Prevotella promotes proliferation and migration in esophageal squamous cell carcinoma by activating NF-κB signaling pathway

Prevotella promotes proliferation and migration in esophageal squamous cell carcinoma by activating NF-κB signaling pathway | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Prevotella promotes proliferation and migration in esophageal squamous cell carcinoma by activating NF-κB signaling pathway Sun fanyue, Baoyong Wang, Yuxin Yang, Xinpeng Shi, Chao Zhang, and 6 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3433179/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Purpose Esophageal squamous cell carcinoma (ESCC) is a highly fatal malignant tumor of the digestive tract. Although the relationship between the bacterial genus Prevotella and ESCC has attracted attention recently, its specific role and molecular mechanisms remain unclear. Methods In this study, we employed 16S rDNA sequencing technology to analyze the differences in Prevotella in 25 cases of esophageal squamous cell carcinoma (ESCC) and adjacent tissues (3 cm from the lesion). Subsequently, we co-cultured Prevotella with ESCC cells Eca109 and TE- 1, and through CCK8 assays, colony formation assays, and scratch assays, we investigated the influence of Prevotella on the proliferation and migration abilities of ESCC cells. Utilizing qT-PCR and protein immunoblot assays to examine the expression of proteins related to epithelial-mesenchymal transition (EMT) and NF-κB. Results The relative abundance of Prevotella was markedly elevated in ESCC tissues as compared to adjacent non-tumor tissues. Upon infection, we observed a significant enhancement in the proliferation and migration capacities of ESCC cells. Besides, the stimulation by Prevotella led to a significant upregulation in the expression of essential EMT-associated proteins, including N-cadherin, Matrix metalloproteinase-9 (MMP9), and Vimentin, in ESCC cells, with a concurrent downregulation of E-cadherin. Quantitative PCR and Western blot analysis further indicated that the mRNA levels of NF-κB and c-Myc and the protein expression of Bcl-xl and NF-κB were significant upregulation in ESCC cells by stimulating with Prevotella . Conclusion Our research unveiled the pivotal role of Prevotella in the genesis and advancement of ESCC, proposing its influence on ESCC proliferation, migration, and EMT process via the NF-κB pathway, Our results offered a novel avenue for delving into the microbial mechanisms underpinning esophageal cancer. esophageal squamous cell carcinoma Prevotella NF-κB epithelial-mesenchymal transition Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Esophageal cancer ranks as one of the most common malignant tumors in the digestive tract, with its incidence and mortality rates being the sixth and fourth, respectively, among all malignant tumors [ 1 ]. It could be histologically classified into Esophageal Squamous Cell Carcinoma (ESCC) and Esophageal Adenocarcinoma (EAC), with over 90% of cases being ESCC [ 2 ]. Despite significant progress in the treatment of ESCC, the five-year survival rate remains less than 20% due to the lack of distinct symptoms in early-stage esophageal cancer, leading to a persistently high mortality rate [ 3 ]. Several risk factors are associated with esophageal cancer, including smoking, alcohol consumption, genetics, and esophagitis [ 4 ]. Recent studies have highlighted the crucial role of the esophageal microbiome in the development and progression of esophageal cancer [ 5 ]. For example, Jiang et al.[ 6 ] through 16S rRNA gene sequencing for microbiome analysis, found that the abundance of Streptococcus , Actinomyces , Digestifilum , Clostridium , and Prevotella was higher in ESCC. Our previous research has also demonstrated variations in Prevotella between ESCC patients and healthy individuals, suggesting that alterations in Prevotella might be a potential predictive marker for ESCC [ 7 ]. Prevotella , a Gram-negative anaerobic bacterium, has been associated with various diseases, such as periodontal disease, chronic osteomyelitis, rheumatoid arthritis, and intestinal diseases [ 8 ], and may cause infection through virulence factors like adhesins, hemolysins, LPS, proteases, etc. [ 9 ]. Currently, there is a scarcity of reports on the relationship between Prevotella and the onset and progression of ESCC. This study primarily employs 16S rDNA gene sequencing to analyze the differences in Prevotella abundance in cancer and adjacent tissues from ESCC patients, and to verify in vitro that Prevotella can affect the onset and progression of ESCC via the NF-κB signaling pathway. The research aims to elucidate the molecular mechanism of Prevotella in the onset and progression of ESCC, providing novel molecular markers for the early diagnosis of ESCC and a new theoretical basis for the treatment of ESCC. Materials and methods Ethical statement All patients involved in this study provided informed consent and the research was approved by the Ethics Committee of the Luoyang Central Hospital affiliated with Zhengzhou University (Ethics Number: LWLL-2023-08-30-01). 16S rDNA sequencing of clinical samples For this study, 25 cases of pathologically diagnosed esophageal squamous cell carcinoma (ESCC) patients' cancer and adjacent tissues were selected. Genomic DNA was extracted, amplified in the V3-V4 region with primer sequences 341F: 5'-CCTACGGGRSGCAGCAG-3'; 806R: 5'-GGACTACVVGGGTATCTAATC-3', and sequenced using Illumina NovaSeq PE250. Detailed sequencing and data analysis steps are provided in Supplementary Material S1. Cultivation of cells and bacteria Human ESCC cell lines Eca109 (obtained from middle-section esophageal squamous carcinoma, transplantable in BALB/c nude mice) and TE- 1 (highly differentiated squamous cancer cells, non-transplantable) were supplied by Shanghai Kuisei Biotech Co., Ltd. (Shanghai, China). These cell lines were cultivated in RPMI 1640 medium (containing 10% fetal bovine serum, 10 U/mL penicillin, and 100 mg/mL streptomycin) at 37°C with 5% CO2 and 95% air. Prevotella (BNCC 353448) was provided by Beina Chuanglian Biotech Institute (Beijing, China) and cultured anaerobically at 37°C for 2-3 days in a sulfite ethanol salt fluid medium. Infection of ESCC cells with prevotella A total of 300 μL of bacterial fluid was added to a colorimetric dish, and the UV spectrophotometer OD600 was used to measure the vitality of Prevotella (OD values between 1-2 indicate good vitality). The corresponding volume of bacterial suspension was centrifuged, and resuspended at 4°C, 12,000 rpm for 5 min, the old bacterial medium was discarded, and 1 ml PBS was added for resuspension. The bacterial suspension was inoculated into the cell culture medium at MOI = 200 and incubated for 24 h. Experimental grouping The groups were divided into Eca109 + PBS control group (Eca109 - CON), Prevotella -infected Eca109 group (Eca109 + Prevotella ), TE- 1+PBS control group (TE- 1 - CON), and Prevotella -infected TE- 1 group (TE- 1 + Prevotella). Cell proliferation assay Cell proliferation was measured using the CCK8 method. Eca109, TE- 1 cells were diluted to 5 × 104 /mL, plated in 96-well plates, and co-cultured with Prevotella for 24h and 48h at various MOIs. Absorbance at 450 nm was measured using an enzyme-labeled instrument after incubation with Cell Counting Kit-8 (CCK8) solution. Colony formation assay This assay was utilized to assess cell proliferation capability. Logarithmic growth phase cells were diluted and plated, then inoculated with Prevotella at MOI = 200, and incubated for 14 days. Afterward, cells were fixed and stained, and photographs were taken. Scratch assay The scratch assay was used to evaluate cell migration ability. After marking, seeding, incubation, scratching, and washing, the cells were photographed, then incubated with or without Prevotella for 24 hours. PBS was used as a control group. Relative migration was quantified as a percentage, calculated from randomly chosen scratch distances at 0 hours and 24 hours. RNA extraction and real-time q uantitative PCR After 24h infection of Eca109 and TE- 1 cells with Prevotella , total RNA was extracted using a kit provided by Promega (Shanghai, China). cDNA was synthesized and quantitative real-time PCR was performed using kits from Tiangen Biotech (Beijing, China). Selected primers are shown in Table 1, with GAPDH as the internal reference, and relative mRNA expression levels were calculated using the 2^(-ΔΔCt) method. Table 1 Real-time quantitative PCR primer sequences Gene Forward sequence (5'-3') Reverse sequence (5'-3') NF-κB CTCCGAGACTTTCGAGGAAATAC GCCATTGTAGTTGGTAGCCTTCA CMyc GGCTCCTGGCAAAAGGTCA CTGCGTAGTTGTGCTGATGT GAPDH GACTCATGACCACAGTCCATGC AGAGGCAGGGATGATGTTCTG Western blot analysis Eca109 and TE- 1 cells were infected with Prevotella for 24 hours. Total protein was extracted from Eca109-CON, Eca109+ Prevotella , TE- 1-CON, and TE- 1+ Prevotella groups and protein concentration was determined using the BCA method. Based on BCA quantification results, the procedures of loading, electrophoresis, membrane transfer, and blocking were conducted. Primary antibodies were applied as follows: rabbit anti-NF-κB (1:1000, abcam, UK), rabbit anti-BCL-XL (1:1000, Biyuntian Biotech, Shanghai, China), rabbit anti-CyclinD1 (1:1000, Biyuntian Biotech, Shanghai, China), rabbit anti-MMP2 (1:1000, Biyuntian Biotech, Shanghai, China), rabbit anti-MMP9 (1:1000, abcam, UK), rabbit anti-E-cadherin (1:1000, abcam, UK), rabbit anti-N-cadherin (1:1000, abcam, UK), rabbit anti-Vimentin (1:1000, Biyuntian Biotech, Shanghai, China), and rabbit anti-GAPDH (1:1000, Biyuntian Biotech, Shanghai, China). They were incubated on a shaker overnight at 4°C. Following three washes with 1 ×TBST for 10 minutes each, secondary antibody (1:1000, Biyuntian Biotech, Shanghai, China) was added and incubated at room temperature for 1 hour. The membranes were washed again three times with 1×TBST, each for 10 minutes. Bands were visualized and imaged using a gel imaging system (Thermo Fisher Scientific, RockFord, IL, USA). Band intensities were analyzed using Image J software, with the ratio of band intensity to that of the internal reference representing the relative expression of the target protein. Statistical analysis Data were analyzed using GraphPad Prism 9 software and presented as mean ± standard error of the mean (SEM) or standard deviation (SD). Comparisons between groups were conducted using multiple t-tests. Statistical significance was set at p < 0.05, with highly significant differences at p < 0.01. Results Enrichment of p revotella in esophageal squamous cell carcinoma tissues Utilizing the Illumina Nova SeqPE250 system, we conducted a 16S rDNA gene sequencing analysis on the esophageal tissues of patients with esophageal squamous cell carcinoma, differentiating between cancerous (EC group) and adjacent non-cancerous tissues (NC group) to investigate the composition of the esophageal microbiome (Fig. 1). Analysis at the genus level revealed a significantly higher abundance of Prevotella in the EC group compared to the NC group ( p = 0.03). Fig. 1 Relative abundance and differential analysis of Prevotella in tumor and tumor-adjacent tissues of patients with ESCC. (a) The relative abundance of Prevotella in each sample; (b) Differential analysis of the relative abundance of Prevotella genus between the two groups. *Indicates a p value less than 0.05. EC, esophageal squamous cell carcinoma tumor group; NC, tumor-adjacent tissue group. n = 25. Prevotella e nhances the proliferative capability of ESCC cells To investigate the role of Prevotella in the progression and development of ESCC, we assessed the effects of Prevotella on the proliferative capabilities of Eca109 and TE- 1 cells using the Cell Counting Kit-8 (CCK8) method. Our results indicate that following 24 and 48 hours of stimulation with Prevotella , both Eca109 (Fig. 2A) and TE- 1 cells (Fig. 2B) exhibited a dose-dependent increase in proliferation rate in correlation with the multiplicity of infection (MOI). Compared to MOI = 0, the proliferation of both Eca109 ( p < 0.01) and TE- 1 cells ( p < 0.05) was significantly enhanced at MOI = 200 after 24 and 48 hours of stimulation with Prevotella . Furthermore, under MOI = 200, the proliferative capability of Eca109 ( p = 0.21) and TE- 1 cells ( p = 0.50) was found to be elevated at 24 hours compared to 48 hours of stimulation, even though these differences were not statistically significant. Consequently, we selected MOI = 200 and a 24-hour stimulation period with Prevotella as the standard infection dosage and duration for subsequent experiments. Similarly, the clonogenic assay demonstrated that the growth rate of Eca109 ( p = 0.04) and TE- 1 cells ( p = 0.04) was significantly elevated following stimulation with Prevotella , compared to the control group (Fig. 2C). Moreover, through western blot analysis, we identified significant upregulation of CyclinD1 at the protein level in both Eca109 ( p = 0.04) and TE- 1 cells ( p = 0.02) after infection with Prevotella (Fig. 2D), which further substantiated our findings that Prevotella enhances the proliferative capability of ESCC cells. Fig. 2 Prevotella promotes the proliferation of esophageal squamous cell carcinoma. (a, b) CCK8 assay results demonstrating the enhanced proliferation of Eca109 and TE- 1 cells following co-cultivation with Prevotella . (c) Clonogenic assay of Eca109 and TE- 1 cells after co-cultivation with Prevotella , visualized by microscopy (left) and quantified (right). (d) Western blot analysis revealing increased expression of CyclinD1 following co-cultivation with Prevotella . Data represents the mean and standard error of 3 independent experiments. * p < 0.05. Effect of prevotella on ESCC cell migration The migratory ability of ESCC cells was assessed using a scratch assay, and images were captured at 0 and 24 h of cell migration, as shown in Fig. 3. After stimulating by Prevot ella for 24 h, there was a pronounced increase in the migratory capabilities of Eca109 (Fig. 3A) and TE- 1 (Fig. 3B) cells compared to the control group ( p < 0.01). Furthermore, the expression level of MMP2 protein in ESCC cells was evaluated using a Western blot analysis. As shown in Fig. 3C, both Eca109 and TE- 1 cells exhibited a significant increase in MMP2 expression following stimulation by Prevotella , compared to the control group ( p < 0.01). These findings provide additional evidence that exposure to Prevotella significantly enhances the migration abilities of Eca109 and TE- 1 cells. Fig. 3 Prevotella Enhances the Motility of ESCC cells. (a, b) Scratch assays reveal increased migration capabilities in Eca109 and TE- 1 cells after stimulating by Prevotella ; (c) Western blot analysis indicates a significant increase in the expression of MMP2 protein in ESCC cells after stimulating by Prevotella. Data represents the mean and standard error of 3 independent experiments. * p < 0.05, ** p < 0.01, *** p < 0.001. EMT modulation in ESCC cells by prevotella EMT is a critical event facilitating cancer metastasis. Our investigations via qRT-PCR and Western blot assays reveal this intricate relationship (Fig. 4). Following stimulation by Prevotella , the expression of key EMT proteins in Eca109 cells, namely Vimentin ( p = 0.02) and MMP9 ( p = 0.04), was significantly upregulated, while the expression of E-cadherin showed a trend toward downregulation ( p = 0.07). In TE- 1 cells stimulated with Prevotella , the expression of N-cadherin ( p = 0.03) and MMP9 ( p = 0.04) was significantly increased, and Vimentin exhibited an upward trend ( p = 0.02), whereas the expression of E-cadherin was markedly downregulated ( p < 0.01). These results suggest that Prevotella exerts a considerable influence on the EMT of ESCC cells. Fig. 4 Influence of Prevotella on EMT in ESCC cells. (a) Western blot image. (b, c) Expression analysis of Vimentin, N-cadherin, MMP9, and E-cadherin proteins in Eca109 and TE- 1 cells following stimulation with Prevotella . Data represents the mean and standard error of 3 independent experiments. * p < 0.05, ** p < 0.01, *** p < 0.001. Activation of NF-κB signaling pathway possibly stimulated by prevotella The anti-apoptotic gene Bcl-xl and the proto-oncogene c-Myc are downstream targets of the NF-κB pathway. Through qRT-PCR analysis, it was observed (Fig. 5A, B) that stimulation with Prevotella significantly upregulated the expression of NF-κB and c-Myc genes at the mRNA level in both Eca109 and TE- 1 cells ( p < 0.05). Further, Western blot assays demonstrated (Fig. 5C, D, E) a significant increase in the expression of Bcl-xl and NF-κB proteins in Eca109 and TE- 1 cells following stimulation with Prevotella ( p < 0.05). The aforementioned results suggested that Prevotella may influence the development of ESCC by activating the NF-κB signaling pathway. Fig. 5 Activation of NF-kB Pathway by Prevotella . (a, b) RT-PCR results show significant upregulation of NF-kB and c-Myc regulatory genes in Eca109 and TE- 1 cells following stimulation with Prevotella . (c, d, e) Western blot analysis reveals an increase in the expression of NF-kB and BCL-XL following stimulation with Prevotella . Data represents the mean and standard error of 3 independent experiments. * p < 0.05, ** p < 0.01. Discussion With the continual advancement of microbial sequencing technology, mounting evidence has begun to illustrate that dysregulation of the microbial community has become one of the critical factors in the development and progression of various tumors, including esophageal cancer, gastric cancer, and colorectal cancer [10– 15]. In the current study, our results from 16S rDNA sequencing revealed that the relative abundance of Prevotella was significantly elevated in ESCC tissues compared to adjacent non-tumorous tissues, implying a potential association between Prevotella and the onset and progression of ESCC. In accordance with our observation, Zhao et al. [16] noticed a substantial increase in the abundance of Prevotella at both the genus and family levels in the oral cavity of esophageal cancer patients. Studies have identified an increased abundance of Prevotella in patients with erosive esophagitis, Barrett's esophagus [16], and ESCC [17]. Collectively, these studies supported the potential role of Prevotella as a putative biomarker for ESCC and underscored its key regulatory function in the initiation and advancement of ESCC. Our findings demonstrate a notable stimulatory effect of Prevotella on ESCC cells, leading to an enhanced rate of proliferation. Cell proliferation is meticulously regulated by a balance between pro-apoptotic and anti-apoptotic molecules [18], and uncontrolled proliferation is a hallmark of tumorigenesis [19]. Observations from both MTT and colony formation assays revealed that the proliferative and migratory capabilities of ESCC cells were significantly augmented following stimulation by Prevotella . This discovery emphasized the important role of Prevotella in promoting the progression of ESCC. Existing studies have shown that microbes could induce cancer cell proliferation and migration through host autocrine and paracrine signaling [20]. Bacterial carcinogenesis is often associated with over-proliferation, further activation of inflammatory pathways, inhibition of apoptosis, and triggering of cellular transformation [21,22]. NF-κB is a key inflammatory signaling pathway in the pathogenesis of ESCC [23,24]. Our results implied that infection with Prevotella might induce overexpression of NF-κB in ESCC cells, thereby driving their immortalization and oncogenic transformation [25,26]. EMT is widely regarded as a pivotal step in cancer cells acquiring migration and invasion capabilities [27]. During the EMT process, cancer cells lose their epithelial phenotype and transition into a mesenchymal phenotype, accompanied by a loss of cell polarity and epithelial-specific markers such as E-cadherin and β-catenin, and the expression of mesenchymal markers like N-cadherin, Vimentin, and ZEB1 [28,29]. In order to further explore the effects of Prevotella on ESCC cell migration and EMT, Western blot assay was used to detect the expression of EMT-related proteins. Notably, our results revealed that Prevotella could significantly impact key markers in the EMT process of ESCC cells, such as the expression of Vimentin, N-cadherin, MMP9, and E-cadherin, which further suggested that Prevotella stimulation might enhance the migration and invasion capabilities of ESCC cells by promoting the EMT process. Moreover, existing evidence has demonstrated an association between the activation of the NF-κB signaling pathway and migration and invasion in ESCC cells [30]. Microbial infection might activate telomerase reverse transcriptase through NF-κB overexpression, consequently influencing inflammatory response, EMT, as well as the invasion and metastasis abilities of tumor cells [25]. These findings further corroborate the central role of NF-κB in inducing and sustaining EMT [31]. Taken together, we posit that Prevotella -induced migration and EMT in ESCC cells might be mediated through the modulation of the NF-κB signaling pathway. The classical NF-κB signaling pathway represents a complex regulatory mechanism, with its activation dependent on signals from pattern recognition receptors, T-cell receptors, B-cell receptors, pro-inflammatory cytokine receptors, and others. NF-κB pathway could influence the expression of downstream genes, thereby affecting tumor proliferation and apoptosis [32]. Our study further explored the interrelationship between Prevotella stimulation and the expression of NF-κB, c-Myc genes, as well as Bcl-xl and NF-κB proteins in ESCC cells. Results uncovered that Prevotella stimulation could significantly upregulate the expression of these molecules, indicating that Prevotella might promote the occurrence and progression of ESCC by activating the NF-κB signaling pathway. Our finding resonated with the study by Dong et al. [33], who observed that Prevotella not only affected tumor proliferation and migration but also participated in the onset of other diseases, such as persistent human tumor virus infections and cervical lesions in women of childbearing age, through the NF-κB/C-myc pathway. Additionally, research has found that Prevotella could improve cholestasis and liver fibrosis in primary sclerosing cholangitis by enhancing the FXR signaling pathway [34]. These discoveries emphasized the role of Prevotella in various diseases, and a deeper understanding of its interaction with the host might provide vital clues for developing new treatment or prevention strategies, particularly in the context of tumors and chronic inflammatory diseases. Although current research has partially elucidated the potential effects of Prevotella on ESCC, the specific mechanisms of action still require further exploration and validation. For example, employing a nude mouse tumorigenesis model could further investigate Prevotella's in vivo mechanism of action on ESCC, along with in vitro experiments to determine whether Prevotella could activate the NF-κB signaling pathway through factors such as lipopolysaccharides, adhesins, and hemolysins, thereby affecting the onset and progression of ESCC. Future research should focus on these aspects for a more comprehensive and in-depth understanding of Prevotella 's role in the pathogenesis and progression of ESCC. Conclusions Our study revealed the pivotal regulatory role of Prevotella in the pathogenesis and progression of ESCC. Through 16S rDNA sequencing analysis, we observed a significant increase in the abundance of Prevotella in ESCC tissue compared to adjacent non-cancerous tissues. Further experiments demonstrated that stimulation by Prevotel la markedly elevated the proliferation and migration abilities of ESCC cells and induced changes in the expression of key genes and proteins involved in EMT and the NF-κB signaling pathway. These findings not only emphasized the possibility of Prevotella promoting the onset and development of ESCC through the NF-κB pathway but also provided valuable insights into the microbial mechanisms of ESCC. Further research focusing on the interactions between Prevotella and the NF-κB pathway,which may offer innovative strategies for inhibiting the progression and improving prognosis in ESCC. Declarations Authors contribution: Fanyue Sun contributed to the study conception and design. Material preparation were performed by Yuxin Yang, data collection were performed by Xinpeng Shi, and Chao Zhang. data analysis were performed by Yunshuai Wang, Haichao Liu, Yu Zhang.Tian Yang and XiaoDong Liu collected the important background information.The first draft of the manuscript was written by Fanyue Sun and all authors commented on previous versions of the manuscript. Funding acquisition was provided by Xiaoyong Luo and Baoyong Wang;All authors read and approved the final manuscript. Funding: This work was supported by the 2023 Henan Provincial Science and Technology Tackling Key Problems Project (232102311130). Institutional Review Board Statement: Informed Consent Statement: Not applicable. Data Availability Statement: The original manuscript of this study is included in the article and further information is available upon reasonable request to the corresponding author. Acknowledgments: Conflicts of Interest: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. References Mao Y-S, Gao S-G, Wang Q, Shi X-T, Li Y, Gao W-J et al Analysis of a registry database for esophageal cancer from high-volume centers in China. Diseases of the Esophagus 2020 3;33. doi: 10. 1093/dote/doz091 Gupta B, Kumar N (2017) Worldwide incidence, mortality and time trends for cancer of the oesophagus. Eur J Cancer Prev 26:107–118 doi: 10. 1097/CEJ.0000000000000249 Smyth EC, Lagergren J, Fitzgerald RC, Lordick F, Shah MA, Lagergren P et al (2017) Oesophageal cancer. Nat Rev Dis Primers 2017 27;3:17048. doi: 10. 1038/nrdp.48 Kavin H, Yaremko L, Valaitis J, Chowdhury L (1996) ;110:904– 14. doi: 10. 1053/gast.1996.v110.pm8608902 Meng C, Bai C, Brown TD, Hood LE, Tian Q (2018) ;16:33–49. doi: 10. 1016/j.gpb.2017.06.002 Jiang Z, Wang J, Shen Z, Zhang Z, Wang S Characterization of Esophageal Microbiota in Patients With Esophagitis and Esophageal Squamous Cell Carcinoma. Front Cell Infect Microbiol 2021 1111. doi 3389/fcimb.2021.774330 Zhao Q, Yang T, Yan Y, Zhang Y, Li Z, Wang Y et al Alterations of Oral Microbiota in Chinese Patients With Esophageal Cancer. Front Cell Infect Microbiol 2020 2110. 10.3389/fcimb.2020.541144 Larsen JM (2017) The immune response to Prevotella bacteria in chronic inflammatory disease. Immunology 151:363–374 doi: 10. 1111/imm. 12760 Jiang L, Shang M, Yu S, Liu Y, Zhang H, Zhou Y et al A high-fiber diet synergizes with Prevotella copri and exacerbates rheumatoid arthritis. Cell Mol Immunol 2022 2;19:1414–1424. 10. 1038/s41423-022-00934-6 Deng Y, Tang D, Hou P, Shen W, Li H, Wang T et al (2021) ;150:104709. doi: 10. 1016/j.micpath.2020.104709 Ferreira RM, Pereira-Marques J, Pinto-Ribeiro I, Costa JL, Carneiro F, Machado JC et al (2018) Gastric microbial community profiling reveals a dysbiotic cancer-associated microbiota. Gut 67:226–236 1136/gutjnl-2017-314205 Qu R, Zhang Y, Ma Y, Zhou X, Sun L, Jiang C et al (2023) ;10. doi: 10. 1002/advs.202205563 Ma J, Li J, Jin C, Yang J, Zheng C, Chen K et al Association of gut microbiome and primary liver cancer: A two -sample Mendelian randomization and case–control study. Liver Int 2023 8;43:221–233. 10. 1111/liv.15466 Kartal E, Schmidt TSB, Molina-Montes E, Rodríguez-Perales S, Wirbel J, Maistrenko OM et al (2022) A faecal microbiota signature with high specificity for pancreatic cancer. Gut 71:1359–1372 1136/gutjnl-2021-324755 Sobstyl M, Brecht P, Sobstyl A, Mertowska P, Grywalska E (2022) The Role of Microbiota in the Immunopathogenesis of Endometrial Cancer. Int J Mol Sci 20:23:5756. 10.3390/ijms23105756 Liu N, Ando T, Ishiguro K, Maeda O, Watanabe O, Funasaka K et al (2013) Characterization of bacterial biota in the distal esophagus of Japanese patients with reflux esophagitis and Barrett’s esophagus. BMC Infect Dis 11:13:130. 10. 1186/1471-2334-13–130 Chen X, Winckler B, Lu M, Cheng H, Yuan Z, Yang Y et al Oral Microbiota and Risk for Esophageal Squamous Cell Carcinoma in a High-Risk Area of China. PLoS One 2015 7;10:e0143603. doi: 10. 1371/journal.pone.0143603 Sherr CJ (1994) G1 phase progression: Cycling on cue. Cell 79:551–555 doi: 10. 1016/0092-8674(94)90540- 1 Hanahan D, Weinberg RA (2011) Hallmarks of Cancer: The Next Generation. Cell 144:646–674 1016/j.cell.2011.02.013 Udayasuryan B, Ahmad RN, Nguyen TTD, Umaña A, Monét Roberts L, Sobol P et al (2022) 18;15 Fusobacterium nucleatum induces proliferation and migration in pancreatic cancer cells through host autocrine and paracrine signaling. Sci Signal doi: 10. 1126/scisignal.abn4948 Karpiński TM (2019) The Microbiota and Pancreatic Cancer. Gastroenterol Clin North Am 48:447–464 1016/j.gtc.2019.04.008 Lv J, Guo L, Liu J-J, Zhao H-P, Zhang J, Wang J-H Alteration of the esophageal microbiota in Barrett’s esophagus and esophageal adenocarcinoma. World J Gastroenterol 2019 14;25:2149–2161. 10.3748/wjg.v25.i18.2149 Coussens LM, Zitvogel L, Palucka AK (1979) Neutralizing Tumor-Promoting Chronic Inflammation: A Magic Bullet? Science 2013 18;339:286–91. doi: 10. 1126/science.1232227 Abdel-Latif MM, Duggan S, Reynolds JV, Kelleher D (2009) ;9:396–404. doi: 10. 1016/j.coph.2009.06.010 Zheng H, Li LL, Hu DS, Deng XY, Cao Y (2007) Role of Epstein-Barr virus encoded latent membrane protein 1 in the carcinogenesis of nasopharyngeal carcinoma. Cell Mol Immunol 4:185–196 Ghareghomi S, Ahmadian S, Zarghami N, Kahroba H (2021) Fundamental insights into the interaction between telomerase/TERT and intracellular signaling pathways. Biochimie 181:12–24 1016/j.biochi.2020. 11.015 Wei C, Yang C, Wang S, Shi D, Zhang C, Lin X et al Crosstalk between cancer cells and tumor associated macrophages is required for mesenchymal circulating tumor cell-mediated colorectal cancer metastasis. Mol Cancer 2019 30;18:64. 10. 1186/s12943-019-0976-4 Thiery JP, Acloque H, Huang RYJ, Nieto MA (2009) Epithelial-Mesenchymal Transitions in Development and Disease. Cell 139:871–890 doi: 10. 1016/j.cell.2009. 11.007 Zeisberg M, Neilson EG Biomarkers for epithelial-mesenchymal transitions. J Clin Invest 2009 1;119:1429–1437. doi: 10. 1172/JCI36183 Wang F, He W, Fanghui P, Wang L, Fan Q (2013) NF-κBP65 promotes invasion and metastasis of oesophageal squamous cell cancer by regulating matrix metalloproteinase-9 and epithelial-to-mesenchymal transition. Cell Biol Int 37:780–788. 10. 1002/cbin.10089 Wang L, Wang L, Zhang H, Lu J, Zhang Z, Wu H et al AREG mediates the epithelial- mesenchymal transition in pancreatic cancer cells via the EGFR/ERK/NF- κB signalling pathway. Oncol Rep 2020 27; 10.3892/or.2020.7523 Yu H, Lin L, Zhang Z, Zhang H, Hu H Targeting NF-κB pathway for the therapy of diseases: mechanism and clinical study. Signal Transduct Target Ther 2020 21;5:209. 10. 1038/s41392-020-00312-6 Dong B, Huang Y, Cai H, Chen Y, Li Y, Zou H et al Prevotella as the hub of the cervicovaginal microbiota affects the occurrence of persistent human papillomavirus infection and cervical lesions in women of childbearing age via host NF-κB / C‐myc . J Med Virol 2022 30;94:5519–5534. 10. 1002/jmv.28001 Jiang B, Yuan G, Wu J, Wu Q, Li L, Jiang P (2022) ;1868:166320. doi: 10. 1016/j.bbadis.2021.166320 Supplementary Files Supplementary File is not available with this version. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3433179","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":239529294,"identity":"d2a1de6e-1a60-49d0-ade6-6679ef79ddca","order_by":0,"name":"Sun fanyue","email":"","orcid":"","institution":"Zhengzhou University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Sun","middleName":"","lastName":"fanyue","suffix":""},{"id":239529295,"identity":"cbb95105-d10b-4a14-85eb-be0b0df717dc","order_by":1,"name":"Baoyong Wang","email":"","orcid":"","institution":"Luoyang Central Hospital Affiliated of Zhengzhou University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Baoyong","middleName":"","lastName":"Wang","suffix":""},{"id":239529296,"identity":"48a31345-5779-4e4d-863f-f40fe5c29c81","order_by":2,"name":"Yuxin Yang","email":"","orcid":"","institution":"Zhengzhou University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Yuxin","middleName":"","lastName":"Yang","suffix":""},{"id":239529297,"identity":"ef0460eb-5f56-4ada-a99d-c29da33061c5","order_by":3,"name":"Xinpeng Shi","email":"","orcid":"","institution":"Luoyang Central Hospital Affiliated of Zhengzhou University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Xinpeng","middleName":"","lastName":"Shi","suffix":""},{"id":239529298,"identity":"6992a422-3281-4d29-a710-b868c91d094a","order_by":4,"name":"Chao Zhang","email":"","orcid":"","institution":"Luoyang Central Hospital Affiliated of Zhengzhou University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Chao","middleName":"","lastName":"Zhang","suffix":""},{"id":239529299,"identity":"a2248b13-9478-4e23-bf13-b55e5a91e10a","order_by":5,"name":"Yunshuai Wang","email":"","orcid":"","institution":"Luoyang Central Hospital Affiliated of Zhengzhou University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Yunshuai","middleName":"","lastName":"Wang","suffix":""},{"id":239529300,"identity":"704af9f2-8b97-41f2-9f95-9d72585f3b83","order_by":6,"name":"Haichao Liu","email":"","orcid":"","institution":"Luoyang Central Hospital Affiliated of Zhengzhou University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Haichao","middleName":"","lastName":"Liu","suffix":""},{"id":239529301,"identity":"f825cc85-4686-4d4f-b1f7-5ca074b6afc0","order_by":7,"name":"Yu Zhang","email":"","orcid":"","institution":"Luoyang Central Hospital Affiliated of Zhengzhou University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Yu","middleName":"","lastName":"Zhang","suffix":""},{"id":239529302,"identity":"24597bc1-d98b-444c-899c-a3e60c72c5ff","order_by":8,"name":"Tian Yang","email":"","orcid":"","institution":"Luoyang Central Hospital Affiliated of Zhengzhou University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Tian","middleName":"","lastName":"Yang","suffix":""},{"id":239529303,"identity":"f45da04e-c51b-4707-9fd8-ff2c3b8aeb26","order_by":9,"name":"XiaoDong Liu","email":"","orcid":"","institution":"Luoyang Central Hospital Affiliated of Zhengzhou University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"XiaoDong","middleName":"","lastName":"Liu","suffix":""},{"id":239529304,"identity":"c938c429-19b8-4396-8d40-6985749279f0","order_by":10,"name":"Xiaoyong Luo","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAy0lEQVRIie3RPQrCMBTA8ZTA65LqGpfWI1QCnXoTl2TJ5urUoVBIR1e9RcELpD5w1As4FARn3R2sxb1xE8x/yvB+5IsQn+8XCyGwhOTxlFLs3AgF0hMtZjXo9BtyUM2ZzbmTSCqQGBkrBDKSkiJfjpKgAtvuzCXOMLIdOepVOXouGpb2YW4iw4lMgxLHCbyJMqj2FUu5E2EUbL8Lqoa6Ek5BttuTFhz7R5Yud0lqs7iydf+VG8TuXuTjZCiAz0I6jQ893Ud9Pp/vD3sBZPI/EzbgPaQAAAAASUVORK5CYII=","orcid":"","institution":"Luoyang Central Hospital Affiliated of Zhengzhou University","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Xiaoyong","middleName":"","lastName":"Luo","suffix":""}],"badges":[],"createdAt":"2023-10-11 14:59:34","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3433179/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3433179/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":44742262,"identity":"8e3c176b-5719-44f2-af5e-ff0a1d76c840","added_by":"auto","created_at":"2023-10-16 23:34:33","extension":"jpeg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":12428,"visible":true,"origin":"","legend":"\u003cp\u003eRelative abundance and differential analysis of \u003cem\u003ePrevotella \u003c/em\u003ein tumor and tumor-adjacent tissues of patients with ESCC. \u003cstrong\u003e(a) \u003c/strong\u003eThe relative abundance of \u003cem\u003ePrevotella \u003c/em\u003ein each sample; \u003cstrong\u003e(b) \u003c/strong\u003eDifferential analysis of the relative abundance of \u003cem\u003ePrevotella \u003c/em\u003egenus between the two groups. *Indicates a \u003cem\u003ep \u003c/em\u003evalue less than 0.05. EC, esophageal squamous cell carcinoma tumor group; NC, tumor-adjacent tissue group. \u003cem\u003en \u003c/em\u003e= 25.\u003c/p\u003e","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-3433179/v1/4ea2966cf990fc0faa42c5ab.jpeg"},{"id":44741968,"identity":"1ced8cad-a649-4cb2-89c3-5656de503e65","added_by":"auto","created_at":"2023-10-16 23:26:33","extension":"jpeg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":44382,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003ePrevotella \u003c/em\u003epromotes the proliferation of esophageal squamous cell carcinoma. \u003cstrong\u003e(a, b) \u003c/strong\u003eCCK8 assay results demonstrating the enhanced proliferation of Eca109 and TE- 1 cells following co-cultivation with \u003cem\u003ePrevotella\u003c/em\u003e. \u003cstrong\u003e(c) \u003c/strong\u003eClonogenic assay of Eca109 and TE- 1 cells after co-cultivation with \u003cem\u003ePrevotella\u003c/em\u003e, visualized by microscopy (left) and quantified (right). \u003cstrong\u003e(d) \u003c/strong\u003eWestern blot analysis revealing increased expression of CyclinD1 following co-cultivationwith \u003cem\u003ePrevotella\u003c/em\u003e. Data represents the mean and standard error of 3 independent experiments. * \u003cem\u003ep \u003c/em\u003e\u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-3433179/v1/a4b0fbc23e71c1abce553043.jpeg"},{"id":44741967,"identity":"45c30a26-f86b-4d7f-83c2-749d7996cdee","added_by":"auto","created_at":"2023-10-16 23:26:32","extension":"jpeg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":41736,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003ePrevotella \u003c/em\u003eEnhances the Motility of ESCC cells. \u003cstrong\u003e(a, b) \u003c/strong\u003eScratch assays reveal increased migration capabilities in Eca109 and TE- 1 cells after stimulating by \u003cem\u003ePrevotella\u003c/em\u003e; \u003cstrong\u003e(c) \u003c/strong\u003eWestern blot analysis indicates a significant increase in the expression of MMP2 protein in ESCC cells after stimulating by \u003cem\u003ePrevotella. \u003c/em\u003eData represents the mean and standard error of 3 independent experiments. *\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.05, ** \u003cem\u003ep \u003c/em\u003e\u0026lt; 0.01, *** \u003cem\u003ep \u003c/em\u003e\u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-3433179/v1/60c9627a798bd41b5eea55a2.jpeg"},{"id":44741971,"identity":"fbdd1b28-d641-4511-9286-a0dd3755adc4","added_by":"auto","created_at":"2023-10-16 23:26:33","extension":"jpeg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":15235,"visible":true,"origin":"","legend":"\u003cp\u003eInfluence of \u003cem\u003ePrevotella \u003c/em\u003eon EMT in ESCC cells. \u003cstrong\u003e(a) \u003c/strong\u003eWestern blot image. \u003cstrong\u003e(b, c) \u003c/strong\u003eExpression analysis of Vimentin, N-cadherin, MMP9, and E-cadherin proteins in Eca109 and TE- 1 cells following stimulation with \u003cem\u003ePrevotella\u003c/em\u003e. Data represents the mean and standard error of 3 independent experiments. * \u003cem\u003ep \u003c/em\u003e\u0026lt; 0.05, ** \u003cem\u003ep \u003c/em\u003e\u0026lt; 0.01, *** \u003cem\u003ep \u003c/em\u003e\u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-3433179/v1/55018fb925a67891d5c3e565.jpeg"},{"id":44742261,"identity":"b5d1c22f-762b-4c12-8fa4-0193242badf1","added_by":"auto","created_at":"2023-10-16 23:34:32","extension":"jpeg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":23072,"visible":true,"origin":"","legend":"\u003cp\u003eActivation of NF-kB Pathway by \u003cem\u003ePrevotella\u003c/em\u003e. \u003cstrong\u003e(a, b) \u003c/strong\u003eRT-PCR results show significant upregulation of NF-kB and c-Myc regulatory genes in Eca109 and TE- 1 cells following stimulation with \u003cem\u003ePrevotella\u003c/em\u003e. \u003cstrong\u003e(c, d, e) \u003c/strong\u003eWestern blot analysis reveals an increase in the expression of NF-kB and BCL-XL following stimulation with \u003cem\u003ePrevotella\u003c/em\u003e. Datarepresents the mean and standard error of 3 independent experiments. * \u003cem\u003ep \u003c/em\u003e\u0026lt; 0.05, ** \u003cem\u003ep \u003c/em\u003e\u0026lt; 0.01.\u003c/p\u003e","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-3433179/v1/42a76d5c996d0b8abe0bf7b6.jpeg"},{"id":45352619,"identity":"d0aa5391-8a5c-4736-b190-62085d30caeb","added_by":"auto","created_at":"2023-10-28 06:52:25","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":579738,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3433179/v1/f8bdc857-1ce6-43d2-b515-995767253242.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Prevotella promotes proliferation and migration in esophageal squamous cell carcinoma by activating NF-κB signaling pathway","fulltext":[{"header":"Introduction","content":"\u003cp\u003eEsophageal cancer ranks as one of the most common malignant tumors in the digestive tract, with its incidence and mortality rates being the sixth and fourth, respectively, among all malignant tumors [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. It could be histologically classified into Esophageal Squamous Cell Carcinoma (ESCC) and Esophageal Adenocarcinoma (EAC), with over 90% of cases being ESCC [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Despite significant progress in the treatment of ESCC, the five-year survival rate remains less than 20% due to the lack of distinct symptoms in early-stage esophageal cancer, leading to a persistently high mortality rate [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eSeveral risk factors are associated with esophageal cancer, including smoking, alcohol consumption, genetics, and esophagitis [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Recent studies have highlighted the crucial role of the esophageal microbiome in the development and progression of esophageal cancer [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. For example, Jiang et al.[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e] through 16S rRNA gene sequencing for microbiome analysis, found that the abundance of \u003cem\u003eStreptococcus\u003c/em\u003e, \u003cem\u003eActinomyces\u003c/em\u003e, \u003cem\u003eDigestifilum\u003c/em\u003e, \u003cem\u003eClostridium\u003c/em\u003e, and \u003cem\u003ePrevotella\u003c/em\u003e was higher in ESCC. Our previous research has also demonstrated variations in \u003cem\u003ePrevotella\u003c/em\u003e between ESCC patients and healthy individuals, suggesting that alterations in \u003cem\u003ePrevotella\u003c/em\u003e might be a potential predictive marker for ESCC [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. \u003cem\u003ePrevotella\u003c/em\u003e, a Gram-negative anaerobic bacterium, has been associated with various diseases, such as periodontal disease, chronic osteomyelitis, rheumatoid arthritis, and intestinal diseases [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e8\u003c/span\u003e], and may cause infection through virulence factors like adhesins, hemolysins, LPS, proteases, etc. [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e9\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eCurrently, there is a scarcity of reports on the relationship between \u003cem\u003ePrevotella\u003c/em\u003e and the onset and progression of ESCC. This study primarily employs 16S rDNA gene sequencing to analyze the differences in \u003cem\u003ePrevotella\u003c/em\u003e abundance in cancer and adjacent tissues from ESCC patients, and to verify in vitro that \u003cem\u003ePrevotella\u003c/em\u003e can affect the onset and progression of ESCC via the NF-κB signaling pathway. The research aims to elucidate the molecular mechanism of \u003cem\u003ePrevotella\u003c/em\u003e in the onset and progression of ESCC, providing novel molecular markers for the early diagnosis of ESCC and a new theoretical basis for the treatment of ESCC.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cp\u003e\u003cstrong\u003eEthical statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll patients involved in this study provided informed consent and the research was approved by the Ethics Committee of the Luoyang Central Hospital affiliated with Zhengzhou University (Ethics Number: LWLL-2023-08-30-01).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e16S rDNA sequencing of clinical samples\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFor this study, 25 cases of pathologically diagnosed esophageal squamous cell carcinoma (ESCC) patients\u0026apos; cancer and adjacent tissues were selected. Genomic DNA was extracted, amplified in the V3-V4 region with primer sequences 341F: 5\u0026apos;-CCTACGGGRSGCAGCAG-3\u0026apos;; 806R: 5\u0026apos;-GGACTACVVGGGTATCTAATC-3\u0026apos;, and sequenced using Illumina NovaSeq PE250. Detailed sequencing and data analysis steps are provided in Supplementary Material S1.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCultivation of cells and bacteria\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHuman ESCC cell lines Eca109 (obtained from middle-section esophageal squamous carcinoma, transplantable in BALB/c nude mice) and TE- 1 (highly differentiated squamous cancer cells, non-transplantable) were supplied by Shanghai Kuisei Biotech Co., Ltd. (Shanghai, China). These cell lines were cultivated in RPMI 1640 medium (containing 10% fetal bovine serum, 10 U/mL penicillin, and 100 mg/mL streptomycin) at 37\u0026deg;C with 5% CO2 and 95% air. \u003cem\u003ePrevotella \u003c/em\u003e(BNCC 353448) was provided by Beina Chuanglian Biotech Institute (Beijing, China) and cultured anaerobically at 37\u0026deg;C for 2-3 days in a sulfite ethanol salt fluid medium.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eInfection of ESCC cells with \u003cem\u003eprevotella\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA total of 300 \u0026mu;L of bacterial fluid was added to a colorimetric dish, and the UV spectrophotometer OD600 was used to measure the vitality of \u003cem\u003ePrevotella\u003c/em\u003e(OD values between 1-2 indicate good vitality). The corresponding volume of bacterial suspension was centrifuged, and resuspended at 4\u0026deg;C, 12,000 rpm for 5 min, the old bacterial medium was discarded, and 1 ml PBS was added for resuspension. The bacterial suspension was inoculated into the cell culture medium at MOI = 200 and incubated for 24 h.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eExperimental grouping\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe groups were divided into Eca109 + PBS control group (Eca109 - CON), \u003cem\u003ePrevotella\u003c/em\u003e-infected Eca109 group (Eca109 + \u003cem\u003ePrevotella\u003c/em\u003e), TE- 1+PBS control group (TE- 1 - CON), and \u003cem\u003ePrevotella\u003c/em\u003e-infected TE- 1 group (TE- 1 + Prevotella).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCell proliferation assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCell proliferation was measured using the CCK8 method. Eca109, TE- 1 cells were diluted to 5 \u0026times; 104 /mL, plated in 96-well plates, and co-cultured with \u003cem\u003ePrevotella \u003c/em\u003efor 24h and 48h at various MOIs. Absorbance at 450 nm was measured using an enzyme-labeled instrument after incubation with Cell Counting Kit-8 (CCK8) solution.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eColony formation assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis assay was utilized to assess cell proliferation capability. Logarithmic growth phase cells were diluted and plated, then inoculated with \u003cem\u003ePrevotella \u003c/em\u003eat MOI = 200, and incubated for 14 days. Afterward, cells were fixed and stained, and photographs were taken.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eScratch assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe scratch assay was used to evaluate cell migration ability. After marking, seeding, incubation, scratching, and washing, the cells were photographed, then incubated with or without \u003cem\u003ePrevotella \u003c/em\u003efor 24 hours. PBS was used as a control group. Relative migration was quantified as a percentage, calculated from randomly chosen scratch distances at 0 hours and 24 hours.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eRNA extraction and real-time q uantitative PCR\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAfter 24h infection of Eca109 and TE- 1 cells with \u003cem\u003ePrevotella\u003c/em\u003e, total RNA was extracted using a kit provided by Promega (Shanghai, China). cDNA was synthesized and quantitative real-time PCR was performed using kits from Tiangen Biotech (Beijing, China). Selected primers are shown in Table 1, with GAPDH as the internal reference, and relative mRNA expression levels were calculated using the 2^(-\u0026Delta;\u0026Delta;Ct) method.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 1 \u003c/strong\u003eReal-time quantitative PCR primer sequences\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"638\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"16.927899686520377%\" valign=\"top\"\u003e\n \u003cp\u003eGene\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"44.827586206896555%\" valign=\"top\"\u003e\n \u003cp\u003eForward sequence (5\u0026apos;-3\u0026apos;)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"38.244514106583075%\" valign=\"top\"\u003e\n \u003cp\u003eReverse sequence (5\u0026apos;-3\u0026apos;)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"16.927899686520377%\" valign=\"top\"\u003e\n \u003cp\u003eNF-\u0026kappa;B\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"44.827586206896555%\" valign=\"top\"\u003e\n \u003cp\u003eCTCCGAGACTTTCGAGGAAATAC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"38.244514106583075%\" valign=\"top\"\u003e\n \u003cp\u003eGCCATTGTAGTTGGTAGCCTTCA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"16.927899686520377%\" valign=\"top\"\u003e\n \u003cp\u003eCMyc\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"44.827586206896555%\" valign=\"top\"\u003e\n \u003cp\u003eGGCTCCTGGCAAAAGGTCA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"38.244514106583075%\" valign=\"top\"\u003e\n \u003cp\u003eCTGCGTAGTTGTGCTGATGT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"16.927899686520377%\" valign=\"top\"\u003e\n \u003cp\u003eGAPDH\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"44.827586206896555%\" valign=\"top\"\u003e\n \u003cp\u003eGACTCATGACCACAGTCCATGC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"38.244514106583075%\" valign=\"top\"\u003e\n \u003cp\u003eAGAGGCAGGGATGATGTTCTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003eWestern blot analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eEca109 and TE- 1 cells were infected with \u003cem\u003ePrevotella \u003c/em\u003efor 24 hours. Total protein was extracted from Eca109-CON, Eca109+\u003cem\u003ePrevotella\u003c/em\u003e, TE- 1-CON, and TE- 1+\u003cem\u003ePrevotella \u003c/em\u003egroups and protein concentration was determined using the BCA method. Based on BCA quantification results, the procedures of loading, electrophoresis, membrane transfer, and blocking were conducted. Primary antibodies were applied as follows: rabbit anti-NF-\u0026kappa;B (1:1000, abcam, UK), rabbit anti-BCL-XL (1:1000, Biyuntian Biotech, Shanghai, China), rabbit anti-CyclinD1 (1:1000, Biyuntian Biotech, Shanghai, China), rabbit anti-MMP2 (1:1000, Biyuntian Biotech, Shanghai, China), rabbit anti-MMP9 (1:1000, abcam, UK), rabbit anti-E-cadherin (1:1000, abcam, UK), rabbit anti-N-cadherin (1:1000, abcam, UK), rabbit anti-Vimentin (1:1000, Biyuntian Biotech, Shanghai, China), and rabbit anti-GAPDH (1:1000, Biyuntian Biotech, Shanghai, China). They were incubated on a shaker overnight at 4\u0026deg;C. Following three washes with 1 \u0026times;TBST for 10 minutes each, secondary antibody (1:1000, Biyuntian Biotech, Shanghai, China) was\u003c/p\u003e\n\u003cp\u003eadded and incubated at room temperature for 1 hour. The membranes were washed again three times with 1\u0026times;TBST, each for 10 minutes. Bands were visualized and imaged using a gel imaging system (Thermo Fisher Scientific, RockFord, IL, USA). Band intensities were analyzed using Image J software, with the ratio of band intensity to that of the internal reference representing the relative expression of the target protein.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eData were analyzed using GraphPad Prism 9 software and presented as mean \u0026plusmn; standard error of the mean (SEM) or standard deviation (SD). Comparisons between groups were conducted using multiple t-tests. Statistical significance was set at\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.05, with highly significant differences at\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.01.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eEnrichment of p\u003cem\u003erevotella \u003c/em\u003ein esophageal squamous cell carcinoma tissues\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eUtilizing the Illumina Nova SeqPE250 system, we conducted a 16S rDNA gene sequencing analysis on the esophageal tissues of patients with esophageal squamous cell carcinoma, differentiating between cancerous (EC group) and adjacent non-cancerous tissues (NC group) to investigate the composition of the esophageal microbiome (Fig. 1). Analysis at the genus level revealed a significantly higher abundance of \u003cem\u003ePrevotella \u003c/em\u003ein the EC group compared to the NC group (\u003cem\u003ep\u003c/em\u003e = 0.03).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFig. 1 \u003c/strong\u003eRelative abundance and differential analysis of \u003cem\u003ePrevotella\u003c/em\u003e in tumor and tumor-adjacent tissues of patients with ESCC. \u003cstrong\u003e(a)\u003c/strong\u003eThe relative abundance of \u003cem\u003ePrevotella \u003c/em\u003ein each sample; \u003cstrong\u003e(b) \u003c/strong\u003eDifferential analysis of the relative abundance of \u003cem\u003ePrevotella \u003c/em\u003egenus between the two groups. *Indicates a \u003cem\u003ep \u003c/em\u003evalue less than 0.05. EC, esophageal squamous cell carcinoma tumor group; NC, tumor-adjacent tissue group. \u003cem\u003en \u003c/em\u003e= 25.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003ePrevotella e\u003c/em\u003enhances the proliferative capability of ESCC cells\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo investigate the role of \u003cem\u003ePrevotella \u003c/em\u003ein the progression and development of ESCC, we assessed the effects of \u003cem\u003ePrevotella \u003c/em\u003eon the proliferative capabilities of Eca109 and TE- 1 cells using the Cell Counting Kit-8 (CCK8) method. Our results indicate that following 24 and 48 hours of stimulation with \u003cem\u003ePrevotella\u003c/em\u003e, both Eca109 (Fig. 2A) and TE- 1 cells (Fig. 2B) exhibited a dose-dependent increase in proliferation rate in correlation with the multiplicity of infection (MOI). Compared to MOI = 0, the proliferation of both Eca109 (\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01) and TE- 1 cells (\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05) was significantly enhanced at MOI = 200 after 24 and 48 hours of stimulation with \u003cem\u003ePrevotella\u003c/em\u003e. Furthermore, under MOI = 200, the proliferative capability of Eca109 (\u003cem\u003ep\u003c/em\u003e = 0.21) and TE- 1 cells (\u003cem\u003ep\u003c/em\u003e = 0.50) was found to be elevated at 24 hours compared to 48 hours of stimulation, even though these differences were not statistically significant. Consequently, we selected MOI = 200 and a 24-hour stimulation period with \u003cem\u003ePrevotella \u003c/em\u003eas the standard infection dosage and duration for subsequent experiments.\u003c/p\u003e\n\u003cp\u003eSimilarly, the clonogenic assay demonstrated that the growth rate of Eca109 (\u003cem\u003ep\u003c/em\u003e = 0.04) and TE- 1 cells (\u003cem\u003ep\u003c/em\u003e = 0.04) was significantly elevated following stimulation with \u003cem\u003ePrevotella\u003c/em\u003e, compared to the control group (Fig. 2C). Moreover, through western blot analysis, we identified significant upregulation of CyclinD1 at the protein level in both Eca109 (\u003cem\u003ep \u003c/em\u003e= 0.04) and TE- 1 cells (\u003cem\u003ep \u003c/em\u003e= 0.02) after infection with \u003cem\u003ePrevotella \u003c/em\u003e(Fig. 2D), which further substantiated our findings that \u003cem\u003ePrevotella \u003c/em\u003eenhances the proliferative capability of ESCC cells.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFig. 2 \u003c/strong\u003e\u003cem\u003ePrevotella \u003c/em\u003epromotes the proliferation of esophageal squamous cell carcinoma. \u003cstrong\u003e(a, b) \u003c/strong\u003eCCK8 assay results demonstrating the enhanced proliferation of Eca109 and TE- 1 cells following co-cultivation with \u003cem\u003ePrevotella\u003c/em\u003e. \u003cstrong\u003e(c) \u003c/strong\u003eClonogenic assay of Eca109 and TE- 1 cells after co-cultivation with \u003cem\u003ePrevotella\u003c/em\u003e, visualized by microscopy (left) and quantified (right). \u003cstrong\u003e(d) \u003c/strong\u003eWestern blot analysis revealing increased expression of CyclinD1 following co-cultivation with \u003cem\u003ePrevotella\u003c/em\u003e. Data represents the mean and standard error of 3 independent experiments. * \u003cem\u003ep \u003c/em\u003e\u0026lt; 0.05.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEffect of \u003cem\u003eprevotella \u003c/em\u003eon ESCC cell migration\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe migratory ability of ESCC cells was assessed using a scratch assay, and images were captured at 0 and 24 h of cell migration, as shown in Fig. 3. After stimulating by \u003cem\u003ePrevot\u003c/em\u003e\u003cem\u003eella \u003c/em\u003efor 24 h, there was a pronounced increase in the migratory capabilities of Eca109 (Fig. 3A) and TE- 1 (Fig. 3B) cells compared to the control group (\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01).\u003c/p\u003e\n\u003cp\u003eFurthermore, the expression level of MMP2 protein in ESCC cells was evaluated using a Western blot analysis. As shown in Fig. 3C, both Eca109 and TE- 1 cells exhibited a significant increase in MMP2 expression following stimulation by \u003cem\u003ePrevotella\u003c/em\u003e, compared to the control group (\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.01). These findings provide additional evidence that exposure to \u003cem\u003ePrevotella \u003c/em\u003esignificantly enhances the migration abilities of Eca109 and TE- 1 cells.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFig. 3 \u003c/strong\u003e\u003cem\u003ePrevotella \u003c/em\u003eEnhances the Motility of ESCC cells. \u003cstrong\u003e(a, b) \u003c/strong\u003eScratch assays reveal increased migration capabilities in Eca109 and TE- 1 cells after stimulating by \u003cem\u003ePrevotella\u003c/em\u003e; \u003cstrong\u003e(c) \u003c/strong\u003eWestern blot analysis indicates a significant increase in the expression of MMP2 protein in ESCC cells after stimulating by \u003cem\u003ePrevotella. \u003c/em\u003eData represents the mean and standard error of 3 independent experiments. *\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.05, ** \u003cem\u003ep \u003c/em\u003e\u0026lt; 0.01, *** \u003cem\u003ep \u003c/em\u003e\u0026lt; 0.001.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEMT modulation in ESCC cells by \u003cem\u003eprevotella\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eEMT is a critical event facilitating cancer metastasis. Our investigations via qRT-PCR and Western blot assays reveal this intricate relationship (Fig. 4). Following stimulation by \u003cem\u003ePrevotella\u003c/em\u003e, the expression of key EMT proteins in\u003c/p\u003e\n\u003cp\u003eEca109 cells, namely Vimentin (\u003cem\u003ep \u003c/em\u003e= 0.02) and MMP9 (\u003cem\u003ep \u003c/em\u003e= 0.04), was significantly upregulated, while the expression of E-cadherin showed a trend toward downregulation (\u003cem\u003ep\u003c/em\u003e = 0.07). In TE- 1 cells stimulated with \u003cem\u003ePrevotella\u003c/em\u003e, the expression of N-cadherin (\u003cem\u003ep\u003c/em\u003e = 0.03) and MMP9 (\u003cem\u003ep\u003c/em\u003e = 0.04) was significantly increased, and Vimentin exhibited an upward trend (\u003cem\u003ep\u003c/em\u003e = 0.02), whereas the expression of E-cadherin was markedly downregulated (\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01). These results suggest that \u003cem\u003ePrevotella \u003c/em\u003eexerts a considerable influence on the EMT of ESCC cells.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFig. 4 \u003c/strong\u003eInfluence of \u003cem\u003ePrevotella \u003c/em\u003eon EMT in ESCC cells. \u003cstrong\u003e(a)\u003c/strong\u003e Western blot image. \u003cstrong\u003e(b, c) \u003c/strong\u003eExpression analysis of Vimentin, N-cadherin, MMP9, and E-cadherin proteins in Eca109 and TE- 1 cells following stimulation with \u003cem\u003ePrevotella\u003c/em\u003e. Data represents the mean and standard error of 3 independent experiments. * \u003cem\u003ep \u003c/em\u003e\u0026lt; 0.05, ** \u003cem\u003ep \u003c/em\u003e\u0026lt; 0.01, *** \u003cem\u003ep \u003c/em\u003e\u0026lt; 0.001.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eActivation of NF-\u0026kappa;B signaling pathway possibly stimulated by \u003cem\u003eprevotella\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe anti-apoptotic gene Bcl-xl and the proto-oncogene c-Myc are downstream targets of the NF-\u0026kappa;B pathway. Through qRT-PCR analysis, it was observed (Fig. 5A, B) that stimulation with \u003cem\u003ePrevotella\u003c/em\u003e significantly upregulated the expression of NF-\u0026kappa;B and c-Myc genes at the mRNA level in both Eca109 and TE- 1 cells (\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05). Further, Western blot assays demonstrated (Fig. 5C, D, E) a significant increase in the expression of Bcl-xl and NF-\u0026kappa;B proteins in Eca109 and TE- 1 cells following stimulation with \u003cem\u003ePrevotella \u003c/em\u003e(\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05). The aforementioned results suggested that \u003cem\u003ePrevotella\u003c/em\u003e may influence the development of ESCC by activating the NF-\u0026kappa;B signaling pathway.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFig. 5 \u003c/strong\u003eActivation of NF-kB Pathway by \u003cem\u003ePrevotella\u003c/em\u003e. \u003cstrong\u003e(a, b) \u003c/strong\u003eRT-PCR results show significant upregulation of NF-kB and c-Myc regulatory genes in Eca109 and TE- 1 cells following stimulation with \u003cem\u003ePrevotella\u003c/em\u003e. \u003cstrong\u003e(c, d, e) \u003c/strong\u003eWestern blot analysis reveals an increase in the expression of NF-kB and BCL-XL following stimulation with \u003cem\u003ePrevotella\u003c/em\u003e. Data represents the mean and standard error of 3 independent experiments. * \u003cem\u003ep \u003c/em\u003e\u0026lt; 0.05, ** \u003cem\u003ep \u003c/em\u003e\u0026lt; 0.01.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eWith the continual advancement of microbial sequencing technology, mounting evidence has begun to illustrate that dysregulation of the microbial community has become one of the critical factors in the development and progression of various tumors, including esophageal cancer, gastric cancer, and colorectal cancer [10\u0026ndash; 15]. In the current study, our results from 16S rDNA sequencing revealed that the relative abundance of \u003cem\u003ePrevotella \u003c/em\u003ewas significantly elevated in ESCC tissues compared to adjacent non-tumorous tissues, implying a potential association between \u003cem\u003ePrevotella \u003c/em\u003eand the onset and progression of ESCC. In accordance with our observation, Zhao et al. [16] noticed a substantial increase in the abundance of \u003cem\u003ePrevotella \u003c/em\u003eat both the genus and family levels in the oral cavity of esophageal cancer patients. Studies have identified an increased abundance of \u003cem\u003ePrevotella\u003c/em\u003e in patients with erosive esophagitis, Barrett's esophagus [16], and ESCC [17]. Collectively, these studies supported the potential role of \u003cem\u003ePrevotella \u003c/em\u003eas a putative biomarker for ESCC and underscored its key regulatory function in the initiation and advancement of ESCC.\u003c/p\u003e\n\u003cp\u003eOur findings demonstrate a notable stimulatory effect of \u003cem\u003ePrevotella \u003c/em\u003eon ESCC cells, leading to an enhanced rate of proliferation. Cell proliferation is meticulously regulated by a balance between pro-apoptotic and anti-apoptotic molecules [18], and uncontrolled proliferation is a hallmark of tumorigenesis [19]. Observations from both MTT and colony formation assays revealed that the proliferative and migratory capabilities of ESCC cells were significantly augmented following stimulation by \u003cem\u003ePrevotella\u003c/em\u003e. This discovery emphasized the important role of \u003cem\u003ePrevotella \u003c/em\u003ein promoting the progression of ESCC. Existing studies have shown that microbes could induce cancer cell proliferation and migration through host autocrine and paracrine signaling [20]. Bacterial carcinogenesis is often associated with over-proliferation, further activation of inflammatory pathways, inhibition of apoptosis, and triggering of cellular transformation [21,22]. NF-\u0026kappa;B is a key inflammatory signaling pathway in the pathogenesis of\u003c/p\u003e\n\u003cp\u003eESCC [23,24]. Our results implied that infection with \u003cem\u003ePrevotella \u003c/em\u003emight induce overexpression of NF-\u0026kappa;B in ESCC cells, thereby driving their immortalization and oncogenic transformation [25,26].\u003c/p\u003e\n\u003cp\u003eEMT is widely regarded as a pivotal step in cancer cells acquiring migration and invasion capabilities [27]. During the EMT process, cancer cells lose their epithelial phenotype and transition into a mesenchymal phenotype, accompanied by a loss of cell polarity and epithelial-specific markers such as E-cadherin and \u0026beta;-catenin, and the expression of mesenchymal markers like N-cadherin, Vimentin, and ZEB1 [28,29]. In order to further explore the effects of \u003cem\u003ePrevotella\u003c/em\u003e on ESCC cell migration and EMT, Western blot assay was used to detect the expression of EMT-related proteins. Notably, our results revealed that \u003cem\u003ePrevotella \u003c/em\u003ecould significantly impact key markers in the EMT process of ESCC cells, such as the expression of Vimentin, N-cadherin, MMP9, and E-cadherin, which further suggested that \u003cem\u003ePrevotella \u003c/em\u003estimulation might enhance the migration and invasion capabilities of ESCC cells by promoting the EMT process. Moreover, existing evidence has demonstrated an association between the activation of the NF-\u0026kappa;B signaling pathway and migration and invasion in ESCC cells [30]. Microbial infection might activate telomerase reverse transcriptase through NF-\u0026kappa;B overexpression, consequently influencing inflammatory response, EMT, as well as the invasion and metastasis abilities of tumor cells [25]. These findings further corroborate the central role of NF-\u0026kappa;B in inducing and sustaining EMT [31]. Taken together, we posit that \u003cem\u003ePrevotella\u003c/em\u003e-induced migration and EMT in ESCC cells might be mediated through the modulation of the NF-\u0026kappa;B signaling pathway.\u003c/p\u003e\n\u003cp\u003eThe classical NF-\u0026kappa;B signaling pathway represents a complex regulatory mechanism, with its activation dependent on signals from pattern recognition receptors, T-cell receptors, B-cell receptors, pro-inflammatory cytokine receptors, and others. NF-\u0026kappa;B pathway could influence the expression of downstream genes, thereby affecting tumor proliferation and apoptosis [32]. Our study further explored the interrelationship between \u003cem\u003ePrevotella \u003c/em\u003estimulation and the expression of NF-\u0026kappa;B, c-Myc genes, as well as Bcl-xl and NF-\u0026kappa;B proteins in ESCC cells. Results uncovered that \u003cem\u003ePrevotella \u003c/em\u003estimulation could significantly upregulate the expression of these molecules, indicating that \u003cem\u003ePrevotella \u003c/em\u003emight promote the occurrence and progression of ESCC by activating the NF-\u0026kappa;B signaling pathway. Our finding resonated with the study by Dong et al. [33], who observed that \u003cem\u003ePrevotella \u003c/em\u003enot only affected tumor proliferation and migration but also participated in the onset of other diseases, such as persistent human tumor virus infections and cervical lesions in women of childbearing age, through the NF-\u0026kappa;B/C-myc pathway. Additionally, research has found that \u003cem\u003ePrevotella\u003c/em\u003e could improve cholestasis and liver fibrosis in primary sclerosing cholangitis by enhancing the FXR signaling pathway [34]. These discoveries emphasized the role of \u003cem\u003ePrevotella \u003c/em\u003ein various diseases, and a deeper understanding of its interaction with the host might provide vital clues for developing new treatment or prevention strategies, particularly in the context of tumors and chronic inflammatory diseases.\u003c/p\u003e\n\u003cp\u003eAlthough current research has partially elucidated the potential effects of \u003cem\u003ePrevotella\u003c/em\u003e on ESCC, the specific mechanisms of action still require further exploration and validation. For example, employing a nude mouse tumorigenesis model could further investigate Prevotella's in vivo mechanism of action on ESCC, along with in vitro experiments to determine whether \u003cem\u003ePrevotella\u003c/em\u003e could activate the NF-\u0026kappa;B signaling pathway through factors such as lipopolysaccharides, adhesins, and hemolysins, thereby affecting the onset and progression of ESCC. Future research should focus on these aspects for a more comprehensive and in-depth understanding of \u003cem\u003ePrevotella 's \u003c/em\u003erole in the pathogenesis and progression of ESCC.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eOur study revealed the pivotal regulatory role of \u003cem\u003ePrevotella\u003c/em\u003e in the pathogenesis and progression of ESCC. Through 16S rDNA sequencing analysis, we observed a significant increase in the abundance of \u003cem\u003ePrevotella \u003c/em\u003ein ESCC tissue compared to adjacent non-cancerous tissues. Further experiments demonstrated that stimulation by \u003cem\u003ePrevotel\u003c/em\u003e\u003cem\u003ela \u003c/em\u003emarkedly elevated the proliferation and migration abilities of ESCC cells and induced changes in the expression of key genes and proteins involved in EMT and the NF-\u0026kappa;B signaling pathway. These findings not only emphasized the possibility of \u003cem\u003ePrevotella \u003c/em\u003epromoting the onset and development of ESCC through the NF-\u0026kappa;B pathway but also provided valuable insights into the microbial mechanisms of ESCC. Further research focusing on the interactions between \u003cem\u003ePrevotella \u003c/em\u003eand the NF-\u0026kappa;B pathway,which may offer innovative strategies for inhibiting the progression and improving prognosis in ESCC.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthors contribution: \u003c/strong\u003eFanyue Sun contributed to the study conception and design. Material preparation were performed by Yuxin Yang, data collection were performed by Xinpeng Shi, and Chao Zhang. data analysis were performed by Yunshuai Wang, Haichao Liu, Yu Zhang.Tian Yang and XiaoDong Liu collected the important background information.The first draft of the manuscript was written by Fanyue Sun and all authors commented on previous versions of the manuscript. Funding acquisition was provided by Xiaoyong Luo and Baoyong Wang;All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding: \u003c/strong\u003eThis work was supported by the 2023 Henan Provincial Science and Technology Tackling Key Problems Project (232102311130).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eInstitutional Review Board Statement:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eInformed Consent Statement: \u003c/strong\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability Statement: \u003c/strong\u003eThe original manuscript of this study is included in the article and further information is available upon reasonable request to the corresponding author.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflicts of Interest: \u003c/strong\u003eThe authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eMao Y-S, Gao S-G, Wang Q, Shi X-T, Li Y, Gao W-J et al Analysis of a registry database for esophageal cancer from high-volume centers in China. Diseases of the Esophagus 2020 3;33. doi: 10. 1093/dote/doz091\u003c/li\u003e\n\u003cli\u003eGupta B, Kumar N (2017) Worldwide incidence, mortality and time trends for cancer of the oesophagus. Eur J Cancer Prev 26:107\u0026ndash;118 doi: 10. 1097/CEJ.0000000000000249\u003c/li\u003e\n\u003cli\u003eSmyth EC, Lagergren J, Fitzgerald RC, Lordick F, Shah MA, Lagergren P et al (2017) Oesophageal cancer. Nat Rev Dis Primers 2017 27;3:17048. doi: 10. 1038/nrdp.48\u003c/li\u003e\n\u003cli\u003eKavin H, Yaremko L, Valaitis J, Chowdhury L (1996) ;110:904\u0026ndash; 14. doi: 10. 1053/gast.1996.v110.pm8608902\u003c/li\u003e\n\u003cli\u003eMeng C, Bai C, Brown TD, Hood LE, Tian Q (2018) ;16:33\u0026ndash;49. doi: 10. 1016/j.gpb.2017.06.002\u003c/li\u003e\n\u003cli\u003eJiang Z, Wang J, Shen Z, Zhang Z, Wang S Characterization of Esophageal Microbiota in Patients With Esophagitis and Esophageal Squamous Cell Carcinoma. Front Cell Infect Microbiol 2021 1111. doi 3389/fcimb.2021.774330\u003c/li\u003e\n\u003cli\u003eZhao Q, Yang T, Yan Y, Zhang Y, Li Z, Wang Y et al Alterations of Oral Microbiota in Chinese Patients With Esophageal Cancer. Front Cell Infect Microbiol 2020 2110. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fcimb.2020.541144\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\n\u003cli\u003eLarsen JM (2017) The immune response to \u003cem\u003ePrevotella\u003c/em\u003e bacteria in chronic inflammatory disease. Immunology 151:363\u0026ndash;374 doi: 10. 1111/imm. 12760\u003c/li\u003e\n\u003cli\u003eJiang L, Shang M, Yu S, Liu Y, Zhang H, Zhou Y et al A high-fiber diet synergizes with Prevotella copri and exacerbates rheumatoid arthritis. Cell Mol Immunol 2022 2;19:1414\u0026ndash;1424. 10. 1038/s41423-022-00934-6\u003c/li\u003e\n\u003cli\u003eDeng Y, Tang D, Hou P, Shen W, Li H, Wang T et al (2021) ;150:104709. doi: 10. 1016/j.micpath.2020.104709\u003c/li\u003e\n\u003cli\u003eFerreira RM, Pereira-Marques J, Pinto-Ribeiro I, Costa JL, Carneiro F, Machado JC et al (2018) Gastric microbial community profiling reveals a dysbiotic cancer-associated microbiota. Gut 67:226\u0026ndash;236 1136/gutjnl-2017-314205\u003c/li\u003e\n\u003cli\u003eQu R, Zhang Y, Ma Y, Zhou X, Sun L, Jiang C et al (2023) ;10. doi: 10. 1002/advs.202205563\u003c/li\u003e\n\u003cli\u003eMa J, Li J, Jin C, Yang J, Zheng C, Chen K et al Association of gut microbiome and primary liver cancer: A two -sample Mendelian randomization and case\u0026ndash;control study. Liver Int 2023 8;43:221\u0026ndash;233. 10. 1111/liv.15466\u003c/li\u003e\n\u003cli\u003eKartal E, Schmidt TSB, Molina-Montes E, Rodr\u0026iacute;guez-Perales S, Wirbel J, Maistrenko OM et al (2022) A faecal microbiota signature with high specificity for pancreatic cancer. Gut 71:1359\u0026ndash;1372 1136/gutjnl-2021-324755\u003c/li\u003e\n\u003cli\u003eSobstyl M, Brecht P, Sobstyl A, Mertowska P, Grywalska E (2022) The Role of Microbiota in the Immunopathogenesis of Endometrial Cancer. Int J Mol Sci 20:23:5756. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/ijms23105756\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\n\u003cli\u003eLiu N, Ando T, Ishiguro K, Maeda O, Watanabe O, Funasaka K et al (2013) Characterization of bacterial biota in the distal esophagus of Japanese patients with reflux esophagitis and Barrett\u0026rsquo;s esophagus. BMC Infect Dis 11:13:130. 10. 1186/1471-2334-13\u0026ndash;130\u003c/li\u003e\n\u003cli\u003eChen X, Winckler B, Lu M, Cheng H, Yuan Z, Yang Y et al Oral Microbiota and Risk for Esophageal Squamous Cell Carcinoma in a High-Risk Area of China. PLoS One 2015 7;10:e0143603. doi: 10. 1371/journal.pone.0143603\u003c/li\u003e\n\u003cli\u003eSherr CJ (1994) G1 phase progression: Cycling on cue. Cell 79:551\u0026ndash;555 doi: 10. 1016/0092-8674(94)90540- 1\u003c/li\u003e\n\u003cli\u003eHanahan D, Weinberg RA (2011) Hallmarks of Cancer: The Next Generation. Cell 144:646\u0026ndash;674 1016/j.cell.2011.02.013\u003c/li\u003e\n\u003cli\u003eUdayasuryan B, Ahmad RN, Nguyen TTD, Uma\u0026ntilde;a A, Mon\u0026eacute;t Roberts L, Sobol P et al (2022) 18;15 \u003cem\u003eFusobacterium nucleatum\u003c/em\u003e induces proliferation and migration in pancreatic cancer cells through host autocrine and paracrine signaling. Sci Signal doi: 10. 1126/scisignal.abn4948\u003c/li\u003e\n\u003cli\u003eKarpiński TM (2019) The Microbiota and Pancreatic Cancer. Gastroenterol Clin North Am 48:447\u0026ndash;464 1016/j.gtc.2019.04.008\u003c/li\u003e\n\u003cli\u003eLv J, Guo L, Liu J-J, Zhao H-P, Zhang J, Wang J-H Alteration of the esophageal microbiota in Barrett\u0026rsquo;s esophagus and esophageal adenocarcinoma. World J Gastroenterol 2019 14;25:2149\u0026ndash;2161. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3748/wjg.v25.i18.2149\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\n\u003cli\u003eCoussens LM, Zitvogel L, Palucka AK (1979) Neutralizing Tumor-Promoting Chronic Inflammation: A Magic Bullet? Science 2013 18;339:286\u0026ndash;91. doi: 10. 1126/science.1232227\u003c/li\u003e\n\u003cli\u003eAbdel-Latif MM, Duggan S, Reynolds JV, Kelleher D (2009) ;9:396\u0026ndash;404. doi: 10. 1016/j.coph.2009.06.010\u003c/li\u003e\n\u003cli\u003eZheng H, Li LL, Hu DS, Deng XY, Cao Y (2007) Role of Epstein-Barr virus encoded latent membrane protein 1 in the carcinogenesis of nasopharyngeal carcinoma. Cell Mol Immunol 4:185\u0026ndash;196\u003c/li\u003e\n\u003cli\u003eGhareghomi S, Ahmadian S, Zarghami N, Kahroba H (2021) Fundamental insights into the interaction between telomerase/TERT and intracellular signaling pathways. Biochimie 181:12\u0026ndash;24 1016/j.biochi.2020. 11.015\u003c/li\u003e\n\u003cli\u003eWei C, Yang C, Wang S, Shi D, Zhang C, Lin X et al Crosstalk between cancer cells and tumor associated macrophages is required for mesenchymal circulating tumor cell-mediated colorectal cancer metastasis. Mol Cancer 2019 30;18:64. 10. 1186/s12943-019-0976-4\u003c/li\u003e\n\u003cli\u003eThiery JP, Acloque H, Huang RYJ, Nieto MA (2009) Epithelial-Mesenchymal Transitions in Development and Disease. Cell 139:871\u0026ndash;890 doi: 10. 1016/j.cell.2009. 11.007\u003c/li\u003e\n\u003cli\u003eZeisberg M, Neilson EG Biomarkers for epithelial-mesenchymal transitions. J Clin Invest 2009 1;119:1429\u0026ndash;1437. doi: 10. 1172/JCI36183\u003c/li\u003e\n\u003cli\u003eWang F, He W, Fanghui P, Wang L, Fan Q (2013) NF-\u0026kappa;BP65 promotes invasion and metastasis of oesophageal squamous cell cancer by regulating matrix metalloproteinase-9 and epithelial-to-mesenchymal transition. Cell Biol Int 37:780\u0026ndash;788. 10. 1002/cbin.10089\u003c/li\u003e\n\u003cli\u003eWang L, Wang L, Zhang H, Lu J, Zhang Z, Wu H et al AREG mediates the epithelial- mesenchymal transition in pancreatic cancer cells via the EGFR/ERK/NF- \u0026kappa;B signalling pathway. Oncol Rep 2020 27;\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3892/or.2020.7523\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\n\u003cli\u003eYu H, Lin L, Zhang Z, Zhang H, Hu H Targeting NF-\u0026kappa;B pathway for the therapy of diseases: mechanism and clinical study. Signal Transduct Target Ther 2020 21;5:209. 10. 1038/s41392-020-00312-6\u003c/li\u003e\n\u003cli\u003eDong B, Huang Y, Cai H, Chen Y, Li Y, Zou H et al \u003cem\u003ePrevotella\u003c/em\u003e as the hub of the cervicovaginal microbiota affects the occurrence of persistent human papillomavirus infection and cervical lesions in women of childbearing age via host \u003cem\u003eNF-\u0026kappa;B\u003c/em\u003e / \u003cem\u003eC‐myc\u003c/em\u003e. J Med Virol 2022 30;94:5519\u0026ndash;5534. 10. 1002/jmv.28001\u003c/li\u003e\n\u003cli\u003eJiang B, Yuan G, Wu J, Wu Q, Li L, Jiang P (2022) ;1868:166320. doi: 10. 1016/j.bbadis.2021.166320\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Supplementary Files","content":"\u003cp\u003eSupplementary File is not available with this version.\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"esophageal squamous cell carcinoma, Prevotella, NF-κB, epithelial-mesenchymal transition","lastPublishedDoi":"10.21203/rs.3.rs-3433179/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3433179/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003ePurpose \u003c/strong\u003eEsophageal squamous cell carcinoma (ESCC) is a highly fatal malignant tumor of the digestive tract. Although the relationship between the bacterial genus \u003cem\u003ePrevotella \u003c/em\u003eand ESCC has attracted attention recently, its specific role and molecular mechanisms remain unclear.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethods \u003c/strong\u003eIn this study, we employed 16S rDNA sequencing technology to analyze the differences in \u003cem\u003ePrevotella \u003c/em\u003ein 25 cases of esophageal squamous cell carcinoma (ESCC) and adjacent tissues (3 cm from the lesion). Subsequently, we co-cultured \u003cem\u003ePrevotella \u003c/em\u003ewith ESCC cells Eca109 and TE- 1, and through CCK8 assays, colony formation assays, and scratch assays, we investigated the influence of \u003cem\u003ePrevotella \u003c/em\u003eon the proliferation and migration abilities of ESCC cells. Utilizing qT-PCR and protein immunoblot assays to examine the expression of proteins related to epithelial-mesenchymal transition (EMT) and NF-κB.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults \u003c/strong\u003eThe relative abundance of \u003cem\u003ePrevotella \u003c/em\u003ewas markedly elevated in ESCC tissues as compared to adjacent non-tumor tissues. Upon infection, we observed a significant enhancement in the proliferation and migration capacities of ESCC cells. Besides, the stimulation by \u003cem\u003ePrevotella \u003c/em\u003eled to a significant upregulation in the expression of essential EMT-associated proteins, including N-cadherin, Matrix metalloproteinase-9 (MMP9), and Vimentin, in ESCC cells, with a concurrent downregulation of E-cadherin. Quantitative PCR and Western blot analysis further indicated that the mRNA levels of NF-κB and c-Myc and the protein expression of Bcl-xl and NF-κB were significant upregulation in ESCC cells by stimulating with \u003cem\u003ePrevotella\u003c/em\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusion \u003c/strong\u003eOur research unveiled the pivotal role of \u003cem\u003ePrevotella \u003c/em\u003ein the genesis and advancement of ESCC, proposing its influence on ESCC proliferation, migration, and EMT process via the NF-κB pathway, Our results offered a novel avenue for delving into the microbial mechanisms underpinning esophageal cancer.\u003c/p\u003e","manuscriptTitle":"Prevotella promotes proliferation and migration in esophageal squamous cell carcinoma by activating NF-κB signaling pathway","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2023-10-16 23:26:28","doi":"10.21203/rs.3.rs-3433179/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"86e99d67-1d2a-417e-9a0d-da35f545fdb1","owner":[],"postedDate":"October 16th, 2023","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2023-10-28T06:44:18+00:00","versionOfRecord":[],"versionCreatedAt":"2023-10-16 23:26:28","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3433179","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3433179","identity":"rs-3433179","version":["v1"]},"buildId":"ehx78VzkSd0WSzXnipQa-","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}