Chimeric Allergen Receptor regulatory T cells suppress birch pollen allergic airway inflammation.

Chimeric Allergen Receptor regulatory T cells suppress birch pollen allergic airway inflammation. | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Chimeric Allergen Receptor regulatory T cells suppress birch pollen allergic airway inflammation. Yannick muller, Ana Alcaraz-Serna, Aurelien Trompette, Raphaël Porret, and 14 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7301724/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Asthma is a deadly chronic respiratory disease affecting over 300 million people. While allergen immunotherapy remains the only disease-modifying treatment, it is poorly applicable for patients with severe asthma. Here we explored the therapeutic potential of regulatory T cells (Tregs) armed with chimeric allergen receptors -named CAlleR- redirected against the major allergen of birch pollen Bet v1. Four novel anti-Bet v1 antibodies were identified and used to engineer and functionally validate CAlleR. CAlleR Tregs showed specific activation and in vitro suppression and significantly reduced the airway hyperresponsiveness in birch pollen- sensitized mice. Mechanistically, CAlleR Tregs migrated to the lungs and mediastinal lymph nodes, interacted with CD11c⁺ dendritic cells and were activated in a FcγR-dependent manner by complexing birch allergens with allosteric anti-Bet v1 antibodies. These findings unveil a novel mechanism for targeting soluble antigens and highlight the potential of CAlleR Tregs to prevent and treat severe allergies. Health sciences/Diseases/Immunological disorders/Inflammatory diseases/Allergy Health sciences/Diseases/Immunological disorders/Inflammatory diseases/Asthma Biological sciences/Immunology/Translational immunology Biological sciences/Immunology/Antigen processing and presentation/Immune tolerance Biological sciences/Immunology/Lymphocytes/T cells/CD4-positive T cells/Regulatory T cells Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Introduction Asthma affects over 300 million people worldwide and remains a deadly disease if insufficiently treated, representing a high burden on individuals, caregivers, and healthcare systems 1, 2 . Allergic asthma is driven by an exacerbated type 2 immune response, characterized by the over-production of IL-4, IL-5, and IL-13 by Th2 cells. These cytokines promote IgE class switching, eosinophil recruitment, and mast cell activation resulting in airway hyperresponsiveness and airway mucus plugging, the principal cause of death in asthma 3 . Despite the approval of several anti-cytokines biologics, allergen immunotherapy (AIT) remains the only disease-modifying therapy 4, 5, 6 . A major cause of allergic rhinitis and asthma is related to birch sensitization affecting 8-16% of the European population 7 . Birch pollen cross-reacts with a large family of trees including alder, hazel, oak, hornbeam, chestnut, and beech. This birch homologous group shares highly cross-reactive allergens derived from the pathogenesis related 10 protein (PR-10) family, among which the birch allergen Bet v1 is the immunodominant and most abundant allergenic protein 8 . While AIT for birch-pollen associated rhinitis and asthma has been shown to be effective 9 , it remains contraindicated in patients with severe and uncontrolled asthma and is poorly effective in poly-sensitized patients 6 . This highlights the unmet need for new, safe, and durable treatments for severe allergic asthma. Regulatory T cells (Tregs) are crucial for suppressing type 2 inflammation through multiple modalities including IL-2 consumption, production of IL-10 and TGF-β, and downregulation of dendritic cell immunogenic activities 10 . Importantly, Tregs can be expanded ex vivo and re-infused with multiple clinical trials evaluating their potential in autoimmune and inflammatory disorders 11 . However, Treg therapy has shown only limited efficacy which has been mostly attributed to the lack of antigen specificity 12 . To overcome this limitation, efforts have focused on redirecting Treg specificity by engineering synthetic receptors such as Chimeric Antigen Receptors (CARs). Herein, we hypothesized that Tregs can be armed with Chimeric Allergen Receptors (CAlleRs) to target allergens such as Bet v1 to reset tolerance against birch pollen-associated allergic diseases. We identified and characterized four novel anti-birch specific antibodies and generated single-chain variable fragments fused to a CD28-ζ signaling domain. We demonstrated allergen specific response of CAlleRs. To decipher the physiological mechanisms by which CAlleR activation occurs, we showed that soluble allergens can induce maximal activity of CAlleRs when stabilized by an allosteric antibody in a Fc receptor-dependent manner. Finally, CAlleR Tregs preserved lung function in birch pollen-sensitized mice. Results Characterization of four novel high-affinity anti-Bet v1 monoclonal antibodies (mAbs) CD19 + IgM - IgG + B cells from a birch allergic donor were sorted and immortalized for single-cell plating ( Suppl. Fig. 1a ). Over 5000 clones were screened by ELISA. We could identify four Bet v1-specific clones after Sanger sequencing of the heavy variable (VH) and light variable (VL) gene pairs ( Fig. 1a,b ). Two of the four clones (mAb 5 and mAb 8) shared the same V gene, IGHV5-51 for the heavy and IGKV1-39 for the light but had different complementarity-determining region 3 (CDRH3). To validate the antibody specificity, we produced all four selected mAbs, as well as three previously reported control anti-Bet v1 mAbs (REGN5713, REGN5714 and REGN5715) 13 . Clones 5, 8, 10 and 11 showed similar half maximal effective concentration (EC 50 ) and demonstrated higher binding capacities than the control anti-birch antibodies ( Fig. 1b,c ). Importantly, they did not fix unrelated allergens, confirming their specificity to Bet v1 ( Fig. 1d ). We next assessed their binding affinity to Bet v1 by bio-layer interferometry (BLI) assay. Clones 5 and 8 showed higher associations and almost no dissociation compared to mAb 10 and 11 ( Fig. 1e ). To evaluate the neutralization capacity of the antibodies, we tested their capacity to block Bet v1-specific IgE binding from three birch-allergic donors. Clones 5 and 8 showed the strongest blocking capacity individually. Despite the high affinity of mAbs 10 and 11, they showed lower blocking effect ( Fig. 1f ). Cross-competitive Bet v1 binding study was further performed. We observed that mAbs 5 and 8 shared the same binding epitope than that of REGN5713 which partially overlapped with mAb 11. Interestingly, mAb 10 competed with an overlapping epitope partially shared with mAb 11 ( Fig. 1g ). To further demonstrate that mAb 8 and 10 bind distinct regions of Bet v1, we performed single-particle negative-stain electron microscopy on Bet v1 complexed with a three-fold molar excess of Fab08 and Fab10. Particles were picked from raw micrographs and subjected to reference-free 2D classification and 3D reconstruction ( Suppl. Fig. 2a ). Bet v1 appeared as a monomer, with Fab08 and Fab10 bound on opposite sides of the protein at an angle of approximately 30 degrees. To gain deeper insight into the epitopes recognized by the two Fabs and to compare them with the previously described REGN mAbs, cryo-electron microscopy (cryo-EM) on the complex was conducted. Reconstruction of the Bet v1–Fab08–Fab10 complex was obtained at a resolution of 4.8 Å, allowing Ca positioning ( Fig. 1h ). Bet v1 adopted a structure consisting of a seven-stranded anti-parallel β-sheet wrapped around a 25-residue-long C-terminal amphipathic α-helix, as previously described 14 . Fab08 sandwiched the C-terminal α-helix, similarly as REGN5713, with interactions mediated almost exclusively by its heavy chain. Fab10 bound a distinct, localized epitope consisting of a loop formed by residues 60 to 65, included among the binding epitopes of REGN5715 ( Fig. 1i ) 13 . Overall, the characteristics of the novel anti-Bet v1 mAbs were promising for further evaluation as single-chain variable fragments (scFvs) in the design of CAlleRs. Activation and proliferation of CAlleR T cells by artificial antigen presenting cell (aAPC) expressing Bet v1 We next generated scFvs derived from our four anti-Bet v1 mAbs and fused them to a CD28 hinge, transmembrane and co-stimulatory domains followed by a CD3z intracellular signaling domain. Anti-CD19 CAR was used as control and mCherry as a reporter ( Fig. 2a ). To evaluate the functional activity of the CAlleRs, we first engineered artificial K562 cells with a PDGF- truncated receptor covalently linked to the Bet v1 recombinant protein and a GFP molecule on the N and C terminus respectively ( Fig. 2b ). To validate the specificity of the selected CAlleRs Jurkat NFAT reporter cell lines were transduced and co-cultured with K562 Bet v1 for 24h ( Fig. 2c and Suppl. Fig. 3a ). CAlleR 5 and 8 displayed the highest NFAT activity, followed by CAlleR 11 and CAlleR 10 similarly to their binding affinities ( Fig. 2d ). Primary human CAlleR T cells were then generated to validate their functionality in vitro ( Fig. 2e ). Similar transduction efficiencies were obtained (prior calculation of MOI= 1) ( Fig. 2f,g ). Again, CAlleR 5 and 8 showed stronger binding to biotinylated Bet v1 compared to CAlleR 11 and 10 ( Fig. 2g ), correlating with CD25 and CD71 upregulation ( Fig. 2h-j ). Human CAlleR 8 Tregs show the highest in vitro suppressive capacity Next, the suppressive capacity of CAlleR Tregs was evaluated by applying a similar editing strategy to freshly isolated CD4 + CD25 + CD127 low Tregs ( Fig. 3a,b ). After 7 days of culture, the cells expanded 20-40-fold ( Fig. 3c ) and maintained a stable Treg phenotype independently of CAlleR expression ( Fig. 3d ). Similar transduction was observed among all CAlleRs ( Fig. 3e ). We observed a Bet v1-induced upregulation of early activation markers (OX40 and 41BB) in CAlleR Tregs ( Fig. 3f ). Interestingly, the higher activation rates observed with CAlleR 5 and 8 Tregs were consistent with those obtained with T cells ( Fig. 3f and 2h,i ). To evaluate their suppressive function, CFSE-labeled CAlleR 8 or CAlleR 11 T cells were cocultured with K562 Bet v1 and different ratios of CAlleR or polyclonally expanded Tregs ( Fig. 3g,h ). Overall, CAlleR Tregs exhibited greater suppressive capacity than polyclonal Tregs correlating with the in vitro activation levels. CAlleR 8 Tregs exhibited the highest suppressive capacity for both CAlleR 8 and 11 T cells. We therefore selected this candidate for the in vivo studies. Soluble Bet v1 is presented to CAlleRs through allosteric antibodies Since CAR signaling for soluble ligands relies on ligand-mediated dimerization and eukaryotic cells do not constitutively express allergens 15 , we hypothesized that anti-Bet v1 antibodies can stabilize soluble antigens and contribute to CAlleR activation. Indeed, soluble Bet v1 alone was insufficient to activate CAlleR T cells ( Fig. 4a ). Yet, in the presence of non-competitive mAbs we observed a modest upregulation of activation markers ( Fig. 4a ) in line with the competition binding assays ( Fig. 1g-i and Suppl. Fig. 2a ). To further assess this antibody-dependent activation, we examined the effect of low- medium- and high-affinity FcgR (CD16, CD32, CD64, respectively) by generating specific K562 cell lines ( Suppl. Fig. 4a,b ). The activation of CAlleR T cells was FcgR dependent and required allosteric stabilization of the Bet v1 ( Fig. 4a ). Importantly, we observed an antibody dose-dependent activation of the CAlleR 8 in the presence of mAb 10 ( Fig. 4b,c ). Similar results were obtained with CAlleR 8 Tregs ( Fig. 4d ), correlating with their capacity to uptake preferentially CD32 and CD64 ( Fig. 4e ). The suppressive capacity of CAlleR 8 Tregs was FcgR and antibody concentration dependent and better than polyclonal Tregs in all conditions ( Fig. 4f,g ). Interestingly, the suppression was less efficient against CAlleR 8 T cells stimulated with mAb 10 bound to CD64 compared CD32, suggesting more resistance to Treg when T effector cells (Teff) are strongly activated ( Suppl. Fig. 4c ). CAlleR effector T cells proliferated in vivo in an antibody-dependent manner The in vivo functionality of the CAlleR was first validated by engineering murine effector T cells and monitoring CFSE dilution. CAlleR 8 Teff were infused in birch pollen extract (BPE)-sensitized mice ( Fig. 5a-d ). Their presence and proliferation were compared in the lung, mediastinal lymph node (mLN), cervical lymph node (cLN)) and the spleen of PBS and BPE-sensitized mice. CAlleR 8 and polyclonal Teff were detected in all organs ( Fig. 5e and Suppl. Fig. 5a) . Yet, CAlleR 8 Teff proliferated significantly more than their polyclonal counterpart in a birch dependent manner, predominantly in the lungs and draining mediastinal lymph nodes ( Fig. 5f and Suppl. Fig. 5a ). To confirm CAlleR 8 Teff proliferation in response to birch specific immunoglobulins in a FcgR dependent manner, we purified bone marrow-derived dendritic cells (BMDCs) expressing high levels of FcgR 16 . We then investigated whether BPE-exposed mice produced specific immunoglobulins capable of mediating CAlleR 8 T cell activation via the FcgR on BMDCs ( Fig. 5g ). After the sensitization protocol, high levels of anti-Bet v 1 IgG1 were detected in allergic mice serum ( Fig. 5h ), which induced CAlleR 8 T cell activation when BMDCs and the allergen were present ( Fig.5i,j ). These findings demonstrate that CAlleR 8 Teff proliferate in allergen-exposed organs in a birch-specific antibody-dependent manner. CAlleR 8 Tregs suppress allergic airway inflammation in mice Considering the risks associated with CAR T cell therapies, we generated CAlleR murine Tregs expressing either the CAlleR 8 or a control anti-HLA-A2 CAR 17 with Thy1.1 as reporter ( Fig. 6a ). After 7 days of culture, phenotype and transduction efficiency were evaluated ( Fig. 6b ) prior to injection to BPE-exposed mice ( Fig. 6c ). Treg-treated mice had lower cell influx in the bronchoalveolar lavage fluid (BALF) than allergic mice indistinctively of their specificity ( Fig. 6d ). Importantly, CAlleR 8 Tregs significantly reduced the eosinophils percentage in the BALF ( Fig. 6e ). Additionally, Treg infusion correlated with increased IL-10 levels in the BALF ( Fig. 6f ). In the lungs of Treg-treated mice, lower levels of eosinophils (CD45 + CD11c - CD11b + Ly6G - Ly6C - SiglecF + ) were detected ( Fig. 6g and Suppl. Fig. 6a ). Notably, expression of SiglecF, a marker for eosinophilic activation, was also decreased on these cells ( Fig. 6h and Suppl. Fig. 6a ). These findings coincided with reduced birch specific IgG and total IgE levels in the serum of these mice ( Suppl. Fig. 6b,c ). However, dendritic cell (CD11c + CD11b + F4/80 - MHC-II + ) infiltration in the lungs was not reduced ( Suppl. Fig. 6d ). Although no overall differences were observed in the proportions of T cell populations in the lungs and mLNs ( Suppl. Fig. 6e,f ), Treg-treated mice exhibited reduced CD4 + T cell activation, as indicated by reduced CD44 expression ( Suppl. Fig.6e ), along with diminished production of IL-4, IL-13, and IL-17 ( Fig. 6i and Suppl. Fig.6g ). Lung mucus production was quantified using Periodic Acid Schiff (PAS) staining. Mice treated with CAlleR 8 Tregs showed fewer PAS+ airways than the other groups ( Fig. 6j,k ). This finding was supported by improved lung function with CAlleR 8 Treg-treated mice showing reduced airway hyper-reactivity, as measured by lung stiffness (H) and tissue resistance (G) after methacholine challenge ( Fig. 6l ). Overall, these data demonstrate the protective nature of Treg in a preclinical mouse model of allergic airway inflammation that can be further enhanced with CAlleRs. CAlleR 8 Tregs prevent allergic airway inflammation We next evaluated whether Tregs can prevent allergic disease development. To this end, engineered Tregs were adoptively transferred to mice prior to their first exposure to BPE ( Fig. 7a ). In this context, only the CAlleR 8 Tregs reduced the cellular influx in the BALF, with a lower proportion of eosinophils and lymphocytes ( Fig. 7b,c ). Increased IL-10 was also detected in the BALF of CAlleR 8 Tregs-treated mice ( Fig. 7d ). In the lung, no significant differences were observed in the proportion of neutrophils (CD45 + CD11c - CD11b + Ly6G + ), monocytes (CD45 + CD11c - CD11b + Ly6G - Ly6C + ), and eosinophils (CD45 + CD11c - CD11b + Ly6G - Ly6C - SiglecF + ) ( Fig. 7e and Suppl. Fig.7a ). Yet, SiglecF high eosinophils were significantly less prevalent in mice treated with CAlleR 8 ( Fig. 7f and Suppl. Fig. 7a ). Although in this model the anti-Betv1 IgG1 production remained unaffected by Treg transfer ( Suppl. Fig. 7b ), CAlleR 8 Tregs reduced total IgE levels ( Suppl. Fig. 7c ). CAlleR 8 Tregs did not significantly affect the dendritic cell (CD11c + CD11b + F4/80 - MHC-II + ) infiltration in the lungs ( Supl. Fig. 7d ). Similarly, Treg prophylactic treatment had no effect in the T cell compartment, neither on the proportions of the different populations nor on their activation status in the lungs and the mLNs ( Supl. Fig. 7e,f ). However, significantly less IL-4 production by CD4 + T cells was observed (Fig. 7g and Suppl. Fig. 7g) Importantly, mice treated with CAlleR 8 Tregs exhibited reduced mucus production ( Fig. 7h,i ), a finding associated with significantly improved lung function with reduced airway hyper-reactivity, as measured by reduced airway (Rn) and tissue (G) resistance as well as lung stiffness (H) after methacholine challenge ( Fig. 7j ). These data demonstrate that CAlleR 8 Tregs can prevent the inflammatory response of birch pollen-induced allergic asthma. CAlleR 8 Tregs migrate to BPE-exposed lungs and mediastinal lymph nodes to preferentially interact with CD11c + antigen presenting cells To further investigate the mechanism of CAlleR Treg in vivo , we engineered the cells with a GFP reporter ( Fig. 8a ). After in vitro expansion, transduction and phenotype of the engineered Tregs were confirmed ( Fig. 8b) and cells were adoptively transferred to mice, which were then exposed to BPE for four consecutive days ( Fig. 8c). In mice exposed to BPE, the number of CAlleR 8 Tregs was significantly higher in the lungs and draining lymph nodes (mLN) compared to PBS control mice ( Fig. 8d,e ). Importantly, CAlleR 8 Tregs made significantly more contacts with CD11c + APCs present in the mLN than unspecific A2-CAR Tregs ( Fig. 8f ). This difference was not observed in the lung and spleen of the mice ( Fig. 8f ). Thus, the CAlleR enabled specific migration and interactions of the Tregs with CD11c + APCs present in the mLN. Discussion Herein, we provide proof-of-concept and preclinical evidence that CAlleR Treg redirected against Bet v1 can downmodulate birch pollen-induced allergic airway inflammation. While polyclonal, allergen-unspecific Tregs demonstrated partial protective effects under inflammatory conditions, they were insufficient to prevent disease onset in the absence of inflammation. Importantly, we identified a key mechanism underlying the activation of CAR T cells targeting soluble antigens: engagement is dependent on allosteric antibodies stabilized via high-affinity FcγRs. These findings not only elucidate a novel principle of CAR activation by soluble proteins but also open new avenues for redirecting Treg specificity towards allergens for therapeutic intervention. Several attempts have been made to develop CAR T therapies targeting soluble factors, such as citrullinated vimentin, mesothelin, anti-factor VIII or insulin with limited success 18, 19, 20, 21 . Importantly, soluble antigen can trigger CAR activation by (1) forming a dimer or (2) simultaneously binding two different CARs recognizing distinct epitopes. Herein we discovered a third mechanism of CAR activation by soluble antigens mediated by allosteric, allergen-specific antibodies, which are stabilized in a Fc receptor affinity-dependent manner. Importantly, signal transduction requires an actin-dependent, dynamic process of CAR clustering that monomeric soluble antigens alone cannot trigger 15, 22 . Thus, the large pre-existing repertoire of allergen-specific antibodies in patients with severe asthma could contribute to enhance the suppressive function of CAlleR Tregs. The findings of our study could be leveraged to autoimmune diseases such as rheumatoid arthritis, for which an anti-citrullinated peptide CAR Treg therapy is currently under evaluation (NCT06201416). Our data indicated a preferential migration of CAlleR Tregs to the mediastinal lymph nodes and the lungs, reinforcing initial observations that redirecting the specificity of Tregs is sufficient to retain them in various tissues, such as the gut 23 or an HLA-A2 islet graft 24 . Yet, in inflammatory conditions, i.e., during the second round of allergen sensitization, we also observed a functional activity of the non-specific CAR-edited Treg cells. While the HLA-A2 CAR remains inactive in HLA-A2–negative control mice, thus effectively ruling out off-target activity 17 , its enhanced recruitment in the lung may be associated with the pulmonary passage following cell infusion 25 , which, in combination with pro-inflammatory chemokines, promote homing and persistence of the cells in the lungs. Imprinting of Tregs by lung dendritic cells could favor CCR4 upregulation and thereby a more efficient trafficking to the lungs 26 . Luster et al . demonstrated that CCR7 on Treg is required to suppress allergic airway inflammation during the sensitization phase, whereas CCR4 is essential for suppressing inflammation during the effector phase 27 . Future studies should better characterize the interplay between the CAlleR and the chemokine receptors in the trafficking dynamics between the mediastinal lymph node and the lung. Our data builds on previous evidence suggesting that the transfer of Tregs can modulate allergic airway inflammation in vivo 28, 29 . The main advantage of Tregs over other cell-therapy modalities, such as CAR T cells redirected against IL-5 and secreting IL-4/13 muteins 30 is their safety profile, as they lack proliferative capacities and produce considerably less pro-inflammatory cytokines 31 . Our findings show that CAlleR Tregs reduced levels of IL-4 in CD4 + T cells, which could explain the decrease of eosinophils in the BALF as IL-4 mediates eosinophils’ transendothelial migration 32 . Beyond their immunoregulatory functions, Tregs also contribute directly to tissue repair and homeostasis through amphiregulin-dependent mechanisms, an additional remarkable advantage over more conventional T cell therapies 33 . Yet, bona fide self-antigen-specific Treg cells can lose Foxp3 expression during an inflammatory autoimmune response 34 or upon repetitive stimulation 35 . Thus, future studies should evaluate the persistence and stability of the CAlleR Tregs over time and define the optimal modalities for implementing such approach, e.g., outside the pollen season or as an adjunct to a desensitization protocol to reduce local inflammation. The present study has several limitations. First, we focused on birch pollen-related airway allergic inflammation. However, patients with severe allergic asthma often suffer from multiple sensitizations against PR-10 unrelated proteins, such as profilins or polcalcins 36, 37 . Therefore, future studies should evaluate the potential bystander suppression of birch pollen-specific CAlleR Tregs and their capacity to suppress PR-10-unrelated memory T cells. Moreover, redirecting Treg specificity towards perennial allergens such as house dust mite may be also relevant considering the challenges associated with allergen avoidance. Accordingly, future studies should investigate the suppressive capacity of CAlleR Tregs in polysensitized mouse models. In parallel, it will be critical to assess the phenotypic stability and functional activities of CAlleR Tregs under repeated allergen stimulation as we have not investigated their persistence beyond five days after injection. Finally, we did not assess the suppressive capacity of Tregs on allergen-specific B cells, which may also contribute to allergen mobilization through their BCRs. In conclusion, we demonstrate that CAlleR Tregs can effectively prevent and downmodulate birch pollen-induced allergic airway inflammation. Our data provide compelling evidence for the role of allosteric antibodies in enhancing the action and homing of Tregs, contributing to the restoration of immune tolerance to soluble allergens. Future work should evaluate if such approach could also be suitable to restore tolerance against food allergies. Methods Human blood products Deidentified human peripheral blood from healthy donors was ordered at the Swiss Transfusion Center as buffy coats. For B cell sorting, peripheral blood mononuclear cells were isolated from a birch allergic female donor enrolled in the Immuno-IgE study, which was approved by the Institutional Review Board of the Lausanne university hospital (CER-VD 2020-02798 Switzerland). Written and informed consent was obtained prior to sample collection. Ficoll-Paque (Cytiva, USA; Cat. #17144003) density gradient centrifugation was used to isolate peripheral blood mononuclear cells (PBMCs). B cell sorting, immortalization, and cloning B cells were isolated from PBMCs with EasySep™ Human B Cell Isolation Kit according to manufacturer’s instructions (Stemcell Technologies, Canada, Cat# 17954) and labeled with LIVE/DEAD™ Fixable Aqua Dead Cell Stain Kit (Invitrogen, Waltham, MA, USA, Cat# L34957), mouse anti-human CD19 APC (BD Biosciences, Franklin Lakes, NJ, USA, Cat#555415; Clone SJ25C1), mouse anti-human IgM-PECy7 (Biolegend; Cat#314532; clone MHM-88), mouse anti-human IgG AF488 (Biolegend; San Diego, CA, USA, Cat#410706; Clone M1310G05), mouse anti-human IgE PE (Biolegend; San Diego, CA, USA, Cat#325506; clone MHE-18) mouse anti-human CD27 (BD Biosciences, Franklin Lakes, NJ, USA, Cat#646851; Clone HB7). Viable CD19 + CD27 + IgM - IgG + IgE - B cells were sorted with BD FACS Aria II cell sorter (BD Biosciences, Franklin Lakes, NJ, USA). B cell immortalization was performed as previously described 38 . Briefly, B cells were incubated for 3 hours at 37°C in complete DMEM medium (ThermoFisher Scientific, Waltham, MA, USA, Cat# A4192102) supplemented with 10%FCS, 1% Pen-Strep, 1% MEM Non-essential amino acids (ThermoFisher Scientific, Waltham, MA, USA, Cat# 11140050), 1%L-Glutamine, 1%Na-Pyruvate, 30mg/ml Transferrin (HOLO) (Biovision, Zürich, Switzerland, Cat# 7542-100), 1% kanamycin, 55mM 2-mercaptoethanol (Gibco, Grand Island, NY, USA, Cat.#21985-023), 2mg/ml CL264 TLR-7 agonist (Invivogen, San Diego, CA, USA, Cat #tlrl-c264e-5) and 40% Ebstein Barr virus obtained from Human gammaherpesvirus 4 (HHV-4) cell’s supernatant (ATCC, Manassas, VA, USA, Cat #VR-1492). B cells were plated at 3 cells per well with 26 000 autologous irradiated PBMCs in 384-well plate. Screening for each well was performed with an indirect Bet v1 ELISA detecting anti-Betv1 antibodies in the supernatant. Among 5760 clones, we could identify 15 binders which were further selected for RT-PCR as previously described 39 . Among those 15 clones, 6 paired heavy and light chain productive sequences were obtained with Sanger sequencing (Fasteris, Geneva, Switzerland). PCR amplification with custom primers (Microsynth AG, Balgach, Switzerland) was performed to extract the variable chain sequences of the antibodies and subcloning into AbVec2.0-IGHG1, AbVec1.1-IGKC or AbVec1.1-IGLC2-XhoI vectors (Addgene plasmids, #80795, #80796 and #99575, respectively). Resulting plasmids were used for transient transfection of ExpiCHO cells with 1.5 mg/ml of each plasmid. After seven days of cell culture, supernatants were collected and antibodies were purified using Sartobind Lab protein A columns according to manufacturer’s instructions (Sartorius AG, Göttingen, Germany, Cat #93PRAP06HB-12--A). Recombinant Bet v1 production Bet v1 DNA sequence was codon optimized for E. coli, synthesized by Genscript and cloned into a bacterial expression vector, pET29b, with a 10xHistag at the C-terminus and a Avitag. Recombinant Bet v1 (rBet v1) was expressed in E.coli BL21(DE3) cells by growing cells at 37 °C until an O.D. of 0.6, followed by induction with 0.5 mM Isopropyl β-D-1-thiogalactopyranoside overnight at 18 °C. Bacterial pellet was harvested for 15 minutes at 5000g, was lysed using sonication in buffer A (20 mM HEPES 7.5, 700 mM NaCl, 10% glycerol). Clarification of the cell’s lysate was performed by centrifugation for 30 minutes at 30 000 g. The protein was purified by nickel affinity, with a HisTrap HP 5 mL column, washed with buffer A and then eluted on a linear gradient of buffer B (buffer A + 500 mM imidazole, pH 7.5). Eluted fractions of rBet v1 was concentrated and injected onto a Superdex 75 16/600 gel filtration column (GE Healthcare/Cytiva) in 20 mM HEPES 7.5, 250 mM NaCl. After size exclusion, PBS buffer exchange was performed by dialysis and rBet v1 was diluted at 1mg/ml and stored at -20ºC. ELISA Antibody binding towards Bet v1 was assessed by indirect ELISA. NuncSorp plates were coated with 2mg/ml of rBet v1 diluted in coating buffer (15mM Na 2 CO 3 , 34.87mM NaHCO 3 ) overnight at 4ºC, washed with PBS-Tween 0.05% and blocked with PBS-BSA 1% for 2h at RT. Serial dilutions of the 6 novel mAbs were performed starting at 1 mg/ml and incubated for 2h. Serum samples from mice were diluted at 1:100 prior to incubation. Plates were then washed and 1 mg/ml of biotin mouse anti-human IgG antibody (BD Pharmigen, USA, Cat #555785; Clone G18-14) or 2mg/ml Goat anti-Mouse IgG1 Cross-Adsorbed Secondary Antibody, Biotin-XX (Life Technologies, Carlsbad, CA, USA, Cat #A10519) was used respectively for detection and incubated 1 hour at RT. Streptavidin horseradish peroxidase conjugate (BD Pharmigen, USA; Cat #554066; 1:1000 dilution) was added and incubated for 1h at RT. Tetramethylbenzidine substrate (BD Biosciences, San Diego, CA, USA, Cat #555214) was added for 20 minutes and the reaction was stopped with 2N sulfuric acid. Absorbance was measured on a spectrophotometer at 450nm (630nm reference). Binding of human IgG mAbs to other proteins, kindly provided by Dr. Régine Audran and Dr. Craig Fenwick, (rag weed, grass, Derp2, bee venom) was assessed using the same protocol but using a 10 mg/ml concentration for each extract. For total quantification of murine IgE, purifed goat anti-mouse IgE antibody (SouthernBiotech, Birmingham, AL, USA, Cat #1110-1) was coated at 2mg/ml in PBS and incubated overnight at 4ºC. After wash and blocking, 1:50 dilution of serum samples and 2-fold serial dilutions of purified mouse IgE for standard curve starting at 2 mg/ml (BD Pharmigen, Franklin Lakes, NJ, USA, Cat #553481) were added to the wells. After 2h of incubation, well were washed and detection goat anti-mouse IgE-AP antibody was added at 2 mg/ml (SouthernBiotech, Birmingham, AL, USA, Cat #1110-04) and incubated for 2h. Finally, wells were washed and 4-Nitrophenyl phosphate disodium salt hexahydrate (Sigma Aldrich, St. Louis, MO, USA, Cat #N2765-100TAB) was diluted in diethanolamine buffer (1M, pH 9.8, Sigma Aldrich, Cat #31590-250G), added to the wells and incubated for at least 5 minutes prior to absorbance measurement at 450 nm. IL-10 ELISA was performed according to manufacturer’s instructions (ELISA MAX™ Standard Set Mouse IL-10, Biolegend, San Diego, CA, USA, Cat. # 431411). Affinity and blocking capacity of anti-Bet v1 antibodies Affinity towards Bet v1 for each antibody was assessed with Gator® Prime Core Biolayer Interferometry System (BLI) by using a protein A coated probe (Gator, Palo Alto, CA, USA, Cat #160001). After binding of the antibodies to the biosensors, tips were dipped into 500 nM or 300 nM of Bet v1 protein. The strength of association and dissociation of the Bet v1 to the antibodies were measured. Blocking capacity of the anti-Bet v1 antibodies was assessed as previously described 13 by coating NuncSorp plates with 2 mg/ml of anti-human IgE monoclonal antibody (NBS-C BioScience, Vienna, Austria; clone Le27; Cat #0908-1-010) in coating buffer and incubated overnight at 4ºC. Washing with PBS 0.05%Tween and blocking with PBS 1%BSA for 2h at RT was performed before adding the serum of birch allergic patients diluted in dilution buffer so that the concentration added to the wells was 4 ng/ml of anti-Bet v1 IgE. Biotinlylated rBet v1 at 1nM was premixed for 2h at RT with 3-fold serial dilutions of the four anti-Bet v1 antibodies starting at 1 mM and then added to the IgE coated plate for 2h at RT. Plates were subsequently washed and streptavidin horseradish peroxidase conjugate (BD Pharmigen, USA; Cat #554066; 1:1000 dilution) was added and incubated 1h at RT. Tetramethylbenzidine substrate (BD Biosciences, San Diego, CA, USA; Cat #555214) was added for 20 minutes and the reaction was stopped with 2N sulfuric acid. Absorbance was measured on a spectrophotometer at 450nm (630 nm reference). Calculation of the percentage of blocking was performed as follows: Competition assay with Luminex bead-based assay Covalent coupling of rBet v1 to Luminex beads was performed according to manufacturer’s instructions with Bio-Plex Amine Coupling Kit (Bio-Rad, France; Cat #171406001). 30-fold molar excess of capture mAbs were combined with rBet v1 coupled beads for 30 minutes. Biotinylated competitor mAbs were then added to each well and incubated for further 20 minutes. Biotinylated mAbs bound to rBet v1 were stained with Streptavidin-PE (BD Pharmigen, USA; Cat # 554061 ; 1:1000 dilution) and analyzed on 200 Bioplex instruments. Negative stain electron microscopy The samples were adsorbed to a glow-discharged (20mA for 15s, Glowcube Plus, Quorum) carbon-coated copper grid 400 mesh (EMS, Hatfield, PA, USA), 5 ml of sample at 120 mg/ml were absorbed for 1 min, followed by 3 washes with deionized water (5 ml), and stained with a 1% uranyl acetate solution (3 ml) for 60 s. Observations were made using an Talos electron microscope (Thermo Fisher, Hillsboro, USA) operated at 120 kV. Digital images were collected using a direct detector camera Ceta 16M (Thermo Fisher, Hillsboro, USA) 4098 × 4098 pixels. Automatic data collection was performed using the EPU software v2.0 at a nominal magnification of x92,000, corresponding to a pixel size of 1.5 Å using a defocus range from -1mm to -2.5 mm. Image preprocessing, two-dimensional classification, and three-dimensional processing were done using the CryoSPARC software (v4.4). Cryo-EM data collection Grids were screened for particle presence and ice quality on a TFS Glacios microscope (200 kV), and the best grids were transferred to a TFS Titan Krios G4. Cryo-EM data were collected using a TFS Titan Krios G4 transmission electron microscope, equipped with a Cold-FEG on a Falcon IV detector in electron counting mode. Falcon IV gain references were collected just before data collection. Data were collected using TFS EPU v2.12.1 utilizing the aberration-free image shift protocol, recording four micrographs per ice hole. Movies were recorded at a magnification of ×120,000, corresponding to the 0.658 Å pixel size at the specimen level, with defocus values ranging from −1 to −2.4 µm. Exposures were obtained with 60 e− Å−2 total dose. In total, 4530 micrographs in EER format were collected. Cryo-EM data processing and structure fitting Data processing was performed with cryoSPARC (Version 4.4) including Motion correction and CTF determination. Particle picking and extraction (extraction box size 256 pixels) were carried out using cryoSPARC Version 4.478. Next, several rounds of reference-free 2D classification were performed to remove artifacts and selected particles were used for ab initio reconstruction and hetero-refinement. After hetero-refinement, 18’497 particles contributed to an initial 3D reconstruction of 4.8 Å resolution (Fourier-shell coefficient (FSC) 0.143) with C1 symmetry. A model of a Bet v1 (PDB ID 4A81) and AlphaFold2 (ColabFold implementation) models of the Fab 08 and 10 were fitted into the cryo-EM maps with UCSF ChimeraX (version 1.5). These docked models were extended and rebuilt without lateral chain manually using Coot (Version 0.9.8.8) and Phenix (Version 1.21) 40, 41 . Figures were prepared using ChimeraX (USCF, CA) 42 . Cell line generation NFAT-Luciferase Jurkat cells were purchased from BPE Bioscience Inc (San Diego, CA, USA) and cultured in RPMI 1640 (Gibco) supplemented with 10% FBS, 1% non-essential amino acids, 1% sodium pyruvate, 1% penicillin-streptomycin, Geneticin (1mg/ml). Lentiviruses encoding the different anti-Bet v1 CAlleRs or the anti-CD19 CAR with mCherry reporter were used to transduce cells that were further sorted to purify mCherry + cells. For K562 Betv1 generation, the Bet v1 protein linked to the platelet-derived growth factor (PDGF) transmembrane domain and to GFP was cloned in the lentiviral expression vector pCDH-EF1-FHC plasmid (Addgene #64874) 43 under the EF1a promoter. Lentiviral particles were used to transduce tumor K562 cell line that was further sorted to purify GFP + cells. K562 cells were genetically modified to knock out CD32 (FcγRII) using CRISPR-Cas9. Briefly, 80 μM crispr RNA (crRNA) sequences targeting FCGR2A gene (tggagcacgttgatccacgg and aaagcacagtcagatgcaca) (Synthego, Redwood City, California, USA) and 80 μM trans-activating crRNA (IDT, Newark, NJ, USA, Lot# 748524) were complexed with 45 μM high-fidelity recombinant Cas9 protein (produced by the Protein Production and Structure Core Facility of the EPFL - Swiss Federal Technology Institute of Lausanne, Switzerland) and mixed with 1 × 10⁶ K562 cells resuspended in 20 µL Lonza P3 Primary Cell Solution prior electroporation in a Lonza 4D-Nucleofector X Unit with the FF-120 program. After electroporation, cells were immediately transferred to pre-warmed RPMI-1640 medium supplemented with 10% FBS and incubated at 37°C, 5% CO₂. CD32 deficient cells were further sorted. To generate K562 CD64 cells, CD32 deficient cells were transduced with a lentivirus encoding human CD64 and further sorted. Animals Female Balb/c aged 6 weeks were purchased from Jackson Laboratory and maintained at the animal facility of the University of Lausanne. All animal protocols were approved by the Cantonal Commission for Animal Experiments from the Canton of Vaud (Switzerland) (License number: VD3893). Primary cell preparation, isolation and sorting Human T cells were enriched using EasySep Human T cell enrichment Kit following manufacturer’s instructions (StemCell Technologies, Vancouver, Canada, Cat.#17952). For human Tregs, CD25 + PBMCs were enriched using CD25 MicroBeads II (Miltenyi Biotec, Bergisch-Gladbach, Germany, Cat.#130-092-983) and stained with CD4-FITC (BD), CD25(CD25-4E3)-APC and CD127-PE for further sorting on a BD FACS Aria II cell sorter (BD Biosciences, Franklin Lakes, NJ, USA) as CD4 + CD25 + CD127 low . Human primary cells were cultured for two days in X-Vivo 15 medium (Lonza, Basel, Switzerland, Cat.#02-053Q) supplemented with 5% human AB serum (Pan-Biotech, Aidenbach, Germany, Cat.#P30-2901), 1% penicillin-streptomycin (BioConcept, Allschwill, Switzerland, Cat.#4-01F00-H), 55 mM 2-mercaptoethanol (Gibco, Grand Island, NY, USA, Cat.#21985-023) and 10mM N-acetyl-L-cysteine (Sigma-Aldrich, Saint-Louis, MO, USA, Cat.#A9165-25G). After viral transduction, cells were cultured in RPMI medium (Gibco, Walthman, MA, USA, Cat.#61870-010) supplemented with 10% FBS (Sigma-Aldrich, Saint-Louis, MO, USA, Cat.#F7524), 1% non-essential amino acids (Gibco, Grand Island, NY, USA, Cat.#11140-050), 10 mM Hepes (Gibco, Paisley, UK, Cat.#15630-056), 1 mM sodium pyruvate (Gibco, Waltham, MA, USA, Cat.#11360-039), and 1% penicillin-streptomycin. Medium was supplemented with recombinant human IL-2 (Miltenyi Biotec, Bergisch-Gladbach, Germany, Cat.#130-097-746) at 30 IU/ml for effector T cells and 300 IU/ml for Tregs. Both T cells and Tregs were activated from day 0 with anti-CD3/CD28 Dynabeads (Gibco, Waltham, MA, USA, Cat.#11131D) at 1:1 ratio. Murine T cells were isolated from spleens and lymph nodes of female Balb/c mice. T cells were enriched by negative selection using Easysep mouse T cell isolation kit (StemCell Technologies, Vancouver, Canada, Cat.#19851). For Treg isolation, CD4 + T cells were isolated using EasySep CD4+ T cell isolation kit according to manufacturer’s instructions (StemCell Technologies, Vancouver, Canada, Cat. #19852A). CD4 + T cells were stained with CD25(PC61)-PE (Invitrogen) and CD4(RM4-5)-APC (BD), and the CD4 + CD25 high fraction purified using a MoFlo Astrios (Beckman Coulter) or a AriaII (BD) cell sorters. Murine T cells were cultured in supplemented RPMI cell culture medium with 55 mM 2-mercaptoethanol (Gibco, Grand Island, NY, USA, Cat.#21985-023). T cells were activated with mouse anti-CD3/CD28 Dynabeads (Gibco, Waltham, MA, USA, Cat.#11452D) at 1:1 bead to cell ratio for conventional T cells and at 3:1 ratio for Tregs. The medium was supplemented with 50 IU/mL human IL-2 (Miltenyi Biotec, Bergisch-Gladbach, Germany, Cat.#130-097-746), 5ng/mL human IL7 (Miltenyi Biotec, Bergisch-Gladbach, Germany, Cat.#130-095-362) and human 5ng/mL IL15 (Miltenyi Biotec, Bergisch-Gladbach, Germany, Cat.#130-095-764) for conventional T cells. For Tregs medium was supplemented with 2000 IU/mL recombinant human IL-2 (Miltenyi Biotec, Bergisch-Gladbach, Germany, Cat.#130-097-746) for Treg. On day 7 of culture, beads were removed and cells rested overnight before further experiments. Plasmids Second generation CARs/CAlleRs with the CD28 hinge, CD28 transmembrane, CD28 intracellular domains and the CD3ζ signaling domain were cloned in the pCDH-EF1-FHC lentiviral vector plasmid (Addgene, no. 64874) as previously described 23 . The CARs were designed using the scFv derived from the four novel anti-Bet v1 antibodies and the anti-CD19 scFv derived from clone FMC63 as previously described 44 . The murine stem cell virus-based splice-gag vector (pMSGV) was used to introduce the scFv of either the CAlleR 8 or an anti-HLA A2 CAR (clone SN607D8) 17,24 fused to the hinge, transmembrane and intracellular domains of mouse CD28, and the signaling domain of mouse CD3ζ. The retroviral vector was kindly provided by Dr. Melita Irving (Lausanne University Hospital and University of Lausanne). Virus production To produce lentiviruses, 3x10 6 HEK293T cells were seeded in 9ml of supplemented DMEM and transfected 24h later with 4 μg of vector plasmid, 4 μg of pCMV-dR8.9 packaging plasmid, and 2 μg of pMD2.G2 packaging vector diluted in PEI. Supernatant was collected 48h and 72h post-transfection, filtered through a 45mm filter, ultracentrifuged at 50 000 G for 2h and stored at -80ºC. Retroviruses were produced using the Platinum-E (Plat-E) Retroviral Packaging Cell Line (Cell Biolabs, San Diego, CA, USA, Cat. #RV-101). Briefly, Plat-E cells were grown in DMEM supplemented with 10 μg/mL blasticidin (Invivogen, San Diego, CA, USA, Cat. #ant-bl-1) and 1 μg/mL puromycin (Sigma-Aldricht, St. Louis, MO, USA, Cat. #P8833) before transfection with 10 μg of CAR and 10 μg of pCL-Eco (Addgene plasmid #12371) in Turbofect reagent (Thermofisher Scientific, Waltham, MA, USA, Cat. #R0531). Two days after transfection, Plat-E supernatant was collected, and viruses were concentrated 400 times after ultracentrifugation at 50 000G for 1h30 at 4ºC. Cell transduction For human cells, transduction was performed 24 hours post-activation by adding a multiplicity of infection (MOI) of 1 of pre-titrated lentivirus to the culture. After 20 hours of incubation, the virus was washed, and cells were resuspended in fresh supplemented medium with cytokines. For murine cells, transduction was performed 24 hours post-activation for T conv and 72 hours post-activation for Tregs. Cells were incubated with 10% concentrated retrovirus in a non-treated culture plate (Greiner Bio-One, Austria) pre-coated overnight with 20 µg/mL RetroNectin (Takara Bio USA, San Jose, CA, USA, Cat. #T100A). The cell-virus mixture was spinoculated at 2000g for 1.5 hours at 32°C, followed by overnight incubation at 37°C, 5% CO₂. After 18 hours of transduction, the virus was removed by washing, and cells were resuspended in fresh medium. Luciferase assay To screen CAlleR functionality, NFAT cells were co-cultured with K562 WT or expressing Bet v1 at a 2:1 ratio for 24h at 37ºC, 5% CO 2 . After incubation, luciferase assay was performed as previously described 23 . Briefly, cells were lysed for 20 minutes under shaking conditions with 50ml harvesting buffer (50 mM 2-morpholinoethanesulfonic acid sodium (NaMES) (Sigma-Aldrich, Saint-Louis, MO, USA, Cat. #1061970100), 50 mM Tris-HCl, 1 mM dithiothreitol (Thermo Fisher Scientific, Waltham, MA, USA, Cat. #R0861), 0.4% Triton X-100 (Thermo Fisher Scientific, Waltham, MA, USA, Cat. #9002-93-1)). After incubation, 50 μl luciferase buffer (125 mM NaMES, 125 mM Tris-HCl, 25 mM (CH 3 COO) 2 Mg · 4H 2 O (Sigma-Aldrich, Saint-Louis, MO, USA, Cat. #M0631), 2.5 mM adenosine triphosphate (ATP, Thermo Fisher Scientific, Waltham, MA, USA, Cat. #R0441)) was added and incubated for one minute under shaking conditions prior to adding 50 μL of luciferin buffer (1 mM D-luciferin (Thermo Fisher Scientific, Waltham, MA, USA, Cat. #88292) in 4.8 mM KH 2 PO 4 (Merck, Darmstadt, Germany, Cat. #1.04873) and incubating for 5 minutes protected from light. Luminescence was measured as relative light units (RLU) on the Synergy H1 Hybrid reader (BioTek, Winooski, VT, USA). In vitro human T cell and Tregs activation, proliferation and suppression assays For activation and proliferation assays involving human primary T cells and Tregs, 0.1x10 6 primary cells were co-cultured with 120G irradiated K562 Bet v1 at different ratios, or when not specified at 1:5 ratio. For activation assay testing different FcγR, 120G irradiated K562 in presence of Bet v1 protein (1 μg/ml) and anti-Bet v1 monoclonal antibodies (0.5 μg/ml). After two days of co-culture, cells were stained for activation markers and analysed by flow cytometry. Anti-CD3 was used as positive control (1μg/ml, clone OKT3, BD Biosciences, Franklin Lakes, NJ, USA, Cat. #566685) For suppression assays, Tregs were debeaded, washed, rested for 8h and plated in 1:2 serial dilutions up to 1:64. Beads were also removed from effector T cells, cells were then washed and stained with 1 μM CFSE (Vybrant™ CFDA SE Cell Tracer Kit, Invitrogen™, Waltham, MA, USA, Cat. #V12883) in PBS for 5 minutes. Then, 0.1x10 6 effector T cells were co-cultured with Tregs at different ratios and 0.01x10 6 irradiated K562 cells. Suppression assay using different FcgR K562 cell lines, Tregs and effector T cells were plated as previously mentioned using 1 μg/ml of Bet v1 and different concentrations of mAb 10. Cells were incubated for 96h before analyzing CFSE dilutions. The FlowJo software was used to calculate the division index and percentage of suppression for each condition was calculated as follows: In vitro murine T cells and Treg activation In vitro activation of CAlleR murine cells was assessed by co-culturing 0.1x10 6 T cells or Tregs with 0.02x10 6 bone marrow derived dendritic cells (BMDC) generated as previously described 45 in presence of Bet v1 (1 μg/ml) and mAb 10 (0.5 μg/ml) or 10% heat inactivated murine serum. Cells were incubated for 24h and upregulation of activation markers was assessed by flow cytometry. Mouse model of birch pollen induced allergic airway inflammation Birch pollen extract (European white betula pendula, Stallergenes Greer, NC, USA, Cat. #XP527D3A25) was reconstituted in sterile PBS at 3.33 mg/ml. On days 0, 2, 4, 7, 9 and 11 mice were anesthetized by inhalation in a chamber with 4% isofluorane for 1 min and intranasally instillated with 30 ml of diluted BPE. On days 14 or 15 mice were euthanized with 225 mg/kg intraperitoneal injection of pentobarbital (Escornakon, Streuli Pharma AG, Uznach, Switzerland). Organ collection and processing After sacrifice, blood was collected from abdominal aorta for serum isolation. Lungs were extracted, cut and digested for 30 minutes at 37ºC with 0.2 mg/ml of Collagenase D (Sigma-Aldrich, MO, USA, Cat. #11088858001) resuspended in HBSS (Gibco), 10 mM Hepes and 5% FBS. Mediastinal lymph nodes were collected and digested the same way as lungs. Organs were then smashed on a 70 mm cell strainers with syringe plungers and stained for flow cytometry analysis. Spleens were directly smashed on 70 mm cell strainers and erythrocytes were lysed with ACK lysis buffer (155 mM NH₄Cl, 10 mM KHCO₃, 0.1 mM EDTA in distilled water, pH 7.4) prior staining for flow cytometry. For bronchoalveolar lavage fluid (BALF) collection, tracheas were cannulated with a 18G Venflon™ (BD, Cat. #393226) and flushed three times with 500 ml of ice-cold PBS supplemented with 0.2% BSA (Sigma-Aldrich, Saint-Louis, MO, USA, Cat. #A8806). Total BALF cell counts were determined with Coulter Counter Multisizer 4e (Beckman Coulter, Brea, CA, USA, Cat. #B23005). Cytospins were obtained by centrifuging 80 000 cells at 800 rpm for 5 minutes. Resulting cytospin slides were stained with RAL Diff-Quik™ solution (CellaVisio, Lund, Sweden, Cat. #720555-0000). Percentages of monocytes/macrophages, eosinophils, neutrophils and lymphocytes were assessed by counting 200 cells per cytospin. Flow Cytometry For human samples, cells were washed once with PBS supplemented with 0.5% FBS, 0.4% EDTA. After discarding supernatant, cells were incubated for 30 minutes at 4ºC in same wash buffer with diluted antibodies: anti-human CD3 (UCHT-1), PECy7 (1:400 dilution), BD Biosciences, 563423; anti-human CD4 (RPA-T4), AF700 (1:400 dilution), BD Biosciences, 557922; anti-human CD8 (RPA-T8), APC-Cy7 (1:400 dilution), BD Biosciences, 557760; anti-human CD8 (SK1), PE (1:250 dilution), BD Biosciences, 345773; anti-human CD25 (M-A251), FITC (1:400 dilution), BD Biosciences, 555431; anti-human CD25 (CD25-4E3), APC (1:250 dilution), Thermo Fischer Scientific, 17-0257-42; anti-human CD64 (REA978), APC (1:200 dilution), Miltenyi Biotech, 130-116-197; anti-human CD71 (M-A712), FITC (1:400 dilution), BD Pharmigen, 555536; anti-human CD127 (hIL-7R-M21), PE (1:200 dilution), BD Biosciences, 557938; anti-human CD32 (FLI8.26), APC (1:200 dilution), BD Biosciences, 559769; anti-human CD16 (3G8), PE (1:200 dilution), BD Biosciences, 555407; Biotinylated rBet v1 (1μg/ml); Streptavidin, PE (1:1000 dilution), BD Biosciences, 554061; DAPI (Live/Dead), Invitrogen (1:2500 dilution), D1306; Phamtom Dye (Live/Dead), Pacific blue (1:2500 dilution), Proteintech, PD00004. After 30min incubation, samples were washed again and either resuspended in washing buffer prior flow cytometry acquisition, or permeabilized and fixed using eBioscience Foxp3/Transcription Factor Staining Buffer according to manufacturer’s instructions (Invitrogen, Cat #00-5523-00). Intracellular staining was performed with anti-human Foxp3 (PCH101), eFluor660 (1:250 dilution), Thermo Fisher scientific, 50-4776-42; Helios (22F6), PE (1:250 dilution), Biolegend, 137216. For murine samples, cells were incubated with an anti-mouse CD16/32 antibody (TruStain FcX PLUS, clone S17011E), Biolegend (1:250 dilution), Cat. #156604 for 15 minutes at 4ºC. After blocking, cells were washed and extracellular staining was performed for 30 minutes at 4ºC with the following antibodies: anti-mouse CD3 (145-2C11), PE-Cy7 (1:250 dilution) and APC-Cy7 (1:100 dilution), BD Biosciences, 552774 and 561042 respectively; anti-mouse CD4 (RM4-5), PerCP-Cy5.5 (1:300 dilution) and APC (1:250 dilution), BD Biosciences, 561090 and 553051 respectively; anti-mouse CD8a (53-6.7), FITC (1:100 dilution) and Pacific Blue (1:400 dilution), BD Biosciences, 553030 and 558106 respectively; anti-mouse CD25 (PC61.5), PE (1:200 dilution), Invitrogen, 12-0251-83; anti-mouse CD25 (PC61), PerCP-Cy5.5 (1:250 dilution), BD Biosciences, 551071; anti-mouse CD44 (IM7), FITC (1:100 dilution), BD Biosciences, 553133; anti-mouse CD45 (30-F11), PE-Cy7 (1:250), BD Biosciences, 552848; anti-mouse CD45.2 (104), AF700 (1:100 dilution), Biolegend, 109821; anti-mouse CD69 (H1.2F3), PE (1:400 dilution), BD Biosciences, 553237; anti-mouse CD86 (GL1), PE (1:250 dilution), BD Biosciences, 553692; anti-mouse CD90.1 (Thy1.1; OX-7), PerCP Cy5.5 (1:250 dilution), BD Biosciences, 557266; anti-mouse CD90.1 (Thy1.1; REA838), FITC (1:500 dilution), Miltenyi Biotech, 130-112-872; anti-mouse CD11c (HL3), APC (1:100 dilution), BD Biosciences, 550261; anti-mouse CD11c (N418), APC-Cy7 (1:600 dilution), Biolegend, 117323; anti-mouse CD11b (M1/70), PEcy7 (1:600 dilution), BD Biosciences, 561098; anti-mouse MHC-II (M5/114.15.2), AF700 (1:1000 dilution), Biolegend, 107621; anti-mouse F480 (BM8), PerCP (1:100 dilution), Biolegend, 123126; anti-mouse Ly6C (HK1.4), Pacific Blue (1:1000 dilution), Biolegend, 128013; anti-mouse SiglecF (E50-2440), PE (1:100 dilution), BD Biosciences, 562068; anti-mouse Ly6G (1A8), PerCP Cy5.5 (1:100 dilution), BD Biosciences, 560602; biotinylated rBet v1 (1μg/ml); Streptavidin, APC (1:500 dilution) and PE (1:1000 dilution), BD Biosciences, 554067 and 554061 respectively; Aqua (Live/Dead), Amcyan (1:1000 dilution), Invitrogen, L34957; DAPI (Live/Dead), Invitrogen (1:2500 dilution), D1306. After incubation, samples were washed again and either fixed with BD FACS Lysing Solution following manufacturer’s instructions (BD Biosciences, Cat #349202) or permeabilized and fixed using eBioscience Foxp3/Transcription Factor Staining Buffer set (Invitrogen, Cat #00-5523-00) prior intracellular staining. Intracellular staining was performed with anti-mouse Foxp3 (FJK-16s), FITC (1:250 dilution) and PE (1:250 dilution), Invitrogen, 11-5773-82 and 12-5773-82 respectively; anti-mouse IL-4 (BVD6-24G2), PECy7 (1:100 dilution), invitrogen, 25-7042-41; anti-mouse IL-5 (TRFK5), APC (1:100 dilution), BD Biosciences, 562048; anti-mouse IL-13 (eBio13A), ef450 (1:100 dilution), Invitrogen, 48-7133-80; anti-mouse IL-17 (eBio17B7), PE (1:100 dilution), Invitrogen, 12-7177-81. Single-cell suspensions were resuspended in supplemented PBS prior acquisition by an LSRFortessa cell analyser (BD Biosciences, Franklin Lakes, NK, USA). Flow cytometry data were analyzed using FlowJo software v10.9.0. Lung function Mice were anesthetized with intraperitoneal injection of 50 mg/kg of pentobarbital and intramuscular injection of 100 mg/kg ketamine. Mice were tracheotomized and a 18G metallic canula was inserted in the trachea and secured with sutures. Mice were connected to the FlexiVent FX (SCIREQ Scientific Respiratory Equipment Inc., Montréal, Canada) and mechanically ventilated a 150 breaths/min, a tidal volume of 10ml/kg and a PEEP set at 3 cm H2O. Forced oscillation perturbation was performed to test the lung to a standardized signal of oscillatory frequencies above and below the normal ventilation frequency. Changes in resistance to increasing concentrations of nebulized acetyl-b-methacholine chloride (Sigma Aldrich) were measured from snapshot perturbation measurements taken using the forced oscillation perturbation technique. Immunofluorescense organ staining, imaging and analysis Mice were euthanized and lungs, mediastinal lymph nodes and spleen were dissected and fixed in 4% parafolmaldehyde (PFA, Sigma Aldrich, Saint-Louis, MO, USA, Cat. #158127) overnight at 4ºC under shaking conditions. Organs were then washed three times in PBS and incubated in PBS with 30% sucrose overnight at 4ºC prior to embedding in Tissue-Tek (Sakura, Osaka, Japan, Cat. #4583) and snap-frozen in dry ice. Organ sections were cut with 10μm thickness and assembled in microscopy slides for further staining. Slides were fixed in 4% PFA for 5 minutes, washed three times with room temperature PBS and incubated at room temperature in blocking buffer (PBS supplemented with 5% donkey serum, 0.5% BSA, 0.1% Triton-X-100, 0.01% sodium azide) for 30 minutes. Primary antibodies (rabbit anti-GFP (Abcam, Cambridge, UK, Cat #ab290; 1:2000 dilution), rat anti-mouse B220 (Thermo Fisher Scientific, Waltham, MA, USA, Cat #14-0452-81; 1:600 dilution), armenian hamster anti-mouse CD11c (BD Biosciences, Franklin Lakes, NJ, USA, Cat #550283; 1:200 dilution) were diluted in blocking buffer and incubated overnight at 4ºC. Slides were then washed with PBS 0.3% Triton X-100 and secondary antibodies (IgG donkey anti-rabbit-AF488 (Thermo Fisher Scientific, Waltham, MA, USA, Cat #A-21206; 1:300 dilution), IgG chicken anti-rat-AF647 (Thermo Fisher Scientific, Waltham, MA, USA, Cat #A-21472; 1:300 dilution), IgG goat anti-armenian hamster-biotinylated (Jackson Immuno Research, West Grove, PA, USA, Cat #127-065-160; 1:600 dilution)) were diluted in blocking buffer and incubated 1h at room temperature. After secondary staining, washing step was repeated three additional times and Streptavidin-AF555 (Thermo Fisher Scientific, Waltham, MA, USA, Cat #S32355; 1:300 dilution) was diluted in blocking buffer, added to the slides and incubated for 1h at room temperature. Slides were washed again and mounted with Fluoromount-G Mounting Medium with DAPI (Thermo Fisher Scientific, Waltham, MA, USA, Cat #00-4959-52) prior storage at 4ºC. Images were acquired at 20x magnification with Hamamatsu NanoZoomer S60 slide scanner and analyzed with QuPath software v0.5.1 46 . Briefly, whole-slide images were imported into the software and after necessary adjustments to color normalization, regions of interest (ROI) were manually annotated to analyze whole stained tissues. A machine learning-based classifier was developed in QuPath to differentiate positive and negative cells for each channel. Classifier’s performance was improved by refining the training dataset and adjusting classifier parameters. Then, automated cell detection was performed using QuPath’s built-in cell detection algorithm. The trained classifier was then applied to the detected cells, categorizing them as positive or negative based on the learned features. The number of GFP + cells was calculated for each ROI and density of cells was assessed by dividing the number of detected positive cells by the area of ROI. Cell interactions were quantified by determining the number of double positive cells. Statistical analysis For experiments involving human primary cells, each replicate corresponded to a unique healthy donor. In animal experiments, each replicate represented a single mouse, except for immunofluorescence staining, where two separate slides per organ were independently prepared, stained, and analyzed as technical replicates. Statistical analyses were performed using GraphPad Prism version 10.4.1 (GraphPad Software, Boston, MA, USA). The specific statistical tests used for each experiment are detailed in the corresponding figure legends, along with exact P values. Normality of the data was assessed using the Shapiro-Wilk test. Declarations Data availability Data are available in the article and supplementary information or from the corresponding author upon reasonable request. Source data are provided with this paper. Cryo-EM map is available on Zenodo () and will be made public upon publication. A private access link has been provided for peer review (). Acknowledgments We thank the Immunology and Allergy Division of the Centre Hospitalier Universitaire Vaudois (CHUV) and the Center for Immunotherapy and Vaccinology for their support. We are grateful to the Dubochet Center for Imaging (DCI Lausanne) at the École Polytechnique Fédérale de Lausanne (EPFL) and University of Lausanne (Unil) for their assistance and to the PSPST platform at EPFL for their help in the antibody production and characterization. We also thank the Cellular imaging Facility of Unil for assistance with immunofluorescense image analysis, and the Unil’s animal facility for their dedicated animal care. Finally, we thank the patient and healthy donors who voluntarily contributed to this study. Funding YDM received funding for this project from the Gabriella Giorgi-Cavaglieri Foundation, and AAS was supported by educational grants from the Martin Escudero Foundation and the Machaon Foundation. Author contribution Conceptualization and supervision: YDM. Designed experiments: AAS, YDM, LP, CF, AT, NU. Performed experiments: AAS, AT, RPO, NC, RC, EL, LE, OAA, EP, AS, SG, CF, JC. Analyzed data: AAS, AT, LP, CF, YDM. Provided reagents and advice: AT, LP, NU, AS, SG, CF, CG, AM. Wrote original draft: AAS, YDM. Reviewed and edited the manuscript: all. All authors approved the manuscript. Ethics declaration Competing interests: A patent application (EP25183719.1) based on the findings of this study has been filled by PACTT (Technology transfer office UNIL-CHUV) with YDM and AAS listed as inventors. The other authors declare no competing interests. References (GINA), G.I.f.A. Global Strategy for Asthma Management and Prevention, 2024. 2024. Papi, A., Brightling, C., Pedersen, S.E. & Reddel, H.K. Asthma. Lancet 391 ,783-800 (2018). Maddox, L. & Schwartz, D.A. The pathophysiology of asthma. Annu Rev Med 53 ,477-498 (2002). Brusselle, G.G. & Koppelman, G.H. Biologic Therapies for Severe Asthma. N Engl J Med 386 ,157-171 (2022). Israel, E. & Reddel, H.K. Severe and Difficult-to-Treat Asthma in Adults. N Engl J Med 377 ,965-976 (2017). Cox, L. et al. Allergen immunotherapy: a practice parameter third update. J Allergy Clin Immunol 127 ,S1-55 (2011). Biedermann, T. et al. Birch pollen allergy in Europe. Allergy 74 ,1237-1248 (2019). Schenk, M.F. et al. Proteomic analysis of the major birch allergen Bet v 1 predicts allergenicity for 15 birch species. J Proteomics 74 ,1290-1300 (2011). Wahn, U., Bachert, C., Heinrich, J., Richter, H. & Zielen, S. Real-world benefits of allergen immunotherapy for birch pollen-associated allergic rhinitis and asthma. Allergy 74 ,594-604 (2019). Akbari, O., Stock, P., DeKruyff, R.H. & Umetsu, D.T. Role of regulatory T cells in allergy and asthma. Curr Opin Immunol 15 ,627-633 (2003). Raffin, C., Vo, L.T. & Bluestone, J.A. T(reg) cell-based therapies: challenges and perspectives. Nat Rev Immunol 20 ,158-172 (2020). Baeten, P., Van Zeebroeck, L., Kleinewietfeld, M., Hellings, N. & Broux, B. Improving the Efficacy of Regulatory T Cell Therapy. Clin Rev Allergy Immunol 62 ,363-381 (2022). Atanasio, A. et al. Targeting immunodominant Bet v 1 epitopes with monoclonal antibodies prevents the birch allergic response. J Allergy Clin Immunol 149 ,200-211 (2022). Gajhede, M. et al. X-ray and NMR structure of Bet v 1, the origin of birch pollen allergy. Nat Struct Biol 3 ,1040-1045 (1996). Chang, Z.L. et al. Rewiring T-cell responses to soluble factors with chimeric antigen receptors. Nat Chem Biol 14 ,317-324 (2018). Guilliams, M., Bruhns, P., Saeys, Y., Hammad, H. & Lambrecht, B.N. The function of Fcgamma receptors in dendritic cells and macrophages. Nat Rev Immunol 14 ,94-108 (2014). Wagner, J.C., Ronin, E., Ho, P., Peng, Y. & Tang, Q. Anti-HLA-A2-CAR Tregs prolong vascularized mouse heterotopic heart allograft survival. Am J Transplant 22 ,2237-2245 (2022). Lanitis, E. et al. Redirected antitumor activity of primary human lymphocytes transduced with a fully human anti-mesothelin chimeric receptor. Mol Ther 20 ,633-643 (2012). Hombach, A. et al. An anti-CD30 chimeric receptor that mediates CD3-zeta-independent T-cell activation against Hodgkin's lymphoma cells in the presence of soluble CD30. Cancer Res 58 ,1116-1119 (1998). Fu, R.Y. et al. CD4(+) T cells engineered with FVIII-CAR and murine Foxp3 suppress anti-factor VIII immune responses in hemophilia a mice. Cell Immunol 358 ,104216 (2020). Tenspolde, M. et al. Regulatory T cells engineered with a novel insulin-specific chimeric antigen receptor as a candidate immunotherapy for type 1 diabetes. J Autoimmun 103 ,102289 (2019). Qiu, Y. et al. Mechanical force determines chimeric antigen receptor microclustering and signaling. Mol Ther 32 ,1016-1032 (2024). Porret, R. et al. T cell receptor precision editing of regulatory T cells for celiac disease. Sci Transl Med 17 ,eadr8941 (2025). Muller, Y.D. et al. Precision Engineering of an Anti-HLA-A2 Chimeric Antigen Receptor in Regulatory T Cells for Transplant Immune Tolerance. Front Immunol 12 ,686439 (2021). Fischer, U.M. et al. Pulmonary passage is a major obstacle for intravenous stem cell delivery: the pulmonary first-pass effect. Stem Cells Dev 18 ,683-692 (2009). Mikhak, Z., Strassner, J.P. & Luster, A.D. Lung dendritic cells imprint T cell lung homing and promote lung immunity through the chemokine receptor CCR4. J Exp Med 210 ,1855-1869 (2013). Afshar, R. et al. Compartmentalized chemokine-dependent regulatory T-cell inhibition of allergic pulmonary inflammation. J Allergy Clin Immunol 131 ,1644-1652 (2013). Xu, W. et al. Adoptive transfer of induced-Treg cells effectively attenuates murine airway allergic inflammation. PLoS One 7 ,e40314 (2012). Kearley, J., Barker, J.E., Robinson, D.S. & Lloyd, C.M. Resolution of airway inflammation and hyperreactivity after in vivo transfer of CD4+CD25+ regulatory T cells is interleukin 10 dependent. J Exp Med 202 ,1539-1547 (2005). Jin, G. et al. A single infusion of engineered long-lived and multifunctional T cells confers durable remission of asthma in mice. Nat Immunol 25 ,1059-1072 (2024). Esensten, J.H., Muller, Y.D., Bluestone, J.A. & Tang, Q. Regulatory T-cell therapy for autoimmune and autoinflammatory diseases: The next frontier. J Allergy Clin Immunol 142 ,1710-1718 (2018). Moser, R., Fehr, J. & Bruijnzeel, P.L. IL-4 controls the selective endothelium-driven transmigration of eosinophils from allergic individuals. J Immunol 149 ,1432-1438 (1992). Arpaia, N. et al. A Distinct Function of Regulatory T Cells in Tissue Protection. Cell 162 ,1078-1089 (2015). Bailey-Bucktrout, S.L. et al. Self-antigen-driven activation induces instability of regulatory T cells during an inflammatory autoimmune response. Immunity 39 ,949-962 (2013). Hoffmann, P. et al. Loss of FOXP3 expression in natural human CD4+CD25+ regulatory T cells upon repetitive in vitro stimulation. Eur J Immunol 39 ,1088-1097 (2009). Cacheiro-Llaguno, C. et al. Polysensitisation is associated with more severe symptoms: The reality of patients with allergy. Clin Exp Allergy 54 ,607-620 (2024). Ruiz-Hornillos, J. et al. Profilin is a marker of severity in allergic respiratory diseases. Allergy 75 ,853-861 (2020). Traggiai, E. et al. An efficient method to make human monoclonal antibodies from memory B cells: potent neutralization of SARS coronavirus. Nat Med 10 ,871-875 (2004). Fenwick, C. et al. A highly potent antibody effective against SARS-CoV-2 variants of concern. Cell Rep 37 ,109814 (2021). Emsley, P., Lohkamp, B., Scott, W.G. & Cowtan, K. Features and development of Coot. Acta Crystallogr D Biol Crystallogr 66 ,486-501 (2010). Liebschner, D. et al. Macromolecular structure determination using X-rays, neutrons and electrons: recent developments in Phenix. Acta Crystallogr D Struct Biol 75 ,861-877 (2019). Goddard, T.D. et al. UCSF ChimeraX: Meeting modern challenges in visualization and analysis. Protein Sci 27 ,14-25 (2018). Yousefzadeh, M.J. et al. Mechanism of suppression of chromosomal instability by DNA polymerase POLQ. PLoS Genet 10 ,e1004654 (2014). Muller, Y.D. et al . The CD28-Transmembrane Domain Mediates Chimeric Antigen Receptor Heterodimerization with CD28. Front Immunol 12 , 639818 (2021). Alcaraz-Serna, A. et al. Immune synapse instructs epigenomic and transcriptomic functional reprogramming in dendritic cells. Sci Adv 7 (2021). Bankhead, P. et al. QuPath: Open source software for digital pathology image analysis. Sci Rep 7 ,16878 (2017). Additional Declarations Yes there is potential Competing Interest. A patent application (EP25183719.1) based on the findings of this study has been filled by PACTT (Technology transfer office UNIL-CHUV) with YDM and AAS listed as inventors. The other authors declare no competing interests. Supplementary Files SupplementalFigures.docx Supplemental figures Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7301724","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":497302204,"identity":"e0e6f3af-2885-4cbc-acef-6bd025ddc850","order_by":0,"name":"Yannick muller","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA5ElEQVRIie3OIQvCQBTA8TeswzyL8wsIZzmL+FluDGY5zIaFs5i072MYFQxvDLYyXR1YJoLJYptg8HRBDZ6LhvtfOHjHj3cAOt2/xuQBaEwRYADkMTFELWIISbyaBF4k+k1Iso2LwvegGzgCL5vM7lucwHWlIOl4RFjMgeaOCIPTvrcOODEWqYIgp5YjJk8SmbhnJPdYw5gpSHZ+Izfc1SD5c0v1sQgQJXFRSVq53MJiz6TpQYRzdHvL9IjhQkGaGaet0nfbNHHDosShTRJnWlwVpIPVbX5M8TsAsIXqVafT6XSP7qGMXsw0zCl+AAAAAElFTkSuQmCC","orcid":"","institution":"CHUV","correspondingAuthor":true,"prefix":"","firstName":"Yannick","middleName":"","lastName":"muller","suffix":""},{"id":497302205,"identity":"105422cf-3ca5-4b8f-aa7a-fe26c0dfda20","order_by":1,"name":"Ana Alcaraz-Serna","email":"","orcid":"","institution":"Centre Hospitalier Universitaire Vaudois, CHUV","correspondingAuthor":false,"prefix":"","firstName":"Ana","middleName":"","lastName":"Alcaraz-Serna","suffix":""},{"id":497302206,"identity":"6823b5ca-a258-4426-9f01-b50e1de8088f","order_by":2,"name":"Aurelien Trompette","email":"","orcid":"","institution":"University of Lausanne","correspondingAuthor":false,"prefix":"","firstName":"Aurelien","middleName":"","lastName":"Trompette","suffix":""},{"id":497302207,"identity":"652b7d83-f171-4b1b-8b11-2cadaf45af32","order_by":3,"name":"Raphaël Porret","email":"","orcid":"","institution":"Centre Hospitalier Universitaire Vaudois, CHUV","correspondingAuthor":false,"prefix":"","firstName":"Raphaël","middleName":"","lastName":"Porret","suffix":""},{"id":497302208,"identity":"c6c564d5-f958-4c9d-8b22-c5d751d4dcfc","order_by":4,"name":"Erica Lana","email":"","orcid":"","institution":"Centre Hospitalier Universitaire Vaudois, CHUV","correspondingAuthor":false,"prefix":"","firstName":"Erica","middleName":"","lastName":"Lana","suffix":""},{"id":497302209,"identity":"1442286c-0cb6-4ac8-a13a-9a5a17d47f8b","order_by":5,"name":"Rebecca Cecchin","email":"","orcid":"","institution":"Centre Hospitalier Universitaire Vaudois, CHUV","correspondingAuthor":false,"prefix":"","firstName":"Rebecca","middleName":"","lastName":"Cecchin","suffix":""},{"id":497302210,"identity":"83cadf5f-7917-444f-8ab3-f66c1e941d75","order_by":6,"name":"Apiha Shanmuganathan","email":"","orcid":"","institution":"Centre Hospitalier Universitaire Vaudois, CHUV","correspondingAuthor":false,"prefix":"","firstName":"Apiha","middleName":"","lastName":"Shanmuganathan","suffix":""},{"id":497302211,"identity":"315e0203-b575-4e4f-9ca9-2184fd4e7fad","order_by":7,"name":"Seher Guney","email":"","orcid":"","institution":"Centre Hospitalier Universitaire Vaudois, CHUV","correspondingAuthor":false,"prefix":"","firstName":"Seher","middleName":"","lastName":"Guney","suffix":""},{"id":497302212,"identity":"1190d0d0-6837-4d86-93c2-f2f723f2da6d","order_by":8,"name":"Laura Ermellino","email":"","orcid":"","institution":"Centre Hospitalier Universitaire Vaudois, CHUV","correspondingAuthor":false,"prefix":"","firstName":"Laura","middleName":"","lastName":"Ermellino","suffix":""},{"id":497302213,"identity":"2b78df8e-a77e-4ceb-91a2-72aee6409d6b","order_by":9,"name":"Oscar Alfageme-Abello","email":"","orcid":"","institution":"Centre Hospitalier Universitaire Vaudois, CHUV","correspondingAuthor":false,"prefix":"","firstName":"Oscar","middleName":"","lastName":"Alfageme-Abello","suffix":""},{"id":497302214,"identity":"f888a705-a328-4e71-9fff-5adfbcdeb82a","order_by":10,"name":"Noemie Chillier","email":"","orcid":"","institution":"Centre Hospitalier Universitaire Vaudois, CHUV","correspondingAuthor":false,"prefix":"","firstName":"Noemie","middleName":"","lastName":"Chillier","suffix":""},{"id":497302215,"identity":"d2217984-ac2b-49af-a666-d0c7628d60fd","order_by":11,"name":"Eleonora Pace","email":"","orcid":"","institution":"Centre Hospitalier Universitaire Vaudois, CHUV","correspondingAuthor":false,"prefix":"","firstName":"Eleonora","middleName":"","lastName":"Pace","suffix":""},{"id":497302216,"identity":"fea8cfc6-63be-47b8-b329-61d6215f9b5a","order_by":12,"name":"Antonio Mancarella","email":"","orcid":"","institution":"Centre Hospitalier Universitaire Vaudois, CHUV","correspondingAuthor":false,"prefix":"","firstName":"Antonio","middleName":"","lastName":"Mancarella","suffix":""},{"id":497302217,"identity":"c9bdc478-5876-4891-a15f-f18f7880686e","order_by":13,"name":"Jeremy Campos","email":"","orcid":"","institution":"Centre Hospitalier Universitaire Vaudois, CHUV","correspondingAuthor":false,"prefix":"","firstName":"Jeremy","middleName":"","lastName":"Campos","suffix":""},{"id":497302218,"identity":"6972680e-af05-4138-a85d-ef55f3ebcdbe","order_by":14,"name":"Christophe von Garnier","email":"","orcid":"","institution":"Centre Hospitalier Universitaire Vaudois, CHUV","correspondingAuthor":false,"prefix":"","firstName":"Christophe","middleName":"","lastName":"von Garnier","suffix":""},{"id":497302219,"identity":"5f68a1ad-9b29-4f05-8b61-7ee92b2e073f","order_by":15,"name":"Craig Fenwick","email":"","orcid":"https://orcid.org/0000-0002-9435-0110","institution":"Service of Immunology and Allergy, Lausanne University Hospital, University of Lausanne","correspondingAuthor":false,"prefix":"","firstName":"Craig","middleName":"","lastName":"Fenwick","suffix":""},{"id":497302220,"identity":"5eace6ac-6f2e-42cc-af3d-e4d34cd8740c","order_by":16,"name":"Laurent Perez","email":"","orcid":"","institution":"Centre Hospitalier Universitaire Vaudois, CHUV","correspondingAuthor":false,"prefix":"","firstName":"Laurent","middleName":"","lastName":"Perez","suffix":""},{"id":497302221,"identity":"01ef56f3-23d7-4e90-8453-0bf305085622","order_by":17,"name":"Niki Ubags","email":"","orcid":"https://orcid.org/0000-0002-0177-4134","institution":"Faculty of Biology and Medicine, University of Lausanne, Service de Pneumologie, CHUV","correspondingAuthor":false,"prefix":"","firstName":"Niki","middleName":"","lastName":"Ubags","suffix":""}],"badges":[],"createdAt":"2025-08-05 14:31:35","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7301724/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7301724/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":88652724,"identity":"26ddb966-3560-4f4a-a81f-5d61f873cc34","added_by":"auto","created_at":"2025-08-08 17:57:12","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":884197,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDiscovery and characterization of four novel anti-Betv1 human antibodies.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea\u003c/strong\u003e, Experimental design of human anti-Betv1 discovery. \u003cstrong\u003eb\u003c/strong\u003e, Characteristics of four human anti-Bet v1 antibodies with variable domain genes (V, (D) and J) for heavy (H) and light (L) chains, third complementarity-determining region amino acid sequences (CDR3), and EC50 against Bet v1.\u003cstrong\u003e c\u003c/strong\u003e, Anti-Betv1 ELISA of the novel anti-Bet v1 antibodies (n=3) and the three anti-Bet v1 Regeneron antibodies (REGN5713, REGN5714 and RENG5715) (n=2). \u003cstrong\u003ed\u003c/strong\u003e, Allergen specificity of anti-Betv1 antibodies assessed by ELISA. \u003cstrong\u003ee\u003c/strong\u003e, BLI kinetics of each novel antibody immobilized on a protein A-loaded biosensor and Bet v1 in solution. Red lines represent fittings to the sensogram traces. A 3-fold (from 300 to 11 nM) or 2-fold (from 500 to 62.25 nM) Bet v1 dilution series were used. \u003cstrong\u003ef\u003c/strong\u003e, ELISA testing anti-Bet v1 antibody blocking Bet v1 binding to specific polyclonal IgE (n=3 biologically independent samples). \u003cstrong\u003eg\u003c/strong\u003e, Competitive binding study between antibodies binding Bet v1 protein coupled-beads. Competitors induced either strong blocking (red boxes), partial competition (grey boxes), or non-competitive binding (white boxes) with corresponding mAb to Bet v1. \u003cstrong\u003eh, \u003c/strong\u003eCryo-EM reconstruction of the complex at 4.8 Å resolution. The map is colored according to local resolution.\u003cstrong\u003e i, \u003c/strong\u003eStructural model derived from cryo-EM shown from side and top views. Bet v1 is in blue, Fab08 heavy chain in red, light chain in orange, Fab10 heavy chain in green, and light chain in cyan. Data in \u003cstrong\u003ec\u003c/strong\u003eand \u003cstrong\u003ef\u003c/strong\u003e is represented as mean ± SEM. Exact P values were determined by one-way ANOVA with Tukey’s test in \u003cstrong\u003ef.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"image1.png","url":"https://assets-eu.researchsquare.com/files/rs-7301724/v1/2221d4f9a9dbd36406d93db2.png"},{"id":88653030,"identity":"6a0489c4-3539-4a5f-b4b8-d3f46af8d2c6","added_by":"auto","created_at":"2025-08-08 18:05:12","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":712159,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eValidation of four novel anti-Betv1 CAlleR T cells\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea\u003c/strong\u003e, Anti-Bet v1 CAlleR and anti-CD19 CAR lentiviral constructs. \u003cstrong\u003eb\u003c/strong\u003e, Construct of lentivirus encoding surface expression of Bet v1 used to transduce K562 cells and phenotype check by GFP reporter expression. \u003cstrong\u003ec\u003c/strong\u003e, Experimental design of a CAlleR screening platform using NFAT-Luciferase CD4+ Jurkat cells. \u003cstrong\u003ed\u003c/strong\u003e, Luminescence signal measured in Relative Light Units (RLU) of anti-Bet v1 CAlleR and control NFAT cell lines after 24h co-culture with K562 Betv1 cells (ratio 1:2) (n=3 from three independent experiments).\u003cstrong\u003e e\u003c/strong\u003e, Experimental design of human anti-Bet v1 CAlleR T cells production. \u003cstrong\u003ef\u003c/strong\u003e, Representative flow cytometry plots showing mCherry reporter expression and binding to Bet v1 of human anti-Bet v1 CAlleR T cells. \u003cstrong\u003eg,\u003c/strong\u003e Cumulative percentages of transduction efficiency (mCherry\u003csup\u003e+\u003c/sup\u003eBetv1\u003csup\u003e+\u003c/sup\u003e) of CAR CD19 and anti-Betv1 CAlleRs and mean fluorescence intensity (MFI) of Bet v1 expression (n= 7-10 biologically independent experiments). \u003cstrong\u003eh\u003c/strong\u003e, Representative flow cytometry plots of CD25 and CD71 expression on T cells after 48h co-culture with K562 WT or K562 Betv1 (ratio 1:1). \u003cstrong\u003ei,\u003c/strong\u003e Cumulative data showing percentages of CD25\u003csup\u003e+\u003c/sup\u003eCD71\u003csup\u003e+\u003c/sup\u003e T cells after 48h co-culture (n= 4-5 biologically independent experiments).\u003cstrong\u003e j\u003c/strong\u003e, Correlation between CAlleR Bet v1 binding and activation (CD25\u003csup\u003e+\u003c/sup\u003eCD71\u003csup\u003e+\u003c/sup\u003e expression) is plotted with best fit lines using simple linear regression and calculated using Pearson correlation coefficient. Data is represented as mean ± SEM in \u003cstrong\u003ed\u003c/strong\u003e, \u003cstrong\u003eg\u003c/strong\u003e and \u003cstrong\u003ei\u003c/strong\u003e. Exact P values were determined by two-way ANOVA with Dunnett’s test in \u003cstrong\u003ed\u003c/strong\u003e and \u003cstrong\u003ei\u003c/strong\u003e, and by one-way ANOVA with Tukey’s test in \u003cstrong\u003ef\u003c/strong\u003e.\u003c/p\u003e","description":"","filename":"image2.png","url":"https://assets-eu.researchsquare.com/files/rs-7301724/v1/9ae43c70c751d945c1c74489.png"},{"id":88652732,"identity":"a027bc22-d944-47ff-b06b-0bcaac56d99e","added_by":"auto","created_at":"2025-08-08 17:57:12","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":961033,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAnti-Betv1 CAlleR 8 Treg cells show higher suppressive capacity in vitro.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea\u003c/strong\u003e, Experimental design of human CAlleR Treg cells production. \u003cstrong\u003eb\u003c/strong\u003e, Representative plots of CD25 and CD127 expression on cells at the different steps of Treg isolation. \u003cstrong\u003ec\u003c/strong\u003e, Expansion of Tregs over 7 days of cell culture. \u003cstrong\u003ed\u003c/strong\u003e, Representative plots and cumulative data of Foxp3 and Helios expression in Tregs after expansion. \u003cstrong\u003ee\u003c/strong\u003e, Representative plots and cumulative data of transduction efficiency of anti-Bet v1 CAlleR Tregs (n=3-4). \u003cstrong\u003ef\u003c/strong\u003e, Representative plots and cumulative data of CAlleR Treg activation markers (assessed by 41BB and OX40 expression) after 24h coculture with K562 WT or K562 Betv1 at a K562: Treg ratio of 1:5. \u003cstrong\u003eg\u003c/strong\u003e, \u003cstrong\u003eh\u003c/strong\u003e, Suppressive effect of CAlleR and polyclonal Tregs on (\u003cstrong\u003eg\u003c/strong\u003e) CFSE\u003csup\u003e+\u003c/sup\u003e CAlleR 8 or (\u003cstrong\u003eh\u003c/strong\u003e) CFSE\u003csup\u003e+\u003c/sup\u003e CAlleR 11 effector T cells. Plots show representative CFSE dilutions of effector T cells after 96h coculture with K562 Betv1 (K562 Betv1: T effector ratio 1:10) and different ratios of Tregs and cumulative data showing the percentage of proliferation suppression. Data represents mean ± SEM from 3 to 4 independent experiments. Exact P values were determined by unpaired t-test in\u003cstrong\u003e f\u003c/strong\u003e and two-way ANOVA with Dunnett’s test to compare CAlleR to polyclonal Tregs in \u003cstrong\u003eg\u003c/strong\u003e and \u003cstrong\u003eh\u003c/strong\u003e.\u003c/p\u003e","description":"","filename":"image3.png","url":"https://assets-eu.researchsquare.com/files/rs-7301724/v1/3c7119e2face446d1a5f8c8a.png"},{"id":88652726,"identity":"0dd77b69-a4ef-4b93-9190-19f353481126","added_by":"auto","created_at":"2025-08-08 17:57:12","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":785057,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAllosteric antibody-mediated CAlleR activation through FcγR\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea\u003c/strong\u003e, Heatmaps showing mean expression of CD25 and CD71 activation markers on CAlleR T cells upon 48h coculture with Bet v1 and anti-Bet v1 antibodies with or without K562 expressing three different FcγR. \u003cstrong\u003eb\u003c/strong\u003e, Representative plots of CD25 and CD71 expression on CAlleR 8 T cells upon 48h co-culture (n=3) with different concentrations of mAb10 and Bet v 1 (1μg/ml) in the presence of K562 expressing CD32 or CD64. \u003cstrong\u003ec\u003c/strong\u003e, Dose-response curves with EC50 of CAlleR 8 T cell activation in presence of K562 expressing CD32 or CD64, Bet v1 (1μg/ml) and different concentrations of mAb 10 (n=3). \u003cstrong\u003ed\u003c/strong\u003e, Representative flow cytometry plots and cumulative data of 41BB and OX40 expression on CAlleR 8 Treg after 24 co-culture with K562 expressing different FcγR and mAb 10 (1μg/ml) (n=3). \u003cstrong\u003ee\u003c/strong\u003e, CAlleR 8-mediated trogocytosis of FcγR on Treg cells after 24h co-culture with different K562, Bet v1 (1μg/ml) and mAb10 (1μg/ml) (n=3). \u003cstrong\u003ef\u003c/strong\u003e, \u003cstrong\u003eg\u003c/strong\u003e, Suppressive effect of CAlleR 8 and polyclonal Tregs on CAlleR 8 effector T cells upon 96h co-culture with K562 expressing either (\u003cstrong\u003ef\u003c/strong\u003e) CD32 or (\u003cstrong\u003eg\u003c/strong\u003e) CD64 (K562: T effector ratio of 1:10), Bet v1 (1μg/ml) and different concentrations of mAb 10. Plots show representative CFSE dilutions of CAlleR 8 effector T cells and cumulative data of the percentage of proliferation suppression. In \u003cstrong\u003ea\u003c/strong\u003e, \u003cstrong\u003eb\u003c/strong\u003e,\u003cstrong\u003e c\u003c/strong\u003e, \u003cstrong\u003ed\u003c/strong\u003e and \u003cstrong\u003ee\u003c/strong\u003e co-culture of K562 with T or Treg cells was performed at a 1:5 ratio. Data represents mean ± SEM from 3 to 4 independent experiments. P values were determined by one-way ANOVA with Tukey’s multiple comparison test in \u003cstrong\u003ed\u003c/strong\u003e and e and by two-way ANOVA with Dunnett’s test to compare CAlleR 8 to polyclonal Tregs in\u003cstrong\u003e f\u003c/strong\u003e and\u003cstrong\u003e g\u003c/strong\u003e.\u003c/p\u003e","description":"","filename":"image4.png","url":"https://assets-eu.researchsquare.com/files/rs-7301724/v1/a7343ae01d0ddabff79c8932.png"},{"id":88652728,"identity":"badb5ac4-31df-4517-b1bd-66a4b7deff26","added_by":"auto","created_at":"2025-08-08 17:57:12","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":448750,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCAlleR 8 T cells proliferated in allergic mice that produced allosteric antibodies.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea\u003c/strong\u003e, Experimental design of murine CAlleR 8 and Polyclonal effector T cells (Teff) generation. \u003cstrong\u003eb\u003c/strong\u003e, Experimental design of the allergic airway inflammation mouse model with adoptive transfer of transduced Teff at day 10. \u003cstrong\u003ec\u003c/strong\u003e, Transduction efficiency of T conv after 7 days of expansion. \u003cstrong\u003ed\u003c/strong\u003e, Bet v1 IgG1 detection in murine sera by ELISA. \u003cstrong\u003ee\u003c/strong\u003e, Cumulative data of the percentage of transduced (Thy1.1\u003csup\u003e+\u003c/sup\u003e) T conv detected among the CD3\u003csup\u003e+\u003c/sup\u003e cells in the different collected organs (lung, mediastinal lymph node (mLN), cervical lymph node (cLN) and spleen) (n=5-6). \u003cstrong\u003ef\u003c/strong\u003e, Cumulative data of the percentage of Thy1.1\u003csup\u003e+\u003c/sup\u003eCD4\u003csup\u003e+\u003c/sup\u003e cells that proliferated (gated on CFSE\u003csup\u003e-\u003c/sup\u003e) in the different organs in mice exposed to PBS or BPE (n=6). \u003cstrong\u003eg\u003c/strong\u003e, Experimental design of CAR A2 and CAlleR 8 Teff production and co-culture with BMDCs in presence of Bet v1 and serum from mice exposed to either PBS or BPE. \u003cstrong\u003eh\u003c/strong\u003e, Bet v1 specific IgG1 detection in the serum of mice exposed to PBS (n=2) or BPE (n=3) by ELISA.\u003cstrong\u003e i\u003c/strong\u003e, Cumulative data of transduction efficiency (Thy1.1\u003csup\u003e+\u003c/sup\u003e) of CAR A2 and CAlleR 8 Teff after 7 days of expansion (n=3).\u003cstrong\u003e j\u003c/strong\u003e, Representative flow cytometry plots and cumulative data showing the expression of CD25 and CD69 in CAR A2 and CAlleR 8 Teff after 24h co-culture with Betv1 (1 μg/ml), mouse serum (10%) and/or BMDCs (BMDC: Teff ratio 1:5) (for each condition and for each serum, 3 biologically independent samples of Teff were tested). Data in \u003cstrong\u003ed\u003c/strong\u003e, \u003cstrong\u003ee, f, h \u003c/strong\u003eand\u003cstrong\u003e i\u003c/strong\u003e are represented by mean ± SEM and by median ± interquartile range in \u003cstrong\u003ej\u003c/strong\u003e. P values in \u003cstrong\u003ed\u003c/strong\u003e were calculated with Kruskal-Wallis test with Dunn’s multiple comparison test, in \u003cstrong\u003ee \u003c/strong\u003eand\u003cstrong\u003e f\u003c/strong\u003e with two-way ANOVA and Tukey’s multiple comparison test and with Mann-Whitney U test in\u003cstrong\u003e j.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"image5.png","url":"https://assets-eu.researchsquare.com/files/rs-7301724/v1/a4700bd8a9ee82a3172b8961.png"},{"id":88653032,"identity":"874cf58f-3fc9-4de3-8267-30efdc864707","added_by":"auto","created_at":"2025-08-08 18:05:12","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":1128672,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCAlleR 8 Tregs downmodulate the allergic airway inflammation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea\u003c/strong\u003e, CAR A2 and CAlleR 8 constructs. Experimental design for mouse CAlleR Treg production. \u003cstrong\u003eb\u003c/strong\u003e, Representative flow cytometry plots and cumulative data of CAlleR Treg phenotype after 7 days of expansion with CD25 and Foxp3 expression to assess purity (n=4-6) and Thy1.1 and Bet v1 expression for transduction efficiency (n=4-7). Cumulative data of Treg expansion after 7 days of culture. \u003cstrong\u003ec\u003c/strong\u003e, \u003cem\u003eIn vivo\u003c/em\u003e experimental design of BPE induced allergic airway inflammation. \u003cstrong\u003ed\u003c/strong\u003e, Cell counts in BALF (n=6-9). \u003cstrong\u003ee\u003c/strong\u003e, Differential counts of cells infiltrating the BALF (n=6-9). \u003cstrong\u003ef\u003c/strong\u003e, IL-10 quantification in BALF by ELISA. \u003cstrong\u003eg\u003c/strong\u003e, Percentages of granulocytes in the lungs (n=7-9). \u003cstrong\u003eh\u003c/strong\u003e, SiglecF expression on eosinophils in the lungs (n=4-9). \u003cstrong\u003ei\u003c/strong\u003e, Th2 cytokines production in CD4\u003csup\u003e+\u003c/sup\u003e T cells of the lungs (n=7-10). \u003cstrong\u003ej\u003c/strong\u003e, Representative images of hematoxylin/eosin (H/E) and periodic acid Schiff (PAS) staining of the lungs (black bars represent 100 mm scale). \u003cstrong\u003ek\u003c/strong\u003e, Quantification of PAS+ small and medium airways of the lungs (n= 7-9). \u003cstrong\u003el\u003c/strong\u003e, Flexivent measurement of Newtonian resistance (Rn), tissue elastance (H) and tissue damping (G) at baseline and different doses of inhaled methacholine (n=4-5). Data are presented as mean ± SEM from 2 independent experiments (except for \u003cstrong\u003el\u003c/strong\u003e that shows data from 1 experiment). n indicates the number of mice. P values were determined by one-way ANOVA with Tukey’s multiple comparison test in \u003cstrong\u003ed\u003c/strong\u003e, \u003cstrong\u003ee\u003c/strong\u003e, \u003cstrong\u003ef\u003c/strong\u003e, \u003cstrong\u003eg, i\u003c/strong\u003e and \u003cstrong\u003ek\u003c/strong\u003e and two-way ANOVA with Tukey’s multiple comparison test in \u003cstrong\u003eh\u003c/strong\u003e and Sidak’s test in \u003cstrong\u003el\u003c/strong\u003e.\u003c/p\u003e","description":"","filename":"image6.png","url":"https://assets-eu.researchsquare.com/files/rs-7301724/v1/64638e677db3c9feaca322ad.png"},{"id":88652731,"identity":"881208e0-1e65-4b02-b861-41e264383d95","added_by":"auto","created_at":"2025-08-08 17:57:12","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":946539,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCAlleR 8 Tregs prevent BPE allergic airway inflammation.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea\u003c/strong\u003e, \u003cem\u003eIn vivo \u003c/em\u003eexperimental design of BPE induced allergic airway inflammation. \u003cstrong\u003eb\u003c/strong\u003e, Cell counts in BALF (n=5-9). \u003cstrong\u003ec\u003c/strong\u003e, Differential counts of cells infiltrating the BALF (n=5-9). \u003cstrong\u003ed\u003c/strong\u003e, IL-10 quantification in BALF by ELISA. \u003cstrong\u003ee\u003c/strong\u003e, Percentages of granulocytes in the lungs (n=4-7). \u003cstrong\u003ef\u003c/strong\u003e, SiglecF expression on eosinophils in the lungs (n=4-7). \u003cstrong\u003eg\u003c/strong\u003e, Th2 cytokines production in CD4\u003csup\u003e+\u003c/sup\u003e T cells of the mediastinal lymph node (n=5-7). \u003cstrong\u003eh\u003c/strong\u003e, Representative images of hematoxylin/eosin (H/E) and periodic acid Schiff (PAS) staining of the lungs (black bars represent 100 mm scale). \u003cstrong\u003ei\u003c/strong\u003e, Quantification of PAS+ small and medium airways of the lungs (n=6-9). \u003cstrong\u003ej\u003c/strong\u003e, Flexivent measurement of Newtonian resistance (Rn), tissue elastance (H) and tissue damping (G) at baseline and different doses of inhaled methacholine (n=5). Data are presented as mean ± SEM from 2 independent experiments (except for \u003cstrong\u003ej\u003c/strong\u003e that shows data from 1 experiment). P values were determined by one-way ANOVA with Tukey’s multiple comparison test in \u003cstrong\u003eb\u003c/strong\u003e, \u003cstrong\u003ec\u003c/strong\u003e, \u003cstrong\u003ed\u003c/strong\u003e, \u003cstrong\u003ee\u003c/strong\u003e, \u003cstrong\u003eg \u003c/strong\u003eand \u003cstrong\u003ei\u003c/strong\u003e and with two-way ANOVA with Tukey’s multiple comparison test in \u003cstrong\u003ef\u003c/strong\u003e and Sidak’s test in\u003cstrong\u003e j\u003c/strong\u003e.\u003c/p\u003e","description":"","filename":"image7.png","url":"https://assets-eu.researchsquare.com/files/rs-7301724/v1/4967b775826f500fc1fed97f.png"},{"id":88652729,"identity":"0350d43b-8f12-4f0a-b020-4a61e1497a81","added_by":"auto","created_at":"2025-08-08 17:57:12","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":938934,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCAlleR 8 Treg cells preferentially migrate to the mediastinal lymph nodes where they get in contact with CD11c\u003c/strong\u003e\u003csup\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/sup\u003e\u003cstrong\u003e APCs for allergen presentation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea\u003c/strong\u003e, Experimental design of murine CAlleR 8 GFP\u003csup\u003e+\u003c/sup\u003e and CAR A2 GFP\u003csup\u003e+\u003c/sup\u003e Treg cells production. \u003cstrong\u003eb\u003c/strong\u003e, Representative plots of Treg cells phenotype and transduction efficiency after 7 days of expansion. \u003cstrong\u003ec\u003c/strong\u003e, Experimental design of the allergic airway inflammation mouse model and adoptive Treg cells transfer. \u003cstrong\u003ed\u003c/strong\u003e, Representative images of CAlleR 8 and CAR A2 Treg cells in the mediastinal lymph nodes (mLNs), lung and spleen of mice exposed to PBS or BPE. White bars represent the scale of 20μm and small images show fluorescence channels of the magnified region outlined in white squares. \u003cstrong\u003ee\u003c/strong\u003e, Cumulative data of detection of GFP\u003csup\u003e+\u003c/sup\u003e cells /mm2 in each organ (n=8 in lung and spleen and n=5-8 in mLN from 4 mice with images duplicates). \u003cstrong\u003ef\u003c/strong\u003e, Cumulative data of percentage of GFP\u003csup\u003e+\u003c/sup\u003e cells interacting with CD11c\u003csup\u003e+\u003c/sup\u003e, B220\u003csup\u003e+\u003c/sup\u003e APCs or with none of them (No CD11c\u003csup\u003e+\u003c/sup\u003e/B220\u003csup\u003e+\u003c/sup\u003e contact) for each organ (n=8 in lung and spleen and n=5-8 in mLN from 4 mice with images duplicates). In \u003cstrong\u003ee\u003c/strong\u003e and \u003cstrong\u003ej\u003c/strong\u003e, data is represented by median ± interquartile range and in \u003cstrong\u003ef\u003c/strong\u003e by mean ± SEM. P values were calculated with Kruskal-Wallis and Dunn’s multiple comparison test in \u003cstrong\u003ee\u003c/strong\u003e and with two-way ANOVA with Tukey’s test in \u003cstrong\u003ef\u003c/strong\u003e.\u003c/p\u003e","description":"","filename":"image8.png","url":"https://assets-eu.researchsquare.com/files/rs-7301724/v1/17747bad87375ffdfb888a0b.png"},{"id":91103728,"identity":"88b6115c-4e48-48c3-ba0a-3339169d9907","added_by":"auto","created_at":"2025-09-11 15:08:47","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":8871359,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7301724/v1/dc92b9a0-acfd-46d8-8cc0-1dbf494192ea.pdf"},{"id":88653031,"identity":"7e0817c5-4b7d-4ce0-a436-9a1de515d023","added_by":"auto","created_at":"2025-08-08 18:05:12","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":1688262,"visible":true,"origin":"","legend":"Supplemental figures","description":"","filename":"SupplementalFigures.docx","url":"https://assets-eu.researchsquare.com/files/rs-7301724/v1/adbda9f9e0895951022616ad.docx"}],"financialInterests":"\u003cb\u003eYes\u003c/b\u003e there is potential Competing Interest.\nA patent application (EP25183719.1) based on the findings of this study has been filled by PACTT (Technology transfer office UNIL-CHUV) with YDM and AAS listed as inventors. The other authors declare no competing interests.","formattedTitle":"Chimeric Allergen Receptor regulatory T cells suppress birch pollen allergic airway inflammation.","fulltext":[{"header":"Introduction","content":"\u003cp\u003eAsthma affects over 300 million people worldwide and remains a deadly disease if insufficiently treated, representing a high burden on individuals, caregivers, and healthcare systems\u003csup\u003e1, 2\u003c/sup\u003e.\u0026nbsp;Allergic asthma is driven by an exacerbated type 2 immune response, characterized by the over-production of IL-4, IL-5, and IL-13 by Th2 cells. These cytokines promote IgE class switching, eosinophil recruitment, and mast cell activation resulting in airway hyperresponsiveness and airway mucus plugging, the principal cause of death in asthma\u003csup\u003e3\u003c/sup\u003e. Despite the approval of several anti-cytokines biologics, allergen immunotherapy (AIT) remains the only disease-modifying therapy\u003csup\u003e4, 5, 6\u003c/sup\u003e.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eA major cause of allergic rhinitis and asthma is related to birch sensitization affecting 8-16% of the European population\u003csup\u003e7\u003c/sup\u003e. Birch pollen cross-reacts with a large family of trees including alder, hazel, oak, hornbeam, chestnut, and beech. \u0026nbsp;This birch homologous group shares highly cross-reactive allergens derived from the pathogenesis related 10 protein (PR-10) family, among which the birch allergen Bet v1 is the immunodominant and most abundant allergenic protein\u003csup\u003e8\u003c/sup\u003e. While AIT for birch-pollen associated rhinitis and asthma has been shown to be effective\u003csup\u003e9\u003c/sup\u003e, it remains contraindicated in patients with severe and uncontrolled asthma and is poorly effective in poly-sensitized patients\u003csup\u003e6\u003c/sup\u003e. This highlights the unmet need for new, safe, and durable treatments for severe allergic asthma.\u003c/p\u003e\n\u003cp\u003eRegulatory T cells (Tregs) are crucial for suppressing type 2 inflammation through multiple modalities including IL-2 consumption, production of IL-10 and TGF-β, and downregulation of dendritic cell immunogenic activities\u003csup\u003e10\u003c/sup\u003e. Importantly, Tregs can be expanded \u003cem\u003eex vivo\u003c/em\u003e and re-infused with multiple clinical trials evaluating their potential in autoimmune and inflammatory disorders\u003csup\u003e11\u003c/sup\u003e. However, Treg therapy has shown only limited efficacy which has been mostly attributed to the lack of antigen specificity\u003csup\u003e12\u003c/sup\u003e. To overcome this limitation, efforts have focused on redirecting Treg specificity by engineering synthetic receptors such as Chimeric Antigen Receptors (CARs).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eHerein, we hypothesized that Tregs can be armed with Chimeric Allergen Receptors (CAlleRs) to target allergens such as Bet v1 to reset tolerance against birch pollen-associated allergic diseases. We identified and characterized four novel anti-birch specific antibodies and generated single-chain variable fragments fused to a CD28-ζ signaling domain. We demonstrated allergen specific response of CAlleRs. To decipher the physiological mechanisms by which CAlleR activation occurs, we showed that soluble allergens can induce maximal activity of CAlleRs when stabilized by an allosteric antibody in a Fc receptor-dependent manner. \u0026nbsp;Finally, CAlleR Tregs preserved lung function in birch pollen-sensitized mice.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eCharacterization of four novel high-affinity anti-Bet v1 monoclonal antibodies (mAbs)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCD19\u003csup\u003e+\u003c/sup\u003eIgM\u003csup\u003e-\u003c/sup\u003eIgG\u003csup\u003e+\u003c/sup\u003e B cells from a birch allergic donor were sorted and immortalized for single-cell plating (\u003cstrong\u003eSuppl. Fig. 1a\u003c/strong\u003e). Over 5000 clones were screened by ELISA. We could identify four Bet v1-specific clones after Sanger sequencing of the heavy variable (VH) and light variable (VL) gene pairs (\u003cstrong\u003eFig. 1a,b\u003c/strong\u003e). Two of the four clones (mAb 5 and mAb 8) shared the same V gene, IGHV5-51 for the heavy and IGKV1-39 for the light but had different complementarity-determining region 3 (CDRH3). To validate the antibody specificity, we produced all four selected mAbs, as well as three previously reported control anti-Bet v1 mAbs (REGN5713, REGN5714 and REGN5715)\u003csup\u003e\u0026nbsp;13\u003c/sup\u003e. Clones 5, 8, 10 and 11 showed similar half maximal effective concentration (EC\u003csub\u003e50\u003c/sub\u003e) and demonstrated higher binding capacities than the control anti-birch antibodies (\u003cstrong\u003eFig. 1b,c\u003c/strong\u003e). Importantly, they did not fix unrelated allergens, confirming their specificity to Bet v1 (\u003cstrong\u003eFig. 1d\u003c/strong\u003e). \u0026nbsp;We next assessed their binding affinity to Bet v1 by bio-layer interferometry (BLI) assay. Clones 5 and 8 showed higher associations and almost no dissociation compared to mAb 10 and 11 (\u003cstrong\u003eFig. 1e\u003c/strong\u003e). To evaluate the neutralization capacity of the antibodies, we tested their capacity to block Bet v1-specific IgE binding from three birch-allergic donors. Clones 5 and 8 showed the strongest blocking capacity individually. Despite the high affinity of mAbs 10 and 11, they showed lower blocking effect (\u003cstrong\u003eFig. 1f\u003c/strong\u003e). Cross-competitive Bet v1 binding study was further performed. We observed that mAbs 5 and 8 shared the same binding epitope than that of REGN5713 which partially overlapped with mAb 11. Interestingly, mAb 10 competed with an overlapping epitope partially shared with mAb 11 (\u003cstrong\u003eFig. 1g\u003c/strong\u003e). To further demonstrate that mAb 8 and 10 bind distinct regions of Bet v1, we performed single-particle negative-stain electron microscopy on Bet v1 complexed with a three-fold molar excess of Fab08 and Fab10. Particles were picked from raw micrographs and subjected to reference-free 2D classification and 3D reconstruction (\u003cstrong\u003eSuppl. Fig. 2a\u003c/strong\u003e). Bet v1 appeared as a monomer, with Fab08 and Fab10 bound on opposite sides of the protein at an angle of approximately 30 degrees. To gain deeper insight into the epitopes recognized by the two Fabs and to compare them with the previously described REGN mAbs, cryo-electron microscopy (cryo-EM) on the complex was conducted. Reconstruction of the Bet v1–Fab08–Fab10 complex was obtained at a resolution of 4.8 Å, allowing Ca\u0026nbsp;positioning (\u003cstrong\u003eFig. 1h\u003c/strong\u003e). Bet v1 adopted a structure consisting of a seven-stranded anti-parallel β-sheet wrapped around a 25-residue-long C-terminal amphipathic α-helix, as previously described\u003csup\u003e14\u003c/sup\u003e. Fab08 sandwiched the C-terminal α-helix, similarly as REGN5713, with interactions mediated almost exclusively by its heavy chain. Fab10 bound a distinct, localized epitope consisting of a loop formed by residues 60 to 65, included among the binding epitopes of REGN5715 (\u003cstrong\u003eFig. 1i\u003c/strong\u003e)\u003csup\u003e\u0026nbsp;13\u003c/sup\u003e. Overall, the characteristics of the novel anti-Bet v1 mAbs were promising for further evaluation as single-chain variable fragments (scFvs) in the design of CAlleRs. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eActivation and proliferation of CAlleR T cells by artificial antigen presenting cell (aAPC) expressing Bet v1\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe next generated scFvs derived from our four anti-Bet v1 mAbs and fused them to a CD28 hinge, transmembrane and co-stimulatory domains followed by a CD3z\u0026nbsp;intracellular signaling domain. Anti-CD19 CAR was used as control and mCherry as a reporter (\u003cstrong\u003eFig. 2a\u003c/strong\u003e). To evaluate the functional activity of the CAlleRs, we first engineered artificial K562 cells with a PDGF- truncated receptor covalently linked to the Bet v1 recombinant protein and a GFP molecule on the N and C terminus respectively (\u003cstrong\u003eFig. 2b\u003c/strong\u003e). To validate the specificity of the selected CAlleRs Jurkat NFAT reporter cell lines were transduced and co-cultured with K562 Bet v1 for 24h (\u003cstrong\u003eFig. 2c\u003c/strong\u003e and \u003cstrong\u003eSuppl. Fig. 3a\u003c/strong\u003e).\u0026nbsp;CAlleR 5 and 8 displayed the highest NFAT activity, followed by CAlleR 11 and CAlleR 10 similarly to their binding affinities (\u003cstrong\u003eFig. 2d\u003c/strong\u003e).\u003c/p\u003e\n\u003cp\u003ePrimary human CAlleR T cells were then generated to validate their functionality \u003cem\u003ein vitro\u003c/em\u003e (\u003cstrong\u003eFig. 2e\u003c/strong\u003e). Similar transduction efficiencies were obtained (prior calculation of MOI= 1) (\u003cstrong\u003eFig. 2f,g\u003c/strong\u003e). Again, CAlleR 5 and 8 showed stronger binding to biotinylated Bet v1 compared to CAlleR 11 and 10 (\u003cstrong\u003eFig. 2g\u003c/strong\u003e), correlating with CD25 and CD71 upregulation (\u003cstrong\u003eFig. 2h-j\u003c/strong\u003e).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHuman CAlleR 8 Tregs show the highest \u003cem\u003ein vitro\u003c/em\u003e suppressive capacity\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNext, the suppressive capacity of CAlleR Tregs was evaluated by applying a similar editing strategy to freshly isolated CD4\u003csup\u003e+\u003c/sup\u003eCD25\u003csup\u003e+\u003c/sup\u003eCD127\u003csup\u003elow\u003c/sup\u003e Tregs (\u003cstrong\u003eFig. 3a,b\u003c/strong\u003e). After 7 days of culture, the cells expanded 20-40-fold (\u003cstrong\u003eFig. 3c\u003c/strong\u003e) and maintained a stable Treg phenotype independently of CAlleR expression (\u003cstrong\u003eFig. 3d\u003c/strong\u003e). Similar transduction was observed among all CAlleRs (\u003cstrong\u003eFig. 3e\u003c/strong\u003e). We observed a Bet v1-induced upregulation of early activation markers (OX40 and 41BB) in CAlleR Tregs (\u003cstrong\u003eFig. 3f\u003c/strong\u003e). Interestingly, the higher activation rates observed with CAlleR 5 and 8 Tregs were consistent with those obtained with T cells (\u003cstrong\u003eFig. 3f and 2h,i\u003c/strong\u003e). To evaluate their suppressive function, CFSE-labeled CAlleR 8 or CAlleR 11 T cells were cocultured with K562 Bet v1 and different ratios of CAlleR or polyclonally expanded Tregs (\u003cstrong\u003eFig. 3g,h\u003c/strong\u003e). Overall, CAlleR Tregs exhibited greater suppressive capacity than polyclonal Tregs correlating with the \u003cem\u003ein vitro\u003c/em\u003e activation levels. CAlleR 8 Tregs exhibited the highest suppressive capacity for both CAlleR 8 and 11 T cells. We therefore selected this candidate for the \u003cem\u003ein vivo\u003c/em\u003e studies.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSoluble Bet v1 is presented to CAlleRs through allosteric antibodies\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSince CAR signaling for soluble ligands relies on ligand-mediated dimerization and eukaryotic cells do not constitutively express allergens\u003csup\u003e15\u003c/sup\u003e, we hypothesized that anti-Bet v1 antibodies can stabilize soluble antigens and contribute to CAlleR activation. Indeed, soluble Bet v1 alone was insufficient to activate CAlleR T cells (\u003cstrong\u003eFig. 4a\u003c/strong\u003e). Yet, in the presence of non-competitive mAbs we observed a modest upregulation of activation markers (\u003cstrong\u003eFig. 4a\u003c/strong\u003e) in line with the competition binding assays (\u003cstrong\u003eFig. 1g-i and Suppl. Fig. 2a\u003c/strong\u003e). To further assess this antibody-dependent activation, we examined the effect of low- medium- and high-affinity FcgR (CD16, CD32, CD64, respectively) by generating specific K562 cell lines (\u003cstrong\u003eSuppl. Fig. 4a,b\u003c/strong\u003e). The activation of CAlleR T cells was FcgR dependent and required allosteric stabilization of the Bet v1 (\u003cstrong\u003eFig. 4a\u003c/strong\u003e). Importantly, we observed an antibody dose-dependent activation of the CAlleR 8 in the presence of mAb 10 (\u003cstrong\u003eFig. 4b,c\u003c/strong\u003e). Similar results were obtained with CAlleR 8 Tregs (\u003cstrong\u003eFig. 4d\u003c/strong\u003e), correlating with their capacity to uptake preferentially CD32 and CD64 (\u003cstrong\u003eFig. 4e\u003c/strong\u003e). The suppressive capacity of CAlleR 8 Tregs was FcgR and antibody concentration dependent and better than polyclonal Tregs in all conditions (\u003cstrong\u003eFig. 4f,g\u003c/strong\u003e). Interestingly, the suppression was less efficient against CAlleR 8 T cells stimulated with mAb 10 bound to CD64 compared CD32, suggesting more resistance to Treg when T effector cells (Teff) are strongly activated (\u003cstrong\u003eSuppl. Fig. 4c\u003c/strong\u003e).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCAlleR effector T cells proliferated \u003cem\u003ein vivo\u003c/em\u003e in an antibody-dependent manner\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe \u003cem\u003ein vivo\u003c/em\u003e functionality of the CAlleR was first validated by engineering murine effector T cells and monitoring CFSE dilution. CAlleR 8 Teff were infused in birch pollen extract (BPE)-sensitized mice (\u003cstrong\u003eFig. 5a-d\u003c/strong\u003e). Their presence and proliferation were compared in the lung, mediastinal lymph node (mLN), cervical lymph node (cLN)) and the spleen of PBS and BPE-sensitized mice. CAlleR 8 and polyclonal Teff were detected in all organs (\u003cstrong\u003eFig. 5e and Suppl. Fig. 5a)\u003c/strong\u003e. Yet, CAlleR 8 Teff proliferated significantly more than their polyclonal counterpart in a birch dependent manner, predominantly in the lungs and draining mediastinal lymph nodes (\u003cstrong\u003eFig. 5f and Suppl. Fig. 5a\u003c/strong\u003e). To confirm CAlleR 8 Teff proliferation in response to birch specific immunoglobulins in a FcgR dependent manner, we purified bone marrow-derived dendritic cells (BMDCs) expressing high levels of FcgR\u003csup\u003e16\u003c/sup\u003e. We then investigated whether BPE-exposed mice produced specific immunoglobulins capable of mediating CAlleR 8 T cell activation via the FcgR on BMDCs (\u003cstrong\u003eFig. 5g\u003c/strong\u003e). After the sensitization protocol, high levels of anti-Bet v 1 IgG1 were detected in allergic mice serum (\u003cstrong\u003eFig. 5h\u003c/strong\u003e), which induced CAlleR 8 T cell activation when BMDCs and the allergen were present (\u003cstrong\u003eFig.5i,j\u003c/strong\u003e). These findings demonstrate that CAlleR 8 Teff proliferate in allergen-exposed organs in a birch-specific antibody-dependent manner.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCAlleR 8 Tregs suppress allergic airway inflammation in mice\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eConsidering the risks associated with CAR T cell therapies, we generated CAlleR murine Tregs expressing either the CAlleR 8 or a control anti-HLA-A2 CAR\u003csup\u003e17\u003c/sup\u003e with Thy1.1 as reporter (\u003cstrong\u003eFig. 6a\u003c/strong\u003e). After 7 days of culture, phenotype and transduction efficiency were evaluated (\u003cstrong\u003eFig. 6b\u003c/strong\u003e) prior to injection to BPE-exposed mice (\u003cstrong\u003eFig. 6c\u003c/strong\u003e). Treg-treated mice had lower cell influx in the bronchoalveolar lavage fluid (BALF) than allergic mice indistinctively of their specificity (\u003cstrong\u003eFig. 6d\u003c/strong\u003e). Importantly, CAlleR 8 Tregs significantly reduced the eosinophils percentage in the BALF (\u003cstrong\u003eFig. 6e\u003c/strong\u003e). Additionally, Treg infusion correlated with increased IL-10 levels in the BALF (\u003cstrong\u003eFig. 6f\u003c/strong\u003e). In the lungs of Treg-treated mice, lower levels of eosinophils (CD45\u003csup\u003e+\u003c/sup\u003eCD11c\u003csup\u003e-\u003c/sup\u003eCD11b\u003csup\u003e+\u003c/sup\u003eLy6G\u003csup\u003e-\u003c/sup\u003eLy6C\u003csup\u003e-\u003c/sup\u003eSiglecF\u003csup\u003e+\u003c/sup\u003e) were detected (\u003cstrong\u003eFig. 6g and Suppl. Fig. 6a\u003c/strong\u003e). Notably, expression of SiglecF, a marker for eosinophilic activation, was also decreased on these cells (\u003cstrong\u003eFig. 6h and Suppl. Fig. 6a\u003c/strong\u003e). These findings coincided with reduced birch specific IgG and total IgE levels in the serum of these mice (\u003cstrong\u003eSuppl. Fig. 6b,c\u003c/strong\u003e). However, dendritic cell (CD11c\u003csup\u003e+\u003c/sup\u003eCD11b\u003csup\u003e+\u003c/sup\u003eF4/80\u003csup\u003e-\u003c/sup\u003eMHC-II\u003csup\u003e+\u003c/sup\u003e) infiltration in the lungs was not reduced (\u003cstrong\u003eSuppl. Fig. 6d\u003c/strong\u003e). Although no overall differences were observed in the proportions of T cell populations in the lungs and mLNs (\u003cstrong\u003eSuppl. Fig. 6e,f\u003c/strong\u003e), Treg-treated mice exhibited reduced CD4\u003csup\u003e+\u003c/sup\u003e T cell activation, as indicated by reduced CD44 expression (\u003cstrong\u003eSuppl. Fig.6e\u003c/strong\u003e), along with diminished production of IL-4, IL-13, and IL-17 (\u003cstrong\u003eFig. 6i and Suppl. Fig.6g\u003c/strong\u003e). Lung mucus production was quantified using Periodic Acid Schiff (PAS) staining. Mice treated with CAlleR 8 Tregs showed fewer PAS+ airways than the other groups (\u003cstrong\u003eFig. 6j,k\u003c/strong\u003e). This finding was supported by improved lung function with CAlleR 8 Treg-treated mice showing reduced airway hyper-reactivity, as measured by lung stiffness (H) and tissue resistance (G) after methacholine challenge (\u003cstrong\u003eFig. 6l\u003c/strong\u003e). Overall, these data demonstrate the protective nature of Treg in a preclinical mouse model of allergic airway inflammation that can be further enhanced with CAlleRs.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCAlleR 8 Tregs prevent allergic airway inflammation\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe next evaluated whether Tregs can prevent allergic disease development. To this end, engineered Tregs were adoptively transferred to mice prior to their first exposure to BPE (\u003cstrong\u003eFig. 7a\u003c/strong\u003e). In this context, only the CAlleR 8 Tregs reduced the cellular influx in the BALF, with a lower proportion of eosinophils and lymphocytes (\u003cstrong\u003eFig. 7b,c\u003c/strong\u003e). Increased IL-10 was also detected in the BALF of CAlleR 8 Tregs-treated mice (\u003cstrong\u003eFig. 7d\u003c/strong\u003e). In the lung, no significant differences were observed in the proportion of neutrophils (CD45\u003csup\u003e+\u003c/sup\u003eCD11c\u003csup\u003e-\u003c/sup\u003eCD11b\u003csup\u003e+\u003c/sup\u003eLy6G\u003csup\u003e+\u003c/sup\u003e), monocytes (CD45\u003csup\u003e+\u003c/sup\u003eCD11c\u003csup\u003e-\u003c/sup\u003eCD11b\u003csup\u003e+\u003c/sup\u003eLy6G\u003csup\u003e-\u003c/sup\u003eLy6C\u003csup\u003e+\u003c/sup\u003e), and eosinophils (CD45\u003csup\u003e+\u003c/sup\u003eCD11c\u003csup\u003e-\u003c/sup\u003eCD11b\u003csup\u003e+\u003c/sup\u003eLy6G\u003csup\u003e-\u003c/sup\u003eLy6C\u003csup\u003e-\u003c/sup\u003eSiglecF\u003csup\u003e+\u003c/sup\u003e) (\u003cstrong\u003eFig. 7e and Suppl. Fig.7a\u003c/strong\u003e). Yet, SiglecF high eosinophils were significantly less prevalent in mice treated with CAlleR 8 (\u003cstrong\u003eFig. 7f and Suppl. Fig. 7a\u003c/strong\u003e). Although in this model the anti-Betv1 IgG1 production remained unaffected by Treg transfer (\u003cstrong\u003eSuppl. Fig. 7b\u003c/strong\u003e), CAlleR 8 Tregs reduced total IgE levels (\u003cstrong\u003eSuppl. Fig. 7c\u003c/strong\u003e). CAlleR 8 Tregs did not significantly affect the dendritic cell (CD11c\u003csup\u003e+\u003c/sup\u003eCD11b\u003csup\u003e+\u003c/sup\u003eF4/80\u003csup\u003e-\u003c/sup\u003eMHC-II\u003csup\u003e+\u003c/sup\u003e) infiltration in the lungs (\u003cstrong\u003eSupl. Fig. 7d\u003c/strong\u003e). Similarly, Treg prophylactic treatment had no effect in the T cell compartment, neither on the proportions of the different populations nor on their activation status in the lungs and the mLNs (\u003cstrong\u003eSupl. Fig. 7e,f\u003c/strong\u003e). However, significantly less IL-4 production by CD4\u003csup\u003e+\u003c/sup\u003e T cells was observed \u003cstrong\u003e(Fig. 7g and Suppl. Fig. 7g)\u003c/strong\u003e Importantly, mice treated with CAlleR 8 Tregs exhibited reduced mucus production (\u003cstrong\u003eFig. 7h,i\u003c/strong\u003e), a finding associated with significantly improved lung function with reduced airway hyper-reactivity, as measured by reduced airway (Rn) and tissue (G) resistance as well as lung stiffness (H) after methacholine challenge (\u003cstrong\u003eFig. 7j\u003c/strong\u003e). These data demonstrate that CAlleR 8 Tregs can prevent the inflammatory response of birch pollen-induced allergic asthma.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCAlleR 8 Tregs migrate to BPE-exposed lungs and mediastinal lymph nodes to preferentially interact with CD11c\u003csup\u003e+\u003c/sup\u003e antigen presenting cells\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo further investigate the mechanism of CAlleR Treg \u003cem\u003ein vivo\u003c/em\u003e, we engineered the cells with a GFP reporter (\u003cstrong\u003eFig. 8a\u003c/strong\u003e). After \u003cem\u003ein vitro\u003c/em\u003e expansion, transduction and phenotype of the engineered Tregs were confirmed (\u003cstrong\u003eFig. 8b)\u0026nbsp;\u003c/strong\u003eand cells were adoptively transferred to mice, which were then exposed to BPE for four consecutive days (\u003cstrong\u003eFig. 8c).\u003c/strong\u003e In mice exposed to BPE, the number of CAlleR 8 Tregs was significantly higher in the lungs and draining lymph nodes (mLN) compared to PBS control mice (\u003cstrong\u003eFig. 8d,e\u003c/strong\u003e). Importantly, CAlleR 8 Tregs made significantly more contacts with CD11c\u003csup\u003e+\u003c/sup\u003e APCs present in the mLN than unspecific A2-CAR Tregs (\u003cstrong\u003eFig. 8f\u003c/strong\u003e). This difference was not observed in the lung and spleen of the mice (\u003cstrong\u003eFig. 8f\u003c/strong\u003e). Thus, the CAlleR enabled specific migration and interactions of the Tregs with CD11c\u003csup\u003e+\u003c/sup\u003e APCs present in the mLN.\u0026nbsp;\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eHerein, we provide proof-of-concept and preclinical evidence that CAlleR Treg redirected against Bet v1 can downmodulate birch pollen-induced allergic airway inflammation. While polyclonal, allergen-unspecific Tregs demonstrated partial protective effects under inflammatory conditions, they were insufficient to prevent disease onset in the absence of inflammation. Importantly, we identified a key mechanism underlying the activation of CAR T cells targeting soluble antigens: engagement is dependent on allosteric antibodies stabilized via high-affinity FcγRs. These findings not only elucidate a novel principle of CAR activation by soluble proteins but also open new avenues for redirecting Treg specificity towards allergens for therapeutic intervention.\u003c/p\u003e\n\u003cp\u003eSeveral attempts have been made to develop CAR T therapies targeting soluble factors, such as citrullinated vimentin, mesothelin, anti-factor VIII or insulin with limited success\u003csup\u003e18, 19, 20, 21\u003c/sup\u003e. Importantly, soluble antigen can trigger CAR activation by (1) forming a dimer or (2) simultaneously binding two different CARs recognizing distinct epitopes. Herein we discovered a third mechanism of CAR activation by soluble antigens mediated by allosteric, allergen-specific antibodies, which are stabilized in a Fc receptor affinity-dependent manner. Importantly, signal transduction requires an actin-dependent, dynamic process of CAR clustering that monomeric soluble antigens alone cannot trigger\u003csup\u003e15, 22\u003c/sup\u003e. Thus, the large pre-existing repertoire of allergen-specific antibodies in patients with severe asthma could contribute to enhance the suppressive function of CAlleR Tregs. The findings of our study could be leveraged to autoimmune diseases such as rheumatoid arthritis, for which an anti-citrullinated peptide CAR Treg therapy is currently under evaluation (NCT06201416).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eOur data indicated a preferential migration of CAlleR Tregs to the mediastinal lymph nodes and the lungs, reinforcing initial observations that redirecting the specificity of Tregs is sufficient to retain them in various tissues, such as the gut \u003csup\u003e23\u003c/sup\u003e or an HLA-A2 islet graft\u003csup\u003e24\u003c/sup\u003e. Yet, in inflammatory conditions, i.e., during the second round of allergen sensitization, we also observed a functional activity of the non-specific CAR-edited Treg cells. \u0026nbsp;While the HLA-A2 CAR remains inactive in HLA-A2–negative control mice, thus effectively ruling out off-target activity\u003csup\u003e17\u003c/sup\u003e, its enhanced recruitment in the lung may be associated with the pulmonary passage following cell infusion\u003csup\u003e25\u003c/sup\u003e, which, in combination with pro-inflammatory chemokines, promote homing and persistence of the cells in the lungs. Imprinting of Tregs by lung dendritic cells could favor CCR4 upregulation and thereby a more efficient trafficking to the lungs\u003csup\u003e26\u003c/sup\u003e. Luster \u003cem\u003eet al\u003c/em\u003e. demonstrated that CCR7 on Treg is required to suppress allergic airway inflammation during the sensitization phase, whereas CCR4 is essential for suppressing inflammation during the effector phase\u003csup\u003e27\u003c/sup\u003e. \u0026nbsp;Future studies should better characterize the interplay between the CAlleR and the chemokine receptors in the trafficking dynamics between the mediastinal lymph node and the lung. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003eOur data builds on previous evidence suggesting that the transfer of Tregs can modulate allergic airway inflammation \u003cem\u003ein vivo\u003c/em\u003e\u003csup\u003e28, 29\u003c/sup\u003e. The main advantage of Tregs over other cell-therapy modalities, such as CAR T cells redirected against IL-5 and secreting IL-4/13 muteins\u003csup\u003e30\u003c/sup\u003e is their safety profile, as they lack proliferative capacities and produce considerably less pro-inflammatory cytokines\u003csup\u003e31\u003c/sup\u003e. Our findings show that CAlleR Tregs reduced levels of IL-4 in CD4\u003csup\u003e+\u003c/sup\u003e T cells, which could explain the decrease of eosinophils in the BALF as IL-4 mediates eosinophils’ transendothelial migration\u003csup\u003e32\u003c/sup\u003e. Beyond their immunoregulatory functions, Tregs also contribute directly to tissue repair and homeostasis through amphiregulin-dependent mechanisms, an additional remarkable advantage over more conventional T cell therapies\u003csup\u003e33\u003c/sup\u003e. Yet, bona fide self-antigen-specific Treg cells can lose Foxp3 expression during an inflammatory autoimmune response\u003csup\u003e34\u003c/sup\u003e or upon repetitive stimulation\u003csup\u003e35\u003c/sup\u003e. Thus, future studies should evaluate the persistence and stability of the CAlleR Tregs over time and define the optimal modalities for implementing such approach, e.g., outside the pollen season or as an adjunct to a desensitization protocol to reduce local inflammation.\u003c/p\u003e\n\u003cp\u003eThe present study has several limitations. First, we focused on birch pollen-related airway allergic inflammation. However, patients with severe allergic asthma often suffer from multiple sensitizations against PR-10 unrelated proteins, such as profilins or polcalcins\u003csup\u003e36, 37\u003c/sup\u003e. Therefore, future studies should evaluate the potential bystander suppression of birch pollen-specific CAlleR Tregs and their capacity to suppress PR-10-unrelated memory T cells. Moreover, redirecting Treg specificity towards perennial allergens such as house dust mite may be also relevant considering the challenges associated with allergen avoidance. Accordingly, future studies should investigate the suppressive capacity of CAlleR Tregs in polysensitized mouse models. In parallel, it will be critical to assess the phenotypic stability and functional activities of CAlleR Tregs under repeated allergen stimulation as we have not investigated their persistence beyond five days after injection. Finally, we did not assess the suppressive capacity of Tregs on allergen-specific B cells, which may also contribute to allergen mobilization through their BCRs.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn conclusion, we demonstrate that CAlleR Tregs can effectively prevent and downmodulate birch pollen-induced allergic airway inflammation. Our data provide compelling evidence for the role of allosteric antibodies in enhancing the action and homing of Tregs, contributing to the restoration of immune tolerance to soluble allergens. Future work should evaluate if such approach could also be suitable to restore tolerance against food allergies. \u0026nbsp;\u003c/p\u003e"},{"header":"Methods","content":"\u003cp\u003e\u003cstrong\u003eHuman blood products\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eDeidentified human peripheral blood from healthy donors was ordered at the Swiss Transfusion Center as buffy coats. For B cell sorting, peripheral blood mononuclear cells were isolated from a birch allergic female donor enrolled in the Immuno-IgE study, which was approved by the Institutional Review Board of the Lausanne university hospital (CER-VD 2020-02798 Switzerland). Written and informed consent was obtained prior to sample collection. Ficoll-Paque (Cytiva, USA; Cat. #17144003) density gradient centrifugation was used to isolate peripheral blood mononuclear cells (PBMCs).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eB cell sorting, immortalization, and cloning\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eB cells were isolated from PBMCs with EasySep\u0026trade; Human B Cell Isolation Kit according to manufacturer\u0026rsquo;s instructions (Stemcell Technologies, Canada, Cat#\u0026nbsp;17954) and labeled with LIVE/DEAD\u0026trade; Fixable Aqua Dead Cell Stain Kit (Invitrogen, Waltham, MA, USA, Cat# L34957), mouse anti-human\u0026nbsp;CD19 APC (BD Biosciences, Franklin Lakes, NJ, USA, Cat#555415; Clone SJ25C1), mouse anti-human IgM-PECy7 (Biolegend; Cat#314532; clone MHM-88), mouse anti-human\u0026nbsp;IgG\u0026nbsp;AF488 (Biolegend; San Diego, CA, USA, Cat#410706; Clone M1310G05), mouse anti-human IgE PE (Biolegend; San Diego, CA, USA, Cat#325506; clone MHE-18) mouse anti-human CD27 (BD Biosciences, Franklin Lakes, NJ, USA, Cat#646851; Clone HB7). Viable CD19\u003csup\u003e+\u003c/sup\u003eCD27\u003csup\u003e+\u003c/sup\u003eIgM\u003csup\u003e-\u003c/sup\u003eIgG\u003csup\u003e+\u003c/sup\u003eIgE\u003csup\u003e-\u003c/sup\u003e B cells were sorted with BD FACS Aria II cell sorter (BD Biosciences, Franklin Lakes, NJ, USA). B cell immortalization was performed as previously described\u003csup\u003e38\u003c/sup\u003e. Briefly,\u0026nbsp;B cells were incubated for 3 hours at 37\u0026deg;C in complete DMEM medium (ThermoFisher Scientific, Waltham, MA, USA, Cat#\u0026nbsp;A4192102) supplemented with 10%FCS, 1% Pen-Strep, 1% MEM Non-essential amino acids (ThermoFisher Scientific, Waltham, MA, USA, Cat#\u0026nbsp;11140050), 1%L-Glutamine, 1%Na-Pyruvate, 30mg/ml Transferrin (HOLO) (Biovision, Z\u0026uuml;rich, Switzerland, Cat# 7542-100), 1% kanamycin, 55mM 2-mercaptoethanol (Gibco, Grand Island, NY, USA, Cat.#21985-023), 2mg/ml CL264 TLR-7 agonist (Invivogen, San Diego, CA, USA, Cat #tlrl-c264e-5) and 40%\u0026nbsp;Ebstein Barr virus obtained from Human gammaherpesvirus 4 (HHV-4) cell\u0026rsquo;s supernatant (ATCC, Manassas, VA, USA, Cat #VR-1492). B cells were plated at 3 cells per well with 26 000 autologous irradiated PBMCs in 384-well plate. Screening for each well was performed with an indirect Bet v1 ELISA detecting anti-Betv1 antibodies in the supernatant. Among 5760 clones, we could identify 15 binders which were further selected for RT-PCR as previously described\u003csup\u003e39\u003c/sup\u003e. Among those 15 clones, 6 paired heavy and light chain productive sequences were obtained with Sanger sequencing (Fasteris, Geneva, Switzerland). PCR amplification with custom primers (Microsynth AG, Balgach, Switzerland) was performed to extract the variable chain sequences of the antibodies and subcloning into AbVec2.0-IGHG1, AbVec1.1-IGKC or AbVec1.1-IGLC2-XhoI vectors (Addgene plasmids, #80795, #80796 and #99575, respectively). Resulting plasmids were used for transient transfection of ExpiCHO cells with 1.5\u0026nbsp;mg/ml of each plasmid. After seven days of cell culture, supernatants were collected and antibodies were purified using Sartobind Lab protein A columns according to manufacturer\u0026rsquo;s instructions (Sartorius AG, G\u0026ouml;ttingen, Germany, Cat #93PRAP06HB-12--A).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eRecombinant Bet v1 production\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBet v1 DNA sequence was codon optimized for E. coli, synthesized by Genscript and cloned into a bacterial expression vector, pET29b, with a 10xHistag at the C-terminus and a Avitag. Recombinant Bet v1 (rBet v1) was expressed in E.coli BL21(DE3) cells by growing cells at 37 \u0026deg;C until an O.D. of 0.6, followed by induction with 0.5 mM Isopropyl \u0026beta;-D-1-thiogalactopyranoside overnight at 18 \u0026deg;C. Bacterial pellet was harvested for 15 minutes at 5000g, was lysed using sonication in buffer A (20 mM HEPES 7.5, 700 mM NaCl, 10% glycerol). Clarification of the cell\u0026rsquo;s lysate was performed by centrifugation for 30 minutes at 30 000 g. The protein was purified by nickel affinity, with a HisTrap HP 5 mL column, washed with buffer A and then eluted on a linear gradient of buffer B (buffer A + 500 mM imidazole, pH 7.5). Eluted fractions of rBet v1 was concentrated and injected onto a Superdex 75 16/600 gel filtration column (GE Healthcare/Cytiva) in 20 mM HEPES 7.5, 250 mM NaCl. After size exclusion, PBS buffer exchange was performed by dialysis and rBet v1 was diluted at 1mg/ml and stored at -20\u0026ordm;C.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eELISA\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAntibody binding towards Bet v1 was assessed by indirect ELISA. NuncSorp plates were coated with 2mg/ml of rBet v1 diluted in coating buffer (15mM Na\u003csub\u003e2\u003c/sub\u003eCO\u003csub\u003e3\u003c/sub\u003e, 34.87mM NaHCO\u003csub\u003e3\u003c/sub\u003e) overnight at 4\u0026ordm;C, washed with PBS-Tween 0.05% and blocked with PBS-BSA 1% for 2h at RT. Serial dilutions of the 6 novel mAbs were performed starting at 1\u0026nbsp;mg/ml and incubated for 2h. Serum samples from mice were diluted at 1:100 prior to incubation. Plates were then washed and 1\u0026nbsp;mg/ml of biotin mouse anti-human IgG antibody (BD Pharmigen, USA, Cat #555785; Clone G18-14) or 2mg/ml Goat anti-Mouse IgG1 Cross-Adsorbed Secondary Antibody, Biotin-XX (Life Technologies, Carlsbad, CA, USA, Cat #A10519) was used respectively for detection and incubated 1 hour at RT. \u0026nbsp; Streptavidin horseradish peroxidase conjugate (BD Pharmigen, USA; Cat #554066; 1:1000 dilution) was added and incubated for 1h at RT. Tetramethylbenzidine substrate (BD Biosciences, San Diego, CA, USA, Cat #555214) was added for 20 minutes and the reaction was stopped with 2N sulfuric acid. Absorbance was measured on a spectrophotometer at 450nm (630nm reference). Binding of human IgG mAbs to other proteins, kindly provided by Dr. R\u0026eacute;gine Audran and Dr. Craig Fenwick, (rag weed, grass, Derp2, bee venom) was assessed using the same protocol but using a 10\u0026nbsp;mg/ml concentration for each extract. For total quantification of murine IgE, purifed goat anti-mouse IgE antibody (SouthernBiotech, Birmingham, AL, USA, Cat #1110-1) was coated at 2mg/ml in PBS and incubated overnight at 4\u0026ordm;C. After wash and blocking, 1:50 dilution of serum samples and 2-fold serial dilutions of purified mouse IgE for standard curve starting at 2\u0026nbsp;mg/ml (BD Pharmigen, Franklin Lakes, NJ, USA, Cat #553481) were added to the wells. After 2h of incubation, well were washed and detection goat anti-mouse IgE-AP antibody was added at 2\u0026nbsp;mg/ml (SouthernBiotech, Birmingham, AL, USA, Cat #1110-04) and incubated for 2h. Finally, wells were washed and 4-Nitrophenyl phosphate disodium salt hexahydrate (Sigma Aldrich, St. Louis, MO, USA, Cat #N2765-100TAB) was diluted in diethanolamine buffer (1M, pH 9.8, Sigma Aldrich, Cat #31590-250G), added to the wells and incubated for at least 5 minutes prior to absorbance measurement at 450 nm. IL-10 ELISA was performed according to manufacturer\u0026rsquo;s instructions (ELISA MAX\u0026trade; Standard Set Mouse IL-10, Biolegend, San Diego, CA, USA, Cat. #\u0026nbsp;431411).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAffinity and blocking capacity of anti-Bet v1 antibodies\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAffinity towards Bet v1 for each antibody was assessed with\u0026nbsp;Gator\u0026reg; Prime Core Biolayer Interferometry System (BLI) by using a protein A coated probe (Gator, Palo Alto, CA, USA, Cat #160001). After binding of the antibodies to the biosensors, tips were dipped into 500 nM or 300 nM of Bet v1 protein. The strength of association and dissociation of the Bet v1 to the antibodies were measured.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eBlocking capacity of the anti-Bet v1 antibodies was assessed as previously described\u003csup\u003e13\u003c/sup\u003e by coating NuncSorp plates with 2 mg/ml of anti-human IgE monoclonal antibody (NBS-C BioScience, Vienna, Austria; clone Le27; Cat #0908-1-010) in coating buffer and incubated overnight at 4\u0026ordm;C. Washing with PBS 0.05%Tween and blocking with PBS 1%BSA for 2h at RT was performed before adding the serum of birch allergic patients diluted in dilution buffer so that the concentration added to the wells was 4 ng/ml of anti-Bet v1 IgE. Biotinlylated rBet v1 at 1nM was premixed for 2h at RT with 3-fold serial dilutions of the four anti-Bet v1 antibodies starting at 1 mM and then added to the IgE coated plate for 2h at RT. Plates were subsequently washed and streptavidin horseradish peroxidase conjugate (BD Pharmigen, USA; Cat #554066; 1:1000 dilution) was added and incubated 1h at RT. Tetramethylbenzidine substrate (BD Biosciences, San Diego, CA, USA; Cat #555214) was added for 20 minutes and the reaction was stopped with 2N sulfuric acid. Absorbance was measured on a spectrophotometer at 450nm (630 nm reference). Calculation of the percentage of blocking was performed as follows:\u003c/p\u003e\n\u003cp\u003e\u003cimg src=\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAApoAAABOCAYAAACAPLbvAAAAAXNSR0IArs4c6QAAIABJREFUeF7t3QW0JEfZxvEO7m5BE5zgDsGd4O7uENxdg7u7uwV3d4JbEtwhECS4Q77zq++8e3r7jPTcO3Nv9t6nztmzuzM93VVP2b/e963q3Q4//PDDu6QoEAWiQBSIAlEgCkSBKLBkBXYLaC5Z0dwuCkSBKBAFokAUiAJRoCkQ0ExDiAJRIApEgSgQBaJAFFiJAgHNlciam0aBKBAFokAUiAJRIAoENNMGokAUiAJRIApEgSgQBVaiQEBzJbLmplEgCkSBKBAFokAUiAIBzbSBKBAFokAUiAJRIApEgZUoENBciay5aRSIAlEgCkSBKBAFokBAM20gCkSBKBAFokAUiAJRYCUKBDRXImtuGgWiQBSIAlEgCkSBKBDQTBuIAlEgCkSBKBAFokAUWIkCAc2VyJqbRoEoEAWiQBSIAlEgCgQ00waiQBSIAlEgCkSBKBAFVqJAQHMlsuamUSAKRIEoEAWiQBSIAgHNtIEoEAWiQBSIAlEgCkSBlSgQ0FyJrLlpFIgCUSAKRIEoEAWiQEAzbSAKRIEoEAWiQBSIAlFgJQoENFcia24aBaJAFIgCUSAKRIEoENBMG4gCUSAKRIEoEAWiQBRYiQIBzZXImptGgSgQBaJAFIgCUSAKBDTTBqJAFIgCUSAKRIEoEAVWokBAcyWy5qZbQYE///nP3de//vXuNKc5TXe6051uR5EOOeSQ7t73vnf39re/vXvPe97TXfayl93Q4srXE5/4xO5Zz3pWd7/73a972MMetqHP3+iH/e9//+t+8pOfdP/85z+7M53pTN2Rj3zkiVk48MADu9ve9rbd97///e41r3lNd+UrX3mjs7rm56nT7373u93f/va3ne5x9KMfvTvpSU/anfKUp+z8ezPS4Ycf3h166KHdv/71r+5UpzpVd6QjHWlUNn7/+9933/ve97o99tijO/nJT77jN3/961+7q13tat1nPvOZ7gtf+EJ3nvOcZ9T9lnmRMv3whz/sfv3rX3d77733Trd+//vf393pTnfq9tprr+4lL3lJ034jk3Zwk5vcpPvjH//Y7b///t05z3nOjXz8pjzrc5/7XHf6059+p3bSz4i+/9KXvrR7+MMf3p33vOftPvShDy01nz/72c+6H//4xzvdUzs/3vGO1+r/xCc+8VKft+jNjH9HPepRR7dF7fuXv/xlGzcvcIELdEc72tF2PPJFL3pR98hHPrJ9TlPjy6pTQHPVCuf+u6wCQPL6179+d6Mb3ah79atfvVM5TJK3utWtuhe+8IUbDpoy8tOf/rTla5999tnyoPn3v/+9e8QjHtH9/Oc/7wySxznOcRp0vvOd72yD5KUvfekddfORj3yku+ENb7hhoPmJT3yi++Y3v9nd9a53XVc7V7YHPOAB3Zvf/ObuZje7WZtQQKfJwp/b3OY23Y1vfONRsOl3r3vd65ouZzzjGdeVLz/+/Oc/3z3jGc9okP+gBz2oO9axjjXqniDtvve9b9Nmv/322+k3n/rUp1p53v3ud28KaIK4u93tbt2b3vSmtjA59alPvSN/FjYWcvK4GaApI+973/u6u9/97tsGNE9wghN0T3va01o7lyxstA2LxQL9f/zjH901r3nNTv0sGzTpfY973KM7xjGO0V3lKldpiykLJdDv+Y9//OObwWFMMgZZxNz+9rcfc/nMayzKPvCBD7Rx76pXvWprs2MSrR796Ed3T33qU7vPfvaz3fnPf/6dfnbPe96z5TGgOUbNXBMFVqQAkLnlLW/ZsV4edthh3Xvf+96dJqMDDjigff+85z1vU0DzF7/4RQOqK13pSlseNP/73/92P/jBDzqD59nPfvZm0fzNb37T3fzmN2+r8j7EsJCZKDbKosnyxQI2tIaspVm+9a1vbZOT+13oQhdqFkQWN8Boknv5y1/e7bnnnnNv7TcXvvCFu+c+97ltclpr+tOf/tS9+MUv7r785S+3iZ3etB4DmvoMS/sHP/jBTv1961vf6o55zGPuyIrJj9XOYm4zLJpf/epXu4c85CHdpz/96e5xj3vcTgsFIAN6PvrRj24aaHr2He94x20Dmsp7lrOcpVnMpS996UvdTW9609aPL3jBC+5oNyzhxuZlg6aFh0WRPgfqWAB5GZ7//Oc3K+pjH/vY9v2YdItb3KL72te+1n3jG98Yc/nUa1gjzS/GPmMC2B0Lmhand7jDHbovfvGL3V3ucpe2UO+n+9///t23v/3tgOa6aig/jgLrVMBAwb2gY7MwsVxe4xrX2HHXgOY6BV7nz1mUWT9YnDcLNMFuTYLLAE2TCZgTjgE0KwFNVspXvvKV3dnOdra5yoFDkyNr3HpAk3X1P//5TwN3kxX391jQNMHJ7+67794mSFaZi13sYkcI0ASSL3jBC7pf/epXzWoGhIXIVApozm1iK79Am9GO3/jGN24IaLIcstYDTqBZYSpve9vbGvCaB1i55yWWWCEXrKDrAU0w/YY3vKE72clO1gwZXPeLgOa73vWu7i1veUuDZW0brAY059Vevo8CG6iAicZK9t///ndzX4kdApuPetSjdsQHFmganExUrFHi0S5/+cu3AeH4xz9+x+XLNQEcDEBgwecGTzGfv/3tb9v3XC3cNOJquBNZtVzHirrvvvu2z62ouWhZqc585jM3tzGLJiC5+MUv3p5vcmfxMyC6xmAln6xKBx10ULMqsQZaJV/mMpdpAxC3pu+scI9ylKM01y2L2EMf+tAGPVb29PDbV73qVd0nP/nJZln0mWuA3h/+8Ifu9a9/fXuOchqk5fva1752iyuqxDoMDgs6TCRnPetZu+985zstZo9l6XrXu14DgOte97qtvPe6173aNQ9+8IObJiwf6oXVAGxyuXF7GpCt2uWLu03e6E0n1rWnPOUpDbqU0TXKzlriHu7n9yaTK17xip1J5853vnPTQrnkSflZmMSS0ZTl5clPfnJbgLjfuc997lZMZbjc5S63U2s1eb3sZS/rTFrufb7zna/F1j796U9v5VF+aQiarCssEyYaWnKFHfvYx+5YGuXL9TTl5mNZFUqhHdAB+LJ+0udEJzpRc8VWUl/KyWoEYgGp+2oD7qttvOIVr2iQKGnHrCPCFMaApv7gnnTXPlgs3bsfS1wWzWc+85ktjkxb9/d1rnOdBsmrjEelq3al/6hPC0pWW4AgFWiCUG1C6AALGo20Q+1In9SGnvOc57T6+8tf/tLGgdvd7nZtzADofieEQXuRTnva0zarGOAWKnGf+9ynWXTdY7fddmtjjgWu+2gX4o2f8IQntPt7vraj3XN7SvqpNnXwwQd3LLS8HNo+TbVpbU7Z9Bvt9LWvfW1zo57whCdsbf8MZzhDu4+8ghJ51X+1nUtd6lKtroVL0Ei70B+1PTGj2tjQuq6/0FU+xLBz20o0FGKivQIwIEcHfehJT3pSa2tiUYWOKK9xQT/StoV+0N0Cy3XGCXnwe3n+2Mc+1tqrMivXpCQ/xsSvfOUrbTzS5ukor6yoyqlN9EHTuOc57suTQOeyvPOa0ApI6tvGXHq4t+fIv3GmYmtZx/uLrGc/+9mtHfEMKLMxuBbO6lg7MP71k3ChRUDTeKAtmFe0R+O2caeS/qj/W0B++MMfbm1VO9Fe1P3YOOyx03JiNMcqleu2jQIAUIcz6ZnkQQf4MQCc4hSnaDoUaApM54IzYJksTawGSQOhzm1CN0Cyhhqw3dOgCwRNqCYUAGdAFS8GMkFSTcoGXpBkcuEmB5oG/AJNkyIAueQlL9niiVwjzwZzA6yNDu4pj2JyDMoGHLAnyQuLlXhTeWa1cq2JCwSbjExot771rRtMGRgBBGAEVP5vIFU24KUcNikZnFm0CsCq8biXzwC1cgFfg7bBUD7pbpBXTgM6zU3C8kQrf6zuTfLybNIfWjRNJL4z2YEsz3IPE6+JTv1aOJgIHvjABzZoUGc0MVkCDnWpjCAAaEoGelqr17JkWoSog1kWTWCvDZhgPNPfBnbAZ8KjrVSgKb9c5SYxrl350SYqVo2+IEjcJAh3b9or30UvetHWNkDxNIum8loUABk6i3uTWEFo6ff9zTuLgibAB1EmSwsv9XHc4x63wY3JTCrQFGOsDkAtENIGTdT6yaqShRXQ1+/ArTADQGHSlQo0aeM6bcniyr/Bysc//vEGFdo+S5FyacfarnamP4A/7Vm/BxK/+93vGlzou6ARtIMk96bRDW5wg9Y/AQvY084tLtQjfUCJhYn2aGGq3kGNPmYhSz/9SRvVd40vYNO9bZLTl40L8qv/y0v1G/Wtvtzf+AHgfE8fbU4/15dANPgDMMY1ICmmsZLnyb98WZiBQ23cmKMt68vuL13hCldobV/4hAUxmCzQ9L02oCyTLJrKp73r+/qsBbG8V/312w1ws6AAfurT39qWNqlvMR4AK20WaGqX2q16pJU60Sa1U0k/9299x7zAq6GOhfC4v/CQk5zkJHMtmhZuDBPqxRhioWKMU4/qor9A99xFQFOb1qeNJ8bqS1ziEg32++5zoAmezTMWqIDUc7U9Y6AF6jJTQHOZauZeW0IBEGMyNwixlnFh6JgG4HJpFmiyNNbq04BpwAFCJiMTihW4QRoo+tzkYmKzmYdLxkRjZS35vUHdoGeVCZLAhIEbRBjg7I780Y9+1ADQAOp5rqlksDVJebYVvg0NAsFZ7GqANziynEiAx2SkHILhJZOX/9sAJa8mIuUHj0CGBcREapIBliwbBl0TsZWwwdk9TXyTgMHkKQ9g2KBMAwO0gZdFzmRgImEpAHkmeYOkSWUMaJrMTFQFiJ5DP/k3+YEsFleDPECXgDLgA7w0dI3/A5C6j4nVwAzOFwHNqiuQqmylj8UJGKy4tAJNEx5LEouKdmTCM/HTVGIZM0m7H72Bs3rxO3A8DzTdw8IJONgRDl7U6WMe85jWZspiVm1qUdDUfyyiaK7Nm4A9AxBrT1KBJpipOjDJAQAgBN5WlUyoFozaq7YF/rULVjvAU6AJvPUBeksmYO2GdVjd6ddgRfviVdA3gY3vlN0YYvHo/5L7afvalAWpvqkeLXpoD8qALCDUzsWAs/RVWwNYFiHyABxYOrWR+h6Aqn/ALj+Sexlz1GFBISgGiwBV0j4tZoxvLMmse/JmEa2PAEB5swNb0s5o4PfVdquueFVY79Q1iFRmY6XyGAu1Y4tN44K+Xgt3YDcWNP1e+wFjXMPgDNSDzWFSdgvpd7zjHQ2OJW1L3V3rWtdq44zFT7nOQTl9aWQ8Mo6qP9CrbVgkAk9ttRZNFhg0p7+2MgY0WTDVuzFJm+e5MMZpH8b0YVoENI0L2oXx15yiDZhTjFtVh8Zz/VT9muMsPpXBXGRuGNbrevtiQHO9Cub3W04B1i2QaWA2AJqEK0bO4OCzaTGaV7/61RsIsoixBgATgMJVbnCzkjWImUDAmYmsBkBCsmII0jaQgwAQacBwHctApWmbgep6g2l/N3b9DjTZZdsHTc8Hs/IjAU2DnnuYsEzIBnaTZ02adT/uF/BNqzpCw0Rt4DbgGdCGq3NlM6l4jkEZ8LDaGGRZC/3eJO3/ILZ2nY8FzeFmIFYRVib5B68mOxOIQf4c5zhHKwpLE+A1AYPsZYEmKzMQACMWBhLrljyyhPT1GbrODf4mfYBJQ5MCyxAAoHe5l11HbxOgelO2WRZNefCbiuNkpdJmTbruwcLST4uCJredvLLC6SssXYAYcAIradJmIHmyKLIIA8/DBF70J3AxKwEC/WNSUlZ9EfBXe2VNOte5ztVAU/ueFqNpopZ//diCRNsvyxSrGOBQ11zfFiusXzWRy0uBJQsn2K3/u1Yf66dJm4FYqsARMABwwwRe5E+/GoImbSsZf3yvPKy7QNsiUx8ZJv1Bvyuo8j14AYjGpHpO/Y52oFUbpScAtHAB6RZY+rVwAWAFWLUPaRHQHG4GYi3Xd0HgMBl7PQeclmudy9uC3uKn+uSkGE31KN/GJ3Wrb1ggAPK+HvooCyBQM0aPAU3lZ8UG3NqSvu+Psb5vJa7yjAVNC3gufhbKGh+UjQVdm6nd55M2A3m+hYr45f5+hJmdbeSXAc2RQuWy7aGAQYPVwARSbh6d1+Rg4mSBMlBPA00DM2sRi6QBRwIxOi+45MrmKgZbwK4slaVugaZOb0JcFDTBggndAMlFLfaMVQxIAFh5cd9FQNNAbVICZkPQdJ8KDwBPY5K8+A0rDq1MFFxpXGBAnoXC5GbiA1iTQNNkYXLxzHmbgYagCbAsBJSn4qgKNFmN3Y91gkVTHmZZNFkegdQ01zl9AL9nqVsJaLLuuL+JuCbbaZuBuM1Zj4AWYGMxcr9hHFdpz63uvvM2A7HGmewqRpA1CoSb1PppEdBkSeHW7U9qFmlceayGFnHuPwk0LeiAGisji/kqEvCjnbJXYtnRHlkagQcom7TrHPxpc8qgnUogVVuiIUDW94wB4MEiQ/+uY3EKLH3HcrQoaOo32hCLr3KAcf2Em1rMp1ATMKrtjgVNVlFgKE+TLILaqcWNvI5N2isLIlc5+AKXFm76lXGQpdMY2A+rGYKm8lnwjdkMNAs0PZPRQD0VeNHL2M6aXvHU0zYDaYes8OpbCAw3s3rWfqclYSf+zNoMpI3LGws2LcA4iJ22eW8saJpjtN1++wb44NPC34KC1pNA0xgjJIAVvrwMY+t83nUBzXkK5fttpQBAZF0wgJe7GXyCIu5Ykwf3Q4EmaDFwSiZUIGbVaNXOHcv97TMwYrXKImMAsioHViyg3DKS53CBWtGavKya54Emi5zBuxJwkEfQYkA1MBroDWDuZ0Ll9lkENA084odYOMv1Wc+rMgNxK/5ph6n3G5GJy8TGXS4fJiUuVpYwoGJiBpA1CUwCTYMn12JtWqj7TzreaAiaXMsgH4iBAgMvaxDwU073Za3yfxbCAk3xsiatfowmQOZimwaaYqTUP7AA7JJJyqTCRaetlcV3GmiyMqhLoMnCK1zBZ6wsk/SmKWCeB5omV/nXRrU7LrtaXK0VNE3GNp6oh5rYtX39RN/iLuVeLNDUp+RBoqHna6OTrFPrHYi0LZYaVr86r9E969gs1kKTv3ybrMWwASWeBYn+LPEWblyL6kT/Mx6AD5O0hQsrGshyD32nNmEYE7Q7oKvdzQNNfdc4UK5Umsm7NgnctUWWMWMKWATCylWeCHku1/k0i6ays2Dr10KEhpuwPMPiVd3UwnlePYAz5dN/LazliRdFf2Kdt6gDRP00BE3QIzxgvaBJf5oBr9JRW2SN1Z9nWTSrr2qPrM42LvljoaHPTzvoXF/St+btOrcgZB2XD9CrrbHGT0pjQNNYbAwF8Czm/WSRp23qb+YBoAlyLYT0R5ZocK++LThrI+C8uh77fUBzrFK5bssrAGhMdICPBa8/6LJUACmdEVgWaHKZGKANOjqxyd//a+cz2KxDcQ0ooK/e8gA+WH5MQOVqYkk1ERW8GtRYS3zWh4BynRvwgJrJzEQOksCSQRqAGsh8Dn5NRIDZIChfLAFimFgtWA8qNg8oGHDq0G+TBCsvy1xtTABFLFcGMLAk1hNIs0iZdFlS/bvi2/qNx6DGlWxSF6jOxVYTubwbELmnyrImvz5nBQaEJjwAB9TBgwHbpA+YaGuCdn8wJwF59zOoGoRZf1zDGuk7z2HJcw9uR6BLV9YruqoDv2Hx8j3rjHxL2oRJixXJZClfQ3eiia6OTWFZAYDKBJbdW/wbC4J2ok2oL+EIyqbOTHIWJABGXssiW7tZuYO1R2UDoRYSXMGgyOQOrIFJ391X9eEeLFDihbXPSW9AkWcuPm1cW5y2u7di74BXf5c7F6S2aHLTN5SlQFO7V1cWV/qGyVa7W8XZmnTQvzyjfzKA/g5A6e3Z2ixd9AFgAQ4t3rRz/V0/1//8HyQLU+CCtnCgs34knrLAChiqb3XrGeAHUKhb1wCx4TmHvpPHevMXWDe2sL6CddZf+bJYk2fxocYI9SN/8qFc8mdh5Pk8MsY4bQgMeYbwAe1K26a/BZ72JPxCH9EP9Htlspj0W2XzubFmWvIbcKrPgd3a/eyZ+ktff+3LWEQfegtr8AyLJVbW2vSjj7AsamcFcfqlhZy86j/DRBeASWN9HNyrOxoau4ypINuYpP6M+dqjxZ/YaOODawE/TwJIpql6o4m2rk58Xge0Vxyv3zAoCPUYjgnyaayq8oD52pQ3qQz6tbHc+E2fSUmfqgUoPfrJWGgBYLFED33RWKbPG0eN8aydtPTZmLNyFwGCgOYiauXaLasA97iBmxVDJwMQVoUGVoOIwc6g5jsdEUSZPE1KIMbkDpBM2qxsLE0mNoBqheh34gN18BpkDZgGNRMFNxg4AHLifAwmYBAEApGLXOQiDVDqHEWDJauga62GudVqxyIoNIG4p2tYB/yORc1gY1JTVgMjC6jP5N0gZOJSNqtj+aSHzwCeQY61TIyYydVgBl48x2SlHCYykxhIM4hPG7Bq8w2Lbb0q0mQN4Lh4DNaVWJfrlXyeyWLDQmPSUgaThAmZdcnkB3QBogmXxlzMJl2QYSKTJ1Dp36COO9qk5h526wJGcKQ8JneTuvwALYM9GCtLVcVamTQ8u3a69zuKidskbSJQN65xvfxoP+JjPY9FjL5gpo5hYsFkUTWxlYUdrAAh9W4SU1+era0AGGUFDurEBOXfgG7SkSXarWewRALicuPLvwlU+wXRJmzfWVzQVh3135RCBxOV9qLtgdyCJxBsElUXgMLCAqya6PQTixbtRhukt/bTz8cyBh3tl/VKPm1+oZ3nSOpDOdWB8oEYfZtVW99jDdMHTNbGBP0MOIEg4GwRoVzapv7GbeperLrq1u+NI9ohmNJ/jDdAxe/dW31qD5W0bfUmzlsYDBAHOvTRl7V5IAOehJ+Ad31EWQCexZdQGfnVRrQ77RlU6D/uB6LkQXsBmRaYyqsdGR+0K/1M/vV9FjBlB47KOeutU8qtbxmzhOq4j+fpN/p+//B+EFZHlVl0Gz/l2eIXqOrX7mfx4m/wBtAsbC3CjL80ZwUv70Pp6Lnurf8CWuU1ZoBH2ghFUI/qW5vVR9SV9iePFujmAuOv7+gu/xbJ6lesKqjW9o0dknlCW9HW9OkC0mE7di/zgf5ljhgCpAWtevGdfio/FqD0t9jsJ3VuvPa3OjKW1+ZBefXHYoX12jjE4m6c1Ce1c/1QXllEl23NlM8tBZoakg7MHaDjE2yMK2/WQGaS0PmWdb96lgo2WGm8LCvLPrdqGYNz7hEFokAUiAJRIApEgfUosHTQtHpgLbBStwKr7fSVSatkFhBm8OFu1PUUhJmb6RxkskCBTNYS7rRhsgK0igCm/WR1YgXTf++tFZXVQL3SbdL91pJvq3ruTaZ6eZ+008x9BWsrD8vVJLfWWp690b+pt24Mz1SsfHCTuMbqE3RbtdWOUNewDnAzsoxwAVmVuWaSK3Cjy5bnRYEoEAWiQBSIAtMVWCpoMvczQYMisRBMvI4GqAQSBFxzo3C9LQs0mdkFRDNVc0VyLYFZrphJz2Cl5GJgcudeqpgv7oY6hqMCwLl0uBu4K7hFl/XGitph6b5cGtMS14g4OkHRk+LdjsiNm3bcx9wd3Ebi7IZJjKI2I+6lXg2nbpjwK3HZcN2ILeG+5J6zUAHqwx2yR2Q9krcoEAWiQBSIAttNgaWCptgKACkWBhiJL7BJoJKYCvEmNlpMs+CtpQLqLSFiLIZBsJPux3Im0FuMkCBY7nVWM7FgYtbEzYhTkUCsf4s5qzd4rCWPw9+Ij7CbTcwOzaYlmwtAKWvmruReF0OoPmhts4pYlGFcifABwcdi43wvWZiIkVIHdZSOjQpizwRMC2EQ9G5h4b51WPEy6iT3iAJRIApEgSgQBZarwNJAEzRwLwNJk3+dVVUH5wpyB3F1vt+YYrBwCbRmofRvsMH62AcuwGanHUsmC6UAZW7zWZZHljZBxADODrhKgo3rQNbaoMD6KWhcUHMF17peQDIItGlCEK/g9goirvsJsnYNS67gYpBUR0TYCchSKuBXELF4TeUEvY7O8FvxpgDYJgBlF8zLUus791FGZ/LJgw0E/gyD6P3GvV3DHV1vQei/Ym5MXSx6jeMrlFeAskBqsD4ETYHhFgYWI/037th4I7BbAHsdv2FhULv6tC1B3/UWl2HeBERrL+qFFVhdsXaDXtouyyq9qCa5PgpEgSgQBaLAdlNgaaApho5Fs16ZZccbMLMDC0BxO9ulOHwDwjTBQaDdiHbMgg2wALxYsvqHidoBDFgAl5hQwMc6ZqfbtAROWc4c5VC77hxfYccvUHP8RcWWiqUU62mnnvhBCbj5nEsX0IBJz1PGOltLfuz8Yp0De+AIiNsJK3EXA2SfA0cgZSeY0AK74ACuXXFiSbn07WxjcQVl9Yo5EOX3ANlOSrto+2ed0V3cqt1xZUEWSiA2dZq7HtjakTkv0QdEznsnKn2mgSbtWb3VR8XFypt72tVaYQN2U5Y28mXHLuuy3Yh2Zg7hWr0CeO3PzkxxrhY57qseZ7WNeeXO91EgCkSBKBAFosB4BZYGmqx2YiIdkVBnd3EL25oPjLjSuT79HzA5tgHs+XtSAk+ODAB/9ZJ71i/w1D/1nnXS8QNgTrwlK9q8ZDu/ozxs/hGLCfSALMulZ/VBxDEPQIgl1rEongMEuf9BL3h03IF4QbDIcgeWwClIBkI2wTi+og4u9jxuZTAK6sC474GjY0rqnDpHjgBzm4UAJKuwjTAAjYWOO1+8K608W+xiHbHgGcDTZiZw69gYxxqAQ5bF4bltpdlGgqa8i9EEo/0EHB3jIY/yXgfaWkhIjlqp9zQD9iFoWjQ4TsbGLUAN9gG330zbkDSvzeT7KBAFokAUiAJRYHEFlgaaHs0CB5pY6sRjiit0NhiXp/OquGtt6nCeFssnqJn0flUWQ65tEAnwagey+wATu8YrAU9niAFEsDfm/DVAxlrG3Q50Wbz17fNFAAAUFUlEQVRAmTPU+m9Z8YyCP/mWQCfLLatpvbfa4bUOSvWHpQ3IOucLiIovlORTYgmsMxtZ3JydCAYBJmjt77Z2f5AEECtcgHXXZiubiGhcBwgDKta6OtvOTu46sw9g+b1YVmENALjexrF4k1nsF7Msmqy09W7raaCpXixeAPlY0OQid1+LBO51u/bVQ52FNq0E6qC/iFmspLk6CkSBKBAFosDWU4Cxaz1pqaApnpIV0yu6WM5AAmsmsGOZAmKgEEB5c4h/11tS+oVguWOtY9GsDTiABRzZvOM3lVj2WCJZEOtdwrMEYVX0Ng4ABzTryCDWQ1ZGUFfvP3YItkO2bT6pV1VxqztI1mf1Oj5QJ97SgdjgDqz6XszoJDftgQce2MrHMgem3YdG/ddPAVMhAg69tmu7kjM9ucnBvGcJMZBvm5aAZ7n86cEiSKtyb7PqsfQB62k72EFaxdXO0lH8I+3mnRwwCzTVlw094k77x0aBYhZaoA7CWTfFyNo8JZVFkw4OWp62uLCgsdOdPup8zCJkPZ0pv40CUSAKRIEoEAV2VmCpoDkUFwV7tZc4PODJrQsYABRgdPyR+ENWvX4Cqlzb3hJQ74l1L/fwKrS+FRTMsTaKh/T2i3nJphjAy/InDrDeUGDzCVDkEneWpsSa6rR8RzWVyxUAeT1XvaoMmHnLAHe2uECbkdwHDIHXSe+HFXdppznIEj9ZMaAFuJ7NKiquELQWYPmcNdL9bWKSJy5/34N2kF8H1As54FKvMyyFNoh1pKO4zmkJiIPgeUnYQb3lYta1s0BTvYFhGtR7aFl7WZaFHLAKWxBw+6tzdSEpg/YB/lksJyWLHnVq4WCjmgWC+yZFgSgQBaJAFIgCG6fAykBTnCKY4i5nkWP5ApqsasChQBOcDQGgQLO+Y7Wr9y/7rP8eXGcusigCiWnxnn05WQTtcObmZ1ll5ZJXrnDQahNTWde414EeC18BKdB0XqjNQJ7Hle0+/rZhRYyoPAE7sZzDzTLAi3W33ukLDL2Ci/UNWFaqA93FG/atfQDSofj12i1AywUNxPrvSnUdaBY/KkTBphhnU7KCsnxuVJoFmoBb+ADLcu0or/evKr96pqtNP04DYNm0Y5xbXFlYM4URDBP45mpnFeYOZxUHxqyatVlro8qf50SBKBAFokAU2M4KrAw0gQKrlI0/9QYXsY0sklzidmyDHta1oftVTB044FoFTKx4dnRz+7Jq9V8rCUJYPbmqx7xu0q5t0AJc7U7mtuWeZf3iZu0fFC7Gz452bn6bmLixvb/V5iOu67333nvH+5JZbeuIHpADUAEl1zsLKIBlheMer1hSoQViMm0gApv0AY6u81vPkT8bqTzLRiDWX5Zb5eViBuU0AbU0ZWWkN3CVR+UF9a5jBXVdH0hX3fjF28ovrW0G6x+wDgjVsTIqj3bgaCPxlOqi2oVNXmCUhbjePWuBYAEz6U1NLMXqgAYWN/Rn/WQJpmlc6Kuu9dw/CkSBKBAFosD/K7AS0BQ3yZrJBWuTTiWTPzjgdgZP3M5gYFLyNhyQ6UzEvfbaq+2+FqPZh1LfsYZygdeB37MqFnCxPvZdx+7nSCExljbK9GGV5ZK7mcWQi9cGHK5llktgyWLGCsl9W7u9PZ/7l/WM610ZQTMtuNVZ6IAuSxzgBj2g3M5q0KUskjz6nfyxrIJRz3OIuf+DVQmsgTMWVNZWbnRxn/JAE1ZNgA7IWXEBc+1qX2UnYHUUziA0opLyiw11GHslIEpbcMj6q37kt5+UG2SCTdbnfffdt230cb7oMIl/pa3jnLQ1JxXQkUVX8tkyD95fpYa593IU0OeEzPA29McP7VDIiz5vIVbHly3nqfPvwhNjAXTooYe2jXz1koj5v9w1r+BZEdLCO1QeokklMT/YwMjbYcG96jN/l6mmdmYsHiYx7crMI7NZC13eJXkzNs6Lre/n32/MM+L/laMS44CFuzHcPJcUBaYpsBLQBDMgjXWw/z5qDVbjBD+sXGIluTTXmrifQQl3et4Q8/8qCg1g/d1nn30agEoGCUBvYgN0SVFgOymg7fOuCMvglegnFn6hJJsBmvLhlAOAuR1A01nL9LdIrthqi2LnJfMGeZmCZDEvTIZnayNAEwCbrxgS6jzftfYPm18tlh0vZ5OqI/Esjj2DUcTChmdqTHKaCaMNT9d6k8WWeVdfEBsvfG1ssjAX5mTutk+in3jQ9K3hEXVj753rtocCKwHNjZCOu5WLmSuW5UyHTuo6Fj2AyeLKXW2AMZALDzC41xuPolUU2A4KsDCZ8C3AWMFZ9fvWHCEuJt7NAk2b/ljutgNosmZa6NrEWJsrhRQJfWI0qFNDxOSDfxv5NgI0wS7IFMrUj5Nfa//gcWFssUnUplPl9m9eOSFBYvjHJF4xHiE6rCc5rxkkmgcsbBhm+i89mXVvp5bwkplHeCmd4NH3+vGu8RIB6aQoME2BXRI0xR2y2jnehqt5V3KtrLopmlh1fHGJLMhcGgZ1UG5l3D+nc9V5yf2jwGYrwMIEWpzo4AxcQNf3sgQ0N7eGxJEL8dlM0AS/XPU2Fy4DNFkNHVdXoElhcf5em+uPWPV5iTua5Ve41wEHHDDv8pnfsw7bWMlSzNUtVn8saDJYOA7P8Xk8YzTqn6QS0FxX1WybH++SoLltaicFjQJRYM0KcOfVa2ZZdVj0hY/0z5AFmharLD6g1OY/IApOHc1mw50YYRMsr4B4SrFqYq4BkrhP93a9WGuAIIyHNcrffm9yN2E7AQHIAA2bCsUcAwDuSC58XhrXsbCJW7bJz+ZBblgWMrGLAMakL3a8FtnyzlILpi3A5dOLLbzgwHd1Ggc9nFG83377NVcoy5QzfMWcO+/X6Rr+DUQ805FpzgwexkI79cKGQmUV2y4kwYJWuVggWSnd2wZLICKJtz/ooINa3DpdnZoBMkGQ+4hfZGnmQhdPTU/Hygm/ck8x32LpPaNOjmD5ZPGzsHZvAMQ17TfuRQP/dn+gJ9bfUXLqQ93Ii82qYuUt0CsPYhj7LwWRf+Xzmec7OcWzvGFNfdJXSEDFng9Bk7WPxVyoGE2Uv+6nbO6nzt2D3qygTuFQD35bGyhp2d+LoK78n2teLDoXNu3dx/1p4SziOp+ZZZTBQfsYA5ruqw04ktBvlUsZ+8cRFmhy8/MMOFLP85RLrPxmxaOuedDID1eiQEBzJbLmplEgCmy2As6QdYIBi5AJWKwZyDDZVgKaIE2sN+AAkWBNPJuQHN4AE61J3R8uVqcgABefm1Sd9wpSwBGPgbg157+CPKckcJ16NpB06gYgdA3wBZqA0AZB+fA8IABUQZGJnqvTm9JM9H4vX9yw8gMwWJpsBAROLHOuBV5CBcAZIJLADjAEqCxrwBiogC3wrfw2NYJCZ88CXflX3n4CP8oGMgCr8oA5ebLh03OUyXXc4mCMy1gdCOsRnw80JWWR30kWTSeDKA/LHpcvaAROIAxk+i1AB1hiDm0wVb9c1/WKXb937wJNz/SGMABELzGZoN8JKLMsmhYTdWydstuICtidBkIHJ6PYNCqpJ9c45QKQik21iAGAygoctQV6eemFvFrMKBfgV6/aDFBUj9MsmuqdJnTwRr6KcQXvFias9/2Nn4uCpnrUFpXF5lQbe4UXaIOVCjS1KfkH+Nq6Y/mU2QbQpCgQ0EwbiAJRYEsqANbADjgxsbMoijUDR33QNNGzjNWGQnHO4iadTQtAgANrImuWzw877LB2Pq1/Ox0DvIEZG/AkrkZWShAHeoSw2CDid+4DZuWBJYzlkOWHdU/+JNAmltofgMblDxxYZ53M4EQJLzgwyYubcw9lBXnyA1ZcY+IHVKyg8gBuAUPF/NGEe5eFDZQDH7DG8ieBBxY49xomllHATluQDOS4oOkAYlkZwRgI9+KNAi6wBabHgCZ4oxcLn00xNAT66qFONhE+BcgldQu8WUJZ2Bx9BuZZ1/qg6fQS1rpFQJNmnm9h4ig6oMv6qLxgmvYVlqS9gEX6sI6DVG2KtRZogkvtR/1YrABfCTC7J6v5GND0G/XtxSfqDdDTwP8Bdx8IXbsIaGpT6pD1WBtjzVV+bVbZ6pXIBZq+L0szrwGNtR39JykKBDTTBqJAFNhyCnADs6x4ixTI4TZmWQJcNjhUXPekGE2TJlA0SYJF15tk/Z4FyyRebw9jCQVNJnwQJAEFEMoaCcRM2n4PekFP/yUOkzYDcY2zxDlKxrFe/ZhS9wcuYAK09EETONnwAcwKNF0LvMT6cd2yoHLP9xNoYhkE3CyajuCRWDVZykCl49H6qTZXsc6xPAo5oO3BBx/c4NXre33mbxtIpNp1PhY0+5uBwLfyqjdABhyFD4Dn/tnHrJ9c0c4Utst7GaDJDc2qx7rHSrjHHnu08vg3K7B4+HqDnc+HrnPwZ1e7vMqfxYewCRZLR2rVUU/A36JCm/CMeRZNz2LVZDXkCge9rJDaHCv1cIPsIqApH8JD1D+rqDbiM21XHdcxR5NiNF0r/EA+yrK85QaYFGghBQKaC8mVi6NAFNgVFGAx5Brmzi6wMwmz8gAtljZpGmgCRaDJysdSxQLGMigODYCBHRZI8AbuuNrrLN0CTccWcVuvBTSBKTckqxD3PHBitQJYNkO6J8vSWNDktpZXoDx8M5hNIs7xrXCASa/NnVTntKAlAJEX9+YCZtEUH8ml65l1lM4yQZM7Wf0AHVBeqUATrLHMAkFQN8uiqa2whE5znVuksJoCShbIclFrD8ITDjnkkJ1iESdtBmLdFYrgHGTPoZtYVFA86UilsRZN5RbaIE7WQoMVWrgEK/MwLQKarpVPVv1alLFMKy/Ldb2cZBJoAnN9RtsHm0lRIKCZNhAFosCWUoAFScwiS5F4w3JpAkAuZ0DI4mPDCtB0LVisI3fEl7EQgUkHqrPo7bnnns2yCDhthAF/rFysd57BxVtHh3m7F4sjSxuLmo0esyyarmXp9CyJ9Q6kOlZGnB9LVQGxa0EIeGPxGguarGVctVye8txPwKBeGrH//vuPjqsD16yKXNmspmCVpYtWIJDrmgYFKpNAE2wB03m7zocWTZZqEMuSyBorsRizwqlLZ3A6oxkg0rAPmmIpWQLLdc6t7bNpoEkf1llg7Tcs134vXIF7WXvpbzCbBJpc+RYmAE2elNsiRrn7r1SuetFmWIIB9bxd50DXEV5c9YCWG39SWgQ06w1z4pXLeileFJBz9YN3qUCThdvGOEl/4ToXDlJteksNMCnMwgoENBeWLD+IAlHgiKwAoGHVAWLc5/2dr+IwudVZp7wetjYDmTBdz7oHIEzKJlNWMbGRXOmgDswAHK5B3wM4k6rNL4ALgAIf4MmiB2yBod/UJpr+Bg2WN5AA2FgaTdYsl6xU/rCsmtyBFoDgDhVPCm5tTgGyXJUsWSDIxhbQw+rK0icMQHynZ7NO+QMq62xRsCi2z+YlIAqiuag9BxyBGHmYlLj4wTCXOQtx7Yj2b5t3gFRZZv0ekIlj5dIWf1mfccuDfS5lv3NP5VEHyiwuUJ31N8t4JvATtkAvsGY3PNjyp96wxupIP25uG5EqFlU9g0fxrKAOHAuJUMc0cRRcgZN8+p06dI37ibH0PJZc4RMs5RY08iqfrq/jjYQvAEr1qY3QWygDC6cFg01gQhDAs3LWoejA3f2BpvrT1rTZ/tt5ql6cQaoObQQSMzwpWVzJGxC2SW5aEipi0SRffWuxcojn1b/EYQL5Ak2LMuVh0VbvrNystWJok6JAQDNtIApEgS2jAIuOiRakiKM0UVc8JYsVV14BkknfsTlcgaxuJkcAY3JkieMKNqmz6gBTwArATLDgwveSXeGgEiQAGL8HuCCC+xvQgDeWMTBVEOS3QNOkb5MMi5FjdlhOTfDACNCK/zShuzegZe3kegWCJnMxlUBV/oEd0HU0DlAo6y5AAgq+4yoGRSxzgAKUc8Urh5hQQMMaycILPKuckxoJQASvLJp17A3wq2OWym1OV3r7Q0MhAf0d8+BX2UCivHDRghb1YIOM8tKNHmIlwb+65soGp2AbrCkPILThSrIBS10JPQD9gBAkahfc7IDd4gC0OrpHmWk/PHOYjmAR+GoH2lhZ7XymftU5+PRv+aGvuvHb3XffveVNPalfdSmUQ5u0sUl4B/3E9dabgFhlazMZ2FcuMZ21EadfH+pbPQBqMNpP6hv0KjfrLdc/i33Vff91oADSczybXqz2yqEMFlbq26JHuwDO2h+NfWZxA4j1Je0V/E/K65YZbFKQ0QoENEdLlQujQBSIAlEgCkSBKBAFFlEgoLmIWrk2CkSBKBAFokAUiAJRYLQCAc3RUuXCKBAFokAUiAJRIApEgUUUCGguolaujQJRIApEgSgQBaJAFBitQEBztFS5MApEgSgQBaJAFIgCUWARBQKai6iVa6NAFIgCUSAKRIEoEAVGKxDQHC1VLowCUSAKRIEoEAWiQBRYRIGA5iJq5dooEAWiQBSIAlEgCkSB0QoENEdLlQujQBSIAlEgCkSBKBAFFlEgoLmIWrk2CkSBKBAFokAUiAJRYLQCAc3RUuXCKBAFokAUiAJRIApEgUUUCGguolaujQJRIApEgSgQBaJAFBitQEBztFS5MApEgSgQBaJAFIgCUWARBQKai6iVa6NAFIgCUSAKRIEoEAVGKxDQHC1VLowCUSAKRIEoEAWiQBRYRIGA5iJq5dooEAWiQBSIAlEgCkSB0QoENEdLlQujQBSIAlEgCkSBKBAFFlEgoLmIWrk2CkSBKBAFokAUiAJRYLQCAc3RUuXCKBAFokAUiAJRIApEgUUUCGguolaujQJRIApEgSgQBaJAFBitQEBztFS5MApEgSgQBaJAFIgCUWARBf4PTVoFUd9WC8QAAAAASUVORK5CYII=\" width=\"666\" height=\"78\"\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompetition assay with Luminex bead-based assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCovalent coupling of rBet v1 to Luminex beads was performed according to manufacturer\u0026rsquo;s instructions with Bio-Plex Amine Coupling Kit (Bio-Rad, France; Cat #171406001). 30-fold molar excess of capture mAbs were combined with rBet v1 coupled beads for 30 minutes. Biotinylated competitor mAbs were then added to each well and incubated for further 20 minutes. Biotinylated mAbs bound to rBet v1 were stained with Streptavidin-PE (BD Pharmigen, USA; Cat #\u0026nbsp;554061 ; 1:1000 dilution) and analyzed on 200 Bioplex instruments. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eNegative stain electron microscopy\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe samples were adsorbed to a glow-discharged (20mA for 15s, Glowcube Plus, Quorum) carbon-coated copper grid 400 mesh (EMS, Hatfield, PA, USA), 5 ml of sample at 120 mg/ml were absorbed for 1 min, followed by 3 washes with deionized water (5 ml), and stained with a 1% uranyl acetate solution (3 ml) for 60\u0026thinsp;s. Observations were made using an Talos electron microscope (Thermo Fisher, Hillsboro, USA) operated at 120\u0026thinsp;kV. Digital images were collected using a direct detector camera Ceta 16M (Thermo Fisher, Hillsboro, USA) 4098\u0026thinsp;\u0026times;\u0026thinsp;4098 pixels. Automatic data collection was performed using the EPU software v2.0 at a nominal magnification of x92,000, corresponding to a pixel size of 1.5 \u0026Aring; using a defocus range from -1mm to -2.5 mm. Image preprocessing, two-dimensional classification, and three-dimensional processing were done using the CryoSPARC software (v4.4).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCryo-EM data collection\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eGrids were screened for particle presence and ice quality on a TFS Glacios microscope (200\u0026thinsp;kV), and the best grids were transferred to a TFS Titan Krios G4. Cryo-EM data were collected using a TFS Titan Krios G4 transmission electron microscope, equipped with a Cold-FEG on a Falcon IV detector in electron counting mode. Falcon IV gain references were collected just before data collection. Data were collected using TFS EPU v2.12.1 utilizing the aberration-free image shift protocol, recording four micrographs per ice hole. Movies were recorded at a magnification of \u0026times;120,000, corresponding to the 0.658\u0026thinsp;\u0026Aring; pixel size at the specimen level, with defocus values ranging from \u0026minus;1 to \u0026minus;2.4\u0026thinsp;\u0026micro;m. Exposures were obtained with 60\u0026thinsp;e\u0026minus;\u0026thinsp;\u0026Aring;\u0026minus;2 total dose. In total, 4530 micrographs in EER format were collected.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCryo-EM data processing and structure fitting\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eData processing was performed with cryoSPARC (Version 4.4) including Motion correction and CTF determination. Particle picking and extraction (extraction box size 256 pixels) were carried out using cryoSPARC Version 4.478. Next, several rounds of reference-free 2D classification were performed to remove artifacts and selected particles were used for ab initio reconstruction and hetero-refinement. After hetero-refinement, 18\u0026rsquo;497 particles contributed to an initial 3D reconstruction of 4.8\u0026thinsp;\u0026Aring; resolution (Fourier-shell coefficient (FSC) 0.143) with C1 symmetry. A model of a Bet v1 (PDB ID 4A81) and AlphaFold2 (ColabFold implementation) models of the Fab 08 and 10 were fitted into the cryo-EM maps with UCSF ChimeraX (version 1.5). These docked models were extended and rebuilt without lateral chain manually using Coot (Version 0.9.8.8) and Phenix (Version 1.21)\u003csup\u003e\u0026nbsp;40, 41\u003c/sup\u003e. Figures were prepared using ChimeraX (USCF, CA)\u003csup\u003e\u0026nbsp;42\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCell line generation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNFAT-Luciferase Jurkat cells were purchased from BPE Bioscience Inc (San Diego, CA, USA) and cultured in RPMI 1640 (Gibco) supplemented with 10% FBS, 1% non-essential amino acids, 1% sodium pyruvate, 1% penicillin-streptomycin, Geneticin (1mg/ml). Lentiviruses encoding the different anti-Bet v1 CAlleRs or the anti-CD19 CAR with mCherry reporter were used to transduce cells that were further sorted to purify mCherry\u003csup\u003e+\u003c/sup\u003e cells. For K562 Betv1 generation, the Bet v1 protein linked to the platelet-derived growth factor (PDGF) transmembrane domain and to GFP was cloned in the lentiviral expression vector pCDH-EF1-FHC plasmid (Addgene #64874)\u003csup\u003e\u0026nbsp;43\u003c/sup\u003e under the EF1a promoter. Lentiviral particles were used to transduce tumor K562 cell line that was further sorted to purify GFP\u003csup\u003e+\u003c/sup\u003e cells. K562 cells were genetically modified to knock out CD32 (Fc\u0026gamma;RII) using CRISPR-Cas9. Briefly, 80 \u0026mu;M crispr RNA (crRNA) sequences targeting FCGR2A gene (tggagcacgttgatccacgg and aaagcacagtcagatgcaca) (Synthego, Redwood City, California, USA) and 80 \u0026mu;M trans-activating crRNA (IDT, Newark, NJ, USA, Lot# 748524) were complexed with 45 \u0026mu;M high-fidelity recombinant Cas9 protein (produced by \u0026nbsp;the Protein Production and Structure Core Facility of the EPFL - Swiss Federal Technology Institute of Lausanne, Switzerland) and mixed with 1 \u0026times; 10⁶ K562 cells resuspended in 20 \u0026micro;L Lonza P3 Primary Cell Solution prior electroporation in a Lonza 4D-Nucleofector X Unit with the FF-120 program. After electroporation, cells were immediately transferred to pre-warmed RPMI-1640 medium supplemented with 10% FBS and incubated at 37\u0026deg;C, 5% CO₂. CD32 deficient cells were further sorted. To generate K562 CD64 cells, CD32 deficient cells were transduced with a lentivirus encoding human CD64 and further sorted.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAnimals\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFemale Balb/c aged 6 weeks were purchased from Jackson Laboratory and maintained at the animal facility of the University of Lausanne. All animal protocols were approved by the Cantonal Commission for Animal Experiments from the Canton of Vaud (Switzerland) (License number: VD3893).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePrimary cell preparation, isolation and sorting\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHuman T cells were enriched using EasySep Human T cell enrichment Kit following manufacturer\u0026rsquo;s instructions (StemCell Technologies, Vancouver, Canada, Cat.#17952). For human Tregs, CD25\u003csup\u003e+\u003c/sup\u003e PBMCs were enriched using CD25 MicroBeads II (Miltenyi Biotec, Bergisch-Gladbach, Germany, Cat.#130-092-983) and stained with CD4-FITC (BD), CD25(CD25-4E3)-APC and CD127-PE for further sorting on a BD FACS Aria II cell sorter (BD Biosciences, Franklin Lakes, NJ, USA) as CD4\u003csup\u003e+\u003c/sup\u003eCD25\u003csup\u003e+\u003c/sup\u003eCD127\u003csup\u003elow\u003c/sup\u003e. Human primary cells were cultured for two days in X-Vivo 15 medium (Lonza, Basel, Switzerland, Cat.#02-053Q) supplemented with 5% human AB serum (Pan-Biotech, Aidenbach, Germany, Cat.#P30-2901), 1% penicillin-streptomycin (BioConcept, Allschwill, Switzerland, Cat.#4-01F00-H), 55 mM 2-mercaptoethanol (Gibco, Grand Island, NY, USA, Cat.#21985-023) and 10mM N-acetyl-L-cysteine (Sigma-Aldrich, Saint-Louis, MO, USA, Cat.#A9165-25G). After viral transduction, cells were cultured in RPMI medium (Gibco, Walthman, MA, USA, Cat.#61870-010) supplemented with 10% FBS (Sigma-Aldrich, Saint-Louis, MO, USA, Cat.#F7524), 1% non-essential amino acids (Gibco, Grand Island, NY, USA, Cat.#11140-050), 10 mM Hepes (Gibco, Paisley, UK, Cat.#15630-056), 1 mM sodium pyruvate (Gibco, Waltham, MA, USA, Cat.#11360-039), and 1% penicillin-streptomycin. Medium was supplemented with recombinant human IL-2 (Miltenyi Biotec, Bergisch-Gladbach, Germany, Cat.#130-097-746) at 30 IU/ml for effector T cells and 300 IU/ml for Tregs. Both T cells and Tregs were activated from day 0 with anti-CD3/CD28 Dynabeads (Gibco, Waltham, MA, USA, Cat.#11131D) at 1:1 ratio.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eMurine T cells were isolated from spleens and lymph nodes of female\u0026nbsp;Balb/c\u0026nbsp;mice.\u0026nbsp;T cells were enriched by negative selection using Easysep mouse T cell isolation kit (StemCell Technologies, Vancouver, Canada, Cat.#19851). For Treg isolation, CD4\u003csup\u003e+\u003c/sup\u003e T cells were isolated using EasySep CD4+ T cell isolation kit according to manufacturer\u0026rsquo;s instructions (StemCell Technologies, Vancouver, Canada, Cat. #19852A). CD4\u003csup\u003e+\u003c/sup\u003e T cells were stained with CD25(PC61)-PE (Invitrogen) and CD4(RM4-5)-APC (BD), and the CD4\u003csup\u003e+\u003c/sup\u003eCD25\u003csup\u003ehigh\u003c/sup\u003e fraction purified using a MoFlo Astrios (Beckman Coulter) or a AriaII (BD) cell sorters. Murine T cells were cultured in supplemented RPMI cell culture medium with 55 mM 2-mercaptoethanol (Gibco, Grand Island, NY, USA, Cat.#21985-023). T cells were activated with mouse anti-CD3/CD28 Dynabeads (Gibco, Waltham, MA, USA, Cat.#11452D) at 1:1 bead to cell ratio for conventional T cells and at 3:1 ratio for Tregs. The medium was supplemented with 50 IU/mL human IL-2 (Miltenyi Biotec, Bergisch-Gladbach, Germany, Cat.#130-097-746), 5ng/mL human IL7 (Miltenyi Biotec, Bergisch-Gladbach, Germany, Cat.#130-095-362) and \u0026nbsp;human 5ng/mL IL15 (Miltenyi Biotec, Bergisch-Gladbach, Germany, Cat.#130-095-764) for conventional T cells. For Tregs medium was supplemented with 2000 IU/mL recombinant human IL-2 (Miltenyi Biotec, Bergisch-Gladbach, Germany, Cat.#130-097-746) for Treg. On day 7 of culture, beads were removed and cells rested overnight before further experiments. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePlasmids\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSecond generation CARs/CAlleRs with the CD28 hinge, CD28 transmembrane, CD28 intracellular domains and the CD3\u0026zeta; signaling domain were cloned in the pCDH-EF1-FHC lentiviral vector plasmid (Addgene, no. 64874) as previously described\u003csup\u003e23\u003c/sup\u003e. The CARs were designed using the scFv derived from the four novel anti-Bet v1 antibodies and the anti-CD19 scFv derived from clone FMC63 as previously described\u003csup\u003e44\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eThe murine stem cell virus-based splice-gag vector (pMSGV) was used to introduce the scFv of either the CAlleR 8 or an anti-HLA A2 CAR (clone SN607D8)\u003csup\u003e17,24\u003c/sup\u003e fused to the hinge, transmembrane and intracellular domains of mouse CD28, and the signaling domain of mouse CD3\u0026zeta;. The retroviral vector was kindly provided by Dr. Melita Irving (Lausanne University Hospital and University of Lausanne). \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eVirus production\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo produce lentiviruses, 3x10\u003csup\u003e6\u003c/sup\u003e HEK293T cells were seeded in 9ml of supplemented DMEM and transfected 24h later with 4 \u0026mu;g of vector plasmid, 4 \u0026mu;g of pCMV-dR8.9 packaging plasmid, and 2 \u0026mu;g of pMD2.G2 packaging vector diluted in PEI. Supernatant was collected 48h and 72h post-transfection, filtered through a 45mm filter, ultracentrifuged at 50 000 G for 2h and stored at -80\u0026ordm;C.\u003c/p\u003e\n\u003cp\u003eRetroviruses were produced using the Platinum-E (Plat-E) Retroviral Packaging Cell Line (Cell Biolabs, San Diego, CA, USA, Cat. #RV-101). Briefly, Plat-E cells were grown in DMEM supplemented with 10 \u0026mu;g/mL blasticidin (Invivogen, San Diego, CA, USA, Cat. #ant-bl-1) and 1 \u0026mu;g/mL puromycin (Sigma-Aldricht, St. Louis, MO, USA, Cat. #P8833) before transfection with 10 \u0026mu;g of CAR and 10 \u0026mu;g of pCL-Eco (Addgene plasmid #12371) in Turbofect reagent (Thermofisher Scientific, Waltham, MA, USA, Cat. #R0531). Two days after transfection, Plat-E supernatant was collected, and viruses were concentrated 400 times after ultracentrifugation at 50 000G for 1h30 at 4\u0026ordm;C.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCell transduction\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFor human cells, transduction was performed 24 hours post-activation by adding a multiplicity of infection (MOI) of 1 of pre-titrated lentivirus to the culture. After 20 hours of incubation, the virus was washed, and cells were resuspended in fresh supplemented medium with cytokines. For murine cells, transduction was performed 24 hours post-activation for T conv and 72 hours post-activation for Tregs. Cells were incubated with 10% concentrated retrovirus in a non-treated culture plate (Greiner Bio-One, Austria) pre-coated overnight with 20 \u0026micro;g/mL RetroNectin (Takara Bio USA, San Jose, CA, USA, Cat. #T100A). The cell-virus mixture was spinoculated at 2000g for 1.5 hours at 32\u0026deg;C, followed by overnight incubation at 37\u0026deg;C, 5% CO₂. After 18 hours of transduction, the virus was removed by washing, and cells were resuspended in fresh medium.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eLuciferase assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo screen CAlleR functionality, NFAT cells were co-cultured with K562 WT or expressing Bet v1 at a 2:1 ratio for 24h at 37\u0026ordm;C, 5% CO\u003csub\u003e2\u003c/sub\u003e. After incubation, luciferase assay was performed as previously described\u003csup\u003e23\u003c/sup\u003e. Briefly, cells were lysed for 20 minutes under shaking conditions with 50ml harvesting buffer (50 mM 2-morpholinoethanesulfonic acid sodium (NaMES) (Sigma-Aldrich, Saint-Louis, MO, USA, Cat. #1061970100), 50 mM Tris-HCl, 1 mM dithiothreitol (Thermo Fisher Scientific, Waltham, MA, USA, Cat. #R0861), 0.4% Triton X-100 (Thermo Fisher Scientific, Waltham, MA, USA, Cat. #9002-93-1)). After incubation, 50 \u0026mu;l luciferase buffer (125 mM NaMES, 125 mM Tris-HCl, 25 mM (CH\u003csub\u003e3\u003c/sub\u003eCOO)\u003csub\u003e2\u003c/sub\u003eMg \u0026middot; 4H\u003csub\u003e2\u003c/sub\u003eO (Sigma-Aldrich, Saint-Louis, MO, USA, Cat. #M0631), 2.5 mM adenosine triphosphate (ATP, Thermo Fisher Scientific, Waltham, MA, USA, Cat. #R0441)) was added and incubated for one minute under shaking conditions prior to adding 50 \u0026mu;L of luciferin buffer (1 mM D-luciferin (Thermo Fisher Scientific, Waltham, MA, USA, Cat. #88292) in 4.8 mM KH\u003csub\u003e2\u003c/sub\u003ePO\u003csub\u003e4\u003c/sub\u003e (Merck, Darmstadt, Germany, Cat. #1.04873) and incubating for 5 minutes protected from light. Luminescence was measured as relative light units (RLU) on the Synergy H1 Hybrid reader (BioTek, Winooski, VT, USA).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eIn vitro human T cell and Tregs activation, proliferation and suppression assays\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFor activation and proliferation assays involving human primary T cells and Tregs, 0.1x10\u003csup\u003e6\u003c/sup\u003e primary cells were co-cultured with 120G irradiated K562 Bet v1 at different ratios, or when not specified at 1:5 ratio. For activation assay testing different Fc\u0026gamma;R, 120G irradiated K562 in presence of Bet v1 protein (1 \u0026mu;g/ml) and anti-Bet v1 monoclonal antibodies (0.5 \u0026mu;g/ml). After two days of co-culture, cells were stained for activation markers and analysed by flow cytometry. Anti-CD3 was used as positive control (1\u0026mu;g/ml, clone OKT3,\u0026nbsp;BD Biosciences, Franklin Lakes, NJ, USA, Cat. #566685)\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eFor suppression assays, Tregs were debeaded, washed, rested for 8h and plated in 1:2 serial dilutions up to 1:64. Beads were also removed from effector T cells, cells were then washed and stained with 1 \u0026mu;M CFSE (Vybrant\u0026trade; CFDA SE Cell Tracer Kit, Invitrogen\u0026trade;, Waltham, MA, USA, Cat. #V12883) in PBS for 5 minutes. Then, 0.1x10\u003csup\u003e6\u003c/sup\u003e effector T cells were co-cultured with Tregs at different ratios and 0.01x10\u003csup\u003e6\u003c/sup\u003e irradiated K562 cells. Suppression assay using different FcgR K562 cell lines, Tregs and effector T cells were plated as previously mentioned using 1 \u0026mu;g/ml of Bet v1 and different concentrations of mAb 10. Cells were incubated for 96h before analyzing CFSE dilutions. The FlowJo software was used to calculate the division index and percentage of suppression for each condition was calculated as follows:\u003c/p\u003e\n\u003cp\u003e\u003cimg src=\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAqcAAABFCAYAAAB39k+kAAAAAXNSR0IArs4c6QAAAARnQU1BAACxjwv8YQUAAAAJcEhZcwAAFiUAABYlAUlSJPAAACM8SURBVHhe7Z3/ixxF/v+f+/kDlN7xpzsRmd7AicKI9prDW4UEzh73IHAQ7YmCCErW2R8OckomTCIiRs1s7iIEs7sBhSCeM3unnIi77ihEuJ6TMxllh1P8wfQQRPLTTAb9B+r9g/2qT3VNdc/M7uzuzN7rAQ1JVW13feupZ1e96lUTQggBhmEYhmEYhhkB/p8ewDAMwzAMwzC7BYtThmEYhmEYZmRgccowDMMwDMOMDCxOGYZhGIZhmJGBxSnDMAzDMAwzMrA4ZRhmTzM9PY2JiQlMTExgYWFBj2ZGhEajgampKdlWtVpNT7LrtNttLCwsYGpqCo1GQ48eefbquzA1NYX5+Xk0m009ihlTWJwyDLOnuXr1KvL5vB4sGZYYymazWx70h3GP7WBhYQETExPIZrN61NDIZDK4du0abNvWo0aCRqOB/fv34/Lly7h06RIymYyeZOTZrnehVqvJv90NPv30UwCA4zioVCp6NDOGsDhlGGbPc+edd+pBzIgyNTWlB+06tVoN9957Lx555BGsr69jZmZGTzI27MV3IZ1OY3FxEYuLizhy5MjIfdwxg8PilGGY/2l834fv+7jrrrv0qIEolUrwfR+HDx/Wo/pmGPfYDg4fPgzf91EqlfSoPU+z2cShQ4fgui4WFxf16D1F0ruQNHN+1113yb/dTXK5HEqlEgqFAtbW1vRoZoxgccowzP80MzMzmJmZQSqV0qMGIpPJYGZmBul0Wo/qm2HcYztIp9OYmZkZy6XsrfKXv/wFnU4Hp06d0qP2HHHvQq9l/lQqJf92t3nmmWdgWRb+9Kc/6VHMGMHilGEYhmEMNJtNLC0twXGckRBeu8UXX3yhB40sqVQK+XweQRCw/ekYw+KUYZg9g7qbmjZoTE9P4/Lly3rS2N3hFy9elGH6Umaz2UQul5NxuVwOzWaz5y7otbU1udlJzZeattc9AKBSqUTuE7dLuVKpYHJyUqZDOPtFz5icnIx9hs7JkyeNdWGqP71+5ufn0W63I/cjms0m5ufnI/nM5XK4du2anlRiat9sNhtZwl1bW+u6J6HWSzab7ao3nc8++wwA8Oyzz+pRXZjaOJvN4uLFi5F0VG69DCYhpfeJdruNkydPRsoQ5zXAVFeDvgsI279QKAAAqtVqpHwLCwvGvqazU2UmHn/8cQDAhx9+qEcx44JgGIbZA7RaLeE4jgAglpeXZXi5XBYABABRKpUifyOEEJZlCQDC930Zls/nBQDhOE4krQifA0DYth0J9zzP+Izl5WUBQBSLRdFqtSJhrutG0sbdQyh5yufzXfexLEsEQRBJv7GxIZ9RLpeFbduiVCrJ+wAQq6urkb+JIy6/Qqm/jY0NYdu2KBaLolgsyvBisaj/idjY2BCWZQnLsmS9t1otUSwWZd7U9qB4x3EifxMEgWxztSxUdj1cCCFs2xb5fD4SFofrusa86FC+qY1brZasZ7XOTOVWy2CqK+oTq6urwnEckc/nRalUErZtCyT00WG9C77vy/Z3HEf4vi8v6nNqfevsVJl14vLDjAfccgzD7AlIIJgGXRIKpjiTAKHB1rKsSFoRDqwARLlcjoSXSiXjM2hA1cnn811iL+4eq6urAjHi0CSCCBqgdTGmCt1+8H0/9hlUf47jSNEsFCGki3ghhBQmJtFH9aXHUfvq9U5tpT9HFVREqVTqymcSVH9JxNUNfcSo4XHlpj5liqM+YVmW2NjYMP6N/mEyzHdBJJRRJa6udqrMOnFlYcYDXtZnGGZPsLS0BIQ7y3UGdZ+TyWTgOA46nU7Xrt+3334btm1Hlov7QV9GX1xcxPr6eiQsjnfeeQcA8PTTT+tRmJubA8Il17gl9FdeeSXy/4cffhgIl1uHxcsvvxzZSPPAAw8AAIIgUFL9soRcr9dh27bRjjPOlRS1r17vtEkrCIJIeebm5uB5Hur1OhYWFlCr1XDmzBmsrKx0bfjZCm+++SZgaJtUKgUhhGzjpHKn02l4ngcA+OSTTyJxRD6fj2xIS6fT0ifsjRs3lJTDfRe2wk6WmdlbsDhlGGbsqdVq6HQ6QDiADQOyM/z4449lWLvdxtLSEo4ePaqkTOb8+fMAgEKhgKmpKVy8eDFWRMaxsrICALj99tv1qMjg/d1330XiCF2Mme6zVW655ZbI/+PaoVqtAgki1ITavqrNo27nqAuWCxcuwLZtFAoFHDp0CB999FFsvjYLOYDvVae9yn3fffcBAL766is9CgBw66236kHGe23Hu7BZdqrMzN6DxSnDMIwBmnWqVCpSTL7//vtA6K6mX2ZnZ+H7PlzXRRAEeO6557Bv376umVSmN67rIjRHM1767FwqlcKlS5cAAJOTk0b/nVuFhCDDMMODxSnDMIyBVCoFz/PQ6XTkru2zZ8/ixIkTXTORvZiZmcH6+jqCIEA+n0en00GhUGCBOiA0E9cv7XYbx44dkx8GTz75pJ6EYZgRhMUpwzBjjzojZnIz89NPP+lBffHUU08BoUuatbU13Lx5c6BZUx06ZrFcLgOA0a2PCcdxAADffvutHhWxs9RnDkeRe+65BwBw5coVPQoIBaWO2r6D2Mm++OKLsG0b6+vr8DwP1Wp1Ux8EpjwRSW2j0qvc169fBwAcPHhQjxqI7XoXNsNOldlEUpsxow+LU4Zhxp5UKiVFwuuvvx6JazQacoPIoMzOzsKyLKysrOCll15CLpcbaNa0VqthYmKiSyTQZqF+eeyxxwAAb731lh4lTQ3y+bweNZLs378fCJfDdR+glUoF9Xo9EoawfV3XBQAUi0U9Gu12u6uOFxYWcPXqVVy4cAEI7U8ty0KhUOh54hFBz4yz5YXSNmfPnu0SRI1GQ4rp/fv3w7Is4ya7drstfX6aNjENwna9CwhFplrGXh8KO1VmE9SPxuGDjTGgb99nGIYZR8jdErm8IZ+ejuNIt0Ke5+l/Jv9G94dJqL43k9zXkOsa1W8jueBxHEe6xFF9YKo+KEXMPYTmt9Lk59TkHomeDaArjtw89eMvUiiufUzp4+pPdfujP1+tU/Jh6bquyOfzsXVD/jIpH6VSSZRKJeF5nrAsK+LmiMqn5ynORVEcVL8mt0uE2jbk55Xypf8t5SvO56fuJksk9AmhuN3Sy7kd74Je947jyDz109e2u8wqlB9TGZnxgMUpwzB7BnLaTYNhqVQSrVZLihIaXAlKS+lNAx750UzyCaqKLSiCJAgCKQrUeDd0jN/PPQgqBw3OVBYqowo5xKd0tm1LYb26uiqFBuUliXK5HJs+rv6CIIh9PqGWxbZtWR8kTGAQJ1Sfen7UutTbmp7r+34kT/0IVBLYJlGuQh8car48zzP2J9/3pXClfHieZ/THmdQn1Hoy9d1hvwtqn7LDAx30cIrT23qnykzE+cRlxocJ8cvXEsMwDMMwGvPz81haWoLv+7xEPAa0223s27cPk5OTiUfhMqMN25wyO06lUsH09HSXvdkwiTtzfBxQz6FmGGZ3eeGFF2BZFo4dO6ZHMSPIuXPn0Ol0pH/hUWGcx6TdYMviVB1IySHy5OQkstmsNHZmGIRftNlsFqdOncLzzz8vT7ZB2I9yuZzsQ7lcrmtzgQptNIkTuOQY23GcseqHlUpFbmagMpig+spms3oUwzBDJJ1O491330W9Xsf8/LwezYwQlUoFr732GorFImZnZ/XoXWW3x6RarYbp6em+vFU0Go3IeDw1NdXz79rtNubn5zE5OSl14Pz8fOI4noi+zj8IZLvkaMb+ZFvCxsg7BxnA97If2y1arZbsK7p9nAjtnVzXFa1WSwRBINOaaLVawrbt2HgVMsbX7fdGEbIFS7KT0m3GRrW9GWavQRuyXNc12koyuwfZIvf6/RwFdnpMCoIgYu/b67nUz8lem+ypkWB3T5sCLWXTW9JmzX7YtDglsWHbdteDyYi8VyUwwyNuh+uoQB1X7ytCeVnVH3wSYKZBgOJ6bWYgKH2c8fwoQB8XSe/M8vKy3EhAGxBYnDLMzqFuStM3/TC7h+M4Ip/Pj02b7MSY1Gq1RLFYlGOGFW7WSxpjhOINQR+rKdwk/kl/6OXpJWqT2LQ4JUGh76Yk4oQF879Hry9F6sAqfugKRP8b+vCJ63cm1A+pUcW27VjxLsKvWdd15Y8v/bixOGUYhhkvdmJMWl5eFsViUY4p5OlAH1NVaJLEtOpNY44e12q1BELvCTo0jpvierFpm9MffvhBD4pgOueY+d/k1KlTQMJ55IMYiM/Pz8OyLPz5z3/Wo2JJpVLI5/MIgmBXbH16UalU5LGWcQ7eM5kM1tfXkU6n9SiGYRhmjNiJMWlubg6vvvpq7Jhi4uOPPwYA3HfffXoUHnzwQQDAyspKJJyOdjYdLEIasNPp9H3wBbFpcXrrrbcCYUZ7GbzWajVpXDs5Odl1kgdC0aFvcKFd3RMTE5ienpbPqVQqcgNWNpuN3C/uWbVaDdlsVhr3qqdVtNttLCwsSENe1ehdfVYul5PhKpVKRd7bdH+CjIzpOZQ2l8t1CTQyLjZtNFMbWX1uXP6g1Qvd6+TJk12nfVA7TExMyJdGDZ+cnIzdhGSi0WggCAJ4njfQS2JibW0N1WoVi4uLA9/r8ccfB8JjKEcNyhPlkWEYhtnbmMakZrMZGfOnp6elNqANTaQbBhV7/UDPuuOOO/Qo/OpXv5L/VjUXTVTGTZzYtg30cbxvF/pUar/Q8ipN88YtR/q+L5cjacrYZH9ADoDJjrBUKskpaXKo6/u+KBaL0q6SDG5padP0rFKpJMrlsrwXOdRWl1A9z5P3pHyIHs6AhWYETHYY6v1V1E0+tDQbKKdk6LYyunFxSzFK1m0+6B56/gj6O3WKXz8lhMri+76cpnddN7KcTEsRpvzGQUsBcXkTynKDir6s3wo3QW1lGZvasV8oD5u5BjFpGTRfgpf1GYZhxh7Tbz+NdTCYr9GBHnF6K4l+lvV7jV+m+F737RUfx2AjogbZEiI8FSKuQASl18Vpks2CUESiazhVhZ6vN5a6e11/HlWWbrwrQqFnh6eVkJAkwamWTxWm+sYcypMKiQn9maurq112JySK9I5J9aQLQyqPqf7puXodCMXAWb8fPcdRdtATSc8y0U96yqNaj9RXKIz6AP2f6g3aaSVJ9JOXnYbaelCRyeKUYRhmvIkbk9RJLhqffd836o1+6UckwiA+VUzxve7bKz6OTS/rA0Aul8Pq6iosy0IQBHjooYcS7Sf++9//AqH9nMp3330HxNgsAMBXX30FALj//vtjl67pHsQ333wDhMvji4uLkTiC0qjU63UEQYBLly5JG79MJtNlQ/v222+jXq/jxIkTkfLQdLfrujJM5Z133on8f3Z2NvYUC91kIpVKQQjRNX1+5coVQLHvIJrNJgqFAgDglVdeicQhdAoMADdu3IiEU13W6/WuJXR61l133SXDtsrhw4cBAK+//roMu3TpEhzHQSaTQaPRwGuvvYZSqYRMJoO1tTX84Q9/wOnTpyGEwNGjR1EoFBL7HrO90DIUX3zxxRdf0WtQMpkMlpeX0el0pK/QQ4cO4d133+3ST3uVLYlThOLq+++/h+d5AIAjR47E2kKQE9rf/va3kfAvvvgCAHDw4MFIOFGtVgEgcROMLpYuX74MAHj55Zcj4Sr33HNP5P9qvkulUqJd45kzZ2BZFp555hm0223UajWcPHkSBw4cgG3bKJVKkfSHDx+GZVlYWVlBNpvtsjFVmZmZgeM4CIIA+/fvj61PhGK40+kYxTAZKsdttIkTxdQe+Xw+IoSbzSY6nQ5s2zbeb7Ok02mUy2WsrKxgenoaU1NTuHbtGt566y0AQKFQgG3bckPVSy+9BMdx5IfK8ePHYdu23HjFJKP/cPZ79XLCzDAMwwyHubk5eJ6HarWKffv24cSJEyN3sMB2smVxinBGr1KpSIH03nvv6UnQbrdRr9dhWVaX8v/6668BZTeYCs1EmjbUUJxlWV1xV65cgWVZxsak2b9f//rXkXBVlOl5VKnVauh0Ouh0Orjttttw22234fTp0+h0OlhcXMS1a9e6/j6dTuPzzz+H4zioVquwbTtxsF9fX4fneXJGOu7EJJrlvP/++/Uo/POf/wQAPPzww3oU2u02giAAEoT9E088EQmnenvkkUci4cMgl8uh1WrhjTfewAcffCDrsFKpoFqt4vz587KN6/U6pqenI38/NTUly8MkE5rzDHwdP35cv5VET8sXX3zxxdcv12a5cOECLMuKnYAaNnQ6IWmhOFTNQNqDdEMc+mRgL4YiTok//vGPQIxroC+//BIwCJt2uy1dE+jL0gDwn//8BwBw4MABPUrG6Uv9NJuoP0uNs227S0BS5ZrEnAo1XKlUkp1vfX0di4uLXXlRyWQyuHr1KsrlMizLQqFQiBWoJPh934fjOFhZWcGTTz6pJ8O//vUvAMDvfvc7PUqKydtvv12PkrOqjuN0CXuaqdbbg3YV9qqfzZJKpTAzMyPbhTwWuK4rPzJoFvnOO++M/C3N8JoE/GahI1I3cyXNdjMMwzBML1588UVp7njgwIGhjm8maGe9CRrT9MlA085+FdIT+mRgLwYWp9lsNlZQEaZZvH//+9+AwX/WuXPnAEWx63z++ecAgLvvvluPwtmzZwHDDB+JVv1ZAKQbpKNHj+pRUszF2b4Oi1wuh48++gjo42tjZmYG6+vrsCxLNrIKmUr85je/0aPQ6XQAg8hEaNMJAM8//3wkPMlmlp71+9//Xo/qyc8//6wH9eTcuXNyNroXlmUBocCNY9AXe2ZmpusLuN/LVOdJDJo3hmEYZrxJ+t2vVCr49NNP8be//U3an5omqIYJTQKadMmPP/4IGCYDyUzTpE9ootI0GdiLgcXplStXjBmHsoz86KOP6lFyU5O6dF+pVKSA0pdpiXq9rgcBocgMggDFYrFLCJj8qCIMX1paguM4XUuU6oyqvuFIh74UfvrpJz0KjUYD2Ww2EjY5Odk1m6wvpRO5XK5rY08qlYr9ogmCAJZlGfNMgl+vj1qthmq1GrHbJEjY6x8Y7XZ7U/amZEds2nyWRK1Wk5ug1LJRvV2/fl1J/f/7VxLUl/T+sptQXuL6OcMwDLM3iRuTarUa5ufn8cEHHyCVSmFubg6u66JarfacHNwKtDemWq12aRaa0HrhhRci4ZlMRk5m6drl/fffBwCcPn06Et4X+vb9JFTfpsvLy9LF0MbGhvA8T8Dgg5MgX5vkTmB5eVnk83npSiefz4tW6NOU0qjPI1dIrfBsYxiO0SLIxZDqD6xcLnf5GVUhv58ml0s65O9T9UMaBIEolUrCsqyIuyhyCeF5XsS/adxZtFZ4pBm5i2i1WjJvumspIX5x7UCuqMrlcqRO1KPITPWgu98Soc9XU76oLehZy8vLsfWvQuUf1OURufQyYdu2cBynKyzpGdTP+snzTkN1Hue+Q0f1j6u6GmEYhmHGg7gxaWNjQ1iW1TXeU3ok6Kw4yA0VjcWmsZ8gN46qViINEucOivKsaiJ6ZtK4nMTA4rRYLArXdWVBaYAkoRlHEATS35Vt29LpPfkLpcpQK50qyfM8OYCb0qmQiHIcR+TzeZlP8oUZ1yhxDu7jUAU53V91cq+mI8e5lJbKpAtAEudUT2p5qb50yP8ntYH+/NXV1cizHcdJrIc436dCqSPLshLvoUP37Dc9vQhx/Yk+TqitqJ/EpRdKPfXbvjsJ5V//MdKh+o+74sT8KKD2wbgfOGb32djYkO9rr3dqt6AJCvUjnmG2k42NjchvmPpe2LYt8vm8ccxMwjQmra6uSs2iT37puqCfsUx9l01X3GScSTfoekXHpIm28ls/kDjdaajxBvmBVE+GYkYDEl/9tAnNSutfkzo0S00vQdKLQ/ccZfFm27awlFPL9iL66okK/aAN8q6b2KzDZ5Vh3GM72Ml80aC21fYYNiSeXdcdubzp0Ef0ZmaOdrKtmf4xvRe0EmopJ0X2YhzGpN1mYJvTnYQ24MTZZ5qgjVeDui1gto9cLgfHcXDmzJkuOxadVCqFmzdvdtmu6Bw/fhw3b96EEALXrl0zugwjaGPV+fPn9aiR4fz58+h0OnKD4F5E97DAjC50QMcoUavVcO+99+KRRx7B+vp6l50ew2w3pvcinU5jcXERi4uLOHLkSF82oeMwJu06ulodJWhWbBDoi3PQKXZmewmCQFgJtq7bRb9L5qOAaZlnL0EzSabZIN/3he/7W+4bGxsbwvf9Lb3/w7jHdrCT+aLf0VGZnaTfj83MQu4WQRAI3/eNpgdUv3HsZFuPI5udkd4qvd4L+o1LWskbpzFpN4l/O3YZPzT+1Te+9ALh8uBWBzlm+JB9sW3b2y7AaKll3MQe/XBtxoZp1EkSp8xo0WsQ3mnoXR6V/GwVGqeYwSFtMIriNGm5flzHpN1iZJf1ydF9vV7vcncUh+r4vNcRoczOk0qlcPXqVZw+fRp//etfey7dbwU6TjcIgr77zyiQy+XkSVdUBob5X6bZbEoXgHthKZ8P6NgavU4v2k1SqRTy+TyCIOga38Z1TNo1dLXKMAyzFdTd1DRD5DiOcZNH3O5w8thAlzpLEgRBZFcouWnr5RFgdXVV5kHNl5q21z1EOLut3idut245dNtG6UQ460PPIK8X/RCXL1P96fVj8uJBqJs5KL3necaNH4SpfV3XjSxlqruO6Z6EWi+u63bVmw71hTiPJaurq5G8CMPOYeojJnzfF57nRXZJe55nLLvosx+RiQ6VkdD7hHpROlNb+4orIIR9Ti2P+jzHcSJ5L5fLXTuv++13hKnMrut2tQn1J71vmGYK9XK2Qm81at/QTSLUcupXqVSK7Qtq3lUGya/oY+ZUhM+DwUUUMxgsThmGGRpkugFNTJC5Ag0iOjQgqT/6tARmMu1ptVoCBpt0EiT6M1RfwSTUKEwVDyLhHkLJkyr46D6WwecsDVQ04NmhexW6D3rYp6kk5Yvqj8RqsViMDPQm+7YNg29CEgiUN30QpvZV/0b9MFDLQmXXw4Xifqcf+hEE1B8QLplSPat1YNt2l0infukoPh1VIajne5B+ZAonW1K1fulShZiprdV3SC+HUMSe2gepn6muGynM1CdMUH+gMqv30Mum9ye1b5ieR+Uk10X5fD7y4aO/+77vy3olEU4XlZv6neM4Mk9Ub1DE6Wby209fFGy2MRS49hiGGRo0kJkEFA1opjjTjz4NMpZlRdIKxZ+xPsNRirFrpcFOJ5/Pd4mKuHuQmzo9vVDKZoqjgUoXY6rQ7Ye4fAml/hxtwyEJGl3EC0XMmAbauJlTal+93qmt9OeoQoIolUpd+UyC6q8XlE6/dyu0A4T2wRSEm6wsgws3qjc9bpB+5CfYRvYqU1xbUzn0GUVhEPzUX039i+6jf0zpxJWBPgbU8Lj+RO+qKY7KaVlWpEzq3+h5jMuTCsK+SAJWKO8bsZn8mn6nTPSbjolnZG1OGYYZP5aWloDwGDydQV1JZTIZOI6DTqeDtbW1SNzbb78N27YHtt3S3bwsLi5ifX09EhbHO++8AwB4+umn9SjMzc0B4fnScedlv/LKK5H/P/zww4By/vQwePnllyPHCz/wwANAaOem0mg0UK/XYdu20Y7T5DIHSvvq9U7nZgdBECnP3NwcPM9DvV7HwsICarUazpw5g5WVlYGOQR4E/d5kBwjliG0A+Oyzz9DpdJDL5bryksvlYFkWOp0Ovvzyy0gcttiPtgKV4+9//3skfG1tDUEQRI6WpP76xBNPKCl/gfrFlStX9KgIb775JmDo86lUCkIIWeak/pROp6W95SeffBKJI/L5fOTs9XQ6LY/svnHjhpKyf4IgwBtvvCHzs7i4iF9069bzy2w/LE4ZhhkKtVoNnU4HCH/gh8Gzzz4LAPj4449lWLvdxtLSEo4ePaqkTIb8CRYKBUxNTeHixYuxIjKOlZUVAMDtt9+uR0UG1u+++y4SR+gCyHSfrXLLLbdE/h/XDtVqFUgQoSbU9p2YmOi6CF1MXLhwAbZto1Ao4NChQ/joo49i8zUMTPe+44479CApVOM+mkjAffPNNzJsGP1oKzz++OOA0heJ8+fPw3XdSNkpzUMPPdTVVtT+P/zwg0xvgnyN9+qrvfrTfffdBwD46quv9CgAwK233qoHxd5rEHThSWw1v8z2w+KUYZiRhWZgK5WKFAHvv/8+AOCZZ56JpE1idnYWvu/DdV0EQYDnnnsO+/bt65oBY3rjui5CkzDjpQuCVCqFS5cuAQAmJycHOlRlWNx999160KbY7X5EqwlBEMhd/41GA9VqFadOndKTA7+sY8dex48f15NHoI8RhtlpWJwyDDOypFIpeJ6HTqeDzz77DABw9uxZnDhxomsmshczMzNYX19HEATI5/PodDooFAo7Jiz2CjTr1C/tdhvHjh2Tgu7JJ5/Uk2w7P//8sx60aXa7H9FqwnvvvQcAuHjxIlzX7fooINh1FTOOsDhlGGYoqDNijUYjEgcAP/30kx7UF0899RQA4MMPP8Ta2hpu3rw50KypDh03WC6XAQCXL1/WkxhxHAcA8O233+pRETvLOJEwStDxznE2h6alarV9B7GTffHFF2HbNtbX1+F5HqrV6qaEnClP/UJL8+qy9/333w8A+Prrr2WYyrVr1wAADz74oB4FbKEfbRV9NWFpack4a0r99ccff9Sj+iapz6v06k/Xr18HABw8eFCP2hW2O79b6avML7A4ZRhmKKRSKTmYvf7665G4RqMhN9MMyuzsLCzLwsrKCl566SXjBpYkarUaJiYmugQz2RT2y2OPPQYAeOutt/QoaWpAG1ZGnf379wPhsu3FixcjcZVKBfV6PRKGsH1d1wUAFItFPRrtdrurjhcWFnD16lVcuHABCO1PLctCoVDoe0aPnhlny6ujb54DgH/84x+Atjno0UcfBULbTF1M1Go1BEEQ2TAzrH6kotZBv4JfXU3IZrPGTT1Q+uupU6e6yoc+Z1TpHmfPnu26R6PRkHnev3+/3ECm13+73ZYO6U0bJTfLlStXInnqt/6wA/ml98fULkyf6Nv3GYZhNgu5ryFXL6XQp6fjONKtkMk5Nf2N7leSUH1v6q5lVMiFi+qjkFzPkN9Dofl71B2Jm+4hNB+ueYOfU92FkVCeDYNvStXHZj/E5Usk1J/qFkd/vlqn5F/SdV2Rz+dj60b1G+mEztxLpZJ0Yq+696Hy6XmKcx8UB9Wv7lZJh8oS184ml0oU5xj8nOr5G7QfUTlN7Uv+Pa3wIAbP8yLpktpaaO+Z7taLUPsr+b6l99G27S43WSbi7pHkhzXOb6gpn0nlJLddev8Riiss6oOO48h7JL1zKpvJL+XJFEfQ802/c0z/sDhlGGaokENt+uEvhae/0GBNgwpBaSm9aTAiP5omgUGoYgvKwBmEp8Coz0HMSTBx9yCoHDRIUVmojCob2ulNtnKqz6p2glKSz0bRI19x9RcEQezzCbUstm3L+iDRAINwoPrU86/Wpd7WqvBT86QLQBMksE0iT4XuSeJLfb7ezipl7QQl8heq19Ug/aisnQSlt2+r1ZJ1bFlW5GMnqa1VrJgz3FUG6a9xkABXy+N5nvE99cPTtiidlXDaVlI51f5n+k1Q3y07PHBBD6c407OJQfKrv2d6mxNUrrh4pj8mxC8vNcMwDMOMJPPz81haWoLv+7FLpeTOioc0Zrdot9vYt28fJicnpc0ysznY5pRhGIYZaV544QVYloVjx47pUQwzMpw7dw6dTkf6w2U2D4tThmEYZqRJp9N49913Ua/XMT8/r0czzK5TqVTw2muvoVgsYnZ2Vo9mBoTFKcMwDDPyzM7OYmNjA5VKBdlsNrLbXN21re+mZ5jtpNlsYn5+HkeOHEG5XMarr76qJ2E2AYtThmEYZizIZDL4/vvvcfDgQTz99NNoNptoNpvSNRYAHDhwoMs9EMNsF57nAQCCIEAul9OjmU3CG6IYhmEYhmGYkYFnThmGYRiGYZiRgcUpwzAMwzAMMzKwOGUYhmEYhmFGBhanDMMwDMMwzMjA4pRhGIZhGIYZGVicMgzDMAzDMCPD/wFjmF11JiKgaAAAAABJRU5ErkJggg==\" style=\"width: 617px; height: 62.6996px;\" width=\"617\" height=\"62.6996\"\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eIn vitro murine T cells and Treg activation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn vitro activation of CAlleR murine cells was assessed by co-culturing 0.1x10\u003csup\u003e6\u003c/sup\u003e T cells or Tregs with 0.02x10\u003csup\u003e6\u003c/sup\u003e bone marrow derived dendritic cells (BMDC) generated as previously described\u003csup\u003e45\u003c/sup\u003e in presence of Bet v1 (1 \u0026mu;g/ml) and mAb 10 (0.5 \u0026mu;g/ml) or 10% heat inactivated murine serum. Cells were incubated for 24h and upregulation of activation markers was assessed by flow cytometry.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMouse model of birch pollen induced allergic airway inflammation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBirch pollen extract (European white betula pendula, Stallergenes Greer, NC, USA, Cat. #XP527D3A25) was reconstituted in sterile PBS at 3.33 mg/ml. On days 0, 2, 4, 7, 9 and 11 mice were anesthetized by inhalation in a chamber with 4% isofluorane\u003csub\u003e\u0026nbsp;\u003c/sub\u003efor 1 min and intranasally instillated with 30 ml of diluted BPE. On days 14 or 15 mice were euthanized with 225 mg/kg intraperitoneal injection of pentobarbital (Escornakon, Streuli Pharma AG, Uznach, Switzerland).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eOrgan collection and processing\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAfter sacrifice, blood was collected from abdominal aorta for serum isolation. Lungs were extracted, cut and digested for 30 minutes at 37\u0026ordm;C with 0.2 mg/ml of Collagenase D (Sigma-Aldrich, MO, USA, Cat. #11088858001) resuspended in HBSS (Gibco), 10 mM Hepes and 5% FBS. Mediastinal lymph nodes were collected and digested the same way as lungs. Organs were then smashed on a 70 mm cell strainers with syringe plungers and stained for flow cytometry analysis. Spleens were directly smashed on 70 mm cell strainers and erythrocytes were lysed with ACK lysis buffer (155 mM NH₄Cl, 10 mM KHCO₃, 0.1 mM EDTA in distilled water, pH 7.4) prior staining for flow cytometry.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eFor bronchoalveolar lavage fluid (BALF) collection, tracheas were cannulated with a 18G Venflon\u0026trade; (BD, Cat. #393226) and flushed three times with 500 ml of ice-cold PBS supplemented with 0.2% BSA (Sigma-Aldrich, Saint-Louis, MO, USA, Cat. #A8806). Total BALF cell counts were determined with Coulter Counter Multisizer 4e (Beckman Coulter, Brea, CA, USA, Cat. #B23005). Cytospins were obtained by centrifuging 80 000 cells at 800 rpm for 5 minutes. Resulting cytospin slides were stained with RAL Diff-Quik\u0026trade; solution (CellaVisio, Lund, Sweden, Cat. #720555-0000). Percentages of monocytes/macrophages, eosinophils, neutrophils and lymphocytes were assessed by counting 200 cells per cytospin. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFlow Cytometry\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFor human samples, cells were washed once with PBS supplemented with 0.5% FBS, 0.4% EDTA. After discarding supernatant, cells were incubated for 30 minutes at 4\u0026ordm;C in same wash buffer with diluted antibodies: anti-human CD3 (UCHT-1), PECy7 (1:400 dilution), BD Biosciences, 563423; anti-human CD4 (RPA-T4), AF700 (1:400 dilution), BD Biosciences, 557922; anti-human CD8 (RPA-T8), APC-Cy7 (1:400 dilution), BD Biosciences, 557760; anti-human CD8 (SK1), PE (1:250 dilution), BD Biosciences, 345773; anti-human CD25 (M-A251), FITC (1:400 dilution), BD Biosciences, 555431; anti-human CD25 (CD25-4E3), APC (1:250 dilution), Thermo Fischer Scientific, 17-0257-42; anti-human CD64 (REA978), APC (1:200 dilution), Miltenyi Biotech, 130-116-197; anti-human CD71 (M-A712), FITC (1:400 dilution), BD Pharmigen, 555536; anti-human CD127 (hIL-7R-M21), PE (1:200 dilution), BD Biosciences, 557938; anti-human CD32 (FLI8.26), APC (1:200 dilution), BD Biosciences, 559769; anti-human CD16 (3G8), PE (1:200 dilution), BD Biosciences, 555407; Biotinylated rBet v1 (1\u0026mu;g/ml); Streptavidin, PE (1:1000 dilution), BD Biosciences, 554061; DAPI (Live/Dead), Invitrogen (1:2500 dilution), D1306; Phamtom Dye (Live/Dead), Pacific blue (1:2500 dilution), Proteintech, PD00004. After 30min incubation, samples were washed again and either resuspended in washing buffer prior flow cytometry acquisition, or permeabilized and fixed using eBioscience Foxp3/Transcription Factor Staining Buffer according to manufacturer\u0026rsquo;s instructions (Invitrogen, Cat #00-5523-00). Intracellular staining was performed with anti-human Foxp3 (PCH101), eFluor660 (1:250 dilution), Thermo Fisher scientific, 50-4776-42; Helios (22F6), PE (1:250 dilution), Biolegend, 137216.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eFor murine samples, cells were incubated with an anti-mouse CD16/32 antibody (TruStain FcX PLUS, clone S17011E), Biolegend (1:250 dilution), Cat. #156604 for 15 minutes at 4\u0026ordm;C. After blocking, cells were washed and extracellular staining was performed for 30 minutes at 4\u0026ordm;C with the following antibodies: anti-mouse CD3 (145-2C11), PE-Cy7 (1:250 dilution) and APC-Cy7 (1:100 dilution), BD Biosciences, 552774 and 561042 respectively; anti-mouse CD4 (RM4-5), PerCP-Cy5.5 (1:300 dilution) and APC (1:250 dilution), BD Biosciences, 561090 and 553051 respectively; anti-mouse CD8a (53-6.7), FITC (1:100 dilution) and Pacific Blue (1:400 dilution), BD Biosciences, 553030 and 558106 respectively; anti-mouse CD25 (PC61.5), PE (1:200 dilution), Invitrogen, 12-0251-83; anti-mouse CD25 (PC61), PerCP-Cy5.5 (1:250 dilution), BD Biosciences, 551071; anti-mouse CD44 (IM7), FITC (1:100 dilution), BD Biosciences, 553133; anti-mouse CD45 (30-F11), PE-Cy7 (1:250), BD Biosciences, 552848; anti-mouse CD45.2 (104), AF700 (1:100 dilution), Biolegend, 109821; anti-mouse CD69 (H1.2F3), PE (1:400 dilution), BD Biosciences, 553237; anti-mouse CD86 (GL1), PE (1:250 dilution), BD Biosciences, 553692; anti-mouse CD90.1 (Thy1.1; OX-7), PerCP Cy5.5 (1:250 dilution), BD Biosciences, 557266; anti-mouse CD90.1 (Thy1.1; REA838), FITC (1:500 dilution), Miltenyi Biotech, 130-112-872; anti-mouse CD11c (HL3), APC (1:100 dilution), BD Biosciences, 550261; anti-mouse CD11c (N418), APC-Cy7 (1:600 dilution), Biolegend, 117323; anti-mouse CD11b (M1/70), PEcy7 (1:600 dilution), BD Biosciences, 561098; anti-mouse MHC-II (M5/114.15.2), AF700 (1:1000 dilution), Biolegend, 107621; anti-mouse F480 (BM8), PerCP (1:100 dilution), Biolegend, 123126; anti-mouse Ly6C (HK1.4), Pacific Blue (1:1000 dilution), Biolegend, 128013; anti-mouse SiglecF (E50-2440), PE (1:100 dilution), BD Biosciences, 562068; anti-mouse Ly6G (1A8), PerCP Cy5.5 (1:100 dilution), BD Biosciences, 560602; biotinylated rBet v1 (1\u0026mu;g/ml); Streptavidin, APC (1:500 dilution) and PE (1:1000 dilution), BD Biosciences, 554067 and 554061 respectively; Aqua (Live/Dead), Amcyan (1:1000 dilution), Invitrogen, L34957; DAPI (Live/Dead), Invitrogen (1:2500 dilution), D1306. After incubation, samples were washed again and either fixed with BD FACS Lysing Solution following manufacturer\u0026rsquo;s instructions (BD Biosciences, Cat #349202) or permeabilized and fixed using eBioscience Foxp3/Transcription Factor Staining Buffer set (Invitrogen, Cat #00-5523-00) prior intracellular staining. Intracellular staining was performed with anti-mouse Foxp3 (FJK-16s), FITC (1:250 dilution) and PE (1:250 dilution), Invitrogen, 11-5773-82 and 12-5773-82 respectively; anti-mouse IL-4 (BVD6-24G2), PECy7 (1:100 dilution), invitrogen, 25-7042-41; anti-mouse IL-5 (TRFK5), APC (1:100 dilution), BD Biosciences, 562048; anti-mouse IL-13 (eBio13A), ef450 (1:100 dilution), Invitrogen, 48-7133-80; anti-mouse IL-17 (eBio17B7), PE (1:100 dilution), Invitrogen, 12-7177-81.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eSingle-cell suspensions were resuspended in supplemented PBS prior acquisition by an LSRFortessa cell analyser (BD Biosciences, Franklin Lakes, NK, USA). Flow cytometry data were analyzed using FlowJo software v10.9.0.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eLung function\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMice were anesthetized with intraperitoneal injection of 50 mg/kg of pentobarbital and intramuscular injection of 100 mg/kg ketamine. Mice were tracheotomized and a 18G metallic canula was inserted in the trachea and secured with sutures. Mice were connected to the FlexiVent FX (SCIREQ Scientific Respiratory Equipment Inc., Montr\u0026eacute;al, Canada) and mechanically ventilated a 150 breaths/min, a tidal volume of 10ml/kg and a PEEP set at 3\u0026thinsp;cm H2O. Forced oscillation perturbation was performed to test the lung to a standardized signal of oscillatory frequencies above and below the normal ventilation frequency. Changes in resistance to increasing concentrations of nebulized acetyl-b-methacholine chloride (Sigma Aldrich) were measured from snapshot perturbation measurements taken using the forced oscillation perturbation technique.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eImmunofluorescense organ staining, imaging and analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMice were euthanized and lungs, mediastinal lymph nodes and spleen were dissected and fixed in 4% parafolmaldehyde (PFA, Sigma Aldrich, Saint-Louis, MO, USA, Cat. #158127) overnight at 4\u0026ordm;C under shaking conditions. Organs were then washed three times in PBS and incubated in PBS with 30% sucrose overnight at 4\u0026ordm;C prior to embedding in Tissue-Tek (Sakura, Osaka, Japan, Cat. #4583) and snap-frozen in dry ice. Organ sections were cut with 10\u0026mu;m thickness and assembled in microscopy slides for further staining. Slides were fixed in 4% PFA for 5 minutes, washed three times with room temperature PBS and incubated at room temperature in blocking buffer (PBS supplemented with 5% donkey serum, 0.5% BSA, 0.1% Triton-X-100, 0.01% sodium azide) for 30 minutes. Primary antibodies (rabbit anti-GFP (Abcam, Cambridge, UK, Cat #ab290; 1:2000 dilution), rat anti-mouse B220 (Thermo Fisher Scientific, Waltham, MA, USA, Cat #14-0452-81; 1:600 dilution), armenian hamster anti-mouse CD11c (BD Biosciences, Franklin Lakes, NJ, USA, Cat #550283; 1:200 dilution) were diluted in blocking buffer and incubated overnight at 4\u0026ordm;C. Slides were then washed with PBS 0.3% Triton X-100 and secondary antibodies (IgG donkey anti-rabbit-AF488 (Thermo Fisher Scientific, Waltham, MA, USA, Cat #A-21206; 1:300 dilution), IgG chicken anti-rat-AF647 (Thermo Fisher Scientific, Waltham, MA, USA, Cat #A-21472; 1:300 dilution), IgG goat anti-armenian hamster-biotinylated (Jackson Immuno Research, West Grove, PA, USA, Cat #127-065-160; 1:600 dilution)) were diluted in blocking buffer and incubated 1h at room temperature. After secondary staining, washing step was repeated three additional times and Streptavidin-AF555 (Thermo Fisher Scientific, Waltham, MA, USA, Cat #S32355; 1:300 dilution) was diluted in blocking buffer, added to the slides and incubated for 1h at room temperature. Slides were washed again and mounted with Fluoromount-G Mounting Medium with DAPI (Thermo Fisher Scientific, Waltham, MA, USA, Cat #00-4959-52) prior storage at 4\u0026ordm;C.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eImages were acquired at 20x magnification with Hamamatsu NanoZoomer S60 slide scanner and analyzed with QuPath software v0.5.1\u003csup\u003e46\u003c/sup\u003e. Briefly, whole-slide images were imported into the software and after necessary adjustments to color normalization, regions of interest (ROI) were manually annotated to analyze whole stained tissues. A machine learning-based classifier was developed in QuPath to differentiate positive and negative cells for each channel. Classifier\u0026rsquo;s performance was improved by refining the training dataset and adjusting classifier parameters. Then, automated cell detection was performed using QuPath\u0026rsquo;s built-in cell detection algorithm. The trained classifier was then applied to the detected cells, categorizing them as positive or negative based on the learned features. The number of GFP\u003csup\u003e+\u003c/sup\u003e cells was calculated for each ROI and density of cells was assessed by dividing the number of detected positive cells by the area of ROI. Cell interactions were quantified by determining the number of double positive cells.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFor experiments involving human primary cells, each replicate corresponded to a unique healthy donor. In animal experiments, each replicate represented a single mouse, except for immunofluorescence staining, where two separate slides per organ were independently prepared, stained, and analyzed as technical replicates. Statistical analyses were performed using GraphPad Prism version 10.4.1 (GraphPad Software, Boston, MA, USA). The specific statistical tests used for each experiment are detailed in the corresponding figure legends, along with exact P values. Normality of the data was assessed using the Shapiro-Wilk test.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eData are available in the article and supplementary information or from the corresponding author upon reasonable request. Source data are provided with this paper. Cryo-EM map is available on Zenodo () and will be made public upon publication. A private access link has been provided for peer review ().\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe thank the Immunology and Allergy Division of the Centre Hospitalier Universitaire Vaudois (CHUV) and the Center for Immunotherapy and Vaccinology for their support. We are grateful to the Dubochet Center for Imaging (DCI Lausanne) at the École Polytechnique Fédérale de Lausanne (EPFL) and University of Lausanne (Unil) for their assistance and to the PSPST platform at EPFL for their help in the antibody production and characterization. We also thank the Cellular imaging Facility of Unil for assistance with immunofluorescense image analysis, and the Unil’s animal facility for their dedicated animal care. Finally, we thank the patient and healthy donors who voluntarily contributed to this study.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eYDM received funding for this project from the Gabriella Giorgi-Cavaglieri Foundation, and AAS was supported by educational grants from the Martin Escudero Foundation and the Machaon Foundation.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contribution\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eConceptualization and supervision: YDM.\u003c/p\u003e\n\u003cp\u003eDesigned experiments: AAS, YDM, LP, CF, AT, NU.\u003c/p\u003e\n\u003cp\u003ePerformed experiments: AAS, AT, RPO, NC, RC, EL, LE, OAA, EP, AS, SG, CF, JC.\u003c/p\u003e\n\u003cp\u003eAnalyzed data: AAS, AT, LP, CF, YDM.\u003c/p\u003e\n\u003cp\u003eProvided reagents and advice: AT, LP, NU, AS, SG, CF, CG, AM.\u003c/p\u003e\n\u003cp\u003eWrote original draft: AAS, YDM.\u003c/p\u003e\n\u003cp\u003eReviewed and edited the manuscript: all.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAll authors approved the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics declaration\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCompeting interests:\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eA patent application (EP25183719.1) based on the findings of this study has been filled by PACTT (Technology transfer office UNIL-CHUV) with YDM and AAS listed as inventors. The other authors declare no competing interests.\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003e(GINA), G.I.f.A. Global Strategy for Asthma Management and Prevention, 2024. 2024.\u003c/li\u003e\n\u003cli\u003ePapi, A., Brightling, C., Pedersen, S.E. \u0026amp; Reddel, H.K. Asthma. \u003cem\u003eLancet\u003c/em\u003e \u003cstrong\u003e391\u003c/strong\u003e,783-800 (2018).\u003c/li\u003e\n\u003cli\u003eMaddox, L. \u0026amp; Schwartz, D.A. The pathophysiology of asthma. \u003cem\u003eAnnu Rev Med\u003c/em\u003e \u003cstrong\u003e53\u003c/strong\u003e,477-498 (2002).\u003c/li\u003e\n\u003cli\u003eBrusselle, G.G. \u0026amp; Koppelman, G.H. Biologic Therapies for Severe Asthma. \u003cem\u003eN Engl J Med\u003c/em\u003e \u003cstrong\u003e386\u003c/strong\u003e,157-171 (2022).\u003c/li\u003e\n\u003cli\u003eIsrael, E. \u0026amp; Reddel, H.K. Severe and Difficult-to-Treat Asthma in Adults. \u003cem\u003eN Engl J Med\u003c/em\u003e \u003cstrong\u003e377\u003c/strong\u003e,965-976 (2017).\u003c/li\u003e\n\u003cli\u003eCox, L.\u003cem\u003e et al.\u003c/em\u003e Allergen immunotherapy: a practice parameter third update. \u003cem\u003eJ Allergy Clin Immunol\u003c/em\u003e \u003cstrong\u003e127\u003c/strong\u003e,S1-55 (2011).\u003c/li\u003e\n\u003cli\u003eBiedermann, T.\u003cem\u003e et al.\u003c/em\u003e Birch pollen allergy in Europe. \u003cem\u003eAllergy\u003c/em\u003e \u003cstrong\u003e74\u003c/strong\u003e,1237-1248 (2019).\u003c/li\u003e\n\u003cli\u003eSchenk, M.F.\u003cem\u003e et al.\u003c/em\u003e Proteomic analysis of the major birch allergen Bet v 1 predicts allergenicity for 15 birch species. \u003cem\u003eJ Proteomics\u003c/em\u003e \u003cstrong\u003e74\u003c/strong\u003e,1290-1300 (2011).\u003c/li\u003e\n\u003cli\u003eWahn, U., Bachert, C., Heinrich, J., Richter, H. \u0026amp; Zielen, S. Real-world benefits of allergen immunotherapy for birch pollen-associated allergic rhinitis and asthma. \u003cem\u003eAllergy\u003c/em\u003e \u003cstrong\u003e74\u003c/strong\u003e,594-604 (2019).\u003c/li\u003e\n\u003cli\u003eAkbari, O., Stock, P., DeKruyff, R.H. \u0026amp; Umetsu, D.T. Role of regulatory T cells in allergy and asthma. \u003cem\u003eCurr Opin Immunol\u003c/em\u003e \u003cstrong\u003e15\u003c/strong\u003e,627-633 (2003).\u003c/li\u003e\n\u003cli\u003eRaffin, C., Vo, L.T. \u0026amp; Bluestone, J.A. T(reg) cell-based therapies: challenges and perspectives. \u003cem\u003eNat Rev Immunol\u003c/em\u003e \u003cstrong\u003e20\u003c/strong\u003e,158-172 (2020).\u003c/li\u003e\n\u003cli\u003eBaeten, P., Van Zeebroeck, L., Kleinewietfeld, M., Hellings, N. \u0026amp; Broux, B. Improving the Efficacy of Regulatory T Cell Therapy. \u003cem\u003eClin Rev Allergy Immunol\u003c/em\u003e \u003cstrong\u003e62\u003c/strong\u003e,363-381 (2022).\u003c/li\u003e\n\u003cli\u003eAtanasio, A.\u003cem\u003e et al.\u003c/em\u003e Targeting immunodominant Bet v 1 epitopes with monoclonal antibodies prevents the birch allergic response. \u003cem\u003eJ Allergy Clin Immunol\u003c/em\u003e \u003cstrong\u003e149\u003c/strong\u003e,200-211 (2022).\u003c/li\u003e\n\u003cli\u003eGajhede, M.\u003cem\u003e et al.\u003c/em\u003e X-ray and NMR structure of Bet v 1, the origin of birch pollen allergy. \u003cem\u003eNat Struct Biol\u003c/em\u003e \u003cstrong\u003e3\u003c/strong\u003e,1040-1045 (1996).\u003c/li\u003e\n\u003cli\u003eChang, Z.L.\u003cem\u003e et al.\u003c/em\u003e Rewiring T-cell responses to soluble factors with chimeric antigen receptors. \u003cem\u003eNat Chem Biol\u003c/em\u003e \u003cstrong\u003e14\u003c/strong\u003e,317-324 (2018).\u003c/li\u003e\n\u003cli\u003eGuilliams, M., Bruhns, P., Saeys, Y., Hammad, H. \u0026amp; Lambrecht, B.N. The function of Fcgamma receptors in dendritic cells and macrophages. \u003cem\u003eNat Rev Immunol\u003c/em\u003e \u003cstrong\u003e14\u003c/strong\u003e,94-108 (2014).\u003c/li\u003e\n\u003cli\u003eWagner, J.C., Ronin, E., Ho, P., Peng, Y. \u0026amp; Tang, Q. Anti-HLA-A2-CAR Tregs prolong vascularized mouse heterotopic heart allograft survival. \u003cem\u003eAm J Transplant\u003c/em\u003e \u003cstrong\u003e22\u003c/strong\u003e,2237-2245 (2022).\u003c/li\u003e\n\u003cli\u003eLanitis, E.\u003cem\u003e et al.\u003c/em\u003e Redirected antitumor activity of primary human lymphocytes transduced with a fully human anti-mesothelin chimeric receptor. \u003cem\u003eMol Ther\u003c/em\u003e \u003cstrong\u003e20\u003c/strong\u003e,633-643 (2012).\u003c/li\u003e\n\u003cli\u003eHombach, A.\u003cem\u003e et al.\u003c/em\u003e An anti-CD30 chimeric receptor that mediates CD3-zeta-independent T-cell activation against Hodgkin\u0026apos;s lymphoma cells in the presence of soluble CD30. \u003cem\u003eCancer Res\u003c/em\u003e \u003cstrong\u003e58\u003c/strong\u003e,1116-1119 (1998).\u003c/li\u003e\n\u003cli\u003eFu, R.Y.\u003cem\u003e et al.\u003c/em\u003e CD4(+) T cells engineered with FVIII-CAR and murine Foxp3 suppress anti-factor VIII immune responses in hemophilia a mice. \u003cem\u003eCell Immunol\u003c/em\u003e \u003cstrong\u003e358\u003c/strong\u003e,104216 (2020).\u003c/li\u003e\n\u003cli\u003eTenspolde, M.\u003cem\u003e et al.\u003c/em\u003e Regulatory T cells engineered with a novel insulin-specific chimeric antigen receptor as a candidate immunotherapy for type 1 diabetes. \u003cem\u003eJ Autoimmun\u003c/em\u003e \u003cstrong\u003e103\u003c/strong\u003e,102289 (2019).\u003c/li\u003e\n\u003cli\u003eQiu, Y.\u003cem\u003e et al.\u003c/em\u003e Mechanical force determines chimeric antigen receptor microclustering and signaling. \u003cem\u003eMol Ther\u003c/em\u003e \u003cstrong\u003e32\u003c/strong\u003e,1016-1032 (2024).\u003c/li\u003e\n\u003cli\u003ePorret, R.\u003cem\u003e et al.\u003c/em\u003e T cell receptor precision editing of regulatory T cells for celiac disease. \u003cem\u003eSci Transl Med\u003c/em\u003e \u003cstrong\u003e17\u003c/strong\u003e,eadr8941 (2025).\u003c/li\u003e\n\u003cli\u003eMuller, Y.D.\u003cem\u003e et al.\u003c/em\u003e Precision Engineering of an Anti-HLA-A2 Chimeric Antigen Receptor in Regulatory T Cells for Transplant Immune Tolerance. \u003cem\u003eFront Immunol\u003c/em\u003e \u003cstrong\u003e12\u003c/strong\u003e,686439 (2021).\u003c/li\u003e\n\u003cli\u003eFischer, U.M.\u003cem\u003e et al.\u003c/em\u003e Pulmonary passage is a major obstacle for intravenous stem cell delivery: the pulmonary first-pass effect. \u003cem\u003eStem Cells Dev\u003c/em\u003e \u003cstrong\u003e18\u003c/strong\u003e,683-692 (2009).\u003c/li\u003e\n\u003cli\u003eMikhak, Z., Strassner, J.P. \u0026amp; Luster, A.D. Lung dendritic cells imprint T cell lung homing and promote lung immunity through the chemokine receptor CCR4. \u003cem\u003eJ Exp Med\u003c/em\u003e \u003cstrong\u003e210\u003c/strong\u003e,1855-1869 (2013).\u003c/li\u003e\n\u003cli\u003eAfshar, R.\u003cem\u003e et al.\u003c/em\u003e Compartmentalized chemokine-dependent regulatory T-cell inhibition of allergic pulmonary inflammation. \u003cem\u003eJ Allergy Clin Immunol\u003c/em\u003e \u003cstrong\u003e131\u003c/strong\u003e,1644-1652 (2013).\u003c/li\u003e\n\u003cli\u003eXu, W.\u003cem\u003e et al.\u003c/em\u003e Adoptive transfer of induced-Treg cells effectively attenuates murine airway allergic inflammation. \u003cem\u003ePLoS One\u003c/em\u003e \u003cstrong\u003e7\u003c/strong\u003e,e40314 (2012).\u003c/li\u003e\n\u003cli\u003eKearley, J., Barker, J.E., Robinson, D.S. \u0026amp; Lloyd, C.M. Resolution of airway inflammation and hyperreactivity after in vivo transfer of CD4+CD25+ regulatory T cells is interleukin 10 dependent. \u003cem\u003eJ Exp Med\u003c/em\u003e \u003cstrong\u003e202\u003c/strong\u003e,1539-1547 (2005).\u003c/li\u003e\n\u003cli\u003eJin, G.\u003cem\u003e et al.\u003c/em\u003e A single infusion of engineered long-lived and multifunctional T cells confers durable remission of asthma in mice. \u003cem\u003eNat Immunol\u003c/em\u003e \u003cstrong\u003e25\u003c/strong\u003e,1059-1072 (2024).\u003c/li\u003e\n\u003cli\u003eEsensten, J.H., Muller, Y.D., Bluestone, J.A. \u0026amp; Tang, Q. Regulatory T-cell therapy for autoimmune and autoinflammatory diseases: The next frontier. \u003cem\u003eJ Allergy Clin Immunol\u003c/em\u003e \u003cstrong\u003e142\u003c/strong\u003e,1710-1718 (2018).\u003c/li\u003e\n\u003cli\u003eMoser, R., Fehr, J. \u0026amp; Bruijnzeel, P.L. IL-4 controls the selective endothelium-driven transmigration of eosinophils from allergic individuals. \u003cem\u003eJ Immunol\u003c/em\u003e \u003cstrong\u003e149\u003c/strong\u003e,1432-1438 (1992).\u003c/li\u003e\n\u003cli\u003eArpaia, N.\u003cem\u003e et al.\u003c/em\u003e A Distinct Function of Regulatory T Cells in Tissue Protection. \u003cem\u003eCell\u003c/em\u003e \u003cstrong\u003e162\u003c/strong\u003e,1078-1089 (2015).\u003c/li\u003e\n\u003cli\u003eBailey-Bucktrout, S.L.\u003cem\u003e et al.\u003c/em\u003e Self-antigen-driven activation induces instability of regulatory T cells during an inflammatory autoimmune response. \u003cem\u003eImmunity\u003c/em\u003e \u003cstrong\u003e39\u003c/strong\u003e,949-962 (2013).\u003c/li\u003e\n\u003cli\u003eHoffmann, P.\u003cem\u003e et al.\u003c/em\u003e Loss of FOXP3 expression in natural human CD4+CD25+ regulatory T cells upon repetitive in vitro stimulation. \u003cem\u003eEur J Immunol\u003c/em\u003e \u003cstrong\u003e39\u003c/strong\u003e,1088-1097 (2009).\u003c/li\u003e\n\u003cli\u003eCacheiro-Llaguno, C.\u003cem\u003e et al.\u003c/em\u003e Polysensitisation is associated with more severe symptoms: The reality of patients with allergy. \u003cem\u003eClin Exp Allergy\u003c/em\u003e \u003cstrong\u003e54\u003c/strong\u003e,607-620 (2024).\u003c/li\u003e\n\u003cli\u003eRuiz-Hornillos, J.\u003cem\u003e et al.\u003c/em\u003e Profilin is a marker of severity in allergic respiratory diseases. \u003cem\u003eAllergy\u003c/em\u003e \u003cstrong\u003e75\u003c/strong\u003e,853-861 (2020).\u003c/li\u003e\n\u003cli\u003eTraggiai, E.\u003cem\u003e et al.\u003c/em\u003e An efficient method to make human monoclonal antibodies from memory B cells: potent neutralization of SARS coronavirus. \u003cem\u003eNat Med\u003c/em\u003e \u003cstrong\u003e10\u003c/strong\u003e,871-875 (2004).\u003c/li\u003e\n\u003cli\u003eFenwick, C.\u003cem\u003e et al.\u003c/em\u003e A highly potent antibody effective against SARS-CoV-2 variants of concern. \u003cem\u003eCell Rep\u003c/em\u003e \u003cstrong\u003e37\u003c/strong\u003e,109814 (2021).\u003c/li\u003e\n\u003cli\u003eEmsley, P., Lohkamp, B., Scott, W.G. \u0026amp; Cowtan, K. Features and development of Coot. \u003cem\u003eActa Crystallogr D Biol Crystallogr\u003c/em\u003e \u003cstrong\u003e66\u003c/strong\u003e,486-501 (2010).\u003c/li\u003e\n\u003cli\u003eLiebschner, D.\u003cem\u003e et al.\u003c/em\u003e Macromolecular structure determination using X-rays, neutrons and electrons: recent developments in Phenix. \u003cem\u003eActa Crystallogr D Struct Biol\u003c/em\u003e \u003cstrong\u003e75\u003c/strong\u003e,861-877 (2019).\u003c/li\u003e\n\u003cli\u003eGoddard, T.D.\u003cem\u003e et al.\u003c/em\u003e UCSF ChimeraX: Meeting modern challenges in visualization and analysis. \u003cem\u003eProtein Sci\u003c/em\u003e \u003cstrong\u003e27\u003c/strong\u003e,14-25 (2018).\u003c/li\u003e\n\u003cli\u003eYousefzadeh, M.J.\u003cem\u003e et al.\u003c/em\u003e Mechanism of suppression of chromosomal instability by DNA polymerase POLQ. \u003cem\u003ePLoS Genet\u003c/em\u003e \u003cstrong\u003e10\u003c/strong\u003e,e1004654 (2014).\u003c/li\u003e\n\u003cli\u003eMuller, Y.D. \u003cem\u003eet al\u003c/em\u003e. The CD28-Transmembrane Domain Mediates Chimeric Antigen Receptor Heterodimerization with CD28. \u003cem\u003eFront Immunol\u003c/em\u003e \u003cstrong\u003e12\u003c/strong\u003e, 639818 (2021).\u003c/li\u003e\n\u003cli\u003eAlcaraz-Serna, A.\u003cem\u003e et al.\u003c/em\u003e Immune synapse instructs epigenomic and transcriptomic functional reprogramming in dendritic cells. \u003cem\u003eSci Adv\u003c/em\u003e \u003cstrong\u003e7\u003c/strong\u003e (2021).\u003c/li\u003e\n\u003cli\u003eBankhead, P.\u003cem\u003e et al.\u003c/em\u003e QuPath: Open source software for digital pathology image analysis. \u003cem\u003eSci Rep\u003c/em\u003e \u003cstrong\u003e7\u003c/strong\u003e,16878 (2017).\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-7301724/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7301724/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eAsthma is a deadly chronic respiratory disease affecting over 300 million people. While allergen immunotherapy remains the only disease-modifying treatment, it is poorly applicable for patients with severe asthma. Here we explored the therapeutic potential of regulatory T cells (Tregs) armed with chimeric allergen receptors -named CAlleR- redirected against the major allergen of birch pollen Bet v1. Four novel anti-Bet v1 antibodies were identified and used to engineer and functionally validate CAlleR. CAlleR Tregs showed specific activation and \u003cem\u003ein vitro\u003c/em\u003e suppression and significantly reduced the airway hyperresponsiveness in birch pollen- sensitized mice. Mechanistically, CAlleR Tregs migrated to the lungs and mediastinal lymph nodes, interacted with CD11c⁺ dendritic cells and were activated in a FcγR-dependent manner by complexing birch allergens with allosteric anti-Bet v1 antibodies. These findings unveil a novel mechanism for targeting soluble antigens and highlight the potential of CAlleR Tregs to prevent and treat severe allergies.\u003c/p\u003e","manuscriptTitle":"Chimeric Allergen Receptor regulatory T cells suppress birch pollen allergic airway inflammation.","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-08-08 17:57:07","doi":"10.21203/rs.3.rs-7301724/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"2ebf10c5-fddd-4fcc-ab91-8e9ed3516842","owner":[],"postedDate":"August 8th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":52829378,"name":"Health sciences/Diseases/Immunological disorders/Inflammatory diseases/Allergy"},{"id":52829379,"name":"Health sciences/Diseases/Immunological disorders/Inflammatory diseases/Asthma"},{"id":52829380,"name":"Biological sciences/Immunology/Translational immunology"},{"id":52829381,"name":"Biological sciences/Immunology/Antigen processing and presentation/Immune tolerance"},{"id":52829382,"name":"Biological sciences/Immunology/Lymphocytes/T cells/CD4-positive T cells/Regulatory T cells"}],"tags":[],"updatedAt":"2025-09-11T15:00:37+00:00","versionOfRecord":[],"versionCreatedAt":"2025-08-08 17:57:07","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7301724","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7301724","identity":"rs-7301724","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}