuata (Coleoptera: Chrysomelidae) in field and laboratory conditions. Journal of Environmental Science and Health, Part B 53, 447–453. https://doi.org/10.1080/03601234.2018.1455363 Pope, C.N., Liu, J., 1997. Age-related differences in sensitivity to organophosphorus pesticides. Environmental Toxicology and Pharmacology 4, 309–314. https://doi.org/10.1016/S1382-6689(97)10029-1 Riddiford, L.M., 1994. Cellular and Molecular Actions of Juvenile Hormone I. General Considerations and Premetamorphic Actions, in: Evans, P.D. (Ed.), Advances in Insect Physiology. Academic Press, pp. 213–274. https://doi.org/10.1016/S0065-2806(08)60084-3 Rocha, P.R.D., Ribeiro, M.O., Sandini, T.M., Camargo, E.L.R.A., Bernardi, M.M., Spinosa, H. de S., 2019. Perinatal glyphosate-based herbicide impaired maternal behavior by reducing the striatal dopaminergic activity and delayed the offspring reflex development. Atas de Saúde Ambiental 7, 130–156. Roulin, A.C., Wu, M., Pichon, S., Arbore, R., Kühn-Bühlmann, S., Kölliker, M., Walser, J.-C., 2014. De Novo Transcriptome Hybrid Assembly and Validation in the European Earwig (Dermaptera, Forficula auricularia). PLOS ONE 9, e94098. https://doi.org/10.1371/journal.pone.0094098 Santillo, D.J., Brown, P.W., Leslie, D.M., 1989. Response of Songbirds to Glyphosate-Induced Habitat Changes on Clearcuts. The Journal of Wildlife Management 53, 64–71. https://doi.org/10.2307/3801307 Schowalter, T.D., Noriega, J.A., Tscharntke, T., 2018. Insect effects on ecosystem services—Introduction. Basic and Applied Ecology, Insect Effects on Ecosystem services 26, 1–7. https://doi.org/10.1016/j.baae.2017.09.011 Shinoda, T., Itoyama, K., 2003. Juvenile hormone acid methyltransferase: A key regulatory enzyme for insect metamorphosis. Proceedings of the National Academy of Sciences 100, 11986–11991. https://doi.org/10.1073/pnas.2134232100 Stuijfzand, S.C., Poort, L., Greve, G.D., van der Geest, H.G., Kraak, M.H.S., 2000. Variables determining the impact of diazinon on aquatic insects: Taxon, developmental stage, and exposure time. Enviro Toxic and Chemistry 19, 582–587. https://doi.org/10.1002/etc.5620190309 Therneau, T.M., 2015. A package for survival analysis in S. Thesing, J., Kramer, J., Koch, L.K., Meunier, J., 2015. Short-term benefits, but transgenerational costs of maternal loss in an insect with facultative maternal care. Proc. R. Soc. B. 282, 20151617. https://doi.org/10.1098/rspb.2015.1617 Trumbo, S.T., 2019. The physiology of insect families: A door to the study of social evolution, in: Advances in Insect Physiology. Elsevier, pp. 203–250. https://doi.org/10.1016/bs.aiip.2019.02.002 .Trumbo, S.T., 2018. Juvenile hormone and parental care in subsocial insects: implications for the role of juvenile hormone in the evolution of sociality. Current Opinion in Insect Science, Vectors and medical and veterinary entomology * Social insects 28, 13–18. https://doi.org/10.1016/j.cois.2018.04.001 Van Meyel, S., Devers, S., Dupont, S., Dedeine, F., Meunier, J., 2021. Alteration of gut microbiota with a broad-spectrum antibiotic does not impair maternal care in the European earwig. Journal of Evolutionary Biology 34, 1034–1045. https://doi.org/10.1111/jeb.13791 Vazquez, D.E., Balbuena, M.S., Chaves, F., Gora, J., Menzel, R., Farina, W.M., 2020. Sleep in honey bees is affected by the herbicide glyphosate. Sci Rep 10, 10516. https://doi.org/10.1038/s41598-020-67477-6 Vázquez, D.E., Ilina, N., Pagano, E.A., Zavala, J.A., Farina, W.M., 2018. Glyphosate affects the larval development of honey bees depending on the susceptibility of colonies. PLOS ONE 13, e0205074. https://doi.org/10.1371/journal.pone.0205074 Weiß, C., Kramer, J., Holländer, K., Meunier, J., 2014. Influences of Relatedness, Food Deprivation, and Sex on Adult Behaviors in the Group-living Insect Forficula auricularia. Ethology 120, 923–932. https://doi.org/10.1111/eth.12261 Wong, J.W.Y., Kölliker, M., 2012. The Effect of Female Condition on Maternal Care in the European Earwig. Ethology 118, 450–459. https://doi.org/10.1111/j.1439-0310.2012.02030.x Wu, M., Walser, J.-C., Sun, L., Kölliker, M., 2020. The genetic mechanism of selfishness and altruism in parent-offspring coadaptation. Sci. Adv. 6, eaaw0070. https://doi.org/10.1126/sciadv.aaw0070 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 25 Jun, 2025 Read the published version in Ecotoxicology → Version 1 posted Editorial decision: Revision requested 21 Apr, 2025 Reviews received at journal 21 Apr, 2025 Reviewers agreed at journal 12 Apr, 2025 Reviews received at journal 29 Nov, 2024 Reviewers agreed at journal 19 Nov, 2024 Reviewers agreed at journal 06 Nov, 2024 Reviewers invited by journal 06 Nov, 2024 Editor assigned by journal 31 Aug, 2024 Submission checks completed at journal 31 Aug, 2024 First submitted to journal 30 Aug, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5004621","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":357501435,"identity":"23d791ca-1c20-4771-bd8e-3231c7183fcb","order_by":0,"name":"Laura Pasquier","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABGUlEQVRIie3RvWrDMBDA8TMCZxH1mqHFr3BBECj9epUYQ7MYWuji0RColzyAO+UVBBlKocMZraJZC8nQyZMHd/OQoYoNoaRKu3bQfxCc4IcOBOBy/cNOvg8EcAnA9rP3YSP+AbntCXUzwz+JSe3xcTLQ46aFTRjmyYg+X1fR84Aja1J1F2bMb2yEJ+JpDtVI6hrLolpHLzOOQFqdS2KssC6WCOCgPDlMUHFaR1L507Z8VIgQKOtiQS28LaibRWHIlt52ZAI7YhZjVjJMBDOvRNm7IUBkCKOOAB0j1QM7xSqWurov5xSLjmg9RVR2EgTx0qvTzdUij5dNS9dnclVmkKYXGOYzK+lDMsfk8PYXAP3X/SAul8vl6vsC4wxmS3BC8W4AAAAASUVORK5CYII=","orcid":"","institution":"Institut de Recherche sur la Biologie de l'Insecte","correspondingAuthor":true,"prefix":"","firstName":"Laura","middleName":"","lastName":"Pasquier","suffix":""},{"id":357501436,"identity":"b473dd25-e3a8-4618-8363-7b8d1921b6e3","order_by":1,"name":"Julie Groutsch","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Julie","middleName":"","lastName":"Groutsch","suffix":""},{"id":357501437,"identity":"91c36830-0f28-4e08-9883-4891b2cdfc24","order_by":2,"name":"Maïlys Verger","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Maïlys","middleName":"","lastName":"Verger","suffix":""},{"id":357501440,"identity":"18a12121-e46b-40e6-b375-d9d884cedace","order_by":3,"name":"Violette Wallart","email":"","orcid":"","institution":"Institut de Recherche sur la Biologie de l'Insecte","correspondingAuthor":false,"prefix":"","firstName":"Violette","middleName":"","lastName":"Wallart","suffix":""},{"id":357501441,"identity":"e84b36c0-dc65-47f6-b70a-893db47e4429","order_by":4,"name":"Joël Meunier","email":"","orcid":"","institution":"Institut de Recherche sur la Biologie de l'Insecte","correspondingAuthor":false,"prefix":"","firstName":"Joël","middleName":"","lastName":"Meunier","suffix":""},{"id":357501444,"identity":"6cb99371-bd0d-4d6a-b188-23ccfe44968d","order_by":5,"name":"Charlotte Lécureuil","email":"","orcid":"","institution":"Institut de Recherche sur la Biologie de l'Insecte","correspondingAuthor":false,"prefix":"","firstName":"Charlotte","middleName":"","lastName":"Lécureuil","suffix":""}],"badges":[],"createdAt":"2024-08-30 14:40:13","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5004621/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5004621/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s10646-025-02912-w","type":"published","date":"2025-06-25T15:57:23+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":65665439,"identity":"d532daf4-fe16-4393-af57-957d77736b26","added_by":"auto","created_at":"2024-10-01 05:57:55","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":25684,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eResults of experiment 1 on the effects of maternal exposure to GBH on the expression of egg care and post-hatching care.\u003c/strong\u003e (A) Probability that mothers collected their experimentally dispersed eggs. (B) Frequency of mother-egg contacts over 30 min of observation. (C) Level of maternal egg defence against a simulated predator attack. (D) Time spent by females to retrieve their eggs after this simulated predator attack. (E) Frequency of mother-nymphs contacts over 20 min of observation. (F) Level of nymph defence against a simulated predator attack. Boxplots depict median and interquartile ranges, with whiskers extending to 1.5 times the interquartile range and dots representing jittered experimental values. \u003csup\u003ens\u003c/sup\u003e P \u0026gt; 0.05.\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-5004621/v1/47e540c7d5f851f3ea2c16a6.png"},{"id":65664234,"identity":"013d36d3-80e8-4dc9-887a-876f6772e1fa","added_by":"auto","created_at":"2024-10-01 05:33:55","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":23671,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eResults of experiment 1 on the effects of maternal exposure to GBH on clutch fate\u003c/strong\u003e. (A) Egg development time. (B) Proportion of clutches that completely failed before hatching. (C) Number of nymphs produced at egg hatching. (D) Mean fresh weight of newly hatched nymphs. (E) Size of newly hatched nymphs. (F) Nymph survival during the first eight days of family life. Boxplots depict median and interquartile ranges, with whiskers extending to 1.5 times the interquartile range and dots representing jittered experimental values. \u003csup\u003ens\u003c/sup\u003e P \u0026gt; 0.05.\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-5004621/v1/cff2ebcd9c1848efbc452b17.png"},{"id":65664236,"identity":"e2ee098e-1194-4901-8c48-92151361e152","added_by":"auto","created_at":"2024-10-01 05:33:55","extension":"jpeg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":235132,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eResults of experiment 2 on the effects of nymph exposure to GBH on locomotion and pathogen resistance.\u003c/strong\u003e (A) Locomotor activity defined as the distance walked by a nymph during 20 min of observation. (B) Survival rate of the nymphs after exposure to spores of an entomopathogenic fungus. Boxplots depict median and interquartile ranges, with whiskers extending to 1.5 times the interquartile range and dots representing jittered experimental values. \u003csup\u003ens\u003c/sup\u003e P \u0026gt; 0.05. Different letters indicate P \u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-5004621/v1/52808034862d8f58ed1ed540.jpeg"},{"id":65664237,"identity":"2ce652bc-19cc-4d11-ab62-9c340fe54b53","added_by":"auto","created_at":"2024-10-01 05:33:55","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":11102,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eResults of experiment 2 on the effects of nymph exposure to GBH on gene expression of JH pathway.\u003c/strong\u003e Relative quantity (log transformed) of genes relative to actin housekeeping gene. (A) JHAMT, (B) Krh1, (C) JHEH, (D) JH esterase. Boxplots depict median and interquartile ranges, with whiskers extending to 1.5 times the interquartile range and dots representing jittered experimental values. \u003csup\u003ens\u003c/sup\u003e P \u0026gt; 0.05.\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-5004621/v1/3e1e77a823b0b91296d0957a.png"},{"id":85686196,"identity":"38744dc3-261a-4e17-9ee4-f47ca8c9ca11","added_by":"auto","created_at":"2025-06-30 16:04:43","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1368192,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5004621/v1/e03a9b91-f312-4510-a631-e1813f27bc5a.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Exposure to a glyphosate-based herbicide does not alter maternal care and offspring quality in the European earwig","fulltext":[{"header":"Introduction","content":"\u003cp\u003eGlyphosate, or N-(phosphonomethyl) glycine, is the active ingredient in Roundup, one of the world\u0026rsquo;s most widely used herbicides in small and large scale crop production (Benbrook, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). This molecule typically acts by inhibiting the 5-enolpyruvyl shikimate-3-phosphate synthase (EPSPS), an enzyme that enables the biosynthesis of aromatic amino acids in plants, fungi and bacteria (Duke and Powles, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). Because this enzyme is not present in animals, it was long thought that exposure to glyphosate-based herbicide (GBH) would have no effect on mammals, birds and arthropods. However, a growing body of evidence indicates that this is not necessarily the case. In a taxonomically large number of species, exposure to GBH has been shown to alter fitness-related traits such as behaviour, development, and immunity (for review de Brito Rodrigues et al. 2017; Battisti et al. 2021; Talyn et al. 2023). For example, GBH exposure modifies locomotor activity in termites, cockroaches and in rats (Ekaye et al., \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Kanabar et al., \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Rocha et al., \u003cspan citationid=\"CR77\" class=\"CitationRef\"\u003e2019\u003c/span\u003e), alters the moulting and metamorphosis process in juveniles of \u003cem\u003eSpodoptera littoralis\u003c/em\u003e, \u003cem\u003eSpodoptera frugiperda\u003c/em\u003e and honey bees (El-Sheikh et al., \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; V\u0026aacute;zquez et al., \u003cspan citationid=\"CR89\" class=\"CitationRef\"\u003e2018\u003c/span\u003e), reduces immunocompetence and immunity in silkworms (Feng et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2023\u003c/span\u003e), as well as impairs reproduction in the mallard duck (Oliveira et al., \u003cspan citationid=\"CR70\" class=\"CitationRef\"\u003e2007\u003c/span\u003e) and other birds population in wetlands (Linz et al., \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e1996\u003c/span\u003e; Santillo et al., \u003cspan citationid=\"CR79\" class=\"CitationRef\"\u003e1989\u003c/span\u003e). The mechanisms driving these alterations remain unclear and are often attributed to the toxic impact of adjuvants present in GBHs (Defarge et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2018\u003c/span\u003e), GBH-induced changes in the host microbiota (Cullen et al., \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; V\u0026aacute;zquez et al., \u003cspan citationid=\"CR89\" class=\"CitationRef\"\u003e2018\u003c/span\u003e), and/or endocrine disruptor properties of GBH (for reviews see Kalofiri et al., \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Levine et al., \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Mu\u0026ntilde;oz et al., \u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). They may also involve other physiological parameters of the hosts, as suggested by the age-specific effects of GBH \u0026ndash; stronger effects in juveniles than adults - reported in some mammals (Pope and Liu, \u003cspan citationid=\"CR75\" class=\"CitationRef\"\u003e1997\u003c/span\u003e) and insects (Fogel et al., \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Stuijfzand et al., \u003cspan citationid=\"CR82\" class=\"CitationRef\"\u003e2000\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn addition to the host traits detailed above, recent data indicate that GBHs may also alter the expression of social behaviours, such as maternal care, which have major implications for individual fitness and population dynamics (Cummings et al., \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; Fong-McMaster et al., \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). For instance, GBH exposure decreases the amount of time mothers spend caring for their offspring in rats (Dechartres et al., \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2019\u003c/span\u003e) and reduces the expression of maternal defensive and grooming behaviours in rats and mice (Ait-Bali et al., \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Rocha et al., \u003cspan citationid=\"CR77\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). However, these data are mostly from studies in mammals, raising questions about the effect of GBH exposure on the expression of parental care in other animals, including insects. This lack of data on insects is surprising for three main reasons. First, parental care is a taxonomically widespread phenomenon in arthropods (Machado and Trumbo, \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Meunier et al., \u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e2022\u003c/span\u003e), in which it is well documented that even subtle changes in the expression of this behaviour can dramatically affect reproduction and population dynamics, with major consequences for terrestrial ecosystems functioning, biodiversity maintenance, and crop protection (Schowalter et al., \u003cspan citationid=\"CR80\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Second, studies suggest that exposure to various pesticides and chemical pollutants can alter insect parental care, opening the possibility of an effect of GBHs on this trait (de Oliveira et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Gallegos et al., \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Finally, insects are frequently exposed to GBHs in crops and gardens (Mazzia et al., \u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Studying their effects is, therefore, biologically relevant and timely, as it could enhance our understanding of the maintenance and population dynamics of many species that play crucial role in current agroecosystems.\u003c/p\u003e \u003cp\u003eThe European earwig is an ideal species to study the effect of GBH on maternal care, as it is well known for the extensive care that mothers give to their eggs and newly hatched juveniles, and its ubiquity in multiple agricultural areas worldwide (Honorio et al., \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Meunier, \u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Orpet et al., \u003cspan citationid=\"CR71\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Earwig mothers typically care for their egg during 50 days, during which they regularly groom, clean and move their eggs during development (Koch and Meunier, \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Thesing et al., \u003cspan citationid=\"CR84\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). They then care for their juveniles (called nymphs) for two weeks, providing them with food, protecting them against pathogens and defending them against predators (K\u0026ouml;lliker, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2007\u003c/span\u003e; Lamb, \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e1976\u003c/span\u003e). Unlike egg care, post-hatching care is facultative in this species, as newly hatched nymphs quickly become mobile and able to forage independently (Wong and K\u0026ouml;lliker, \u003cspan citationid=\"CR91\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). Regardless of its maternal care, the European earwig is widespread in vineyards and orchards, where a wide variety of pesticides and herbicides are frequently used (Malagnoux et al., \u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e2015b\u003c/span\u003e). This species is considered a crop auxiliary in pip-fruit orchards, where it feeds on aphids, moths and psyllids without eating the fruit, while it is considered a pest in stone fruit orchards, where it also feeds on leaves and fruit (Alins et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Dib et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Orpet et al., \u003cspan citationid=\"CR71\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Previous studies have shown that exposure of earwig females to pesticides such as deltamethrin reduces the expression of maternal care and increases their investment in future reproduction (Mauduit et al., \u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e2021a\u003c/span\u003e; Meunier et al., \u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Similarly, a recent study showed that direct exposure of males to the GBH Roundup\u0026copy; altered their locomotor activity, but not their boldness, aggregation level or immunity (Pasquier et al., \u003cspan citationid=\"CR73\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). In contrast, female exposure to other chemicals such as cadmium, an heavy metal pollutant, and pyriproxyfen, another pesticide, does not alter the expression of maternal care (Honorio et al., \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2023a\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2023b\u003c/span\u003e; Merleau et al., \u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e2022\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn this study, we conducted two experiments in the European earwig to investigate the effects of (1) direct exposure of females to GBH on the expression of maternal care and the associated clutch fate, and (2) direct exposure of juveniles to GBH on their behaviour, pathogen resistance and expression of genes involved in the development. In the first experiment, we exposed 239 females to one of four solutions of a glyphosate formulation commonly used in domestic gardens (RoundUp GT Max\u0026reg;, Scotts France SAS) and then measured the expression of six classical forms of egg and nymph care, as well as the development time and hatching rate of their eggs, and the size and weight of newly hatched nymphs. In the second experiment, we exposed 282 nymphs to either a control solution or a solution containing the highest concentration of the same glyphosate formulation (detailed above) and then measured their general activity, the expression of genes involved in their development (JH pathway) and their survival after infection with the common entomopathogenic fungus \u003cem\u003eMetarhizium brunneum\u003c/em\u003e. Overall, we predicted that female exposure to GBH induces changes in their expression of maternal care and the development/quality of their resulting nymphs, and that juvenile exposure to GBH alters their behaviour, gene expression of JH production and survival to pathogen infection.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1 Animal breeding and overview of experiments 1 and 2\u003c/h2\u003e \u003cp\u003eThe two experiments involved 239 field-sampled females and 282 of their first generation laboratory-born nymphs. All these individuals belonged to \u003cem\u003eForficula auricularia\u003c/em\u003e Linneaus, 1758, also called \u003cem\u003eForficula auricularia\u003c/em\u003e clade A (Gonz\u0026aacute;lez-Migu\u0026eacute;ns et al., \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). We collected the females in July 2022 in an organic peach orchard near Valence, France (Lat 44.978526, Long 4.926383). We then maintained them under standard laboratory conditions until oviposition, which occurred in December 2022 (Mauduit et al., \u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e2021b\u003c/span\u003e; Merleau et al., \u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). The first experiment started 16 days after oviposition. On that day, we counted and trimmed the number of eggs produced by each mother to 25 to standardise the amount of care subsequently required by the clutch. We then exposed each mother to one of three doses of glyphosate formulation or a control solution and subsequently used standard protocols to measure the expression of care and non-care behaviours, as well as the clutch fate (see details below). The second experiment started nine days after egg hatching. On that day, we isolated 235 nymphs from 56 control clutches (4\u0026thinsp;\u0026plusmn;\u0026thinsp;2 nymphs per clutch), exposed each of them to either a high dose of glyphosate formulation or a control solution and then used standard protocols to measure their locomotor activity and immune competence and for gene expression, we isolated 47 nymphs from 24 control clutches of the 56 previous clutches (2\u0026thinsp;\u0026plusmn;\u0026thinsp;1 nymphs per clutch) using the same protocol (see details below).\u003c/p\u003e \u003cp\u003eThroughout the two experiments, females, eggs and nymphs were maintained under standard laboratory conditions (Meunier et al., \u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). From oviposition to hatching, each female and her eggs were kept in small Petri dishes (diameter 5 cm) at a constant 10\u0026deg;C in the dark. From hatching, each female and her nymphs were maintained in large Petri dishes (diameter 9 cm) under 12:12 light:dark cycle at 20:18\u0026deg;C, respectively. Each Petri dish was lined with moist sand. Before oviposition and after egg hatching, each female (and her nymphs) was fed with laboratory prepared diet consisting mainly of a mixture of pollen, cat food and bird seed (details in Kramer, Thesing, et Meunier 2015). The food was changed once a week. We did not provide food to the mothers between oviposition and egg hatching, as females typically stop their foraging activity during this period (K\u0026ouml;lliker, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2007\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2 Exposures of mothers and nymphs to glyphosate-based herbicide\u003c/h2\u003e \u003cp\u003eIn the first experiment, we exposed 239 females to one of four doses of the glyphosate formulation. For this exposure, we used RoundUp GT Max\u0026reg; (Scotts France SAS) and followed a standard protocol that mimics earwig exposure to pesticides (including RoundUp GT Max\u0026reg;) through contact with a contaminated surface (Malagnoux et al., \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e2015a\u003c/span\u003e; Meunier et al., \u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Pasquier et al., \u003cspan citationid=\"CR73\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Following (Pasquier et al., \u003cspan citationid=\"CR73\" class=\"CitationRef\"\u003e2024\u003c/span\u003e), we prepared four GBH solutions by diluting RoundUp GT Max in milliQ water at concentrations equal to the Normal Application Rate (NAR) (240mg/m\u0026sup2;; N\u0026thinsp;=\u0026thinsp;60), 10 times lower than NAR (24mg/m\u0026sup2;; N\u0026thinsp;=\u0026thinsp;60), 10 times higher than NAR (2400mg/m\u0026sup2;; N\u0026thinsp;=\u0026thinsp;59), or to a control solution (0mg/m\u0026sup2;; N\u0026thinsp;=\u0026thinsp;60). As an indication, French tree growers use an average of 1,500g/ha (=\u0026thinsp;150 mg/m\u0026sup2;) of GBH in their crops (ANSES, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). We applied 200\u0026micro;L of each of these solutions evenly to filter papers (VWR 516\u0026ndash;0812; diameter 5.5 cm) previously placed in individual Petri dishes and allowed them to dry for a few minutes under a hood. We subsequently placed each female in these Petri dishes and allowed them to walk on the filter paper for four hours at room temperature (Mauduit et al., \u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e2021b\u003c/span\u003e; Merleau et al., \u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Once this delay is over, we returned each mother to her initial Petri dish with her eggs.\u003c/p\u003e \u003cp\u003eIn the second experiment, we randomly selected 6\u0026thinsp;\u0026plusmn;\u0026thinsp;2 nymphs per family and exposed three of them to the formulated GBH solution at 10 times the NAR (2400 mg/m\u0026sup2;, N\u0026thinsp;=\u0026thinsp;121) and the three others to the control milliQ water solution (N\u0026thinsp;=\u0026thinsp;137). The exposure was done on single individuals. We used the same protocol as described above to prepare the solutions and do the exposure. After exposure, we transferred each nymph to new petri dishes until their use for subsequent measurements.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3 Measurement of pre- and post-hatching maternal care (experiment 1)\u003c/h2\u003e \u003cp\u003eWe first tested whether the exposure of the 239 mothers to GBH affects their expression egg care in terms of egg collection, frequency of maternal contact with the eggs, egg defence and egg retrieval after abandonment (Merleau et al., \u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Meunier et al., \u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). (1) Egg collection shows the extent to which mothers actively collect their eggs after the clutch has been experimentally dispersed (Merleau et al., \u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). For this measurement, we randomly scattered the 25 eggs from each female in the Petri dish while the females were isolated for GBH exposure. At the end of the exposure period, we replaced each female in the centre of her petri dish and recorded the number of eggs gathered within a 1 cm circle 2h post-exposure. (2) The frequency of contact between mothers and eggs reflects the number of observations during which a mother was in contact with its eggs over 30 min of observation (Boos et al., \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). Twenty-four hours after exposure of the females, we used a scan sampling procedure by direct observation through the lids of the Petri dishes. We recorded every minute whether the females were touching/cleaning the eggs with their mouthparts (i.e. grooming) and/or with antennae (i.e. antennation). (3) Just after measuring the frequency of the contact between mother and eggs, we measured the level of egg defence, which shows females\u0026rsquo; willingness to protect their eggs from a simulated predator attack. We gently opened each Petri dish, standardly poked each female on the pronotum with a glass capillary (1 poke / sec) and recorded the number of pokes required until they moved more than 1 body length away from the clutch. High values of egg defence (poke number) show high maternal investment in egg care and vice versa. Finally, (4) the delay of egg retrieval shows the delay after which a female returns to its eggs after being chased away by a simulated predator attack (Thesing et al., \u003cspan citationid=\"CR84\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Immediately after the measurement of egg defence, we recorded the number of seconds it took for each female to touch one of her eggs again. We stopped recordings after 600s (10 min). Long delays of egg retrieval indicate low maternal egg care and vice versa. After this last measurement, we maintained each female under the standard conditions described above until egg hatching.\u003c/p\u003e \u003cp\u003eWe then tested whether maternal exposure to GBH before the eggs hatched later affects their expression of care for the nymphs (Meunier et al., \u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Thesing et al., \u003cspan citationid=\"CR84\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Eight days after hatching, we measured two forms of post-hatching maternal care in the 205 females whose eggs had hatched (D0: N\u0026thinsp;=\u0026thinsp;53, D24: N\u0026thinsp;=\u0026thinsp;50, D240: N\u0026thinsp;=\u0026thinsp;52 and D2400: N\u0026thinsp;=\u0026thinsp;50). These forms of care were (1) the frequency of maternal contact with the clutch of nymphs and then, (2) the level of nymph defence against a simulated predator attack. We performed these measurements using the same procedures described above. In brief, we used the scan sampling technique to record whether females actively touched the nymphs with their mouthparts/antennas and then, to record the number of pokes required to move a mother away from her clutch.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4 Measurement of non-care behaviours by mothers (experiment 1)\u003c/h2\u003e \u003cp\u003eWe also used the females exposed to GBH to measure two behaviours that were not associated with care. The first one was (1) the frequency of self-grooming, an important behaviour allowing insects to remove dirt and pathogens, to apply self-secreted chemicals on the cuticle to enhance protection against desiccation and to mediate communication with conspecifics (Blomquist and Bagn\u0026egrave;res, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; Boos et al., \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Wei\u0026szlig; et al., \u003cspan citationid=\"CR90\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). We measured the frequency of self-grooming both during egg care and during nymph care. This occurred during the 30 min of scan sampling where we recorded the frequencies of mother-egg and mother-nymph interactions (see above). We defined self-grooming as when a female touched or scratched any part of her body (i.e., antennae, legs, abdomen, cerci) with her mouthparts and/or legs. The second behaviour was (2) the locomotor activity of females in absence of eggs (Merleau et al., \u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). On day 55 after exposure, we gently transferred each female to an empty circular arena (diameter 18 cm) held between two glass plates on an infrared light table. We then video recorded females for 20 min under darkness with infrared light (BASLER BCA 1300, Germany; Media Recorder v4.0, Noldus Information Systems, the Netherlands) and defined its locomotor activity as the total distance walked by the female during this time. This distance was automatically extracted from the videos using the software EthoVision XT 16 (Noldus Information Technology\u0026copy;, Wageningen, Netherlands).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5 Measurement of offspring development and quality (experiment 1)\u003c/h2\u003e \u003cp\u003eIn addition to maternal behaviours, we also tested the effect of female exposure to GBH on their clutch fate in terms of egg development time, hatching rate, nymph weight at hatching, nymph size and nymph survival rate during the first eight days of family life. (1) We defined egg development time as the number of days between oviposition and hatching. (2) We defined egg hatching rate as the number of newly hatched nymphs divided by the number of eggs present with the female on the day of exposure, i.e. day 25 after oviposition. (3) We measured the mean weight of newly hatched nymphs by weighing a random group of ten nymphs per clutch (or the total number of nymphs available if less than ten) to the nearest 0.01 mg using a microbalance (OHAUS\u0026copy; Discovery DV215CD). (4) As a proxy of body size, we measured the minimum inter-ocular distance of one random 2-days old nymph per family using a binocular scope (Leica M80\u003cb\u003e\u0026reg;\u003c/b\u003e) and ImageJ version 1.54d software. Finally, we (5) defined nymph survival during the first eight days of family life as the number of nymphs still alive on the eighth day of family life divided by the number of nymphs initially present in the clutch.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6 Measurement of nymph locomotion, pathogen resistance and gene expression (experiment 2)\u003c/h2\u003e \u003cp\u003eIn the second experiment, we tested the effects of nymph exposure to GBH or control solution on their locomotor activity (2 nymphs per family), pathogen resistance (2 other nymphs per family\u0026thinsp;+\u0026thinsp;the 2 nymphs used for locomotor activity), and gene expression (2 other nymphs per family). We conducted all these measurements one day after GBH exposure (ie 10 days after hatching). (1) We measured locomotor activity using the same protocol as described above for mothers. It was defined as the total distance a nymph walked in an open arena 3.75 cm in diameter for 20 minutes. (2) We measured pathogen resistance as the survival rate of nymphs after exposure to spores of the entomopathogenic fungus \u003cem\u003eM. brunneum. M. brunneum\u003c/em\u003e is a common, natural and lethal pathogen of \u003cem\u003eF. auricularia\u003c/em\u003e (Kohlmeier et al., \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). We individually placed each nymph on a filter paper and then covered them with 100\u0026micro;L of either a solution of \u003cem\u003eM. brunneum\u003c/em\u003e spores (3.10\u003csup\u003e8\u003c/sup\u003e spores/mL, diluted with 70% water and 30% humectant in 0.01% Tween 80 \u0026ndash; Mycelia #04-21-5000SPW) or to a control solution (milliQ water). We allowed the nymphs to rest on the filter paper for five seconds and then transferred them to a new Petri dish (diameter 5.5). This Petri dish contained a layer of moist sand and was kept under a 12:12 light:dark cycle at 20:18\u0026deg;C and received the laboratory prepared food that was changed once a week. We then checked each Petri dish daily to record whether the nymphs were dead or alive for the next 21 days. Overall, this provided us with a total of 67 nymphs exposed to both GBH and \u003cem\u003eM. brunneum\u003c/em\u003e, 53 nymphs exposed to GBH only, 59 nymphs exposed to \u003cem\u003eM. brunneum\u003c/em\u003e only and 56 nymphs exposed to neither GBH nor \u003cem\u003eM. brunneum.\u003c/em\u003e (3) We used RT-qPCR to measure the expression of four genes involved in the juvenile hormone pathway in nymphs (Table\u0026nbsp;2). Juvenile hormone is one of the main hormones involved in metamorphosis regulation in insects (Riddiford, \u003cspan citationid=\"CR76\" class=\"CitationRef\"\u003e1994\u003c/span\u003e). These genes were JHAMT, which catalyses one of the last steps in juvenile hormone synthesis (Riddiford, \u003cspan citationid=\"CR76\" class=\"CitationRef\"\u003e1994\u003c/span\u003e), Kr-h1 which encodes a transcription factor in the juvenile hormone signalling pathway (Shinoda and Itoyama, \u003cspan citationid=\"CR81\" class=\"CitationRef\"\u003e2003\u003c/span\u003e), and JHE (JH esterase) and JHEH (JH epoxyde hydrolase) which encode for enzymes breaking down juvenile hormone (Li et al., \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). We performed RNA extraction using NucleoSpin \u0026reg; RNA kit (Macherey Nagel, D\u0026uuml;ren, Germany), according to the manufacturer's instructions. In brief, cells were lysed by mechanical grinding with Tissue Lyser (Qiagen, Hilden, Germany) and 2 Tungsten beads (Qiagen, Hilden, Germany) in buffer containing β-mercaptoethanol. After filtration of the lysate, nucleic acids were retained on a silica column in a salt-rich medium. The membrane was washed with 70% ethanol, and the DNA digested by rDNase. Finally, the RNA was eluted in 40\u0026micro;L of water. The extracted RNA was quantified using the Qubit \u0026reg; 2.0 flowmeter (Invitrogen, Eugene, USA) and the Qubit TM HS RNA Assay kit (Invitrogen, Eugene, USA). Reverse transcription was performed on 750ng of RNA using the QuantiTect kit Reverse Transcription Kit (Qiagen, Hilden, Germany) according to the manufacturer's instructions. Genomic DNA removal was performed prior to the reverse transcription at 42\u0026deg;C for 2 min in a volume of 14\u0026micro;L. The reverse transcription was performed at 42\u0026deg;C for 15 min and 3 min at 95\u0026deg;C. The cDNAs obtained from the earwigs\u0026rsquo; RNA were stored at -20\u0026deg;C and diluted 1:10 prior to use in qPCR. Real-time PCR was performed in a final volume of 13\u0026micro;L using SYBR 1X (i.e. 6.25\u0026micro;L MESA Blue qPCR TM Mastermix Plus for SYBR\u0026reg;Assay, (EurogenTech, Seraing, Belgium), primers at 3.125\u0026micro;M final (1.2\u0026micro;L forward and reverse primer mix) and cDNA (3\u0026micro;L, i.e. 11.25ng RNA equivalent per well). Samples (triplicates for housekeeping genes, Krh1 and JHAMT and duplicates for JHEH and JH esterase) were distributed in a 384-well plate (4309849, Applied Biosystems TM, Waltham, USA) using the EpMotion5070 robot (Eppendorf, Montesson, France). QPCR was performed using the QuantStudio TM 6Flex machine (Thermo Fisher, Waltham, USA) and associated software. The primers used are shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. We used Actin and Mnf as housekeeping genes, which are reference genes in the European earwig (Roulin et al., \u003cspan citationid=\"CR78\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). The relative gene expression quantification was calculated according to the 2\u0026thinsp;\u0026minus;\u0026thinsp;ΔΔCT method (Livak and Schmittgen, \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e2001\u003c/span\u003e) with ΔCt\u0026thinsp;=\u0026thinsp;Ct target gene - Ct housekeeping genes and ΔΔCt\u0026thinsp;=\u0026thinsp;ΔCt sample - ΔCt D0.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimers pairs used in RT-qPCR\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimer name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGene name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGenBank ref (TSA)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAmplified fragment length (bp)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eSequence (5' \u0026minus;\u0026thinsp;3')\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2062.Fa.Kr-h1.F4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eKr-h1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eGAYQ02035509.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e165\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eCCTGTATGGGTGCGTGTATG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2063.Fa.Kr-h1.R4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eGAGGCCTCACAAATGCTCAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2022.Fa.JHEH.F2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eJHEH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eGAYQ02037617.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e204\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eATGCTAAACCGCCACCTAGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2023.Fa.JHEH.R2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eCCCCGAGTCCAGGTTTAGTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2240.Fa.JH_esterase.F3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eJHE\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eGAYQ02037746.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e173\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eTGCTGCTTTTGGTGGGAATC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2241.Fa.JH_esterase.R3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eTTTCACGTGCTGCTTTCTGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2056.Fa.JHAMT.F3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eJHAMT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eGAYQ02029801.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e168\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eCAAGGCGATATTGGAGCACC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2057.Fa.JHAMT. R3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eGGGACAATAGGCAAGGAAAGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2130.Fa.Actin.F6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eactin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eGAYQ02043878.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e247\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eCACCCCGTTTTACTGACGGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2131.Fa.Actin.R6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eGACCAGCAAGGTCAAGACGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2126.Fa.mnf.F4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003emnf\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eGAYQ02036296.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e178\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eGAAACCCCTCTTTGGCGAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2127.Fa.mnf.R4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eCCGCTGATAAAGGATGGCAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.7 Statistical analysis\u003c/h2\u003e \u003cp\u003eWe conducted all statistical analyses using the software R v4.1.1 (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.r-\u003c/span\u003e\u003cspan address=\"https://www.r-\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e project. Org/) loaded with the packages \u003cem\u003ecar\u003c/em\u003e (Fox and Weisberg, 2023), \u003cem\u003eDHARMa\u003c/em\u003e (Hartig, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2020\u003c/span\u003e), \u003cem\u003eemmeans\u003c/em\u003e (Lenth et al., \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2023\u003c/span\u003e) and \u003cem\u003esurvival\u003c/em\u003e (Therneau, \u003cspan citationid=\"CR83\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). We analysed the egg grooming, the self-grooming, the number of pokes for eggs and juveniles, the delay of maternal return for eggs, the activity of the females, the egg development, the number of newly hatched juveniles, the weight of juveniles at hatching and the size of the juveniles using ten linear models (\u003cem\u003elm\u003c/em\u003e function R). We analysed the egg gathering (proportion of females with gathered clutch after 2h) and the ratio of full clutch failure (proportion of clutch failure) using two generalized linear models (\u003cem\u003eglm\u003c/em\u003e function R) with binomial error distribution and balanced using the \u003cem\u003ecloglog\u003c/em\u003e function for the ratio of full clutch failure. We analysed the number of contacts from mothers to juveniles using a generalized linear model (\u003cem\u003eglm\u003c/em\u003e function R) with poisson error distribution. For the analyses of gene expression (JHEH, JHAMT, Krh1 and JH esterase) and for the activity of the juveniles we used five linear mixed models (\u003cem\u003elmer\u003c/em\u003e function R). Finally, we analysed the survival of juveniles after pathogen infection using a Cox proportional hazard regression model allowing for censored data to account for juveniles still alive at the end of the observation time. In each of these models, we entered as response variables the type of exposure (GBH alone, Metarhizium alone, GBH\u0026thinsp;+\u0026thinsp;Metarhizium and control categorical). We checked that all model assumptions were met using the \u003cem\u003eDHARMa\u003c/em\u003e R package and transformed the response variable where it was required. In particular, we used log\u0026thinsp;+\u0026thinsp;20 transformation for the activity of the females, log\u0026thinsp;+\u0026thinsp;1 transformation for the egg grooming, the self-grooming, the number of pokes for juveniles, and the activity of the juveniles, log transformation for the egg development and the weight of juveniles, log\u0026thinsp;+\u0026thinsp;0.1 transformation for the number of pokes for eggs, and squared transformation for the number of newly hatched juveniles. Statistical values were obtained using Type II ANOVA (\u003cem\u003eAnova\u003c/em\u003e function in the \u003cem\u003ecar\u003c/em\u003e package in R), where the effect of each variable is corrected by the variance explained by the other variables. Finally, we conducted pairwise comparisons using estimated marginal means of the models with P-values corrected for multiple testing using Tukey methods (\u003cem\u003eemmeans\u003c/em\u003e package).\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eExperiment 1 - Maternal exposure to GBH\u003c/b\u003e \u003c/p\u003e \u003cp\u003eMaternal exposure to GBH had no effect on the expression of maternal care and non-care behaviours, as well as no effect on the fate of their clutch. GBH exposure did not affect the likelihood of egg collection by mothers after dispersal (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea; LR χ\u003csup\u003e2\u003c/sup\u003e\u003csub\u003e3\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;4.69, P\u0026thinsp;=\u0026thinsp;0.196), the frequency of egg grooming behaviour (Fig.\u0026nbsp;1b; F\u003csub\u003e3,235\u003c/sub\u003e= 0.38, P\u0026thinsp;=\u0026thinsp;0.765), the level of egg defence (Fig.\u0026nbsp;1c; F\u003csub\u003e3,233\u003c/sub\u003e= 0.84, P\u0026thinsp;=\u0026thinsp;0.471), the time taken by mothers to return to their clutch of eggs (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ed; LR χ\u003csup\u003e2\u003c/sup\u003e\u003csub\u003e3\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;2.30, P\u0026thinsp;=\u0026thinsp;0.512), the frequency of mother-nymph contacts (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ee; LR χ\u003csup\u003e2\u003c/sup\u003e\u003csub\u003e3\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;3.01, P\u0026thinsp;=\u0026thinsp;0.390) and the level of nymph defence ( Fig.\u0026nbsp;1f; F\u003csub\u003e3,148\u003c/sub\u003e= 2.01, P\u0026thinsp;=\u0026thinsp;0.115). It also had no effect on the frequency of self-grooming during both egg care and nymph care (F\u003csub\u003e3,235\u003c/sub\u003e= 0.69, P\u0026thinsp;=\u0026thinsp;0.560 and F\u003csub\u003e3,153\u003c/sub\u003e= 0.53, P\u0026thinsp;=\u0026thinsp;0.665 respectively), and on the general locomotor activity of the exposed females (F\u003csub\u003e3,74\u003c/sub\u003e= 1.35, P\u0026thinsp;=\u0026thinsp;0.264). Finally, GBH exposure did not affect egg development (Fig.\u0026nbsp;2a; F\u003csub\u003e3,200\u003c/sub\u003e= 0.24, P\u0026thinsp;=\u0026thinsp;0.867), the probability of total clutch failure (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb; LR χ\u003csup\u003e2\u003c/sup\u003e\u003csub\u003e3\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;0.71, P\u0026thinsp;=\u0026thinsp;0.871), hatching rate (Fig.\u0026nbsp;2c; F\u003csub\u003e3,196\u003c/sub\u003e= 0.77, P\u0026thinsp;=\u0026thinsp;0.512), fresh weight of newly hatched nymphs (Fig.\u0026nbsp;2d; F\u003csub\u003e3,195\u003c/sub\u003e= 0.84, P\u0026thinsp;=\u0026thinsp;0.472), the size of these nymphs (Fig.\u0026nbsp;2e; F\u003csub\u003e3,135\u003c/sub\u003e= 0.91, P\u0026thinsp;=\u0026thinsp;0.437) and the nymph survival during the first eight days of family life (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ef; LR χ\u003csup\u003e2\u003c/sup\u003e\u003csub\u003e3\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;2.63, P\u0026thinsp;=\u0026thinsp;0.452).\u003c/p\u003e \u003cp\u003e \u003cb\u003eExperiment 2 \u0026ndash; Nymph exposure to GBH\u003c/b\u003e \u003c/p\u003e \u003cp\u003eAs in the mothers, exposure of nymphs to GBH had no effect on their locomotor activity (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea; LR χ\u003csup\u003e2\u003c/sup\u003e\u003csub\u003e1\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;0.56, P\u0026thinsp;=\u0026thinsp;0.455), their resistance to pathogens (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eb; LR χ\u003csup\u003e2\u003c/sup\u003e\u003csub\u003e1\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;0.16, P\u0026thinsp;=\u0026thinsp;0.691) and the expression of the four genes of the juvenile hormone pathway (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e; JHAMT: LR χ\u003csup\u003e2\u003c/sup\u003e\u003csub\u003e1\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;0.01, P\u0026thinsp;=\u0026thinsp;0.918, Krh1: LR χ\u003csup\u003e2\u003c/sup\u003e\u003csub\u003e1\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;0.15, P\u0026thinsp;=\u0026thinsp;0.702, JHEH: LR χ\u003csup\u003e2\u003c/sup\u003e\u003csub\u003e1\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;1.03, P\u0026thinsp;=\u0026thinsp;0.306 and JH esterase: LR χ\u003csup\u003e2\u003c/sup\u003e\u003csub\u003e1\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;0.07, P\u0026thinsp;=\u0026thinsp;0.797). Contact with the fungal pathogen reduced nymph survival rate overall (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eb; LR χ\u003csup\u003e2\u003c/sup\u003e\u003csub\u003e1\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;12.04, P\u0026thinsp;\u0026lt;\u0026thinsp;0.005), but this effect was independent of GBH exposure (LR χ\u003csup\u003e2\u003c/sup\u003e\u003csub\u003e1\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;0.02, P\u0026thinsp;=\u0026thinsp;0.899).\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eA growing body of research suggests that exposure to glyphosate-based herbicides (GBH) can affect the survival and reproduction of non-target animals ranging from mammals to arthropods (Defarge et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Motta and Moran, \u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Pereira et al., \u003cspan citationid=\"CR74\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Our data on the European earwig do not align with these findings. We found that direct exposure to Roundup, even at doses 10 times higher than those authorized in French orchards, did not alter the behaviour, physiology, gene expression or immune competence of either female or juvenile earwigs. Given that exposure to Roundup using the same doses and methods significantly altered the activity of male earwigs (Pasquier et al., \u003cspan citationid=\"CR73\" class=\"CitationRef\"\u003e2024\u003c/span\u003e), the present results suggest that tolerance and/or resistance of the European earwig to GBH exposure could be trait, sex and stage specific. A sex-specific effect of GBH would be consistent with previous results showing that exposure to the three pesticides spinosad, acetamiprid, and chlorpyrifos-ethyl altered the predatory behaviour of female but not male European earwigs (Malagnoux et al., \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e2015a\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eContrary to what has been shown in several rodents (Ait-Bali et al., \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Dechartres et al., \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Rocha et al., \u003cspan citationid=\"CR77\" class=\"CitationRef\"\u003e2019\u003c/span\u003e), we found that direct exposure to roundup does not alter the expression of maternal care in the European earwig. The apparent absence of effect in the European earwig suggests that the genetic, physiological and/or hormonal mechanisms regulating parental care differ between mammals and insects. This could mean that insects, such as the European earwig, might be less susceptible to disruption by exogenous chemical compounds. Unfortunately, our current knowledge of these regulatory mechanisms is very limited in insects (Trumbo, \u003cspan citationid=\"CR85\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; .Trumbo, \u003cspan citationid=\"CR86\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Wu et al., \u003cspan citationid=\"CR92\" class=\"CitationRef\"\u003e2020\u003c/span\u003e), in contrast to mammals (for review Keller et al., \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Therefore, future studies are needed to describe their nature and explain whether they could explain this apparent resilience to GBH. Notwithstanding the mechanisms involved, our results show that the risk of GBH for the expression of maternal care is limited in the European earwig.\u003c/p\u003e \u003cp\u003eIn addition to maternal care, we detected no effect of Roundup on the juveniles in terms of general activity, expression of JH pathway genes and survival after a fungal infection. These findings contrast with results showing that GBHs exposure alters larvae development, behaviour and immunity in various species, including honeybees, amphipods, mosquitoes, damselflies, and lacewings (Baglan et al., \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Du et al., \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Feng et al., \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Gauthier et al., \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Janssens and Stoks, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Lajmanovich et al., \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2003\u003c/span\u003e; Vazquez et al., \u003cspan citationid=\"CR88\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). However, they are in line with previous results in earwigs showing that direct exposure to a chemical pollutant does not alter nymph survival and weight change during development (Honorio et al., \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2023b\u003c/span\u003e). Interestingly, the fact that Roundup exposure does not alter the expression of JH pathway genes in juveniles suggest that it may lack endocrine-disrupting effects in insects, contrary to the effect commonly observed in mammals (for reviews see Kalofiri et al., \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Levine et al., \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Mu\u0026ntilde;oz et al., \u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). However, additional support in other insect species is required to confirm this hypothesis.\u003c/p\u003e \u003cp\u003eOverall, there could be three main explanations for the apparent lack of effect of direct exposure to GBH on earwig females and juveniles. First, our exposure methods could be ineffective. However, this is unlikely to explain our results. The use of identical methods and dose ranges allowed us to detect an effect of roundup exposure on male earwig activity (Pasquier et al., \u003cspan citationid=\"CR73\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Similarly, a previous study using the same methods and doses found effects of this GBH in wolf spiders (Lacava et al., \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Finally, our methods have proven effective in detecting the effects of various pesticides, such as deltamethrin, spinosad, acetamiprid, and chlorpyrifos-ethyl, on earwigs (Mauduit et al., \u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e2021b\u003c/span\u003e; Meunier et al., \u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Malagnoux et al., \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e2015a\u003c/span\u003e). Second, the European earwig may not be sensitive to GBH because GBH acts on parameters that are not involved in the regulation of its physiology, behaviour or immunity. For example, glyphosate's mode of action makes it possible to alter the host microbiota (V\u0026aacute;zquez et al., \u003cspan citationid=\"CR89\" class=\"CitationRef\"\u003e2018\u003c/span\u003e), where even subtle changes are increasingly known to have profound effects on many host functions, including metabolism, development, cognition, nutrition and immunity (Engel et al., \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Girard et al., \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Liberti and Engel, \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). However, recent data show that the gut microbiota of the European earwig may not be an important driver of its biological functions (Cheutin et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Van Meyel et al., \u003cspan citationid=\"CR87\" class=\"CitationRef\"\u003e2021\u003c/span\u003e), which would render this effect of GBH inoperative in this species. A third hypothesis is that the European earwig is not sensitive to GBH because it possesses efficient detoxification mechanisms that act before GBH can have an effect. In line with this hypothesis, the expression of detoxification enzymes is generally higher in earwigs exposed to several pesticides compared to non-exposed ones (Fricaux et al., \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2023\u003c/span\u003e), and this species has acquired resistance to insecticides like chlorpyrifos (Le Navenant et al., \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). However, whether and how this detoxification applies to GBH remains to be further investigated. Overall, the fact that we did not detect an effect of GBH on the traits measured in earwig females and juveniles calls for future studies to explore the physiological mechanisms at play in this species and to conduct longitudinal studies to monitor the apparent lack of effects of GBH over several generations (e.g., Arreguin-Rebolledo et al., \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Kubsad et al., \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Le Du-Carr\u0026eacute;e et al., \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Milesi et al., \u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn conclusion, the data presented in this study show no effect of direct exposure to a formulated glyphosate solution on females and juveniles of the European earwig, even at high concentrations. This apparent lack of effect can be surprising, as this GBH is known to alter life history traits ranging from behaviour, to development and immunity in a broad range of animals (for review de Brito Rodrigues et al. 2017; Battisti et al. 2021; Talyn et al. 2023). However, it is consistent with recent studies suggesting that the European earwig (particularly females) is only poorly affected by direct exposure to various pesticides and chemical pollutants (Honorio et al., \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2023a\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2023b\u003c/span\u003e; Le Navenant et al., \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Malagnoux et al., \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e2015a\u003c/span\u003e; Merleau et al., \u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e2022\u003c/span\u003e) (but see (Mauduit et al., \u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e2021b\u003c/span\u003e)). These results highlight the variable sensitivity of animal species to chemical contaminants and open the way for future work to explore the underlying mechanisms that explain this variation and its implications for the evolution of these species in contaminated areas, as well as their conservation and population dynamics in and around agrosystems.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eFUNDING\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis action was led by the Ministries for Agriculture and Food Sovereignty, for an Ecological Transition and Territorial Cohesion, for Health and Prevention, and of Higher Education and Research, with the financial support of the French Office for Biodiversity, as part of \u0026ldquo;the national call for projects on the Ecophyto II+ plan, part 2, years 2020-2021\u0026rdquo;, with the fees for diffuse pollution coming from the Ecophyto II+ plan (project \u003cem\u003eBioIndicFin\u003c/em\u003e). This study was also supported by the Centre-Val de Loire region (APR-IA \u003cem\u003eDisruptCare\u003c/em\u003e).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAUTHOR INFORMATION\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAUTHORS AND AFFILIATIONS\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eInstitut de Recherche sur la Biologie de l\u0026rsquo;Insecte, UMR 7261, CNRS, University of Tours, Tours, France\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eLaura Pasquier, Julie Groutsch, Ma\u0026iuml;lys Verger, Violette Wallart, Jo\u0026euml;l Meunier, Charlotte L\u0026eacute;cureuil\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCORRESPONDING AUTHOR\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCorrespondence to L Pasquier,
[email protected]\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eETHICS DECLARATIONS\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eETHICAL APPROVAL\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u003cstrong\u003e\u003cbr\u003e\u0026nbsp;CONSENT TO PARTICIPATE\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCONSENT TO\u003c/strong\u003e \u003cstrong\u003ePUBLISH\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAll authors approved the final version to be submitted for publication.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCOMPETING INTERESTS\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors have no relevant financial or non-financial interests to disclose.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDATA AVAILABILITY\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eData can be provided on request if necessary by contacting us.\u0026nbsp;\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eAll authors contributed to the study conception and design. Material preparation and data collection were performed by JG, MV, LP, VW, JM and CL and statistical analysis were performed by JG, LP and JM. The first draft of the manuscript was written by LP and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript.\u003c/p\u003e\u003ch2\u003eAcknowledgement\u003c/h2\u003e\u003cp\u003eThe authors would like to thank Romain Honorio for his help in collecting earwigs.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAit-Bali, Y., Ba-M\u0026rsquo;hamed, S., Gambarotta, G., Sasso\u0026egrave;-Pognetto, M., Giustetto, M., Bennis, M., 2020. Pre- and postnatal exposure to glyphosate-based herbicide causes behavioral and cognitive impairments in adult mice: evidence of cortical ad hippocampal dysfunction. Arch Toxicol 94, 1703\u0026ndash;1723. https://doi.org/10.1007/s00204-020-02677-7\u003c/li\u003e\n\u003cli\u003eAlins, G., Lordan, J., Rodr\u0026iacute;guez-Gasol, N., Arn\u0026oacute;, J., Pe\u0026ntilde;alver-Cruz, A., 2023. Earwig releases provide accumulative biological control of the woolly apple aphid over the years. Insects 14, 890. https://doi.org/10.3390/insects14110890\u003c/li\u003e\n\u003cli\u003eANSES, 2020. Rapport d\u0026rsquo;\u0026eacute;valuation comparative - Cas de produits \u0026agrave; base de glyphosate - Examen des alternatives en arboriculture [WWW Document]. Anses - Agence nationale de s\u0026eacute;curit\u0026eacute; sanitaire de l\u0026rsquo;alimentation, de l\u0026rsquo;environnement et du travail. URL https://www.anses.fr/fr/content/rapport-d%E2%80%99%C3%A9valuation-comparative-cas-de-produits-%C3%A0-base-de-glyphosate-examen-des (accessed 8.8.23).\u003c/li\u003e\n\u003cli\u003eArreguin-Rebolledo, U., P\u0026aacute;ez-Osuna, F., Betancourt-Lozano, M., Rico-Mart\u0026iacute;nez, R., 2023. Effets synergiques multi-et transg\u0026eacute;n\u0026eacute;rationnels du glyphosate et du chlorpyrifos \u0026agrave; des concentrations pertinentes pour l\u0026rsquo;environnement chez le rotif\u0026egrave;re estuarien \u003cem\u003eProales similis\u003c/em\u003e. Environmental Pollution 318, 120708. https://doi.org/10.1016/j.envpol.2022.120708\u003c/li\u003e\n\u003cli\u003eBaglan, H., Lazzari, C.R., Guerrieri, F.J., 2018. Glyphosate impairs learning in \u003cem\u003eAedes aegypti \u003c/em\u003emosquito larvae at field-realistic doses. Journal of Experimental Biology 221, jeb187518. https://doi.org/10.1242/jeb.187518\u003c/li\u003e\n\u003cli\u003eBenbrook, C.M., 2016. Trends in glyphosate herbicide use in the United States and globally. Environ Sci Eur 28, 3. https://doi.org/10.1186/s12302-016-0070-0\u003c/li\u003e\n\u003cli\u003eBlomquist, G., Bagn\u0026egrave;res, A.-G., 2010. Insect hydrocarbons: biology, biochemistry and chemical ecology. Cambridge University Press, Cambridge.\u003c/li\u003e\n\u003cli\u003eBoos, S., Meunier, J., Pichon, S., K\u0026ouml;lliker, M., 2014. Maternal care provides antifungal protection to eggs in the European earwig. Behavioral Ecology 25, 754\u0026ndash;761. https://doi.org/10.1093/beheco/aru046\u003c/li\u003e\n\u003cli\u003eCheutin, M.-C., Leclerc, B., Meunier, J., 2024. With or without you: Gut microbiota does not predict aggregation behavior in European earwig females. Behavioral Ecology. https://doi.org/10.1093/beheco/arae022\u003c/li\u003e\n\u003cli\u003eCullen, M.G., Bliss, L., Stanley, D.A., Carolan, J.C., 2023. Investigating the effects of glyphosate on the bumblebee proteome and microbiota. Science of The Total Environment 864, 161074. https://doi.org/10.1016/j.scitotenv.2022.161074\u003c/li\u003e\n\u003cli\u003eCummings, J.A., Clemens, L.G., Nunez, A.A., 2010. Mother counts: how effects of environmental contaminants on maternal care could affect the offspring and future generations. Front Neuroendocrinol 31, 440\u0026ndash;451. https://doi.org/10.1016/j.yfrne.2010.05.004\u003c/li\u003e\n\u003cli\u003ede Oliveira, M.A.L., Rojas, V.C.T., de S\u0026aacute;, J.C., de Novais, C.O., Silva, M.S., de Almeida Paula, H.A., Kirsten, T.B., Bernardi, M.M., Pinheiro, L.C., Giusti-Paiva, A., Vilela, F.C., 2022. Perinatal exposure to glyphosate-based herbicides induced neurodevelopmental behaviors impairments and increased oxidative stress in the prefrontal cortex and hippocampus in offspring. International Journal of Developmental Neuroscience 82, 528\u0026ndash;538. https://doi.org/10.1002/jdn.10207\u003c/li\u003e\n\u003cli\u003eDechartres, J., Pawluski, J.L., Gueguen, M., Jablaoui, A., Maguin, E., Rhimi, M., Charlier, T.D., 2019. Glyphosate and glyphosate‐based herbicide exposure during the peripartum period affects maternal brain plasticity, maternal behaviour and microbiome. J Neuroendocrinol 31. https://doi.org/10.1111/jne.12731\u003c/li\u003e\n\u003cli\u003eDefarge, N., Spiroux de Vend\u0026ocirc;mois, J., S\u0026eacute;ralini, G.E., 2018. Toxicity of formulants and heavy metals in glyphosate-based herbicides and other pesticides. Toxicology Reports 5, 156\u0026ndash;163. https://doi.org/10.1016/j.toxrep.2017.12.025\u003c/li\u003e\n\u003cli\u003eDib, H., Jamont, M., Sauphanor, B., Capowiez, Y., 2011. Predation potency and intraguild interactions between generalist (\u003cem\u003eForficula auricularia\u003c/em\u003e) and specialist (\u003cem\u003eEpisyrphus balteatus\u003c/em\u003e) predators of the rosy apple aphid (\u003cem\u003eDysaphis plantaginea\u003c/em\u003e). Biological Control 59, 90\u0026ndash;97. https://doi.org/10.1016/j.biocontrol.2011.07.012\u003c/li\u003e\n\u003cli\u003eDu, Q., Ren, X., Ma, X., Wang, D., Song, X., Hu, H., Wu, C., Shan, Y., Ma, Yajie, Ma, Yan, 2024. Impact of a glyphosate-based herbicide on the longevity, fertility, and transgenerational effects on Chrysopa pallens (Rambur) (Neuroptera: Chrysopidae). Environ Sci Pollut Res 31, 21845\u0026ndash;21856. https://doi.org/10.1007/s11356-024-32601-w\u003c/li\u003e\n\u003cli\u003eDuke, S.O., Powles, S.B., 2008. Glyphosate: a once-in-a-century herbicide. Pest Management Science 64, 319\u0026ndash;325. https://doi.org/10.1002/ps.1518\u003c/li\u003e\n\u003cli\u003eEkaye, S.-O., Uyi, O., Ezugwu, C.H., 2022. High mortality and impaired locomotor response of organophosphates herbicide, glyphosate on the african mound termite, \u003cem\u003eMacrotermes bellicosus\u003c/em\u003e workers. European Journal of Science, Innovation and Technology 2, 149\u0026ndash;159.\u003c/li\u003e\n\u003cli\u003eEl-Sheikh, E.-S.A., Kamita, S.G., Hammock, B.D., 2016. Effects of juvenile hormone (JH) analog insecticides on larval development and JH esterase activity in two spodopterans. Pesticide Biochemistry and Physiology 128, 30\u0026ndash;36. https://doi.org/10.1016/j.pestbp.2015.10.008\u003c/li\u003e\n\u003cli\u003eEngel, K.C., St\u0026ouml;kl, J., Schweizer, R., Vogel, H., Ayasse, M., Ruther, J., Steiger, S., 2016. A hormone-related female anti-aphrodisiac signals temporary infertility and causes sexual abstinence to synchronize parental care. Nat Commun 7, 11035. https://doi.org/10.1038/ncomms11035\u003c/li\u003e\n\u003cli\u003eFeng, P., Dai, M., Yang, J., Wang, Y., Mao, T., Su, W., Li, F., Sun, H., Wei, J., Li, B., 2022. Effects of glyphosate on the growth, development, and physiological functions of silkworm, Bombyx mori. Archives of Insect Biochemistry and Physiology 111, e21919. https://doi.org/10.1002/arch.21919\u003c/li\u003e\n\u003cli\u003eFeng, P., Wang, Y., Zou, H., Zhu, Q., Ren, Y., Shu, Q., Su, W., Liu, W., Hu, Y., Li, B., 2023. The effects of glyphosate exposure on gene transcription and immune function of the silkworm, \u003cem\u003eBombyx mori\u003c/em\u003e. Archives of Insect Biochemistry and Physiology 112, e21990. https://doi.org/10.1002/arch.21990\u003c/li\u003e\n\u003cli\u003eFogel, M.N., Schneider, M.I., Rimoldi, F., Ladux, L.S., Desneux, N., Ronco, A.E., 2016. Toxicity assessment of four insecticides with different modes of action on pupae and adults of Eriopis connexa (Coleoptera: Coccinellidae), a relevant predator of the Neotropical Region. Environ Sci Pollut Res Int 23, 14918\u0026ndash;14926. https://doi.org/10.1007/s11356-016-6654-9\u003c/li\u003e\n\u003cli\u003eFong-McMaster, C., Konji, S., Nitschke, A., Konkle, A.T., 2020. Canadian Arctic Contaminants and Their Effects on the Maternal Brain and Behaviour: A Scoping Review of the Animal Literature. International Journal of Environmental Research and Public Health 17, 926. https://doi.org/10.3390/ijerph17030926\u003c/li\u003e\n\u003cli\u003eFox, Weisberg, 2023. An R companion to applied regression [WWW Document]. SAGE Publications Inc. URL https://us.sagepub.com/en-us/nam/an-r-companion-to-applied-regression/book246125 (accessed 11.23.23).\u003c/li\u003e\n\u003cli\u003eFricaux, T., Le Navenant, A., Siegwart, M., Rault, M., Coustau, C., Le Goff, G., 2023. The Molecular Resistance Mechanisms of European Earwigs from Apple Orchards Subjected to Different Management Strategies. Insects 14, 944. https://doi.org/10.3390/insects14120944\u003c/li\u003e\n\u003cli\u003eGallegos, C.E., Bartos, M., Bras, C., Gumilar, F., Antonelli, M.C., Minetti, A., 2016. Exposure to a glyphosate-based herbicide during pregnancy and lactation induces neurobehavioral alterations in rat offspring. NeuroToxicology 53, 20\u0026ndash;28. https://doi.org/10.1016/j.neuro.2015.11.015\u003c/li\u003e\n\u003cli\u003eGauthier, M., Defrance, J., Jumarie, C., Vulliet, E., Garric, J., Boily, M., Geffard, O., 2023. Disruption of oogenesis and molting by methoprene and glyphosate in Gammarus fossarum: involvement of retinoic acid? Environ Sci Pollut Res 30, 86060\u0026ndash;86071. https://doi.org/10.1007/s11356-023-28327-w\u003c/li\u003e\n\u003cli\u003eGirard, M., Luis, P., Moro, C.V., Minard, G., 2023. Crosstalk between the microbiota and insect postembryonic development. Trends in Microbiology 31, 181\u0026ndash;196. https://doi.org/10.1016/j.tim.2022.08.013\u003c/li\u003e\n\u003cli\u003eGonz\u0026aacute;lez-Migu\u0026eacute;ns, R., Mu\u0026ntilde;oz-Nozal, E., Jim\u0026eacute;nez-Ruiz, Y., Mas-Peinado, P., Ghanavi, H.R., Garc\u0026iacute;a-Par\u0026iacute;s, M., 2020. Speciation patterns in the \u003cem\u003eForficula auricularia\u003c/em\u003e species complex: cryptic and not so cryptic taxa across the western Palaearctic region. Zoological Journal of the Linnean Society 190, 788\u0026ndash;823. https://doi.org/10.1093/zoolinnean/zlaa070\u003c/li\u003e\n\u003cli\u003eHartig, F., 2020. DHARMa: Residual diagnostic for hierarchical (Multi-level / mixed) regression models.\u003c/li\u003e\n\u003cli\u003eHonorio, R., Cheutin, M. \u0026ndash;C., Pasquier, L., De Wever, S., Perdereau, E., Villalta, I., L\u0026eacute;cureuil, C., Meunier, J., 2024. The European earwig: a model species for studying the (early) evolution of social life. Insect. Soc. https://doi.org/10.1007/s00040-024-00985-0\u003c/li\u003e\n\u003cli\u003eHonorio, R., Depierrefixe, P., Devers, S., Rouelle, M., Meunier, J., L\u0026eacute;cureuil, C., 2023a. Effects of cadmium ingestion on reproduction and maternal egg care in the European earwig. Animal Behaviour 195, 1\u0026ndash;8. https://doi.org/10.1016/j.anbehav.2022.10.008\u003c/li\u003e\n\u003cli\u003eHonorio, R., Moreau, S., L\u0026eacute;cureuil, C., Meunier, J., 2023b. Cadmium does not affect post-hatching maternal care or early offspring development in earwigs. Behavioral Ecology 34, 399\u0026ndash;407. https://doi.org/10.1093/beheco/arad011\u003c/li\u003e\n\u003cli\u003eJanssens, L., Stoks, R., 2017. Stronger effects of Roundup than its active ingredient glyphosate in damselfly larvae. Aquatic Toxicology 193, 210\u0026ndash;216. https://doi.org/10.1016/j.aquatox.2017.10.028\u003c/li\u003e\n\u003cli\u003eKalofiri, P., Balias, G., Tekos, F., 2021. The EU endocrine disruptors\u0026rsquo; regulation and the glyphosate controversy. Toxicology Reports 8, 1193\u0026ndash;1199. https://doi.org/10.1016/j.toxrep.2021.05.013\u003c/li\u003e\n\u003cli\u003eKanabar, M., Bauer, S., Ezedum, Z.M., Dwyer, I.P., Moore, W.S., Rodriguez, G., Mall, A., Littleton, A.T., Yudell, M., Kanabar, J., Tucker, W.J., Daniels, E.R., Iqbal, M., Khan, H., Mirza, A., Yu, J.C., O\u0026rsquo;Neal, M., Volkenborn, N., Pochron, S.T., 2021. Roundup negatively impacts the behavior and nerve function of the Madagascar hissing cockroach (\u003cem\u003eGromphadorhina portentosa\u003c/em\u003e). Environmental Science and Pollution Research 28, 32933\u0026ndash;32944. https://doi.org/10.1007/s11356-021-13021-6\u003c/li\u003e\n\u003cli\u003eKeller, M., Vandenberg, L.N., Charlier, T.D., 2019. The parental brain and behavior: A target for endocrine disruption. Frontiers in Neuroendocrinology 54, 100765. https://doi.org/10.1016/j.yfrne.2019.100765\u003c/li\u003e\n\u003cli\u003eKoch, L.K., Meunier, J., 2014. Mother and offspring fitness in an insect with maternal care: phenotypic trade-offs between egg number, egg mass and egg care. BMC Evolutionary Biology 14, 125. https://doi.org/10.1186/1471-2148-14-125\u003c/li\u003e\n\u003cli\u003eKohlmeier, P., Holl\u0026auml;nder, K., Meunier, J., 2016. Survival after pathogen exposure in group-living insects: don\u0026rsquo;t forget the stress of social isolation! Journal of Evolutionary Biology 29, 1867\u0026ndash;1872. https://doi.org/10.1111/jeb.12916\u003c/li\u003e\n\u003cli\u003eK\u0026ouml;lliker, M., 2007. Benefits and costs of earwig (Forficula auricularia) family life. Behav Ecol Sociobiol 61, 1489\u0026ndash;1497. https://doi.org/10.1007/s00265-007-0381-7\u003c/li\u003e\n\u003cli\u003eKramer, J., Thesing, J., Meunier, J., 2015. Negative association between parental care and sibling cooperation in earwigs: a new perspective on the early evolution of family life? Journal of Evolutionary Biology 28, 1299\u0026ndash;1308. https://doi.org/10.1111/jeb.12655\u003c/li\u003e\n\u003cli\u003eKubsad, D., Nilsson, E.E., King, S.E., Sadler-Riggleman, I., Beck, D., Skinner, M.K., 2019. Assessment of Glyphosate Induced Epigenetic Transgenerational Inheritance of Pathologies and Sperm Epimutations: Generational Toxicology. Sci Rep 9, 6372. https://doi.org/10.1038/s41598-019-42860-0\u003c/li\u003e\n\u003cli\u003eLacava, M., Garc\u0026iacute;a, L.F., Viera, C., Michalko, R., 2021. The pest-specific effects of glyphosate on functional response of a wolf spider. Chemosphere 262, 127785. https://doi.org/10.1016/j.chemosphere.2020.127785\u003c/li\u003e\n\u003cli\u003eLajmanovich, R.C., Sandoval, M.T., Peltzer, P.M., 2003. Induction of Mortality and Malformation in Scinax nasicus Tadpoles Exposed to Glyphosate Formulations. Bulletin of Environmental Contamination and Toxicology 70, 612\u0026ndash;618. https://doi.org/10.1007/s00128-003-0029-x\u003c/li\u003e\n\u003cli\u003eLamb, R.J., 1976. PARENTAL BEHAVIOR IN THE DERMAPTERA WITH SPECIAL REFERENCE TO \u003cem\u003eFORFICULA AURICULARIA\u003c/em\u003e (DERMAPTERA: FORFICULIDAE). Can Entomol 108, 609\u0026ndash;619. https://doi.org/10.4039/Ent108609-6\u003c/li\u003e\n\u003cli\u003eLe Du-Carr\u0026eacute;e, J., Boukhari, R., Cachot, J., Cabon, J., Louboutin, L., Morin, T., Danion, M., 2021. Effets g\u0026eacute;n\u0026eacute;rationnels d\u0026rsquo;une exposition chronique \u0026agrave; une faible concentration de glyphosate pertinente pour l\u0026rsquo;environnement sur la truite arc-en-ciel, \u003cem\u003eOncorhynchus mykiss\u003c/em\u003e. Science of The Total Environment 801, 149462. https://doi.org/10.1016/j.scitotenv.2021.149462\u003c/li\u003e\n\u003cli\u003eLe Navenant, A., Siegwart, M., Maugin, S., Capowiez, Y., Rault, M., 2019. Metabolic mechanisms and acetylcholinesterase sensitivity involved in tolerance to chlorpyrifos-ethyl in the earwig \u003cem\u003eForficula auricularia \u003c/em\u003e. Chemosphere 227, 416\u0026ndash;424. https://doi.org/10.1016/j.chemosphere.2019.04.065\u003c/li\u003e\n\u003cli\u003eLenth, R.V., Bolker, B., Buerkner, P., Gin\u0026eacute;-V\u0026aacute;zquez, I., Herve, M., Jung, M., Love, J., Miguez, F., Riebl, H., Singmann, H., 2023. emmeans: estimated marginal means, aka least-squares means.\u003c/li\u003e\n\u003cli\u003eLevine, S.L., Webb, E.G., Saltmiras, D.A., 2020. Review and analysis of the potential for glyphosate to interact with the estrogen, androgen and thyroid pathways. Pest Management Science 76, 2886\u0026ndash;2906. https://doi.org/10.1002/ps.5983\u003c/li\u003e\n\u003cli\u003eLi, Y.-Y., Chen, J.-J., Liu, M.-Y., He, W.-W., Reynolds, J.A., Wang, Y.-N., Wang, M.-Q., Zhang, L.-S., 2022. Enhanced Degradation of Juvenile Hormone Promotes Reproductive Diapause in the Predatory Ladybeetle Coccinella Septempunctata. Front Physiol 13, 877153. https://doi.org/10.3389/fphys.2022.877153\u003c/li\u003e\n\u003cli\u003eLiberti, J., Engel, 2020. The gut microbiota \u0026mdash; brain axis of insects. Current Opinion in Insect Science 39, 6\u0026ndash;13. https://doi.org/10.1016/j.cois.2020.01.004\u003c/li\u003e\n\u003cli\u003eLinz, G.M., Blixt, D.C., Bergman, D.L., Bleier, W.J., 1996. Responses of Red-Winged Blackbirds, Yellow-Headed Blackbirds and Marsh Wrens to Glyphosate-Induced Alterations in Cattail Density (Respuesta de Agelaius phoeniceus, Xanthocephalus xanthocephalus y Cistothorus palustris a Alteraci\u0026oacute;n en la Densidad de Eneas Tratadas con Yerbicidas. Journal of Field Ornithology 67, 167\u0026ndash;176.\u003c/li\u003e\n\u003cli\u003eLivak, K.J., Schmittgen, T.D., 2001. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2\u0026minus;\u0026Delta;\u0026Delta;CT Method. Methods 25, 402\u0026ndash;408. https://doi.org/10.1006/meth.2001.1262\u003c/li\u003e\n\u003cli\u003eMachado, G., Trumbo, S., 2018. Parental care. In: Cordoba-aguilar A, Gonzalez-Tokman D, Gonzalez-santoyo I (eds) Insect behavior: from mechanisms to ecological and evolutionary consequences. Oxford University Press, Oxford.\u003c/li\u003e\n\u003cli\u003eMalagnoux, L., Capowiez, Y., Rault, M., 2015a. Impact of insecticide exposure on the predation activity of the European earwig \u003cem\u003eForficula auricularia\u003c/em\u003e. Environmental Science and Pollution Research 22, 14116\u0026ndash;14126. https://doi.org/10.1007/s11356-015-4520-9\u003c/li\u003e\n\u003cli\u003eMalagnoux, L., Marliac, G., Simon, S., Rault, M., Capowiez, Y., 2015b. Management strategies in apple orchards influence earwig community. Chemosphere 124, 156\u0026ndash;162. https://doi.org/10.1016/j.chemosphere.2014.12.024\u003c/li\u003e\n\u003cli\u003eMatsuura, I., Saitoh, T., Tani, E., Wako, Y., Iwata, H., Toyota, N., Ishizuka, Y., Namiki, M., Hoshino, N., Tsuchitani, M., Ikeda, Y., 2005. Evaluation of a Two-Generation Reproduction Toxicity Study Adding Endopoints to Detect Endocrine Disrupting Activity Using Lindane. The Journal of Toxicological Sciences 30, S135-161. https://doi.org/10.2131/jts.30.S135\u003c/li\u003e\n\u003cli\u003eMauduit, E., L\u0026eacute;cureuil, C., Meunier, J., 2021a. Sublethal exposure to deltamethrin stimulates reproduction and has limited effects on post-hatching maternal care in the European earwig. Environmental Science and Pollution Research 28, 39501\u0026ndash;39512. https://doi.org/10.1007/s11356-021-13511-7\u003c/li\u003e\n\u003cli\u003eMauduit, E., L\u0026eacute;cureuil, C., Meunier, J., 2021b. Sublethal exposure to deltamethrin stimulates reproduction and has limited effects on post-hatching maternal care in the European earwig. Environmental Science and Pollution Research 28, 39501\u0026ndash;39512. https://doi.org/10.1007/s11356-021-13511-7\u003c/li\u003e\n\u003cli\u003eMazzia, C., Pasquet, A., Caro, G., Th\u0026eacute;nard, J., Cornic, J.-F., Hedde, M., Capowiez, Y., 2015. The impact of management strategies in apple orchards on the structural and functional diversity of epigeal spiders. Ecotoxicology 24, 616\u0026ndash;625. https://doi.org/10.1007/s10646-014-1409-1\u003c/li\u003e\n\u003cli\u003eMerleau, L.-A., Larrigaldie, I., Bousquet, O., Devers, S., Keller, M., L\u0026eacute;cureuil, C., Meunier, J., 2022. Exposure to pyriproxyfen (juvenile hormone agonist) does not alter maternal care and reproduction in the European earwig. Environmental Science and Pollution Research International 29, 72729\u0026ndash;72746. https://doi.org/10.1007/s11356-022-20970-z\u003c/li\u003e\n\u003cli\u003eMeunier, J., 2024. The biology and social life of earwigs (Dermaptera). Annual Review of Entomology 69. https://doi.org/10.1146/annurev-ento-013023-015632\u003c/li\u003e\n\u003cli\u003eMeunier, J., Dufour, J., Van Meyel, S., Rault, M., L\u0026eacute;cureuil, C., 2020. Sublethal exposure to deltamethrin impairs maternal egg care in the European earwig \u003cem\u003eForficula auricularia \u003c/em\u003e. Chemosphere 258, 127383. https://doi.org/10.1016/j.chemosphere.2020.127383\u003c/li\u003e\n\u003cli\u003eMeunier, J., K\u0026ouml;rner, M., Kramer, J., 2022. Reproductive Strategies in Insects, 1st ed. CRC Press, Boca Raton. https://doi.org/10.1201/9781003043195\u003c/li\u003e\n\u003cli\u003eMeunier, J., Wong, J.W.Y., G\u0026oacute;mez, Y., Kuttler, S., R\u0026ouml;llin, L., Stucki, D., K\u0026ouml;lliker, M., 2012. One clutch or two clutches? Fitness correlates of coexisting alternative female life-histories in the European earwig. Evol Ecol 26, 669\u0026ndash;682. https://doi.org/10.1007/s10682-011-9510-x\u003c/li\u003e\n\u003cli\u003eMilesi, M.M., Lorenz, V., Durando, M., Rossetti, M.F., Varayoud, J., 2021. Glyphosate Herbicide: Reproductive Outcomes and Multigenerational Effects. Front. Endocrinol. 12. https://doi.org/10.3389/fendo.2021.672532\u003c/li\u003e\n\u003cli\u003eMotta, E.V.S., Moran, N.A., 2020. Impact of glyphosate on the honey bee gut microbiota: effects of intensity, duration, and timing of exposure. mSystems 5, e00268-20. https://doi.org/10.1128/mSystems.00268-20\u003c/li\u003e\n\u003cli\u003eMu\u0026ntilde;oz, J.P., Bleak, T.C., Calaf, G.M., 2021. Glyphosate and the key characteristics of an endocrine disruptor: A review. Chemosphere 270, 128619. https://doi.org/10.1016/j.chemosphere.2020.128619\u003c/li\u003e\n\u003cli\u003eOliveira, A.G., Telles, L.F., Hess, R.A., Mahecha, G.A.B., Oliveira, C.A., 2007. Effects of the herbicide Roundup on the epididymal region of drakes \u003cem\u003eAnas platyrhynchos\u003c/em\u003e. Reproductive Toxicology 23, 182\u0026ndash;191. https://doi.org/10.1016/j.reprotox.2006.11.004\u003c/li\u003e\n\u003cli\u003eOrpet, R.J., Crowder, D.W., Jones, V.P., 2019. Biology and management of European earwig in orchards and vineyards. Journal of Integrated Pest Management 10, 21. https://doi.org/10.1093/jipm/pmz019\u003c/li\u003e\n\u003cli\u003ePalanza, P., Morellini, F., Parmigiani, S., vom Saal, F.S., 2002. Ethological methods to study the effects of maternal exposure to estrogenic endocrine disrupters: A study with methoxychlor. Neurotoxicology and Teratology, Effects of Estrogen-like Endocrine Disrupters on Development of Brain and Behaviour 24, 55\u0026ndash;69. https://doi.org/10.1016/S0892-0362(01)00191-X\u003c/li\u003e\n\u003cli\u003ePasquier, L., L\u0026eacute;cureuil, C., Meunier, J., 2024. Limited effects of glyphosate on the behaviour and immunity of males from six populations of the European earwig [WWW Document]. https://doi.org/10.21203/rs.3.rs-3742095/v1\u003c/li\u003e\n\u003cli\u003ePereira, J.L., Galdino, T.V.S., Silva, G.A.R., Pican\u0026ccedil;o, M.C., Silva, A.A., Corr\u0026ecirc;a, A.S., Martins, J.C., 2018. Effects of glyphosate on the non-target leaf beetle \u003cem\u003eCerotoma arcuata \u003c/em\u003e(Coleoptera: Chrysomelidae) in field and laboratory conditions. Journal of Environmental Science and Health, Part B 53, 447\u0026ndash;453. https://doi.org/10.1080/03601234.2018.1455363\u003c/li\u003e\n\u003cli\u003ePope, C.N., Liu, J., 1997. Age-related differences in sensitivity to organophosphorus pesticides. Environmental Toxicology and Pharmacology 4, 309\u0026ndash;314. https://doi.org/10.1016/S1382-6689(97)10029-1\u003c/li\u003e\n\u003cli\u003eRiddiford, L.M., 1994. Cellular and Molecular Actions of Juvenile Hormone I. General Considerations and Premetamorphic Actions, in: Evans, P.D. (Ed.), Advances in Insect Physiology. Academic Press, pp. 213\u0026ndash;274. https://doi.org/10.1016/S0065-2806(08)60084-3\u003c/li\u003e\n\u003cli\u003eRocha, P.R.D., Ribeiro, M.O., Sandini, T.M., Camargo, E.L.R.A., Bernardi, M.M., Spinosa, H. de S., 2019. Perinatal glyphosate-based herbicide impaired maternal behavior by reducing the striatal dopaminergic activity and delayed the offspring reflex development. Atas de Sa\u0026uacute;de Ambiental 7, 130\u0026ndash;156.\u003c/li\u003e\n\u003cli\u003eRoulin, A.C., Wu, M., Pichon, S., Arbore, R., K\u0026uuml;hn-B\u0026uuml;hlmann, S., K\u0026ouml;lliker, M., Walser, J.-C., 2014. De Novo Transcriptome Hybrid Assembly and Validation in the European Earwig (Dermaptera, Forficula auricularia). PLOS ONE 9, e94098. https://doi.org/10.1371/journal.pone.0094098\u003c/li\u003e\n\u003cli\u003eSantillo, D.J., Brown, P.W., Leslie, D.M., 1989. Response of Songbirds to Glyphosate-Induced Habitat Changes on Clearcuts. The Journal of Wildlife Management 53, 64\u0026ndash;71. https://doi.org/10.2307/3801307\u003c/li\u003e\n\u003cli\u003eSchowalter, T.D., Noriega, J.A., Tscharntke, T., 2018. Insect effects on ecosystem services\u0026mdash;Introduction. Basic and Applied Ecology, Insect Effects on Ecosystem services 26, 1\u0026ndash;7. https://doi.org/10.1016/j.baae.2017.09.011\u003c/li\u003e\n\u003cli\u003eShinoda, T., Itoyama, K., 2003. Juvenile hormone acid methyltransferase: A key regulatory enzyme for insect metamorphosis. Proceedings of the National Academy of Sciences 100, 11986\u0026ndash;11991. https://doi.org/10.1073/pnas.2134232100\u003c/li\u003e\n\u003cli\u003eStuijfzand, S.C., Poort, L., Greve, G.D., van der Geest, H.G., Kraak, M.H.S., 2000. Variables determining the impact of diazinon on aquatic insects: Taxon, developmental stage, and exposure time. Enviro Toxic and Chemistry 19, 582\u0026ndash;587. https://doi.org/10.1002/etc.5620190309\u003c/li\u003e\n\u003cli\u003eTherneau, T.M., 2015. A package for survival analysis in S.\u003c/li\u003e\n\u003cli\u003eThesing, J., Kramer, J., Koch, L.K., Meunier, J., 2015. Short-term benefits, but transgenerational costs of maternal loss in an insect with facultative maternal care. Proc. R. Soc. B. 282, 20151617. https://doi.org/10.1098/rspb.2015.1617\u003c/li\u003e\n\u003cli\u003eTrumbo, S.T., 2019. The physiology of insect families: A door to the study of social evolution, in: Advances in Insect Physiology. Elsevier, pp. 203\u0026ndash;250. https://doi.org/10.1016/bs.aiip.2019.02.002\u003c/li\u003e\n\u003cli\u003e.Trumbo, S.T., 2018. Juvenile hormone and parental care in subsocial insects: implications for the role of juvenile hormone in the evolution of sociality. Current Opinion in Insect Science, Vectors and medical and veterinary entomology * Social insects 28, 13\u0026ndash;18. https://doi.org/10.1016/j.cois.2018.04.001\u003c/li\u003e\n\u003cli\u003eVan Meyel, S., Devers, S., Dupont, S., Dedeine, F., Meunier, J., 2021. Alteration of gut microbiota with a broad-spectrum antibiotic does not impair maternal care in the European earwig. Journal of Evolutionary Biology 34, 1034\u0026ndash;1045. https://doi.org/10.1111/jeb.13791\u003c/li\u003e\n\u003cli\u003eVazquez, D.E., Balbuena, M.S., Chaves, F., Gora, J., Menzel, R., Farina, W.M., 2020. Sleep in honey bees is affected by the herbicide glyphosate. Sci Rep 10, 10516. https://doi.org/10.1038/s41598-020-67477-6\u003c/li\u003e\n\u003cli\u003eV\u0026aacute;zquez, D.E., Ilina, N., Pagano, E.A., Zavala, J.A., Farina, W.M., 2018. Glyphosate affects the larval development of honey bees depending on the susceptibility of colonies. PLOS ONE 13, e0205074. https://doi.org/10.1371/journal.pone.0205074\u003c/li\u003e\n\u003cli\u003eWei\u0026szlig;, C., Kramer, J., Holl\u0026auml;nder, K., Meunier, J., 2014. Influences of Relatedness, Food Deprivation, and Sex on Adult Behaviors in the Group-living Insect Forficula auricularia. Ethology 120, 923\u0026ndash;932. https://doi.org/10.1111/eth.12261\u003c/li\u003e\n\u003cli\u003eWong, J.W.Y., K\u0026ouml;lliker, M., 2012. The Effect of Female Condition on Maternal Care in the European Earwig. Ethology 118, 450\u0026ndash;459. https://doi.org/10.1111/j.1439-0310.2012.02030.x\u003c/li\u003e\n\u003cli\u003eWu, M., Walser, J.-C., Sun, L., K\u0026ouml;lliker, M., 2020. The genetic mechanism of selfishness and altruism in parent-offspring coadaptation. Sci. Adv. 6, eaaw0070. https://doi.org/10.1126/sciadv.aaw0070\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"ecotoxicology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"ectx","sideBox":"Learn more about [Ecotoxicology](https://www.springer.com/journal/10646)","snPcode":"10646","submissionUrl":"https://submission.nature.com/new-submission/10646/3","title":"Ecotoxicology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Forficula auricularia, Maternal care, Pesticide, Pest control, Larvae","lastPublishedDoi":"10.21203/rs.3.rs-5004621/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5004621/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eSublethal exposure to pesticides can affect the reproduction and population dynamics of many non-target organisms, such as insects. Among these pesticides, glyphosate-based herbicides (GBHs) were long thought to have no effect on insects because their active compounds can only affect plants and microorganisms. However, a growing body of evidence suggests that GBH can directly or indirectly alter a wide range of fitness-related traits in insects. In this study, we tested whether exposure to the GBH Roundup\u0026copy; affects maternal care behaviour and juvenile development, locomotion and immunity in the European earwig, an insect commonly found in vineyards and orchards. First, we exposed female earwigs to Roundup at concentrations ten times below, equal to and ten times above the normal application rate (NAR) and then measured the expression of maternal care in terms of egg collection, egg and juvenile care, and egg and juvenile defense. We also measured maternal self-grooming and locomotor activity, and the development time, weight and size of newly produced juveniles. In a second experiment, we exposed earwig juveniles to a control solution or to Roundup and then measured their locomotion, the expression of genes involved in their development (the juveniles hormone pathway), and their survival after exposure to a fungal pathogen. Overall, our results showed no significant effect of Roundup on any of the parameters measured. This finding suggests that direct exposure to a GBH may not necessarily induce behavioural, physiological and developmental alteration in this species. It also calls for future studies to explore the underlying mechanisms behind this apparent lack of sensibility. More generally, these results highlight the importance of assessing the impact of pesticide use and the factors driving potential resilience across a wide range of non-target organisms to ensure sustainable agricultural practices.\u003c/p\u003e","manuscriptTitle":"Exposure to a glyphosate-based herbicide does not alter maternal care and offspring quality in the European earwig","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-10-01 05:33:50","doi":"10.21203/rs.3.rs-5004621/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-04-21T15:58:53+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-04-21T05:40:10+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"89700056290816946481099236566867397827","date":"2025-04-12T10:26:23+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-11-29T16:08:00+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"169892366413268710758544132976840482840","date":"2024-11-19T14:20:40+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"165260030709522580555129355799639176471","date":"2024-11-06T16:56:47+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-11-06T16:52:45+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-08-31T05:42:05+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-08-31T05:40:32+00:00","index":"","fulltext":""},{"type":"submitted","content":"Ecotoxicology","date":"2024-08-30T14:38:47+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"ecotoxicology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"ectx","sideBox":"Learn more about [Ecotoxicology](https://www.springer.com/journal/10646)","snPcode":"10646","submissionUrl":"https://submission.nature.com/new-submission/10646/3","title":"Ecotoxicology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"3bc9fb41-11fc-4b61-8815-39bab03140b4","owner":[],"postedDate":"October 1st, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-06-30T16:02:17+00:00","versionOfRecord":{"articleIdentity":"rs-5004621","link":"https://doi.org/10.1007/s10646-025-02912-w","journal":{"identity":"ecotoxicology","isVorOnly":false,"title":"Ecotoxicology"},"publishedOn":"2025-06-25 15:57:23","publishedOnDateReadable":"June 25th, 2025"},"versionCreatedAt":"2024-10-01 05:33:50","video":"","vorDoi":"10.1007/s10646-025-02912-w","vorDoiUrl":"https://doi.org/10.1007/s10646-025-02912-w","workflowStages":[]},"version":"v1","identity":"rs-5004621","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5004621","identity":"rs-5004621","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.