Spiroplasma, Wolbachia, Sodalis and trypanosome associations in Glossina tachinoides from Yankari game reserve, Nigeria | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Spiroplasma , Wolbachia , Sodalis and trypanosome associations in Glossina tachinoides from Yankari game reserve, Nigeria Atoh Cedric Munu Tamuton, Youssouf Mouliom Mfopit, Aminu Bashir Yusuf, and 7 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6252946/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 13 Aug, 2025 Read the published version in BMC Veterinary Research → Version 1 posted 16 You are reading this latest preprint version Abstract Background . Tsetse flies are vectors of African trypanosomiasis, a disease that affects both humans and animals. Trypanosomiasis remains a threat to lives and an impediment to socio-economic development in sub-Saharan Africa. In spite of decades of chemotherapy and vector control, the disease has not been eradicated. The parasites have developed resistance to the existing drugs, while the available vector control strategies are expensive and unsustainable. Therefore, there is a need to explore other control approaches, such as the transformation of tsetse fly endosymbionts to render the fly refractory to trypanosome infection. The aim of this study was to investigate the prevalence and association of trypanosome infection with some endosymbionts in tsetse flies from Yankari Game Reserve. Results . Tsetse flies were caught using biconical traps and identified morphologically. They were dissected and their entire gut was isolated and used for DNA extraction. Polymerase chain reaction was used to confirm the identity of the flies by amplifying the cytochrome C oxidase-1 gene and to screen for the presence of endosymbionts ( Sodalis glossinidius , Wolbachia , and Spiroplasma sp.) and trypanosomes. A single tsetse fly species was identified: Glossina tachinoides . A trypanosome infection rate of 10.70% was found and three species of trypanosomes detected ( Trypanosoma grayi , Trypanosoma congolense, and Trypanosoma vivax ), with Trypanosoma grayi being the most prevalent (9.78%). Wolbachia and Spiroplasma species were found in 2.80% and 40.8% of flies respectively, while Sodalis glossinidius was not detected. There was an association between the presence of trypanosomes and Wolbachia, while no association was found between trypanosomes and Spiroplasma . Conclusion. This study revealed that the presence of Wolbachia seems to favour trypanosome infections. Investigation on the Wolbachia genetic polymorphism in tsetse could help to better understand this association. Trypanosoma Spiroplasma Wolbachia Sodalis glossinidius Glossina tachinoides Yankari Game Reserve Introduction Tsetse flies ( Glossina spp. ) are viviparous obligate hematophagous insects found in sub-Saharan Africa that serve as vectors of African trypanosomiasis, a parasitic disease known as “ sleeping sickness ” or Human African Trypanosomiasis (HAT) in humans and “ Nagana ” or Animal African Trypanosomiasis (AAT) in cattle [ 1 ]. African trypanosomiasis (AT) constitutes a major impediment to livestock production and economic development in several parts of sub-Saharan Africa, making farmers lose about 4.75 billion US dollars per year despite decades of attempts to control the disease and its vectors [ 2 ]. Trypanosome infections have been estimated to cause up to 20% output losses in cattle rearing across a variety of metrics, including mortality, calving rate, draft power, meat, and milk production [ 2 ]. Preventive or curative approaches such as vector control and drug administration are being used to control AT. The drugs presently used for the management of trypanosome infections in animals are not very efficient due to the increasing number of drug resistant strains, high cost, toxicity, and less availability [ 3 ]. Several techniques have been developed for vector control, such as trapping, use of insecticides, and the sterile insect technique. However, the challenges with these techniques are their field application and sustainability. Furthermore, investigations of endosymbionts that could be implicated in the vector competence of tsetse flies have been undertaken in different tsetse species [ 4 ]. These developments aimed at mitigating the vector competence of tsetse fly. Factors such as the fly species, genetic variability within a given species, and the presence of endosymbiotic microorganisms seem to regulate the vector competence of tsetse flies [ 5 ]. Mitigating vector competence will require sustainable control and surveillance measures to be developed, that ensure complete interruption of disease transmission. These could be achieved using genetic engineering to generate transgenic insects capable of blocking the biological and cyclical transmission of the parasites [ 6 ]. The microbial community influences several aspects of Tsetse’s physiology, including nutrition, fecundity, and vector competence [ 7 , 8 ]. Tsetse flies are known to harbour three phylogenetically distinct bacterial endosymbionts, Wolbachia Sodalis glossinidius and Wigglesworthia glossinidia which are transmitted maternally to their progenies and show different levels of relation with their host [ 8 , 9 ]. Recently, Spiroplasma was reported as an endosymbiont of tsetse flies [ 10 ]. Wigglesworthia glossinidia is an obligate symbiotic bacterium found in all tsetse species. It provides food supplements to maintain the fecundity of the tsetse fly and is therefore important for their larval development and contributes later to the maturation of the immune system [ 4 ]. Sodalis glossinidius is suspected to be involved in tsetse fly vector competence by favouring parasite fixing in the insect midgut through a complex biochemical mechanism involving the production of N-acetyl glucosamine [ 9 ]. The colonisation of the tsetse’s midgut and spread of the trypanosome correlate positively with the presence of Sodalis glossinidius [ 11 ]. Bacteria belonging to the genus Wolbachia are a group of intracellular alpha proteobacteria that are trans-ovarially transmitted between different generations of tsetse flies and occur in numerous arthropods (65% of insects) and filarial nematode species. These bacteria are associated with the reproductive tissues and cause reproductive abnormalities such as cytoplasmic incompatibility (CI), parthenogenesis, male death, and feminisation [ 12 ]. Spiroplasma is a genus of wall-less bacteria belonging to the class Mollicutes, and it has been associated with diverse plants and arthropods. Spiroplasma has been reported to confer protection against a nematode in Drosophila neotestacea [ 13 ] against fungi in the pea aphid ( Acyrthosiphon pisum ), and against a parasitoid wasp in Drosophila hydei [ 14 ]. Several reports are available on the prevalence of S. glossinidius , Wolbachia , and Spiroplasma in different tsetse species from various geographical locations, highlighting an association between the presence of Sodalis glossinidius and the ability of tsetse flies to harbour trypanosomes [ 15 ]. However, there is lack of information on the prevalence and relationship between the presence of endosymbionts and trypanosome infections in Glossina tachinoides from Yankari Game Reserve, Nigeria. Therefore, this study aimed to investigate the prevalence and association between trypanosomes and endosymbionts inTsetse flies from Yankari Game Reserve. Methods Study area This study was carried out in Yankari Game Reserve (Fig. 1 ). The game reserve occupies an area of about 2244 km 2 . The park is centred at 9.50’N and 10.30’E in the south-central area of Bauchi State in North-eastern Nigeria, in the southern portion of the Sudan Savanna Zone [ 16 ]. The annual rainfall in the area ranges between 900 mm 3 and 1,000 mm 3 , with the wet season starting in May and ending in September and the dry season starting in October and ending in April [ 17 ]. Sampling, morphological identification, and dissection of tsetse flies Trapping of tsetse flies was conducted in November using 11 biconical traps placed at suitable locations (cool, shady areas to avoid desiccation of flies) for three consecutive days. The geographical coordinates of each trap were recorded using a Global Positioning System (GPS) device (GPSMAP® 60CSx Garmin). Tsetse flies were collected once a day at 4 pm. Species and sexes were identified immediately using morphological features such as size, colour and number of dark tarsal segments [ 18 ]. The flies were dissected under a microscope in a drop of phosphate buffered saline (PBS) solution using sterile dissection tools. The tools were cleaned using 3% bleach (sodium hypochlorite), followed by 70% ethanol, and finally sterile distilled water after the dissection of each fly to prevent contamination. Guts and other body parts were separately transferred into cryotubes containing RNA Later® (Sigma-Aldrich) and stored at room temperature in the field, then at − 20 ℃ in the laboratory until required for use. DNA extraction DNA was extracted from the dissected guts using the AccuPrep Genomic DNA extraction kit (Bioneer, South Korea) according to the manufacturer’s instructions. The extracted DNA was quantified using a NanoDrop1000 C spectrophotometer (Thermo scientific, Germany) and stored at -20 ℃. Molecular confirmation of tsetse fly species To confirm the species of tsetse flies previously identified morphologically, a PCR was performed to amplify the mitochondrial cytochrome C oxidase 1 gene (COX1) using COX-1 primers (Table 1 ) adapted from Dyer et al. [ 19 ]. The PCR reaction was carried out in a 20 µL volume containing 1X DreamTaq buffer, 1 U DreamTaq polymerase, 0.2 mM dNTPs, 2 µM each of forward and reverse primers, 2 µL of DNA template, and the volume was made up with nuclease-free water. The cycling conditions were; initial denaturation at 95 ℃ for 5 minutes, followed by 30 cycles of denaturation at 94 ℃ for 60 s, annealing at 55 ℃ for 60 s, and elongation at 72 ℃ for 2 minutes, and a final extension at 72 ℃ for 10 minutes. Identification of different trypanosome species A nested PCR was carried out using ITS-1 generic primers (Table 1 ) from Adams et al. [ 20 ]. The first round of PCR was performed in a 20 µL reaction volume containing 1X DreamTaq buffer, 1 U DreamTaq polymerase 0.2 mM dNTPs, 1 µM each of the outer primers (forward and reverse), and 3 µL of DNA template. The volume was made up using nuclease free-water. The cycling conditions were; initial denaturation at 95 ℃ for 3 minutes, followed by 35 cycles of denaturation at 94 ℃ for 30 s, annealing at 54 ℃ for 30 s, extension at 72 ℃ for 60 s, and a final extension at 72 ℃ for 5 minutes. The second round of PCR was carried out using ITS-1 internal primers (Table 1 ) and was performed in 20 µL reaction volume containing 1X DreamTaq buffer, 1 U DreamTaq polymerase, 0.2 mM dNTPs, 1 µM of each primer, 2 µL DNA (1/40 dilution of first round PCR product) and the volume was made up with nuclease free water. The cycling conditions were as followed: initial denaturation at 95 ℃ for 3 minutes, followed by 35 cycles of denaturation at 94 ℃ for 30 s, annealing at 55 ℃ for 30 s, extension at 72 ℃ for 60 s, and a final extension at 72 ℃ for 5 minutes. Another nested PCR targeting the glycosomal Glyceraldehyde-3-phosphate dehydrogenase (gGAPDH) gene of trypanosomes was performed to confirm the trypanosomes positive tsetse guts using gGAPDH primers (Table 1 ) designed by Hamilton et al. [ 21 ] following the protocol of Weber et al. [ 22 ]. The first round PCR was performed in a 20 µL reaction volume containing 1X DreamTaq buffer, 1 U DreamTaq polymerase, 0.2 mM dNTPs, 1 µM of each gGAPDH external primer, 2 µL DNA template and the volume was made up using nuclease free water. The cycling conditions were; initial denaturation for 3 minutes at 95°C, followed by 30 cycles of 60 s at 95°C, 30 s at 55°C and 60 s at 72°C, and a final elongation at 72°C for 10 minutes. The first PCR products were diluted 40-fold and 1 µL of this dilution was used for the second PCR round using gGAPDH internal primers, performed in a 20 µL reaction volume containing 1X DreamTaq buffer, 1 U DreamTaq polymerase, 0.2 mM dNTPs, 1 µM each of gGAPDH internal primer (Table 1 ), and the volume was made up using nuclease free water. The cycling conditions were; initial denaturation for 3 minutes at 95°C, followed by 30 cycles of 60 s at 95°C, 30 s at 52°C and 60 s at 72°C, and a final elongation at 72°C for 10 minutes. Amplicons were resolved on 1.5% agarose gel. Detection of endosymbionts The presence of S. glossinidius was screened by PCR using pSG2 (Table 1 ) adapted from Darby et al. [ 23 ] in a total reaction volume of 20 µL containing 1X DreamTaq buffer, 1 U DreamTaq polymerase, 0.2 mM dNTPs, 1 µM each of primers, and 3 µL of DNA template. The volume was made up using nuclease-free water. The cycling conditions were: initial denaturation at 94 ℃ for 3 minutes, followed by 30 cycles of 94 ℃ for 30 s, 51 ℃ for 30 s, 72 ℃ for 30 s, and a final extension at 72 ℃ for 5 minutes. Wolbachia was detected by PCR using W-spec primers (Table 1 ) that amplify a 438 bp DNA fragment of the 16S rRNA [ 12 ] in a 20 µL reaction volume containing 1X DreamTaq buffer, 0.15 mM dNTPs, 1 U DreamTaq polymerase, 0.5 µM each of primers, and 2 µL of template DNA. The volume was made up using nuclease-free water. The cycling conditions were: initial denaturation at 95 ℃ for 5 minutes, followed by 30 cycles of 95 ℃ for 30 s, 54 ℃ for 30 s, 72 ℃ for 60 s, and a final extension at 72 ℃ for 10 minutes. Spiroplasma was detected by amplifying the 16S rRNA gene of the bacterium using 63F primers (Table 1 ) as described by Doudoumis et al. [ 10 ] in a 20 µL reaction volume consisting of 1X DreamTaq buffer, 0.15 mM dNTPs, 1 U DreamTaq polymerase, 0.25 µM each of primers, and 3 µL of template DNA. The cycling conditions were: initial denaturation at 95 ℃ for 5 minutes, followed by 30 cycles of 95 ℃ for 30 s, 59 ℃ for 30 s, 72 ℃ for 60 s, and a final extension at 72 ℃ for 10 minutes. All PCR products were resolved on 1.5% agarose gel and visualised under UV illumination. Table 1 Sequence of primers used for molecular identification of organisms Organisim Primer Direction Sequence Reference Glossina spp COX1 Forward TTGATTTTTTGGTCATCCAGAAGT [ 19 ] Glossina spp COX1 Reverse TGAAGCTTAAATTCATTGCACTAATC [ 19 ] Trypanosoma spp ITS-1 External Forward TGCAATTATTGGTCGCGC [ 20 ] Trypanosoma spp ITS-1 External Reverse CTTTGCTGCGTTCTT [ 20 ] Trypanosoma spp ITS-1 Internal Forward AAGCCAAGTCATCCATCG [ 20 ] Trypanosoma spp ITS-1 Internal Reverse TAGAGGAAGCAAAAG [ 20 ] Trypanosoma spp gGAPDH External Forward TTYGCCGYATYGGYCGCATGG [ 21 ] Trypanosoma spp gGAPDH External Reverse ACMAGRTCCACCACRCGGTG [ 21 ] Trypanosoma spp gGAPDH Internal Forward GCSTAYCAGATGAAGTAC GAC [ 22 ] Trypanosoma spp gGAPDH Internal Reverse GTTYTGCAGSGTCGCCTTGG [ 21 ] Sodalis pSG2 Forward TGAAGTTGGGAATGTCG [ 23 ] Sodalis pSG2 Reverse AGTTGTAGCACAGCGTGTA [ 23 ] Wolbachia W-spec Forward CATACC TATTCGAAGGGATAG [ 12 ] Wolbachia W-spec Reverse AGCTTCGAGTGAA ACCAATTC [ 12 ] Spiroplasma 63F Forward GCCTAATACATGCAAGTCGAAC [ 10 ] Spiroplasma 63F Reverse TAGCCGTGGCTTTCTGGTAA [ 10 ] PCR products purification and sequencing PCR amplicons were excised from the gel and purified using the GeneJET Gel Extraction Kit (Thermo Scientific) following the manufacturer’s instructions. The purified DNA was used for direct Sanger sequencing by a commercial provider (Microsynth SeqLab, Göttingen, Germany). The sequences generated were analysed using the Bio-edit software, and a BLAST (Basic Local Alignment Search Tool) search was conducted using Nucleotide BLAST at the NCBI (National Center for Biotechnology Information) database [ 24 ]. Nucleotide sequences isolated in this study were deposited in GenBank and accession numbers assigned. Statistical analyses Entomological data were expressed in terms of abundance of tsetse flies, estimated by fly apparent density per trap per day (ADT) according to the following formula: ADT = Nc/TD (where Nc is the number of captured tsetse flies, T is the number of traps, and D is the number of trapping days). Trypanosomes and symbionts hosted by tsetse flies were expressed in terms of prevalence. The Fisher test and the logistic regression model were used to analyse the association between the presence of symbionts ( Wolbachia and Spiroplasma , respectively) and trypanosome infection in tsetse flies. Results and Discussion Entomological survey A total of 2,742 tsetse flies were captured, using 11 biconical traps in four days. The apparent fly density was 83.03 F/T/D. All the captured flies were morphologically identified as Glossina tachinoides , and 215 were dissected for the study. The amplification (Fig. 2 ) and sequencing of the COX1 partial gene sequence confirmed the Glossina species to be G. tachinoides . The sequence of our amplicons was closely related (99.87% similarity) to other Glossina tachinoides COX1 sequences isolated in the same locality (MG234544, MG234547). A relatively high apparent tsetse fly density of 83.03 F/T/D was determined. Previous studies reported apparent fly densities of 22.5 [ 25 ] and 128.03F/T/D for G. tachinoides [ 26 ]. This variation in apparent fly density could be a result of variations in study periods. In our study, samples were collected at the beginning of the dry season (November), and in the other studies, samples were collected in March and August, respectively. We identified the presence of a single tsetse fly species ( Glossina tachinoides ), whereas a previous study reported two species: Glossina morsitans and Glossina tachinoides [ 25 ]. The same study reported Glossina tachinoides as the predominant species of tsetse flies in Yankari Game Reserve [ 25 ]. This difference in Glossina species may be due to variation in trap locations during the entomological survey. Trypanosome infection rate Out of 215 guts of Glossina tachinoides analysed by ITS-1 nested PCR (Fig. S1 ), only 23 (10.70%) were infected with at least one species of trypanosomes. Three species of trypanosomes were identified Trypanosoma grayi , T . congolense , and T. vivax . The number of flies infected by T. grayi , T. congolense and T. vivax were: 21/215 (9.77%), 9/215 (4.19%), and 2/215 (0.93%). There were 14/23 single infections (Table 2 ) and 9 mixed infections (7/23 T. grayi - T. congolense and 2/23 T. grayi - T. vivax ). Following the identification of trypanosomes using ITS-1 nested PCR, gGAPDH nested PCR (Fig. 3 ) was performed to confirm the trypanosomes positive tsetse flies. Table 2 Trypanosome species isolated from midgut of Glossina tachinoides Type of Infection T. grayi T. congolense T. vivax T. grayi/congolense T. grayi/vivax Infections (/215) 12 1 1 7 2 Prevalence 5.58% 0.47% 0.47% 3.26% 0.93% Overall prevalence of trypanosome infection = 23/215 (10.70%) The trypanosome infection rate of 10.70% was similar to the 11.9% infection rate obtained in another study in the same location on Glossina tachinoides [ 26 ]. This study reported the presence of three species of trypanosomes: T. congolense , T. vivax and T. grayi , which supported the work of Weber et al. [ 22 ], where they reported the presence of the same species. No trypanosome species of the Trypanosoma brucei complex was found, which is in agreement with Weber et al. [ 22 ] that reported the absence of T. brucei species. Trypanosoma vivax was found in only two Tsetse fly samples. This low infection rate observed could be due to the fact that DNA was extracted only from the midgut of tsetse flies since the life cycle of T . vivax is restricted to the mouthparts, though few reports show that this parasite can be detected in the midgut of tsetse flies up to four days after an infectious blood meal [ 27 ]. Symbiont occurrence rate Out of 215 midgut samples screened for the presence of Spiroplasma , Wolbachia , and Sodalis glossinidius (Fig. 4 , Fig. S2 ), 87 harboured Spiroplasma , and 6 harboured Wolbachia while no sample was found to harbour S. glossinidius , giving endosymbiont infection rates of 40.70%, 2.80% and 0.00% respectively. Our findings reported the presence of two Tsetse’s symbiotic bacteria: Spiroplasma and Wolbachia . The absence of Sodalis glossinidius in Glossina tachinoides agrees with the findings of Mfopit et al. [ 28 ], who reported a 0.00% prevalence of Sodalis in the same study location, but differs with 3.7% and 16% infection rates reported for G. austeni and G. pallidipes , respectively, in Shimba Hills National Reserve, Kenya [ 29 ]. Results from our study also differ with the 37.0% Sodalis infection rate found in Glossina tachinoides captured in Cameroon [ 4 ]. The remarkable difference observed with our study could be attributed to differences in tsetse species and geographic location because the microbiota of tsetse flies vary with Glossina species and geographic location [ 11 ]. The low occurrence of Wolbachia (2.80%) corroborates with another study that reported the absence of Wolbachia in the Glossina palpalis group [ 30 ]. However, Kame-Ngasse et al. [ 4 ] reported a high prevalence of 68.1% in Glossina tachinoides from the Adamawa region, Cameroon. These observations suggest that the prevalence of Wolbachia may depend on the ecological conditions of tsetse fly populations [ 31 ]. The high infection rate of tsetse flies with Spiroplasma (40.8%) is consistent with other studies reporting 37.5% [ 10 ] and 44.5% infection rate of Spiroplasma in G. tachinoides captured from Burkina Faso [ 30 ]. Relationship between trypanosome infection and symbiont presence Of the 87 tsetse flies harbouring Spiroplasma , 13 were infected with at least one trypanosome species (Table 3 ). Of the 128 tsetse flies that were negative for Spiroplasma , 10 were harbouring trypanosomes. There was no association ( p = 0.116) between the presence of Spiroplasma and the trypanosome infection. Out of 6 flies harbouring Wolbachia , 5 were infected with at least one trypanosome species, while one was trypanosome negative. Of the 209 Wolbachia negative flies, 18 were infected by trypanosomes. The Fisher test (Table 3 ) showed that there was a positive association between Wolbachia presence and trypanosome infection ( p = 0.001). Table 3 Statistical association of Wolbachia and Spiroplasma endosymbionts with trypanosome DNA in Glossina tachinoides Spiroplasma and trypanosome co-infection (N = 215) Wolbachia and trypanosome co-infection (N = 215) T/S S- S+ W/T W- W+ T- 118 74 T- 191 1 T+ 10 13 T+ 18 5 p = 0.116 p = 0.001 T+/T-: Trypanosome positive/negative, W+/W-: Wolbachia positive/negative Sp+/Sp-: Spiroplasma positive/negative. No association was observed between the presence of Spiroplasma and the presence of trypanosome infection, suggesting that Spiroplasma has no effect on the establishment of trypanosomes within the midgut of tsetse flies. An association was observed between Wolbachia and trypanosomes in Tsetse flies, but this association could not be conclusive due to the fact that only a few Tsetse flies (6/215) were harbouring the bacterium. This study differs from that of Kante et al. [ 32 ], who reported the absence of an association between Wolbachia and the presence of trypanosomes in Glossina palpalis palpalis populations from three sleeping sickness foci of southern Cameroon. The study should be performed with different haplotypes of Wolbachia to have a clearer picture of the possible relationship existing between the presence of Wolbachia and the level of trypanosome infection in tsetse flies. Tsetse fly COX1, trypanosome ITS-1, Wolbachia , and Spiroplasma 16SrRNA sequences obtained from this study were deposited on the NCBI database under the following accession numbers. Glossina tachinoides ; OQ653471, Trypanosoma congolense ; OQ658682 and OQ658683, Trypanosoma vivax ; OQ658688, Trypanosoma grayi ; OQ658685, OQ658686, and OQ658687 Wolbachia ; OQ658372, and Spiroplasma ; OQ658371. Conclusion This study found that Glossina tachinoides from Yankari Game Reserve are infected with trypanosomes, with a prevalence of 10.70%. The infection rates of Sodalis , Wolbachia and Spiroplasma were 0.00%, 2.80%, and 40.70%, respectively. An association was observed between Wolbachia and trypanosomes in tsetse flies, but no association was observed between Spiroplasma and trypanosomes. These findings provide useful data on the microbiota of tsetse flies and could be further used to investigate and understand the role of these symbiotic bacteria on the physiology of tsetse flies, thus helping in the development of new disease control techniques. Declarations Data availability The datasets supporting the conclusions of this article are included within the article and its additional files. Nucleotide sequences are openly available in National Center for Biotechnology Information (https://www.ncbi.nlm.nih.gov/), with following reference numbers: Glossina tachinoides : OQ65347; Trypanosoma congolense : OQ658682 and OQ658683; Trypanosoma vivax : OQ658688; Trypanosoma grayi : OQ658685, OQ658686, and OQ658687; Wolbachia : OQ658372 and Spiroplasma : OQ658371. Conflicts of interest The authors declare no conflict of interest Funding This work was supported by the Africa Centre of Excellence for Neglected Tropical Diseases and Forensic Biotechnology (ACENTDFB), Ahmadu Bello University, Zaria, Nigeria; and also by the Deutsche Forschungsgemeinschaft (DFG project grant to GDC: Ke428/13-1). Acknowledgement The authors sincerely thank Africa Centre of Excellence for Neglected Tropical Diseases and Forensic Biotechnology (ACENTDFB), Ahmadu Bello University, Zaria, Nigeria for sponsoring the research. We also thank the Centre for Biotechnology Research and Training (CBRT), Ahmadu Bello University for their technical assistance during laboratory work. Our sincere gratitude goes to the department of Biochemistry, Ahmadu Bello University for administrative and technical support in carrying out the study. We would also like to thank the following persons: Prof. Achukwi Daniel, Mr. Nsadztsen Gilbert Adzemye, and Mr. Ahmadu, a staff member of the Nigerian Institute of Trypanosomiasis Research. Authors contributions YMM conceived the study: ACMT, YMM, AA, GDC, and JK designed the protocol of the study. ACMT, YMM, ABY, PYM, EFG and GAA contributed to sample collection. ACMT and YMM carried out laboratory analyses. AA, GDC, MM and JK supervised laboratory analyses. YMM carried out data analyses. ACMT drafted the manuscript. All authors read, revised, and approved the manuscript. Ethics approval and consent to participate Not applicable Consent for publication Not applicable References Attardo GM, Scolari F, Malacrida A. Bacterial Symbionts of Tsetse Flies: Relationships and Functional Interactions Between Tsetse Flies and Their Symbionts. In: Kloc M, editor. Symbiosis: Cellular, Molecular, Medical and Evolutionary Aspects [Internet]. Cham: Springer International Publishing; 2020 [cited 2023 Feb 27]. pp. 497–536. (Results and Problems in Cell Differentiation; vol. 69). Available from: https://link.springer.com/ 10.1007/978-3-030-51849-3_19 Namangala B, Odongo S. Animal African Trypanosomosis in Sub-Saharan Africa and Beyond African Borders. In: Magez S, Radwanska M, editors. Trypanosomes and Trypanosomiasis [Internet]. Vienna: Springer Vienna; 2014 [cited 2023 Feb 28]. pp. 239–60. Available from: https://link.springer.com/ 10.1007/978-3-7091-1556-5_10 Geerts S, Holmes PH, Eisler MC, Diall O. African bovine trypanosomiasis: the problem of drug resistance. Trends Parasitol. 2001;17(1):25–8. Kame-Ngasse GI, Njiokou F, Melachio-Tanekou TT, Farikou O, Simo G, Geiger A. Prevalence of symbionts and trypanosome infections in tsetse flies of two villages of the Faro and Déo division of the Adamawa region of Cameroon. BMC Microbiol. 2018;18(1):159. Simo G, Kanté ST, Madinga J, Kame G, Farikou O, Ilombe G et al. Molecular identification of Wolbachia and Sodalis glossinidius in the midgut of Glossina fuscipes quanzensis from the Democratic Republic of Congo. Parasite. 26:5. Rio RVM, Hu Y, Aksoy S. Strategies of the home-team: symbioses exploited for vector-borne disease control. Trends Microbiol. 2004;12(7):325–36. Balmand S, Lohs C, Aksoy S, Heddi A. Tissue distribution and transmission routes for the tsetse fly endosymbionts. J Invertebr Pathol. 2013;112:S116–22. Wang J, Weiss BL, Aksoy S. Tsetse fly microbiota: form and function. Front Cell Infect Microbiol [Internet]. 2013 [cited 2023 Feb 28];3. Available from: http://journal.frontiersin.org/article/ 10.3389/fcimb.2013.00069/abstract Dale C, Welburn SC. The endosymbionts of tsetse flies: manipulating host–parasite interactions. Int J Parasitol. 2001;31(5–6):628–31. Doudoumis V, Blow F, Saridaki A, Augustinos A, Dyer NA, Goodhead I, et al. Challenging the Wigglesworthia, Sodalis, Wolbachia symbiosis dogma in tsetse flies: Spiroplasma is present in both laboratory and natural populations. Sci Rep. 2017;7(1):4699. Farikou O, Njiokou F, Mbida Mbida JA, Njitchouang GR, Djeunga HN, Asonganyi T, et al. Tripartite interactions between tsetse flies, Sodalis glossinidius and trypanosomes—An epidemiological approach in two historical human African trypanosomiasis foci in Cameroon. Infect Genet Evol. 2010;10(1):115–21. Werren JH, Windsor DM. Wolbachia infection frequencies in insects: evidence of a global equilibrium? Proceedings of the Royal Society of London Series B: Biological Sciences. 2000;267(1450):1277–85. Jaenike J, Unckless R, Cockburn SN, Boelio LM, Perlman SJ. Adaptation via Symbiosis: Recent Spread of a Drosophila Defensive Symbiont. Science. 2010;329(5988):212–5. Xie J, Vilchez I, Mateos M. Spiroplasma Bacteria Enhance Survival of Drosophila hydei Attacked by the Parasitic Wasp Leptopilina heterotoma. Raine NE, editor. PLoS ONE. 2010;5(8):e12149. Geiger A, Ravel S, Frutos R, Cuny G. Sodalis glossinidius (Enterobacteriaceae) and Vectorial Competence of Glossina palpalis gambiensis and Glossina morsitans morsitans for Trypanosoma congolense Savannah Type. Curr Microbiol. 2005;51(1):35–40. Odunlami S. An assessment of the ecotourism potential of yankari national park, nigeria. In 2003 [cited 2024 Sep 12]. Available from: https://www.semanticscholar.org/paper/%22AN-ASSESSMENT-OF-THE-ECOTOURISM-POTENTIAL-OF-PARK%2C-Odunlami/b1f4929d2bbd0fb956149a9eb672419825958cee Abdullahi M, Sanusi S, Abdul S, F.B.J.. S. An Assessment of the Herbaceous Species Vegetation of Yankari Game Reserve. Bauchi Nigeria. 2009;6:20–5. Gooding RH, Krafsur ES. Tsetse genetics: Contributions to Biology, Systematics, and Control of Tsetse Flies. Annu Rev Entomol. 2005;50(1):101–23. Dyer N, Lawton S, Ravel S, Choi K, Lehane M, Robinson A, et al. Molecular phylogenetics of tsetse flies (Diptera: Glossinidae) based on mitochondrial (COI, 16S, ND2) and nuclear ribosomal DNA sequences, with an emphasis on the palpalis group. Mol Phylogenet Evol. 2008;49(1):227–39. Adams ER, Malele II, Msangi AR, Gibson WC. Trypanosome identification in wild tsetse populations in Tanzania using generic primers to amplify the ribosomal RNA ITS-1 region. Acta Trop. 2006;100(1–2):103–9. Hamilton PB, Stevens JR, Gaunt MW, Gidley J, Gibson WC. Trypanosomes are monophyletic: evidence from genes for glyceraldehyde phosphate dehydrogenase and small subunit ribosomal RNA. Int J Parasitol. 2004;34(12):1393–404. Weber JS, Ngomtcho SCH, Shaida SS, Chechet GD, Gbem TT, Nok JA, et al. Genetic diversity of trypanosome species in tsetse flies (Glossina spp.) in Nigeria. Parasites Vectors. 2019;12(1):481. Darby AC, Lagnel J, Matthew CZ, Bourtzis K, Maudlin I, Welburn SC. Extrachromosomal DNA of the Symbiont Sodalis glossinidius . J Bacteriol. 2005;187(14):5003–7. Syngai G, Barman P, Bharali R, Dey S. BLAST: An introductory tool for students to Bioinformatics Applications. Kenean J Sci. 2013;2:67–76. Shaida SS, Weber JS, Gbem TT, Ngomtcho SCH, Musa UB, Achukwi MD, et al. Diversity and phylogenetic relationships of Glossina populations in Nigeria and the Cameroonian border region. BMC Microbiol. 2018;18(1):180. Isaac C, Ciosi M, Hamilton A, Scullion KM, Dede P, Igbinosa IB, et al. Molecular identification of different trypanosome species and subspecies in tsetse flies of northern Nigeria. Parasites Vectors. 2016;9(1):301. Ooi CP, Schuster S, Cren-Travaillé C, Bertiaux E, Cosson A, Goyard S et al. The Cyclical Development of Trypanosoma vivax in the Tsetse Fly Involves an Asymmetric Division. Frontiers in Cellular and Infection Microbiology [Internet]. 2016 [cited 2023 Feb 28];6. Available from: https://www.frontiersin.org/articles/ 10.3389/fcimb.2016.00115 Mfopit YM, Weber JS, Chechet GD, Ibrahim MAM, Signaboubo D, Achukwi DM et al. Molecular detection of Sodalis glossinidius, Spiroplasma and Wolbachia endosymbionts in wild population of tsetse flies collected in Cameroon, Chad and Nigeria. Res Sq. 2023;rs.3.rs-2902767. Wamwiri FN, Alam U, Thande PC, Aksoy E, Ngure RM, Aksoy S, et al. Wolbachia, Sodalis and trypanosome co-infections in natural populations of Glossina austeni and Glossina pallidipes. Parasites Vectors. 2013;6(1):232. El Khamlichi S, Maurady A, Asimakis E, Stathopoulou P, Sedqui A, Tsiamis G. Detection and Characterization of Spiroplasma and Wolbachia in a Natural Population of Glossina Tachinoides. In: Kacprzyk J, Balas VE, Ezziyyani M, editors. Advanced Intelligent Systems for Sustainable Development (AI2SD’2020). Cham: Springer International Publishing; 2022. pp. 256–64. (Advances in Intelligent Systems and Computing). Yun Y, Lei C, Peng Y, Liu F, Chen J, Chen L. Wolbachia Strains Typing in Different Geographic Population Spider, Hylyphantes Graminicola (Linyphiidae). Curr Microbiol. 2011;62(1):139–45. Kante TS, Melachio Tanekou TT, Amih O, Njiokou F, Simo G. Detection of Wolbachia and different trypanosome species in Glossina palpalis palpalis populations from three sleeping sickness foci of southern Cameroon. Parasites Vectors. 2018;11. Additional Declarations No competing interests reported. Supplementary Files FigureS1TrypanoITS1.jpg Fig. S1. PCR amplification of trypanosome (ITS-1 gene) from genomic DNA of tsetse fly. MM: marker (50bp), lane 005: mixed infection of T. vivax and T. grayi, lane 007: T. congolense , lane 017: T. grayi, lane 22: mixed infection of T. grayi and T. congolense, lane 037: mixed infection of T. grayi and T. vivax NC: negative control and PC: positive control. FigureS2Wolbachia.jpg Fig. S2. PCR amplification of endosymbionts. A. Wolbachia 16SrRNA gene. M: marker, lane 1, 2, 3 and 4 are positive Wolbachia samples, NC: negative control and PC: positive control. Cite Share Download PDF Status: Published Journal Publication published 13 Aug, 2025 Read the published version in BMC Veterinary Research → Version 1 posted Editorial decision: Revision requested 25 Apr, 2025 Reviewers agreed at journal 25 Apr, 2025 Reviewers agreed at journal 25 Apr, 2025 Reviews received at journal 25 Apr, 2025 Reviews received at journal 24 Apr, 2025 Reviewers agreed at journal 12 Apr, 2025 Reviewers agreed at journal 11 Apr, 2025 Reviewers agreed at journal 10 Apr, 2025 Reviewers agreed at journal 10 Apr, 2025 Reviews received at journal 09 Apr, 2025 Reviewers agreed at journal 05 Apr, 2025 Reviewers invited by journal 03 Apr, 2025 Editor invited by journal 25 Mar, 2025 Editor assigned by journal 20 Mar, 2025 Submission checks completed at journal 20 Mar, 2025 First submitted to journal 18 Mar, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6252946","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":438323381,"identity":"a324cd3d-e3c1-4183-8ff9-3a1a1c1531e6","order_by":0,"name":"Atoh Cedric Munu Tamuton","email":"","orcid":"","institution":"Department of Biochemistry, Ahmadu Bello University, Zaria","correspondingAuthor":false,"prefix":"","firstName":"Atoh","middleName":"Cedric Munu","lastName":"Tamuton","suffix":""},{"id":438323383,"identity":"fbebeba9-558c-4e9c-9ab4-3fae30dc4d00","order_by":1,"name":"Youssouf Mouliom Mfopit","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA8klEQVRIiWNgGAWjYBADfgbmAwwMCQw2DAwSIL4NYS2SDWwJQC0JaVAtacRqYUg4TFiLwfEe448/Kg5L6LYxH3vw8Mf5xP7ZzQcfMCTcw63lzBkzaZ4zhyXMjrGlGyQk3E6ccedYsgFDQjFuLTdyzJgZ2w7Xmd3vMZMAaWkAikgw/kjAp8X44882kC08IC3nEueDtAADAp8WAwlehJYDiRsIaZE8c6wM6Jd0qF/Sko033khLBnoKtxa+482bgSFmDdTCfOzhDxs72Xk3kg8++IBHi8IBBJsNRDg2gEjcGhgY5BvQtNjjUTwKRsEoGAUjFAAAHEJbc2hlrckAAAAASUVORK5CYII=","orcid":"","institution":"Institute of Agricultural Research for Development (IRAD)","correspondingAuthor":true,"prefix":"","firstName":"Youssouf","middleName":"Mouliom","lastName":"Mfopit","suffix":""},{"id":438323385,"identity":"40e9672e-1ae0-4c38-911b-5ec870450526","order_by":2,"name":"Aminu Bashir Yusuf","email":"","orcid":"","institution":"Nigerian Institute for Trypanosomiasis Research (NITR)","correspondingAuthor":false,"prefix":"","firstName":"Aminu","middleName":"Bashir","lastName":"Yusuf","suffix":""},{"id":438323387,"identity":"2d11ed92-0d74-4ff8-80ec-551d1912f0a8","order_by":3,"name":"Peter Yunenui Mahbou","email":"","orcid":"","institution":"Department of Biochemistry, Ahmadu Bello University, Zaria","correspondingAuthor":false,"prefix":"","firstName":"Peter","middleName":"Yunenui","lastName":"Mahbou","suffix":""},{"id":438323389,"identity":"edbdf9be-b874-4968-89f4-e17317507e63","order_by":4,"name":"Edwige Flore Gouegni","email":"","orcid":"","institution":"Department of Biochemistry, Ahmadu Bello University, Zaria","correspondingAuthor":false,"prefix":"","firstName":"Edwige","middleName":"Flore","lastName":"Gouegni","suffix":""},{"id":438323390,"identity":"d70d65bc-653b-467b-be35-20e8d9192abe","order_by":5,"name":"Grace Amarachi Amos","email":"","orcid":"","institution":"Department of Zoology, Ahmadu Bello University","correspondingAuthor":false,"prefix":"","firstName":"Grace","middleName":"Amarachi","lastName":"Amos","suffix":""},{"id":438323392,"identity":"345fbfa4-48f6-4a13-aaf6-2e480257ef5a","order_by":6,"name":"Mohammed Mamman","email":"","orcid":"","institution":"Department of Veterinary Pharmacology, Ahmadu Bello University","correspondingAuthor":false,"prefix":"","firstName":"Mohammed","middleName":"","lastName":"Mamman","suffix":""},{"id":438323393,"identity":"a344c427-a596-425c-b8ca-042f254ef157","order_by":7,"name":"Auwal Adamu","email":"","orcid":"","institution":"Department of Biochemistry, Ahmadu Bello University, Zaria","correspondingAuthor":false,"prefix":"","firstName":"Auwal","middleName":"","lastName":"Adamu","suffix":""},{"id":438323395,"identity":"61c47edd-6264-420f-afe7-66be79349d36","order_by":8,"name":"Gloria Dada Chechet","email":"","orcid":"","institution":"Department of Biochemistry, Ahmadu Bello University, Zaria","correspondingAuthor":false,"prefix":"","firstName":"Gloria","middleName":"Dada","lastName":"Chechet","suffix":""},{"id":438323396,"identity":"89fd477f-894b-48cc-93c9-2c666896001c","order_by":9,"name":"Junaidu Kabir","email":"","orcid":"","institution":"Department of Veterinary Public Health and Preventive Medicine, Ahmadu Bello University","correspondingAuthor":false,"prefix":"","firstName":"Junaidu","middleName":"","lastName":"Kabir","suffix":""}],"badges":[],"createdAt":"2025-03-18 12:08:09","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6252946/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6252946/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s12917-025-04959-7","type":"published","date":"2025-08-13T15:56:52+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":89310508,"identity":"fbb800d0-e7b9-47f1-8bc4-0e0606c56bf8","added_by":"auto","created_at":"2025-08-18 16:05:05","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":946536,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6252946/v1/888c7b5c-0c8c-4ad7-a2b8-620e7d09041a.pdf"},{"id":79916257,"identity":"0fd48368-cf18-4bbd-9b6a-d88ed173f3b7","added_by":"auto","created_at":"2025-04-04 12:40:01","extension":"jpg","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":31508,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFig. S1. \u003c/strong\u003ePCR amplification of trypanosome (ITS-1 gene) from genomic DNA of tsetse fly.\u003cstrong\u003e \u003c/strong\u003eMM: marker (50bp), lane 005: mixed infection of T. vivax and T. grayi, lane 007: \u003cem\u003eT. congolense\u003c/em\u003e, lane 017: \u003cem\u003eT. grayi,\u003c/em\u003e lane 22: mixed infection of \u003cem\u003eT. grayi \u003c/em\u003eand\u003cem\u003e T. congolense, \u003c/em\u003elane 037: mixed infection of\u003cem\u003e T. grayi and T. vivax \u003c/em\u003eNC: negative control and PC: positive control.\u003c/p\u003e","description":"","filename":"FigureS1TrypanoITS1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6252946/v1/b429c4d27d56c85c00f14da2.jpg"},{"id":79916258,"identity":"e6d98c14-92a3-4e19-9bd3-a9d43d928ef5","added_by":"auto","created_at":"2025-04-04 12:40:01","extension":"jpg","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":94496,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFig. S2. \u003c/strong\u003ePCR amplification of endosymbionts. A. \u003cem\u003eWolbachia\u003c/em\u003e 16SrRNA gene.\u003cstrong\u003e \u003c/strong\u003eM: marker, lane 1, 2, 3 and 4 are positive \u003cem\u003eWolbachia\u003c/em\u003e samples, NC: negative control and PC: positive control.\u003c/p\u003e","description":"","filename":"FigureS2Wolbachia.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6252946/v1/edb71cc32845b360273728e7.jpg"}],"financialInterests":"No competing interests reported.","formattedTitle":"\u003cp\u003e\u003cem\u003eSpiroplasma\u003c/em\u003e, \u003cem\u003eWolbachia\u003c/em\u003e, \u003cem\u003eSodalis\u003c/em\u003e and trypanosome associations in \u003cem\u003eGlossina tachinoides\u003c/em\u003e from Yankari game reserve, Nigeria\u003c/p\u003e","fulltext":[{"header":"Introduction","content":"\u003cp\u003eTsetse flies (\u003cem\u003eGlossina spp.\u003c/em\u003e) are viviparous obligate hematophagous insects found in sub-Saharan Africa that serve as vectors of African trypanosomiasis, a parasitic disease known as \u0026ldquo;\u003cem\u003esleeping sickness\u003c/em\u003e\u0026rdquo; or Human African Trypanosomiasis (HAT) in humans and \u0026ldquo;\u003cem\u003eNagana\u003c/em\u003e\u0026rdquo; or Animal African Trypanosomiasis (AAT) in cattle [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. African trypanosomiasis (AT) constitutes a major impediment to livestock production and economic development in several parts of sub-Saharan Africa, making farmers lose about 4.75\u0026nbsp;billion US dollars per year despite decades of attempts to control the disease and its vectors [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Trypanosome infections have been estimated to cause up to 20% output losses in cattle rearing across a variety of metrics, including mortality, calving rate, draft power, meat, and milk production [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Preventive or curative approaches such as vector control and drug administration are being used to control AT. The drugs presently used for the management of trypanosome infections in animals are not very efficient due to the increasing number of drug resistant strains, high cost, toxicity, and less availability [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Several techniques have been developed for vector control, such as trapping, use of insecticides, and the sterile insect technique. However, the challenges with these techniques are their field application and sustainability.\u003c/p\u003e \u003cp\u003eFurthermore, investigations of endosymbionts that could be implicated in the vector competence of tsetse flies have been undertaken in different tsetse species [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. These developments aimed at mitigating the vector competence of tsetse fly. Factors such as the fly species, genetic variability within a given species, and the presence of endosymbiotic microorganisms seem to regulate the vector competence of tsetse flies [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Mitigating vector competence will require sustainable control and surveillance measures to be developed, that ensure complete interruption of disease transmission. These could be achieved using genetic engineering to generate transgenic insects capable of blocking the biological and cyclical transmission of the parasites [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. The microbial community influences several aspects of Tsetse\u0026rsquo;s physiology, including nutrition, fecundity, and vector competence [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Tsetse flies are known to harbour three phylogenetically distinct bacterial endosymbionts, \u003cem\u003eWolbachia Sodalis glossinidius and Wigglesworthia glossinidia\u003c/em\u003e which are transmitted maternally to their progenies and show different levels of relation with their host [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Recently, \u003cem\u003eSpiroplasma\u003c/em\u003e was reported as an endosymbiont of tsetse flies [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e].\u003c/p\u003e \u003cp\u003e \u003cem\u003eWigglesworthia glossinidia\u003c/em\u003e is an obligate symbiotic bacterium found in all tsetse species. It provides food supplements to maintain the fecundity of the tsetse fly and is therefore important for their larval development and contributes later to the maturation of the immune system [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. \u003cem\u003eSodalis glossinidius\u003c/em\u003e is suspected to be involved in tsetse fly vector competence by favouring parasite fixing in the insect midgut through a complex biochemical mechanism involving the production of N-acetyl glucosamine [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. The colonisation of the tsetse\u0026rsquo;s midgut and spread of the trypanosome correlate positively with the presence of \u003cem\u003eSodalis glossinidius\u003c/em\u003e [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Bacteria belonging to the genus \u003cem\u003eWolbachia\u003c/em\u003e are a group of intracellular alpha proteobacteria that are trans-ovarially transmitted between different generations of tsetse flies and occur in numerous arthropods (65% of insects) and filarial nematode species. These bacteria are associated with the reproductive tissues and cause reproductive abnormalities such as cytoplasmic incompatibility (CI), parthenogenesis, male death, and feminisation [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. \u003cem\u003eSpiroplasma\u003c/em\u003e is a genus of wall-less bacteria belonging to the class Mollicutes, and it has been associated with diverse plants and arthropods. \u003cem\u003eSpiroplasma\u003c/em\u003e has been reported to confer protection against a nematode in \u003cem\u003eDrosophila neotestacea\u003c/em\u003e [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e] against fungi in the pea aphid (\u003cem\u003eAcyrthosiphon pisum\u003c/em\u003e), and against a parasitoid wasp in \u003cem\u003eDrosophila hydei\u003c/em\u003e [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eSeveral reports are available on the prevalence of \u003cem\u003eS. glossinidius\u003c/em\u003e, \u003cem\u003eWolbachia\u003c/em\u003e, and \u003cem\u003eSpiroplasma\u003c/em\u003e in different tsetse species from various geographical locations, highlighting an association between the presence of \u003cem\u003eSodalis glossinidius\u003c/em\u003e and the ability of tsetse flies to harbour trypanosomes [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. However, there is lack of information on the prevalence and relationship between the presence of endosymbionts and trypanosome infections in \u003cem\u003eGlossina tachinoides\u003c/em\u003e from Yankari Game Reserve, Nigeria. Therefore, this study aimed to investigate the prevalence and association between trypanosomes and endosymbionts inTsetse flies from Yankari Game Reserve.\u003c/p\u003e"},{"header":"Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eStudy area\u003c/h2\u003e \u003cp\u003eThis study was carried out in Yankari Game Reserve (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The game reserve occupies an area of about 2244 km\u003csup\u003e2\u003c/sup\u003e. The park is centred at 9.50\u0026rsquo;N and 10.30\u0026rsquo;E in the south-central area of Bauchi State in North-eastern Nigeria, in the southern portion of the Sudan Savanna Zone [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. The annual rainfall in the area ranges between 900 mm\u003csup\u003e3\u003c/sup\u003e and 1,000 mm\u003csup\u003e3\u003c/sup\u003e, with the wet season starting in May and ending in September and the dry season starting in October and ending in April [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e].\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eSampling, morphological identification, and dissection of tsetse flies\u003c/h3\u003e\n\u003cp\u003eTrapping of tsetse flies was conducted in November using 11 biconical traps placed at suitable locations (cool, shady areas to avoid desiccation of flies) for three consecutive days. The geographical coordinates of each trap were recorded using a Global Positioning System (GPS) device (GPSMAP\u0026reg; 60CSx Garmin). Tsetse flies were collected once a day at 4 pm. Species and sexes were identified immediately using morphological features such as size, colour and number of dark tarsal segments [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. The flies were dissected under a microscope in a drop of phosphate buffered saline (PBS) solution using sterile dissection tools. The tools were cleaned using 3% bleach (sodium hypochlorite), followed by 70% ethanol, and finally sterile distilled water after the dissection of each fly to prevent contamination. Guts and other body parts were separately transferred into cryotubes containing RNA Later\u0026reg; (Sigma-Aldrich) and stored at room temperature in the field, then at \u0026minus;\u0026thinsp;20 ℃ in the laboratory until required for use.\u003c/p\u003e\n\u003ch3\u003eDNA extraction\u003c/h3\u003e\n\u003cp\u003eDNA was extracted from the dissected guts using the AccuPrep Genomic DNA extraction kit (Bioneer, South Korea) according to the manufacturer\u0026rsquo;s instructions. The extracted DNA was quantified using a NanoDrop1000 C spectrophotometer (Thermo scientific, Germany) and stored at -20 ℃.\u003c/p\u003e\n\u003ch3\u003eMolecular confirmation of tsetse fly species\u003c/h3\u003e\n\u003cp\u003eTo confirm the species of tsetse flies previously identified morphologically, a PCR was performed to amplify the mitochondrial \u003cem\u003ecytochrome C oxidase 1 gene\u003c/em\u003e (COX1) using COX-1 primers (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) adapted from Dyer et al. [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. The PCR reaction was carried out in a 20 \u0026micro;L volume containing 1X DreamTaq buffer, 1 U DreamTaq polymerase, 0.2 mM dNTPs, 2 \u0026micro;M each of forward and reverse primers, 2 \u0026micro;L of DNA template, and the volume was made up with nuclease-free water. The cycling conditions were; initial denaturation at 95 ℃ for 5 minutes, followed by 30 cycles of denaturation at 94 ℃ for 60 s, annealing at 55 ℃ for 60 s, and elongation at 72 ℃ for 2 minutes, and a final extension at 72 ℃ for 10 minutes.\u003c/p\u003e\n\u003ch3\u003eIdentification of different trypanosome species\u003c/h3\u003e\n\u003cp\u003eA nested PCR was carried out using ITS-1 generic primers (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) from Adams et al. [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. The first round of PCR was performed in a 20 \u0026micro;L reaction volume containing 1X DreamTaq buffer, 1 U DreamTaq polymerase 0.2 mM dNTPs, 1 \u0026micro;M each of the outer primers (forward and reverse), and 3 \u0026micro;L of DNA template. The volume was made up using nuclease free-water. The cycling conditions were; initial denaturation at 95 ℃ for 3 minutes, followed by 35 cycles of denaturation at 94 ℃ for 30 s, annealing at 54 ℃ for 30 s, extension at 72 ℃ for 60 s, and a final extension at 72 ℃ for 5 minutes. The second round of PCR was carried out using ITS-1 internal primers (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) and was performed in 20 \u0026micro;L reaction volume containing 1X DreamTaq buffer, 1 U DreamTaq polymerase, 0.2 mM dNTPs, 1 \u0026micro;M of each primer, 2 \u0026micro;L DNA (1/40 dilution of first round PCR product) and the volume was made up with nuclease free water. The cycling conditions were as followed: initial denaturation at 95 ℃ for 3 minutes, followed by 35 cycles of denaturation at 94 ℃ for 30 s, annealing at 55 ℃ for 30 s, extension at 72 ℃ for 60 s, and a final extension at 72 ℃ for 5 minutes.\u003c/p\u003e \u003cp\u003eAnother nested PCR targeting the glycosomal Glyceraldehyde-3-phosphate dehydrogenase (gGAPDH) gene of trypanosomes was performed to confirm the trypanosomes positive tsetse guts using gGAPDH primers (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) designed by Hamilton et al. [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e] following the protocol of Weber et al. [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. The first round PCR was performed in a 20 \u0026micro;L reaction volume containing 1X DreamTaq buffer, 1 U DreamTaq polymerase, 0.2 mM dNTPs, 1 \u0026micro;M of each gGAPDH external primer, 2 \u0026micro;L DNA template and the volume was made up using nuclease free water. The cycling conditions were; initial denaturation for 3 minutes at 95\u0026deg;C, followed by 30 cycles of 60 s at 95\u0026deg;C, 30 s at 55\u0026deg;C and 60 s at 72\u0026deg;C, and a final elongation at 72\u0026deg;C for 10 minutes. The first PCR products were diluted 40-fold and 1 \u0026micro;L of this dilution was used for the second PCR round using gGAPDH internal primers, performed in a 20 \u0026micro;L reaction volume containing 1X DreamTaq buffer, 1 U DreamTaq polymerase, 0.2 mM dNTPs, 1 \u0026micro;M each of gGAPDH internal primer (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e), and the volume was made up using nuclease free water. The cycling conditions were; initial denaturation for 3 minutes at 95\u0026deg;C, followed by 30 cycles of 60 s at 95\u0026deg;C, 30 s at 52\u0026deg;C and 60 s at 72\u0026deg;C, and a final elongation at 72\u0026deg;C for 10 minutes. Amplicons were resolved on 1.5% agarose gel.\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eDetection of endosymbionts\u003c/h2\u003e \u003cp\u003eThe presence of \u003cem\u003eS. glossinidius\u003c/em\u003e was screened by PCR using pSG2 (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) adapted from Darby et al. [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e] in a total reaction volume of 20 \u0026micro;L containing 1X DreamTaq buffer, 1 U DreamTaq polymerase, 0.2 mM dNTPs, 1 \u0026micro;M each of primers, and 3 \u0026micro;L of DNA template. The volume was made up using nuclease-free water. The cycling conditions were: initial denaturation at 94 ℃ for 3 minutes, followed by 30 cycles of 94 ℃ for 30 s, 51 ℃ for 30 s, 72 ℃ for 30 s, and a final extension at 72 ℃ for 5 minutes. \u003cem\u003eWolbachia\u003c/em\u003e was detected by PCR using W-spec primers (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) that amplify a 438 bp DNA fragment of the 16S rRNA [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e] in a 20 \u0026micro;L reaction volume containing 1X DreamTaq buffer, 0.15 mM dNTPs, 1 U DreamTaq polymerase, 0.5 \u0026micro;M each of primers, and 2 \u0026micro;L of template DNA. The volume was made up using nuclease-free water. The cycling conditions were: initial denaturation at 95 ℃ for 5 minutes, followed by 30 cycles of 95 ℃ for 30 s, 54 ℃ for 30 s, 72 ℃ for 60 s, and a final extension at 72 ℃ for 10 minutes. \u003cem\u003eSpiroplasma\u003c/em\u003e was detected by amplifying the 16S rRNA gene of the bacterium using 63F primers (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) as described by Doudoumis et al. [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e] in a 20 \u0026micro;L reaction volume consisting of 1X DreamTaq buffer, 0.15 mM dNTPs, 1 U DreamTaq polymerase, 0.25 \u0026micro;M each of primers, and 3 \u0026micro;L of template DNA. The cycling conditions were: initial denaturation at 95 ℃ for 5 minutes, followed by 30 cycles of 95 ℃ for 30 s, 59 ℃ for 30 s, 72 ℃ for 60 s, and a final extension at 72 ℃ for 10 minutes. All PCR products were resolved on 1.5% agarose gel and visualised under UV illumination.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eSequence of primers used for molecular identification of organisms\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOrganisim\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDirection\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSequence\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eReference\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eGlossina spp\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCOX1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTTGATTTTTTGGTCATCCAGAAGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eGlossina spp\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCOX1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTGAAGCTTAAATTCATTGCACTAATC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eTrypanosoma spp\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eITS-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eExternal Forward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTGCAATTATTGGTCGCGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eTrypanosoma spp\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eITS-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eExternal Reverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCTTTGCTGCGTTCTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eTrypanosoma spp\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eITS-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eInternal Forward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAAGCCAAGTCATCCATCG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eTrypanosoma spp\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eITS-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eInternal Reverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTAGAGGAAGCAAAAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eTrypanosoma spp\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003egGAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eExternal Forward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTTYGCCGYATYGGYCGCATGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eTrypanosoma spp\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003egGAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eExternal Reverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eACMAGRTCCACCACRCGGTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eTrypanosoma spp\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003egGAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eInternal Forward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGCSTAYCAGATGAAGTAC GAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eTrypanosoma spp\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003egGAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eInternal Reverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGTTYTGCAGSGTCGCCTTGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eSodalis\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003epSG2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTGAAGTTGGGAATGTCG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eSodalis\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003epSG2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAGTTGTAGCACAGCGTGTA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eWolbachia\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eW-spec\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCATACC TATTCGAAGGGATAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eWolbachia\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eW-spec\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAGCTTCGAGTGAA ACCAATTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eSpiroplasma\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e63F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGCCTAATACATGCAAGTCGAAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eSpiroplasma\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e63F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTAGCCGTGGCTTTCTGGTAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003ePCR products purification and sequencing\u003c/h3\u003e\n\u003cp\u003ePCR amplicons were excised from the gel and purified using the GeneJET Gel Extraction Kit (Thermo Scientific) following the manufacturer\u0026rsquo;s instructions. The purified DNA was used for direct Sanger sequencing by a commercial provider (Microsynth SeqLab, G\u0026ouml;ttingen, Germany). The sequences generated were analysed using the Bio-edit software, and a BLAST (Basic Local Alignment Search Tool) search was conducted using Nucleotide BLAST at the NCBI (National Center for Biotechnology Information) database [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Nucleotide sequences isolated in this study were deposited in GenBank and accession numbers assigned.\u003c/p\u003e\n\u003ch3\u003eStatistical analyses\u003c/h3\u003e\n\u003cp\u003eEntomological data were expressed in terms of abundance of tsetse flies, estimated by fly apparent density per trap per day (ADT) according to the following formula: ADT\u0026thinsp;=\u0026thinsp;Nc/TD (where Nc is the number of captured tsetse flies, T is the number of traps, and D is the number of trapping days). Trypanosomes and symbionts hosted by tsetse flies were expressed in terms of prevalence. The Fisher test and the logistic regression model were used to analyse the association between the presence of symbionts (\u003cem\u003eWolbachia\u003c/em\u003e and \u003cem\u003eSpiroplasma\u003c/em\u003e, respectively) and trypanosome infection in tsetse flies.\u003c/p\u003e"},{"header":"Results and Discussion","content":"\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eEntomological survey\u003c/h2\u003e \u003cp\u003eA total of 2,742 tsetse flies were captured, using 11 biconical traps in four days. The apparent fly density was 83.03 F/T/D. All the captured flies were morphologically identified as \u003cem\u003eGlossina tachinoides\u003c/em\u003e, and 215 were dissected for the study. The amplification (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e) and sequencing of the COX1 partial gene sequence confirmed the \u003cem\u003eGlossina\u003c/em\u003e species to be \u003cem\u003eG. tachinoides\u003c/em\u003e. The sequence of our amplicons was closely related (99.87% similarity) to other \u003cem\u003eGlossina tachinoides\u003c/em\u003e COX1 sequences isolated in the same locality (MG234544, MG234547).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eA relatively high apparent tsetse fly density of 83.03 F/T/D was determined. Previous studies reported apparent fly densities of 22.5 [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e] and 128.03F/T/D for \u003cem\u003eG. tachinoides\u003c/em\u003e [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. This variation in apparent fly density could be a result of variations in study periods. In our study, samples were collected at the beginning of the dry season (November), and in the other studies, samples were collected in March and August, respectively. We identified the presence of a single tsetse fly species (\u003cem\u003eGlossina tachinoides\u003c/em\u003e), whereas a previous study reported two species: \u003cem\u003eGlossina morsitans\u003c/em\u003e and \u003cem\u003eGlossina tachinoides\u003c/em\u003e [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. The same study reported \u003cem\u003eGlossina tachinoides\u003c/em\u003e as the predominant species of tsetse flies in Yankari Game Reserve [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. This difference in \u003cem\u003eGlossina\u003c/em\u003e species may be due to variation in trap locations during the entomological survey.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eTrypanosome infection rate\u003c/h2\u003e \u003cp\u003eOut of 215 guts of \u003cem\u003eGlossina tachinoides\u003c/em\u003e analysed by ITS-1 nested PCR (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e), only 23 (10.70%) were infected with at least one species of trypanosomes. Three species of trypanosomes were identified \u003cem\u003eTrypanosoma grayi\u003c/em\u003e, \u003cem\u003eT\u003c/em\u003e. \u003cem\u003econgolense\u003c/em\u003e, and \u003cem\u003eT. vivax\u003c/em\u003e. The number of flies infected by \u003cem\u003eT. grayi\u003c/em\u003e, \u003cem\u003eT. congolense\u003c/em\u003e and \u003cem\u003eT. vivax\u003c/em\u003e were: 21/215 (9.77%), 9/215 (4.19%), and 2/215 (0.93%). There were 14/23 single infections (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e) and 9 mixed infections (7/23 \u003cem\u003eT. grayi\u003c/em\u003e-\u003cem\u003eT. congolense\u003c/em\u003e and 2/23 \u003cem\u003eT. grayi\u003c/em\u003e-\u003cem\u003eT. vivax\u003c/em\u003e). Following the identification of trypanosomes using ITS-1 nested PCR, gGAPDH nested PCR (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e) was performed to confirm the trypanosomes positive tsetse flies.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eTrypanosome species isolated from midgut of \u003cem\u003eGlossina tachinoides\u003c/em\u003e\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eType of Infection\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eT. grayi\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eT. congolense\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003eT. vivax\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003eT. grayi/congolense\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003eT. grayi/vivax\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eInfections (/215)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrevalence\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5.58%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.47%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.47%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e3.26%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.93%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"6\" nameend=\"c6\" namest=\"c1\"\u003e \u003cp\u003eOverall prevalence of trypanosome infection\u0026thinsp;=\u0026thinsp;23/215 (10.70%)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe trypanosome infection rate of 10.70% was similar to the 11.9% infection rate obtained in another study in the same location on \u003cem\u003eGlossina tachinoides\u003c/em\u003e [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. This study reported the presence of three species of trypanosomes: \u003cem\u003eT. congolense\u003c/em\u003e, \u003cem\u003eT. vivax\u003c/em\u003e and \u003cem\u003eT. grayi\u003c/em\u003e, which supported the work of Weber et al. [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e], where they reported the presence of the same species. No trypanosome species of the \u003cem\u003eTrypanosoma brucei\u003c/em\u003e complex was found, which is in agreement with Weber et al. [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e] that reported the absence of \u003cem\u003eT. brucei\u003c/em\u003e species. \u003cem\u003eTrypanosoma vivax\u003c/em\u003e was found in only two Tsetse fly samples. This low infection rate observed could be due to the fact that DNA was extracted only from the midgut of tsetse flies since the life cycle of \u003cem\u003eT\u003c/em\u003e. \u003cem\u003evivax\u003c/em\u003e is restricted to the mouthparts, though few reports show that this parasite can be detected in the midgut of tsetse flies up to four days after an infectious blood meal [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eSymbiont occurrence rate\u003c/h2\u003e \u003cp\u003eOut of 215 midgut samples screened for the presence of \u003cem\u003eSpiroplasma\u003c/em\u003e, \u003cem\u003eWolbachia\u003c/em\u003e, and \u003cem\u003eSodalis glossinidius\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003e, Fig. \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e), 87 harboured \u003cem\u003eSpiroplasma\u003c/em\u003e, and 6 harboured \u003cem\u003eWolbachia\u003c/em\u003e while no sample was found to harbour \u003cem\u003eS. glossinidius\u003c/em\u003e, giving endosymbiont infection rates of 40.70%, 2.80% and 0.00% respectively.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eOur findings reported the presence of two Tsetse\u0026rsquo;s symbiotic bacteria: \u003cem\u003eSpiroplasma\u003c/em\u003e and \u003cem\u003eWolbachia\u003c/em\u003e. The absence of \u003cem\u003eSodalis glossinidius\u003c/em\u003e in \u003cem\u003eGlossina tachinoides\u003c/em\u003e agrees with the findings of Mfopit et al. [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e], who reported a 0.00% prevalence of \u003cem\u003eSodalis\u003c/em\u003e in the same study location, but differs with 3.7% and 16% infection rates reported for \u003cem\u003eG. austeni\u003c/em\u003e and \u003cem\u003eG. pallidipes\u003c/em\u003e, respectively, in Shimba Hills National Reserve, Kenya [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Results from our study also differ with the 37.0% \u003cem\u003eSodalis\u003c/em\u003e infection rate found in \u003cem\u003eGlossina tachinoides\u003c/em\u003e captured in Cameroon [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. The remarkable difference observed with our study could be attributed to differences in tsetse species and geographic location because the microbiota of tsetse flies vary with \u003cem\u003eGlossina\u003c/em\u003e species and geographic location [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. The low occurrence of \u003cem\u003eWolbachia\u003c/em\u003e (2.80%) corroborates with another study that reported the absence of \u003cem\u003eWolbachia\u003c/em\u003e in the \u003cem\u003eGlossina palpalis\u003c/em\u003e group [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. However, Kame-Ngasse et al. [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e] reported a high prevalence of 68.1% in \u003cem\u003eGlossina tachinoides\u003c/em\u003e from the Adamawa region, Cameroon. These observations suggest that the prevalence of \u003cem\u003eWolbachia\u003c/em\u003e may depend on the ecological conditions of tsetse fly populations [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. The high infection rate of tsetse flies with \u003cem\u003eSpiroplasma\u003c/em\u003e (40.8%) is consistent with other studies reporting 37.5% [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e] and 44.5% infection rate of \u003cem\u003eSpiroplasma\u003c/em\u003e in \u003cem\u003eG. tachinoides\u003c/em\u003e captured from Burkina Faso [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eRelationship between trypanosome infection and symbiont presence\u003c/h2\u003e \u003cp\u003eOf the 87 tsetse flies harbouring \u003cem\u003eSpiroplasma\u003c/em\u003e, 13 were infected with at least one trypanosome species (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Of the 128 tsetse flies that were negative for \u003cem\u003eSpiroplasma\u003c/em\u003e, 10 were harbouring trypanosomes. There was no association (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.116) between the presence of \u003cem\u003eSpiroplasma\u003c/em\u003e and the trypanosome infection. Out of 6 flies harbouring \u003cem\u003eWolbachia\u003c/em\u003e, 5 were infected with at least one trypanosome species, while one was trypanosome negative. Of the 209 \u003cem\u003eWolbachia\u003c/em\u003e negative flies, 18 were infected by trypanosomes. The Fisher test (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e) showed that there was a positive association between \u003cem\u003eWolbachia\u003c/em\u003e presence and trypanosome infection (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.001).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eStatistical association of \u003cem\u003eWolbachia and Spiroplasma\u003c/em\u003e endosymbionts with trypanosome DNA in \u003cem\u003eGlossina tachinoides\u003c/em\u003e\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colspan=\"3\" nameend=\"c3\" namest=\"c1\"\u003e \u003cp\u003e\u003cem\u003eSpiroplasma\u003c/em\u003e and trypanosome co-infection\u003c/p\u003e \u003cp\u003e(N\u0026thinsp;=\u0026thinsp;215)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"3\" nameend=\"c6\" namest=\"c4\"\u003e \u003cp\u003e\u003cem\u003eWolbachia\u003c/em\u003e and trypanosome co-infection\u003c/p\u003e \u003cp\u003e(N\u0026thinsp;=\u0026thinsp;215)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eT/S\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eS-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eS+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eW/T\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eW-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eW+\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eT-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e118\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e74\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eT-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e191\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eT+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eT+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"3\" nameend=\"c3\" namest=\"c1\"\u003e \u003cp\u003e\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.116\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"3\" nameend=\"c6\" namest=\"c4\"\u003e \u003cp\u003e\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.001\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eT+/T-: Trypanosome positive/negative, W+/W-: \u003cem\u003eWolbachia\u003c/em\u003e positive/negative Sp+/Sp-: \u003cem\u003eSpiroplasma\u003c/em\u003e positive/negative.\u003c/p\u003e \u003cp\u003eNo association was observed between the presence of \u003cem\u003eSpiroplasma\u003c/em\u003e and the presence of trypanosome infection, suggesting that \u003cem\u003eSpiroplasma\u003c/em\u003e has no effect on the establishment of trypanosomes within the midgut of tsetse flies. An association was observed between \u003cem\u003eWolbachia\u003c/em\u003e and trypanosomes in Tsetse flies, but this association could not be conclusive due to the fact that only a few Tsetse flies (6/215) were harbouring the bacterium. This study differs from that of Kante et al. [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e], who reported the absence of an association between \u003cem\u003eWolbachia\u003c/em\u003e and the presence of trypanosomes in \u003cem\u003eGlossina palpalis palpalis\u003c/em\u003e populations from three sleeping sickness foci of southern Cameroon. The study should be performed with different haplotypes of \u003cem\u003eWolbachia\u003c/em\u003e to have a clearer picture of the possible relationship existing between the presence of \u003cem\u003eWolbachia\u003c/em\u003e and the level of trypanosome infection in tsetse flies.\u003c/p\u003e \u003cp\u003eTsetse fly COX1, trypanosome ITS-1, \u003cem\u003eWolbachia\u003c/em\u003e, and \u003cem\u003eSpiroplasma\u003c/em\u003e 16SrRNA sequences obtained from this study were deposited on the NCBI database under the following accession numbers. \u003cem\u003eGlossina tachinoides\u003c/em\u003e; OQ653471, \u003cem\u003eTrypanosoma congolense\u003c/em\u003e; OQ658682 and OQ658683, \u003cem\u003eTrypanosoma vivax\u003c/em\u003e; OQ658688, \u003cem\u003eTrypanosoma grayi\u003c/em\u003e; OQ658685, OQ658686, and OQ658687 \u003cem\u003eWolbachia\u003c/em\u003e; OQ658372, and \u003cem\u003eSpiroplasma\u003c/em\u003e; OQ658371.\u003c/p\u003e \u003c/div\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThis study found that \u003cem\u003eGlossina tachinoides\u003c/em\u003e from Yankari Game Reserve are infected with trypanosomes, with a prevalence of 10.70%. The infection rates of \u003cem\u003eSodalis\u003c/em\u003e, \u003cem\u003eWolbachia\u003c/em\u003e and \u003cem\u003eSpiroplasma\u003c/em\u003e were 0.00%, 2.80%, and 40.70%, respectively. An association was observed between \u003cem\u003eWolbachia\u003c/em\u003e and trypanosomes in tsetse flies, but no association was observed between \u003cem\u003eSpiroplasma\u003c/em\u003e and trypanosomes. These findings provide useful data on the microbiota of tsetse flies and could be further used to investigate and understand the role of these symbiotic bacteria on the physiology of tsetse flies, thus helping in the development of new disease control techniques.\u003c/p\u003e "},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eData availability\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets supporting the conclusions of this article are included within the article and its additional files. Nucleotide sequences are openly available in National Center for Biotechnology Information (https://www.ncbi.nlm.nih.gov/), with following reference numbers: \u003cem\u003eGlossina tachinoides\u003c/em\u003e: OQ65347; \u003cem\u003eTrypanosoma congolense\u003c/em\u003e: OQ658682 and OQ658683; \u003cem\u003eTrypanosoma vivax\u003c/em\u003e: OQ658688; \u003cem\u003eTrypanosoma grayi\u003c/em\u003e: OQ658685, OQ658686, and OQ658687; \u003cem\u003eWolbachia\u003c/em\u003e: OQ658372 and \u003cem\u003eSpiroplasma\u003c/em\u003e: OQ658371.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflicts of interest\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no conflict of interest\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the Africa Centre of Excellence for Neglected Tropical Diseases and Forensic Biotechnology (ACENTDFB), Ahmadu Bello University, Zaria, Nigeria; and also by the Deutsche Forschungsgemeinschaft (DFG project grant to GDC: Ke428/13-1).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors sincerely thank Africa Centre of Excellence for Neglected Tropical Diseases and Forensic Biotechnology (ACENTDFB), Ahmadu Bello University, Zaria, Nigeria for sponsoring the research. We also thank the Centre for Biotechnology Research and Training (CBRT), Ahmadu Bello University for their technical assistance during laboratory work. Our sincere gratitude goes to the department of Biochemistry, Ahmadu Bello University for administrative and technical support in carrying out the study. We would also like to thank the following persons: Prof. Achukwi Daniel, Mr. Nsadztsen Gilbert Adzemye, and Mr. Ahmadu, a staff member of the Nigerian Institute of Trypanosomiasis Research.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eYMM conceived the study: ACMT, YMM, AA, GDC, and JK designed the protocol of the study. ACMT, YMM, ABY, PYM, EFG and GAA contributed to sample collection. ACMT and YMM carried out laboratory analyses. AA, GDC, MM and JK supervised laboratory analyses. YMM carried out data analyses. ACMT drafted the manuscript. All authors read, revised, and approved the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAttardo GM, Scolari F, Malacrida A. Bacterial Symbionts of Tsetse Flies: Relationships and Functional Interactions Between Tsetse Flies and Their Symbionts. In: Kloc M, editor. Symbiosis: Cellular, Molecular, Medical and Evolutionary Aspects [Internet]. Cham: Springer International Publishing; 2020 [cited 2023 Feb 27]. pp. 497\u0026ndash;536. (Results and Problems in Cell Differentiation; vol. 69). Available from: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://link.springer.com/\u003c/span\u003e\u003cspan address=\"https://link.springer.com/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/978-3-030-51849-3_19\u003c/span\u003e\u003cspan address=\"10.1007/978-3-030-51849-3_19\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNamangala B, Odongo S. Animal African Trypanosomosis in Sub-Saharan Africa and Beyond African Borders. In: Magez S, Radwanska M, editors. Trypanosomes and Trypanosomiasis [Internet]. Vienna: Springer Vienna; 2014 [cited 2023 Feb 28]. pp. 239\u0026ndash;60. Available from: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://link.springer.com/\u003c/span\u003e\u003cspan address=\"https://link.springer.com/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/978-3-7091-1556-5_10\u003c/span\u003e\u003cspan address=\"10.1007/978-3-7091-1556-5_10\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGeerts S, Holmes PH, Eisler MC, Diall O. African bovine trypanosomiasis: the problem of drug resistance. Trends Parasitol. 2001;17(1):25\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKame-Ngasse GI, Njiokou F, Melachio-Tanekou TT, Farikou O, Simo G, Geiger A. Prevalence of symbionts and trypanosome infections in tsetse flies of two villages of the Faro and D\u0026eacute;o division of the Adamawa region of Cameroon. BMC Microbiol. 2018;18(1):159.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSimo G, Kant\u0026eacute; ST, Madinga J, Kame G, Farikou O, Ilombe G et al. Molecular identification of Wolbachia and Sodalis glossinidius in the midgut of Glossina fuscipes quanzensis from the Democratic Republic of Congo. Parasite. 26:5.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRio RVM, Hu Y, Aksoy S. Strategies of the home-team: symbioses exploited for vector-borne disease control. Trends Microbiol. 2004;12(7):325\u0026ndash;36.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBalmand S, Lohs C, Aksoy S, Heddi A. Tissue distribution and transmission routes for the tsetse fly endosymbionts. J Invertebr Pathol. 2013;112:S116\u0026ndash;22.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang J, Weiss BL, Aksoy S. Tsetse fly microbiota: form and function. Front Cell Infect Microbiol [Internet]. 2013 [cited 2023 Feb 28];3. Available from: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://journal.frontiersin.org/article/\u003c/span\u003e\u003cspan address=\"http://journal.frontiersin.org/article/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fcimb.2013.00069/abstract\u003c/span\u003e\u003cspan address=\"10.3389/fcimb.2013.00069/abstract\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDale C, Welburn SC. The endosymbionts of tsetse flies: manipulating host\u0026ndash;parasite interactions. Int J Parasitol. 2001;31(5\u0026ndash;6):628\u0026ndash;31.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDoudoumis V, Blow F, Saridaki A, Augustinos A, Dyer NA, Goodhead I, et al. Challenging the Wigglesworthia, Sodalis, Wolbachia symbiosis dogma in tsetse flies: Spiroplasma is present in both laboratory and natural populations. Sci Rep. 2017;7(1):4699.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFarikou O, Njiokou F, Mbida Mbida JA, Njitchouang GR, Djeunga HN, Asonganyi T, et al. Tripartite interactions between tsetse flies, Sodalis glossinidius and trypanosomes\u0026mdash;An epidemiological approach in two historical human African trypanosomiasis foci in Cameroon. Infect Genet Evol. 2010;10(1):115\u0026ndash;21.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWerren JH, Windsor DM. Wolbachia infection frequencies in insects: evidence of a global equilibrium? Proceedings of the Royal Society of London Series B: Biological Sciences. 2000;267(1450):1277\u0026ndash;85.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJaenike J, Unckless R, Cockburn SN, Boelio LM, Perlman SJ. Adaptation via Symbiosis: Recent Spread of a \u003cem\u003eDrosophila\u003c/em\u003e Defensive Symbiont. Science. 2010;329(5988):212\u0026ndash;5.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXie J, Vilchez I, Mateos M. Spiroplasma Bacteria Enhance Survival of Drosophila hydei Attacked by the Parasitic Wasp Leptopilina heterotoma. Raine NE, editor. PLoS ONE. 2010;5(8):e12149.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGeiger A, Ravel S, Frutos R, Cuny G. Sodalis glossinidius (Enterobacteriaceae) and Vectorial Competence of Glossina palpalis gambiensis and Glossina morsitans morsitans for Trypanosoma congolense Savannah Type. Curr Microbiol. 2005;51(1):35\u0026ndash;40.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOdunlami S. An assessment of the ecotourism potential of yankari national park, nigeria. In 2003 [cited 2024 Sep 12]. Available from: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.semanticscholar.org/paper/%22AN-ASSESSMENT-OF-THE-ECOTOURISM-POTENTIAL-OF-PARK%2C-Odunlami/b1f4929d2bbd0fb956149a9eb672419825958cee\u003c/span\u003e\u003cspan address=\"https://www.semanticscholar.org/paper/%22AN-ASSESSMENT-OF-THE-ECOTOURISM-POTENTIAL-OF-PARK%2C-Odunlami/b1f4929d2bbd0fb956149a9eb672419825958cee\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAbdullahi M, Sanusi S, Abdul S, F.B.J.. S. An Assessment of the Herbaceous Species Vegetation of Yankari Game Reserve. Bauchi Nigeria. 2009;6:20\u0026ndash;5.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGooding RH, Krafsur ES. Tsetse genetics: Contributions to Biology, Systematics, and Control of Tsetse Flies. Annu Rev Entomol. 2005;50(1):101\u0026ndash;23.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDyer N, Lawton S, Ravel S, Choi K, Lehane M, Robinson A, et al. Molecular phylogenetics of tsetse flies (Diptera: Glossinidae) based on mitochondrial (COI, 16S, ND2) and nuclear ribosomal DNA sequences, with an emphasis on the palpalis group. Mol Phylogenet Evol. 2008;49(1):227\u0026ndash;39.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAdams ER, Malele II, Msangi AR, Gibson WC. Trypanosome identification in wild tsetse populations in Tanzania using generic primers to amplify the ribosomal RNA ITS-1 region. Acta Trop. 2006;100(1\u0026ndash;2):103\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHamilton PB, Stevens JR, Gaunt MW, Gidley J, Gibson WC. Trypanosomes are monophyletic: evidence from genes for glyceraldehyde phosphate dehydrogenase and small subunit ribosomal RNA. Int J Parasitol. 2004;34(12):1393\u0026ndash;404.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWeber JS, Ngomtcho SCH, Shaida SS, Chechet GD, Gbem TT, Nok JA, et al. Genetic diversity of trypanosome species in tsetse flies (Glossina spp.) in Nigeria. Parasites Vectors. 2019;12(1):481.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDarby AC, Lagnel J, Matthew CZ, Bourtzis K, Maudlin I, Welburn SC. Extrachromosomal DNA of the Symbiont \u003cem\u003eSodalis glossinidius\u003c/em\u003e. J Bacteriol. 2005;187(14):5003\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSyngai G, Barman P, Bharali R, Dey S. BLAST: An introductory tool for students to Bioinformatics Applications. Kenean J Sci. 2013;2:67\u0026ndash;76.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShaida SS, Weber JS, Gbem TT, Ngomtcho SCH, Musa UB, Achukwi MD, et al. Diversity and phylogenetic relationships of Glossina populations in Nigeria and the Cameroonian border region. BMC Microbiol. 2018;18(1):180.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIsaac C, Ciosi M, Hamilton A, Scullion KM, Dede P, Igbinosa IB, et al. Molecular identification of different trypanosome species and subspecies in tsetse flies of northern Nigeria. Parasites Vectors. 2016;9(1):301.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOoi CP, Schuster S, Cren-Travaill\u0026eacute; C, Bertiaux E, Cosson A, Goyard S et al. The Cyclical Development of Trypanosoma vivax in the Tsetse Fly Involves an Asymmetric Division. Frontiers in Cellular and Infection Microbiology [Internet]. 2016 [cited 2023 Feb 28];6. Available from: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.frontiersin.org/articles/\u003c/span\u003e\u003cspan address=\"https://www.frontiersin.org/articles/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fcimb.2016.00115\u003c/span\u003e\u003cspan address=\"10.3389/fcimb.2016.00115\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMfopit YM, Weber JS, Chechet GD, Ibrahim MAM, Signaboubo D, Achukwi DM et al. Molecular detection of Sodalis glossinidius, Spiroplasma and Wolbachia endosymbionts in wild population of tsetse flies collected in Cameroon, Chad and Nigeria. Res Sq. 2023;rs.3.rs-2902767.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWamwiri FN, Alam U, Thande PC, Aksoy E, Ngure RM, Aksoy S, et al. Wolbachia, Sodalis and trypanosome co-infections in natural populations of Glossina austeni and Glossina pallidipes. Parasites Vectors. 2013;6(1):232.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEl Khamlichi S, Maurady A, Asimakis E, Stathopoulou P, Sedqui A, Tsiamis G. Detection and Characterization of Spiroplasma and Wolbachia in a Natural Population of Glossina Tachinoides. In: Kacprzyk J, Balas VE, Ezziyyani M, editors. Advanced Intelligent Systems for Sustainable Development (AI2SD\u0026rsquo;2020). Cham: Springer International Publishing; 2022. pp. 256\u0026ndash;64. (Advances in Intelligent Systems and Computing).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYun Y, Lei C, Peng Y, Liu F, Chen J, Chen L. Wolbachia Strains Typing in Different Geographic Population Spider, Hylyphantes Graminicola (Linyphiidae). Curr Microbiol. 2011;62(1):139\u0026ndash;45.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKante TS, Melachio Tanekou TT, Amih O, Njiokou F, Simo G. Detection of Wolbachia and different trypanosome species in Glossina palpalis palpalis populations from three sleeping sickness foci of southern Cameroon. Parasites Vectors. 2018;11.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"bmc-veterinary-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"Learn more about [BMC Veterinary Research](http://bmcvetres.biomedcentral.com/)","snPcode":"12917","submissionUrl":"https://submission.nature.com/new-submission/12917/3?","title":"BMC Veterinary Research","twitterHandle":"@BMC_series","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Trypanosoma, Spiroplasma, Wolbachia, Sodalis glossinidius, Glossina tachinoides, Yankari Game Reserve","lastPublishedDoi":"10.21203/rs.3.rs-6252946/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6252946/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground\u003c/strong\u003e. Tsetse flies are vectors of African trypanosomiasis, a disease that affects both humans and animals. Trypanosomiasis remains a threat to lives and an impediment to socio-economic development in sub-Saharan Africa. In spite of decades of chemotherapy and vector control, the disease has not been eradicated. The parasites have developed resistance to the existing drugs, while the available vector control strategies are expensive and unsustainable. Therefore, there is a need to explore other control approaches, such as the transformation of tsetse fly endosymbionts to render the fly refractory to trypanosome infection. The aim of this study was to investigate the prevalence and association of trypanosome infection with some endosymbionts in tsetse flies from Yankari Game Reserve.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults\u003c/strong\u003e. Tsetse flies were caught using biconical traps and identified morphologically. They were dissected and their entire gut was isolated and used for DNA extraction. Polymerase chain reaction was used to confirm the identity of the flies by amplifying the cytochrome C oxidase-1 gene and to screen for the presence of endosymbionts (\u003cem\u003eSodalis glossinidius\u003c/em\u003e, \u003cem\u003eWolbachia\u003c/em\u003e, and \u003cem\u003eSpiroplasma \u003c/em\u003esp.) and trypanosomes. A single tsetse fly species was identified: \u003cem\u003eGlossina tachinoides\u003c/em\u003e. A trypanosome infection rate of 10.70% was found and three species of trypanosomes detected (\u003cem\u003eTrypanosoma grayi\u003c/em\u003e, \u003cem\u003eTrypanosoma congolense,\u003c/em\u003e and \u003cem\u003eTrypanosoma vivax\u003c/em\u003e), with \u003cem\u003eTrypanosoma grayi\u003c/em\u003ebeing the most prevalent (9.78%). \u003cem\u003eWolbachia\u003c/em\u003eand \u003cem\u003eSpiroplasma\u003c/em\u003e species were found in 2.80% and 40.8% of flies respectively, while \u003cem\u003eSodalis glossinidius \u003c/em\u003ewas not detected. There was an association between the presence of trypanosomes and \u003cem\u003eWolbachia,\u003c/em\u003ewhile no association was found between trypanosomes and \u003cem\u003eSpiroplasma\u003c/em\u003e\u003cstrong\u003e.\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusion. \u003c/strong\u003eThis study revealed that the presence of \u003cem\u003eWolbachia\u003c/em\u003e seems to favour trypanosome infections. Investigation on the \u003cem\u003eWolbachia\u003c/em\u003e genetic polymorphism in tsetse could help to better understand this association.\u003c/p\u003e","manuscriptTitle":"Spiroplasma, Wolbachia, Sodalis and trypanosome associations in Glossina tachinoides from Yankari game reserve, Nigeria","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-04-04 12:39:56","doi":"10.21203/rs.3.rs-6252946/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-04-25T16:16:22+00:00","index":"","fulltext":""},{"type":"reviewerAgreed","content":"260234964330849031495026264403368478641","date":"2025-04-25T16:07:17+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"124701891179392045924114397831763536893","date":"2025-04-25T11:02:16+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-04-25T10:14:02+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-04-24T17:36:19+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"234554030949062839367490493637955619852","date":"2025-04-12T10:08:49+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"232006516183389191263018993879477421032","date":"2025-04-11T14:21:44+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"37383987968254197581519012128123832088","date":"2025-04-10T14:43:34+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"73728995921829190957158031406323106834","date":"2025-04-10T08:49:58+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-04-09T11:55:18+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"284521833744727118401945764858063394629","date":"2025-04-05T16:30:34+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-04-03T07:25:31+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2025-03-25T16:15:30+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-03-20T10:34:16+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-03-20T10:32:52+00:00","index":"","fulltext":""},{"type":"submitted","content":"BMC Veterinary Research","date":"2025-03-18T11:54:41+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"bmc-veterinary-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"Learn more about [BMC Veterinary Research](http://bmcvetres.biomedcentral.com/)","snPcode":"12917","submissionUrl":"https://submission.nature.com/new-submission/12917/3?","title":"BMC Veterinary Research","twitterHandle":"@BMC_series","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"12525ea0-724b-439f-bb74-b2511afa278f","owner":[],"postedDate":"April 4th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-08-18T15:59:06+00:00","versionOfRecord":{"articleIdentity":"rs-6252946","link":"https://doi.org/10.1186/s12917-025-04959-7","journal":{"identity":"bmc-veterinary-research","isVorOnly":false,"title":"BMC Veterinary Research"},"publishedOn":"2025-08-13 15:56:52","publishedOnDateReadable":"August 13th, 2025"},"versionCreatedAt":"2025-04-04 12:39:56","video":"","vorDoi":"10.1186/s12917-025-04959-7","vorDoiUrl":"https://doi.org/10.1186/s12917-025-04959-7","workflowStages":[]},"version":"v1","identity":"rs-6252946","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6252946","identity":"rs-6252946","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.