Boron-Magnet Nanoparticles Capture Lipopolysaccharide and Peptidoglycan for Bacteria-Infected Wound Healing

preprint OA: closed CC-BY-4.0
AI-generated summary by claude@2026-07+body, 2026-07-05

Boron-magnet nanoparticles capture lipopolysaccharide and peptidoglycan through hydrolysis to promote bacterial death and reduce inflammation for improved wound healing.

One-sentence paraphrase of the abstract; not a substitute for reading it. No clinical advice. How this works

AI-generated deep summary by claude@2026-07, 2026-07-05 · read from full text

The paper investigated boron-magnet reactive metal boride nanoparticles, using Nano-MgB2 as the representative formulation, to address both bacterial infection and inflammation in non-healing wounds by capturing bacterial cell-wall components. The authors synthesized and characterized Nano-MgB2 and showed that hydrolysis generates a mildly alkaline, low-ROS microenvironment with boron hydroxyl groups and Mg2+, which promotes esterification-based capture of LPS/peptidoglycan and enriches Mg2+ at bacterial membranes, enhancing bacterial killing while suppressing dead-bacteria/endotoxin–driven inflammatory signaling via inhibition of MAPK pathways. They also compared related borides (Nano-AlB2, Nano-BeBx) and demonstrated LPS/PGN binding via formation of borate ester (O-B-O) bonds. A major caveat explicitly noted is that the work is a preprint version and is not yet peer reviewed. This paper does not explicitly discuss endometriosis or adenomyosis; it was included in the corpus via a keyword match in the upstream search index.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Abstract

Abstract Bacteria and excessive inflammation are two main factors causing non-healing wounds. However, current studies have mainly focused on the inhibition of bacteria survival for wound healing while ignoring the excessive inflammation induced by dead bacteria or their released endotoxin, lipopolysaccharide (LPS) or peptidoglycan (PGN). Herein, a boron-magnet strategy was proposed to prevent both infection and excessive inflammation by synthesizing a class of reactive metal boride nanoparticles (MB NPs). The MB NPs were slowly hydrolyzed to generate boron dihydroxy groups and metal cations while generating a local alkaline microenvironment with low levels of reactive oxygen species. This microenvironment promoted MB NPs to capture LPS/PGN through an esterification reaction, which not only enhanced metal cation-induced bacterial death but also inhibited the dead bacteria- or endotoxin-induced excessive inflammation, resulting in accelerated wound healing. Taken together, this boron-magnet strategy provides a new approach to the treatment of bacterial infection and the accompanying inflammation.
Full text 151,285 characters · extracted from preprint-html · click to expand
Boron-Magnet Nanoparticles Capture Lipopolysaccharide and Peptidoglycan for Bacteria-Infected Wound Healing | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Boron-Magnet Nanoparticles Capture Lipopolysaccharide and Peptidoglycan for Bacteria-Infected Wound Healing Yun Meng, Lijie Chen, Yang Chen, Jieyun Shi, Zheng Zhang, Yiwen Wang, and 8 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-1584966/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 29 Nov, 2022 Read the published version in Nature Communications → Version 1 posted You are reading this latest preprint version Abstract Bacteria and excessive inflammation are two main factors causing non-healing wounds. However, current studies have mainly focused on the inhibition of bacteria survival for wound healing while ignoring the excessive inflammation induced by dead bacteria or their released endotoxin, lipopolysaccharide (LPS) or peptidoglycan (PGN). Herein, a boron-magnet strategy was proposed to prevent both infection and excessive inflammation by synthesizing a class of reactive metal boride nanoparticles (MB NPs). The MB NPs were slowly hydrolyzed to generate boron dihydroxy groups and metal cations while generating a local alkaline microenvironment with low levels of reactive oxygen species. This microenvironment promoted MB NPs to capture LPS/PGN through an esterification reaction, which not only enhanced metal cation-induced bacterial death but also inhibited the dead bacteria- or endotoxin-induced excessive inflammation, resulting in accelerated wound healing. Taken together, this boron-magnet strategy provides a new approach to the treatment of bacterial infection and the accompanying inflammation. Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction Wound infection plays an important role in the development of unhealing chronic wounds. Severe cases can lead to sepsis and even multiorgan failure or death 1 , 2 . Currently, antimicrobial agents such as antibiotics and nanoparticles used for treating infected wounds mainly destroy the structure of bacteria to kill live bacteria, however, dead bacteria and the consequent release of massive amounts of lipopolysaccharide (LPS, also called endotoxin) or peptidoglycan (PGN) can activate immune cells to induce excessive inflammation, causing wounds to remain unhealed 3 , 4 . Therefore, developing strategies to simultaneously inhibit the survival of live bacteria and dead bacteria-induced excessive inflammation to heal infected wounds is urgently needed. Certain components of pathogens are crucial for their structure and function, ensuring pathogen survival and pathogenicity. LPS and PGN are typically the key components of gram-negative and gram-positive bacteria, respectively 5 . On the one hand, LPS/PGN is a structural component of the bacteria cell wall, which maintains the integrity of the bacteria and protects the bacteria against antibacterial treatments 6 . On the other hand, LPS/PGN is the main functional component of the dead bacteria or their released endotoxin, which is highly immunogenic and easily induces excessive inflammation to disrupt host tissues after being released from dead bacteria 7 , 8 . Therefore, capturing the key component of bacteria would structurally inhibit bacterial survival and functionally suppress dead bacteria-induced excessive inflammation, finally promoting wound healing. Currently, LPS-binding peptides have been reported to capture LPS, resulting in antibacterial activity or the inhibition of LPS-induced immune cell activation 9 – 11 , although the precise mechanism by which these peptides perform their biological activities remains elusive. Furthermore, the poor bioavailability and the proteolytic stability of peptides limit their application in clinic 12 . Therefore, capturing the key component of bacteria (LPS/PGN) to simultaneously inhibit bacterial survival and dead bacteria-induced excessive inflammation for wound healing is still facing serious challenges. LPS/PGN are mainly composed of many different sugars such as hexose or pentose, which contain many 1,2-diol or 1,3-dial dihydroxyl groups 13 , 14 . Studies have shown that borate materials can produce dynamic borate ester bonds through an esterification reaction with the dihydroxyl groups 15 . This dynamic covalent bond has been widely used to identify substances such as blood, glucose and ATP 16 – 18 . Considering that bacterial LPS/PGN contains structures of 1,2-diol or 1,3-diol and that borate derivatives are prone to react with diol-containing compounds to form borate-diol esters 19 , 20 , materials possessing boron dihydroxyl functional groups may react with LPS/PGN to inhibit bacterial survival and simultaneously reduce dead bacteria-induced virulence. However, such dynamic covalent bonds easily dissociate under acidic and inflammatory conditions. Hence, it is extremely necessary to design an antibacterial reagent that efficiently forms stable borate ester bonds with the key component of bacteria LPS/PGN, finally promoting wound healing. Herein, a boron-magnet strategy was proposed for capturing the crucial component of bacteria (LPS/PGN) to inhibit bacterial survival and decrease dead bacteria-induced excessive inflammation, finally enhancing wound healing. We designed and synthesized a class of nano-scale reactive metal borides (MB NPs, M = Mg, Al, and Be), using Nano-MgB 2 as a representative example to elucidate the mechanism and function of MB in promoting infected wound healing (Scheme 1 .). The Nano-MgB 2 could slowly hydrolyze to generate boron dihydroxy groups and metal cations while generating a local alkaline/low reactive oxygen species (ROS) microenvironment. The alkaline microenvironment could promote the Nano-MgB 2 to capture much more LPS through the esterification reaction between the boron dihydroxyl group and diol of LPS, which led to a high focal concentration of Mg 2+ on the bacterial membrane, enhancing the ability of Mg 2+ to disrupt the membrane structure of living bacteria. Furthermore, Nano-MgB 2 capturing LPS could block dead bacteria or dead bacteria-released endotoxin (LPS)-induced excessive inflammation through the inhibition of mitogen-activated protein kinase (MAPK) signaling pathway in the immune cells. The suppression of both bacterial growth and excessive inflammation significantly promoted wound healing. This boron-magnet strategy can be used to develop new methods for promoting the healing of infected wounds. Results Synthesis and characterization of Nano-MgB 2 As proof of concept, a series of ‘boron-magnet’ materials, reactive metal borides (MB NPs), were synthesized using an improved self-propagating high-temperature synthesis (SHS) approach as previously reported 21 .The X-ray diffraction (XRD) results demonstrated that all three MB NPs were indeed MgB 2 , AlB 2 , and BeB x (Supplementary Fig. 1). We hypothesised that these three MB NPs had antibacterial effects. Therefore, we incubated different concentrations of MB NPs with Pseudomonas aeruginosa , the most common gram-negative bacteria in the chronic wounds 5 , to screen the most effective antibacterial NP. As shown in Supplementary Fig. 2, all MB NPs exhibited significant antibacterial effects, however, Nano-MgB 2 showed a stronger antibacterial effect compared to AlB 2 and BeB x . Therefore, we used Nano-MgB 2 as a representative example to evaluate the synthesis, characterization and function of MB NPs. As shown in Fig. 1 a, b, scanning electron microscopic (SEM) and transmission electron microscopic (TEM) images indicated that the obtained Nano-MgB 2 was well dispersed in water. Dynamic light scattering (DLS) revealed that the mean diameter of Nano-MgB 2 was about 100–200 nm (Supplementary Fig. 3). High-resolution TEM (HRTEM) analysis clearly revealed the lattice fringes of Nano-MgB 2 with d -spacing of 2.65 Å, corresponding to the crystalline face (100) of Nano-MgB 2 (Fig. 1 c). Moreover, the images obtained using low-magnification high-angle annular dark-field scanning TEM (HAADF-STEM) as well as the elemental mapping indicated that this nanoplatform was mainly composed of Mg, B, and O, and the XRD pattern revealed the existence of MgB 2 (Fig. 1 d, e and Supplementary Fig. 1). Because of the layered properties of Nano-MgB 2 , it formed 2D-like nanostructures after hydrolysis (Fig. 1 f, g). Moreover, atomic force microscopy (AFM) indicated that the thickness of Nano-MgB 2 decreased from 60–100 nm before hydrolysis to 7–8 nm after hydrolysis (Fig. 1 h, i) further demonstrating that the morphology of Nano-MgB 2 changed from nanoparticles to 2D nanosheets. All these data demonstrated that the designed nanoparticles were successfully synthesized. Functional characterization of Nano-MgB 2 To determine the functional characterization of Nano-MgB 2 , we first evaluated its ability to generate a weakly alkaline microenvironment, Mg 2+ and boron hydroxyl groups. As shown in Fig. 2a, the pH rapidly increased within 30 min and became nearly stable at around 200 min (pH stabilized at 9.5 in a buffer solution of pH=7.5 and at 8.5 in a buffer solution of pH=5.5). During hydrolysis of Nano-MgB 2 , boron hydroxyl groups were observed in the Fourier transform infrared (FTIR) spectrum, as shown by the broad peak at 3000-3500 cm -1 (Fig. 2b). Furthermore, as shown in Fig. 2c, d, buffer solution with a lower pH led to a faster hydrolysis rate of Nano-MgB 2 . These data demonstrate that hydrolysis of Nano-MgB 2 leads to the generation of an alkaline microenvironment, Mg 2+ and boron hydroxyl groups. To determine whether boron hydroxyl groups act as a ‘boron-magnet’ to capture LPS/PGN, the key components of gram-negative and -positive bacteria, Nano-MgB 2 was incubated with LPS, PGN or dead P. aeruginosa (HIB, heat-inhibited bacteria) . As shown in Fig. 2e, the characteristic peak at 1072 cm -1 demonstrated that the hydrolysate of Nano-MgB 2 reacted with LPS, PGN and HIB to form boronic ester (O-B-O) bonds. Besides Nano-MgB 2 , Nano-AlB 2 and Nano-BeB x can also react with LPS and PGN to form O-B-O bonds, suggesting that members of this class of nano-scale reactive metal borides have similar ‘boron-magnet’ functions (Supplementary 5). Furthermore, we compared the LPS binding activity of Nano-MgB 2 with that of H 3 BO 3 which contains boron hydroxyl groups. As shown by SEM equipped with elemental mapping, a much larger amount of B element was enriched on the bacteria in the Nano-MgB 2 -incubated group than in the H 3 BO 3 -incubated group (Fig. 2f), indicating Nano-MgB 2 forms much more stable borate ester bonds with LPS compared to H 3 BO 3 . In addition, XPS was performed to analyze the samples before and after the hydrolysis of Nano-MgB 2 (Fig. 2g, h). After hydrolysis, the sample was characterized by the disappearance of the characteristic peak for the negatively charged boron species (B-Mg bond, 185.8 eV) and the appearance of the characteristic peak for the positively charged boron species (190.9 eV for B-OH bond and 192.7 eV for HO-B-OH bond, respectively). Therefore, the hydrolysis of Nano-MgB 2 involved oxidation of boron elements. Considering the oxidative stress microenvironment of the bacteria-infected wound, we further examined the ROS scavenging ability of Nano-MgB 2 . Nano-MgB 2 exhibited high reactivity towards broad-spectrum ROS (Fig. 2i), reactive nitrogen species (RNS) (Supplementary Fig. 5), and the direct •OH scavenging ability of Nano-MgB 2 (Supplementary Fig. 6). Thus, the designed reactive metal borides are slowly hydrolyzed to generate boron dihydroxy groups and metal cations while generating a local alkaline/low ROS microenvironment, which promoted the esterification reaction between boron hydroxyl groups and LPS/PGN. Nano-MgB 2 disrupted the structure of bacteria in vitro . As the experiments described above demonstrated that Nano-MgB 2 can react with LPS to form O-B-O bonds, the antibacterial activity of Nano-MgB 2 was further evaluated. As shown in Fig. 3a, b, Nano-MgB 2 exhibited excellent antibacterial activity at a low concentration at around 12.5 μg/mL, whereas H 3 BO 3 +Mg 2+ group exhibited little or no antibacterial effect against P. aeruginosa at the same concentration. This antibacterial effect of our synthesized Nano-MgB 2 was dramatically stronger than that of commercial MgB 2 powders 22 , and was comparable to the effects of antibiotic metronidazole (Supplementary Fig. 7). Furthermore, as shown in Supplementary Fig. 8, Nano-MgB 2 also showed a significant antibacterial effect against S. aureus . Taken together, these data demonstrate that Nano-MgB 2 has excellent antibacterial activity. To further investigate Nano-MgB 2 capturing LPS is required for the antibacterial effect of Nano-MgB 2 , different concentrations of LPS were added to block the reaction between Nano-MgB 2 and LPS. Nano-MgB 2 (6.25 μg/mL) significantly inhibited the growth of P. aeruginosa , however, this inhibition effect was rescued by adding LPS, demonstrating that the O-B-O bond between Nano-MgB 2 and LPS is involved in Nano-MgB 2 -induced bacterial death (Fig. 3c). Furthermore, as shown in the result of SEM, the bacteria typically had a rod-shaped morphology with a smooth and intact cell wall in the blank and H 3 BO 3 +Mg 2+ groups, whereas those treated with Nano-MgB 2 became wrinkled and shrunk (Fig. 3d). TEM analysis revealed that the cytoplasm of bacteria was lost in the Nano-MgB 2 -treated group compared with that in the blank and H 3 BO 3 +Mg 2+ groups, indicating that degradation of the cytoplasm components or cell membrane leakage occurred after Nano-MgB 2 treatment (Fig. 3e). These data demonstrate that Nano-MgB 2 triggers damage to the bacterial membrane. Metal cations such as silver 23 , magnesium 24 , aluminum 25 , zinc 26 , among others are often responsible for disrupting the bacterial membrane by altering the membrane potential and permeability. The reaction between MB and LPS on the cell wall not only produces a focal source of metal ions but also narrows the distance between metal cations and cell membrane 27 . Therefore, we first measured the change of the membrane potential in bacteria treated with Nano-MgB 2 and H 3 BO 3 +Mg 2+ using the fluorophore dye DiSC 3 (5) (a cyanine dye that shows increased fluorescence upon dissipation of the membrane potential) 28 . As shown in Fig. 3f, Nano-MgB 2 significantly changed the membrane potential compared to the blank and H 3 BO 3 +Mg 2+ groups, indicating that a focal source of Mg 2+ from Nano-MgB 2 damages the cell membrane by changing the membrane potential. Next, we detected the permeability of bacterial membranes after Nano-MgB 2 treatment. P. aeruginosa treated with H 3 BO 3 +Mg 2+ and Nano-MgB 2 were stained with SYTO9 and propidium iodide (PI). SYTO9 is a green-fluorescent dye that freely permeates cell membranes and shows a large increase in fluorescence upon binding to nucleic acids. PI is a red-fluorescent dye that can specifically bind to DNA or RNA to enhance fluorescence but cannot pass through the intact membranes of viable cells 28 . As shown in Fig. 3g, Nano-MgB 2 -treated group exhibited a large number of bacteria with red fluorescence (PI staining), compared with the blank and H 3 BO 3 +Mg 2+ groups, suggesting that Nano-MgB 2 significantly increased the membrane permeability of P. aeruginosa . Next, we stained the bacteria with PI and performed fluorescence-activated cell sorting (FACS) to further quantify permeability changes in bacteria in the presence of Nano-MgB 2 . As shown in Fig. 3h, 12.5 μg/mL Nano-MgB 2 induced a change in membrane permeability in 54.1% of bacteria, which was higher than that induced by H 3 BO 3 +Mg 2+ (6.37%). Taken together, these data suggest that Nano-MgB 2 induces cell membrane damage by altering the membrane potential and permeability. To further investigate the molecular mechanism by which Nano-MgB 2 induces bacteria death, RNA-seq was performed to screen for changes in gene expression in Nano-MgB 2 -treated P. aeruginosa . As shown in Supplementary Fig. 9, Nano-MgB 2 down-regulated 1582 genes and ug-regulated 1876 genes. Furthermore, Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis of known Nano-MgB 2 -related genes was performed. Numerous important pathways such as “ABC transporters”, “phosphotransferase system”, “ribosome”, and “aminoacyl-tRNA biosynthesis” were enriched, and most genes in these pathways were upregulated in Nano-MgB 2 -treated P. aeruginosa , suggesting that Nano-MgB 2 induced a stress response (Fig. 3i). Interestingly, the RNA degradation pathway was enriched, and 15 of the 16 related genes were upregulated after Nano-MgB 2 treatment (Fig. 3i, j). Accordingly, we verified the expression of these 16 genes in P. aeruginosa treated with Nano-MgB 2 using QPCR. As shown in Fig. 3k, l, Nano-MgB 2 significantly promoted the expression of these 16 RNA degradation-related genes, consistent with the results of RNA-seq. These data suggest that Nano-MgB 2 kills bacteria by promoting RNA degradation. Indeed, previous studies showed that RNA was degraded in response to changes in membrane permeability 29, 26 . Thus, these data demonstrate that Nano-MgB 2 reacts with LPS in the cell wall continuously releasing Mg 2+ at the cell membrane, which disrupts the bacterial membrane, leading to RNA degradation and bacterial death (Fig. 3m). Nano-MgB 2 suppressed the proinflammatory function of dead bacteria and endotoxin (LPS) in vitro To further investigate whether Nano-MgB 2 inhibits inflammation induced by dead bacteria or dead bacteria-released endotoxin (LPS), we first assessed the toxicity of Nano-MgB 2 towards human cell lines, including skin keratinocytes (HaCat cells) and immunocytes (Raw264.7 macrophages) using cell counting kit-8 (CCK-8). As shown in Supplementary Fig. 10, Nano-MgB 2 was not toxic to skin keratinocytes and immunocytes after incubation for 24 h, and the components released from Nano-MgB 2 such as Mg 2+ and H 3 BO 3 showed no toxicity towards keratinocytes. Next, we treated macrophage cells with LPS or dead bacteria (HIB, heat-inhibited bacteria) in the presence or absence of Nano-MgB 2 . As shown in Fig. 4a, b, LPS and HIB dramatically induced the expression of inflammation-related molecules such as tumor necrosis factor α (TNF-α), interleukin 6 (IL-6), and IL-1β, which were significantly inhibited after treatment with Nano-MgB 2 . These results indicate that dead bacteria and dead bacteria-released endotoxin (LPS) can significantly induce a strong inflammatory response in immune cells and Nano-MgB 2 can interact with LPS to block the inflammatory response. As previously reported, LPS can activate Toll-like receptor 4 and induce the production of inflammatory factors by regulating the mitogen-activated protein kinase (MAPK) signaling pathway 30, 31 . As shown in Fig. 4c-f, LPS-induced phosphorylation of MAPK such as p38, Erk, and JNK were significantly inhibited by Nano-MgB 2 treatment, suggesting that Nano-MgB 2 blocks HIB/endotoxin (LPS)-induced inflammation by regulating MAPK signaling pathway (Fig. 4g). Nano-MgB 2 inhibited bacterial survival in vivo To evaluate the in vivo antibacterial efficacy of Nano-MgB 2 , a P. aeruginosa -infected skin infection model was constructed. As shown in Fig. 5a, the P. aeruginosa infection-induced lesion area was significantly inhibited by Nano-MgB 2 treatment. Consistent with these results, the number of bacteria in the lesions was also decreased (Fig. 5b). As bacterial infections can progress from a local to systemic state, the number of bacteria in the spleen was decreased by Nano-MgB 2 treatment (Fig. 5c). To further investigate the effect of Nano-MgB 2 on P. aeruginosa -infected skin tissue, the skin lesion areas were dissected using hematoxylin and eosin (H&E) staining. As shown in Fig. 5d, the bacteria-infected group showed severely destroyed epidermal skin and a large number of hematoxylin-positive cells in the dermis, which were relieved after Nano-MgB 2 treatment. To determine whether the increased hematoxylin-positive cells were inflammatory cells, we performed immunofluorescence staining with the neutrophil cell marker myeloperoxidase (MPO) 32, 33 and macrophage cell marker F4/80 34, 35 . As shown in Fig. 5e, Nano-MgB 2 treatment significantly decreased the number of P. aeruginosa -induced neutrophils and macrophages, indicating decreased skin infection after Nano-MgB 2 treatment. Consistently, inflammatory factors such as IL-6, TNF-α, and monocyte chemoattractant protein (MCP)-1 were inhibited after Nano-MgB 2 treatment (Fig. 5f). Similar results were observed in mice infected with S. aureus in the presence of Nano-MgB 2 . Nano-MgB 2 significantly inhibited the increase of lesional size in the S. aureus -infected skin (Supplementary Fig. 11 a, b) and bacteria numbers in the skin and spleen (Supplementary Fig. 11 c-f). Furthermore, inflammatory factors such as IL-6, TNF-α, and MCP-1 were significantly inhibited (Supplementary Fig. 11 g, h). These data demonstrate that Nano-MgB 2 can inhibit bacteria growth and decrease bacteria-induced inflammation in vivo . Nano-MgB 2 suppressed dead bacteria-induced skin inflammation in vivo Beside bacteria infection, the dead bacteria or their released endotoxin/LPS also induced excessive inflammation in the skin. As shown in Fig. 6a, dead bacteria significantly cause the redness and swelling of the skin, and this phenomenon was dramatically inhibited after Nano-MgB 2 treatment. To further investigate the inflammatory conditions within the skin, the skin lesion areas were dissected for H&E and immunofluorescence staining. Many hematoxylin-positive cells in the dermis were detected in the dead bacteria group, indicating that dead bacteria induce a large number of inflammatory cells. However, this phenomenon was dose-dependently inhibited by the Nano-MgB 2 (Fig. 6b). Consistent result was shown in immunofluorescence staining that Nano-MgB 2 significantly decreased the number of neutrophils (MPO-positive cells) and macrophages (F4/80-positive cells) induced by dead bacteria (Fig. 6c, d). Furthermore, the inflammatory factors such as IL-6, TNF-α, and MCP-1 were also significantly inhibited after Nano-MgB 2 treatment (Fig. 6e). All these data demonstrate that even dead bacteria can induce serious skin inflammation, and Nano-MgB 2 can inhibit dead bacteria-induced inflammation. Nano-MgB 2 promoted infected-wound healing in vivo Because of the excellent antibacterial and anti-inflammatory activities of Nano-MgB 2 both in vitro and in vivo , we next investigated the function of Nano-MgB 2 in P. aeruginosa -infected skin wound healing. As shown in Fig. 7a, b, 50 µg of Nano-MgB 2 clearly accelerated the healing rate of P. aeruginosa -infected wound. Furthermore, the number of P. aeruginosa in the skin and spleen was significantly reduced after Nano-MgB 2 treatment, which is consistent with the results of H&E staining showing lower inflammatory cell infiltration in the Nano-MgB 2 -treated group (Fig. 7c, d). In addition, the results of immunofluorescence staining showed that Nano-MgB 2 treatment significantly reduced the number of neutrophils (MPO-positive cells) and macrophages (F4/80-positive cells), indicating decreased bacterial infection and inflammation after Nano-MgB 2 treatment (Fig. 7e). Moreover, inflammatory factors such as TNF-α and IL-6 were dramatically decreased after Nano-MgB 2 treatment, further demonstrating decreased bacterial infection and inflammation in Nano-MgB 2 -treated wounds (Fig. 7f). These results are consistent with those observed in S. aureus -infected skin wounds treated with Nano-MgB 2 . Nano-MgB 2 significantly promoted S. aureus -infected skin wound healing (Supplementary Fig. 12 a, b) and inhibited bacterial growth in the skin (Supplementary Fig. 12 c, d). Furthermore, hematoxylin-positive cells and inflammatory factors such as TNF-α, IL-6, and MCP-1 were significantly inhibited (Supplementary Fig. 12 e, f). In addition, the mRNA expression level of the oxidative stress gene Hmox1 was dramatically decreased in Nano-MgB 2 -treated wounds, when compared with the untreated group, suggesting that Nano-MgB 2 decreases oxidative stress through its ROS-scavenging activity (Supplementary Fig. 13). These data demonstrate that Nano-MgB 2 promotes wound healing by inhibiting bacterial growth, bacteria-induced excessive inflammation, and oxidative stress. Discussion Bacteria and bacteria-induced excessive inflammation are involved in the healing of infected wounds. Wound treatment strategies that simultaneously inhibit both bacterial infection and dead-bacteria-induced excessive inflammation are urgently needed in the clinic. LPS /PGN is the key structural and functional component of bacteria that is crucial for ensuring bacterial survival and pathogenicity. Therefore, capturing LPS/PGN is a promising strategy for simultaneously inhibiting live bacterial infection and dead bacteria-induced excessive inflammation, leading to bacteria-infected wound healing. In this study, we proposed the “boron-magnet” strategy for the first time to capture LPS/PGN for infected wound healing based on the reactive MB NPs, which may have better bioavailability and the proteolytic stability than peptides. Our study demonstrated that boron dihydroxyl groups of MB NPs formed stable borate ester bonds with the diol of LPS/PGN exhibiting excellent antibacterial and anti-inflammatory effects, finally promoting wound healing. Here, this ‘boron-magnet’ strategy captured not only LPS but also PGN, demonstrating that this strategy can be widely used for the treatment of both gram-negative and gram-positive bacterial infection. However, the inhibition efficacy of Nano-MgB 2 against gram-positive bacteria was lower than that against gram-negative bacteria. This is because the LPS of P. aeruginosa contains much more 1,2-diol or 1,3-diol compared to PGN of S. aureus , thus much more Nano-MgB 2 reacted with LPS than with PGN, supporting the importance of generating borate ester bonds to achieve antibacterial and anti-inflammatory activities. In addition to the bacteria, this strategy may also be suitable for the treatment of virus infection. Capturing the key component of the virus, such as the spike glycoprotein of SARS-CoV-2, which is the shell protein of the virus and mediates the fusion of the virus membrane with the host cell membrane 36 , may provide a new therapeutic method for virus infection. In this work, Nano-MgB 2 exhibited higher bacteria-binding and antibacterial activities than H 3 BO 3 , a standard antibacterial agent, contains boron dihydroxyl groups 37 , 38 . This is consistent with our prediction that the local alkaline microenvironment generated by hydrolysis of Nano-MgB 2 could enhance the stability of borate ester bonds to effectively improve the binding ability of Nano-MgB 2 to bacterial polysaccharides. This mechanism can be interpreted based on a previous study showing that an alkaline microenvironment changes the hybridization of B atom from sp 2 to sp 3 , leading to the formation of hydroxy boronate anion, thus enhancing the stability of borate ester bonds 20 , 39 . Another interesting finding is that all three types of MB NPs (MgB 2 , AlB 2 , and BeB x ) showed antibacterial activity but exhibited variable activities against P. aeruginosa , indicating that different ions in the NPs have different antibacterial roles. It is generally accepted that metal cations often disrupt the bacterial membrane. Consistently, our study confirmed that Nano-MgB 2 disrupted bacterial membrane through altering the membrane potential and permeability. However, the cause of the varied antibacterial activity among these metal cations requires further investigation. In summary, our work highlights that the ‘boron-magnet’ strategy provides a novel method to treat bacteria-infected wounds by capturing the key components of bacteria and realizing both antibacterial and anti-inflammatory effects. This strategy holds great potential for future clinical translation in the treatment of pathogen infection. Methods Chemical reagents. All the chemical reagents were of analytical grade and used directly without further purification. Magnesium powder (Mg, 99.9%, AR), Aluminum (Al, 99.9%, AR), Beryllium (Be, 99.9%, AR), and Boron (B, 99.9%, AR) powder were purchased from Aladdin. Anhydrous ethanol was purchased from Sigma-Aldrich. The ultrapure water used throughout the experiment was prepared by the ELGA PURELAB classic water purification system. Material characterization. Transmission electron microscope (TEM) images and corresponding element mapping were obtained with Thermo Fisher Scientific Tecnai G2 F30. Scanning electron microscope (SEM) images were acquired by HITACHI S-480. X-ray diffraction (XRD) data were acquired from a Rigaku D/MAX 2250V diffractometer with a scanning rate of 5° min − 1 in the 2θ range of 10–80°. Atomic force microscopy (AFM) images were obtained on a Dimension Fast Scan (Bruker) under ScanAsyst mode. The hydrodynamic size distribution was measured via dynamic light scattering (DLS) in Microtrac Nanotrac wave II. Fourier transform infrared spectroscopy (FTIR) spectra were obtained with a BRUKER TENSOR II using KBr pellets. The variation in pH of the hydrolysate of Nano-MgB 2 nanoparticles (MB NPs) was acquired by using a pH meter (FE28, METTLER TOLEDO). Element concentration was obtained with inductively coupled plasma optical emission spectrometry (ICP-OES) by Agilent Technologies. The X-ray photoelectron spectroscopy (XPS) plots were conducted with a Thermo Fisher Scientific Escalab 250Xi, and the accurate binding energies were determined by taking the position of C 1s peak at 284.8 eV as the calibration reference. Electron spin resonance (ESR) spectra were acquired from the JEOL FA200 electron paramagnetic resonance spectrometer. The ultraviolet-visible absorption spectra (UV-vis) were recorded on the Shimadzu UV-3600 Plus spectrophotometer. Synthesis of MB NPs. The MB NPs (Nano-MgB 2 , Nano-AlB 2, and Nano-BeB x ) were synthesized by a self-propagating high-temperature synthesis (SHS) approach. Typically, 30 mM of metal powder (Mg, Al, or Be) and 40 mM of boron powder were fully ground and placed in a 15 mL corundum crucible. The mixture reacted at 800°C under an Ar (5% O 2 ) atmosphere for 3 h with a heating rate of 10°C/min. Then the resultant products were dispersed in 200 mL anhydrous ethanol, and centrifuged at 5,000 rpm for 5 min to remove large particles. Subsequently, the NPs were collected by centrifugation at 13,000 rpm for 15 min and then washed several times with ethanol. The temporal variation in the pH and of Nano-MgB 2 hydrolysate. 1 mL Nano-MgB 2 solution (1 M Nano-MgB 2 ) was sealed in a dialytic bag (cutoff molecular weight: 5000 Dalton). Then the dialytic bag was placed in a beaker containing 100 mL citric acid-sodium citrate buffer solutions of various pH values (7.5, 6.5 and 4.5) and processed in a shaker at 37°C for 24 h (shaking speed: 100 rpm). At regular intervals, the pH value was detected by a pH meter. 1 mL solution was collected to determine the releasing concentration of Mg and B elements by using ICP-OES, and 1 mL fresh buffer solution was returned. Verification of scavenging effect of Nano-MgB 2 on hydroxyl radical (•OH). Using 5, 5-Dimethyl-1-pyrroline N-oxide (DMPO) as the spin trap, electron spin resonance (ESR) spectroscopy was used to confirm the •OH scavenging effect of Nano-MgB 2 . 100 µL citric acid-sodium citrate buffer solution was prepared (pH = 6.5, 20 µM FeSO 4 ), and Nano-MgB 2 were added to the experimental group (100 µg/mL, without Nano-MgB 2 in the control group), then 20 µL of the mixed solution was added (5 mM H 2 O 2 and 100 mM DMPO) after 15 min. The obtained mixture solution was detected by an ESR spectrometer at room temperature. Verification of scavenging effect of Nano-MgB 2 on ROS and RNS. The ability of Nano-MgB2 to scavenge ROS and RNS was demonstrated by PTIO• and DPPH• scavenging experiments, respectively. PTIO• radicals were dissolved with pH = 7.4 phosphate buffer at a concentration of 25 µg/mL (DPPH• radicals were dissolved in anhydrous ethanol at a concentration of 20 µg/mL), then various concentrations of Nano-MgB 2 (from 0 µg/mL to 400 µg/mL) were added. The total volume of the reaction mixture remains the same by the addition of the corresponding reagent. The mixed solution was incubated at 37°C for 2 h in a water bath under dark conditions, the absorbance was measured at 557 nm (519nm for DPPH•) by UV-vis absorption spectra. Bacterial culture and antibacterial activity test. Staphylococcus aureus (ST398) and Pseudomonas aeruginosa (PA-14) were from Jiang’s lab at East China Normal University. S. aureus were cultured in Trypticase Soy Broth (TSB) and P. aeruginosa were grown in Luria-Broth medium (LB). One day before the experiment, bacteria were incubated overnight in a culture medium at 37℃ (220 rpm shaking), and a small aliquot of cells (4%) was re-inoculated into a fresh culture medium and then grew to logarithmic phase( S. aureus , OD = 0.6–0.8, about 10 8 bacteria; P. aeruginosa , OD = 0.5, about 10 9 bacteria. The bacteria were diluted to 10 8 /mL colony-forming units. Ten microliters of live bacteria were incubated with different concentrations of Nano-MgB 2 at 37℃ for 6 h. The bacteria from the mixture were diluted and plated on TSB or LB agar for 24 h at 37℃, respectively. Finally, the numbers of colonies were counted. Live/dead fluorescent staining and Flow cytometry. P. aeruginosa (10 8 /mL) treated with 272 µM Nano-MgB 2 (12.5 µg/mL) and 544 µM H 3 BO 3 + Mg 2+ for 6 h were stained with SYTO9 (Thermo Fisher Scientific Cat 2266591 6 µM) and Propidium iodide (Beyotime Cat ST511, 15 µM) for 15 min at room temperature in the dark. The live and dead cells were visualized with confocal laser microscopy (Nikon A1 + R-980). For the Flow cytometry assay, bacteria treated with Nano-MgB 2 and H 3 BO 3 + Mg 2+ for 3 h were added with 15 µM Propidium iodide and incubated for 30 min in the dark. Flow cytometry was performed using FACScan (Beckman Coulter). Preparation of bacterial samples for SEM/TEM. Bacteria (1×10 9 ) were collected and treated with 272 µM Nano-MgB 2 (12.5 µg/mL) and 544 µM H 3 BO 3 + Mg 2+ for 3 h, and then washed with PBS and fixed in 2.5% glutaraldehyde solution. After being washed with PBS and dehydrated by ethanol, bacteria were analyzed with SEM(ZEISS Gemini300)and elemental mapping (OXFORD Xplore). For TEM analysis. Bacteria were fixed with 2.5% glutaraldehyde at 4°C and post-fixed with 1% OsO4. The materials were then washed three times with PBS (15 min each) and dehydrated in a graded series of ethanol (15 min for each concentration). After penetration with 100% acetone, the materials were embedded with Epon 812 and successively polymerized at 37 ºC for 18 h, 48 ºC for 24 h and at 60 ºC for 48 h. The embedded samples were finally ultrathin-sectioned for 70 nm and stained with uranyl acetate and lead citrate for transmission electron microscopic (JEM2100, JEOL, Japan) observation and photography. Cytoplasmic membrane depolarization assay. The ability of Nano-MgB 2 to alter the cytoplasmic membrane electrical potential was determined using the membrane potential-sensitive dye DiSC3(5) (3,3'-Dipropylthiadicarbocyanine Iodide; MKBio). Bacteria grown at 37°C in LB medium to mid-logarithmic phase (OD600 = 0.5) were harvested, washed once with PBS, and resuspended by a final concentration of 2 µM DiSC3(5). The mixture was then incubated for 30 min at room temperature to enable dye uptake and fluorescence quenching. The change in fluorescence was measured immediately after the addition of 272 µM Nano-MgB 2 and 544 µM H 3 BO 3 + Mg 2+ using FACScan (Beckman Coulter) for detection. RNA isolation and QPCR RNA isolation procedure for cells. Raw264.7 cells in a 24-well plate were washed with PBS and lysed with TRIzol (Life technologies, Cat15596026). The total RNA was separated with chloroform, precipitated by isopropanol and washed with 75% ethanol in DEPC treated H 2 O. For tissue, the only difference from the procedure in cells is the first step. The tissue was cut for 2 mm pieces and pulverized in 1mL TRIzol with a homogenizer at 4°C for a total of 2×60 sec. For bacteria, 1 mL bacteria were collected and lysed with 100 µL lysozyme (0.4 mg/mL) for 3–5 min. After that, an Eastep Super RNA isolation kit (Shanghai Promega, LS1040) was used for RNA isolation. DNase was used to clean the genome DNA as described by the instructions. Reverse transcription of RNA and QPCR. Each sample of RNA (1–5 µg) was reversed to cDNA using Hifair® III 1st Strand cDNA Synthesis SuperMix for QPCR (YESEN, CHINA 11141ES60) as described by the instructions. Finally, the cDNA was analyzed by Quantitative PCR using Hieff® QPCR SYBR® Green Master Mix (YESEN, CHINA, 11202ES03) on ABI real-time instruments (ABI 7500) as described by the instructions. The primers were listed as follows: mTNF-α-F TCAAGGACTCAAATGGGCTTTC mTNF-α-R TGCAGAACTCAGGAATGGACAT mIL-6-F CTGCAAGAGACTTCCATCCAGTT mIL-6-R GGGAAGGCCGTGGTTGTC mIL-1β-F TAACCTGTGGCCTTGG mIL-1β-R TGTGCTCTGCTTGTGAG mMCP-1-F CAGGTCCCTGTCATGCTTCT mMCP-1-R GTGGGGCGTTAACTGCATCT mHmox1-1-F CAGAACCCAGTCTATGCCCC mHmox1-1-R GTGAGGCCCATACCAGAAGG RNA-seq data analysis and QPCR. Total RNA was extracted using a QIAGEN RNeasy kit (catalog no. 74104) following the manufacturer’s instructions. Ribosomal RNA removal, cDNA library construction, and paired-end sequencing with the Illumina HiSeq 2000 were completed by PersonalBio China. The edge R software package was used to detect DEGs. A fold change ≥ 2 and a false discovery rate (FDR) ≤ 0.05 (edger, Benjamini-Hochberg’s method) were used as a threshold to determine the DEGs. QPCR primers for Pseudomonas aeruginosa were listed in Supplementary Fig. 14. Western blot. Protein from cells . Cells in 6-well plate were lysed with 100 µL RIPA lysis buffer on ice for 20 min (RIPA buffer: 150 mM NaCl, 1% IGEPAL CA-630, 0.5% sodium deoxycholate, 0.1% SDS, 50 mM Tris-HCl, pH8.0 and protease inhibitors). Protein was collected from the supernatant by centrifuging at 12,000 rpm at 4°C for 20 min in a microcentrifuge. Protein from tissues . Dissected 3 mm-width tissue from the wound edge and cut to small pieces. Added 500 µL ice-cold lysis buffer (RIPA as above) to the tissue and homogenized it with an electric homogenizer at 4°C for a total of 2×60 sec. Protein was collected from the supernatant by centrifuging at 12,000 rpm at 4°C for 20 min in a microcentrifuge. The protocol for western blot was performed as previous report 40 . In brief, equal amounts of protein (20–30 µg) were reduced and denatured with 5×laemmli sample buffer, separated by SDS-PAGE gel, and transferred to the nitrocellulose membrane. After that, the membrane was blocked by 5% milk, incubated with the first antibody and second antibody as described by the manufacturer’s instructions. Finally, the membranes were developed by the Odyssey LI-COR instrument. The antibodies from Abways technology (China Inc.) were listed as follows: P38 antibody (Cat:CY5488); Pp38 antibody (Cat:CY6391; ERK1/2 antibody (Cat:CY5487); pErk1/2 antibody (Cat:CY5277); JNK1/2/3 antibody (Cat:CY5490); pJNK1/2/3 antibody (Cat:CY5541); GAPDH (Cat: AB0037). H&E and IF. The samples from the skin wound were dissected and fixed in 4% paraformaldehyde. After dehydrated in gradient alcohol, the samples were embedded in paraffin. Five micrometers of tissue sections were cut and mounted on glass slides. For H&E staining, the sections were dewaxed in xylene, rehydrated in gradient alcohol, washed briefly in distilled H 2 O, stained in Harris hematoxylin solution, differentiated with 0.3% acid alcohol, and stained with eosin. After dehydrating in gradient alcohol again, the sections were cleared in xylene and mounted with a xylene-based mounting medium. For immunofluorescence assays, the sections were pretreated with antigen retrieval solution (pH = 9.0 EDTA solution) after dewaxed in xylene, stained with indicated first antibodies (MPO (Abcam ab208670); mF4/80(Santacruz (BM8), sc-52664) and second antibodies Alexa Fluor 594 donkey anti-rabbit, Alexa Fluor 488 donkey anti-rat according to the manufacturer’s introduction, and then mounted with DAPI-contained mounting solution. The images were scanned by 3DHISTECH CaseViewer 2.4. Inflammation cytokine detection. Protein was collected as mentioned above. TNF-α, IL-6, and MCP-1 concentrations were detected by BD cytometric bead array (CBA) mouse inflammation kit (Catalog No. 552364) using BD FACSCalibur. The samples were prepared as follows: added 50 µL the mixed Capture Beads and 50 µL of sample to assay tubes, then added 50 µL the Mouse Inflammation PE Detection Reagent to each tube. Incubated for 2 h at room temperature in the dark. Added 1mL wash buffer and centrifuged at 200 g for 5 min. Resuspended in 300 µL wash buffer. Detected by flow cytometry and analyzed by FCAP Array software. Animals. Balb/c mice (7–8 weeks, male) were purchased from Charles River (CHINA Inc). All the experiments were approved by the East China Normal University Animal Care and Use Committee, and the ethics number is m20170215. All the surgeries were performed under a general anesthetic condition to minimize suffering. All the mice used in the experimental groups were randomly assigned. Cutaneous bacteria and heat-inhibited bacteria (HIB) infection in mice. The dorsal of mice were shaved and hair was removed by using chemical depilation (VEET, CHINA). For bacteria infection, bacteria in the logarithmic phase( S. aureus , OD = 0.6–0.8, about 10 8 bacteria; P. aeruginosa , OD = 0.5, about 10 9 bacteria)were collected and 10 6 S. aureus or 10 7 P. aeruginosa were intradermally injected into mouse dorsal skin and then intradermally treated with indicated concentrations of Nano-MgB 2 ; For heat-inhibited bacteria infection, 2×10 9 CFU/mL P. aeruginosa were killed at 70 ℃ for 1 hour and 2×10 8 CFU heat-inhibited P. aeruginosa were intradermally injected into mouse dorsal skin and then intradermally treated with indicated concentrations of Nano-MgB 2 . The lesions were photographed and measured by Image J software. Mice were euthanized on day 3 and the lesional skins were collected and homogenized to determine the survival number of bacteria. In some experiments, the lesional skins were collected for H&E staining, QPCR, and inflammation cytokine detection. Cutaneous-infected wound in mice. Mouse skins were shaved as mentioned above. Excisional dorsal skin wounds were made with an 8 mm sterile biopsy punch as previous report 41 and then infected with 10 6 S. aureus or 10 7 P. aeruginosa in the presence or absence of Nano-MgB 2 . The wounds were finally covered with a special kind of plastic sticker (Tegaderm Film, 3M, XH003801525), the wound areas were photographed at the indicated times and calculated by Image J. The mice were euthanized and the skin surrounding the wound edges was collected for H&E staining, QPCR, and Elisa. In some experiments, the whole lesional skins were collected and homogenized to determine the survival number of bacteria. Statistical analysis. All data are present as means ± SD. A two-tailed t-test was used to determine the significances between the two groups. One-way or two-way ANOVA with Bonferroni post test was used to analyze multiple groups. For all the statistical tests, P values < 0.05 were considered to be statistically significant. Data availability The main data supporting the results in this study are available within the paper and its Supplementary Information. All data generated in this study are available from the corresponding authors. Declarations Acknowledgement The authors thank ECNU Multifunctional Platform for Innovation (004) for technology support. The authors would greatly acknowledge the financial support by the National Funds for Distinguished Young Scientists (Grant No. 51725202), the Key Project of Shanghai Science and Technology Commission (Grant No. 19JC1412000), and the National Natural Science Foundation of China (Grant No. 51872094, 82172091). National Science Foundation for the Young Scientists of China (Grant No. 32000948). Author contributions W.B. and Y.W. conceived and supervised the study. Y.M., L.C. and Y.C. designed and performed the experiments. J.S., Z.Z., X.C. and W.Y. prepared and characterized the nanomaterials. Y.M., F.W. and X. J. performed most cell biological and animal experiments. W.Y., L.Z. and C.W. assisted with cell biological and animal experiments. L.C., X.M. and Y.C. analyzed the data. W.B. and Y.W. wrote the manuscript. All authors contributed to the review, revision and finalization of the manuscript. Competing interests The authors have no conflicts to declare. References Xue M, Zhao R, Lin H, Jackson C. Delivery systems of current biologicals for the treatment of chronic cutaneous wounds and severe burns. Adv. Drug Deliv. Rev. 129 , 219–241 (2018). Chin JS, Madden L, Chew SY, Becker DL. Drug therapies and delivery mechanisms to treat perturbed skin wound healing. Adv. Drug Deliv. Rev. 149–150 , 2–18 (2019). Sang Y, et al. Construction of Nanozyme-Hydrogel for Enhanced Capture and Elimination of Bacteria. Adv. Fun. Mater. 29 , 1900518 (2019). Kohanski MA, Dwyer DJ, Collins JJ. How antibiotics kill bacteria: from targets to networks. Nat. Rev. Microbiol. 8 , 423–435 (2010). Gjodsbol K, Christensen JJ, Karlsmark T, Jorgensen B, Klein BM, Krogfelt KA. Multiple bacterial species reside in chronic wounds: a longitudinal study. Int. Wound. J. 3 , 225–231 (2006). Wrighton KH. Bacterial physiology: Bridging the gap for lipopolysaccharides. Nat. Rev. Microbiol. 16 , 184–185 (2018). Yang X, et al. Bacterial Endotoxin Activates the Coagulation Cascade through Gasdermin D-Dependent Phosphatidylserine Exposure. Immunity 51 , 983–996 e986 (2019). Deng M, et al. The Endotoxin Delivery Protein HMGB1 Mediates Caspase-11-Dependent Lethality in Sepsis. Immunity 49 , 740–753 e747 (2018). Shibusawa K, Murakami T, Yomogida S, Tamura H, Nagaoka I. Antimicrobial cathelicidin peptide CAP11 suppresses HMGB1 release from lipopolysaccharide-stimulated mononuclear phagocytes via the prevention of necrotic cell death. Int. J mol. med. 23 , 341–346 (2009). Rosenfeld Y, Papo N, Shai Y. Endotoxin (lipopolysaccharide) neutralization by innate immunity host-defense peptides. Peptide properties and plausible modes of action. J. biol. chem. 281 , 1636–1643 (2006). Saravanan R, et al. Structural basis for endotoxin neutralisation and anti-inflammatory activity of thrombin-derived C-terminal peptides. Nat. commun. 9 , 2762 (2018). Giuliani A, Pirri G, Rinaldi AC. Antimicrobial peptides: the LPS connection. Methods mol. bio. 618 , 137–154 (2010). Sampath V. Bacterial endotoxin-lipopolysaccharide; structure, function and its role in immunity in vertebrates and invertebrates. Agric. Nat. Resour. 52 , 115–120 (2018). Dong H, et al. Structural basis for outer membrane lipopolysaccharide insertion. Nature 511 , 52–56 (2014). Chen W, Zhen X, Wu W, Jiang X. Responsive boron biomaterials and their biomedical applications. Sci. China Chem. 63 , 648–664 (2020). Ni N, Laughlin S, Wang Y, Feng Y, Zheng Y, Wang B. Probing the general time scale question of boronic acid binding with sugars in aqueous solution at physiological pH. Bioorg. Med. Chem. 20 , 2957–2961 (2012). Yuanyuan M, Hanting L, Jinghong M, Jinghua G. Glucose-responsive hydrogels based on phenylboronic acid. Mater. Sci. Forum 913 , 714–721 (2018). Marco-Dufort B, Tibbitt MW. Design of moldable hydrogels for biomedical applications using dynamic covalent boronic esters. Mater. Today Chem. 12 , 16–33 (2019). Peters JA. Interactions between boric acid derivatives and saccharides in aqueous media: Structures and stabilities of resulting esters. Coord. Chem. Rev. 268 , 1–22 (2014). Wang GSaB. A detailed examination of boronic acid-diol complexation. Tetrahedron 58 , 5291–5300 (2002). Chen Z. DN, Yanyan L., Heliang Y., Wenbo B., Jianlin S. Magnesium silicide nanoparticles as a deoxygenation agent for cancer starvation therapy. Nat. Nanotechnol. 121 , 378–386 (2017). Badica P, et al. Antibacterial composite coatings of MgB2 powders embedded in PVP matrix. Sci. Rep. 11 , 9591 (2021). Qiao Y, et al. Light-Activatable Synergistic Therapy of Drug-Resistant Bacteria-Infected Cutaneous Chronic Wounds and Nonhealing Keratitis by Cupriferous Hollow Nanoshells. ACS nano 14 , 3299–3315 (2020). Rahim MI, Eifler R, Rais B, Mueller PP. Alkalization is responsible for antibacterial effects of corroding magnesium. J. Biomed. Mater. Res. A 103 , 3526–3532 (2015). Marco E. B, Angelo A., Manfredi. Dangers in and out. Science 323 , 1683–1684 (2009). Surwade P, Luxton T, Clar J, Xin F, Shah V. Impact of the changes in bacterial outer membrane structure on the anti-bacterial activity of zinc oxide nanoparticles. J. Nanopart. Res. 22 , 43–51 (2020). Slavin YN, Asnis J, Hafeli UO, Bach H. Metal nanoparticles: understanding the mechanisms behind antibacterial activity. J. Nanobiotechnology 15 , 65 (2017). Sun Y, et al. CCN1 promotes IL-1beta production in keratinocytes by activating p38 MAPK signaling in psoriasis. Sci. Rep. 7 , 43310 (2017). Deutscher MP. Degradation of RNA in bacteria: comparison of mRNA and stable RNA. Nucleic Acid Res. 34 , 659–666 (2006). Frazier WJ, Xue J, Luce WA, Liu Y. MAPK signaling drives inflammation in LPS-stimulated cardiomyocytes: the route of crosstalk to G-protein-coupled receptors. PloS one 7 , e50071 (2012). Wang W, Liu P, Hao C, Wu L, Wan W, Mao X. Neoagaro-oligosaccharide monomers inhibit inflammation in LPS-stimulated macrophages through suppression of MAPK and NF-kappaB pathways. Sci. Rep. 7 , 44252 (2017). Amanzada A, Malik IA, Nischwitz M, Sultan S, Naz N, Ramadori G. Myeloperoxidase and elastase are only expressed by neutrophils in normal and in inflamed liver. Histochem. cell biol. 135 , 305–315 (2011). Pulli B, et al. Measuring myeloperoxidase activity in biological samples. PloS one 8 , e67976 (2013). Khazen W, et al. Expression of macrophage-selective markers in human and rodent adipocytes. FEBS letters 579 , 5631–5634 (2005). Dos Anjos Cassado A. F4/80 as a Major Macrophage Marker: The Case of the Peritoneum and Spleen. Results Probl. Cell. Differ. 62 , 161–179 (2017). Plante JA, et al. Spike mutation D614G alters SARS-CoV-2 fitness. Nature 592 , 116–121 (2021). Trippier PC, McGuigan C. Boronic acids in medicinal chemistry: anticancer, antibacterial and antiviral applications. Med. Chem. Comm. 1 , 183 (2010). Sayin Z, Ucan US, Sakmanoglu A. Antibacterial and Antibiofilm Effects of Boron on Different Bacteria. Biol. Trace. Elem. Res. 173 , 241–246 (2016). van Haveren J, Peters JA, Batelaan JG, Kieboom APG, van Bekkum H. pH dependence of the stability of boric acid and borate esters of amino acids and amino diols in aqueous medium as studied by 1B and 1H NMR spectroscopy. Recueil des Travaux Chimiques des Pays-Bas 108 , 179–184 (1989). Wang Z-h, Bao X-g, Hu J-j, Shen S-b, Xu G-h, Wu Y-l. Nicotinamide Riboside Enhances Endothelial Precursor Cell Function to Promote Refractory Wound Healing Through Mediating the Sirt1/AMPK Pathway. Front. Pharmacol. 12 , 671563 (2021). Wu Y, et al. Hyperglycaemia inhibits REG3A expression to exacerbate TLR3-mediated skin inflammation in diabetes. Nat. Commun. 7 , 13393 (2016). Additional Declarations There is NO Competing Interest. Supplementary Files Supportinginformation.docx supporting information NCOMMS2215806RSC.pdf Reporting Summary Cite Share Download PDF Status: Published Journal Publication published 29 Nov, 2022 Read the published version in Nature Communications → Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-1584966","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":105176966,"identity":"1eb5c255-19cc-44a4-b6d9-a4f1b6bdcc19","order_by":0,"name":"Yun Meng","email":"","orcid":"","institution":"Tongji University School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Yun","middleName":"","lastName":"Meng","suffix":""},{"id":105176967,"identity":"40db4825-01ed-430f-984d-37c592743128","order_by":1,"name":"Lijie Chen","email":"","orcid":"","institution":"Shanghai Key Laboratory of Green Chemistry and Chemical Processes, College of Chemistry and Molecular Engineering, East China Normal University","correspondingAuthor":false,"prefix":"","firstName":"Lijie","middleName":"","lastName":"Chen","suffix":""},{"id":105176968,"identity":"0242dc09-9ba0-49d1-894d-0ca0fbacea72","order_by":2,"name":"Yang Chen","email":"","orcid":"","institution":"Tongji University School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Yang","middleName":"","lastName":"Chen","suffix":""},{"id":105176969,"identity":"e811515d-a37e-4db4-90df-a99e0523e3f2","order_by":3,"name":"Jieyun Shi","email":"","orcid":"","institution":"Tongji University School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Jieyun","middleName":"","lastName":"Shi","suffix":""},{"id":105176970,"identity":"f4472ec7-e18c-42d2-849b-73bf6e2585a5","order_by":4,"name":"Zheng Zhang","email":"","orcid":"","institution":"East China Normal University","correspondingAuthor":false,"prefix":"","firstName":"Zheng","middleName":"","lastName":"Zhang","suffix":""},{"id":105176971,"identity":"9809d339-c86a-470f-8dcf-44735543ba18","order_by":5,"name":"Yiwen Wang","email":"","orcid":"","institution":"East China Normal University","correspondingAuthor":false,"prefix":"","firstName":"Yiwen","middleName":"","lastName":"Wang","suffix":""},{"id":105176972,"identity":"b4ae19ea-72fc-485d-bdc1-3587d7077942","order_by":6,"name":"Fan Wu","email":"","orcid":"","institution":"Tongji University School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Fan","middleName":"","lastName":"Wu","suffix":""},{"id":105176973,"identity":"9b1809d5-bb4e-474d-9420-a9be618c6dcf","order_by":7,"name":"Xingwu Jiang","email":"","orcid":"","institution":"Department of Materials Science and State Key Laboratory of Molecular Engineering of Polymers, Fudan University","correspondingAuthor":false,"prefix":"","firstName":"Xingwu","middleName":"","lastName":"Jiang","suffix":""},{"id":105176974,"identity":"8af24495-3c54-447f-919a-b26fb1811afd","order_by":8,"name":"Wei Yang","email":"","orcid":"","institution":"Tongji University School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Wei","middleName":"","lastName":"Yang","suffix":""},{"id":105176975,"identity":"56fde7a9-7163-43a9-83c4-db72963914b5","order_by":9,"name":"Li Zhang","email":"","orcid":"","institution":"Tongji University School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Li","middleName":"","lastName":"Zhang","suffix":""},{"id":105176976,"identity":"47865161-ac24-4d95-8a99-0c0c1591c080","order_by":10,"name":"Chaochao Wang","email":"","orcid":"","institution":"Tongji University School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Chaochao","middleName":"","lastName":"Wang","suffix":""},{"id":105176977,"identity":"630f270a-5b33-4116-b5ca-9d99faac98f2","order_by":11,"name":"Xianfu Meng","email":"","orcid":"","institution":"Tongji University School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Xianfu","middleName":"","lastName":"Meng","suffix":""},{"id":105176978,"identity":"6ac0d9a0-e81b-4dda-b208-9ee4325714d1","order_by":12,"name":"Yelin Wu","email":"","orcid":"","institution":"Shanghai Tenth People’s Hospital, Tongji University School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Yelin","middleName":"","lastName":"Wu","suffix":""},{"id":105176979,"identity":"bb2175de-b5fb-4b1c-861c-e38a7fdadcd2","order_by":13,"name":"Wenbo Bu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAvUlEQVRIiWNgGAWjYDACCR4Ghg82DIwNIA4PsVoYZ6SRqoWZhyQtBrd7j0nbJByW7Z/dwPjgbRuDvDlBLXfOpUnnJBw2nnHnALPh3DYGw50NBLSY3cgxk879cTix4UYCmzRvG0OCwQFitFgkHE6cfyOB/TfxWhiAWjYAbWEmSov9nXPJlj0J6cYbbyQ2S845J2G4gZAWydm9B2/8SLCWnXcj+eCHN2U28gRtQQLgqJEgXv0oGAWjYBSMAtwAADeRQpPWKtFfAAAAAElFTkSuQmCC","orcid":"https://orcid.org/0000-0001-6664-3453","institution":"Fudan University","correspondingAuthor":true,"prefix":"","firstName":"Wenbo","middleName":"","lastName":"Bu","suffix":""}],"badges":[],"createdAt":"2022-04-22 14:36:35","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-1584966/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-1584966/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41467-022-35050-6","type":"published","date":"2022-11-29T05:00:00+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":21359424,"identity":"0e0b4874-c400-4ff1-9b34-696f416c356b","added_by":"auto","created_at":"2022-05-11 18:49:30","extension":"jpeg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":511549,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMorphology and characterization of Nano-MgB\u003c/strong\u003e\u003csub\u003e\u003cstrong\u003e2\u003c/strong\u003e\u003c/sub\u003e\u003cstrong\u003e. a\u003c/strong\u003e, SEM image. \u003cstrong\u003eb\u003c/strong\u003e, TEM image. \u003cstrong\u003ec\u003c/strong\u003e, HRTEM image (Inset graph: fast transform image). \u003cstrong\u003ed\u003c/strong\u003e, HADDF-STEM and EDS elemental mapping images of Nano-MgB\u003csub\u003e2\u003c/sub\u003e. \u003cstrong\u003ee\u003c/strong\u003e, XRD patterns of Nano-MgB\u003csub\u003e2\u003c/sub\u003e . \u003cstrong\u003ef\u003c/strong\u003e, \u003cstrong\u003eg\u003c/strong\u003e, TEM images of a single particle of Nano-MgB\u003csub\u003e2\u003c/sub\u003e before and after hydrolysis. \u003cstrong\u003eh\u003c/strong\u003e, \u003cstrong\u003ei\u003c/strong\u003e, AFM images of Nano-MgB\u003csub\u003e2\u003c/sub\u003e before and after hydrolysis.\u003c/p\u003e","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-1584966/v1/0003e76d72366230f2b12b48.jpeg"},{"id":21359503,"identity":"ecfa40fe-4bbc-4f36-b1aa-ceb04bf0590d","added_by":"auto","created_at":"2022-05-11 18:54:30","extension":"jpeg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":351755,"visible":true,"origin":"","legend":"\u003cp\u003e\t\u003cstrong\u003eFunctional characterization of Nano-MgB\u003c/strong\u003e\u003csub\u003e\u003cstrong\u003e2\u003c/strong\u003e\u003c/sub\u003e\u003cstrong\u003e. a\u003c/strong\u003e, Change of pH over time after Nano-MgB\u003csub\u003e2\u003c/sub\u003e hydrolysis. \u003cstrong\u003eb\u003c/strong\u003e, FTIR spectra of Nano-MgB\u003csub\u003e2\u003c/sub\u003e before and after hydrolysis. \u003cstrong\u003ec\u003c/strong\u003e, \u003cstrong\u003ed\u003c/strong\u003e, The releasing behaviors of B and Mg elements after Nano-MgB\u003csub\u003e2\u003c/sub\u003e hydrolysis in buffer solution with different pH. \u003cstrong\u003ee\u003c/strong\u003e, FTIR spectra of O-B-O formation under various conditions. \u003cstrong\u003ef\u003c/strong\u003e, Elemental mapping of \u003cem\u003eP. aeruginosa\u003c/em\u003e incubated with H\u003csub\u003e3\u003c/sub\u003eBO\u003csub\u003e3\u003c/sub\u003e and Nano-MgB\u003csub\u003e2\u003c/sub\u003e for 2 h. \u003cstrong\u003eg\u003c/strong\u003e, \u003cstrong\u003eh\u003c/strong\u003e, XPS fine spectra of Nano-MgB\u003csub\u003e2\u003c/sub\u003e before and after hydrolysis. \u003cstrong\u003ei\u003c/strong\u003e, UV-vis spectra of DPPH• scavenging ability with different concentrations of Nano-MgB\u003csub\u003e2\u003c/sub\u003e.\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-1584966/v1/dc0a9631ed765f691b2c82dd.jpeg"},{"id":21359713,"identity":"11a192e1-5f5d-4a08-bfe6-aac9959f63c4","added_by":"auto","created_at":"2022-05-11 18:59:30","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":940210,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eNano-MgB\u003c/strong\u003e\u003csub\u003e2\u003c/sub\u003e\u003cstrong\u003e reacted with LPS to disrupt bacterial cell membrane.\u003c/strong\u003e \u003cstrong\u003ea\u003c/strong\u003e, \u003cem\u003eP. aeruginosa\u003c/em\u003e treated with different concentrations of Nano-MgB\u003csub\u003e2\u003c/sub\u003e using colony-forming units counting method. \u003cstrong\u003eb\u003c/strong\u003e, Survival rates of \u003cem\u003eP. aeruginosa\u003c/em\u003e taken as in (\u003cstrong\u003ea\u003c/strong\u003e). \u003cstrong\u003ec\u003c/strong\u003e, Bacterial survival after \u003cem\u003eP. aeruginosa\u003c/em\u003e treated with Nano-MgB\u003csub\u003e2\u003c/sub\u003e in the presence of different concentrations of LPS. \u003cstrong\u003ed\u003c/strong\u003e, SEM images of \u003cem\u003eP. aeruginosa\u003c/em\u003e cells subjected to Nano-MgB\u003csub\u003e2\u003c/sub\u003e and H\u003csub\u003e3\u003c/sub\u003eBO\u003csub\u003e3\u003c/sub\u003e+Mg\u003csup\u003e2+\u003c/sup\u003e. \u003cstrong\u003ee\u003c/strong\u003e, TEM images of\u003cem\u003e P. aeruginosa\u003c/em\u003e cells subjected to Nano-MgB\u003csub\u003e2\u003c/sub\u003e and H\u003csub\u003e3\u003c/sub\u003eBO\u003csub\u003e3\u003c/sub\u003e+Mg\u003csup\u003e2+\u003c/sup\u003e. \u003cstrong\u003ef\u003c/strong\u003e, Membrane potential of \u003cem\u003eP. aeruginosa\u003c/em\u003e treated with Nano-MgB\u003csub\u003e2\u003c/sub\u003e and H\u003csub\u003e3\u003c/sub\u003eBO\u003csub\u003e3\u003c/sub\u003e+Mg\u003csup\u003e2+\u003c/sup\u003e\u003csub\u003e.\u003c/sub\u003e \u003cstrong\u003eg\u003c/strong\u003e, Cell membrane permeability of \u003cem\u003eP. aeruginosa\u003c/em\u003e treated with Nano-MgB\u003csub\u003e2\u003c/sub\u003e and H\u003csub\u003e3\u003c/sub\u003eBO\u003csub\u003e3\u003c/sub\u003e+Mg\u003csup\u003e2+\u003c/sup\u003e by SYTO9 and PI staining. All cells were labelled by the membrane-permeable\u0026nbsp;SYTO9 (green),\u0026nbsp;whereas only cell with damaged membrane were positive for PI (red). scale bar=20 μm. \u003cstrong\u003eh\u003c/strong\u003e, FACS analysis of PI-positive bacteria. \u003cstrong\u003ei\u003c/strong\u003e, KEGG-pathway of RNA-seq after \u003cem\u003eP. aeruginosa\u003c/em\u003e treated with Nano-MgB\u003csub\u003e2\u003c/sub\u003e. \u003cstrong\u003ej. \u003c/strong\u003eHeat map of RNA degradation-related gene expression after \u003cem\u003eP. aeruginosa\u003c/em\u003e treated with Nano-MgB\u003csub\u003e2\u003c/sub\u003e (gene names are labeled in Supplementary Fig. 9). \u003cstrong\u003ek-l\u003c/strong\u003e, QPCR of RNA degradation-related gene expression. \u003cstrong\u003em\u003c/strong\u003e, Schematic illustration of Nano-MgB\u003csub\u003e2\u003c/sub\u003e reacted with LPS to disrupt cell membrane. Values are the mean ± SD, * P\u0026lt;0.05, **P\u0026lt;0.01, ***P\u0026lt;0.001, ****P\u0026lt;0.0001, two-way ANOVA with Bonferroni post test was used to analyze multiple groups.\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-1584966/v1/647833c6af90a79c8c5cf59b.png"},{"id":21359099,"identity":"2c85e774-9146-4cfd-883f-5336392fef47","added_by":"auto","created_at":"2022-05-11 18:39:29","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":301693,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eNano-MgB\u003c/strong\u003e\u003csub\u003e2\u003c/sub\u003e\u003cstrong\u003e inhibited LPS or dead bacteria induced-inflammation in Macrophage.\u003c/strong\u003e\u0026nbsp;\u003cstrong\u003ea\u003c/strong\u003e, QPCR of TNF-α, IL-6 and IL-1β in Raw 264.7 cells treated with100 ng/mL LPS with 50 or 200 μg/mL Nano-MgB\u003csub\u003e2 \u003c/sub\u003efor 3 h. \u003cstrong\u003eb\u003c/strong\u003e, QPCR of TNF-α, IL-6 and IL-1β in Raw 264.7 cells treated with 5 × 10\u003csup\u003e7\u003c/sup\u003e dead bacteria (HIB, heat-inhibited bacteria, \u003cem\u003eP. aeruginosa\u003c/em\u003e) with 50 or 200 μg/mL Nano-MgB\u003csub\u003e2\u003c/sub\u003e for 3h. \u003cstrong\u003ec\u003c/strong\u003e, Western Blot of pP38/P38, pErk/Erk, and pJNK/JNK in Raw 264.7 cells treated as in (\u003cstrong\u003ea\u003c/strong\u003e) for 15 min. \u003cstrong\u003ed\u003c/strong\u003e, Western Blot of pP38/P38, pErk/Erk, and pJNK/JNK in Raw 264.7 cells treated as in (\u003cstrong\u003eb\u003c/strong\u003e) for 15 min. \u003cstrong\u003ee\u003c/strong\u003e, \u003cstrong\u003ef\u003c/strong\u003e, Quantitative analysis of (\u003cstrong\u003ec\u003c/strong\u003e) and (\u003cstrong\u003ed\u003c/strong\u003e) by grayscale scanning using Image J software. \u003cstrong\u003eg\u003c/strong\u003e, Schematic illustration of the mechanism by which Nano-MgB\u003csub\u003e2\u003c/sub\u003e inhibits HIB- or endotoxin (LPS)-induced inflammation.\u003c/p\u003e","description":"","filename":"floatimage51.png","url":"https://assets-eu.researchsquare.com/files/rs-1584966/v1/10a71c1cba508bbb500274e3.png"},{"id":21359100,"identity":"9049a062-59dc-4b7c-8a44-71266ea1c208","added_by":"auto","created_at":"2022-05-11 18:39:30","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":1181942,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eNano-MgB\u003c/strong\u003e\u003csub\u003e2\u003c/sub\u003e\u003cstrong\u003e inhibited skin infection \u003cem\u003ein vivo\u003c/em\u003e. a\u003c/strong\u003e, Photographs of \u003cem\u003eP. aeruginosa\u003c/em\u003e-infected mouse skin treated with or without 10 μg and 50 μg Nano-MgB\u003csub\u003e2 \u003c/sub\u003e(n=5). \u003cstrong\u003eb\u003c/strong\u003e, \u003cstrong\u003ec\u003c/strong\u003e,\u003cstrong\u003e \u003c/strong\u003eSurvival of bacteria from \u003cem\u003eP. aeruginosa\u003c/em\u003e-infected mouse skin or spleen taken as in (\u003cstrong\u003ea\u003c/strong\u003e). \u003cstrong\u003ed\u003c/strong\u003e, H\u0026amp;E staining of \u003cem\u003eP. aeruginosa\u003c/em\u003e-infected mouse skin taken as in (\u003cstrong\u003ea\u003c/strong\u003e). scale bar=200 μm. \u003cstrong\u003ee\u003c/strong\u003e, Immunofluorescence staining with the neutrophil cell marker myeloperoxidase (MPO) and macrophage cell marker F4/80 of \u003cem\u003eP. aeruginosa\u003c/em\u003e-infected mouse skin taken as in (\u003cstrong\u003ea\u003c/strong\u003e). scale bar=100 μm. \u003cstrong\u003ef\u003c/strong\u003e, TNF-α, IL-6 and MCP-1 protein expression detected by CBA MOUSE INFLAMMATION kit in \u003cem\u003eP. aeruginosa\u003c/em\u003e-infected mouse skin taken as in (\u003cstrong\u003ea\u003c/strong\u003e). Values are the mean ± SD, * P\u0026lt;0.05, **P\u0026lt;0.01, ***P\u0026lt;0.001, ****P\u0026lt;0.0001, one-way ANOVA with Bonferroni post test was used to analyze multiple groups.\u003c/p\u003e","description":"","filename":"floatimage61.png","url":"https://assets-eu.researchsquare.com/files/rs-1584966/v1/e2cc2163034ae8c6b2a07512.png"},{"id":21359104,"identity":"eaf6ef1c-27a1-4876-8c18-83079063c2eb","added_by":"auto","created_at":"2022-05-11 18:39:30","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":291786,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eNano-MgB\u003c/strong\u003e\u003csub\u003e2\u003c/sub\u003e\u003cstrong\u003e inhibited dead bacteria-induced skin inflammation\u003cem\u003e in vivo\u003c/em\u003e. a\u003c/strong\u003e, Photographs of dead bacteria-induced (HIB, heat-inhibited bacteria, \u003cem\u003eP. aeruginosa\u003c/em\u003e) mouse skin inflammation treated with or without 10 μg and 50 μg Nano-MgB\u003csub\u003e2 \u003c/sub\u003e(n=3). \u003cstrong\u003eb\u003c/strong\u003e, H\u0026amp;E staining of HIB-induced mouse skin taken as in (\u003cstrong\u003ea\u003c/strong\u003e). Scale bar =100 μm. Immunofluorescence staining with the (\u003cstrong\u003ec)\u003c/strong\u003e macrophage cell marker F4/80 and (\u003cstrong\u003ed\u003c/strong\u003e) neutrophil cell marker myeloperoxidase (MPO) of HIB-induced mouse skin taken as in (\u003cstrong\u003ea\u003c/strong\u003e). Scale bar =100 μm. \u003cstrong\u003ee\u003c/strong\u003e, IL-6, TNF-α, and MCP-1 protein expression detected by CBA MOUSE INFLAMMATION kit of HIB-induced mouse skin taken as in (\u003cstrong\u003ea\u003c/strong\u003e). Values are the mean ± SD, * P\u0026lt;0.05, **P\u0026lt;0.01, ***P\u0026lt;0.001, ****P\u0026lt;0.0001, one-way ANOVA with Bonferroni post test was used to analyze multiple groups.\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"Onlinefloatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-1584966/v1/29031d92ca5be1d1770f4bf8.png"},{"id":21359311,"identity":"f04a3354-c51e-4bb3-ad89-1eeacb0556d2","added_by":"auto","created_at":"2022-05-11 18:44:30","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":330742,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eNano-MgB\u003c/strong\u003e\u003csub\u003e\u003cstrong\u003e2\u003c/strong\u003e\u003c/sub\u003e\u003cstrong\u003e enhanced infected-wound healing. a\u003c/strong\u003e, Photographs of \u003cem\u003eP. aeruginosa\u003c/em\u003e-infected mouse skin wounds treated with or without 50 μg Nano-MgB\u003csub\u003e2\u003c/sub\u003e for different days (n=5). \u003cstrong\u003eb\u003c/strong\u003e,\u003cstrong\u003e \u003c/strong\u003eThe wound healing rate of mice treated as in (\u003cstrong\u003ea\u003c/strong\u003e). \u003cstrong\u003ec\u003c/strong\u003e, Survival of bacteria from \u003cem\u003eP. aeruginosa\u003c/em\u003e-infected mouse skin wound or spleen taken as in (\u003cstrong\u003ea\u003c/strong\u003e). \u003cstrong\u003ed\u003c/strong\u003e, H\u0026amp;E staining of infected wounds treated with or without Nano-MgB\u003csub\u003e2\u003c/sub\u003e at day 12. \u003cstrong\u003ee\u003c/strong\u003e, Immunofluorescence staining with the neutrophil cell marker myeloperoxidase (MPO) and macrophage cell marker F4/80 of \u003cem\u003eP. aeruginosa\u003c/em\u003e-infected mouse skin wounds taken as in (\u003cstrong\u003ea\u003c/strong\u003e) at day 12. \u003cstrong\u003ef\u003c/strong\u003e, TNF-α and IL-6 protein expression detected by CBA Mouse Inflammation kit in \u003cem\u003eP. aeruginosa\u003c/em\u003e-infected mouse skin wounds treated with 50 μg Nano-MgB\u003csub\u003e2\u003c/sub\u003e. Values are the mean ± SD, * P\u0026lt;0.05, **P\u0026lt;0.01, ***P\u0026lt;0.001, ****P\u0026lt;0.0001, two-way ANOVA with Bonferroni post test was used in (\u003cstrong\u003eb\u003c/strong\u003e), and t-test was used in (\u003cstrong\u003ec\u003c/strong\u003e) and (\u003cstrong\u003ef\u003c/strong\u003e).\u003c/p\u003e","description":"","filename":"Onlinefloatimage8.png","url":"https://assets-eu.researchsquare.com/files/rs-1584966/v1/7358d1e89cefa78cb65079db.png"},{"id":29760110,"identity":"47b93ab5-ad57-4ed4-a1f4-4904dfc5c6e8","added_by":"auto","created_at":"2022-12-01 08:14:32","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4390721,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-1584966/v1/19807264-1a13-4f62-98ca-01713cc1aa94.pdf"},{"id":21359107,"identity":"c2e4a8b9-1a6d-4e41-b9ef-b567ea47dbb7","added_by":"auto","created_at":"2022-05-11 18:39:30","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":4320577,"visible":true,"origin":"","legend":"\u003cp\u003esupporting information\u003c/p\u003e","description":"","filename":"Supportinginformation.docx","url":"https://assets-eu.researchsquare.com/files/rs-1584966/v1/4e9b73d4b9330dacb901c011.docx"},{"id":21359425,"identity":"6de5e0a1-7574-4545-9077-c780de34b675","added_by":"auto","created_at":"2022-05-11 18:49:30","extension":"pdf","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":259376,"visible":true,"origin":"","legend":"Reporting Summary","description":"","filename":"NCOMMS2215806RSC.pdf","url":"https://assets-eu.researchsquare.com/files/rs-1584966/v1/22243741c1f847a34b7f41d6.pdf"}],"financialInterests":"There is \u003cb\u003eNO\u003c/b\u003e Competing Interest.","formattedTitle":"Boron-Magnet Nanoparticles Capture Lipopolysaccharide and Peptidoglycan for Bacteria-Infected Wound Healing","fulltext":[{"header":"Introduction","content":"\u003cp\u003eWound infection plays an important role in the development of unhealing chronic wounds. Severe cases can lead to sepsis and even multiorgan failure or death\u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e. Currently, antimicrobial agents such as antibiotics and nanoparticles used for treating infected wounds mainly destroy the structure of bacteria to kill live bacteria, however, dead bacteria and the consequent release of massive amounts of lipopolysaccharide (LPS, also called endotoxin) or peptidoglycan (PGN) can activate immune cells to induce excessive inflammation, causing wounds to remain unhealed\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e,\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e. Therefore, developing strategies to simultaneously inhibit the survival of live bacteria and dead bacteria-induced excessive inflammation to heal infected wounds is urgently needed.\u003c/p\u003e \u003cp\u003eCertain components of pathogens are crucial for their structure and function, ensuring pathogen survival and pathogenicity. LPS and PGN are typically the key components of gram-negative and gram-positive bacteria, respectively\u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e. On the one hand, LPS/PGN is a structural component of the bacteria cell wall, which maintains the integrity of the bacteria and protects the bacteria against antibacterial treatments\u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e. On the other hand, LPS/PGN is the main functional component of the dead bacteria or their released endotoxin, which is highly immunogenic and easily induces excessive inflammation to disrupt host tissues after being released from dead bacteria\u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e. Therefore, capturing the key component of bacteria would structurally inhibit bacterial survival and functionally suppress dead bacteria-induced excessive inflammation, finally promoting wound healing. Currently, LPS-binding peptides have been reported to capture LPS, resulting in antibacterial activity or the inhibition of LPS-induced immune cell activation\u003csup\u003e\u003cspan additionalcitationids=\"CR10\" citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e, although the precise mechanism by which these peptides perform their biological activities remains elusive. Furthermore, the poor bioavailability and the proteolytic stability of peptides limit their application in clinic\u003csup\u003e\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e. Therefore, capturing the key component of bacteria (LPS/PGN) to simultaneously inhibit bacterial survival and dead bacteria-induced excessive inflammation for wound healing is still facing serious challenges.\u003c/p\u003e \u003cp\u003eLPS/PGN are mainly composed of many different sugars such as hexose or pentose, which contain many 1,2-diol or 1,3-dial dihydroxyl groups\u003csup\u003e\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e. Studies have shown that borate materials can produce dynamic borate ester bonds through an esterification reaction with the dihydroxyl groups\u003csup\u003e\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u003c/sup\u003e. This dynamic covalent bond has been widely used to identify substances such as blood, glucose and ATP\u003csup\u003e\u003cspan additionalcitationids=\"CR17\" citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e. Considering that bacterial LPS/PGN contains structures of 1,2-diol or 1,3-diol and that borate derivatives are prone to react with diol-containing compounds to form borate-diol esters\u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e, materials possessing boron dihydroxyl functional groups may react with LPS/PGN to inhibit bacterial survival and simultaneously reduce dead bacteria-induced virulence. However, such dynamic covalent bonds easily dissociate under acidic and inflammatory conditions. Hence, it is extremely necessary to design an antibacterial reagent that efficiently forms stable borate ester bonds with the key component of bacteria LPS/PGN, finally promoting wound healing.\u003c/p\u003e \u003cp\u003eHerein, a boron-magnet strategy was proposed for capturing the crucial component of bacteria (LPS/PGN) to inhibit bacterial survival and decrease dead bacteria-induced excessive inflammation, finally enhancing wound healing. We designed and synthesized a class of nano-scale reactive metal borides (MB NPs, M\u0026thinsp;=\u0026thinsp;Mg, Al, and Be), using Nano-MgB\u003csub\u003e2\u003c/sub\u003e as a representative example to elucidate the mechanism and function of MB in promoting infected wound healing (Scheme \u003cspan refid=\"Sch1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.). The Nano-MgB\u003csub\u003e2\u003c/sub\u003e could slowly hydrolyze to generate boron dihydroxy groups and metal cations while generating a local alkaline/low reactive oxygen species (ROS) microenvironment. The alkaline microenvironment could promote the Nano-MgB\u003csub\u003e2\u003c/sub\u003e to capture much more LPS through the esterification reaction between the boron dihydroxyl group and diol of LPS, which led to a high focal concentration of Mg\u003csup\u003e2+\u003c/sup\u003e on the bacterial membrane, enhancing the ability of Mg\u003csup\u003e2+\u003c/sup\u003e to disrupt the membrane structure of living bacteria. Furthermore, Nano-MgB\u003csub\u003e2\u003c/sub\u003e capturing LPS could block dead bacteria or dead bacteria-released endotoxin (LPS)-induced excessive inflammation through the inhibition of mitogen-activated protein kinase (MAPK) signaling pathway in the immune cells. The suppression of both bacterial growth and excessive inflammation significantly promoted wound healing. This boron-magnet strategy can be used to develop new methods for promoting the healing of infected wounds.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eSynthesis and characterization of Nano-MgB\u003csub\u003e2\u003c/sub\u003e\u003c/h2\u003e \u003cp\u003eAs proof of concept, a series of \u0026lsquo;boron-magnet\u0026rsquo; materials, reactive metal borides (MB NPs), were synthesized using an improved self-propagating high-temperature synthesis (SHS) approach as previously reported\u003csup\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e .The X-ray diffraction (XRD) results demonstrated that all three MB NPs were indeed MgB\u003csub\u003e2\u003c/sub\u003e, AlB\u003csub\u003e2\u003c/sub\u003e, and BeB\u003csub\u003ex\u003c/sub\u003e (Supplementary Fig.\u0026nbsp;1). We hypothesised that these three MB NPs had antibacterial effects. Therefore, we incubated different concentrations of MB NPs with \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e, the most common gram-negative bacteria in the chronic wounds\u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e, to screen the most effective antibacterial NP. As shown in Supplementary Fig.\u0026nbsp;2, all MB NPs exhibited significant antibacterial effects, however, Nano-MgB\u003csub\u003e2\u003c/sub\u003e showed a stronger antibacterial effect compared to AlB\u003csub\u003e2\u003c/sub\u003e and BeB\u003csub\u003ex\u003c/sub\u003e. Therefore, we used Nano-MgB\u003csub\u003e2\u003c/sub\u003e as a representative example to evaluate the synthesis, characterization and function of MB NPs.\u003c/p\u003e \u003cp\u003eAs shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea, b, scanning electron microscopic (SEM) and transmission electron microscopic (TEM) images indicated that the obtained Nano-MgB\u003csub\u003e2\u003c/sub\u003e was well dispersed in water. Dynamic light scattering (DLS) revealed that the mean diameter of Nano-MgB\u003csub\u003e2\u003c/sub\u003e was about 100\u0026ndash;200 nm (Supplementary Fig.\u0026nbsp;3). High-resolution TEM (HRTEM) analysis clearly revealed the lattice fringes of Nano-MgB\u003csub\u003e2\u003c/sub\u003e with \u003cem\u003ed\u003c/em\u003e-spacing of 2.65 \u0026Aring;, corresponding to the crystalline face (100) of Nano-MgB\u003csub\u003e2\u003c/sub\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ec). Moreover, the images obtained using low-magnification high-angle annular dark-field scanning TEM (HAADF-STEM) as well as the elemental mapping indicated that this nanoplatform was mainly composed of Mg, B, and O, and the XRD pattern revealed the existence of MgB\u003csub\u003e2\u003c/sub\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ed, e and Supplementary Fig.\u0026nbsp;1). Because of the layered properties of Nano-MgB\u003csub\u003e2\u003c/sub\u003e, it formed 2D-like nanostructures after hydrolysis (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ef, g). Moreover, atomic force microscopy (AFM) indicated that the thickness of Nano-MgB\u003csub\u003e2\u003c/sub\u003e decreased from 60\u0026ndash;100 nm before hydrolysis to 7\u0026ndash;8 nm after hydrolysis (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eh, i) further demonstrating that the morphology of Nano-MgB\u003csub\u003e2\u003c/sub\u003e changed from nanoparticles to 2D nanosheets. All these data demonstrated that the designed nanoparticles were successfully synthesized.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e\u003cp\u003e\u003cstrong\u003eFunctional\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003echaracterization of\u003c/strong\u003e \u003cstrong\u003eNano-MgB\u003csub\u003e2\u003c/sub\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo determine the functional characterization of Nano-MgB\u003csub\u003e2\u003c/sub\u003e, we first evaluated its ability to generate a weakly alkaline microenvironment, Mg\u003csup\u003e2+\u003c/sup\u003e and\u0026nbsp;boron hydroxyl groups. As shown in Fig. 2a, the pH rapidly increased within 30 min and became nearly stable at around 200 min (pH stabilized at 9.5 in a buffer solution of pH=7.5 and at 8.5 in a buffer solution of pH=5.5). During hydrolysis of Nano-MgB\u003csub\u003e2\u003c/sub\u003e,\u0026nbsp;boron hydroxyl groups\u0026nbsp;were observed in the Fourier transform infrared (FTIR) spectrum, as shown by the broad peak at 3000-3500 cm\u003csup\u003e-1\u003c/sup\u003e (Fig. 2b). Furthermore, as shown in Fig. 2c, d, buffer solution with a lower pH led to a faster hydrolysis rate of Nano-MgB\u003csub\u003e2\u003c/sub\u003e. These data demonstrate that hydrolysis of Nano-MgB\u003csub\u003e2\u003c/sub\u003e leads to the generation of an alkaline microenvironment, Mg\u003csup\u003e2+\u003c/sup\u003eand\u0026nbsp;boron hydroxyl groups.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTo determine whether\u0026nbsp;boron hydroxyl groups\u0026nbsp;act as a\u0026nbsp;\u0026lsquo;boron-magnet\u0026rsquo;\u0026nbsp;to\u0026nbsp;capture LPS/PGN, the key components of gram-negative and -positive bacteria, Nano-MgB\u003csub\u003e2\u003c/sub\u003e was incubated with LPS, PGN or dead \u003cem\u003eP. aeruginosa\u0026nbsp;\u003c/em\u003e(HIB, heat-inhibited bacteria)\u003cem\u003e.\u003c/em\u003e As shown in Fig. 2e, the characteristic peak at 1072 cm\u003csup\u003e-1\u003c/sup\u003e demonstrated that the hydrolysate of Nano-MgB\u003csub\u003e2\u003c/sub\u003e reacted with LPS, PGN and HIB\u003cem\u003e\u0026nbsp;\u003c/em\u003eto form boronic ester (O-B-O) bonds. Besides Nano-MgB\u003csub\u003e2\u003c/sub\u003e, Nano-AlB\u003csub\u003e2\u003c/sub\u003e and Nano-BeB\u003csub\u003ex\u003c/sub\u003e can also react with LPS and PGN to form O-B-O bonds, suggesting that members of this class of nano-scale\u0026nbsp;reactive\u0026nbsp;metal borides have similar\u0026nbsp;\u0026lsquo;boron-magnet\u0026rsquo;\u0026nbsp;functions (Supplementary 5). Furthermore, we compared the LPS binding activity of Nano-MgB\u003csub\u003e2\u003c/sub\u003e with that of H\u003csub\u003e3\u003c/sub\u003eBO\u003csub\u003e3\u003c/sub\u003e which contains boron hydroxyl groups. As shown by SEM equipped with elemental mapping, a much larger amount of B element was enriched on the bacteria in the Nano-MgB\u003csub\u003e2\u003c/sub\u003e-incubated group than in the H\u003csub\u003e3\u003c/sub\u003eBO\u003csub\u003e3\u003c/sub\u003e-incubated group (Fig. 2f), indicating Nano-MgB\u003csub\u003e2\u003c/sub\u003e forms much more stable borate ester bonds with LPS compared to H\u003csub\u003e3\u003c/sub\u003eBO\u003csub\u003e3\u003c/sub\u003e.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn addition, XPS was performed to analyze the samples before and after the hydrolysis of Nano-MgB\u003csub\u003e2\u003c/sub\u003e (Fig. 2g, h). After hydrolysis, the sample was characterized by the disappearance of the characteristic peak for the negatively charged boron species (B-Mg bond, 185.8 eV) and the appearance of the characteristic peak for the positively charged boron species (190.9 eV for B-OH bond and 192.7 eV for HO-B-OH bond, respectively). Therefore, the hydrolysis of Nano-MgB\u003csub\u003e2\u003c/sub\u003e involved oxidation of boron elements. Considering the oxidative stress microenvironment of the bacteria-infected wound, we further examined the ROS scavenging ability of Nano-MgB\u003csub\u003e2\u003c/sub\u003e. Nano-MgB\u003csub\u003e2\u003c/sub\u003e exhibited high reactivity towards broad-spectrum ROS (Fig. 2i), reactive nitrogen species (RNS) (Supplementary Fig. 5), and the direct \u0026bull;OH scavenging ability of Nano-MgB\u003csub\u003e2\u003c/sub\u003e (Supplementary Fig. 6). Thus, the designed reactive metal borides are slowly hydrolyzed to generate boron dihydroxy groups and metal cations while generating a local alkaline/low ROS microenvironment, which promoted the esterification reaction between boron hydroxyl groups and LPS/PGN.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eNano-MgB\u003csub\u003e2\u003c/sub\u003e disrupted the structure of bacteria\u003cem\u003e\u0026nbsp;in vitro\u003c/em\u003e.\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAs the experiments described above demonstrated that\u0026nbsp;Nano-MgB\u003csub\u003e2\u003c/sub\u003e can react with LPS to form O-B-O bonds, the antibacterial\u0026nbsp;activity of Nano-MgB\u003csub\u003e2\u003c/sub\u003e was further evaluated. As shown in Fig. 3a, b, Nano-MgB\u003csub\u003e2\u0026nbsp;\u003c/sub\u003eexhibited excellent antibacterial activity at a low concentration at around 12.5 \u0026mu;g/mL, whereas H\u003csub\u003e3\u003c/sub\u003eBO\u003csub\u003e3\u003c/sub\u003e+Mg\u003csup\u003e2+\u003c/sup\u003e group exhibited little or no antibacterial effect against\u003cem\u003e\u0026nbsp;P. aeruginosa\u0026nbsp;\u003c/em\u003eat the same concentration. This antibacterial effect of our synthesized Nano-MgB\u003csub\u003e2\u003c/sub\u003e was dramatically stronger than that of commercial MgB\u003csub\u003e2\u003c/sub\u003e powders\u003csup\u003e22\u003c/sup\u003e,\u0026nbsp;and was comparable to the effects of antibiotic metronidazole\u0026nbsp;(Supplementary Fig.\u0026nbsp;7).\u0026nbsp;Furthermore, as shown in\u0026nbsp;Supplementary\u0026nbsp;Fig.\u0026nbsp;8,\u0026nbsp;Nano-MgB\u003csub\u003e2\u003c/sub\u003e also\u003csub\u003e\u0026nbsp;\u003c/sub\u003eshowed a significant antibacterial effect against \u003cem\u003eS. aureus\u003c/em\u003e. Taken together, these data demonstrate that Nano-MgB\u003csub\u003e2\u003c/sub\u003e has excellent antibacterial activity.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTo further investigate Nano-MgB\u003csub\u003e2\u003c/sub\u003e capturing LPS is required for the antibacterial effect of Nano-MgB\u003csub\u003e2\u003c/sub\u003e, different concentrations of LPS were added to block the reaction between Nano-MgB\u003csub\u003e2\u003c/sub\u003e and LPS. Nano-MgB\u003csub\u003e2\u003c/sub\u003e (6.25 \u0026mu;g/mL) significantly inhibited the growth of \u003cem\u003eP. aeruginosa\u003c/em\u003e, however, this inhibition effect was rescued by adding LPS, demonstrating that the O-B-O bond between Nano-MgB\u003csub\u003e2\u003c/sub\u003e and LPS is involved in Nano-MgB\u003csub\u003e2\u003c/sub\u003e-induced bacterial death\u0026nbsp;(Fig. 3c). Furthermore, as shown in the result of SEM, the bacteria typically had a rod-shaped morphology with a smooth and intact cell wall in the blank and H\u003csub\u003e3\u003c/sub\u003eBO\u003csub\u003e3\u003c/sub\u003e+Mg\u003csup\u003e2+\u003c/sup\u003e groups, whereas those treated with Nano-MgB\u003csub\u003e2\u003c/sub\u003e became wrinkled and shrunk (Fig. 3d). TEM analysis revealed that the cytoplasm of bacteria was lost in the Nano-MgB\u003csub\u003e2\u003c/sub\u003e-treated group compared with that in the blank and H\u003csub\u003e3\u003c/sub\u003eBO\u003csub\u003e3\u003c/sub\u003e+Mg\u003csup\u003e2+\u003c/sup\u003e groups, indicating that degradation of the cytoplasm components or cell membrane leakage occurred after Nano-MgB\u003csub\u003e2\u003c/sub\u003e treatment (Fig. 3e). These data demonstrate that Nano-MgB\u003csub\u003e2\u003c/sub\u003e triggers damage to the bacterial membrane.\u003c/p\u003e\n\u003cp\u003eMetal\u0026nbsp;cations such as silver\u003csup\u003e23\u003c/sup\u003e, magnesium\u003csup\u003e24\u003c/sup\u003e, aluminum\u003csup\u003e25\u003c/sup\u003e, zinc\u003csup\u003e26\u003c/sup\u003e,\u0026nbsp;among others are often responsible for disrupting the bacterial membrane by altering the membrane potential and permeability. The reaction between MB and LPS on the cell wall not only produces a focal source of metal ions but also narrows the distance between metal cations and cell membrane\u003csup\u003e27\u003c/sup\u003e.\u0026nbsp;Therefore, we first measured the change of the membrane potential in bacteria treated with Nano-MgB\u003csub\u003e2\u003c/sub\u003e and H\u003csub\u003e3\u003c/sub\u003eBO\u003csub\u003e3\u003c/sub\u003e+Mg\u003csup\u003e2+\u003c/sup\u003e using the fluorophore dye DiSC\u003csub\u003e3\u003c/sub\u003e(5) (a cyanine dye that shows increased fluorescence upon dissipation of the membrane potential)\u003csup\u003e28\u003c/sup\u003e. As shown in Fig. 3f, Nano-MgB\u003csub\u003e2\u003c/sub\u003e significantly changed the membrane potential compared to the blank and H\u003csub\u003e3\u003c/sub\u003eBO\u003csub\u003e3\u003c/sub\u003e+Mg\u003csup\u003e2+\u003c/sup\u003e groups, indicating that a focal source of Mg\u003csup\u003e2+\u003c/sup\u003e from Nano-MgB\u003csub\u003e2\u003c/sub\u003e damages the cell membrane by changing the membrane potential. Next, we detected the permeability of bacterial membranes after Nano-MgB\u003csub\u003e2\u003c/sub\u003e treatment. \u003cem\u003eP. aeruginosa\u003c/em\u003e treated with H\u003csub\u003e3\u003c/sub\u003eBO\u003csub\u003e3\u003c/sub\u003e+Mg\u003csup\u003e2+\u003c/sup\u003e and Nano-MgB\u003csub\u003e2\u003c/sub\u003e were stained with SYTO9 and propidium iodide (PI). SYTO9 is a green-fluorescent dye that freely permeates cell membranes and shows a large increase in fluorescence upon binding to nucleic acids. PI is a red-fluorescent dye that can specifically bind to DNA or RNA to enhance fluorescence but cannot pass through the intact membranes of viable cells\u003csup\u003e28\u003c/sup\u003e. As shown in Fig. 3g, Nano-MgB\u003csub\u003e2\u003c/sub\u003e-treated group exhibited a large number of bacteria with red fluorescence (PI staining), compared with the blank and H\u003csub\u003e3\u003c/sub\u003eBO\u003csub\u003e3\u003c/sub\u003e+Mg\u003csup\u003e2+\u003c/sup\u003e groups, suggesting that Nano-MgB\u003csub\u003e2\u003c/sub\u003e significantly increased the membrane permeability of \u003cem\u003eP. aeruginosa\u003c/em\u003e. Next, we stained\u003csub\u003e\u0026nbsp;\u003c/sub\u003ethe bacteria with PI and performed fluorescence-activated cell sorting (FACS) to further quantify permeability changes in bacteria in the presence of Nano-MgB\u003csub\u003e2\u003c/sub\u003e. As shown in Fig. 3h, 12.5 \u0026mu;g/mL Nano-MgB\u003csub\u003e2\u003c/sub\u003e induced a change in membrane permeability in 54.1% of bacteria, which was higher than that induced by H\u003csub\u003e3\u003c/sub\u003eBO\u003csub\u003e3\u003c/sub\u003e+Mg\u003csup\u003e2+\u003c/sup\u003e (6.37%). Taken together, these data suggest that Nano-MgB\u003csub\u003e2\u003c/sub\u003e induces cell membrane damage by altering the membrane potential and permeability.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTo further investigate the molecular mechanism by which Nano-MgB\u003csub\u003e2\u003c/sub\u003e induces bacteria death, RNA-seq was performed to screen for changes in gene expression in Nano-MgB\u003csub\u003e2\u003c/sub\u003e-treated \u003cem\u003eP. aeruginosa\u003c/em\u003e. As shown in\u0026nbsp;Supplementary Fig.\u0026nbsp;9, Nano-MgB\u003csub\u003e2\u003c/sub\u003e down-regulated 1582 genes and ug-regulated 1876 genes. Furthermore, Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis of known Nano-MgB\u003csub\u003e2\u003c/sub\u003e-related genes was performed. Numerous important pathways such as \u0026ldquo;ABC transporters\u0026rdquo;, \u0026ldquo;phosphotransferase system\u0026rdquo;, \u0026ldquo;ribosome\u0026rdquo;, and \u0026ldquo;aminoacyl-tRNA biosynthesis\u0026rdquo; were enriched, and most genes in these pathways were upregulated in Nano-MgB\u003csub\u003e2\u003c/sub\u003e-treated \u003cem\u003eP. aeruginosa\u003c/em\u003e, suggesting that Nano-MgB\u003csub\u003e2\u003c/sub\u003e induced a stress response (Fig. 3i). Interestingly, the RNA degradation pathway was enriched, and 15 of the 16 related genes were upregulated after Nano-MgB\u003csub\u003e2\u003c/sub\u003e treatment (Fig. 3i, j). Accordingly, we verified the expression of these 16 genes in \u003cem\u003eP. aeruginosa\u003c/em\u003e treated with Nano-MgB\u003csub\u003e2\u003c/sub\u003e using QPCR. As shown in Fig. 3k, l, Nano-MgB\u003csub\u003e2\u003c/sub\u003e significantly promoted the expression of these 16 RNA degradation-related genes, consistent with the results of RNA-seq. These data suggest that Nano-MgB\u003csub\u003e2\u003c/sub\u003e kills bacteria by promoting RNA degradation. Indeed, previous studies showed that RNA was degraded in response to changes in membrane permeability\u003csup\u003e29,\u0026nbsp;26\u003c/sup\u003e. Thus, these data demonstrate that Nano-MgB\u003csub\u003e2\u003c/sub\u003e reacts with LPS in the cell wall continuously releasing Mg\u003csup\u003e2+\u003c/sup\u003e at the cell membrane, which disrupts the bacterial membrane, leading to RNA degradation and bacterial death (Fig. 3m).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eNano-MgB\u003csub\u003e2\u003c/sub\u003e suppressed the proinflammatory function of dead bacteria and endotoxin (LPS) \u003cem\u003ein vitro\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo further investigate whether\u0026nbsp;Nano-MgB\u003csub\u003e2\u003c/sub\u003e inhibits inflammation induced by dead bacteria or dead bacteria-released endotoxin (LPS), we first assessed the toxicity of Nano-MgB\u003csub\u003e2\u003c/sub\u003e towards human cell lines, including skin keratinocytes (HaCat cells) and immunocytes (Raw264.7 macrophages) using cell counting kit-8 (CCK-8). As shown in Supplementary Fig. 10, Nano-MgB\u003csub\u003e2\u003c/sub\u003e was not toxic to skin keratinocytes and immunocytes after incubation for 24 h, and the components released from Nano-MgB\u003csub\u003e2\u003c/sub\u003e such as Mg\u003csup\u003e2+\u003c/sup\u003e and H\u003csub\u003e3\u003c/sub\u003eBO\u003csub\u003e3\u003c/sub\u003e showed no toxicity towards keratinocytes. Next, we treated macrophage cells with LPS or dead bacteria (HIB, heat-inhibited bacteria) in the presence or absence of Nano-MgB\u003csub\u003e2\u003c/sub\u003e. As shown in Fig. 4a, b, LPS and HIB dramatically induced the expression of inflammation-related molecules such as tumor necrosis factor \u0026alpha; (TNF-\u0026alpha;), interleukin 6 (IL-6), and IL-1\u0026beta;, which were significantly inhibited after treatment with Nano-MgB\u003csub\u003e2\u003c/sub\u003e. These results indicate that dead bacteria and dead bacteria-released endotoxin (LPS) can significantly induce a strong inflammatory response in immune cells\u0026nbsp;and\u0026nbsp;Nano-MgB\u003csub\u003e2\u003c/sub\u003e can interact with LPS to block the inflammatory response. As previously reported, LPS can activate Toll-like receptor 4 and induce the production of inflammatory factors by regulating the mitogen-activated protein kinase (MAPK) signaling pathway\u003csup\u003e30, 31\u003c/sup\u003e.\u0026nbsp;As shown in Fig. 4c-f, LPS-induced phosphorylation of\u0026nbsp;MAPK such as\u0026nbsp;p38, Erk, and JNK\u0026nbsp;were\u0026nbsp;significantly inhibited by Nano-MgB\u003csub\u003e2\u003c/sub\u003e treatment, suggesting that Nano-MgB\u003csub\u003e2\u003c/sub\u003e blocks HIB/endotoxin (LPS)-induced inflammation by regulating MAPK signaling pathway (Fig. 4g).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eNano-MgB\u003c/strong\u003e\u003csub\u003e2\u003c/sub\u003e\u003cstrong\u003e\u0026nbsp;inhibited bacterial survival \u003cem\u003ein vivo\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo evaluate the \u003cem\u003ein vivo\u003c/em\u003e antibacterial efficacy of Nano-MgB\u003csub\u003e2\u003c/sub\u003e, a \u003cem\u003eP. aeruginosa\u003c/em\u003e-infected skin infection model was constructed. As shown in Fig. 5a,\u0026nbsp;the\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003cem\u003eP. aeruginosa\u003c/em\u003e infection-induced lesion area was significantly inhibited by Nano-MgB\u003csub\u003e2\u003c/sub\u003e treatment. Consistent with these results, the number of bacteria in the lesions was also decreased (Fig. 5b). As bacterial infections can progress from a local to systemic state, the number of bacteria in the spleen was decreased by Nano-MgB\u003csub\u003e2\u003c/sub\u003e treatment (Fig. 5c). To further investigate the effect of Nano-MgB\u003csub\u003e2\u003c/sub\u003e on \u003cem\u003eP. aeruginosa\u003c/em\u003e-infected skin tissue, the skin lesion areas were dissected using hematoxylin and eosin (H\u0026amp;E) staining. As shown in Fig. 5d, the bacteria-infected group showed severely destroyed epidermal skin and a large number of hematoxylin-positive cells in the dermis, which were relieved after Nano-MgB\u003csub\u003e2\u003c/sub\u003e treatment. To determine whether the increased hematoxylin-positive cells were inflammatory cells, we performed immunofluorescence staining with the neutrophil cell marker myeloperoxidase (MPO)\u003csup\u003e32, 33\u003c/sup\u003e and macrophage cell marker F4/80\u003csup\u003e34, 35\u003c/sup\u003e. As shown in Fig. 5e, Nano-MgB\u003csub\u003e2\u003c/sub\u003e treatment significantly decreased the number of \u003cem\u003eP. aeruginosa\u003c/em\u003e-induced neutrophils and macrophages, indicating decreased skin infection after Nano-MgB\u003csub\u003e2\u003c/sub\u003e treatment. Consistently, inflammatory factors such as IL-6, TNF-\u0026alpha;, and monocyte chemoattractant protein (MCP)-1 were inhibited after Nano-MgB\u003csub\u003e2\u003c/sub\u003e treatment (Fig. 5f). Similar results were observed in mice infected with \u003cem\u003eS. aureus\u003c/em\u003e in the presence of Nano-MgB\u003csub\u003e2\u003c/sub\u003e. Nano-MgB\u003csub\u003e2\u003c/sub\u003e significantly inhibited the increase of lesional size in the \u003cem\u003eS. aureus\u003c/em\u003e-infected skin (Supplementary\u0026nbsp;Fig.\u0026nbsp;11 a, b) and bacteria numbers in the skin and spleen (Supplementary Fig.\u0026nbsp;11\u0026nbsp;c-f). Furthermore, inflammatory factors such as IL-6, TNF-\u0026alpha;, and MCP-1 were significantly inhibited (Supplementary Fig.\u0026nbsp;11\u0026nbsp;g, h). These data demonstrate that Nano-MgB\u003csub\u003e2\u003c/sub\u003e can inhibit bacteria growth and decrease bacteria-induced inflammation \u003cem\u003ein vivo\u003c/em\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eNano-MgB\u003c/strong\u003e\u003csub\u003e2\u003c/sub\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003esuppressed dead bacteria-induced skin inflammation\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003ein vivo\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBeside bacteria infection, the\u0026nbsp;dead bacteria or their released endotoxin/LPS\u0026nbsp;also induced excessive inflammation in the skin. As shown in Fig.\u0026nbsp;6a, dead bacteria significantly cause the redness and swelling of the skin, and this phenomenon was dramatically inhibited after Nano-MgB\u003csub\u003e2\u0026nbsp;\u003c/sub\u003etreatment. To further investigate the inflammatory conditions within the skin, the skin lesion areas were dissected for H\u0026amp;E and immunofluorescence staining. Many hematoxylin-positive cells in the dermis were detected in the dead bacteria group, indicating that dead bacteria induce a large number of inflammatory cells. However, this phenomenon was dose-dependently inhibited by the Nano-MgB\u003csub\u003e2\u003c/sub\u003e (Fig. 6b). Consistent result was shown in immunofluorescence staining that Nano-MgB\u003csub\u003e2\u003c/sub\u003e significantly decreased the number of neutrophils (MPO-positive cells) and macrophages (F4/80-positive cells) induced by dead bacteria (Fig. 6c, d). Furthermore, the inflammatory factors such as IL-6, TNF-\u0026alpha;, and MCP-1 were also significantly inhibited after Nano-MgB\u003csub\u003e2\u003c/sub\u003e treatment (Fig. 6e). All these data demonstrate that even dead bacteria can induce serious skin inflammation, and Nano-MgB\u003csub\u003e2\u003c/sub\u003e can inhibit dead bacteria-induced inflammation.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eNano-MgB\u003c/strong\u003e\u003csub\u003e2\u003c/sub\u003e\u003cstrong\u003e\u0026nbsp;promoted infected-wound healing \u003cem\u003ein vivo\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBecause of the excellent antibacterial and anti-inflammatory activities of Nano-MgB\u003csub\u003e2\u0026nbsp;\u003c/sub\u003eboth\u003csub\u003e\u0026nbsp;\u003c/sub\u003e\u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e, we next investigated the function of Nano-MgB\u003csub\u003e2\u003c/sub\u003e in \u003cem\u003eP. aeruginosa\u003c/em\u003e-infected skin wound healing.\u0026nbsp;As shown in\u0026nbsp;Fig. 7a, b, 50 \u0026micro;g of Nano-MgB\u003csub\u003e2\u003c/sub\u003e clearly accelerated the healing rate of \u003cem\u003eP. aeruginosa\u003c/em\u003e-infected wound. Furthermore, the number of \u003cem\u003eP. aeruginosa\u003c/em\u003e in the skin and spleen was significantly reduced after Nano-MgB\u003csub\u003e2\u003c/sub\u003e treatment, which is consistent with the results of H\u0026amp;E staining showing lower inflammatory cell infiltration in the Nano-MgB\u003csub\u003e2\u003c/sub\u003e-treated group (Fig. 7c, d). In addition, the results of immunofluorescence staining showed that Nano-MgB\u003csub\u003e2\u003c/sub\u003e treatment significantly reduced the number of neutrophils (MPO-positive cells) and macrophages (F4/80-positive cells), indicating decreased bacterial infection and inflammation after Nano-MgB\u003csub\u003e2\u003c/sub\u003e treatment (Fig. 7e). Moreover, inflammatory factors such as TNF-\u0026alpha; and IL-6 were dramatically decreased after Nano-MgB\u003csub\u003e2\u003c/sub\u003e treatment, further demonstrating decreased bacterial infection and inflammation in Nano-MgB\u003csub\u003e2\u003c/sub\u003e-treated wounds (Fig. 7f). These results are consistent with those observed in \u003cem\u003eS. aureus\u003c/em\u003e-infected skin wounds treated with Nano-MgB\u003csub\u003e2\u003c/sub\u003e. Nano-MgB\u003csub\u003e2\u003c/sub\u003e significantly promoted \u003cem\u003eS. aureus\u003c/em\u003e-infected skin wound healing (Supplementary Fig.\u0026nbsp;12\u0026nbsp;a, b) and inhibited bacterial growth in the skin (Supplementary Fig. 12\u0026nbsp;c, d). Furthermore, hematoxylin-positive cells and inflammatory factors such as TNF-\u0026alpha;, IL-6, and MCP-1 were significantly inhibited (Supplementary Fig.\u0026nbsp;12\u0026nbsp;e, f). In addition,\u0026nbsp;the mRNA expression level of the oxidative stress gene \u003cem\u003eHmox1\u003c/em\u003e was dramatically decreased in Nano-MgB\u003csub\u003e2\u003c/sub\u003e-treated wounds, when compared with the untreated group, suggesting that Nano-MgB\u003csub\u003e2\u003c/sub\u003e decreases oxidative stress through its ROS-scavenging activity (Supplementary Fig. 13). These data demonstrate that Nano-MgB\u003csub\u003e2\u003c/sub\u003e promotes wound healing by inhibiting bacterial growth, bacteria-induced excessive inflammation, and oxidative stress.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eBacteria and bacteria-induced excessive inflammation are involved in the healing of infected wounds. Wound treatment strategies that simultaneously inhibit both bacterial infection and dead-bacteria-induced excessive inflammation are urgently needed in the clinic. LPS /PGN is the key structural and functional component of bacteria that is crucial for ensuring bacterial survival and pathogenicity. Therefore, capturing LPS/PGN is a promising strategy for simultaneously inhibiting live bacterial infection and dead bacteria-induced excessive inflammation, leading to bacteria-infected wound healing. In this study, we proposed the \u0026ldquo;boron-magnet\u0026rdquo; strategy for the first time to capture LPS/PGN for infected wound healing based on the reactive MB NPs, which may have better bioavailability and the proteolytic stability than peptides. Our study demonstrated that boron dihydroxyl groups of MB NPs formed stable borate ester bonds with the diol of LPS/PGN exhibiting excellent antibacterial and anti-inflammatory effects, finally promoting wound healing.\u003c/p\u003e \u003cp\u003eHere, this \u0026lsquo;boron-magnet\u0026rsquo; strategy captured not only LPS but also PGN, demonstrating that this strategy can be widely used for the treatment of both gram-negative and gram-positive bacterial infection. However, the inhibition efficacy of Nano-MgB\u003csub\u003e2\u003c/sub\u003e against gram-positive bacteria was lower than that against gram-negative bacteria. This is because the LPS of \u003cem\u003eP. aeruginosa\u003c/em\u003e contains much more 1,2-diol or 1,3-diol compared to PGN of \u003cem\u003eS. aureus\u003c/em\u003e, thus much more Nano-MgB\u003csub\u003e2\u003c/sub\u003e reacted with LPS than with PGN, supporting the importance of generating borate ester bonds to achieve antibacterial and anti-inflammatory activities. In addition to the bacteria, this strategy may also be suitable for the treatment of virus infection. Capturing the key component of the virus, such as the spike glycoprotein of SARS-CoV-2, which is the shell protein of the virus and mediates the fusion of the virus membrane with the host cell membrane\u003csup\u003e\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u003c/sup\u003e, may provide a new therapeutic method for virus infection. In this work, Nano-MgB\u003csub\u003e2\u003c/sub\u003e exhibited higher bacteria-binding and antibacterial activities than H\u003csub\u003e3\u003c/sub\u003eBO\u003csub\u003e3\u003c/sub\u003e, a standard antibacterial agent, contains boron dihydroxyl groups\u003csup\u003e\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e, \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u003c/sup\u003e. This is consistent with our prediction that the local alkaline microenvironment generated by hydrolysis of Nano-MgB\u003csub\u003e2\u003c/sub\u003e could enhance the stability of borate ester bonds to effectively improve the binding ability of Nano-MgB\u003csub\u003e2\u003c/sub\u003e to bacterial polysaccharides. This mechanism can be interpreted based on a previous study showing that an alkaline microenvironment changes the hybridization of B atom from \u003cem\u003esp\u003c/em\u003e\u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e to \u003cem\u003esp\u003c/em\u003e\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e, leading to the formation of hydroxy boronate anion, thus enhancing the stability of borate ester bonds\u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eAnother interesting finding is that all three types of MB NPs (MgB\u003csub\u003e2\u003c/sub\u003e, AlB\u003csub\u003e2\u003c/sub\u003e, and BeB\u003csub\u003ex\u003c/sub\u003e) showed antibacterial activity but exhibited variable activities against \u003cem\u003eP. aeruginosa\u003c/em\u003e, indicating that different ions in the NPs have different antibacterial roles. It is generally accepted that metal cations often disrupt the bacterial membrane. Consistently, our study confirmed that Nano-MgB\u003csub\u003e2\u003c/sub\u003e disrupted bacterial membrane through altering the membrane potential and permeability. However, the cause of the varied antibacterial activity among these metal cations requires further investigation.\u003c/p\u003e \u003cp\u003eIn summary, our work highlights that the \u0026lsquo;boron-magnet\u0026rsquo; strategy provides a novel method to treat bacteria-infected wounds by capturing the key components of bacteria and realizing both antibacterial and anti-inflammatory effects. This strategy holds great potential for future clinical translation in the treatment of pathogen infection.\u003c/p\u003e"},{"header":"Methods","content":"\u003cp\u003e \u003cb\u003eChemical reagents.\u003c/b\u003e All the chemical reagents were of analytical grade and used directly without further purification. Magnesium powder (Mg, 99.9%, AR), Aluminum (Al, 99.9%, AR), Beryllium (Be, 99.9%, AR), and Boron (B, 99.9%, AR) powder were purchased from Aladdin. Anhydrous ethanol was purchased from Sigma-Aldrich. The ultrapure water used throughout the experiment was prepared by the ELGA PURELAB classic water purification system.\u003c/p\u003e \u003cp\u003e \u003cb\u003eMaterial characterization.\u003c/b\u003e Transmission electron microscope (TEM) images and corresponding element mapping were obtained with Thermo Fisher Scientific Tecnai G2 F30. Scanning electron microscope (SEM) images were acquired by HITACHI S-480. X-ray diffraction (XRD) data were acquired from a Rigaku D/MAX 2250V diffractometer with a scanning rate of 5\u0026deg; min\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e in the 2θ range of 10\u0026ndash;80\u0026deg;. Atomic force microscopy (AFM) images were obtained on a Dimension Fast Scan (Bruker) under ScanAsyst mode. The hydrodynamic size distribution was measured via dynamic light scattering (DLS) in Microtrac Nanotrac wave II. Fourier transform infrared spectroscopy (FTIR) spectra were obtained with a BRUKER TENSOR II using KBr pellets. The variation in pH of the hydrolysate of Nano-MgB\u003csub\u003e2\u003c/sub\u003e nanoparticles (MB NPs) was acquired by using a pH meter (FE28, METTLER TOLEDO). Element concentration was obtained with inductively coupled plasma optical emission spectrometry (ICP-OES) by Agilent Technologies. The X-ray photoelectron spectroscopy (XPS) plots were conducted with a Thermo Fisher Scientific Escalab 250Xi, and the accurate binding energies were determined by taking the position of C 1s peak at 284.8 eV as the calibration reference. Electron spin resonance (ESR) spectra were acquired from the JEOL FA200 electron paramagnetic resonance spectrometer. The ultraviolet-visible absorption spectra (UV-vis) were recorded on the Shimadzu UV-3600 Plus spectrophotometer.\u003c/p\u003e \u003cp\u003e \u003cb\u003eSynthesis of MB NPs.\u003c/b\u003e The MB NPs (Nano-MgB\u003csub\u003e2\u003c/sub\u003e, Nano-AlB\u003csub\u003e2,\u003c/sub\u003e and Nano-BeB\u003csub\u003ex\u003c/sub\u003e) were synthesized by a self-propagating high-temperature synthesis (SHS) approach. Typically, 30 mM of metal powder (Mg, Al, or Be) and 40 mM of boron powder were fully ground and placed in a 15 mL corundum crucible. The mixture reacted at 800\u0026deg;C under an Ar (5% O\u003csub\u003e2\u003c/sub\u003e) atmosphere for 3 h with a heating rate of 10\u0026deg;C/min. Then the resultant products were dispersed in 200 mL anhydrous ethanol, and centrifuged at 5,000 rpm for 5 min to remove large particles. Subsequently, the NPs were collected by centrifugation at 13,000 rpm for 15 min and then washed several times with ethanol.\u003c/p\u003e \u003cp\u003e \u003cb\u003eThe temporal variation in the pH and of Nano-MgB\u003c/b\u003e \u003csub\u003e \u003cb\u003e2\u003c/b\u003e \u003c/sub\u003e \u003cb\u003ehydrolysate.\u003c/b\u003e 1 mL Nano-MgB\u003csub\u003e2\u003c/sub\u003e solution (1 M Nano-MgB\u003csub\u003e2\u003c/sub\u003e) was sealed in a dialytic bag (cutoff molecular weight: 5000 Dalton). Then the dialytic bag was placed in a beaker containing 100 mL citric acid-sodium citrate buffer solutions of various pH values (7.5, 6.5 and 4.5) and processed in a shaker at 37\u0026deg;C for 24 h (shaking speed: 100 rpm). At regular intervals, the pH value was detected by a pH meter. 1 mL solution was collected to determine the releasing concentration of Mg and B elements by using ICP-OES, and 1 mL fresh buffer solution was returned.\u003c/p\u003e \u003cp\u003e \u003cb\u003eVerification of scavenging effect of Nano-MgB\u003c/b\u003e \u003csub\u003e \u003cb\u003e2\u003c/b\u003e \u003c/sub\u003e \u003cb\u003eon hydroxyl radical (\u0026bull;OH).\u003c/b\u003e Using 5, 5-Dimethyl-1-pyrroline N-oxide (DMPO) as the spin trap, electron spin resonance (ESR) spectroscopy was used to confirm the \u0026bull;OH scavenging effect of Nano-MgB\u003csub\u003e2\u003c/sub\u003e. 100 \u0026micro;L citric acid-sodium citrate buffer solution was prepared (pH\u0026thinsp;=\u0026thinsp;6.5, 20 \u0026micro;M FeSO\u003csub\u003e4\u003c/sub\u003e), and Nano-MgB\u003csub\u003e2\u003c/sub\u003e were added to the experimental group (100 \u0026micro;g/mL, without Nano-MgB\u003csub\u003e2\u003c/sub\u003e in the control group), then 20 \u0026micro;L of the mixed solution was added (5 mM H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e and 100 mM DMPO) after 15 min. The obtained mixture solution was detected by an ESR spectrometer at room temperature.\u003c/p\u003e \u003cp\u003e \u003cb\u003eVerification of scavenging effect of Nano-MgB\u003c/b\u003e \u003csub\u003e \u003cb\u003e2\u003c/b\u003e \u003c/sub\u003e \u003cb\u003eon ROS and RNS.\u003c/b\u003e The ability of Nano-MgB2 to scavenge ROS and RNS was demonstrated by PTIO\u0026bull; and DPPH\u0026bull; scavenging experiments, respectively. PTIO\u0026bull; radicals were dissolved with pH\u0026thinsp;=\u0026thinsp;7.4 phosphate buffer at a concentration of 25 \u0026micro;g/mL (DPPH\u0026bull; radicals were dissolved in anhydrous ethanol at a concentration of 20 \u0026micro;g/mL), then various concentrations of Nano-MgB\u003csub\u003e2\u003c/sub\u003e (from 0 \u0026micro;g/mL to 400 \u0026micro;g/mL) were added. The total volume of the reaction mixture remains the same by the addition of the corresponding reagent. The mixed solution was incubated at 37\u0026deg;C for 2 h in a water bath under dark conditions, the absorbance was measured at 557 nm (519nm for DPPH\u0026bull;) by UV-vis absorption spectra.\u003c/p\u003e \u003cp\u003e \u003cb\u003eBacterial culture and antibacterial activity test.\u003c/b\u003e \u003cem\u003eStaphylococcus aureus\u003c/em\u003e (ST398) and \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e (PA-14) were from Jiang\u0026rsquo;s lab at East China Normal University. \u003cem\u003eS. aureus\u003c/em\u003e were cultured in Trypticase Soy Broth (TSB) and \u003cem\u003eP. aeruginosa\u003c/em\u003e were grown in Luria-Broth medium (LB). One day before the experiment, bacteria were incubated overnight in a culture medium at 37℃ (220 rpm shaking), and a small aliquot of cells (4%) was re-inoculated into a fresh culture medium and then grew to logarithmic phase(\u003cem\u003eS. aureus\u003c/em\u003e, OD\u0026thinsp;=\u0026thinsp;0.6\u0026ndash;0.8, about 10\u003csup\u003e8\u003c/sup\u003e bacteria; \u003cem\u003eP. aeruginosa\u003c/em\u003e, OD\u0026thinsp;=\u0026thinsp;0.5, about 10\u003csup\u003e9\u003c/sup\u003e bacteria. The bacteria were diluted to 10\u003csup\u003e8\u003c/sup\u003e/mL colony-forming units. Ten microliters of live bacteria were incubated with different concentrations of Nano-MgB\u003csub\u003e2\u003c/sub\u003e at 37℃ for 6 h. The bacteria from the mixture were diluted and plated on TSB or LB agar for 24 h at 37℃, respectively. Finally, the numbers of colonies were counted.\u003c/p\u003e \u003cp\u003e \u003cb\u003eLive/dead fluorescent staining and Flow cytometry.\u003c/b\u003e \u003cem\u003eP. aeruginosa\u003c/em\u003e (10\u003csup\u003e8\u003c/sup\u003e/mL) treated with 272 \u0026micro;M Nano-MgB\u003csub\u003e2\u003c/sub\u003e (12.5 \u0026micro;g/mL) and 544 \u0026micro;M H\u003csub\u003e3\u003c/sub\u003eBO\u003csub\u003e3\u003c/sub\u003e\u0026thinsp;+\u0026thinsp;Mg\u003csup\u003e2+\u003c/sup\u003e for 6 h were stained with SYTO9 (Thermo Fisher Scientific Cat 2266591 6 \u0026micro;M) and Propidium iodide (Beyotime Cat ST511, 15 \u0026micro;M) for 15 min at room temperature in the dark. The live and dead cells were visualized with confocal laser microscopy (Nikon A1\u0026thinsp;+\u0026thinsp;R-980). For the Flow cytometry assay, bacteria treated with Nano-MgB\u003csub\u003e2\u003c/sub\u003e and H\u003csub\u003e3\u003c/sub\u003eBO\u003csub\u003e3\u003c/sub\u003e\u0026thinsp;+\u0026thinsp;Mg\u003csup\u003e2+\u003c/sup\u003e for 3 h were added with 15 \u0026micro;M Propidium iodide and incubated for 30 min in the dark. Flow cytometry was performed using FACScan (Beckman Coulter).\u003c/p\u003e \u003cp\u003e \u003cb\u003ePreparation of bacterial samples for SEM/TEM.\u003c/b\u003e Bacteria (1\u0026times;10\u003csup\u003e9\u003c/sup\u003e) were collected and treated with 272 \u0026micro;M Nano-MgB\u003csub\u003e2\u003c/sub\u003e (12.5 \u0026micro;g/mL) and 544 \u0026micro;M H\u003csub\u003e3\u003c/sub\u003eBO\u003csub\u003e3\u003c/sub\u003e\u0026thinsp;+\u0026thinsp;Mg\u003csup\u003e2+\u003c/sup\u003e for 3 h, and then washed with PBS and fixed in 2.5% glutaraldehyde solution. After being washed with PBS and dehydrated by ethanol, bacteria were analyzed with SEM(ZEISS Gemini300)and elemental mapping (OXFORD Xplore). For TEM analysis. Bacteria were fixed with 2.5% glutaraldehyde at 4\u0026deg;C and post-fixed with 1% OsO4. The materials were then washed three times with PBS (15 min each) and dehydrated in a graded series of ethanol (15 min for each concentration). After penetration with 100% acetone, the materials were embedded with Epon 812 and successively polymerized at 37 \u0026ordm;C for 18 h, 48 \u0026ordm;C for 24 h and at 60 \u0026ordm;C for 48 h. The embedded samples were finally ultrathin-sectioned for 70 nm and stained with uranyl acetate and lead citrate for transmission electron microscopic (JEM2100, JEOL, Japan) observation and photography.\u003c/p\u003e \u003cp\u003e \u003cb\u003eCytoplasmic membrane depolarization assay.\u003c/b\u003e The ability of Nano-MgB\u003csub\u003e2\u003c/sub\u003e to alter the cytoplasmic membrane electrical potential was determined using the membrane potential-sensitive dye DiSC3(5) (3,3'-Dipropylthiadicarbocyanine Iodide; MKBio). Bacteria grown at 37\u0026deg;C in LB medium to mid-logarithmic phase (OD600\u0026thinsp;=\u0026thinsp;0.5) were harvested, washed once with PBS, and resuspended by a final concentration of 2 \u0026micro;M DiSC3(5). The mixture was then incubated for 30 min at room temperature to enable dye uptake and fluorescence quenching. The change in fluorescence was measured immediately after the addition of 272 \u0026micro;M Nano-MgB\u003csub\u003e2\u003c/sub\u003e and 544 \u0026micro;M H\u003csub\u003e3\u003c/sub\u003eBO\u003csub\u003e3\u003c/sub\u003e\u0026thinsp;+\u0026thinsp;Mg\u003csup\u003e2+\u003c/sup\u003e using FACScan (Beckman Coulter) for detection.\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eRNA isolation and QPCR\u003c/strong\u003e\u003c/p\u003e\u003cp\u003e \u003cb\u003eRNA isolation procedure for cells.\u003c/b\u003e Raw264.7 cells in a 24-well plate were washed with PBS and lysed with TRIzol (Life technologies, Cat15596026). The total RNA was separated with chloroform, precipitated by isopropanol and washed with 75% ethanol in DEPC treated H\u003csub\u003e2\u003c/sub\u003eO. For tissue, the only difference from the procedure in cells is the first step. The tissue was cut for 2 mm pieces and pulverized in 1mL TRIzol with a homogenizer at 4\u0026deg;C for a total of 2\u0026times;60 sec. For bacteria, 1 mL bacteria were collected and lysed with 100 \u0026micro;L lysozyme (0.4 mg/mL) for 3\u0026ndash;5 min. After that, an Eastep Super RNA isolation kit (Shanghai Promega, LS1040) was used for RNA isolation. DNase was used to clean the genome DNA as described by the instructions.\u003c/p\u003e \u003cp\u003e \u003cb\u003eReverse transcription of RNA and QPCR.\u003c/b\u003e Each sample of RNA (1\u0026ndash;5 \u0026micro;g) was reversed to cDNA using Hifair\u0026reg; III 1st Strand cDNA Synthesis SuperMix for QPCR (YESEN, CHINA 11141ES60) as described by the instructions. Finally, the cDNA was analyzed by Quantitative PCR using Hieff\u0026reg; QPCR SYBR\u0026reg; Green Master Mix (YESEN, CHINA, 11202ES03) on ABI real-time instruments (ABI 7500) as described by the instructions. The primers were listed as follows:\u003c/p\u003e \u003cp\u003emTNF-α-F TCAAGGACTCAAATGGGCTTTC\u003c/p\u003e \u003cp\u003emTNF-α-R TGCAGAACTCAGGAATGGACAT\u003c/p\u003e \u003cp\u003emIL-6-F CTGCAAGAGACTTCCATCCAGTT\u003c/p\u003e \u003cp\u003emIL-6-R GGGAAGGCCGTGGTTGTC\u003c/p\u003e \u003cp\u003emIL-1β-F TAACCTGTGGCCTTGG\u003c/p\u003e \u003cp\u003emIL-1β-R TGTGCTCTGCTTGTGAG\u003c/p\u003e \u003cp\u003emMCP-1-F CAGGTCCCTGTCATGCTTCT\u003c/p\u003e \u003cp\u003emMCP-1-R GTGGGGCGTTAACTGCATCT\u003c/p\u003e \u003cp\u003emHmox1-1-F CAGAACCCAGTCTATGCCCC\u003c/p\u003e \u003cp\u003emHmox1-1-R GTGAGGCCCATACCAGAAGG\u003c/p\u003e \u003cp\u003e \u003cb\u003eRNA-seq data analysis and QPCR.\u003c/b\u003e Total RNA was extracted using a QIAGEN RNeasy kit (catalog no. 74104) following the manufacturer\u0026rsquo;s instructions. Ribosomal RNA removal, cDNA library construction, and paired-end sequencing with the Illumina HiSeq 2000 were completed by PersonalBio China. The edge R software package was used to detect DEGs. A fold change\u0026thinsp;\u0026ge;\u0026thinsp;2 and a false discovery rate (FDR)\u0026thinsp;\u0026le;\u0026thinsp;0.05 (edger, Benjamini-Hochberg\u0026rsquo;s method) were used as a threshold to determine the DEGs. QPCR primers for \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e were listed in Supplementary Fig.\u0026nbsp;14.\u003c/p\u003e \u003cp\u003e \u003cb\u003eWestern blot.\u003c/b\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eProtein from cells\u003c/b\u003e. Cells in 6-well plate were lysed with 100 \u0026micro;L RIPA lysis buffer on ice for 20 min (RIPA buffer: 150 mM NaCl, 1% IGEPAL CA-630, 0.5% sodium deoxycholate, 0.1% SDS, 50 mM Tris-HCl, pH8.0 and protease inhibitors). Protein was collected from the supernatant by centrifuging at 12,000 rpm at 4\u0026deg;C for 20 min in a microcentrifuge. \u003cb\u003eProtein from tissues\u003c/b\u003e. Dissected 3 mm-width tissue from the wound edge and cut to small pieces. Added 500 \u0026micro;L ice-cold lysis buffer (RIPA as above) to the tissue and homogenized it with an electric homogenizer at 4\u0026deg;C for a total of 2\u0026times;60 sec. Protein was collected from the supernatant by centrifuging at 12,000 rpm at 4\u0026deg;C for 20 min in a microcentrifuge.\u003c/p\u003e \u003cp\u003eThe protocol for western blot was performed as previous report\u003csup\u003e\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e\u003c/sup\u003e. In brief, equal amounts of protein (20\u0026ndash;30 \u0026micro;g) were reduced and denatured with 5\u0026times;laemmli sample buffer, separated by SDS-PAGE gel, and transferred to the nitrocellulose membrane. After that, the membrane was blocked by 5% milk, incubated with the first antibody and second antibody as described by the manufacturer\u0026rsquo;s instructions. Finally, the membranes were developed by the Odyssey LI-COR instrument. The antibodies from Abways technology (China Inc.) were listed as follows: P38 antibody (Cat:CY5488); Pp38 antibody (Cat:CY6391; ERK1/2 antibody (Cat:CY5487); pErk1/2 antibody (Cat:CY5277); JNK1/2/3 antibody (Cat:CY5490); pJNK1/2/3 antibody (Cat:CY5541); GAPDH (Cat: AB0037).\u003c/p\u003e \u003cp\u003e \u003cb\u003eH\u0026amp;E and IF.\u003c/b\u003e The samples from the skin wound were dissected and fixed in 4% paraformaldehyde. After dehydrated in gradient alcohol, the samples were embedded in paraffin. Five micrometers of tissue sections were cut and mounted on glass slides. For H\u0026amp;E staining, the sections were dewaxed in xylene, rehydrated in gradient alcohol, washed briefly in distilled H\u003csub\u003e2\u003c/sub\u003eO, stained in Harris hematoxylin solution, differentiated with 0.3% acid alcohol, and stained with eosin. After dehydrating in gradient alcohol again, the sections were cleared in xylene and mounted with a xylene-based mounting medium. For immunofluorescence assays, the sections were pretreated with antigen retrieval solution (pH\u0026thinsp;=\u0026thinsp;9.0 EDTA solution) after dewaxed in xylene, stained with indicated first antibodies (MPO (Abcam ab208670); mF4/80(Santacruz (BM8), sc-52664) and second antibodies Alexa Fluor 594 donkey anti-rabbit, Alexa Fluor 488 donkey anti-rat according to the manufacturer\u0026rsquo;s introduction, and then mounted with DAPI-contained mounting solution. The images were scanned by 3DHISTECH CaseViewer 2.4.\u003c/p\u003e \u003cp\u003e \u003cb\u003eInflammation cytokine detection.\u003c/b\u003e Protein was collected as mentioned above. TNF-α, IL-6, and MCP-1 concentrations were detected by BD cytometric bead array (CBA) mouse inflammation kit (Catalog No. 552364) using BD FACSCalibur. The samples were prepared as follows: added 50 \u0026micro;L the mixed Capture Beads and 50 \u0026micro;L of sample to assay tubes, then added 50 \u0026micro;L the Mouse Inflammation PE Detection Reagent to each tube. Incubated for 2 h at room temperature in the dark. Added 1mL wash buffer and centrifuged at 200 g for 5 min. Resuspended in 300 \u0026micro;L wash buffer. Detected by flow cytometry and analyzed by FCAP Array software.\u003c/p\u003e \u003cp\u003e\u003cb\u003eAnimals.\u003c/b\u003e Balb/c mice (7\u0026ndash;8 weeks, male) were purchased from Charles River (CHINA Inc). All the experiments were approved by the East China Normal University Animal Care and Use Committee, and the ethics number is m20170215. All the surgeries were performed under a general anesthetic condition to minimize suffering. All the mice used in the experimental groups were randomly assigned.\u003c/p\u003e \u003cp\u003e \u003cb\u003eCutaneous bacteria and heat-inhibited bacteria (HIB) infection in mice.\u003c/b\u003e The dorsal of mice were shaved and hair was removed by using chemical depilation (VEET, CHINA). For bacteria infection, bacteria in the logarithmic phase(\u003cem\u003eS. aureus\u003c/em\u003e, OD\u0026thinsp;=\u0026thinsp;0.6\u0026ndash;0.8, about 10\u003csup\u003e8\u003c/sup\u003e bacteria; \u003cem\u003eP. aeruginosa\u003c/em\u003e, OD\u0026thinsp;=\u0026thinsp;0.5, about 10\u003csup\u003e9\u003c/sup\u003e bacteria)were collected and 10\u003csup\u003e6\u003c/sup\u003e \u003cem\u003eS. aureus\u003c/em\u003e or 10\u003csup\u003e7\u003c/sup\u003e \u003cem\u003eP. aeruginosa\u003c/em\u003e were intradermally injected into mouse dorsal skin and then intradermally treated with indicated concentrations of Nano-MgB\u003csub\u003e2\u003c/sub\u003e; For heat-inhibited bacteria infection, 2\u0026times;10\u003csup\u003e9\u003c/sup\u003e CFU/mL \u003cem\u003eP. aeruginosa\u003c/em\u003e were killed at 70 ℃ for 1 hour and 2\u0026times;10\u003csup\u003e8\u003c/sup\u003e CFU heat-inhibited \u003cem\u003eP. aeruginosa\u003c/em\u003e were intradermally injected into mouse dorsal skin and then intradermally treated with indicated concentrations of Nano-MgB\u003csub\u003e2\u003c/sub\u003e. The lesions were photographed and measured by Image J software. Mice were euthanized on day 3 and the lesional skins were collected and homogenized to determine the survival number of bacteria. In some experiments, the lesional skins were collected for H\u0026amp;E staining, QPCR, and inflammation cytokine detection.\u003c/p\u003e \u003cp\u003e \u003cb\u003eCutaneous-infected wound in mice.\u003c/b\u003e Mouse skins were shaved as mentioned above. Excisional dorsal skin wounds were made with an 8 mm sterile biopsy punch as previous report\u003csup\u003e\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e\u003c/sup\u003e and then infected with 10\u003csup\u003e6\u003c/sup\u003e \u003cem\u003eS. aureus\u003c/em\u003e or 10\u003csup\u003e7\u003c/sup\u003e \u003cem\u003eP. aeruginosa\u003c/em\u003e in the presence or absence of Nano-MgB\u003csub\u003e2\u003c/sub\u003e. The wounds were finally covered with a special kind of plastic sticker (Tegaderm Film, 3M, XH003801525), the wound areas were photographed at the indicated times and calculated by Image J. The mice were euthanized and the skin surrounding the wound edges was collected for H\u0026amp;E staining, QPCR, and Elisa. In some experiments, the whole lesional skins were collected and homogenized to determine the survival number of bacteria.\u003c/p\u003e \u003cp\u003e \u003cb\u003eStatistical analysis.\u003c/b\u003e All data are present as means\u0026thinsp;\u0026plusmn;\u0026thinsp;SD. A two-tailed t-test was used to determine the significances between the two groups. One-way or two-way ANOVA with Bonferroni post test was used to analyze multiple groups. For all the statistical tests, P values\u0026thinsp;\u0026lt;\u0026thinsp;0.05 were considered to be statistically significant.\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe main data supporting the results in this study are available within the paper and its Supplementary Information. All data generated in this study are available from the corresponding authors.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors thank ECNU Multifunctional Platform for Innovation (004) for technology support. The authors would greatly acknowledge the financial support by the National Funds for Distinguished Young Scientists (Grant No. 51725202), the Key Project of Shanghai Science and Technology Commission (Grant No. 19JC1412000), and the National Natural Science Foundation of China (Grant No. 51872094, 82172091). National Science Foundation for the Young Scientists of China (Grant No. 32000948).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eW.B. and Y.W. conceived and supervised the study. Y.M., L.C. and Y.C. designed and performed the experiments. J.S., Z.Z., X.C. and W.Y. prepared and characterized the nanomaterials. Y.M., F.W. and X. J. performed most cell biological and animal experiments. W.Y., L.Z. and C.W. assisted with cell biological and animal experiments. L.C., X.M. and Y.C. analyzed the data. W.B. and Y.W. wrote the manuscript. All authors contributed to the review, revision and finalization of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors have no conflicts to declare.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eXue M, Zhao R, Lin H, Jackson C. Delivery systems of current biologicals for the treatment of chronic cutaneous wounds and severe burns. Adv. Drug Deliv. Rev. \u003cb\u003e129\u003c/b\u003e, 219\u0026ndash;241 (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChin JS, Madden L, Chew SY, Becker DL. Drug therapies and delivery mechanisms to treat perturbed skin wound healing. Adv. Drug Deliv. Rev. \u003cb\u003e149\u0026ndash;150\u003c/b\u003e, 2\u0026ndash;18 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSang Y, \u003cem\u003eet al.\u003c/em\u003e Construction of Nanozyme-Hydrogel for Enhanced Capture and Elimination of Bacteria. Adv. Fun. Mater. \u003cb\u003e29\u003c/b\u003e, 1900518 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKohanski MA, Dwyer DJ, Collins JJ. How antibiotics kill bacteria: from targets to networks. Nat. Rev. Microbiol. \u003cb\u003e8\u003c/b\u003e, 423\u0026ndash;435 (2010).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGjodsbol K, Christensen JJ, Karlsmark T, Jorgensen B, Klein BM, Krogfelt KA. Multiple bacterial species reside in chronic wounds: a longitudinal study. Int. Wound. J. \u003cb\u003e3\u003c/b\u003e, 225\u0026ndash;231 (2006).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWrighton KH. Bacterial physiology: Bridging the gap for lipopolysaccharides. Nat. Rev. Microbiol. \u003cb\u003e16\u003c/b\u003e, 184\u0026ndash;185 (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang X, \u003cem\u003eet al.\u003c/em\u003e Bacterial Endotoxin Activates the Coagulation Cascade through Gasdermin D-Dependent Phosphatidylserine Exposure. Immunity \u003cb\u003e51\u003c/b\u003e, 983\u0026ndash;996 e986 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDeng M, \u003cem\u003eet al.\u003c/em\u003e The Endotoxin Delivery Protein HMGB1 Mediates Caspase-11-Dependent Lethality in Sepsis. Immunity \u003cb\u003e49\u003c/b\u003e, 740\u0026ndash;753 e747 (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShibusawa K, Murakami T, Yomogida S, Tamura H, Nagaoka I. Antimicrobial cathelicidin peptide CAP11 suppresses HMGB1 release from lipopolysaccharide-stimulated mononuclear phagocytes via the prevention of necrotic cell death. Int. J mol. med. \u003cb\u003e23\u003c/b\u003e, 341\u0026ndash;346 (2009).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRosenfeld Y, Papo N, Shai Y. Endotoxin (lipopolysaccharide) neutralization by innate immunity host-defense peptides. Peptide properties and plausible modes of action. J. biol. chem. \u003cb\u003e281\u003c/b\u003e, 1636\u0026ndash;1643 (2006).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSaravanan R, \u003cem\u003eet al.\u003c/em\u003e Structural basis for endotoxin neutralisation and anti-inflammatory activity of thrombin-derived C-terminal peptides. Nat. commun. \u003cb\u003e9\u003c/b\u003e, 2762 (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGiuliani A, Pirri G, Rinaldi AC. Antimicrobial peptides: the LPS connection. Methods mol. bio. \u003cb\u003e618\u003c/b\u003e, 137\u0026ndash;154 (2010).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSampath V. Bacterial endotoxin-lipopolysaccharide; structure, function and its role in immunity in vertebrates and invertebrates. Agric. Nat. Resour. \u003cb\u003e52\u003c/b\u003e, 115\u0026ndash;120 (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDong H, \u003cem\u003eet al.\u003c/em\u003e Structural basis for outer membrane lipopolysaccharide insertion. Nature \u003cb\u003e511\u003c/b\u003e, 52\u0026ndash;56 (2014).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen W, Zhen X, Wu W, Jiang X. Responsive boron biomaterials and their biomedical applications. Sci. China Chem. \u003cb\u003e63\u003c/b\u003e, 648\u0026ndash;664 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNi N, Laughlin S, Wang Y, Feng Y, Zheng Y, Wang B. Probing the general time scale question of boronic acid binding with sugars in aqueous solution at physiological pH. Bioorg. Med. Chem. \u003cb\u003e20\u003c/b\u003e, 2957\u0026ndash;2961 (2012).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYuanyuan M, Hanting L, Jinghong M, Jinghua G. Glucose-responsive hydrogels based on phenylboronic acid. Mater. Sci. Forum \u003cb\u003e913\u003c/b\u003e, 714\u0026ndash;721 (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMarco-Dufort B, Tibbitt MW. Design of moldable hydrogels for biomedical applications using dynamic covalent boronic esters. Mater. Today Chem. \u003cb\u003e12\u003c/b\u003e, 16\u0026ndash;33 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePeters JA. Interactions between boric acid derivatives and saccharides in aqueous media: Structures and stabilities of resulting esters. Coord. Chem. Rev. \u003cb\u003e268\u003c/b\u003e, 1\u0026ndash;22 (2014).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang GSaB. A detailed examination of boronic acid-diol complexation. Tetrahedron \u003cb\u003e58\u003c/b\u003e, 5291\u0026ndash;5300 (2002).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen Z. DN, Yanyan L., Heliang Y., Wenbo B., Jianlin S. Magnesium silicide nanoparticles as a deoxygenation agent for cancer starvation therapy. Nat. Nanotechnol. \u003cb\u003e121\u003c/b\u003e, 378\u0026ndash;386 (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBadica P, \u003cem\u003eet al.\u003c/em\u003e Antibacterial composite coatings of MgB2 powders embedded in PVP matrix. Sci. Rep. \u003cb\u003e11\u003c/b\u003e, 9591 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQiao Y, \u003cem\u003eet al.\u003c/em\u003e Light-Activatable Synergistic Therapy of Drug-Resistant Bacteria-Infected Cutaneous Chronic Wounds and Nonhealing Keratitis by Cupriferous Hollow Nanoshells. ACS nano \u003cb\u003e14\u003c/b\u003e, 3299\u0026ndash;3315 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRahim MI, Eifler R, Rais B, Mueller PP. Alkalization is responsible for antibacterial effects of corroding magnesium. J. Biomed. Mater. Res. A \u003cb\u003e103\u003c/b\u003e, 3526\u0026ndash;3532 (2015).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMarco E. B, Angelo A., Manfredi. Dangers in and out. Science \u003cb\u003e323\u003c/b\u003e, 1683\u0026ndash;1684 (2009).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSurwade P, Luxton T, Clar J, Xin F, Shah V. Impact of the changes in bacterial outer membrane structure on the anti-bacterial activity of zinc oxide nanoparticles. J. Nanopart. Res. \u003cb\u003e22\u003c/b\u003e, 43\u0026ndash;51 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSlavin YN, Asnis J, Hafeli UO, Bach H. Metal nanoparticles: understanding the mechanisms behind antibacterial activity. J. Nanobiotechnology \u003cb\u003e15\u003c/b\u003e, 65 (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSun Y, \u003cem\u003eet al.\u003c/em\u003e CCN1 promotes IL-1beta production in keratinocytes by activating p38 MAPK signaling in psoriasis. Sci. Rep. \u003cb\u003e7\u003c/b\u003e, 43310 (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDeutscher MP. Degradation of RNA in bacteria: comparison of mRNA and stable RNA. Nucleic Acid Res. \u003cb\u003e34\u003c/b\u003e, 659\u0026ndash;666 (2006).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFrazier WJ, Xue J, Luce WA, Liu Y. MAPK signaling drives inflammation in LPS-stimulated cardiomyocytes: the route of crosstalk to G-protein-coupled receptors. PloS one \u003cb\u003e7\u003c/b\u003e, e50071 (2012).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang W, Liu P, Hao C, Wu L, Wan W, Mao X. Neoagaro-oligosaccharide monomers inhibit inflammation in LPS-stimulated macrophages through suppression of MAPK and NF-kappaB pathways. Sci. Rep. \u003cb\u003e7\u003c/b\u003e, 44252 (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAmanzada A, Malik IA, Nischwitz M, Sultan S, Naz N, Ramadori G. Myeloperoxidase and elastase are only expressed by neutrophils in normal and in inflamed liver. Histochem. cell biol. \u003cb\u003e135\u003c/b\u003e, 305\u0026ndash;315 (2011).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePulli B, \u003cem\u003eet al.\u003c/em\u003e Measuring myeloperoxidase activity in biological samples. PloS one \u003cb\u003e8\u003c/b\u003e, e67976 (2013).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKhazen W, \u003cem\u003eet al.\u003c/em\u003e Expression of macrophage-selective markers in human and rodent adipocytes. FEBS letters \u003cb\u003e579\u003c/b\u003e, 5631\u0026ndash;5634 (2005).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDos Anjos Cassado A. F4/80 as a Major Macrophage Marker: The Case of the Peritoneum and Spleen. Results Probl. Cell. Differ. \u003cb\u003e62\u003c/b\u003e, 161\u0026ndash;179 (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePlante JA, \u003cem\u003eet al.\u003c/em\u003e Spike mutation D614G alters SARS-CoV-2 fitness. Nature \u003cb\u003e592\u003c/b\u003e, 116\u0026ndash;121 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTrippier PC, McGuigan C. Boronic acids in medicinal chemistry: anticancer, antibacterial and antiviral applications. Med. Chem. Comm. \u003cb\u003e1\u003c/b\u003e, 183 (2010).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSayin Z, Ucan US, Sakmanoglu A. Antibacterial and Antibiofilm Effects of Boron on Different Bacteria. Biol. Trace. Elem. Res. \u003cb\u003e173\u003c/b\u003e, 241\u0026ndash;246 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003evan Haveren J, Peters JA, Batelaan JG, Kieboom APG, van Bekkum H. pH dependence of the stability of boric acid and borate esters of amino acids and amino diols in aqueous medium as studied by 1B and 1H NMR spectroscopy. Recueil des Travaux Chimiques des Pays-Bas \u003cb\u003e108\u003c/b\u003e, 179\u0026ndash;184 (1989).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang Z-h, Bao X-g, Hu J-j, Shen S-b, Xu G-h, Wu Y-l. Nicotinamide Riboside Enhances Endothelial Precursor Cell Function to Promote Refractory Wound Healing Through Mediating the Sirt1/AMPK Pathway. Front. Pharmacol. \u003cb\u003e12\u003c/b\u003e, 671563 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu Y, \u003cem\u003eet al.\u003c/em\u003e Hyperglycaemia inhibits REG3A expression to exacerbate TLR3-mediated skin inflammation in diabetes. Nat. Commun. \u003cb\u003e7\u003c/b\u003e, 13393 (2016).\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"nature-portfolio","isNatureJournal":true,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"","title":"Nature Portfolio","twitterHandle":"","acdcEnabled":false,"dfaEnabled":false,"editorialSystem":"ejp","reportingPortfolio":"","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-1584966/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-1584966/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eBacteria and excessive inflammation are two main factors causing non-healing wounds. However, current studies have mainly focused on the inhibition of bacteria survival for wound healing while ignoring the excessive inflammation induced by dead bacteria or their released endotoxin, lipopolysaccharide (LPS) or peptidoglycan (PGN). Herein, a boron-magnet strategy was proposed to prevent both infection and excessive inflammation by synthesizing a class of reactive metal boride nanoparticles (MB NPs). The MB NPs were slowly hydrolyzed to generate boron dihydroxy groups and metal cations while generating a local alkaline microenvironment with low levels of reactive oxygen species. This microenvironment promoted MB NPs to capture LPS/PGN through an esterification reaction, which not only enhanced metal cation-induced bacterial death but also inhibited the dead bacteria- or endotoxin-induced excessive inflammation, resulting in accelerated wound healing. Taken together, this boron-magnet strategy provides a new approach to the treatment of bacterial infection and the accompanying inflammation.\u003c/p\u003e","manuscriptTitle":"Boron-Magnet Nanoparticles Capture Lipopolysaccharide and Peptidoglycan for Bacteria-Infected Wound Healing","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2022-05-11 18:39:27","doi":"10.21203/rs.3.rs-1584966/v1","editorialEvents":[],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"nature-communications","isNatureJournal":true,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"NCOMMS","sideBox":"Learn more about [Nature Communications](http://www.nature.com/ncomms/)","snPcode":"","submissionUrl":"https://mts-ncomms.nature.com/","title":"Nature Communications","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature Communications","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"f3af4efc-bb2d-488d-bc8b-f3ff63ae8ea6","owner":[],"postedDate":"May 11th, 2022","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2022-12-01T08:14:22+00:00","versionOfRecord":{"articleIdentity":"rs-1584966","link":"https://doi.org/10.1038/s41467-022-35050-6","journal":{"identity":"nature-communications","isVorOnly":false,"title":"Nature Communications"},"publishedOn":"2022-11-29 05:00:00","publishedOnDateReadable":"November 29th, 2022"},"versionCreatedAt":"2022-05-11 18:39:27","video":"","vorDoi":"10.1038/s41467-022-35050-6","vorDoiUrl":"https://doi.org/10.1038/s41467-022-35050-6","workflowStages":[]},"version":"v1","identity":"rs-1584966","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-1584966","identity":"rs-1584966","version":["v1"]},"buildId":"J0_U0BvcaRcwD8yVFaRlm","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. The paper's references may be in our DB but unresolved to ``paper_id`` (resolution happens at ingest when the cited DOI matches a row we already have). Run the cross-source citation reconcile pass to retry.

Source provenance

europepmc
last seen: 2026-05-19T01:45:01.086888+00:00
unpaywall
last seen: 2026-05-27T02:00:06.600101+00:00
License: CC-BY-4.0