Full text
178,210 characters
· extracted from
preprint-html
· click to expand
Cell Cycle Arrest of a ‘Zippering’ Epithelial Cell Cluster Shapes the Face and is Disrupted in Craniofacial Disorders | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results Cell Cycle Arrest of a ‘Zippering’ Epithelial Cell Cluster Shapes the Face and is Disrupted in Craniofacial Disorders T. Qu , B.H. Chacón , L. Faure , M. Losa , R. Hernández-Martínez , K. Robinson , A. Jones , S. Lisgo , J. De Anda , M. Risolino , G. Panagiotakos , E.J. Leslie-Clarkson , I. Adameyko , L. Selleri doi: https://doi.org/10.1101/2025.07.28.667310 T. Qu 1 Program in Craniofacial Biology, University of California , San Francisco, San Francisco, CA 94143, USA 2 Department of Orofacial Sciences, University of California , San Francisco, San Francisco, CA 94143, USA 3 Graduate Program in Oral and Craniofacial Sciences, University of California , San Francisco, San Francisco, CA 94143, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site B.H. Chacón 1 Program in Craniofacial Biology, University of California , San Francisco, San Francisco, CA 94143, USA 2 Department of Orofacial Sciences, University of California , San Francisco, San Francisco, CA 94143, USA 4 Graduate Program in Developmental and Stem Cell Biology, University of California , San Francisco, San Francisco, CA 94143, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site L. Faure 5 Department of Neuroimmunology, Center for Brain Research, Medical University Vienna , Vienna, Austria Find this author on Google Scholar Find this author on PubMed Search for this author on this site M. Losa 1 Program in Craniofacial Biology, University of California , San Francisco, San Francisco, CA 94143, USA 2 Department of Orofacial Sciences, University of California , San Francisco, San Francisco, CA 94143, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site R. Hernández-Martínez 1 Program in Craniofacial Biology, University of California , San Francisco, San Francisco, CA 94143, USA 2 Department of Orofacial Sciences, University of California , San Francisco, San Francisco, CA 94143, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site K. Robinson 6 Department of Human Genetics, Emory University , Atlanta, GA 30322, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site A. Jones 7 Biosciences Institute, Newcastle University , Newcastle upon Tyne, UK Find this author on Google Scholar Find this author on PubMed Search for this author on this site S. Lisgo 7 Biosciences Institute, Newcastle University , Newcastle upon Tyne, UK Find this author on Google Scholar Find this author on PubMed Search for this author on this site J. De Anda 1 Program in Craniofacial Biology, University of California , San Francisco, San Francisco, CA 94143, USA 2 Department of Orofacial Sciences, University of California , San Francisco, San Francisco, CA 94143, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site M. Risolino 1 Program in Craniofacial Biology, University of California , San Francisco, San Francisco, CA 94143, USA 2 Department of Orofacial Sciences, University of California , San Francisco, San Francisco, CA 94143, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site G. Panagiotakos 8 Georgia Panagiotakos: Department of Psychiatry; Nash Family Department of Neuroscience; Friedman Brain Institute; Institute for Regenerative Medicine; Black Family Stem Cell Institute; Alper Center for Neurodevelopment and Regeneration; Seaver Autism Center for Research and Treatment; and Mindich Child Health and Development Institute at the Icahn School of Medicine at Mount Sinai , New York, NY 10029, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site E.J. Leslie-Clarkson 6 Department of Human Genetics, Emory University , Atlanta, GA 30322, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site I. Adameyko 5 Department of Neuroimmunology, Center for Brain Research, Medical University Vienna , Vienna, Austria 9 Department of Physiology and Pharmacology, Karolinska Institutet , Stockholm, Sweden Find this author on Google Scholar Find this author on PubMed Search for this author on this site L. Selleri 1 Program in Craniofacial Biology, University of California , San Francisco, San Francisco, CA 94143, USA 2 Department of Orofacial Sciences, University of California , San Francisco, San Francisco, CA 94143, USA 10 Department of Anatomy, University of California , San Francisco, San Francisco, CA 94143, USA 11 Institute for Human Genetics, University of California , San Francisco, San Francisco, CA 94143, USA 12 Eli and Edythe Broad Center of Regeneration Medicine & Stem Cell Research, University of California , San Francisco, San Francisco, CA 94143, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site For correspondence: licia.selleri{at}ucsf.edu Abstract Full Text Info/History Metrics Supplementary material Preview PDF Abstract Facial features identify individuals, but the mechanisms shaping the human face remain elusive. Orofacial clefting (OFC), the most common craniofacial abnormality, results from failed fusion of the facial prominences that is in part caused by persistence of the cephalic epithelium. Here we uncover the identity, behaviors, and molecular blueprints of a novel craniofacial epithelial population, the Zippering Lambda (ZL), which mediates prominence fusion and is characterized by cell cycle arrest in mouse and human embryos. Remarkably, cell cycle is unleashed in the ZL of Pbx1/2 and p63 mutant mice with OFC. Intersection of ZL-enriched genes with human OFC whole-genome sequencing datasets identifies ZFHX3 variants in affected individuals and cephalic epithelial Zfhx3 deletion causes murine OFC. ZFHX3 and PBX1 genetically interact and synergistically regulate cell cycle inhibitor genes within a complex in embryonic faces. Collectively, we deconstruct new mechanisms that pattern the face, connecting cell cycle arrest to developmental tissue fusion. Introduction Our faces uniquely shape our identities and forge our connections. Early craniofacial morphogenesis requires fusion of transient swellings called the facial prominences. This process occurs between gestational weeks 4 th -8 th in humans 1 , 2 and from embryonic days (E)9.5-E12.5 in mice, exhibiting remarkable similarities between the two species 3 – 5 . Specifically, during the 4 th week of human development (E9.5-E10.5 in mice), the frontonasal prominence (FNP) emerges and divides into the medial (MNP) and lateral nasal (LNP) prominences, which subsequently fuse with the maxillary prominence (MxP) around the 7 th week in humans 1 , 2 (E11.5 in mice). The prominence cores mainly comprise mesenchymal cells that originate from cranial neural crest (CNC), encased in an epithelial layer of surface ectodermal and neuroectodermal origin 6 – 8 . In mice, MNP, LNP, and MxP convergence creates an epithelial seam named the lambdoidal junction (λ) 9 . Epithelial cells at the murine λ must be removed to enable seamless merging of the prominence mesenchymal cores from E11.5-E12.5. Prominence fusion shapes the midface, which consists of the nose, upper lip, and primary palate 1 . While CNC-derived mesenchymal cells have been extensively studied for their role in craniofacial morphogenesis 10 – 19 , previous reports from our 20 , 21 and other labs 22 – 24 highlighted the essential contribution of the epithelium to this process. Developmental abnormalities like orofacial clefting (OFC) occur when facial prominences fail to merge. OFC affects approximately 1 in 1000 live births 25 , leading to significant medical challenges in patients and requiring numerous surgical corrections 26 . Our work has demonstrated that mouse embryos with constitutive compound loss-of-function (LOF) of Pbx genes, encoding homeodomain transcription factors (TFs) 27 , exhibit fully penetrant OFC. Notably, OFC is also present in all embryos with Pbx1 conditional loss in the cephalic epithelium on a Pbx2 or Pbx3 deficient background 20 , 21 , underscoring the importance of the epithelium in facial prominence fusion. Interestingly, humans with PBX1 mutations exhibit a developmental syndrome with facial dysmorphology 28 , and GWAS analysis has revealed an association between PBX1 / PBX2 variants and OFC 29 . We previously reported that PBX TFs mediate facial prominence fusion by either activating a WNT-p63-IRF6 regulatory module that results in apoptosis 20 or regulating epithelial removal at the λ seam through epithelial-to-mesenchymal transition (EMT) 21 . However, only about 50% of epithelial cells are eliminated through apoptosis or EMT at the seam 20 , 21 , suggesting that the epithelium is heterogenous, and additional cellular behaviors contribute to epithelial removal. Actomyosin contractility 30 and cell extrusion 31 , crucial in secondary palate fusion, as well as other cellular behaviors yet to be uncovered, may also mediate epithelial cell removal during facial prominence fusion. Despite the prevalence of human OFC, our knowledge of the underlying cellular and molecular mechanisms is primarily based on mouse models, which have significantly informed craniofacial development 4 , 32 – 34 . Nevertheless, deeper mechanistic understanding of facial morphogenesis and congenital abnormalities in our species necessitates studies in humans. Here, we identified a novel cephalic epithelial cell population, which mediates facial prominence fusion, and is arrested in the cell cycle, that we named the Zippering Lambda (ZL) cluster in mouse embryos. Importantly, comparative analysis revealed the presence of a ZL-like population in human embryos. Both Pbx1/2 and p63 mutant mice with OFC showed cell cycle release in the ZL epithelium. Intersection of ZL-enriched genes with whole genome sequencing (WGS) datasets from OFC trios further uncovered OFC-associated gene variants, including mutations affecting ZFHX3 , which encodes a TF that mediates cell cycle arrest 35 – 37 . Notably, Zfhx3 deletion in mouse cephalic epithelia resulted in OFC, demonstrating that Zfhx3 mutations cause this craniofacial disorder in mammals. Lastly, using biochemical, genetic, and –omics approaches, we found that PBX1-ZFHX3 genetically interact during midfacial morphogenesis, and function within a protein complex in the midface to co-regulate cell cycle inhibitor genes. Our studies uncover a novel cephalic epithelial cell cycle-arrested population at the λ and reveal identical cellular behaviors and transcriptomic signatures in mice and humans during early facial morphogenesis. This research also demonstrates functional involvement of this cell cluster in facial prominence fusion, linking it to a common craniofacial disorder. Together, these investigations highlight novel mechanisms shaping the face. Results Midface λ epithelium comprises multiple cell clusters with distinct transcriptomes To dissect the heterogeneity of the cephalic epithelial cells that envelop the facial prominences during their fusion, we conducted single-cell (sc) RNAseq 38 – 40 . By fluorescence-activated cell sorting (FACS), we purified EpCAM+ 41 epithelial cells from micro-dissected λ tissue of wild-type mouse embryos at developmental stages E9.5, E10.5, and E11.5, encompassing the critical timepoints of facial prominence fusion ( Fig. 1A -A’’’; Fig. S1A). Unsupervised clustering 42 after cell cycle regression and marker gene identification revealed dynamic changes in cell subpopulations across the examined timepoints. By integrating the E9.5 to E11.5 datasets, we detected fourteen unique cell clusters across timepoints, including oral cavity epithelia (OR; Pitx1+ and Pitx2+ ) 43 ; olfactory epithelia (OF; Sox2+ and Dlk1+ ) 44 ; early eye surface epithelia (EE; Hmx1+ and Sfrp2+ ) 45 , 46 ; prominence surface epithelia 1 and 2 (PS1 and PS2; Wnt6+ and Tfap2b+ ) 24 ; nasolacrimal duct epithelia (ND; Aldh1a3+ and Sox9+ ) 47 , 48 ; periderm (PD; Grhl3+ and Tacstd2+ ) 49 ; zippering λ epithelia (ZL; Bambi+ and Bmp4+ ) 50 ; neural stem cells (NSC; Sst+ and Nrsn1+ ) 51 ; olfactory neurons (ON; Tubb3+ and Neurod1+ ) 52 ; neural crest cells (NCC; Sox10+ and Foxd3+ ) 53 ; mesenchyme-like cells (ME; Prrx1+ and Twist1+ ) 54 ; forebrain cells (FB; Fez1+ and Zic1+ ) 55 , 56 ; and blood cells (B; Hba-x+ and Hbb-y+ ) 57 ( Fig. 1B ; Fig. S1B-E). The presence of the latter cell clusters (NCC, ME, FB, B) reflects a relaxed gating strategy during FACS purification to maximize yield of epithelial cells. Notably, the PS cluster comprises PS1 and PS2 subpopulations, grouped based on shared transcriptomes, but separated by cell cycle phases. Specifically, based on enrichment of known markers, we annotated eleven, fourteen, and eleven distinct clusters at E9.5, E10.5, and E11.5, respectively ( Fig. 1C ). Download figure Open in new tab Fig. 1: scRNAseq of midface λ epithelium highlights cell heterogeneity: spatial localization of select cell clusters. (A-A’’’) Experimental design of epithelial cell isolation from the lambdoidal junction (λ) of mouse embryonic facial prominences at different gestational days (E10.5 shown). (A) 3D rendering of an E10.5 mouse embryonic head. (A’) Representative microdissection of half-midface comprising medial nasal prominence (MNP), lateral nasal prominence (LNP), and maxillary prominence (MxP). Dashed lines indicating further dissection to λ-centric region. (A’’) Dissected λ. Green rectangle highlights cross section. (A’’’) Epithelial tissue within λ, isolated via fluorescence activated cell sorting (FACS) for single-cell (sc) RNAseq experiments, highlighted in green on λ midface cryosection. Scale bar: 200 μm. (B) Dendrogram and Uniform Manifold Approximation and Projection (UMAP) of 14 combined clusters across three timepoints. NCC, neural crest cell; ME, mesenchyme; OR, oral cavity epithelium; OF, olfactory epithelium; EE, early eye surface epithelium; FB, forebrain; PS1/PS2, prominence surface epithelium; ND, nasolacrimal duct; PD, periderm; ZL, zippering λ epithelium; NSC, neural stem cell; ON, olfactory neuron; B, blood. (C) UMAP representing scRNAseq datasets of E9.5-E11.5 wild-type murine λ epithelium. Captured cell numbers indicated. (D) Heatmap of normalized gene expression (NGE) for cluster-defining transcripts overlaid on UMAP (left panel) and RNAscope Fluorescent in-situ Hybridization (FISH) validation of the 5 largest clusters across datasets, each characterized by 3 highly enriched transcripts (center and right panels). Representative in vivo spatial validation of gene expression; one transcript assayed for each cluster at E11.5. DAPI stain (center) and RNAscope (right). TUBB3 visualized via immunofluorescence (IF). Dashed lines show epithelium-mesenchyme boundaries. Arrows highlight spatial enrichment of gene expression. OC, oral cavity. Scale bars: 50 μm. (E) Color-coded rendering of E10.5 murine facial prominences in whole head (left) and λ cross section (right) showing spatial patterns of validated cell clusters. OF, dark blue; PS1/PS2, light blue; ON, orange; OR, dark green; ZL, light green. To delineate the spatial relationships among EpCAM+ epithelial populations, we validated the expression of one top differentially expressed gene (DEG) from each cluster by either RNAscope fluorescent in-situ hybridization (FISH; hereafter RNAscope) 58 or immunofluorescence (IF) on E10.5 embryos ( Fig. 1D ; Fig. S1F). OF cells, marked by Sox2 , are localized to the nasal pit together with TUBB3+ ON cells. Wnt6+ PS cells, comprising one of the largest clusters, envelop the surface of the three λ prominences (MNP, LNP and MxP), whereas OR cells, highlighted by Pitx2 expression, flank the oral cavity ( Fig. 1D ). ND, PD, and EE cells cover the nasolacrimal duct, the prominences’ apical surface, and optic vesicle, respectively (Fig. S1F). Intriguingly, a cell cluster adjoining OF, PS and OR, that we termed the zippering λ (ZL) epithelium, is uniquely positioned at the λ prominences’ tips where fusion occurs ( Fig. 1D , E). This cluster is absent at E9.5 before prominence fusion begins, emerges by E10.5 during prominence fusion, and persists through E11.5 when fusion is nearly complete ( Fig. 1C ; Fig. S1C). Altogether, these findings underscore the heterogeneity and dynamic nature of the λ epithelium involved in facial prominence fusion and suggest potential roles for ZL cells in this process. Molecular characterization and in vivo lineage tracing of the ZL cell cluster Considering the murine ZL cell cluster’s distinctive positioning and timing of appearance, we proceeded to explore its molecular signatures. At E9.5, prior to ZL emergence, Bmp4 , a critical craniofacial regulator associated with OFC 59 , is expressed more broadly within the OR, OF, and PS cell clusters, as shown by normalized gene expression (NGE) overlaid on UMAPs ( Fig. 2A ; left). RNAscope and Whole Mount in situ Hybridization (WISH) 20 localized these Bmp4- expressing cells to the FNP and prospective branchial arch (BA)1 junction ( Fig. 2A ; right) and to the rostral FNP ( Fig. 2A ’), respectively. By E10.5, Bmp4 expression increases at the site of prominence fusion and is enriched in the ZL ( Fig. 2B , B’). By E11.5, Bmp4 expression expands to encompass not only the ZL but also the adjacent PS and OF cell populations, overlaying the MNP and LNP (Fig. S2A). Transcripts encoding members of signaling pathways with known roles in craniofacial development and associated with OFC, including TGF-β 60 – 62 , FGF 63 , 64 , and WNT 65 – 67 , are also enriched in the ZL cluster at E10.5 ( Fig. 2C ). We previously reported that the three above pathways converge on Trp63 to orchestrate epithelial apoptosis during midface prominence fusion 20 , 21 , 68 ( Fig. 2C ). Additionally, ZL cells show enrichment of Bambi and Igfbp5 , inhibitors of TGF-β/BMP and IGF signaling 69 – 72 , respectively, and reduced expression of Top2a , a cell cycle progression marker 73 (Fig. S2B,C). To interrogate the developmental trajectory of ZL cells in relation to adjacent cell populations in our scRNAseq datasets, we employed RNA velocity 74 , which infers cell trajectory based on the ratio of unspliced and spliced mRNAs ( Fig. 2D ; Fig. S2D). At E9.5, converging velocity vectors originating from the OR, OF, and PS clusters, point to the emergence of a new cell cluster ( Fig. 2D ). By E10.5, as fusion commences, the ZL cluster, presaged at E9.5, appears at the convergence of distinct vector trajectories stemming from these adjacent cell populations. This robust vector pattern deriving from OF and OR and directed towards the ZL cluster persists until E11.5 ( Fig. 2D ; Fig. S2D). CytoTRACE analysis 75 , which predicts cell differentiation states based on transcriptional diversity, corroborated these findings, identifying the ZL as the most differentiated cluster among λ epithelial cells ( Fig. 2D ’; Fig. S2E). Gene ontology (GO) analysis associated the top 100 DEGs in the ZL cluster with regulation of cell cycle and apoptosis ( Fig. 2E ). Notably, we previously implicated apoptosis in prominence fusion 20 , 21 . Download figure Open in new tab Fig. 2: Molecular characterization and in vivo cell fate mapping of the ZL epithelial cell cluster. (A, B) Overlay of NGE on UMAP shows Bmp4 expression at E9.5 (A) and E10.5 (B) (left). Black dashed area indicates ZL cluster boundaries. RNAscope validations in transverse section (E9.5) and coronal section (E10.5; center). Magnified insets (right; red dashed squares). White arrowheads highlight gene expression. Scale bars: 50 μm. (A’, B’) Whole Mount in situ Hybridization (WISH) validation of Bmp4 expression at E9.5 ( A’ , sagittal view) and E10.5 ( B’ , frontal view). At E10.5, Bmp4 expression (black arrowheads) marks ZL cluster at fusion site. Scale bars: 500 μm. (C) NGE overlaid on UMAPs highlighting ZL enrichment of transcripts previously associated with midface development and cleft lip/palate at E10.5. (D) RNA velocity of E9.5 (vectors, left) and E10.5 (vectors, middle; endpoints, right) scRNAseq datasets. ZL cluster, red dashed area. (D’) CytoTRACE computation of E10.5 scRNAseq dataset highlights ZL (black dashed area) amongst the most differentiated cell clusters. (E) Gene ontology (GO) biological processes associated with top differentially expressed genes (DEGs) in the ZL cluster. Asterisks indicate terms of interest. (F) Reclustering of E10.5 ZL (black-colored area) reveals 5 subclusters (ZL0-4). RNA velocity indicates two terminal endpoints (green stars) in ZL1 and ZL3 corresponding to highly differentiated cell states. (G) NGE overlaid on UMAPs for transcripts enriched in terminal endpoints of E10.5 ZL subclusters at E10.5. (H) Dot plot showing expression of top 5 DEGs in ZL subclusters. ZL1 (orange box) and ZL3 (red box) comprise RNA velocity-predicted endpoints. Dot sizes represent the proportion of cells within a given population expressing the target gene; color intensities indicate average expression levels. (H’) GO terms of top 40 enriched genes in ZL1 and ZL3. Asterisks indicate terms of interest. (I) NGE overlaid on UMAPs showing enrichment of Pitx2 and Wnt4 in OR (left) and PS (right) cluster, respectively, at E10.5. Black dashed area highlights ZL. (J) Genetic lineage tracing validates RNA velocity predictions of ZL cluster origin from OR and PS epithelium. RNAscope validation showing Bmp4/Cdkn1a co-expression in RFP positive cells (left). Arrows within insets highlight signal overlap within prominence tips (right, red dashed squares). Scale bars: 50 μm. Inset scale bars: 20 μm. Further re-clustering of the ZL identified five subclusters (ZL0-4) at E10.5, with ZL1 and ZL3 as endpoints in RNA velocity analysis ( Fig. 2F ). ZL1 and ZL3 are enriched in transcripts that encode signaling effectors we previously implicated in apoptosis at the λ (e.g., Tgfb2 and Lef1 20 , 21 ), an antagonist of WNT/BMP signaling ( Sostdc1 76 , 77 ), and a marker of cell cycle arrest ( Cdkn2a/p21 78 , 79 ) ( Fig. 2G ). GO analysis of the top 40 DEGs from these subclusters revealed that these genes are highly associated with both EMT and apoptosis, cell behaviors we previously reported to mediate prominence fusion 20 , 21 ( Fig. 2H , 2H’). Reclustering of the ZL at E11.5 identified the same 5 subclusters as at E10.5. RNA velocity showed that the ZL population converged into ZL3 and ZL4 at this timepoint, maintaining strong expression of Tgfb2 and Cdkn1a/p21 with reduced Lef1 and Sostdc1 expression. ZL4 was enriched in Isl1 and depleted in Pax3 , both implicated in craniofacial development 80 , 81 (Fig. S2F, G). Compositional analysis indicated a marked decrease in ZL1 and an increase in ZL3 within the ZL from E10.5 to E11.5, highlighting the dynamic evolution of these subpopulations (Fig. S2H). To validate the RNA velocity predictions of neighboring epithelial populations converging into the ZL, we conducted lineage tracing experiments using Cre -recombinase-expressing mouse lines for Pitx2 82 (enriched in OR; Fig2I, left) and Wnt4 83 (enriched in PS; Fig2I, right) crossed with an RFP reporter line 84 . By E10.5, embryos obtained from these crosses displayed distinct RFP+ cells, colocalizing with ZL markers Bmp4 and Cdkn1a/p21 , at the prominence tips ( Fig. 2J ). Taken together, our findings demonstrate that the ZL originates from the adjacent epithelial clusters OR and PS, respectively, is the most differentiated cell cluster, is enriched in genes essential for prominence fusion as well as apoptotic and EMT regulators, and is implicated in cell cycle regulation. The majority of ZL cluster cells are arrested in G0/G1 during facial prominence fusion To elucidate epithelial cell division dynamics at the prominence fusion site, we assigned cell cycle gene expression scores 85 to E9.5 – E11.5 scRNAseq datasets ( Fig. 3A ). At E9.5, prior to ZL emergence, all major cell clusters exhibited G2M/S 86 , 87 phase activity, indicating their proliferative states. At E10.5 and E11.5, in contrast to the adjacent clusters, the ZL showed absence of G2M/S 86 , 87 scoring, suggesting cell cycle arrest. This observation was supported by the ZL exhibiting the lowest S-score among the neighboring clusters at E10.5 ( Fig. 3A ). Confirming these findings in vivo , phosphorylated histone H3 (pHH3) staining, indicative of cells in late-G2/M 88 , was reduced within the ZL versus the adjacent mesenchyme and OF cluster at E10.5 (Fig. S3A). Moreover, bromodeoxyuridine (BrdU) incorporation, which marks DNA synthesis during S 89 , 90 , was not detected in the ZL after a 1-hour labeling period at both E10.5 and E11.5 ( Fig. 3B ; Fig. S3B). Even after a 7-hour chase, BrdU incorporation in ZL cells remained negligible compared to surrounding cells, underscoring the absence of cell cycle progression (Fig. S3C). Transcripts of Mki67 , a marker of active G1/S/G2/M phases that is absent in the quiescent G0 and early G1 phases 91 , were significantly reduced in the ZL at both E10.5 and E11.5 ( Fig. 3C ; left), which was confirmed by decreased KI67 protein levels at E11.5 ( Fig. 3C , right). Additionally, Cdk1 and Aurkb transcripts, associated with G2/M 86 , 87 , 92 , were downregulated in the ZL (Fig. S3D, top left), and significantly reduced in vivo within E10.5 ( Fig. 3D ; Fig. S3E) and E11.5 (Fig. S3F) prominence tips, both adjoining and apart. Other cell cycle-related genes 86 , 87 , 92 , including Anln (M), Pcna (S) , Cdc6 (S) , Cdca8 (G2/M) , Mcm7 (G1/S) , Gins2 (S) , Ccne2 (G1/S) , Ccnd1 (G1/S) , Ccna2 (S/G2) , Ccnb1 (G2/M) , E2f1 (G1/S), and Cdc20 (M), were either absent or downregulated in the ZL cluster at E10.5 (Fig. S3D). The collective downregulation of these genes, coupled with the lack of pHH3 and KI67 staining, along with reduced BrdU incorporation, points to cell cycle arrest in the ZL during prominence fusion. Download figure Open in new tab Fig. 3: The ZL is devoid of cell cycle progression markers, enriched for cell cycle inhibitors, and arrested in G0/G1. (A) Cell cycle phase assignment depicted on UMAP embedding of scRNAseq cell clusters from E9.5–E11.5. Violin plot of scvelo S-phase scoring for ZL and neighboring clusters at E10.5 (t-test * p-value < 0.0001). Black dashed areas indicate ZL cluster boundaries. (B) BrdU incorporation revealed with anti-BrdU antibody (green) after 1 hour chase at E11.5. White dashed lines define epithelium boundaries. Scale bars: 50 µm. (C) NGE overlaid on UMAP shows reduced transcripts for cell proliferation marker Mki67 in E10.5 and E11.5 ZL cluster (left). IF reveals absence of KI67 (pink) from murine ZL at E11.5 (right). Empty arrowheads point to reduced signal in ZL. Scale bars: 50 µm. (D) RNAscope reveals downregulation of Cdk1 (pink) and Aurkb (yellow) from murine ZL at E10.5. Red dashed squares show magnified insets. Empty arrowheads point to absence of signal in ZL cell cluster. Scale bars: 50 µm. Inset scale bars: 20 µm. (E) UMAP of cell cycle arrest gene transcripts ( Cdkn1a/p21 , Gadd45g , and Rb1 ) enriched in the ZL cluster as shown by NGE overlaid on UMAPs (left) and RNAscope validations (middle, right) at E10.5. Red dashed square displays magnified inset with merged signal of Cdkn1a and Gadd45g . Scale bars: 50 µm. (F) Overlap of apoptosis (Cleaved Caspase-3 IF, cCasp3; terminal deoxynucleotidyl transferase dUTP nick end labeling, TUNEL) and cell cycle arrest ( Cdkn1a/p21 , RNAscope) markers, at E10.5. Scale bars: 50 µm. Inset scale bars: 20 µm. (G, G’) Fucci2a mouse system used to selectively label cell cycle phases in the cephalic epithelium (G) , highlights accumulation of ZL cells in G0/G1 at E11.5. IF for cell cycle markers (mCherry, G0/G1; mVenus, S/G2/M) demonstrates enrichment of cells in G0/G1 and absence of cells in S/G2/M within the ZL (G’) . White dashed lines define epithelium boundaries. Presence or absence/reduction of signal is highlighted by full or empty arrowheads, respectively, at the fusion site. Scale bars: 50 µm. Inset scale bars: 20 µm. Bmp4, Cdkn1a, and Bambi expression labels ZL cells across panels. CDH1 protein marks epithelial cells in panels D and F. Cell cycle regulation depends on the synchronized interplay between promoting and inhibitory factors like cyclins and cyclin-dependent kinases 93 , 94 . The absence of cell cycle progression markers in the ZL prompted explorations of cell cycle inhibitors in this population. Our scRNAseq data revealed that Cdkn1a/p21 , encoding a cyclin-dependent kinase inhibitor that inhibits the G1/S and G2/M transitions 78 , 79 , is significantly enriched in the ZL (Fig. S1E). WISH throughout prominence fusion stages visualized Cdkn1a/p21 spatio-temporal expression dynamics (Fig. S4A). Cdkn1a/p21 becomes progressively more restricted from the FNP and prospective BA1 junction at E9.5, to marking the adjoining LNP, MNP, and MxP by E10.5, and to labeling only the fusing prominence tips by E11.25 (Fig. S4A). In parallel, Gadd45g , encoding a GADD45 family protein implicated in cell cycle arrest 95 , exhibits similar expression dynamics (Fig. S4B). NGE overlaid on UMAPs from scRNAseq datasets confirmed restricted expression of Cdkn1a/p21 and Gadd45g in the ZL at E10.5 and E11.5 ( Fig. 3E ; Fig. S4C; top two rows, left). RNAscope corroborated the WISH findings, showing enriched expression of both transcripts at the prominence tips ( Fig. 3E ; Fig. S4C; top two rows, right). Similar expression enrichment in the ZL was confirmed for Rb1 , encoding a transcriptional corepressor that inhibits cell cycle progression 79 , 96 , validated by RNAscope at the prominence tips of E10.5 and E11.5 embryos ( Fig. 3E ; Fig. S4C; bottom row). While detected at negligible levels in the scRNAseq datasets, other cell cycle inhibitor genes, such as Cdkn2a/p16 97 , Cdkn2b/p15 98 , and Cdkn1c/p57 87 , 97 , are also expressed at the prominence tips (Fig. S4D, E). Instead, Cdkn1b/p27 87 , 97 transcripts are present across all λ epithelial populations (Fig. S4D, E). Notably, functional roles of cell cycle inhibitors in the ZL are highlighted by the co-localization of Cdkn1a/p21 transcripts and proteins at the prominence tips (Fig. S4F). Consistent with our previous reports that apoptosis occurs in a subset of epithelial cells at the λ during prominence fusion 20 , 21 , TUNEL staining 99 and IF for cleaved-caspase 3 100 showed that only a subset of Cdkn1a/p21 + ZL cells express apoptotic markers, indicating that not all cell cycle-arrested ZL cells undergo apoptosis at E10.5 ( Fig. 3F ). Collectively, these findings indicate that ZL cells are likely arrested in G0/G1, as demonstrated by lack of proliferative markers and enrichment of cell cycle inhibitors. To orthogonally validate ZL G0/G1 arrest in vivo , we employed the Fucci2a mouse model, which fluorescently labels cells in different cell cycle phases 101 . To specifically mark cephalic epithelial cells, we crossed Fucci2a mice with the Crect-cre line 102 ( Fig. 3G ). E11.5 embryos showed an accumulation of mCherry+ cells (denoting G0/G1) at the prominence tips ( Fig. 3G ’), which was already apparent at E10.5 (Fig. S4G). The presence of mCherry+ cells, which colocalized with the ZL marker Bambi , and the absence/reduction of mVenus+ cells (denoting G2/M) at E11.5 and E10.5 strongly support that the majority of ZL cells are arrested at G0/G1 ( Fig. 3G ’, Fig. S4G). ZL cell cycle arrest is disrupted in different OFC mouse models To examine whether the ZL is perturbed in OFC models, we studied mouse embryos with epithelial-specific LOF of Pbx1 on a Pbx2 -deficient background ( Crect Cre/+ ;Pbx1 f/f ;Pbx2 +/- ; named Pbx1/2 mutants) 20 , 21 , 103 , 104 or with p63 constitutive LOF ( p63 -/- ) 105 . Notably, p63 is expressed only in epithelial tissues, including cephalic epithelia 20 , 106 . Both mutations result in OFC ( Fig. 4A , B) and/or facial dysmorphology in mice and humans 20 , 28 , 29 , 68 , 107 , 108 . scRNAseq analysis of EpCAM+ cells from micro-dissected λ tissue of Pbx1/2 mutant embryos and littermate controls identified 10 cell clusters at E10.5 ( Fig. 4C ). Furthermore, RNA velocity suggested a potential disruption in the vector patterns in the mutant embryos from surrounding epithelial clusters, particularly from PS1, toward the ZL ( Fig. 4D ). Cross-boundary direction correctness 109 , assessing the likelihood of a cell transitioning to a target state based on its current trajectory, pointed to an altered contribution of PS1 to ZL in mutants compared to controls, while OF and OR clusters exhibited similar patterns in both groups ( Fig. 4E ). Given the limitations of scRNAseq in detecting low-abundance transcripts 110 , we also conducted bulk RNAseq of FACS-purified λ epithelium from E11.5 Pbx1/2 mutant and control embryos. Principal component analysis distinctly separated the transcriptomic profiles of mutants from controls ( Fig. 4F ; left), with 718 DEGs identified ( Fig. 4F ; right). As expected, Pbx1 expression was downregulated in mutants. Notably, cell cycle inhibitor genes, such as Cdkn2a/p16 , Cdkn2b/p15 , Gadd45g , Cdkn1c/p57 , and Cdkn1b/p27 , were significantly downregulated in mutants ( Fig. 4F ; bottom). RNA-sieve analysis 111 , which deconvolutes bulk RNA cell samples using scRNAseq expression data, confirmed that the genes significantly dysregulated in mutants were primarily enriched within the ZL, suggesting that perturbation of this epithelial subpopulation is strongly associated with OFC ( Fig. 4G ). Download figure Open in new tab Fig. 4: OFC mouse models with loss of Pbx1/2 exhibit perturbation of the ZL cell cluster and, together with p63 mutants, show dysregulation of cell cycle arrest. (A, B) Gross morphology of E12.5 mouse embryonic midface with epithelial-specific deletion of Pbx1 on a Pbx2 -deficient background ( Crect Cre/+; Pbx1 f/f ;Pbx2 +/- ; hereafter Pbx1/2 mutant) compared to littermate control ( Crect +/+ ;Pbx1 +/+ ;Pbx2 +/- ) (A) and p63 constitutive LOF mutant ( p63 -/- ) (B) . Arrows point to bilateral cleft lip. Scale bar: 500 µm. (C) UMAP of combined scRNAseq clusters from E10.5 control and Pbx1/2 mutant λ epithelium. (D) scRNAseq RNA velocity from micro-dissected λ tissue of E10.5 Pbx1/2 mutant embryos and littermate controls. Epithelial cell clusters comprising OR, OF, PS1/PS2, and ZL highlighted. Insets show boundaries between PS and ZL cluster transitions. (E) Cross-boundary direction correctness of RNA velocity predictions. Asterisk indicates statistical significance (p ≤ 0.05, Kolmogorov-Smirnov test). (F) Principal component analysis (PCA) of bulk RNAseq datasets from sorted λ epithelium of E11.5 Pbx1/2 mutants and controls (n=4; top left). DEGs in Pbx1/2 mutants versus controls highlight cell cycle inhibitor transcripts, including Cdkn2a/p16 , Cdkn2b/p15 , Gadd45g , Cdkn1c/p57 , and Cdkn1b/p27 (top right). These transcripts, enriched in the ZL cluster, are downregulated in Pbx1/2 mutant versus control λ epithelium (heatmap, bottom right). (G) RNAsieve deconvolution of bulk RNAseq expression data using scRNAseq as a reference shows enrichment of top downregulated (left) and upregulated (right) genes in the ZL of Pbx1/2 mutant λ epithelium compared to controls. Heatmap overlaid on scRNAseq of E10.5 wild-type λ epithelium. (H, I) Cell cycle inhibitor gene transcripts, Cdkn2b, Cdkn2a, Cdkn1c, Rb1, and Gadd45g, are reduced/absent in the ZL cluster at the fusion site in OFC mouse models, including Pbx1/2 constitutive loss-of-function (LOF) ( Pbx1 -/- ;Pbx2 +/- ), Pbx1/2 mutants (H) , and p63 constitutive LOF mutants ( p63 -/- ) (I) versus controls ( Pbx1 +/- ;Pbx2 +/- ) (H) , as shown by RNAscope at E10.5. Presence or absence/reduction of signal highlighted by full or empty arrowheads respectively. All scale bars: 50 µm. To validate the predicted gene expression changes in vivo , RNAscope was performed on E10.5 and E11.5 mouse embryos with Pbx1/2 constitutive LOF ( Pbx1 -/- ;Pbx2 +/- ) 20 , 21 , 103 , 104 , as well as conditional Pbx1/2 mutants ( Crect Cre/+ ;Pbx1 f/f ;Pbx2 +/- ) 20 , 21 , and controls ( Pbx1 +/- ;Pbx2 +/- ). The expression of Cdkn2b/p15 , Cdkn2a/p16 , Cdkn1c/p57 , Rb1 , and Gadd45g , enriched in wild-type ZL cells, was markedly reduced or absent at the prominence tips of all mutant embryos compared to controls, suggesting that cell cycle is unleashed in mutant ZL cells ( Fig. 4H ). Similar to prominences that are not touching, adjoining prominences of E11.5 Pbx1/2 mutants also exhibited strikingly decreased expression of cell cycle inhibitors, including Cdkn2a/p16 and Cdkn2b/p15 (Fig. S5A). This finding indicates that cell cycle arrest in the ZL occurs independently of physical contact during midface morphogenesis. Similarly, p63 -/- embryos exhibited marked downregulation of the same cell cycle inhibitor-encoding genes at the prominence tips at E10.5 as Pbx1/2 mutants, pointing to disruption of cell cycle arrest in ZL cells as a general mechanism underlying OFC in two distinct models ( Fig. 4I ). Surprisingly, Cdkn1a/p21 expression was unchanged in either Pbx1/2 or p63 mutants, highlighting the complexity of cell cycle arrest regulation that is driven by inhibitors with overlapping functions 112 (Fig. S5B). Based on expression of cluster-defining makers Bmp4 and Cdkn1a/p21, RNAscope/IF confirmed the presence of a ZL population in Pbx1/2 mutants, characterized by disrupted cell cycle arrest. While PBX1 is absent in the epithelium, as expected, it is still detected in intercalated cells of presumptive olfactory neuronal identity (Fig. S5C). Together, these findings establish that the release of ZL cell cycle arrest in two different OFC models is a critical and likely general mechanism in the pathogenesis of OFC. A cell cycle arrested ZL-like population is present in human embryos: association of ZFHX3 with OFC Given the similarities in early craniofacial morphogenesis between mice and humans 113 and the common genetic etiologies of craniofacial defects, we investigated whether a ZL-like cell cycle-arrested population is present in human embryos during facial prominence fusion. In humans, this process occurs between 5-6 weeks post conception, corresponding to Carnegie stages (CS) 15-17 114 , 115 . In CS16 human embryos, analogous to E10.5 mice 116 , we observed a marked reduction in transcripts and proteins for the cell cycle progression markers CDK1 and KI67, respectively, at the FNP, LNP, and MxP fusion seam, mirroring our findings in the murine ZL cluster ( Fig. 5A , B; Fig. S6A). This reduction coincides with increased expression of the cell cycle inhibitor-encoding genes CDKN1A/P21 and GADD45G , transcripts that defined the ZL cluster in mice ( Fig. 5A , B; Fig. S6A). By CS17, human embryos, akin to E11.5 mice, exhibited similar expression patterns as at CS16, including a reduction of KI67 and CDK1 , along with increased expression of CDKN1A/P21 and GADD45G at the fusion site ( Fig. 5C ; Fig. S6B). These observations highlight striking similarities between mouse and human midface morphogenesis at the morphological, cellular, and molecular level at early gestation, pointing to the involvement of a ZL-like population in human prominence fusion. Download figure Open in new tab Fig. 5: The human embryonic midface comprises an epithelial ‘ZL-like’ cell cycle-arrested population, which is enriched for ZFHX3 , a gene mutated in OFCs. (A) Absence of CDK1 (RNAscope) and KI67 (IF) at the facial prominence fusion site of CS16 human embryos. Increased expression of cell cycle arrest gene CDKN1A/P21 (RNAscope). (A’) Representative high resolution episcopic microscopy (HREM) image of CS16 embryo in lateral (left) and frontal (right) view 160 , 161 . Yellow line denotes plane of section (yellow box). (A’’) CDKN1A/P21 expression domain overlaps with reduced CDK1 and KI67 (magnified inset, blue box). White dashed lines define epithelium boundaries. Presence or absence/reduction of signal highlighted by full or empty arrowheads, respectively. Scale bars: 50 µm. Inset scale bar: 20 µm. (B) Negligible KI67 levels (IF) coincide with domains of high GADD45G expression (RNAscope) at the fusion seam of the three prominences in CS16 embryos. Scale bars: 50 µm. (C) In CS17 human embryos, high GADD45G and CDKN1A/P21 expression overlaps with low KI67 protein at the prominence fusion site. (C’) Representative HREM image of CS17 embryo in frontal view 160 , 161 . Yellow line indicates plane of section (yellow box, scale bar: 200 µm). Blue box shows MNP, LNP and MxP fusion seam. Scale bars: 50 µm. Whole embryo images provided by HDBR Atlas ( https://hdbratlas.org ). (D) Visualization of workflow for data analysis of 759 OFC trios subjected to Whole Genome Sequencing (WGS) and intersected with scRNAseq datasets. (E) Lollipop plot illustrating all rare, predicted damaging ZFHX3 variants exhibited by OFC probands. (F) Bar chart showing significant differences in the percent of probands harboring a rare, predicted damaging ZFHX3 variant in each category analyzed. OFC=orofacial cleft. DS=Down syndrome. gnomAD=genome Aggregation Database (Chi-Squared test). (G) NGE overlaid on UMAP shows strong Zfhx3 enrichment in the E10.5 murine ZL cluster (black dashed area; left). In mouse (E10.5) and human (CS16) midfacial sections, Zfhx3/ZFHX3 is highly expressed (RNAscope) in the λ epithelium. Arrowheads highlight prominence tips/fusion site. Scale bars: 50 µm. (H) Gross morphology of E12.5 mouse embryonic midface with Zfhx3 epithelial-specific deletion ( Crect Cre/+ ;Zfhx3 f/f ) compared to littermate control ( Crect +/+ ;Zfhx3 f/+ ). Arrows point to bilateral cleft lip. Scale bar: 500 µm. To investigate potential associations between genes enriched in the murine ZL cluster and gene variants linked to human OFC, we intersected our scRNAseq dataset from murine λ epithelium with datasets of whole genome sequencing (WGS) from 759 OFC case-parent trios 117 ( Fig. 5D ). Our analyses included both inherited rare variants and de novo variants (MAF 0.9 and LOEUF < 0.35) from the ZL cluster with high pathogenicity prediction scores (SIFT 20). As expected, we found qualifying variants in several genes associated with OFCs, such as BMP4 59 (N=14) and TP63 108 (N=9) (Fig. S6C; Supplemental Table 1). Interestingly, the highest number of variants was found in Zinc-finger homeobox 3 ( ZFHX3 or ATBF1 ; N=42), including one truncating de novo variant ( Fig. 5E ; Fig. S6C). ZFHX3, encoding a transcription factor associated with neuronal 118 , 119 and cardiac 120 function, has been implicated in the control of cell cycle arrest and transactivation of p21 35 – 37 . In humans, previous work highlighted ZFHX3 as a candidate risk gene for OFC 121 , and its variants were linked to a neurodevelopmental disorder occasionally accompanied by cleft palate 119 . However, a causative role for ZFHX3 in OFC pathogenesis remained unexplored. ZFHX3/Zfhx3 is required for facial prominence fusion in mammals As ZFHX3 encodes a large protein comprising 3703 amino acids, we used additional cohorts to determine whether the large number of variants was a function of its size, or if it had biological relevance. We thus compared the percent of OFC probands (N=759) with ZFHX3 variants to trisomy 21 (T21) probands 122 (N=1844), and to individuals in gnomAD v.4.1.0 123 , in order to test if mutation burden was higher for OFCs. We found a statistically significant difference between all three groups, where OFC probands carried the highest burden of variants ( Fig. 5F ) at 13.0% compared to 9.8% in T21 and 5.3% in gnomAD. Given this evidence supporting roles of ZFHX3 in OFC etiology, we further investigated its function in mouse embryos. Zfhx3 was enriched in the ZL cluster at both E10.5 and E11.5 ( Fig. 5G , left; Fig. S6D, right). Interestingly, Zfhx3 enrichment was already present at E9.5, before the emergence of the ZL (Fig. S6D; left), at the converging point of the RNA velocity trajectories (see Fig. 2D ; Fig. S2E). RNAscope confirmed Zfhx3/ZFHX3 expression in the λ epithelium during prominence fusion in both E10.5/E11.5 mouse and CS16 human embryos ( Fig. 5G right; Fig. S6E). Notably, Zfhx3 displayed significant enrichment in the ZL terminal endpoints ZL3 and ZL4 at both E10.5 and E11.5, suggesting potential roles in mediating ZL cell dynamics (Fig. S6F). To unequivocally assess the requirement of epithelial Zfhx3 in prominence fusion, we generated mouse embryos with epithelial-specific Zfhx3 deletion 124 ( Crect Cre/+ ;Zfhx3 f/f ; named Zfhx3 mutants). By E12.5, post prominence fusion, 7 out of 10 homozygous Zfhx3 mutants (70%) exhibited OFC, in contrast to their non-cleft heterozygous and littermate controls ( Fig. 5H ; Fig. S6G). Overall, our findings reveal a ZL-like cell population in humans, sharing transcriptomic signatures in spatial domains overlapping with the murine ZL during prominence fusion. Human ZFHX3 , identified by WGS as the gene with the highest number of de novo variants in OFC patients, is enriched in the murine ZL and human λ epithelium. Lastly, epithelial-specific Zfhx3 loss in the mouse results in embryonic OFC, establishing its requirement in ZL for mammalian facial prominence fusion. ZFHX3 and PBX1 synergistically regulate cell cycle arrest during prominence fusion Our findings above, coupled with previously reported roles of ZFHX3 in mediating cell cycle inhibition, make this transcription factor an ideal candidate to drive facial prominence fusion by regulating cell cycle arrest. To investigate this possibility, we performed chromatin immunoprecipitation and sequencing (ChIPseq) 125 for ZFHX3 on E11.5 whole murine λ tissue. ChIPseq analysis identified ZFHX3 binding at promoters of key cell cycle arrest genes that are significantly enriched in the ZL during prominence fusion, including Rb1 and Cdkn1c/p57 , as well as a putative Cdkn2a/p16 regulatory region ( Fig. 6A ; Fig. S7A). Additionally, ZFHX3 was found to bind its own promoter, a feature common among transcription factors 125 – 127 (Fig. S7A). ZFHX3-bound regions were also marked by H3K27ac in the λ epithelium (our dataset) and p300 peaks (GSM1199037; dataset from Attanasio et al. 2013 128 ), indicative of active enhancers and promoters 129 , 130 , and corresponded to open chromatin regions, as shown by ATACseq 131 (GSE199339; dataset from Van Otterloo et al. 2022 24 ). All datasets were obtained from mouse embryonic tissues: ATACseq on E11.5 cephalic surface ectoderm 24 ; p300 ChIPseq on E11.5 craniofacial tissue 128 ; and our H3K27ac ChIPseq on E11.5 murine λ epithelium. Given the role of epithelial PBX in murine facial prominence fusion 20 , 21 and the altered expression of cell cycle gene in Pbx1/2 mutant murine ZL, we also performed PBX1 ChIPseq on purified E11.5 murine λ epithelium. These experiments revealed overlapping binding of PBX1 and ZFHX3 at Rb1 and Cdkn1c/p57 promoters, as well as at a Cdkn2a/p16 adjacent non-coding region ( Fig. 6A ; Fig. S7A). Notably, the transcripts for all above genes were significantly downregulated in Pbx1/2 mutant ZL (see Fig. 4F , H). ZFHX3 also bound both the Pbx1 and Pbx3 promoters, while PBX1 did not bind the Zfhx3 promoter, suggesting a potential regulatory hierarchy whereby ZFHX3 may direct Pbx gene transcription ( Fig. 6A ; Fig. S7A). Analysis of the putative regulatory elements interacting with these transcription factors showed that PBX1 and ZFHX3 predominantly associated with distal elements when bound independently, with 11,915 peaks and 31,391 peaks, respectively. However, regions co-bound by both PBX1 and ZFHX3 (403 peaks) are primarily associated with promoters, indicating selective co-regulation ( Fig. 6B ). Genomic Regions Enrichment Annotation (GREAT) 132 analysis revealed that these co-bound sites were linked to cell cycle genes, such as cyclin-dependent kinase regulators, and associated with phenotypes related to cellular senescence, a permanent cell cycle arrested state 133 , 134 ( Fig. 6C ). This association was not evident in regions bound solely by either ZFHX3 or PBX1. PBX1 bound-sites were linked to developmental processes including stem cell maintenance and olfactory placode morphogenesis, while ZFHX3 bound-sites were primarily associated with epigenetic regulation ( Fig. 6D ). To ensure robustness in our ChIPseq analysis, only peaks reproducibly detected in at least two replicates were included. De novo motif enrichment analysis using HOMER 135 confirmed that several of the top ZFHX3 motifs comprised AT-rich sequences, including a motif closely resembling the previously published ZFHX3 consensus 118 , 120 (TATTTAATAAT) ( Fig. 6E ). Known motif analysis for PBX1 primarily identified binding sites for PBX family members or co-factors ( Fig. 6F ). Functional validation of PBX1– and ZFHX3-bound regions was performed using luciferase reporter assays in HEK293 cells 20 , 21 , 28 , 136 . Co-transfection of cells with expression constructs for both PBX1 and ZFHX3 significantly increased transactivation of the reporter at the Rb1 , Cdkn1c/p57, and Pbx3 promoters, compared to transactivation by empty vector, PBX1 alone, or ZFHX3 alone, indicating strong synergistic effects of the two factors on transcriptional regulation ( Fig. 6G ). Download figure Open in new tab Fig. 6: ZFHX3 and PBX1 co-regulate cell cycle arrest genes in the λ epithelium. (A) IGV genome browser tracks depicting the Rb1 , Cdkn1c/p57 and Pbx3 loci. ChIPseq tracks: H3K27ac, red; p300 (GSM1199037), pink; PBX1 and ZFHX3, green and blue, respectively. ATACseq track (GSE199339), maroon. Gray bars highlight predicted cis-regulatory elements (CREs) bound by PBX1 and ZFHX3. (B) Fractions of PBX1-only, ZFHX3-only, and PBX1-ZFHX3 co-bound peaks (Both) relative to intergenic, intragenic, or gene promoter regions. (C) Top enriched molecular functions (top) and mouse phenotypes (bottom) associated with PBX1-ZFHX3 co-bound peaks. X-axes show the −log10 of uncorrected p-values. Asterisks highlight categories linked to cell cycle arrest. p-values from Binomial Tests. (D) Top enriched biological processes associated with PBX1 (left) and ZFHX3 (right) peaks, with x-axes displaying the –log10 of uncorrected p-values. Asterisks emphasize biological processes related to prominence fusion for PBX1 and epigenetic regulation for ZFHX3. p-values derived from Binomial Tests. (E) Top motifs identified by HOMER de novo motif enrichment analysis of ZFHX3-bound genomic regions, with p-values and log p-values shown. Asterisk indicates the motif closely resembling the published consensus ZFHX3 binding motif. (F) Known motifs identified by HOMER in genomic regions bound by PBX1; p-values and log p-values displayed. Asterisks denote motifs associated with PBX family members or PBX co-factors. (G) Normalized luciferase activity from transient transfections of HEK293T cells with promoter fragments of Rb1 , Cdkn1c/p57 , or Pbx3 linked to a luciferase reporter and co-transfected with either empty vector or expression constructs for ZFHX3 alone, PBX1 alone, or ZFHX3+PBX1. Transactivation normalized relative to the empty vector control and depicted as fold increase. *p < 0.05, **p < 0.01, ***p < 0.001, T-test for paired comparisons. Black dots represent each biological replicate. A ZFHX3-PBX1 protein complex at the λ mediates facial prominence fusion in mammals Co-immunoprecipitation of PBX1 with ZFHX3 protein from E10.5 and E11.5 murine λ tissue confirmed the association of PBX1 and ZFHX3 proteins during prominence fusion ( Fig. 7A ). To genetically dissect the developmental impact of the PBX1-ZFHX3 complex on facial prominence fusion, using the CrectCre deleter we generated compound mutant embryos in the cephalic epithelium that lacked 1) both alleles of Pbx1 and one allele of Zfhx3, as well as 2) one allele each for Pbx1 , Pbx2 , and Zfhx3 ( Fig. 7B ). Wild-type morphology was observed in embryos with epithelial-specific homozygous loss of Pbx1 or constitutive loss of Pbx2 alone, as well as in embryos heterozygous for both Pbx1 and Pbx2 as we previously reported 20 , 21 , 103 and in embryos with Zfhx3 epithelial-specific heterozygous loss (see Fig. S6G). In contrast, OFC was detected in compound mutants lacking both copies of Pbx1 and one copy of Zfhx3 in the cephalic epithelium ( Crect Cre/+ ;Pbx1 f/f ;Zfhx3 f/+ ; 1 out of 3 embryos). Further, deleting one allele each for Pbx1, Pbx2, and Zfhx3 in the cephalic epithelium also led to OFC ( Crect Cre/+ ;Pbx1 f/+ ;Pbx2 +/- ;Zfhx3 f/+ ; 1 out of 1 embryo) ( Fig. 7B ). These experiments reveal a genetic interaction of Pbx1-Zfhx3 in facial prominence fusion. Together, our findings establish a coordinated genetic and regulatory interaction of PBX1 and ZFHX3, primarily at promoters and cis-regulatory modules of genes encoding cell cycle inhibitors. The PBX1-ZFHX3 complex comprises part of a gene regulatory network essential for cell cycle arrest at the ZL epithelial cluster during prominence fusion and midfacial morphogenesis. Download figure Open in new tab Fig. 7: A ZFHX3-PBX1 protein complex at the λ mediates facial prominence fusion in mammals. (A) Immunoprecipitation of a PBX1-ZFHX3 protein complex in dissected murine λ tissues at E10.5 (left) and E11.5 (right) using ZFHX3 antibody (n=2 biological replicates). IgG used as negative control. kDa, kilodalton. PBX1a, PBX1b, ZFHX3a, and ZFHX3b are known protein isoforms 27 , 125 , 162 . (B) Gross morphology of E12.5 mouse embryonic midface with homozygous Pbx1 and heterozygous Zfhx3 epithelial-specific deletion ( Crect Cre/+ ;Pbx1 f/f ;Zfhx3 f/+ ) or triple heterozygous deletion of Pbx1 , Pbx2 , and Zfhx3 ( Crect Cre/+ ;Pbx1 f/+ ;Pbx2 +/- ;Zfhx3 f/+ ) compared to littermate control ( Crect Cre/+ ;Pbx1 f/+ ;Zfhx3 f/+ ). Arrows point to cleft lip. Scale bar: 500 µm. (C) Model: a PBX-ZFHX3 complex directly regulates expression of cell cycle inhibitors, specifically Cdkn1c/p57 and Rb1 , in the ZL cell cluster of the developing midface. Disruption of this complex due to genetic mutations of Pbx1/2 or Zfhx3 results in OFC in mice. In humans, similar disruption of this complex due to PBX1 mutations 28 , 29 or ZFHX3 mutations 119 , 121 results in facial abnormalities and OFC. Discussion Fusion of the craniofacial prominences shapes the human face, which identifies us. Failure of this process leads to OFC, the most common craniofacial birth defect 25 . While most studies of craniofacial development have focused on NC-derived mesenchyme 10 – 19 , the cephalic epithelium was also recognized as a critical population for proper morphogenesis and fusion of the prominences 20 – 24 , 137 . Previous scRNAseq of the entire murine λ tissue, comprising the mesenchyme, epithelium, and periderm, analyzed primarily the larger mesenchymal population 22 , 137 . By sorting λ epithelial cells, we identified a new cephalic epithelial cell cluster, that we named ZL, located at the λ prominence tips where fusion occurs. The ZL emerged as a distinct and temporally-regulated population with unique spatial location and specific transcriptomic signatures. Lineage tracing experiments provided in vivo validations and confirmed the RNA velocity predictions establishing that neighboring epithelial cell clusters converge onto the ZL. Lack of G2M/S gene expression, accompanied by enrichment of cell cycle inhibitors, along with the use of Fucci2a mice, demonstrated that ZL cells are arrested in G0/G1. Notably, cell cycle regulation has been implicated in the development and disease of many tissues and species, relying on the synchronized interplay between factors promoting and inhibiting cell cycle progression 93 , 94 . Interestingly, a population enriched for Tgfb2 , as well as the cell cycle inhibitors Cdkn1c/p57 and Cdkn2a/p16 , was previously identified at the prominence fusion seam 22 but was not characterized. While only a subset of the cell cycle-arrested ZL cells undergo apoptosis at E10.5, we cannot exclude that additional cells may become apoptotic at later stages. Alternatively, these cells could transition to other cellular states such as EMT, cell extrusion, senescence, or differentiation 20 , 21 , 30 , 31 , 72 , 134 , 138 , some of which have been previously linked to primary and secondary palate fusion 20 , 21 , 30 , 31 . Indeed, cell cycle arrest can precede apoptosis or senescence, both transiently implicated in tissue remodeling during embryogenesis 139 , 140 . Consistent with this idea, cell cycle arrest markers, including Cdkn1a/p21, Cdkn1c/p57 , Cdkn2b/p15, Cdkn2a/p16 , and Rb1 , are involved in both processes 140 – 143 . Further investigations will be needed to elucidate the temporal transition between cell cycle arrest and ensuing cellular behaviors. Intriguingly, in cancer, which is often characterized by uncontrolled proliferation and failure of apoptosis, cell cycle arrest promotes behaviors including extracellular matrix degradation, migration, and invasion 144 – 149 . Furthermore, in Drosophila and Xenopus , cell cycle inhibition is required for neurulation, gastrulation, and organ formation 150 – 153 . Here, we uncover a novel mechanism whereby cell cycle arrest mediates facial prominence and primary palate fusion in mammals, potentially representing a general process underlying diverse developmental tissue fusion events in different species. Significant downregulation of cell cycle inhibitor genes in the ZL of embryos from two different genetic OFC mouse models also strengthens the notion that disruption of cell cycle arrest is likely a general mechanism underlying failure of facial prominence fusion to give rise to this congenital disorder. The intersection of our murine scRNAseq datasets and human WGS of OFCs, identified a novel transcription factor-encoding gene enriched in the ZL, ZFHX3 . Notably, ZFHX3, which is highly mutated in OFC patients, was previously implicated in Cdkn1a/p21 transactivation 35 – 37 , reinforcing the importance of ZL cell cycle arrest in the etiology of OFC. The presence of OFC in mice with cephalic epithelial-specific Zfhx3 loss validates its essential role in mammalian facial prominence fusion. Despite their widespread presence and genome-wide binding, PBX1-ZFHX3 co-binding to a subset of ZL-enriched cell cycle arrest genes highlights their combined requirement in cell cycle regulation during prominence fusion. The appearance of OFC in mutant embryos with compound loss of Pbx family members on a Zfhx3 heterozygous background further establishes genetic interaction between these genes at the organismal level. Lastly, transactivation of select cell cycle target gene promoters elicited by PBX1-ZFHX3 co-expression in luciferase assays points to their synergistic regulation of cell cycle, confirmed by the finding that the two proteins form a complex within murine λ tissues. The presence of PBX1-ZFHX3 complexes may partly explain their selective co-binding to cell cycle regulator genes, restricting their otherwise promiscuous binding behavior 125 . Additional, yet unknown, transcription factors may act as co-factors, further enhancing restricted DNA binding and conferring tissue specificity 154 . Multiple atlases have described genomic landscapes, gene networks, and single-cell transcriptomes of human embryonic tissues and organs 155 – 159 . However, the links between distinct cell populations, their gene transcripts and behaviors, as well as their in vivo functions, in human morphogenesis have remained largely unexplored. Our discovery of a ZL-like epithelial population arrested in the cell cycle in human facial prominences, expressing the same cell cycle regulators as in mice, demonstrates that fusion of the prominences and primary palate share evolutionarily conserved morphogenetic processes and transcriptional mechanisms in mice and humans. Our model proposes that the ZL, a novel, temporally regulated, cell cycle-arrested cephalic epithelial subpopulation is essential for facial prominence fusion in mice and humans and is compromised in craniofacial disorders. Furthermore, ZL-enriched ZFHX3 forms a complex with PBX1 to regulate expression of key cell cycle arrest genes during prominence fusion ( Fig. 7C ). Together, our studies establish a pivotal role for the ZL epithelial cell cluster in shaping the mammalian face and connect cell cycle arrest to developmental tissue fusion. Author Contributions L.S. designed and supervised the study; T.Q. conducted lineage tracing and BrdU incorporation experiments, characterization of p63 mutant mice, ChIPseq assays and bioinformatic analysis, and generated Zfhx3 conditional mutant mice; B.C. performed characterization of epithelial cell populations by RNAscope, WISH, and IF on wild-type and Pbx1/2 mutant embryos, GO analyses, and liaised with collaborators; L.F. and I.A. performed bioinformatic analysis of sc and bulk RNAseq and contributed critical ideas on cell cycle arrest and cell trajectories; M.L. initiated the project, designed the strategy as well as conducted all scRNAseq and bulk RNAseq of cephalic epithelium on wild-type and Pbx1/2 mutant embryos and supervised B.C.; R.H-M. conducted experiments on Fucci2a mouse embryos, RNAscope and IF assays on wild-type and Pbx1/2 mutants, genetic interaction experiments between Pbx1, Pbx2 and Zfhx3 , Co-IP, and luciferase assays; K.R. and E.L. intersected scRNAseq data from the current study with WGS datasets from human OFC patients and identified ZFHX3 as a gene enriched in the ZL carrying a high number of variants in OFC patients; A.J. and S.L. conducted RNAscope and IF experiments on human embryos; J.D-A. assisted with RNAscope, IF assays, and mouse colony maintenance; M.L., M.R. and G.P. provided substantial technical guidance and critical intellectual input; B.C. assembled initial version of figures 1-5 . T.Q. revised the initial figures including additional panels and composed figures 6 - 7 . L.F. contributed multiple figure panels supporting the bioinformatic analyses. B.C. drafted preliminary parts of Results section. T.Q., R.H-M., and L.S. wrote the manuscript, then critically reviewed by all co-authors. Supplementary Figure Legends Fig. S1: Further characterization of cell clusters identified by scRNAseq from E9.5 – E11.5. (A) FACS gating strategy to isolate live EPCAM+ epithelial population from microdissected and dissociated midface λ tissue. Cell viability determined via selection of DAPI-cells (blue box, left). DAPI-EpCAM+ cells (green box, right) averaged 6%-10% of sorted λ tissue depending on tissue stage. (B) Normalized Gene Expression (NGE) of Epcam overlaid on UMAP for combined E9.5-E11.5 datasets. Clusters expressing Epcam (black dashed border) were further analyzed. (C) Relative proportion of clusters by gestational day. Clusters highly expressing Epcam are boxed in red. (D) Distinct embryonic timepoints displayed on combined UMAP from E9.5-E11.5 datasets. (E) Dot plot showing expression of the top 4 differentially expressed genes (DEGs) defining individual clusters. Dot sizes represent the proportion of cells within a given population expressing the target gene; color intensities indicate average expression levels. Five broad cluster categories were defined based on cell type-defining gene expression and/or spatial validation. (F) RNAscope validation of the ND, PD, and EE cell clusters. For ND and PD clusters, NGE heatmaps (left) are overlaid on combined UMAP from E9.5-E11.5 datasets. As the EE cluster is primarily found at E9.5 NGE heatmaps (left, bottom) are overlaid on the corresponding E9.5 UMAP. Cluster defining genes were validated by RNAscope at E11.5 for ND/PD, and at E9.5 for EE (magnified inset for Aldh1a3 expression in ND, red dashed box). Scale bars: 100 (ND, PD) and 50 (EE) µm, respectively. Inset scale bar: 20 µm. e, eye; OV, optical vesicle; BA1, branchial arch 1; MxP, maxillary prominence. White arrows point to gene expression. Fig. S2: Additional molecular characterization and bioinformatic predictions for cell trajectories of ZL epithelial cell cluster. (A) Heatmap of Bmp4 NGE overlaid on UMAP for E11.5 wild-type λ epithelium showing Bmp4 expression beyond the ZL boundaries (black dashed area, left). RNAscope confirms expanded Bmp4 expression beyond the ZL by E11.5 (center). Scale bar: 50 µm. WISH reveals extensive Bmp4 expression throughout the midface (right). Scale bar: 1 mm. (B) Heatmaps of additional key DEGs (enriched Bambi, Igfbp5 in red; absent Top2a in blue) overlaid on UMAPs in the E10.5 ZL cluster. (C) RNAscope shows strong expression of ZL marker genes Bambi and Igfbp5 at the prominence fusion site in both E10.5 coronal and transverse sections. The mitotic division marker Top2a is depleted at the ZL. Presence or absence/reduction of signal is highlighted by full or empty arrowheads, respectively, at the prominence tips or fusion site. Scale bars: 50 µm. (D) RNA velocity analysis of E11.5 scRNAseq datasets. (E) CytoTRACE analysis of combined E9.5-E11.5 scRNAseq datasets. (F) Further analysis of E11.5 ZL cluster (black highlighted area, left) reveals 5 subclusters (ZL0-4). RNA velocity analysis indicates two terminal endpoints (green stars) in ZL3 and ZL4 (center). Terminal differentiation states are visualized in a heatmap overlay on UMAP (right). (G) Select DEGs in E11.5 ZL subclusters shows high expression of Tgfb2 , Cdkn1a/p21 , and Isl1 in terminal states (top), with notable absence of Lef1 , Sostdc1 , and Pax3 in these states (bottom). (H) Changes in ZL subcluster proportions between E10.5 and E11.5. Fig. S3: Reduction/absence of additional cell cycle progression gene transcripts in ZL epithelial cell cluster. (A) Immunofluorescence (IF) staining for phosphorylated Histone H3 (pHH3) and RNAscope for Fgf9 at E10.5. White dashed lines define epithelium boundaries. Scale bars: 50 µm. (B,C) IF for BrdU shows a lack of BrdU incorporation at the E10.5 fusion site at both 1-hour (B) and 7-hour (C) BrdU chase. Scale bars: 50 µm. (D) Heatmaps of NGE of additional cell cycle genes overlaid on E10.5 UMAPs show reduced expression at the ZL (black dashed area). (E, F) RNAscope of Cdk1 (E, F) and Aurkb (E) in domains of high Bambi expression at E10.5 (E) and E11.5 (F) . Absence/reduction of signal highlighted by empty arrowheads at the prominence tips or fusion site. Red dashed squares show magnified insets (right). White dashed lines define epithelium boundaries. Bambi expression labels the ZL cells. Scale bar: 50µm. Inset scale bars: 20µm. Fig. S4: Further characterization of cell cycle arrest in ZL epithelial cell cluster. (A, B) WISH of cell cycle arrest gene transcripts. Cdkn1a/p21 (A) and Gadd45g (B) expression from E9.5 – E11.5. Images shown in sagittal (E9.5 – E10.25) and frontal views (E10.5 – E11.5). Scale bars: 200 µm. Sections of E10.25 and E11.5 WISH embryos (right) highlight localized gene expression at the prominence fusion site. Scale bars: 50 µm. Arrows indicate domains of high expression within the λ. (C) UMAP of transcripts for cell cycle arrest genes ( Cdkn1a/p21 , Gadd45g , and Rb1 ) are enriched in the ZL cluster as shown by NGE overlaid on UMAPs (left) and RNAscope validations (middle, right) at E11.5. Scale bars: 50 µm. (D) NGE of cell cycle inhibitor genes overlaid on E10.5 λ epithelial cluster UMAPs reveal negligible expression of Cdkn2a/p16 and Cdkn2b/p15 , in addition to minimal levels of Cdkn1c/p57 , across clusters. Cdkn1b/p27 shows consistent expression throughout all clusters. Black dashed area highlights ZL cluster. (E) RNAscope reveals localized expression of Cdkn2a/p16 and Cdkn2b/p15 at the prominence fusion site of E10.5 mouse embryo, with clear overlap indicated within magnified insets (red dashed squares). Cdkn1c/p57 is also expressed at the fusion site. Cdkn1b/p27 is expressed throughout the midface. Arrowheads point to gene expression. Scale bars: 50µm. Inset scale bar: 20µm. (F) Co-localization of p21 protein, detected by IF, and Cdkn1a gene transcript (encoding p21), revealed by RNAscope, at the λ fusion site at E10.5. Red dashed square shows magnified inset. Arrowheads highlight co-localized signal. Dashed lines define epithelium boundary in all panels. Scale bars: 50 µm. Inset scale bars: 20 µm. (G) Fucci2a mouse system adapted to selectively label cell cycle phases in the mouse cephalic epithelium in vivo . IF for cell cycle defining markers (mCherry, G0/G1; mVenus, S/G2/M) demonstrates an enrichment of G0/G1 phase and an absence of S/G2/M phase cells within the ZL population at E10.5. IF for CDH1 marks epithelial cells and RNAscope for Bambi expression marks ZL cells. White dashed lines define epithelium boundaries. Presence or absence/reduction of signal highlighted by full or empty arrowheads, respectively. Scale bars: 50 µm. Inset scale bar: 20 µm. Fig. S5: Downregulation of select cell cycle arrest markers within the ZL in a mouse model of OFC. (A) RNAscope shows significant reduction of Cdkn2a/p16 and Cdkn2b/p15 expression at the prominence tips in E11.5 Pbx1/2 mutant (right) vs control (left) embryos. Presence or absence/reduction of signal highlighted by full or empty arrowheads, respectively, at the prominence tips. White dashed lines define epithelium boundaries. All scale bars = 50µm. (B) RNAscope of E10.5 mouse embryos showing Cdkn1a/p21 expression in Pbx1/2 constitutive LOF ( Pbx1 -/- ;Pbx2 +/- ); Pbx1/2 mutant; p63 constitutive LOF; and control ( Pbx1 +/- ;Pbx2 +/- ) prominence tips. (C) IF demonstrates the absence of PBX1 protein in the λ epithelium of E10.5 Pbx1/2 mutant (right), with persisting expression in presumptive olfactory neurons embedded within the epithelium. RNAscope reveals expression of Cdkn1a/p21 and Bmp4 at the prominence tips in both control (left) and Pbx1/2 mutant (right) embryos. Fig. S6: Zfhx3/ZFHX3 is enriched in the ZL epithelium of mouse and human embryos and ZFHX3 carries numerous variants in OFC patients. (A) Transverse section of midface showing λ (blue box) of CS16 human embryo. Scale bar: 100 µm. RNAscope shows enriched expression of GADD45G (orange) at the prominence fusion site of CS16 human embryo, while IF reveals striking reduction of KI67 (blue). Scale bar: 50 µm. Magnified inset (red box) further reinforces that the GADD45G expression domain overlaps with reduced KI67. Inset scale bar: 20 µm. Presence or absence/reduction of signal highlighted by full or empty arrowheads, respectively, at the prominence tips or fusion site. White dashed lines define epithelium boundaries. (B) Representative HREM image of human CS17 embryo in lateral view 160 , 161 . RNAscope at CS17 reveals the absence of CDK1 expression at the prominence fusion site. Scale bar: 50 µm. (C) Table listing the top 13 genes within the ZL cluster exhibiting the highest number of de novo variants along with observed variant types. (D) NGE overlaid on UMAPs highlights strong enrichment of murine Zfhx3 in a subset of cells at E9.5 (left), prior to the emergence of ZL, and within the ZL cluster (black dashed area) at E11.5 (right). (E) RNAscope on sections from mouse (E11.5) and human (CS16) embryos shows that Zfhx3/ZFHX3 is highly expressed in the λ epithelium. Scale bar: 50µm. (F) NGE of murine Zfhx3 overlaid on UMAPs of ZL subclusters analyzed by RNA velocity highlights its enrichment in terminal endpoints (yellow stars) at E10.5 (left) and E11.5 (right). Violin plot of normalized Zfhx3 expression across individual subclusters at these stages is also included for each time point. (G) Gross morphology of E12.5 mouse embryonic midface with epithelial-specific heterozygous deletion of Zfhx3 ( Crect Cre/+ ;Zfhx3 f/+ ). Scale bar: 500 µm. Fig. S7: Further characterization of ZFHX3-PBX1 collaborative DNA binding during prominence fusion. (A) IGV genome browser tracks showing the Zfhx3 , Cdkn2a/p16 and Pbx1 loci. ChIPseq tracks: H3K27ac, red; p300 (GSM1199037), pink; PBX1 and ZFHX3, green and blue, respectively. ATACseq track (GSE199339), maroon. Gray bars highlight predicted cis-regulatory elements (CREs) bound by PBX1 and ZFHX3. View this table: View inline View popup Supplemental Table 1: All rare, predicted pathogenic variants in constrained genes from the ZL Materials and Methods Ethics statement and approval of animal research All animal experiments adhered to national laws and received approval from local regulatory bodies and the Institutional Animal Care and Use Committees (IACUC) at UCSF. IACUC guidelines covered aspects of housing, husbandry, and welfare for experiments involving mice and embryos. Generation of mouse embryos Mouse embryos were generated using previously described mutant alleles and genotyping methods for conditional and constitutive alleles of Zfhx3 1 , Pbx1 2 – 4 , Pbx2 5 , 6 , p63 7 , 8 , and transgenes such as CrectCre 9 , Pitx2Cre 10 , Wnt4Cre 11 , Ai14(RCL-tdT)-D 12 , and Fucci2a 13 . In Fucci2a mice, G0/G1 phase cells are marked by mCherry-hCdt1, which accumulates during G1 and is degraded at the transition to S. Cells in S/G2/M are labeled by mVenus-hGem, which builds up during the S/G2/M phases and rapidly degrades before cytokinesis. Wild-type (WT) Swiss Webster mice over 6 weeks of age, sourced from Charles River Laboratories, were bred via natural timed mating to generate WT embryos. Following euthanasia of the pregnant females, embryos were collected between gestational days E9.5 to E12.5, with E0.5 defined as noon on the day a vaginal plug was detected. Mouse embryonic stages are indicated in figures and/or figure legends. Genotyping of mice and embryos was performed before proceeding with all the analyses and experiments. Both male and female embryos were analyzed without sex discrimination, as the observed phenotypes in Pbx1/2 and p63 mutants are fully penetrant across all specimens. Human Embryos Human embryonic tissues were obtained from the Human Developmental Biology Resource (HDBR) following voluntary pregnancy terminations, with written informed consent from each donor. This study received ethical approval from the Newcastle and North Tyneside 1 National Health Service (NHS) Health Authority Joint Ethics Committee (approval number: 08/H0906/21+5). Human embryo samples at CS16 and CS17 (n=2 for each stage) were fixed with 4% paraformaldehyde (PFA) and then embedded in paraffin. Antigen retrieval was performed according to the manufacturer’s guidelines for the RNAscope Multiplex Fluorescent Reagent Kit v2 (Advanced Cell Diagnostics) 14 . Subsequent incubation and detection steps followed the RNAscope probe manufacturer’s manual. Immediately after completing the RNAscope Multiplex assay, immunofluorescence was conducted using immunohistochemistry (IHC) methods recommended by ACD Bio-Techne. Gross Morphology Mouse embryos were fixed in 4% PFA at 4°C overnight, dehydrated using a methanol/PBS gradient up to 100% methanol, and stored at –20°C. For bleaching, embryos were treated with Dent’s bleach (4:1:1 Methanol:DMSO:Hydrogen peroxide) for 2 hours in the dark at room temperature, followed by a 15-minute rinse in 100% methanol. Embryos were then rehydrated through a decreasing methanol/PBT series ending in PBT (0.1% Triton in 1X PBS). Embryos were stained with DAPI (1:20000) overnight at 4°C. Cell Isolation and Fluorescence Activated Cell Sorting Mouse embryonic litters were dissected in ice-cold PBS, collected and staged based on somite count and limb morphology on designated days of development. Number of embryos used for these experiments are listed in the “Statistics and data reproducibility” section below. At E9.5, embryonic faces were isolated from the heads by dissecting the frontonasal and maxillary prominences, carefully avoiding the forebrain and developing eye placode. At E10.5 and E11.5, entire midfaces were dissected to include the MNP, LNP, and MxP, while avoiding eye and brain tissues. The lambdoidal junction was specifically isolated using surgical scalpels to dissect the upper halves of the LNP and MNP at the horizontal midline of the nasal pits, and the lower half of the MxP at the horizontal midpoint, ensuring the lambdoidal junction remained intact without separating the individual prominences. Swiss Webster WT embryos were pooled before dissociation into single cell suspensions for scRNAseq analysis. Dissected tissue samples were incubated in a fresh cocktail of 1X Liberase TL (Roche cat: 05401020001) and 1X DNAseI Grade II (Roche cat: 10104159001) at 37°C without agitation for 10-13 minutes, with gentle pipetting every 5 minutes to facilitate tissue breakdown. The enzymatic reaction was stopped with ice-cold PBS, and cells were then centrifuged at 300 RCF for 10 minutes and resuspended in ice-cold cell staining buffer (0.5% Bovine Serum Albumin, 2mM EDTA in PBS). Cells were stained with 1.25μL of anti-EpCAM-APC (Invitrogen cat: 17-5791-82) antibody for 15 minutes at 4°C in the dark, followed by centrifugation and resuspension in FACS buffer (5% FBS, 5mM EDTA in PBS). To identify dead cells, DAPI was added to the cell suspension at a 1:1000 ratio. Cells were kept on ice and sorted using a Sony SH800S sorter, with gating strategies employed to exclude doublets and dead cells. DAPI negative, EpCAM positive cells were collected. scRNAseq experiments Generation of count matrices, QC and filtering Live cells from pooled lambdoidal junctions were loaded into a well for single-cell capture using the Chromium Single-Cell 3′ Reagent Kit V3 (10X Genomics). Libraries were prepared with the same kit, with each sample uniquely barcoded using an i7 index. Pooled libraries were then sequenced on an Illumina NovaSeq sequencer. Initial processing of raw sequencing reads was conducted using the Cell Ranger v2.2.0 pipeline from 10X Genomics, which involved demultiplexing and aligning to the mouse genome (mm10 1.2.0). The main subsequent analyses were primarily performed using pagoda2 R package 15 . Additional filtering was performed based on gene/molecule dependency (pagoda2, gene.vs.molecule.cell.filter), with cells having more than 1×10 5 transcripts, less than 1000 transcripts or more than 10% of mitochondrial proportion being filtered out. Genes with less than 10 total transcripts overall were discarded. FAC sorted WT epithelial cells Datasets from E9.5, E10.5, and E11.5 developmental time points were combined as a single pagoda2 object, using the timepoints as the covariate for batch correction. The gene expression variance from the filtered batch-corrected count matrix was adjusted (pagoda2, k=10) to extract over-dispersed genes. PCA was performed on the over-dispersed genes (pagoda2, nPcs=50, maxit=1000). A nearest neighbour graph was calculated from the PC space using 100 neighbors and cosine distances (pagoda2, k=100, centred), and UMAP visualisation 16 (UMAP python, n_neighbors = 30, min_dist = 0.5) was generated from PCA space. Clusters were then identified on the KNN graph using Leiden algorithm 17 (resolution=0.5). Finally, UMAP embedding was generated using the UMAP python package. Separate timepoints were processed similarly, at the differences of the following parameters: 50 nearest neighbors for E11.5 and 30 nearest neighbors for E9.5 and E10.5. Pathway overdispersion analysis was performed to generate biological aspects 18 . For each timepoint, cell cycle was scored using a list of known cell cycle markers, and CytoTRACE 19 values were calculated using the raw filtered count matrices. Pbx1/2 mutant epithelial cells E10.5 datasets from mutant and WT were combined. A single pagoda2 object was generated, using the condition (WT/mutant) as covariate for batch correction. The filtered overview count matrix gene expression variance was adjusted (pagoda2, k=10) to extract over-dispersed genes, and PCA was performed on the over-dispersed genes (pagoda2, nPcs=50, maxit=1000). A nearest neighbour graph was calculated from the PC space using 100 neighbors and cosine distances (pagoda2, k=100, centred, cosine distance), and UMAP visualisation (UMAP python, n_neighbors = 30, min_dist = 0.5) were generated in PCA space. Clusters were then identified on the KNN graph using Leiden algorithm (pagoda2, resolution=0.5). Finally, UMAP embedding was generated using the UMAP python package. To specifically analyze epithelial cells, clusters expressing Epcam were only selected, and subsequently reanalysed using the same parameters as previously. For consistency, Leiden cluster labels from FACS-purified WT datasets (see previous section) were assigned to the WT/Mutant cells, using the conos package 20 . RNA Velocity analysis For all datasets, spliced and unspliced matrices were generated with the kallisto 21 BUS tool using fastq files as input. The generated matrices were subset using the cell barcodes list extracted from the filtering process of the previous analyses mentioned. UMAP coordinates and Leiden clustering labels were transferred to the newly generated data. Main downstream analyses were performed using the scvelo package 22 . Genes with less than 20 total counts or less than 10 unspliced counts were discarded, and only the 2000 top variable genes were kept. For the WT datasets, velocity was computed for each timepoint separately, using stochastic model and default parameters from scvelo. For the mutant E10.5 dataset, RNA velocity was computed separately for each condition, with varying number of neighbors to account for the difference of total number of cells captured (20 and 15 neighbors for WT and mutant respectively). RNA Velocity was estimated using the dynamical model for higher precision. To estimate possible changes in fate transitions between WT and mutant at E10.5, Cross-Boundary Direction Correctness (CBDir) measurement was employed, a measurement initially developed to benchmark RNA velocity estimation tools 23 . Briefly, this measurement estimates how likely it is that a cell will develop into a specific target cell based on its current velocity. The velocity direction of the cell should match the direction of its development towards the target cell. As we know the cluster-wise transitions, we estimated CBDir of cells from a progenitor cluster that bounds the progeny cluster (in other words the nearest neighbors of that cluster). To assess any deviation of CBDir in mutant, Kolmogorov-Smirnov test was performed between the two estimations. Bulk RNAseq As described above (see section titled: Cell Isolation and Fluorescence Activated Cell Sorting), epithelial cells were sorted using FACS (Sony SH800S), collecting 5,000-10,000 live EpCAM positive and negative cells for each embryo directly into separate tubes containing RLT plus lysis buffer (Qiagen, cat: 1053393). After genotyping of individual embryos, RNA from four biological replicates per genotype was collected, with each replicate comprising 3-4 pooled embryos. Number of embryos used for these experiments are listed in the “Statistics and data reproducibility” section below. RNA extraction was performed using the RNeasy Plus Micro Kit (Qiagen, cat: 74034), and RNA quantity was assessed using the Qubit RNA HD Assay Kit (Invitrogen, cat: Q32852). RNA quality was evaluated using an RNA 6000 Pico kit (Agilent, cat: 5067-1513) on a 2100 Bioanalyzer (Agilent). Only RNA samples with RIN>9 were used for library preparation. PolyA mRNAs were captured using the NEBNext Poly(A) mRNA Magnetic Isolation Module (NEB, cat: E7490). RNA sequencing libraries were prepared from 100ng of RNA using the NEBNext Ultra™ II RNA Library Prep Kit for Illumina (NEB, cat: E7775). Library size and quality were verified using an Agilent 2100 Bioanalyzer with the High Sensitivity DNA kit (Agilent, cat: 5067-4626). Library DNA concentration was determined with the QuBit dsDNA HS Assay kit (Invitrogen, cat: Q32854). Libraries were sequenced on the Illumina HiSeq 4000, generating 50 base pair (bp) single-end reads. RNAseq fastq files from all samples were aligned using STAR 24 with GENCODE vM27 genome annotation. Feature counting was done using featureCounts 25 . Processing of count matrix, which includes variance stabilization, PCA and differential expression analysis, was done using the Deseq2 R package 26 . Genes with a fold change ≥1.2 or ≤-1.2 and an FDR ≤0.05 were identified as differentially expressed genes (DEGs). ChIPseq Swiss Webster WT murine embryonic midfaces were dissected from mouse embryos at E11.5 and immediately crosslinked for 10 minutes in 1% formaldehyde (Electron Microscopy Sciences, cat: 15710). Number of embryos used for these experiments are listed in the “Statistics and data reproducibility” section below. For ChIPseq experiments on isolated epithelium cells, dissected midfaces were dissociated into single-cell suspensions following the same protocol as for FACS, and immediately crosslinked for 10 minutes in 1% paraformaldehyde. For H3K27ac datasets, after crosslinking, epithelium and mesenchyme cells were sorted by FACS (Sony SH800S) as described above. For PBX1 datasets, the epithelial population was sorted using the MACS (Miltenyi Biotec) system with CD326 (EpCAM; cat: 130-061-101) microbeads. ChIP assays were conducted as previously reported 27 . Briefly, nuclei were isolated from the crosslinked cells. After disruption of the nuclear membrane, chromatin was sonicated using a Diagenode biorupter to achieve 150–400 bp DNA fragments. After a pre-clearing step, chromatin was incubated overnight with specific antibodies (3-5 µg) at 4°C, followed by a 30-minute incubation with Dynabeads protein A (for PBX1, ZFHX3, H3K27ac ChIPseq; Invitrogen cat: 10002D) to immunoprecipitate specific chromatin complexes. IP and input DNA were purified using the MicroChIP DiaPure kit (Diagenode, cat: C03040001). Antibodies used included PBX1 (Cell Signaling, cat: 4342), H3K27ac (Abcam, cat: 4729) and ZFHX3 (MBL, cat: PD011 and PD010). Following ChIP, DNA libraries were constructed using the MicroPlex Library Preparation Kit v2 (H3K27ac; Diagenode cat: C05010012) or v3 (PBX1, ZFHX3; Diagenode cat: C05010001) and sequenced on an Illumina HiSeq4000 (H3K27ac) or NovaSeqX (PBX1, ZFHX3) to generate 50 bp single-end or paired-end reads, respectively. ChIPseq analysis was conducted using the nf-core/chipseq bioinformatic pipeline 28 , 29 (workflow container 2.0.0), aligned to the mm10 release of the mouse genome (Dec. 2011, GRCm38) using Bowtie2 30 under default parameters. Genomic Regions Enrichment of Annotations Tool (GREAT) analysis identified gene ontology terms associated with genomic regions bound by ZFHX3. Bedtools 31 intersect was used to identify regions co-bound by ZFHX3 and PBX1. Hypergeometric Optimization of Motif EnRichment (HOMER 32 ; v5.1) was utilized for enrichment analysis of known transcription-factor-binding sites and de novo motif discovery. Whole-Mount In Situ Hybridization Dissected embryos were fixed overnight at 4°C in 4% PFA, then dehydrated through a methanol/PBS gradient to 100% methanol and stored at –20°C for up to one year. To prevent probe trapping in the head regions of embryos older than E10.5, holes were punched from the back through to the hindbrain. Whole-mount in situ hybridization was performed as previously described 27 , 33 , 34 . Briefly, embryos were rehydrated and pretreated with Proteinase K (duration of Proteinase K dependent on the stage of the embryos), then hybridized overnight at 70°C with either sense or antisense riboprobes at a final concentration of 1 µg/ml in an incubation buffer containing 50% formamide, 5× SSC, 50 µg/ml yeast RNA, 1% SDS, 50 µg/ml heparin, and 0.1% CHAPS detergent (ThermoFisher Scientific, cat: 28299). Post-hybridization, embryos were washed at 70°C through a series of SSC solutions (5× SSC and 2× SSC, three times each for 30 minutes, and once each in 0.2× SSC and 0.1× SSC for 30 minutes, respectively). After a brief rinse in Tris-buffered saline with 0.1% Tween (TBST), embryos were incubated in 10% blocking reagent (ThermoFisher Scientific, cat: R37620). Positive signals were detected using an alkaline phosphatase (AP)-conjugated anti-digoxigenin antibody (Roche Diagnostics, cat: 11093274910) at a 1:5000 dilution. Following washes in TBST, embryos were incubated in NBT/BCIP in NTMT buffer (Roche Diagnostics, cat: 11681451001) according to the manufacturer’s instructions until color development was complete. Positive hybridization was visualized by a purple (NBT/BCIP) signal. To ensure reproducibility, at least three embryos for each genotype and developmental stage were analyzed. RNAscope and Immunofluorescence on mouse embryonic sections Mouse embryos were collected and fixed in 4% PFA solution either overnight at 4°C or for 2 hours at room temperature with gentle agitation. Fixed embryos were then washed with PBS and allowed to sink in a 30% sucrose solution before being embedded in 100% Neg-50 frozen cryoblocks and stored at –80°C. Frozen blocks were sectioned at 14 μm thickness, air-dried at RT for 1 hour, and subsequently stored at – 80°C. Slides containing transverse and/or coronal midface sections were thawed and washed with 1X PBS to remove excess freezing medium before use. These slides were assayed using the RNAscope Multiplex Fluorescent Reagent Kit V2 (Advanced Cell Diagnostics, cat: 323100), following modified manufacturer instructions. Specifically, antigen retrieval steps were omitted, and protease treatment was limited to a 10-minute exposure to Protease Plus to prevent tissue damage. Probe mixes were hybridized for 2 hours at 40°C in a HybEZ II Oven (Advanced Cell Diagnostics). The appropriate HRP channels were developed with Opal 520, TSA Cy3 Plus, and Cy5 Plus (PerkinElmer, cat: FP1487001KT, NEL744E001KT and NEL745E001KT) dyes. Following this, DAPI staining and mounting with ProLong Gold (Invitrogen, cat: P36930) were performed. For sections requiring immunofluorescence in conjunction with RNAscope, immunofluorescence assays were carried out after the final RNAscope step, which involved blocking the last HRP channel. An antigen blocking solution containing 5% Normal Donkey Serum and 0.1% Tween-20 in 1X PBS was applied to the slides for 45 minutes. Subsequently, primary antibodies against TUBB3 (1:200, Abcam cat: ab18207), RFP mCherry (1:300, Cell Signaling cat: 43590), GFP-Venus (1:200, Nacalai cat: GF090R), E-cadherin (1:100, R&D systems cat: AF748), pHH3 (1:500, Millipore Sigma cat: 06-570), KI67 (1:200, Abcam cat: ab15580), cleaved-Caspase3 (1:200, Cell Signaling cat:9661), EpCAM (1:200, DSHB cat: G8.8), and P21 (1:100, Millipore Sigma cat: MABE1816-100UG) were diluted in an antibody buffer (a 1:5 dilution of blocking solution to PBS-0.1% Tween-20 solution) and applied to the slides overnight at 4°C.The following day, primary antibodies were washed away, and the slides were washed three times for 15 minutes each with antibody buffer. Alexa Fluor secondary antibodies (1:500, Invitrogen), diluted in antibody buffer along with DAPI (1:1000), were applied to the slides for 2 hours at room temperature. Following additional washes to remove the secondary antibody, slides were flicked dry and mounted using ProLong Gold with coverslips. Thymidine Analogue Incorporation and TUNEL Assays Bromodeoxyuridine (BrdU; Invitrogen cat: B23151) was diluted in saline solution (0.9%) to a final concentration of 1mg/ml. Pregnant Swiss Webster dams were anesthetized using isoflurane gas inhalation and injected intraperitoneally with BrdU at a dose of 100μl/10g body weight. Following the injection, the dams were observed and allowed to recover. Pregnant dams were then sacrificed at either 1-or 7-hour post-injection, and embryos were collected, fixed, and cryo-embedded as previously described. For sections from BrdU-injected embryos, slides were treated with a 2M HCl solution for 30 minutes at 37°C, followed by washing and incubating with blocking buffer (10% Normal Goat Serum in PBS with 0.3% Triton X) for 1 hour at room temperature. Rat anti-BrdU antibody (1:500, Abcam ab6326) was diluted in antibody buffer and incubated overnight. The following day, slides were washed, and anti-Rat secondary antibodies (1:500; Invitrogen cat: 21208), along with a DAPI counterstain (1:1000), were applied for incubation before final washes and mounting with Prolong Gold antifade. The TUNEL assay was performed on cryosections following the manufacturer’s guidelines for the In Situ Cell Death Detection Kit (Millipore Sigma, cat: 12156792910). Microscopy of whole embryos or embryonic sections Whole Mount in situ hybridization embryos were imaged using a Leica M20F5A dissecting microscope with a 1x/0.03 lens and variable zoom settings. Images were processed and exported using LAS-X software package. Embryos for gross morphology were imaged using the Axio Imager.Z2 scope at 0.25X magnification using the DAPI filter. Sections were imaged using a Zeiss Axio Observer.Z1, Zeiss Axiovert 200M, or confocal microscope Zeiss LSM 900 microscope with 5x, 10x, or 20x/0.8 objective. For sections imaged on the confocal microscope, several z-slices were acquired. Images were post-processed using ZEN 3.6 or ZEN 2.3 Pro. Adjustments were made to reduce background autofluorescence of the tissues by adjusting the absolute black and absolute white levels using a Best Fit adjustment where necessary. Sections were imaged using the same settings for each experiment. Whole-genome sequencing (WGS) of OFC trios and Down syndrome patients OFC trio samples Case-parent trios with whole genome sequencing data originating from three ancestral groups were used for this study. The first set consists of 376 trios of European ancestry that were recruited from sites in the United States, Argentina, Turkey, Hungary, and Spain; the second is a set of 267 trios from Medellin, Colombia; and the third is a set of 116 trios from Taiwan. In 93.8% of European trios, 96.5% of Taiwanese trios, and 100% of the Colombian trios, parents were unaffected. Because OFC etiology is likely to be multifactorial, parent phenotype status was not considered in this analysis. By proband OFC type, there were 88 cleft lip only (CL; 8 Colombian, 80 European), 613 cleft lip and palate (CLP; 259 Colombian, 238 European, 116 Taiwanese), and 58 cleft palate (CP; all European). Subject recruitment and phenotypic assessment occurred at regional treatment centers. Each site’s institutional review board (IRB) and the IRBs of the affiliated US coordinating institutions (HRPO #03-0871, IRB#HSC-MS-03-090, IRB#970405, IRB#200109094, and IRB#200109094) provided ethical approval and oversight. Whole genome sequencing and variant calling The case-parent OFC trios used in this study were sequenced as part of the Gabriella Miller Kids First (GMKF) Research Consortium. Sequencing was performed on blood samples when available (the majority of samples) and saliva when blood was not obtainable. Whole genome sequencing for European samples was carried out by the McDonnell Genome Institute (MGI) at the Washington University School of Medicine (St. Louis, MO) followed by alignment to hg38 and variant calling at the GMKF Data Resource Center at the Children’s Hospital of Philadelphia. Sequencing for Colombian and Taiwanese samples was carried out by the Broad Institute, with alignment to hg38 and variant calling by GATK pipelines 35 – 37 . Additional details on alignment and workflow used to harmonize these datasets have been published in Mukhopadhyay et al 38 . Quality control The WGS data for all case-parent trios was subjected to several quality metrics. Individual samples were evaluated for missingness, Mendelian error rate, and average read depth, and were removed if these values were greater than three standard deviations from the mean. Additionally, samples with transition/transversion (Ts/Tv), exonic Ts/Tv, silent/replacement, or heterozygotes/homozygotes ratios outside of the expected values were removed. Due to trios within the Colombian cohort having higher rates of consanguinity than other groups, lower heterozygotes/homozygotes ratios were allowed. Identity by descent as tested in PLINK (version 1.90b53) was used to confirm familial relationships, and sex of the samples was confirmed by X chromosome heterozygosity. Down syndrome samples Paired-end WGS was completed by the Broad Institute as part of funded NIH INCLUDE and Gabriella Miller Kids First projects on an Illumina HiSeqX with a target read depth of ∼30x coverage. The data were aligned to hg38 and harmonized by the Kids First Data Research Center via Cavatica using a custom pipeline based on GATK best practices 37 . Quality control (QC) was performed on 2,394 samples and 98,049,632 variants using VCFtools v0.1.13. Variant calls with genotype quality (GQ) < 20 or depth (DP) < 10 were set to missing. Variants were then filtered to remove flagged sites (filter flag not equal to “PASS”), multiallelic sites, monomorphic sites (minor allele count (MAC) 3% missingness, leaving 74,841,842 variants. Samples were dropped for quality metrics outside of three standard deviations from the mean for missingness, theta, transition/transversion (Ts/Tv) ratio, silent/replacement ratio, and heterozygous/homozygous ratio. Sex and family relationships were confirmed by X chromosome heterozygosity and identity-by-descent analyses in PLINK v1.9. The final analysis dataset consisted of 2,344 samples. Variants were then excluded from analysis if they had MAF < 5%, deviated from Hardy-Weinberg (p-value 5%. Full details of sequencing and variant calling are found in Feldman, et. al 39 . Identification of de novo variants Mendelian errors were called in trios using PLINK (version 1.90b53) and bcftools (v1.9). These mendelian errors then underwent further filtering to yield high quality de novo mutation calls including filtering for passing variants, bi-allelic variants only, a minor allele count (MAC) = 1, genotype quality (GQ) ≥ 20, and depth (DP) ≥ 10 using VCFtools (version 0.1.13). Furthermore, we filtered variants on the basis of allele balance (AB), with de novo calls requiring an AB ratio ≥0.30 and ≤0.70 in the proband and an AB ratio < 0.05 in the parents. Annotation of high confidence DNMs was completed with ANNOVAR (version 201707). Following annotation, de novo variants in coding regions were selected based on functional classification (“exonic” and/or “splicing”) and frequency (MAF < 0.3% across all of gnomAD v3.1.2) De novo variant enrichment Enrichment of de novo variants (DNs) in 759 OFC trios, 6,430 ASD probands, and 2,179 unaffected siblings was statistically analyzed using the ‘DenovolyzeR’ package (version 0.2.0) in R. Enrichment is tested by determining if the number of observed variants in a dataset is greater than what is expected based on mutational models described by Samocha, et al 40 . The functions ‘DenovolyzeByClass’ and ‘DenovolyzeByGene’ were used to test for an excess of DNMs both globally and per gene, respectively; however, use of the function ‘includeGenes’ was implemented to restrict testing to the gene sets derived from single cell RNA sequencing only. When testing enrichment per cluster, results were considered significant at p<0.0083 (Bonferroni correction 0.05/6 clusters). Rare variants in top scRNAseq genes The top 150 genes by absolute Z-score of each scRNAseq cluster were converted from Mus musculus to Homo sapiens orthologues using g:Profiler (Raudvere et al., 2019), and coding variants in orthologous genes were then extracted for 876 families with OFCs. Synonymous variants were first removed so that only protein-altering variants remained, and variants were then filtered for minor allele frequency (MAF) of <0.5% in any population in both gnomAD v2.1.1 and v3.1.2. Qualitatively, we evaluated variants based on multiple pathogenicity predictors. We excluded variants with CADD scores 0.05 and prioritized constrained genes (LOEUF 0.9). For ZFHX3 , we visualized predicted damaging variants in OFC probands with ProteinPaint 41 . The percent of probands harboring ZFHX3 variants in OFC, DS, and healthy cohorts were compared using a Chi-Squared test. Gene Ontology Analysis The top 100 differentially expressed genes ordered by Z-score absolute values from E10.5 λ epithelium scRNAseq datasets were used as input into the NIH Database for Annotation, Visualization, and Integrated Discovery (DAVID) functional annotation tool. 100 gene DAVID ID matches to M. musculus were charted using the GOTERM_BP_DIRECT category and ranked by P-value. Luciferase assays The vector constructs for the gene fragment sequences listed below were synthesized by TWIST Bioscience and cloned into the KpnI/HindIII sites of the pNL3.2 (Nluc/minP) vector (Promega, cat: N1041). After cloning, colonies were screened, selected, and sequenced to verify correct insertion. HEK293T cells were cultured in DMEM containing 4.5 g/L glucose, L-glutamine, and sodium pyruvate (Corning, cat: 10-013-CV) supplemented with 10% fetal bovine serum (Cytiva Hyclone, cat: SH30007203) and 1% penicillin-streptomycin (Hyclone, cat: SV30079). The cells were maintained in a humidified chamber with 5% CO2 at 37°C. For co-activation assays, approximately 15,000 HEK293T cells were transfected for 6 hours with 100 µl of OPTIMEM (Gibco, cat: 31985070), 2 µl of Lipofectamine 2000 (Invitrogen, cat: 11668027), and 5 ng of pGL4.54 (luc2/TK) (Promega, cat: E506A) plus the following vector cocktails: 1) Control: 200 ng of empty vector (pCDNA3.0) + 50 ng of empty pNL3.2 (Nluc/minP), 2) ZFHX3: 100 ng of ZFHX3 overexpression vector (OV) + 100 ng of empty vector + 50 ng of the targeted sequence, 3) PBX1: 100 ng of PBX1 OV + 100 ng of empty vector + 50 ng of the targeted sequence, and 4) PBX1+ZFHX3: 100 ng of PBX1 OV + 100 ng of ZFHX3 OV + 50 ng of the targeted sequence. The cocktail mix was added directly to the growth media. After 6 hours, transfection media/cocktail mix was replaced with fresh media, and the cells were incubated for an additional 48 hours. Transfections were performed in 24-well plates, with each condition tested in triplicate. After 54 hours, cells were harvested and analyzed using the Nano-Glo Dual-Luciferase Reporter (Promega, cat: N1610). Briefly, cells were washed with 1X PBS and lysed with 100 µl of 1X PLB lysis buffer (Promega, cat: PRE1941) for 20 minutes at room temperature. The cell lysate was collected and centrifuged for 10 minutes at room temperature. Then, 20 µl of the supernatant was transferred to a 96-well white flat-bottom plate (Costar). The Nano-Glo Dual-Luciferase Reporter Assay was performed using an automated sample injector system (Promega). First, 80 µl of ONE-Glo EX Reagent was injected, and the pGL4.54 (luc2/TK) signal was measured. Subsequently, 80 µl of Nano-DLR Stop&Glo Reagent was injected, and after 5 minutes, the pNL3.2 (Nluc/minP) readout was recorded. The ratio of pGL4.54 (luc2/TK) to pNL3.2 (Nluc/minP) signal for each sample was calculated. Triplicates for each condition were averaged, and results were compared to the normalized control readout. Data are represented as a fold increase and T-tests were performed for paired comparisons. Genome coordinates of the fragments cloned Cdkn1c promoter: 442pb-chr7:143,460,804-143,461,362 Pbx3 promoter-729pb –chr2:34,372,272-34,373,000 Rb1 promoter: 295pb-chr14:73,325,702-73,325,988. Immunoprecipitation Approximately 60 midfaces of Swiss-Webster embryos at either E10.5 or E11.5 were lysed in 500 µl of lysis buffer (50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 2.5 mM MgCl2, 1 mM EDTA, 10% glycerol, 0.2% sodium deoxycholate, 1% Triton X-100) containing phosphatase inhibitors (cocktails #2 and #3, Sigma cat: P5726 and P0044) and protease inhibitors (Sigma, cat: P8340). The supernatant was collected, and protein concentration was measured using the Pierce BCA Protein Assay Kit (Thermo, cat: 23235). For each sample, 800 µg of total protein in 500 µl was used. To pre-clear the samples, 100 µl of Dynabeads Protein-G (Invitrogen, cat: 10003D) were first washed twice with 1X PBS and then twice with wash solution (50 mM Tris-HCl, pH 7.4, 200 mM NaCl). Subsequently, 100 µl of the washed Dynabeads were added to 800 µg of protein supernatant per sample and incubated for 2 hours at 4°C with rotation. The supernatant was then collected, and each sample was incubated overnight at 4°C with rotation with either 5 µg/µl of ZFHX3 antibody (R&D Systems AF7384) or 5 µg/µl of normal sheep IgG (R&D Systems 5-001-A). The following day, the supernatant was discarded, and the Dynabeads were extensively washed with washing solution (50 mM Tris-HCl, pH 7.4, 200 mM NaCl, 10% glycerol, 1% Triton X-100) on ice. Protein complexes were eluted from the Dynabeads by incubating for 15 minutes at 95°C in 80 µl of 4x NuPage Buffer (Invitrogen, cat: NP007) containing 355 mM β-mercaptoethanol (Sigma, cat: 444203). Thirty microliters of each sample were loaded onto a 4-12% polyacrylamide gel (Invitrogen, cat: NP0322) and resolved using a standard Western blot protocol. Following transfer, the protein membrane was incubated overnight at 4°C with a PBX1 antibody (Cell Signaling cat: 4342, 1.4 µg/µl, customized) diluted 1:5000 in 5% blocking reagent/TBST. For signal development, the membrane was incubated with TidyBlot (BioRad, cat: STAR209) diluted 1:200 in blocking reagent/TBST for 1 hour at room temperature, followed by an HRP assay. The signal was developed using SuperSignal substrate (Thermo, cat: 34075). Statistics and data reproducibility Statistical methods were not employed to predetermine sample sizes but followed established field standards. Data were included in the analyses unless there were rare instances of clear technical failures. All omics-datasets adhered to ENCODE guidelines, which require at least two biological replicates for each experiment. scRNAseq required large numbers of WT embryos to isolate λ epithelium through FACS purification. 2 biological replicates were conducted at E9.5 (n=7-14 embryos each; 25k cells) and E10.5 (n=7-14 embryos each; 30k cells), and 3 biological replicates for E11.5 (n=7-14 embryos each; 30k cells). In contrast, scRNAseq of Pbx1/2 mutants was conducted on entire midfaces due to limitations in obtaining mutant embryos because of complex genetics (n=2 embryos used for mutants and WTs respectively; 30k cells). For bulk RNAseq, purified λ epithelium was used in 4 biological replicates (n=2-3 embryos each). For all ChIPseq, 10-12 embryonic midfaces per replicate (minimum 2 independent biological replicates per condition) were pooled for experiments using whole midfaces (ZFHX3 and H3K27ac assays) and 50-60 embryos for experiments using purified λ epithelium (PBX1 assays). The high reproducibility and quality of these replicates led to statistically significant peak detections. For whole-mount in situ hybridization (WISH), RNAScope FISH, gross morphology, immunoprecipitation, and immunofluorescence, at least three independent biological replicates were examined for each genotype or developmental stage. Embryos for these analyses were sourced from various females and underwent a minimum of two completely independent experiments. List of Primers Used Primers to generate WISH riboprobes: Cdkn1a/p21 F: CTCTTCCCCATCTTCGGCC Cdkn1a/p21 R: GAGACGCTTACAATCTGAGTGG Gadd45g F: CCGATGAAGAAGATGAGGGCG Gadd45g R: TGAAAGAGCAGTGCAGTCGG Bmp4 WISH probe was provided by Ian C. Welsh (see Welsh and O’Brian 2009) List of Probes Used Catalog numbers of RNAscope probes (Advanced Cell Diagnostics) : Gadd45g (803431-C2), Cdkn2a (411011-C3), Cdkn2b (458341-C2), Bambi (523071), Pbx1 (435171), Foxn3 (586011), Bmp4 (401301-C2), Cdkn1c (458331-C2), Pitx2 (412841-C2), Aurkb (461761), Zfhx3 (803471), Rb1 (486191-C3), Bambi (523071-C3), Igfbp5 (425731-C2), Cdk1 (476081-C2), Cdkn1b (499991), Itm2b (491791), Tfap2b (536371-C3), Sox2 (401041-C3), Hey1 (319021-C3), Dlk1 (405971-C2), Fgf9 (499811), Wnt6 (401111). Download figure Open in new tab Acknowledgements We thank R. Aho for all artwork; P. Nolan and R. Dumbell for the ZFHX3 antibody; A. Arjun-McKinney for assistance with initial BrdU experiments; P. Martin for mouse colony maintenance and in situ hybridizations not included in the current figures; I. Barozzi, D. Goekbuget, and R. Boileau for guidance in bioinformatic analyses; V. Hermosilla Aguayo for guidance in Co-IP and for generation of probes; J. Zheng for generation of probes; J. Bush for useful discussions; J. Cyster, J. Bush, E. Hutchins and C. Teng for use of microscopes; P. Lupo, S. Sherman, and J. Espinosa for the Down Syndrome WGS data. Work supported by NIH R01 grant R01DE024745 and by UCSF Chancellor recruitment package to LS; R01-DE030342 and R03-DE027103 grants to EJL-C; TRDRP A139592 pre-doctoral fellowship and UCSF ‘Discovery Fellowship’ to TQ; F31DE032561 pre-doctoral fellowship to BC; Austrian Science Fund DOC33-B27 to LF; F31-DE032588 pre-doctoral fellowship to KR; and American Association for Anatomy post-doctoral fellowship to ML. WGS generated through grants: X01-HG010835, X01-HL136465, X01-HL140516, and X01-HL145692. G8.8 antibody developed by A.G. Farr was obtained from the Developmental Studies Hybridoma Bank, created by the NICHD of the NIH and maintained at The University of Iowa. Human embryonic and fetal material and related services provided by the Joint MRC/Wellcome (MR/R006237/1, MR/X008304/1 and 226202/Z/22/Z) Human Developmental Biology Resource ( www.hdbr.org ). The PFCC (RRID:SCR_018206) assisted the generation of Flow Cytometry data, supported in part by DRC Center Grant NIH P30 DK063720. Sequencing performed at UCSF CAT facility. Funder Information Declared National Institutes of Health , R01-DE024745 , R01-DE030342 , R03-DE027103 , F31-DE032561 , F31-DE032588 UCSF Chancellor recruitment package TRDRP , A139592 Austrian Science Fund , DOC33-B27 American Association for Anatomy, https://ror.org/04v1psm68 , Post-Doctoral Fellowship National Institutes of Health , X01-HG010835 , X01-HL136465 , X01-HL140516 , X01-HL145692 , P30-DK063720 Joint MRC/Wellcome Human Developmental Biology Resource , MR/R006237/1 , MR/X008304/1 , 226202/Z/22/Z UCSF , Discovery Fellowship References 1. ↵ Som , P. , and Naidich , T . ( 2013 Dec). Illustrated review of the embryology and development of the facial region, part 1: Early face and lateral nasal cavities – PubMed . AJNR. American journal of neuroradiology 34 . doi: 10.3174/ajnr.A3415 . OpenUrl Abstract / FREE Full Text 2. ↵ Hinrichsen , K . ( 1985 ). The early development of morphology and patterns of the face in the human embryo . Advances in anatomy, embryology, and cell biology 98 . doi: 10.1007/978-3-642-70754-4 . OpenUrl CrossRef 3. ↵ Jiang , R. , Bush , J.O. , and Lidral , A.C . ( 2006 /05/01). Development of the upper lip: Morphogenetic and molecular mechanisms . Developmental Dynamics 235 . doi: 10.1002/dvdy.20646 . OpenUrl CrossRef PubMed Web of Science 4. ↵ Gritli-Linde , A. ( 2008 /01/01). Chapter 2 The Etiopathogenesis of Cleft Lip and Cleft Palate: Usefulness and Caveats of Mouse Models . Current Topics in Developmental Biology 84 . doi: 10.1016/S0070-2153(08)00602-9 . OpenUrl CrossRef PubMed 5. ↵ Martínez-Abadías , N. , Mitteroecker , P. , Parsons , T.E. , Esparza , M. , Sjøvold , T. , Rolian , C. , Richtsmeier , J.T. , and Hallgrímsson , B . ( 2012 Nov 20). The Developmental Basis of Quantitative Craniofacial Variation in Humans and Mice . Evolutionary Biology 39 . doi: 10.1007/s11692-012-9210-7 . OpenUrl CrossRef PubMed 6. ↵ Chang , C.-F. , Schock , E.N. , Billmire , D.A. , and Brugmann , S.A . ( 2015 /01/01). Craniofacial Syndromes: Etiology , Impact and Treatment. Principles of Developmental Genetics . doi: 10.1016/B978-0-12-405945-0.00035-1 . OpenUrl CrossRef 7. Noden , D.M . ( 1988 /09/01). Interactions and fates of avian craniofacial mesenchyme . Development 103 . doi: 10.1242/dev.103.Supplement.121 . OpenUrl Abstract / FREE Full Text 8. ↵ Douarin , N.M.L. , and Dupin , E . (12/01/ 2018 ). The “beginnings” of the neural crest . Developmental biology 444 Suppl 1 . doi: 10.1016/j.ydbio.2018.07.019 . OpenUrl CrossRef PubMed 9. ↵ Tamarin , A. , and Boyde , A . ( 1977 ). Facial and visceral arch development in the mouse embryo: a study by scanning electron microscopy . J Anat 124 , 563 – 580 . OpenUrl PubMed 10. ↵ Soldatov , R. , Kaucka , M. , Kastriti , M.E. , Petersen , J. , Chontorotzea , T. , Englmaier , L. , Akkuratova , N. , Yang , Y. , Häring , M. , Dyachuk , V. , et al. ( 2019 ). Spatiotemporal structure of cell fate decisions in murine neural crest . Science 364 , eaas9536 . doi: 10.1126/science.aas9536 . OpenUrl Abstract / FREE Full Text 11. Zalc , A. , Sinha , R. , Gulati , G.S. , Wesche , D.J. , Daszczuk , P. , Swigut , T. , Weissman , I.L. , and Wysocka , J . ( 2021 ). Reactivation of the pluripotency program precedes formation of the cranial neural crest . Science 371 , eabb4776 . doi: 10.1126/science.abb4776 . OpenUrl Abstract / FREE Full Text 12. Prescott , S.L. , Srinivasan , R. , Marchetto , M.C. , Grishina , I. , Narvaiza , I. , Selleri , L. , Gage , F.H. , Swigut , T. , and Wysocka , J . (09/24/ 2015 ). Enhancer divergence and cis-regulatory evolution in the human and chimp neural crest . Cell 163 . doi: 10.1016/j.cell.2015.08.036 . OpenUrl CrossRef PubMed 13. Kim , S. , Morgunova , E. , Naqvi , S. , Goovaerts , S. , Bader , M. , Koska , M. , Popov , A. , Luong , C. , Pogson , A. , Swigut , T. , et al. (02/01/ 2024 ). DNA-guided transcription factor cooperativity shapes face and limb mesenchyme . Cell 187 . doi: 10.1016/j.cell.2023.12.032 . OpenUrl CrossRef PubMed 14. Dash , S. , and Trainor , P.A . ( 2020 Aug). The development, patterning and evolution of neural crest cell differentiation into cartilage and bone . Bone 137 . doi: 10.1016/j.bone.2020.115409 . OpenUrl CrossRef PubMed 15. Martik , M.L. , Bronner , M.E. , Martik , M.L. , and Bronner , M.E . ( 2021 -09-01). Riding the crest to get a head: neural crest evolution in vertebrates . Nature Reviews Neuroscience 2021 22 : 10 22 . doi: 10.1038/s41583-021-00503-2 . OpenUrl CrossRef 16. Bronner , M.E. , and Simões-Costa , M . ( 2016 ). The Neural Crest Migrating into the Twenty-First Century . Current topics in developmental biology 116 . doi: 10.1016/bs.ctdb.2015.12.003 . OpenUrl CrossRef PubMed 17. Rothstein , M. , and Simoes-Costa , M . (03/30/ 2023 ). On the evolutionary origins and regionalization of the neural crest . Seminars in cell & developmental biology 138 . doi: 10.1016/j.semcdb.2022.06.008 . OpenUrl CrossRef PubMed 18. Candido-Ferreira , I.L. , Lukoseviciute , M. , and Sauka-Spengler , T . (03/30/ 2023 ). Multi-layered transcriptional control of cranial neural crest development . Seminars in cell & developmental biology 138 . doi: 10.1016/j.semcdb.2022.07.010 . OpenUrl CrossRef PubMed 19. ↵ Zhao , R. , Moore , E.L. , Gogol , M.M. , Unruh , J.R. , Yu , Z. , Scott , A. , Wang , Y. , Rajendran , N.K. , and Trainor , P.A . ( 2024 /4/9). Identification and characterization of intermediate states in mammalian neural crest cell epithelial to mesenchymal transition and delamination . eLife 13 . doi: 10.7554/eLife.92844.2 . OpenUrl CrossRef 20. ↵ Ferretti , E. , Li , B. , Zewdu , R. , Wells , V. , Hebert , Jean M. , Karner , C. , Anderson , Matthew J. , Williams , T. , Dixon , J. , Dixon , Michael J. , et al. ( 2011 /10/18). A Conserved Pbx-Wnt-p63-Irf6 Regulatory Module Controls Face Morphogenesis by Promoting Epithelial Apoptosis . Developmental Cell 21 . doi: 10.1016/j.devcel.2011.08.005 . OpenUrl CrossRef PubMed Web of Science 21. ↵ Losa , M. , Risolino , M. , Li , B. , Hart , J. , Quintana , L. , Grishina , I. , Yang , H. , Choi , I.F. , Lewicki , P. , Khan , S. , et al. ( 2018 /03/01). Face morphogenesis is promoted by Pbx-dependent EMT via regulation of Snail1 during frontonasal prominence fusion . Development 145 . doi: 10.1242/dev.157628 . OpenUrl Abstract / FREE Full Text 22. ↵ Li , H. , Jones , Kenneth L ., Hooper , Joan E. , Williams , Trevor , Klein , Allon , Treutlein , Barbara (06/17/ 2019 ). The molecular anatomy of mammalian upper lip and primary palate fusion at single cell resolution . Development (Cambridge, England) 146 . doi: 10.1242/dev.174888 . OpenUrl Abstract / FREE Full Text 23. Vukojevic , K. , Kero , D. , Novakovic , J. , Govorko , D.K. , and Saraga-Babic , M . ( 2012 /08/01). Cell proliferation and apoptosis in the fusion of human primary and secondary palates . European Journal of Oral Sciences 120 . doi: 10.1111/j.1600-0722.2012.00967.x . OpenUrl CrossRef 24. ↵ Van Otterloo , E. , Milanda , I. , Pike , H. , Thompson , J.A. , Li , H. , Jones , K.L. , and Williams , T. ( 2022 ). AP-2α and AP-2β cooperatively function in the craniofacial surface ectoderm to regulate chromatin and gene expression dynamics during facial development . eLife 11 . doi: 10.7554/elife.70511 . OpenUrl CrossRef PubMed 25. ↵ Robinson , K. , Curtis , S.W. , and Leslie , E.J . ( 2024 /05/01). The heterogeneous genetic architectures of orofacial clefts . Trends in Genetics 40 . doi: 10.1016/j.tig.2024.02.004 . OpenUrl CrossRef 26. ↵ Kantar , R.S. , Hamdan , U.S. , Muller , J.N. , Hemal , K. , Younan , R.A. , Haddad , M. , Melhem , A.M. , Don Griot , J.P.W. , Breugem , C.C. , and Mokdad , A.H . (10/01/ 2023 ). Global Prevalence and Burden of Orofacial Clefts: A Systematic Analysis for the Global Burden of Disease Study 2019 . The Journal of craniofacial surgery 34 . doi: 10.1097/SCS.0000000000009591 . OpenUrl CrossRef 27. ↵ Selleri , L. , Zappavigna , V. , and Ferretti , E . (03/01/ 2019 ). ‘Building a perfect body’: control of vertebrate organogenesis by PBX-dependent regulatory networks . Genes & development 33 . doi: 10.1101/gad.318774.118 . OpenUrl Abstract / FREE Full Text 28. ↵ Slavotinek , A. , Risolino , M. , Losa , M. , Cho , M.T. , Monaghan , K.G. , Schneidman-Duhovny , D. , Parisotto , S. , Herkert , J.C. , Stegmann , A.P.A. , Miller , K. , et al. ( 2017 /12/15). De novo, deleterious sequence variants that alter the transcriptional activity of the homeoprotein PBX1 are associated with intellectual disability and pleiotropic developmental defects . Human Molecular Genetics 26 . doi: 10.1093/hmg/ddx363 . OpenUrl CrossRef PubMed 29. ↵ Maili , L. , Letra , A. , Silva , R. , Buchanan , E.P. , Mulliken , J. , Greives , M. , Teichgraeber , J. , Blackwell , S. , Ummer , R. , Weber , R. , et al. ( 2019 Dec 11). PBX-WNT-P63-IRF6 pathway in nonsyndromic cleft lip and palate . Birth defects research 112 . doi: 10.1002/bdr2.1630 . OpenUrl CrossRef 30. ↵ Teng , T. , Teng , C.S. , Kaartinen , V. , and Bush , J.O . ( 2022 May 26). A unique form of collective epithelial migration is crucial for tissue fusion in the secondary palate and can overcome loss of epithelial apoptosis. Development (Cambridge , England ) 149 . doi: 10.1242/dev.200181 . OpenUrl CrossRef 31. ↵ Kim , S. , Lewis , A.E. , Singh , V. , Ma , X. , Adelstein , R. , and Bush , J.O. (Apr 7, 015 ). Convergence and Extrusion Are Required for Normal Fusion of the Mammalian Secondary Palate . PLOS Biology 13 . doi: 10.1371/journal.pbio.1002122 . OpenUrl CrossRef PubMed 32. ↵ Abramyan , J. , and Richman , J.M . ( 2015 Dec). Recent insights into the morphological diversity in the amniote primary and secondary palates . Developmental dynamics: an official publication of the American Association of Anatomists 244 . doi: 10.1002/dvdy.24338 . OpenUrl CrossRef PubMed 33. Juriloff , D.M. , and Harris , M.J . ( 2008 Feb). Mouse genetic models of cleft lip with or without cleft palate. Birth defects research. Part A , Clinical and molecular teratology 82 . doi: 10.1002/bdra.20430 . OpenUrl CrossRef PubMed Web of Science 34. ↵ Suzuki , A. , Sangani , D.R. , Ansari , A. , and Iwata , J . ( 2016 Mar). Molecular mechanisms of midfacial developmental defects . Developmental dynamics: an official publication of the American Association of Anatomists 245 . doi: 10.1002/dvdy.24368 . OpenUrl CrossRef PubMed 35. ↵ Jung , C.-G. , Kim , H.-J. , Kawaguchi , M. , Khanna , K.K. , Hida , H. , Asai , K. , Nishino , H. , and Miura , Y . ( 2005 /12/01). Homeotic factor ATBF1 induces the cell cycle arrest associated with neuronal differentiation . Development 132 . doi: 10.1242/dev.02098 . OpenUrl Abstract / FREE Full Text 36. Miura , Y. , Kataoka , H. , Joh , T. , Tada , T. , Asai , K. , Nakanishi , M. , Okada , N. , and Okada , H . ( 2004 /02/01). Susceptibility to Killer T Cells of Gastric Cancer Cells Enhanced by Mitomycin-C Involves Induction of ATBF1 and Activation of p21 (Waf1/Cip1) Promoter . Microbiology and Immunology 48 . doi: 10.1111/j.1348-0421.2004.tb03491.x . OpenUrl CrossRef PubMed 37. ↵ Mabuchi , M. , Kataoka , H. , Miura , Y. , Kim , T.-S. , Kawaguchi , M. , Ebi , M. , Tanaka , M. , Mori , Y. , Kubota , E. , Mizushima , T. , et al. ( 2010 ). Tumor suppressor, AT motif binding factor 1 (ATBF1), translocates to the nucleus with runt domain transcription factor 3 (RUNX3) in response to TGF-β signal transduction . Biochemical and Biophysical Research Communications 398 , 321 – 325 . doi: 10.1016/j.bbrc.2010.06.090 . OpenUrl CrossRef PubMed 38. ↵ Tang , F. , Barbacioru , C. , Wang , Y. , Nordman , E. , Lee , C. , Xu , N. , Wang , X. , Bodeau , J. , Tuch , B.B. , Siddiqui , A. , et al. ( 2009 -04-06). mRNA-Seq whole-transcriptome analysis of a single cell . Nature Methods 2009 6 : 5 6 . doi: 10.1038/nmeth.1315 . OpenUrl CrossRef 39. Kolodziejczyk , Aleksandra A. , Kim , J.K. , Svensson , V. , Marioni , John C. , and Teichmann , Sarah A . ( 2015 /05/21). The Technology and Biology of Single-Cell RNA Sequencing . Molecular Cell 58 . doi: 10.1016/j.molcel.2015.04.005 . OpenUrl CrossRef PubMed 40. ↵ Cao , J. , Spielmann , M. , Qiu , X. , Huang , X. , Ibrahim , D.M. , Hill , A.J. , Zhang , F. , Mundlos , S. , Christiansen , L. , Steemers , F.J. , et al. ( 2019 ). The single-cell transcriptional landscape of mammalian organogenesis . Nature 566 , 496 – 502 . doi: 10.1038/s41586-019-0969-x . OpenUrl CrossRef PubMed 41. ↵ Trzpis , M. , McLaughlin , P.M.J. , Leij , L.M.F.H.d. , and Harmsen , M.C. ( 2007 /08/01). Epithelial Cell Adhesion Molecule . The American Journal of Pathology 171 . doi: 10.2353/ajpath.2007.070152 . OpenUrl CrossRef PubMed Web of Science 42. ↵ Traag , V.A. , Waltman , L. , and van Eck , N.J. ( 2019 -03-26). From Louvain to Leiden: guaranteeing well-connected communities . Scientific Reports 2019 9 :1 9 . doi: 10.1038/s41598-019-41695-z . OpenUrl CrossRef PubMed 43. ↵ St. Amand , T.R. , Zhang , Y. , Semina , E.V. , Zhao , X. , Hu , Y. , Nguyen , L. , Murray , J.C. , and Chen , Y. ( 2000 ). Antagonistic Signals between BMP4 and FGF8 Define the Expression of Pitx1 and Pitx2 in Mouse Tooth-Forming Anlage . Developmental Biology 217 , 323 – 332 . doi: 10.1006/dbio.1999.9547 . OpenUrl CrossRef PubMed Web of Science 44. ↵ Miller , A.J. , and Cole , S.E . ( 2014 ). Multiple Dlk1 splice variants are expressed during early mouse embryogenesis . The International Journal of Developmental Biology 58 , 65 – 70 . doi: 10.1387/ijdb.130316sc . OpenUrl CrossRef PubMed 45. ↵ Fersioui , Y.E. , Pinton , G. , Allaman-Pillet , N. , and Schorderet , D.F . ( 2021 ). Hmx1 regulates urfh1 expression in the craniofacial region in zebrafish . PLoS ONE 16 . doi: 10.1371/journal.pone.0245239 . OpenUrl CrossRef 46. ↵ Chang , J.T. , Esumi , N. , Moore , K. , Li , Y. , Zhang , S. , Chew , C. , Goodman , B. , Rattner , A. , Moody , S. , Stetten , G. , et al. ( 1999 ). Cloning and Characterization of a Secreted Frizzled-Related Protein that is Expressed by the Retinal Pigment Epithelium . Human Molecular Genetics 8 , 575 – 583 . doi: 10.1093/hmg/8.4.575 . OpenUrl CrossRef PubMed Web of Science 47. ↵ Dupé , V. , Matt , N. , Garnier , J.-M. , Chambon , P. , Mark , M. , and Ghyselinck , N.B . ( 2003 ). A newborn lethal defect due to inactivation of retinaldehyde dehydrogenase type 3 is prevented by maternal retinoic acid treatment . Proceedings of the National Academy of Sciences 100 , 14036 – 14041 . doi: 10.1073/pnas.2336223100 . OpenUrl Abstract / FREE Full Text 48. ↵ Chen , Z. , Huang , J. , Liu , Y. , Dattilo , L.K. , Huh , S.-H. , Ornitz , D. , and Beebe , D.C . ( 2014 /07). FGF signaling activates a Sox9-Sox10 pathway for the formation and branching morphogenesis of mouse ocular glands . Development (Cambridge, England) 141 . doi: 10.1242/dev.108944 . OpenUrl Abstract / FREE Full Text 49. ↵ Peyrard-Janvid , M. , Elizabeth , Youssef , Tiffany , Dunnwald M. , Magnusson , M. , Brian , Unneberg P. , Fransson I. Hannele , et al. ( 2014 ). Dominant Mutations in GRHL3 Cause Van der Woude Syndrome and Disrupt Oral Periderm Development . The American Journal of Human Genetics 94 , 23 – 32 . doi: 10.1016/j.ajhg.2013.11.009 . OpenUrl CrossRef PubMed 50. ↵ Higashihori , N. , Song , Y. , and Richman , J.M . ( 2008 /05/01). Expression and regulation of the decoy bone morphogenetic protein receptor BAMBI in the developing avian face . Developmental Dynamics 237 . doi: 10.1002/dvdy.21529 . OpenUrl CrossRef PubMed 51. ↵ Hendry , S. , Jones , E. , and Emson , P . ( 1984 ). Morphology, distribution, and synaptic relations of somatostatin– and neuropeptide Y-immunoreactive neurons in rat and monkey neocortex . The Journal of Neuroscience 4 , 2497 – 2517 . doi: 10.1523/jneurosci.04-10-02497.1984 . OpenUrl Abstract / FREE Full Text 52. ↵ Pataskar , A. , Jung , J. , Smialowski , P. , Noack , F. , Calegari , F. , Straub , T. , and Tiwari , V.K . ( 2016 /01/01). NeuroD1 reprograms chromatin and transcription factor landscapes to induce the neuronal program . The EMBO Journal 35 . doi: 10.15252/embj.201591206 . OpenUrl Abstract / FREE Full Text 53. ↵ Simões-Costa , M. , and Bronner , M.E . ( 2015 /01/15). Establishing neural crest identity: a gene regulatory recipe . Development 142 . doi: 10.1242/dev.105445 . OpenUrl Abstract / FREE Full Text 54. ↵ Bildsoe , H. , Fan , X. , Wilkie , E.E. , Ashoti , A. , Jones , V.J. , Power , M. , Qin , J. , Wang , J. , Tam , P.P.L. , and Loebel , D.A.F . ( 2016 ). Transcriptional targets of TWIST1 in the cranial mesoderm regulate cell-matrix interactions and mesenchyme maintenance . Developmental Biology 418 , 189 – 203 . doi: 10.1016/j.ydbio.2016.08.016 . OpenUrl CrossRef PubMed 55. ↵ Alhesain , M. , Ronan , H. , LeBeau , F.E.N. , and Clowry , G.J . ( 2023 ). Expression of the schizophrenia associated gene FEZ1 in the early developing fetal human forebrain . Frontiers in Neuroscience 17 . doi: 10.3389/fnins.2023.1249973 . OpenUrl CrossRef 56. ↵ Inoue , T. , Ota , M. , Ogawa , M. , Mikoshiba , K. , and Aruga , J . ( 2007 /05/05). Zic1 and Zic3 Regulate Medial Forebrain Development through Expansion of Neuronal Progenitors . The Journal of Neuroscience 27 . doi: 10.1523/JNEUROSCI.4046-06.2007 . OpenUrl Abstract / FREE Full Text 57. ↵ Hardison , R.C . ( 2012 /12). Evolution of Hemoglobin and Its Genes . Cold Spring Harbor Perspectives in Medicine 2 . doi: 10.1101/cshperspect.a011627 . OpenUrl Abstract / FREE Full Text 58. ↵ Wang , F. , Flanagan , J. , Su , N. , Wang , L.-C. , Bui , S. , Nielson , A. , Wu , X. , Vo , H.-T. , Ma , X.-J. , and Luo , Y . ( 2012 /01). RNAscope: A Novel in Situ RNA Analysis Platform for Formalin-Fixed , Paraffin-Embedded Tissues. The Journal of Molecular Diagnostics: JMD 14 . doi: 10.1016/j.jmoldx.2011.08.002 . OpenUrl CrossRef PubMed Web of Science 59. ↵ Suzuki , S. , Marazita , M.L. , Cooper , M.E. , Miwa , N. , Hing , A. , Jugessur , A. , Natsume , N. , Shimozato , K. , Ohbayashi , N. , Suzuki , Y. , et al. ( 2009 /03/13). Mutations in BMP4 Are Associated with Subepithelial, Microform, and Overt Cleft Lip . The American Journal of Human Genetics 84 . doi: 10.1016/j.ajhg.2009.02.002 . OpenUrl CrossRef PubMed Web of Science 60. ↵ Iwata , J. , Parada , C. , and Chai , Y . ( 2011 /11). The mechanism of TGF-β signaling during palate development . Oral Diseases 17 . doi: 10.1111/j.1601-0825.2011.01806.x . OpenUrl CrossRef PubMed Web of Science 61. Oka , K. , Oka , S. , Sasaki , T. , Ito , Y. , Bringas , P. , Nonaka , K. , and Chai , Y . ( 2007 /03/01). The role of TGF-β signaling in regulating chondrogenesis and osteogenesis during mandibular development . Developmental Biology 303 . doi: 10.1016/j.ydbio.2006.11.025 . OpenUrl CrossRef PubMed Web of Science 62. ↵ Loeys , B.L. , Chen , J. , Neptune , E.R. , Judge , D.P. , Podowski , M. , Holm , T. , Meyers , J. , Leitch , C.C. , Katsanis , N. , Sharifi , N. , et al. ( 2005 Mar). A syndrome of altered cardiovascular, craniofacial, neurocognitive and skeletal development caused by mutations in TGFBR1 or TGFBR2 . Nature genetics 37 . doi: 10.1038/ng1511 . OpenUrl CrossRef PubMed Web of Science 63. ↵ Vasudevan , Harish N. , and Soriano , P . ( 2014 /11/10). SRF Regulates Craniofacial Development through Selective Recruitment of MRTF Cofactors by PDGF Signaling . Developmental Cell 31 . doi: 10.1016/j.devcel.2014.10.005 . OpenUrl CrossRef PubMed 64. ↵ Brewer , J.R. , Molotkov , A. , Mazot , P. , Hoch , R.V. , and Soriano , P . ( 2015 Sep 1). Fgfr1 regulates development through the combinatorial use of signaling proteins . Genes & Development 29 . doi: 10.1101/gad.264994.115 . OpenUrl Abstract / FREE Full Text 65. ↵ Alexander , C. , Piloto , S. , Pabic , P.L. , and Schilling , T.F . (07/24/ 2014 ). Wnt signaling interacts with bmp and edn1 to regulate dorsal-ventral patterning and growth of the craniofacial skeleton . PLoS genetics 10 . doi: 10.1371/journal.pgen.1004479 . OpenUrl CrossRef PubMed 66. Parsons , K.J. , Trent Taylor , A. , Powder , K.E. , Albertson , R.C. , Parsons , K.J. , Trent Taylor , A. , Powder , K.E. , and Albertson , R.C . ( 2014 -04-03). Wnt signalling underlies the evolution of new phenotypes and craniofacial variability in Lake Malawi cichlids . Nature Communications 2014 5 : 1 5 . doi: 10.1038/ncomms4629 . OpenUrl CrossRef 67. ↵ Chai , Y. , and Maxson , R.E . ( 2006 Sep). Recent advances in craniofacial morphogenesis . Developmental dynamics: an official publication of the American Association of Anatomists 235 . doi: 10.1002/dvdy.20833 . OpenUrl CrossRef PubMed Web of Science 68. ↵ Leoyklang , P. , Siriwan , P. , and Shotelersuk , V . ( 2006 /06). A mutation of the p63 gene in non-syndromic cleft lip . Journal of Medical Genetics 43 . doi: 10.1136/jmg.2005.036442 . OpenUrl Abstract / FREE Full Text 69. ↵ Tramullas , M. , Lantero , A. , Díaz , Á. , Morchón , N. , Merino , D. , Villar , A. , Buscher , D. , Merino , R. , Hurlé , J.M. , Izpisúa-Belmonte , J.C. , and Hurlé , M.A . (01/27/ 2010 ). BAMBI (Bone Morphogenetic Protein and Activin Membrane-Bound Inhibitor) Reveals the Involvement of the Transforming Growth Factor-β Family in Pain Modulation . The Journal of neuroscience: the official journal of the Society for Neuroscience 30 . doi: 10.1523/JNEUROSCI.2584-09.2010 . OpenUrl Abstract / FREE Full Text 70. Duan , C. , and Allard , J.B . ( 2020 /03/03). Frontiers | Insulin-Like Growth Factor Binding Protein-5 in Physiology and Disease . Frontiers in Endocrinology 11 . doi: 10.3389/fendo.2020.00100 . OpenUrl CrossRef 71. Salih , D.A.M. , Tripathi , G. , Holding , C. , Szestak , T.A.M. , Gonzalez , M.I. , Carter , E.J. , Cobb , L.J. , Eisemann , J.E. , Pell , J.M. , Salih , D.A.M. , et al. ( 2004 -3-23). Insulin-like growth factor-binding protein 5 (Igfbp5) compromises survival, growth, muscle development, and fertility in mice . Proceedings of the National Academy of Sciences 101 . doi: 10.1073/pnas.0400230101 . OpenUrl Abstract / FREE Full Text 72. ↵ Kim , K.S. , Seu , Y.B. , Baek , S.-H. , Kim , M.J. , Kim , K.J. , Kim , J.H. , and Kim , J.-R . ( 2007 -09-05). Induction of Cellular Senescence by Insulin-like Growth Factor Binding Protein-5 through a p53-dependent Mechanism . Molecular Biology of the Cell. doi: 10.1091/mbc.e07-03-0280 . OpenUrl CrossRef 73. ↵ Pommier , Y. , Nussenzweig , A. , Takeda , S. , Austin , C. , Pommier , Y. , Nussenzweig , A. , Takeda , S. , and Austin , C . ( 2022 -02-28). Human topoisomerases and their roles in genome stability and organization . Nature Reviews Molecular Cell Biology 2022 23 : 6 23 . doi: 10.1038/s41580-022-00452-3 . OpenUrl CrossRef 74. ↵ La Manno , G. , Soldatov , R. , Zeisel , A. , Braun , E. , Hochgerner , H. , Petukhov , V. , Lidschreiber , K. , Kastriti , M.E. , Lönnerberg , P. , Furlan , A. , et al. ( 2018 -08-08). RNA velocity of single cells . Nature 2018 560 : 7719 560 . doi: 10.1038/s41586-018-0414-6 . OpenUrl CrossRef 75. ↵ Gulati , G.S. , Sikandar , S.S. , Wesche , D.J. , Manjunath , A. , Bharadwaj , A. , Berger , M.J. , Ilagan , F. , Kuo , Angera H. , Hsieh , R.W. , Cai , S. , et al. ( 2020 -01-24). Single-cell transcriptional diversity is a hallmark of developmental potential . Science 367 . doi: 10.1126/science.aax0249 . OpenUrl Abstract / FREE Full Text 76. ↵ Faraahi , Z. , Baud’huin , M. , Croucher , P.I. , Eaton , C. , and Lawson , M.A . ( 2019 /05). Sostdc1: A soluble BMP and Wnt antagonist that is induced by the interaction between myeloma cells and osteoblast lineage cells . Bone 122 . doi: 10.1016/j.bone.2019.02.012 . OpenUrl CrossRef PubMed 77. ↵ Wu , X. , Wang , Y. , Huang , R. , Gai , Q. , Liu , H. , Shi , M. , Zhang , X. , Zuo , Y. , Chen , L. , Zhao , Q. , et al. ( 2020 -08-21). SOSTDC1-producing follicular helper T cells promote regulatory follicular T cell differentiation . Science 369 . doi: 10.1126/science.aba6652 . OpenUrl Abstract / FREE Full Text 78. ↵ Karimian , A. , Ahmadi , Y. , and Yousefi , B . ( 2016 /06/01). Multiple functions of p21 in cell cycle, apoptosis and transcriptional regulation after DNA damage . DNA Repair 42 . doi: 10.1016/j.dnarep.2016.04.008 . OpenUrl CrossRef PubMed 79. ↵ Engeland , K. , and Engeland , K . ( 2022 -03-31). Cell cycle regulation: p53-p21-RB signaling . Cell Death & Differentiation 2022 29:5 29 . doi: 10.1038/s41418-022-00988-z . OpenUrl CrossRef PubMed 80. ↵ Akiyama , R. , Kawakami , H. , Taketo , M.M. , Evans , S.M. , Wada , N. , Petryk , A. , and Kawakami , Y . ( 2014 /03/03). Distinct populations within Isl1 lineages contribute to appendicular and facial skeletogenesis through the β-catenin pathway . Developmental biology 387 . doi: 10.1016/j.ydbio.2014.01.001 . OpenUrl CrossRef PubMed 81. ↵ Monsoro-Burq , A.H . ( 2015 /08/01). PAX transcription factors in neural crest development . Seminars in Cell & Developmental Biology 44 . doi: 10.1016/j.semcdb.2015.09.015 . OpenUrl CrossRef PubMed 82. ↵ Liu , W. , Selever , J. , Lu , M.-F. , and Martin , J.F . ( 2003 /12/22). Genetic dissection of Pitx2 in craniofacial development uncovers new functions in branchial arch morphogenesis, late aspects of tooth morphogenesis and cell migration . Development 130 . doi: 10.1242/dev.00849 . OpenUrl Abstract / FREE Full Text 83. ↵ Shan , J. , Jokela , T. , Skovorodkin , I. , and Vainio , S . ( 2010 ). Mapping of the fate of cell lineages generated from cells that express the Wnt4 gene by time-lapse during kidney development . Differentiation 79 , 57 – 64 . doi: 10.1016/j.diff.2009.08.006 . OpenUrl CrossRef PubMed 84. ↵ Srinivas , S. , Watanabe , T. , Lin , C.-S. , William , C.M. , Tanabe , Y. , Jessell , T.M. , and Costantini , F . ( 2001 ). Cre reporter strains produced by targeted insertion of EYFP and ECFP into the ROSA26 locus . BMC Developmental Biology 1 . doi: 10.1186/1471-213X-1-4 . OpenUrl CrossRef PubMed 85. ↵ Butler , A. , Hoffman , P. , Smibert , P. , Papalexi , E. , Satija , R. , Butler , A. , Hoffman , P. , Smibert , P. , Papalexi , E. , and Satija , R . ( 2018 -04-02). Integrating single-cell transcriptomic data across different conditions, technologies, and species . Nature Biotechnology 2018 36 :5 36 . doi: 10.1038/nbt.4096 . OpenUrl CrossRef 86. ↵ Nurse , P . ( 2000 /01/07). A Long Twentieth Century of the Cell Cycle and Beyond . Cell 100 . doi: 10.1016/S0092-8674(00)81684-0 . OpenUrl CrossRef PubMed Web of Science 87. ↵ Koepp , D.M. , Harper , J.W. , and Elledge , S.J . ( 1999 /05/14). How the Cyclin Became a Cyclin . Cell 97 . doi: 10.1016/S0092-8674(00)80753-9 . OpenUrl CrossRef PubMed Web of Science 88. ↵ Kim , J.-Y. , Jeong , H.S. , Chung , T. , Kim , M. , Lee , J.H. , Jung , W.H. , Koo , J.S. , Kim , J.-Y. , Jeong , H.S. , Chung , T. , et al. ( 2017 -05-10). The value of phosphohistone H3 as a proliferation marker for evaluating invasive breast cancers: A comparative study with Ki67 . Oncotarget 8 . doi: 10.18632/oncotarget.17775 . OpenUrl CrossRef PubMed 89. ↵ Gratzner , H.G . ( 1982 -10-29). Monoclonal Antibody to 5-Bromo– and 5-Iododeoxyuridine: A New Reagent for Detection of DNA Replication . Science 218 . doi: 10.1126/science.7123245 . OpenUrl Abstract / FREE Full Text 90. ↵ Buck , S.B. , Bradford , J. , Gee , K.R. , Agnew , B.J. , Clarke , S.T. , and Salic , A . ( 2008 -6-1). Detection of S-phase Cell Cycle Progression using 5-ethynyl-2′-deoxyuridine Incorporation with Click Chemistry, an Alternative to using 5-bromo-2′-deoxyuridine Antibodies . BioTechniques 44 . doi: 10.2144/000112812 . OpenUrl CrossRef PubMed 91. ↵ Miller , I. , Min , M. , Yang , C. , Tian , C. , Gookin , S. , Carter , D. , and Spence , S.L . ( 2018 Jul 31). Ki67 is a Graded Rather than a Binary Marker of Proliferation versus Quiescence . Cell reports 24 . doi: 10.1016/j.celrep.2018.06.110 . OpenUrl CrossRef PubMed 92. ↵ Giotti , B. , Chen , S.-H. , Barnett , M.W. , Regan , T. , Ly , T. , Wiemann , S. , Hume , D.A. , and Freeman , T.C . ( 2019 /08). Assembly of a parts list of the human mitotic cell cycle machinery . Journal of Molecular Cell Biology 11 . doi: 10.1093/jmcb/mjy063 . OpenUrl CrossRef 93. ↵ Vermeulen , K. , Bockstaele , D.R.V. , and Berneman , Z.N . ( 2003 /06). The cell cycle: a review of regulation, deregulation and therapeutic targets in cancer . Cell Proliferation 36 . doi: 10.1046/j.1365-2184.2003.00266.x . OpenUrl CrossRef PubMed Web of Science 94. ↵ Barnum , K.J. , and O’Connell , M.J . ( 2014 ). Cell Cycle Regulation by Checkpoints. Methods in molecular biology (Clifton , N.J .) 1170 . doi: 10.1007/978-1-4939-0888-2_2 . OpenUrl CrossRef PubMed 95. ↵ Tamura , R.E. , Vasconcellos , J.F.d. , Sarkar , D. , Libermann , T.A. , Fisher , P.B. , and Zerbini , L.F. ( 2012 /06). GADD45 proteins: central players in tumorigenesis . Current molecular medicine 12 . doi: 10.2174/156652412800619978 . OpenUrl CrossRef PubMed 96. ↵ Mulligan , G. , and Jacks , T . ( 1998 /06/01). The retinoblastoma gene family: cousins with overlapping interests . Trends in Genetics 14 . doi: 10.1016/S0168-9525(98)01470-X . OpenUrl CrossRef PubMed Web of Science 97. ↵ Zhang , M. , Zhang , L. , Hei , R. , Li , X. , Cai , H. , Wu , X. , Zheng , Q. , and Cai , C . ( 2021 ). CDK inhibitors in cancer therapy, an overview of recent development . Am J Cancer Res 11 , 1913 – 1935 . OpenUrl PubMed 98. ↵ Xia , Y. , Liu , Y. , Yang , C. , Simeone , D.M. , Sun , T.-T. , DeGraff , D.J. , Tang , M.-s. , Zhang , Y. , Wu , X.-R. , Xia , Y. , et al. ( 2021 -04-06). Dominant role of CDKN2B/p15INK4B of 9p21.3 tumor suppressor hub in inhibition of cell-cycle and glycolysis . Nature Communications 2021 12: 1 12 . doi: 10.1038/s41467-021-22327-5 . OpenUrl CrossRef 99. ↵ Gorczyca , W. , Bruno , S. , Darzynkiewicz , R.J. , Gong , J.P. , and Darzynkiewicz , Z . ( 1992 Nov). DNA strand breaks occurring during apoptosis – their early insitu detection by the terminal deoxynucleotidyl transferase and nick translation assays and prevention by serine protease inhibitors . International journal of oncology 1 . doi: 10.3892/ijo.1.6.639 . OpenUrl CrossRef 100. ↵ Porter , A.G. , Jänicke , R.U. , Porter , A.G. , and Jänicke , R.U . ( 1999 -01-28). Emerging roles of caspase-3 in apoptosis . Cell Death & Differentiation 1999 6 : 2 6. doi: 10.1038/sj.cdd.4400476 . OpenUrl CrossRef 101. ↵ Mort , R.L. , Ford , M.J. , Sakaue-Sawano , A. , Lindstrom , N.O. , Casadio , A. , Douglas , A.T. , Keighren , M.A. , Hohenstein , P. , Miyawaki , A. , and Jackson , I.J . ( 2014 -9-2). Fucci2a: A bicistronic cell cycle reporter that allows Cre mediated tissue specific expression in mice . Cell Cycle 13 . doi: 10.4161/15384101.2015.945381 . OpenUrl CrossRef PubMed 102. ↵ Reid , B.S. , Yang , H. , Melvin , V.S. , Taketo , M.M. , and Williams , T . ( 2011 ). Ectodermal WNT/β-catenin signaling shapes the mouse face . Developmental Biology 349 , 261 – 269 . doi: 10.1016/j.ydbio.2010.11.012 . OpenUrl CrossRef PubMed 103. ↵ Selleri , L. , Depew , M.J. , Jacobs , Y. , Chanda , S.K. , Tsang , K.Y. , Cheah , K.S.E. , Rubenstein , J.L.R. , O’Gorman , S. , and Cleary , M.L. ( 2001 ). Requirement for Pbx1in skeletal patterning and programming chondrocyte proliferation and differentiation . Development 128 , 3543 – 3557 . doi: 10.1242/dev.128.18.3543 . OpenUrl Abstract / FREE Full Text 104. ↵ Selleri , L. , Dimartino , J. , Van Deursen , J. , Brendolan , A. , Sanyal , M. , Boon , E. , Capellini , T. , Smith , K.S. , Rhee , J. , Pöpperl , H. , et al. ( 2004 ). The TALE Homeodomain Protein Pbx2 Is Not Essential for Development and Long-Term Survival . Molecular and Cellular Biology 24 , 5324 – 5331 . doi: 10.1128/mcb.24.12.5324-5331.2004 . OpenUrl Abstract / FREE Full Text 105. ↵ Yang , A. , Schweitzer , R. , Sun , D. , Kaghad , M. , Walker , N. , Bronson , R.T. , Tabin , C. , Sharpe , A. , Caput , D. , Crum , C. , and McKeon , F . ( 1999 ). p63 is essential for regenerative proliferation in limb, craniofacial and epithelial development . Nature 398 , 714 – 718 . doi: 10.1038/19539 . OpenUrl CrossRef PubMed Web of Science 106. ↵ Li , Y. , Giovannini , S. , Wang , T. , Fang , J. , Li , P. , Shao , C. , Wang , Y. , Shi , Y. , Candi , E. , Melino , G. , et al. ( 2023 -10-17). p63: a crucial player in epithelial stemness regulation . Oncogene 2023 42 : 46 42 . doi: 10.1038/s41388-023-02859-4 . OpenUrl CrossRef 107. ↵ Thomason , H.A. , Dixon , M.J. , and Dixon , J . ( 2008 ). Facial clefting in Tp63 deficient mice results from altered Bmp4, Fgf8 and Shh signaling . Developmental Biology 321 , 273 – 282 . doi: 10.1016/j.ydbio.2008.06.030 . OpenUrl CrossRef PubMed Web of Science 108. ↵ Khandelwal , K.D. , van den Boogaard , M.-J.H. , Mehrem , S.L. , Gebel , J. , Fagerberg , C. , van Beusekom , E. , van Binsbergen , E. , Topaloglu , O. , Steehouwer , M. , Gilissen , C. , et al. ( 2019 -03-08). Deletions and loss-of-function variants in TP63 associated with orofacial clefting . European Journal of Human Genetics 2019 27 : 7 27 . doi: 10.1038/s41431-019-0370 -0. OpenUrl CrossRef 109. ↵ Qiao , C. , and Huang , Y . ( 2021 -12-3). Representation learning of RNA velocity reveals robust cell transitions . Proceedings of the National Academy of Sciences 118 . doi: 10.1073/pnas.2105859118 . OpenUrl Abstract / FREE Full Text 110. ↵ Liu , S. , and Trapnell , C . ( 2016 ). Single-cell transcriptome sequencing: recent advances and remaining challenges . F1000Research 5 . doi: 10.12688/f1000research.7223.1 . OpenUrl CrossRef PubMed 111. ↵ Erdmann-Pham , D.D. , Fischer , J. , Hong , J. , and Song , Y.S . ( 2021 -10-01). Likelihood-based deconvolution of bulk gene expression data using single-cell references . Genome Research 31 . doi: 10.1101/gr.272344.120 . OpenUrl Abstract / FREE Full Text 112. ↵ Zhang , P . ( 1999 /12/01). The cell cycle and development: redundant roles of cell cycle regulators . Current Opinion in Cell Biology 11 . doi: 10.1016/S0955-0674(99)00032-0 . OpenUrl CrossRef PubMed Web of Science 113. ↵ Selleri , L. , Rijli , F.M. , Selleri , L. , and Rijli , F.M . ( 2023 -04-24). Shaping faces: genetic and epigenetic control of craniofacial morphogenesis . Nature Reviews Genetics 2023 24 : 9 24 . doi: 10.1038/s41576-023-00594-w . OpenUrl CrossRef 114. ↵ Diewert , V.M . ( 1985 ). Development of human craniofacial morphology during the late embryonic and early fetal periods . American Journal of Orthodontics 88 , 64 – 76 . doi: 10.1016/0002-9416(85)90107-1 . OpenUrl CrossRef PubMed Web of Science 115. ↵ O’Rahilly , R. , and Müller , F . ( 2010 /07/01). Developmental Stages in Human Embryos: Revised and New Measurements . Cells Tissues Organs 192 . doi: 10.1159/000289817 . OpenUrl CrossRef PubMed Web of Science 116. ↵ Marcucio , R. , Hallgrimsson , B. , and Young , N.M . ( 2015 ). Facial morphogenesis: physical and molecular interactions between the brain and face . Current topics in developmental biology 115 . doi: 10.1016/bs.ctdb.2015.09.001 . OpenUrl CrossRef PubMed 117. ↵ Mukhopadhyay , N. , Bishop , M. , Mortillo , M. , Chopra , P. , Hetmanski , J.B. , Taub , M.A. , Moreno , L.M. , Valencia-Ramirez , L.C. , Restrepo , C. , Wehby , G.L. , et al. ( 2019 -12-17). Whole genome sequencing of orofacial cleft trios from the Gabriella Miller Kids First Pediatric Research Consortium identifies a new locus on chromosome 21 . Human Genetics 2019 139 : 2 139. doi: 10.1007/s00439-019-02099-1 . OpenUrl CrossRef 118. ↵ Michael Brancaccio , M. , Sethi , S. , Elizabeth Satija , R. , Jessica Jagannath , A. , Couch , Y. , Mattéa , Nicola , et al. ( 2015 ). The Regulatory Factor ZFHX3 Modifies Circadian Function in SCN via an AT Motif-Driven Axis . Cell 162 , 607 – 621 . doi: 10.1016/j.cell.2015.06.060 . OpenUrl CrossRef PubMed 119. ↵ Pérez Baca , M.D.R. , Jacobs , E.Z. , Vantomme , L. , Leblanc , P. , Bogaert , E. , Dheedene , A. , De Cock , L. , Haghshenas , S. , Foroutan , A. , Levy , M.A. , et al. ( 2024 ). Haploinsufficiency of ZFHX3, encoding a key player in neuronal development, causes syndromic intellectual disability . The American Journal of Human Genetics 111 , 509 – 528 . doi: 10.1016/j.ajhg.2024.01.013 . OpenUrl CrossRef PubMed 120. ↵ Jameson , H.S. , Hanley , A. , Hill , M.C. , Xiao , L. , Ye , J. , Bapat , A. , Ronzier , E. , Hall , A.W. , Hucker , W.J. , Clauss , S. , et al. ( 2023 ). Loss of the Atrial Fibrillation-Related Gene, Zfhx3, Results in Atrial Dilation and Arrhythmias . Circulation Research 133 , 313 – 329 . doi: 10.1161/circresaha.123.323029 . OpenUrl CrossRef PubMed 121. ↵ Bishop , M.R. , Diaz Perez , K.K. , Sun , M. , Ho , S. , Chopra , P. , Mukhopadhyay , N. , Hetmanski , J.B. , Taub , M.A. , Moreno-Uribe , L.M. , Valencia-Ramirez , L.C. , et al. ( 2020 ). Genome-wide Enrichment of De Novo Coding Mutations in Orofacial Cleft Trios . The American Journal of Human Genetics 107 , 124 – 136 . doi: 10.1016/j.ajhg.2020.05.018 . OpenUrl CrossRef PubMed 122. ↵ Feldman , E.R. , Li , Y. , Cutler , D.J. , Rosser , T.C. , Wechsler , S.B. , Sanclemente , L. , Rachubinski , A.L. , Elliott , N. , Vyas , P. , Roberts , I. , et al. ( 2024 -09-06). Genome-wide association studies of Down syndrome associated congenital heart defects . medRxiv . doi: 10.1101/2024.09.06.24313183 . OpenUrl Abstract / FREE Full Text 123. ↵ Chen , S. , Francioli , L.C. , Goodrich , J.K. , Collins , R.L. , Kanai , M. , Wang , Q. , Alföldi , J. , Watts , N.A. , Vittal , C. , Gauthier , L.D. , et al. ( 2023 -12-06). A genomic mutational constraint map using variation in 76,156 human genomes . Nature 2023 625 : 7993 625 . doi: 10.1038/s41586-023-06045-0 . OpenUrl CrossRef PubMed 124. ↵ Sun , X. , Fu , X. , Li , J. , Xing , C. , Martin , D.W. , Zhang , H.H. , Chen , Z. , and Dong , J.T . ( 2012 ). Heterozygous deletion of Atbf1 by the Cre-loxP system in mice causes preweaning mortality . genesis 50 , 819 – 827 . doi: 10.1002/dvg.22041 . OpenUrl CrossRef PubMed 125. ↵ Losa , M. , Barozzi , I. , Osterwalder , M. , Hermosilla-Aguayo , V. , Morabito , A. , Chacón , B.H. , Zarrineh , P. , Girdziusaite , A. , Benazet , J.D. , Zhu , J. , et al. ( 2023 -07-06). A spatio-temporally constrained gene regulatory network directed by PBX1/2 acquires limb patterning specificity via HAND2 . Nature Communications 2023 14 :1 14 . doi: 10.1038/s41467-023-39443-z . OpenUrl CrossRef PubMed 126. Brendolan , A. , Ferretti , E. , Salsi , V. , Moses , K. , Quaggin , S. , Blasi , F. , Cleary , M.L. , and Selleri , L . ( 2005 /07/01). A Pbx1-dependent genetic and transcriptional network regulates spleen ontogeny . Development 132 . doi: 10.1242/dev.01884 . OpenUrl Abstract / FREE Full Text 127. ↵ Peiró , S. , Escrivà , M. , Puig , I. , Barberà , M.J. , Dave , N. , Herranz , N. , Larriba , M.J. , Takkunen , M. , Francí , C. , Muñoz , A. , et al. ( 2006 ). Snail1 transcriptional repressor binds to its own promoter and controls its expression . Nucleic Acids Research 34 . doi: 10.1093/nar/gkl141 . OpenUrl CrossRef PubMed Web of Science 128. ↵ Attanasio , C. , Nord , A.S. , Zhu , Y. , Blow , M.J. , Li , Z. , Liberton , D.K. , Morrison , H. , Plajzer-Frick , I. , Holt , A. , Hosseini , R. , et al. ( 2013 ). Fine Tuning of Craniofacial Morphology by Distant-Acting Enhancers . Science 342 , 1241006 – 1241006 . doi: 10.1126/science.1241006 . OpenUrl Abstract / FREE Full Text 129. ↵ Creyghton , M.P. , Cheng , A.W. , Welstead , G.G. , Kooistra , T. , Carey , B.W. , Steine , E.J. , Hanna , J. , Lodato , M.A. , Frampton , G.M. , Sharp , P.A. , et al. ( 2010 -12-14). Histone H3K27ac separates active from poised enhancers and predicts developmental state . Proceedings of the National Academy of Sciences 107 . doi: 10.1073/pnas.1016071107 . OpenUrl Abstract / FREE Full Text 130. ↵ Long , H.K. , Prescott , S.L. , and Wysocka , J . ( 2016 /11/17). Ever-Changing Landscapes: Transcriptional Enhancers in Development and Evolution . Cell 167 . doi: 10.1016/j.cell.2016.09.018 . OpenUrl CrossRef PubMed 131. ↵ Buenrostro , J. , Wu , B. , Chang , H. , and Greenleaf , W. ( 2015 ). ATAC-seq: A Method for Assaying Chromatin Accessibility Genome-Wide . Current protocols in molecular biology / edited by Frederick M. Ausubel … [et al.] 109 . doi: 10.1002/0471142727.mb2129s109 . OpenUrl CrossRef PubMed 132. ↵ McLean , C.Y. , Bristor , D. , Hiller , M. , Clarke , S.L. , Schaar , B.T. , Lowe , C.B. , Wenger , A.M. , and Bejerano , G . ( 2010 ). GREAT improves functional interpretation of cis-regulatory regions . Nature Biotechnology 28 , 495 – 501 . doi: 10.1038/nbt.1630 . OpenUrl CrossRef PubMed Web of Science 133. ↵ Di Micco , R. , Krizhanovsky , V. , Baker , D. , d’Adda di Fagagna , F. , Di Micco , R. , Krizhanovsky , V. , Baker , D. , and d’Adda di Fagagna , F. ( 2020 -12-16). Cellular senescence in ageing: from mechanisms to therapeutic opportunities . Nature Reviews Molecular Cell Biology 2020 22 : 2 22. doi: 10.1038/s41580-020-00314-w . OpenUrl CrossRef 134. ↵ Kumari , R. , and Jat , P . ( 2021 /03/29). Frontiers | Mechanisms of Cellular Senescence: Cell Cycle Arrest and Senescence Associated Secretory Phenotype . Frontiers in Cell and Developmental Biology 9 . doi: 10.3389/fcell.2021.645593 . OpenUrl CrossRef PubMed 135. ↵ Heinz , S. , Benner , C. , Spann , N. , Bertolino , E. , Lin , Y.C. , Laslo , P. , Cheng , J.X. , Murre , C. , Singh , H. , and Glass , C.K . ( 2010 ). Simple Combinations of Lineage-Determining Transcription Factors Prime cis-Regulatory Elements Required for Macrophage and B Cell Identities . Molecular Cell 38 , 576 – 589 . doi: 10.1016/j.molcel.2010.05.004 . OpenUrl CrossRef PubMed Web of Science 136. ↵ Koss , M. , Bolze , A. , Brendolan , A. , Saggese , M. , Terence , Bojilova , E. , Boisson , B. , Owen , Elliott , D.A. , Solloway , M. , et al. ( 2012 ). Congenital Asplenia in Mice and Humans with Mutations in a Pbx/Nkx2-5/p15 Module . Developmental Cell 22 , 913 – 926 . doi: 10.1016/j.devcel.2012.02.009 . OpenUrl CrossRef PubMed Web of Science 137. ↵ Cai , S. , and Yin , N . ( 2024 /10/01). Single-cell transcriptome and chromatin accessibility mapping of upper lip and primary palate fusion . Journal of Cellular and Molecular Medicine 28 . doi: 10.1111/jcmm.70128 . OpenUrl CrossRef 138. ↵ Zajic , E.L.M. , Zhao , R. , McKinney , M.C. , Yi , K. , Wood , C. , Trainor , P.A. , Moore Zajic , E.L. , Zhao , R. , McKinney , M.C. , Yi , K. , et al. ( 2025 -3-10). Cell extrusion drives neural crest cell delamination . Proceedings of the National Academy of Sciences 122 . doi: 10.1073/pnas.2416566122 . OpenUrl CrossRef 139. ↵ Childs , B.G. , Baker , D.J. , Kirkland , J.L. , Campisi , J. , and Deursen , J.M.v. ( 2014 -10-13). Senescence and apoptosis: dueling or complementary cell fates? EMBO reports 15 . doi: 10.15252/embr.201439245 . OpenUrl Abstract / FREE Full Text 140. ↵ Storer , M. , Mas , A. , Robert-Moreno , A. , Pecoraro , M. , Ortells , M.C. , Di Giacomo , V. , Yosef , R. , Pilpel , N. , Krizhanovsky , V. , Sharpe , J. , and Keyes , William M. ( 2013 /11/21). Senescence Is a Developmental Mechanism that Contributes to Embryonic Growth and Patterning . Cell 155 . doi: 10.1016/j.cell.2013.10.041 . OpenUrl CrossRef PubMed Web of Science 141. Rayess , H. , Wang , M.B. , and Srivatsan , E.S . ( 2012 /04/15). Cellular senescence and tumor suppressor gene p16 . International Journal of Cancer 130 . doi: 10.1002/ijc.27316 . OpenUrl CrossRef PubMed Web of Science 142. Stein , G.H. , Drullinger , L.F. , Soulard , A. , and Dulić , V . ( 1999 -3-1). Differential Roles for Cyclin-Dependent Kinase Inhibitors p21 and p16 in the Mechanisms of Senescence and Differentiation in Human Fibroblasts . Molecular and Cellular Biology 19 . doi: 10.1128/MCB.19.3.2109 . OpenUrl Abstract / FREE Full Text 143. ↵ Besson , A. , Dowdy , S.F. , and Roberts , J.M . ( 2008 ). CDK Inhibitors: Cell Cycle Regulators and Beyond . Developmental Cell 14 , 159 – 169 . doi: 10.1016/j.devcel.2008.01.013 . OpenUrl CrossRef PubMed Web of Science 144. ↵ Collins , K. , Jacks , T. , Pavletich , N.P. , Collins , K. , Jacks , T. , and Pavletich , N.P . ( 1997 -4-1). The cell cycle and cancer . Proceedings of the National Academy of Sciences 94 . doi: 10.1073/pnas.94.7.2776 . OpenUrl FREE Full Text 145. Otto , T. , Sicinski , P. , Otto , T. , and Sicinski , P . ( 2017 -01-27). Cell cycle proteins as promising targets in cancer therapy . Nature Reviews Cancer 2017 17 : 2 17 . doi: 10.1038/nrc.2016.138 . OpenUrl CrossRef 146. Bayarmagnai , B. , Perrin , L. , Esmaeili Pourfarhangi , K. , Graña , X. , Tüzel , E. , and Gligorijevic , B . ( 2019 /10/15). Invadopodia-mediated ECM degradation is enhanced in the G1 phase of the cell cycle . Journal of Cell Science 132 . doi: 10.1242/jcs.227116 . OpenUrl Abstract / FREE Full Text 147. Kohrman , A.Q. , and Matus , D.Q . ( 2017 /01/01). Divide or Conquer: Cell Cycle Regulation of Invasive Behavior . Trends in Cell Biology 27 . doi: 10.1016/j.tcb.2016.08.003 . OpenUrl CrossRef PubMed 148. Lan , T. , Yu , M. , Chen , W. , Yin , J. , Chang , H.-T. , Tang , S. , Zhao , Y. , Svoronos , S. , Wong , S.W.K. , Tseng , Y. , et al. ( 2021 -12-06). Decomposition of cell activities revealing the role of the cell cycle in driving biofunctional heterogeneity . Scientific Reports 2021 11 : 1 11 . doi: 10.1038/s41598-021-02926-4 . OpenUrl CrossRef 149. ↵ Martinez , M.A.Q. , Zhao , C.Z. , Moore , F.E.Q. , Yee , C. , Zhang , W. , Shen , K. , Martin , B.L. , and Matus , D.Q . ( 2024 /05/01). Cell cycle perturbation uncouples mitotic progression and invasive behavior in a post-mitotic cell . Differentiation 137 . doi: 10.1016/j.diff.2024.100765 . OpenUrl CrossRef 150. ↵ Leise , W.F. , and Mueller , P.R . ( 2004 /04/15). Inhibition of the cell cycle is required for convergent extension of the paraxial mesoderm during Xenopus neurulation . Development 131 . doi: 10.1242/dev.01054 . OpenUrl Abstract / FREE Full Text 151. Murakami , M.S. , Moody , S.A. , Daar , I.O. , and Morrison , D.K . ( 2004 /02/01). Morphogenesis during Xenopus gastrulation requires Wee1-mediated inhibition of cell proliferation . Development 131 . doi: 10.1242/dev.00971 . OpenUrl Abstract / FREE Full Text 152. Großhans , J. , and Wieschaus , E . ( 2000 /05/26). A Genetic Link between Morphogenesis and Cell Division during Formation of the Ventral Furrow in Drosophila . Cell 101 . doi: 10.1016/S0092-8674(00)80862-4 . OpenUrl CrossRef PubMed Web of Science 153. ↵ Matthew , J. , Vishwakarma , V. , Le , T.P. , Agsunod , R.A. , and Chung , S . ( 2024 -01-26). Coordination of cell cycle and morphogenesis during organ formation . eLife 13 . doi: 10.7554/eLife.95830 . OpenUrl CrossRef 154. ↵ Kim , S. , and Wysocka , J . ( 2023 /02/02). Deciphering the multi-scale, quantitative cis-regulatory code . Molecular Cell 83 . doi: 10.1016/j.molcel.2022.12.032 . OpenUrl CrossRef PubMed 155. ↵ Zhao , C. , Plaza Reyes , A. , Schell , J.P. , Weltner , J. , Ortega , N.M. , Zheng , Y. , Björklund , Å.K. , Baqué-Vidal , L. , Sokka , J. , Trokovic , R. , et al. ( 2024 -11-14). A comprehensive human embryo reference tool using single-cell RNA-sequencing data . Nature Methods 2024 22 : 1 22 . doi: 10.1038/s41592-024-02493-2 . OpenUrl CrossRef 156. Wang , C. , Wang , X. , Wang , W. , Chen , Y. , Chen , H. , Wang , W. , Ye , T. , Dong , J. , Sun , C. , Li , X. , et al. ( 2024 -09-12). Single-cell RNA sequencing analysis of human embryos from the late Carnegie to fetal development . Cell & Bioscience 2024 14 : 1 14 . doi: 10.1186/s13578-024-01302-9 . OpenUrl CrossRef 157. Zhang , B. , He , P. , Lawrence , J.E.G. , Wang , S. , Tuck , E. , Williams , B.A. , Roberts , K. , Kleshchevnikov , V. , Mamanova , L. , Bolt , L. , et al. ( 2023 -12-06). A human embryonic limb cell atlas resolved in space and time . Nature 2023 635 : 8039 635 . doi: 10.1038/s41586-023-06806-x . OpenUrl CrossRef 158. Farah , E.N. , Hu , R.K. , Kern , C. , Zhang , Q. , Lu , T.-Y. , Ma , Q. , Tran , S. , Zhang , B. , Carlin , D. , Monell , A. , et al. ( 2024 -03-13). Spatially organized cellular communities form the developing human heart . Nature 2024 627 : 8005 627 . doi: 10.1038/s41586-024-07171-z . OpenUrl CrossRef 159. ↵ To , K. , Fei , L. , Pett , J.P. , Roberts , K. , Blain , R. , Polański , K. , Li , T. , Yayon , N. , He , P. , Xu , C. , et al. ( 2024 -11-20). A multi-omic atlas of human embryonic skeletal development . Nature 2024 635 : 8039 635 . doi: 10.1038/s41586-024-08189-z . OpenUrl CrossRef 160. ↵ Kerwin , J. , Yang , Y. , Merchan , P. , Sarma , S. , Thompson , J. , Wang , X. , Sandoval , J. , Puelles , L. , Baldock , R. , and Lindsay , S . ( 2010 /10/01). The HUDSEN Atlas: a three-dimensional (3D) spatial framework for studying gene expression in the developing human brain . Journal of Anatomy 217 . doi: 10.1111/j.1469-7580.2010.01290.x . OpenUrl CrossRef PubMed Web of Science 161. ↵ Gerrelli , D. , Lisgo , S. , Copp , A.J. , and Lindsay , S . ( 2015 /09/15). Enabling research with human embryonic and fetal tissue resources . Development 142 . doi: 10.1242/dev.122820 . OpenUrl Abstract / FREE Full Text 162. ↵ Miura , Y. , Tam , T. , Ido , A. , Morinaga , T. , Miki , T. , Hashimoto , T. , and Tamaoki , T . ( 1995 /11/10). Cloning and Characterization of an ATBF1 Isoform That Expresses in a Neuronal Differentiation-dependent Manner (*) . Journal of Biological Chemistry 270 . doi: 10.1074/jbc.270.45.26840 . OpenUrl Abstract / FREE Full Text References 1. ↵ Sun , X. , Fu , X. , Li , J. , Xing , C. , Martin , D.W. , Zhang , H.H. , Chen , Z. , and Dong , J.T . ( 2012 ). Heterozygous deletion of Atbf1 by the Cre-loxP system in mice causes preweaning mortality . genesis 50 , 819 – 827 . doi: 10.1002/dvg.22041 . OpenUrl CrossRef PubMed 2. ↵ Selleri , L. , Depew , M.J. , Jacobs , Y. , Chanda , S.K. , Tsang , K.Y. , Cheah , K.S.E. , Rubenstein , J.L.R. , O’Gorman , S. , and Cleary , M.L. ( 2001 ). Requirement for Pbx1in skeletal patterning and programming chondrocyte proliferation and differentiation . Development 128 , 3543 – 3557 . doi: 10.1242/dev.128.18.3543 . OpenUrl Abstract / FREE Full Text 3. Ferretti , E. , Li , B. , Zewdu , R. , Wells , V. , Hebert , Jean M. , Karner , C. , Anderson , Matthew J. , Williams , T. , Dixon , J. , Dixon , Michael J. , et al. ( 2011 /10/18). A Conserved Pbx-Wnt-p63-Irf6 Regulatory Module Controls Face Morphogenesis by Promoting Epithelial Apoptosis . Developmental Cell 21 . doi: 10.1016/j.devcel.2011.08.005 . OpenUrl CrossRef PubMed Web of Science 4. ↵ Losa , M. , Risolino , M. , Li , B. , Hart , J. , Quintana , L. , Grishina , I. , Yang , H. , Choi , I.F. , Lewicki , P. , Khan , S. , et al. ( 2018 /03/01). Face morphogenesis is promoted by Pbx-dependent EMT via regulation of Snail1 during frontonasal prominence fusion . Development 145 . doi: 10.1242/dev.157628 . OpenUrl Abstract / FREE Full Text 5. ↵ Selleri , L. , Dimartino , J. , Van Deursen , J. , Brendolan , A. , Sanyal , M. , Boon , E. , Capellini , T. , Smith , K.S. , Rhee , J. , Pöpperl , H. , et al. ( 2004 ). The TALE Homeodomain Protein Pbx2 Is Not Essential for Development and Long-Term Survival . Molecular and Cellular Biology 24 , 5324 – 5331 . doi: 10.1128/mcb.24.12.5324-5331.2004 . OpenUrl Abstract / FREE Full Text 6. ↵ Koss , M. , Bolze , A. , Brendolan , A. , Saggese , M. , Terence , Bojilova , E. , Boisson , B. , Owen , Elliott , D.A. , Solloway , M. , et al. ( 2012 ). Congenital Asplenia in Mice and Humans with Mutations in a Pbx/Nkx2-5/p15 Module . Developmental Cell 22 , 913 – 926 . doi: 10.1016/j.devcel.2012.02.009 . OpenUrl CrossRef PubMed Web of Science 7. ↵ Yang , A. , Schweitzer , R. , Sun , D. , Kaghad , M. , Walker , N. , Bronson , R.T. , Tabin , C. , Sharpe , A. , Caput , D. , Crum , C. , et al. ( 1999 /04). p63 is essential for regenerative proliferation in limb, craniofacial and epithelial development . Nature 1999 398 : 6729 398 . doi: 10.1038/19539 . OpenUrl CrossRef 8. ↵ Thomason , H.A. , Dixon , M.J. , and Dixon , J . ( 2008 ). Facial clefting in Tp63 deficient mice results from altered Bmp4, Fgf8 and Shh signaling . Developmental Biology 321 , 273 – 282 . doi: 10.1016/j.ydbio.2008.06.030 . OpenUrl CrossRef PubMed Web of Science 9. ↵ Reid , B.S. , Yang , H. , Melvin , V.S. , Taketo , M.M. , and Williams , T . ( 2011 ). Ectodermal WNT/β-catenin signaling shapes the mouse face . Developmental Biology 349 , 261 – 269 . doi: 10.1016/j.ydbio.2010.11.012 . OpenUrl CrossRef PubMed 10. ↵ Liu , W. , Selever , J. , Lu , M.-F. , and Martin , J.F . ( 2003 /12/22). Genetic dissection of Pitx2 in craniofacial development uncovers new functions in branchial arch morphogenesis, late aspects of tooth morphogenesis and cell migration . Development 130 . doi: 10.1242/dev.00849 . OpenUrl Abstract / FREE Full Text 11. ↵ Shan , J. , Jokela , T. , Skovorodkin , I. , and Vainio , S . ( 2010 ). Mapping of the fate of cell lineages generated from cells that express the Wnt4 gene by time-lapse during kidney development . Differentiation 79 , 57 – 64 . doi: 10.1016/j.diff.2009.08.006 . OpenUrl CrossRef PubMed 12. ↵ Madisen , L. , Zwingman , T.A. , Sunkin , S.M. , Oh , S.W. , Zariwala , H.A. , Gu , H. , Ng , L.L. , Palmiter , R.D. , Hawrylycz , M.J. , Jones , A.R. , et al. ( 2009 -12-20). A robust and high-throughput Cre reporting and characterization system for the whole mouse brain . Nature Neuroscience 2009 13 : 1 13 . doi: 10.1038/nn.2467 . OpenUrl CrossRef 13. ↵ Mort , R.L. , Ford , M.J. , Sakaue-Sawano , A. , Lindstrom , N.O. , Casadio , A. , Douglas , A.T. , Keighren , M.A. , Hohenstein , P. , Miyawaki , A. , and Jackson , I.J . ( 2014 -9-2). Fucci2a: A bicistronic cell cycle reporter that allows Cre mediated tissue specific expression in mice . Cell Cycle 13 . doi: 10.4161/15384101.2015.945381 . OpenUrl CrossRef PubMed 14. ↵ Wang , F. , Flanagan , J. , Su , N. , Wang , L.-C. , Bui , S. , Nielson , A. , Wu , X. , Vo , H.-T. , Ma , X.-J. , and Luo , Y . ( 2012 /01). RNAscope: A Novel in Situ RNA Analysis Platform for Formalin-Fixed, Paraffin-Embedded Tissues . The Journal of Molecular Diagnostics: JMD 14 . doi: 10.1016/j.jmoldx.2011.08.002 . OpenUrl CrossRef PubMed Web of Science 15. ↵ Barkas , N. , Petukhov , V. , Kharchenko , P. , and Biederstedt , E . ( 2021 ). pagoda2: single cell analysis and differential expression . R package version 1 . 16. ↵ Becht , E. , McInnes , L. , Healy , J. , Dutertre , C.-A. , Kwok , I.W.H. , Ng , L.G. , Ginhoux , F. , and Newell , E.W . ( 2018 -12-03). Dimensionality reduction for visualizing single-cell data using UMAP . Nature Biotechnology 2018 37 : 1 37. doi: 10.1038/nbt.4314 . OpenUrl CrossRef 17. ↵ Traag , V.A. , Waltman , L. , and van Eck , N.J. ( 2019 -03-26). From Louvain to Leiden: guaranteeing well-connected communities . Scientific Reports 2019 9 : 1 9 . doi: 10.1038/s41598-019-41695-z . OpenUrl CrossRef 18. ↵ Fan , J. , Salathia , N. , Liu , R. , Kaeser , G.E. , Yung , Y.C. , Herman , J.L. , Kaper , F. , Fan , J.-B. , Zhang , K. , Chun , J. , and Kharchenko , P.V . ( 2016 -01-18). Characterizing transcriptional heterogeneity through pathway and gene set overdispersion analysis . Nature Methods 2015 13 : 3 13 . doi: 10.1038/nmeth.3734 . OpenUrl CrossRef 19. ↵ Gulati , G.S. , Sikandar , S.S. , Wesche , D.J. , Manjunath , A. , Bharadwaj , A. , Berger , M.J. , Ilagan , F. , Kuo , Angera H. , Hsieh , R.W. , Cai , S. , et al. ( 2020 -01-24). Single-cell transcriptional diversity is a hallmark of developmental potential . Science 367 . doi: 10.1126/science.aax0249 . OpenUrl Abstract / FREE Full Text 20. ↵ Barkas , N. , Petukhov , V. , Nikolaeva , D. , Lozinsky , Y. , Demharter , S. , Khodosevich , K. , and Kharchenko , P.V . ( 2019 -07-15). Joint analysis of heterogeneous single-cell RNA-seq dataset collections . Nature Methods 2019 16 : 8 16 . doi: 10.1038/s41592-019-0466-z . OpenUrl CrossRef PubMed 21. ↵ Melsted , P. , Booeshaghi , A.S. , Liu , L. , Gao , F. , Lu , L. , Min , K.H.J. , da Veiga Beltrame , E. , Hjörleifsson , K.E. , Gehring , J. , and Pachter , L. ( 2021 -04-01). Modular, efficient and constant-memory single-cell RNA-seq preprocessing . Nature Biotechnology 2021 39 : 7 39. doi: 10.1038/s41587-021-00870-2 . OpenUrl CrossRef PubMed 22. ↵ Bergen , V. , Lange , M. , Peidli , S. , Wolf , F.A. , and Theis , F.J . ( 2020 -08-03). Generalizing RNA velocity to transient cell states through dynamical modeling . Nature Biotechnology 2020 38 : 12 38. doi: 10.1038/s41587-020-0591-3 . OpenUrl CrossRef PubMed 23. ↵ Qiao , C. , and Huang , Y . ( 2021 -12-3). Representation learning of RNA velocity reveals robust cell transitions . Proceedings of the National Academy of Sciences 118 . doi: 10.1073/pnas.2105859118 . OpenUrl Abstract / FREE Full Text 24. ↵ Dobin , A. , Davis , C.A. , Schlesinger , F. , Drenkow , J. , Zaleski , C. , Jha , S. , Batut , P. , Chaisson , M. , and Gingeras , T.R . ( 2013 /01/01). STAR: ultrafast universal RNA-seq aligner . Bioinformatics 29 . doi: 10.1093/bioinformatics/bts635 . OpenUrl CrossRef PubMed Web of Science 25. ↵ Liao , Y. , Smyth , G.K. , and Shi , W . ( 2014 /04/01). featureCounts: an efficient general purpose program for assigning sequence reads to genomic features . Bioinformatics 30 . doi: 10.1093/bioinformatics/btt656 . OpenUrl CrossRef PubMed Web of Science 26. ↵ Love , M.I. , Huber , W. , and Anders , S . ( 2014 -12-05). Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2 . Genome Biology 2014 15 : 12 15 . doi: 10.1186/s13059-014 -0550-8. OpenUrl CrossRef 27. ↵ Losa , M. , Barozzi , I. , Osterwalder , M. , Hermosilla-Aguayo , V. , Morabito , A. , Chacón , B.H. , Zarrineh , P. , Girdziusaite , A. , Benazet , J.D. , Zhu , J. , et al. ( 2023 -07-06). A spatio-temporally constrained gene regulatory network directed by PBX1/2 acquires limb patterning specificity via HAND2 . Nature Communications 2023 14 : 1 14 . doi: 10.1038/s41467-023-39443-z . OpenUrl CrossRef PubMed 28. ↵ Ewels , P.A. , Peltzer , A. , Fillinger , S. , Patel , H. , Alneberg , J. , Wilm , A. , Garcia , M.U. , Di Tommaso , P. , and Nahnsen , S. ( 2020 -02-13). The nf-core framework for community-curated bioinformatics pipelines . Nature Biotechnology 2020 38 : 3 38 . doi: 10.1038/s41587-020-0439-x . OpenUrl CrossRef 29. ↵ Patel , H. , Espinosa-Carrasco , J. , Wang , C. , Ewels , P. , bot , n.-c. , Silva , T.C. , Peltzer , A. , Langer , B. , Guinchard , S. , Garcia , M.U. , et al. ( 2024 -10-07). nf-core/chipseq: nf-core/chipseq v2.1.0 – Platinum Willow Sparrow . doi: 10.5281/zenodo.13899404 . OpenUrl CrossRef 30. ↵ Langmead , B. , and Salzberg , S.L . ( 2012 Mar 4). Fast gapped-read alignment with Bowtie 2 . Nature methods 9 . doi: 10.1038/nmeth.1923 . OpenUrl CrossRef PubMed Web of Science 31. ↵ Quinlan , A.R. , and Hall , I.M . ( 2010 /03/15). BEDTools: a flexible suite of utilities for comparing genomic features . Bioinformatics 26 . doi: 10.1093/bioinformatics/btq033 . OpenUrl CrossRef PubMed Web of Science 32. ↵ Heinz , S. , Benner , C. , Spann , N. , Bertolino , E. , Lin , Y.C. , Laslo , P. , Cheng , J.X. , Murre , C. , Singh , H. , and Glass , C.K . ( 2010 ). Simple Combinations of Lineage-Determining Transcription Factors Prime cis-Regulatory Elements Required for Macrophage and B Cell Identities . Molecular Cell 38 , 576 – 589 . doi: 10.1016/j.molcel.2010.05.004 . OpenUrl CrossRef PubMed Web of Science 33. ↵ Capellini , T.D. , Zewdu , R. , Giacomo , G.D. , Asciutti , S. , Kugler , J.E. , Gregorio , A.D. , and Selleri , L . ( 2008 Apr 16). Pbx1/Pbx2 govern axial skeletal development by controlling Polycomb and Hox in mesoderm and Pax1/Pax9 in sclerotome . Developmental biology 321 . doi: 10.1016/j.ydbio.2008.04.005 . OpenUrl CrossRef PubMed 34. ↵ Capellini , T.D. , Di Giacomo , G. , Salsi , V. , Brendolan , A. , Ferretti , E. , Srivastava , D. , Zappavigna , V. , and Selleri , L. ( 2006 Jun). Pbx1/Pbx2 requirement for distal limb patterning is mediated by the hierarchical control of Hox gene spatial distribution and Shh expression – PubMed. Development (Cambridge , England ) 133 . doi: 10.1242/dev.02395 . OpenUrl Abstract / FREE Full Text 35. ↵ Conrad , D.F. , Keebler , J.E.M. , DePristo , M.A. , Lindsay , S.J. , Zhang , Y. , Casals , F. , Idaghdour , Y. , Hartl , C.L. , Torroja , C. , Garimella , K.V. , et al. ( 2011 ). Variation in genome-wide mutation rates within and between human families . Nature Genetics 43 , 712 – 714 . doi: 10.1038/ng.862 . OpenUrl CrossRef PubMed 36. McKenna , A. , Hanna , M. , Banks , E. , Sivachenko , A. , Cibulskis , K. , Kernytsky , A. , Garimella , K. , Altshuler , D. , Gabriel , S. , Daly , M. , and DePristo , M.A . ( 2010 -09-01). The Genome Analysis Toolkit: A MapReduce framework for analyzing next-generation DNA sequencing data . Genome Research 20 . doi: 10.1101/gr.107524.110 . OpenUrl Abstract / FREE Full Text 37. ↵ Van der Auwera , G.A. , Carneiro , M.O. , Hartl , C. , Poplin , R. , Angel , G.d. , Levy-Moonshine , A. , Jordan , T. , Shakir , K. , Roazen , D. , Thibault , J. , et al. ( 2013 /10/01). From FastQ Data to High-Confidence Variant Calls: The Genome Analysis Toolkit Best Practices Pipeline . Current Protocols in Bioinformatics 43 . doi: 10.1002/0471250953.bi1110s43 . OpenUrl CrossRef PubMed 38. ↵ Mukhopadhyay , N. , Bishop , M. , Mortillo , M. , Chopra , P. , Hetmanski , J.B. , Taub , M.A. , Moreno , L.M. , Valencia-Ramirez , L.C. , Restrepo , C. , Wehby , G.L. , et al. ( 2019 -12-17). Whole genome sequencing of orofacial cleft trios from the Gabriella Miller Kids First Pediatric Research Consortium identifies a new locus on chromosome 21 . Human Genetics 2019 139 : 2 139 . doi: 10.1007/s00439-019-02099-1 . OpenUrl CrossRef 39. ↵ Feldman , E.R. , Li , Y. , Cutler , D.J. , Rosser , T.C. , Wechsler , S.B. , Sanclemente , L. , Rachubinski , A.L. , Elliott , N. , Vyas , P. , Roberts , I. , et al. ( 2024 -09-06). Genome-wide association studies of Down syndrome associated congenital heart defects . medRxiv . doi: 10.1101/2024.09.06.24313183 . OpenUrl Abstract / FREE Full Text 40. ↵ Samocha , K.E. , Robinson , E.B. , Sanders , S.J. , Stevens , C. , Sabo , A. , McGrath , L.M. , Kosmicki , J.A. , Rehnström , K. , Mallick , S. , Kirby , A. , et al. ( 2014 -09-01). A framework for the interpretation of de novo mutation in human disease . Nature Genetics 2014 46 : 9 46. doi: 10.1038/ng.3050 . OpenUrl CrossRef 41. ↵ Zhou , X. , Edmonson , M.N. , Wilkinson , M.R. , Patel , A. , Wu , G. , Liu , Y. , Li , Y. , Zhang , Z. , Rusch , M.C. , Parker , M. , et al. ( 2015 -12-29). Exploring genomic alteration in pediatric cancer using ProteinPaint . Nature Genetics 2015 48 : 1 48. doi: 10.1038/ng.3466 . OpenUrl CrossRef View the discussion thread. Back to top Previous Next Posted July 30, 2025. Download PDF Supplementary Material Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following Cell Cycle Arrest of a ‘Zippering’ Epithelial Cell Cluster Shapes the Face and is Disrupted in Craniofacial Disorders Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share Cell Cycle Arrest of a ‘Zippering’ Epithelial Cell Cluster Shapes the Face and is Disrupted in Craniofacial Disorders T. Qu , B.H. Chacón , L. Faure , M. Losa , R. Hernández-Martínez , K. Robinson , A. Jones , S. Lisgo , J. De Anda , M. Risolino , G. Panagiotakos , E.J. Leslie-Clarkson , I. Adameyko , L. Selleri bioRxiv 2025.07.28.667310; doi: https://doi.org/10.1101/2025.07.28.667310 Share This Article: Copy Citation Tools Cell Cycle Arrest of a ‘Zippering’ Epithelial Cell Cluster Shapes the Face and is Disrupted in Craniofacial Disorders T. Qu , B.H. Chacón , L. Faure , M. Losa , R. Hernández-Martínez , K. Robinson , A. Jones , S. Lisgo , J. De Anda , M. Risolino , G. Panagiotakos , E.J. Leslie-Clarkson , I. Adameyko , L. Selleri bioRxiv 2025.07.28.667310; doi: https://doi.org/10.1101/2025.07.28.667310 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Developmental Biology Subject Areas All Articles Animal Behavior and Cognition (7635) Biochemistry (17697) Bioengineering (13895) Bioinformatics (41953) Biophysics (21456) Cancer Biology (18595) Cell Biology (25521) Clinical Trials (138) Developmental Biology (13381) Ecology (19903) Epidemiology (2067) Evolutionary Biology (24323) Genetics (15612) Genomics (22511) Immunology (17738) Microbiology (40401) Molecular Biology (17184) Neuroscience (88623) Paleontology (667) Pathology (2833) Pharmacology and Toxicology (4825) Physiology (7644) Plant Biology (15158) Scientific Communication and Education (2046) Synthetic Biology (4296) Systems Biology (9825) Zoology (2271)
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.