Genetic inheritance and identification of molecular markers linked to male sterility in African marigold (Tagetes erecta L.)

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher

Abstract

Abstract The demand for hybrid varieties of African marigold (Tagetes erecta L.) is on the rise due to the increased productivity and uniformity exhibited by F1 hybrids. To simplify the hybridization process, the use of a male sterile line is essential, as emasculation can be complicated due to the unique flower structure of marigold. In this study, seed-propagated petaloid male sterile lines with a genetic inheritance were employed. The inheritance of sterility was investigated across six generations (P1, P2, F1, F2, BC1 and BC2) and confirmed a single dominant gene governing petaloid male sterility over multiple seasons. The identification of molecular markers closely linked to the male sterility locus is crucial for accurately identifying genotypes with the desired traits within breeding populations. The marker CPSSR-39 exhibited clear and consistent segregation, following a Mendelian 1:1 ratio in accordance with the genes governing petaloid male sterility. This study represents the first report of genic petaloid male sterility and demonstrates the validation of linked markers, highlighting the potential use of CPSSR-39 in marker-assisted selection in marigold. This breakthrough opens up numerous opportunities for the commercial hybrid seed production of marigold, marking a significant advancement in marigold breeding.
Full text 111,293 characters · extracted from preprint-html · click to expand
Genetic inheritance and identification of molecular markers linked to male sterility in African marigold (Tagetes erecta L.) | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Genetic inheritance and identification of molecular markers linked to male sterility in African marigold ( Tagetes erecta L.) Akkalareddy Sumalatha This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6810176/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract The demand for hybrid varieties of African marigold ( Tagetes erecta L.) is on the rise due to the increased productivity and uniformity exhibited by F 1 hybrids. To simplify the hybridization process, the use of a male sterile line is essential, as emasculation can be complicated due to the unique flower structure of marigold. In this study, seed-propagated petaloid male sterile lines with a genetic inheritance were employed. The inheritance of sterility was investigated across six generations (P 1 , P 2 , F 1 , F 2 , BC 1 and BC 2 ) and confirmed a single dominant gene governing petaloid male sterility over multiple seasons. The identification of molecular markers closely linked to the male sterility locus is crucial for accurately identifying genotypes with the desired traits within breeding populations. The marker CPSSR-39 exhibited clear and consistent segregation, following a Mendelian 1:1 ratio in accordance with the genes governing petaloid male sterility. This study represents the first report of genic petaloid male sterility and demonstrates the validation of linked markers, highlighting the potential use of CPSSR-39 in marker-assisted selection in marigold. This breakthrough opens up numerous opportunities for the commercial hybrid seed production of marigold, marking a significant advancement in marigold breeding. Molecular Genetics African marigold Mendelian Genetics Petaloid flower Male sterility SSR markers Figures Figure 1 Figure 2 INTRODUCTION Among flower crops, marigold ( Tagetes erecta L.), a member of the Asteraceae family, is gaining popularity due to the rising demand for loose flowers in the market as well as an industrial input for the extraction of carotenoids. There is a global market for carotenoids as food colourants, animal feed, and nutraceuticals (Berman et al., 2015 ). Carotenoids are natural pigments with antioxidative properties that guard against oxidative stress (Sandmann, 2014 ). Some carotenoids are chemically synthesized, while marigold is the major natural source of carotene (Rodrigues et al., 2019 ) and hence area under cultivation of marigold has been increasing over the years, and so is the rise in demand for hybrid seeds of marigold. Marigold flower has a capitulum inflorescence consisting of ray and disc florets. Functional anthers in marigold are hidden within disc florets in the centre of the flower, making emasculation a difficult process. Male sterility is the major approach to avoid emasculation to cut down the labour and cost of hybrid seed production and ensures varietal purity (Chen and Liu, 2014 ; Kim and Zhang, 2018 , Du et al., 2020 ). In marigold, apetaloid and petaloid are the two types of male sterility reported. The absence of ray florets is associated with apetaloid male sterility (Gupta et al., 1999 , He et al., 2009 ; Tejaswini et al. , 2016a), while flowers with only ray florets are associated with petaloid male sterility (Tejaswini et al. , 2016a). In marigold, apetaloid male sterility is reported to be controlled by a single recessive gene (Gupta et al., 1999 , He et al., 2009 ; Tejaswini et al ., 2016a) while petaloids are reported to be cytoplasmic inheritance and maintained by vegetative propagation (Kumar et al., 2017 , Tejaswini et al. , 2016b). In the GMS system of apetaloid male sterility, the segregation occurs at a 1:1 ratio necessitating the removal of 50% fertile plants, which is time and labour-consuming and also difficult to identify prior to flowering. Identifying molecular markers tightly linked to the male sterility locus helps in the early and accurate identification of male sterile genotypes at the seedling stage itself (Hayashi et al., 2011 , Naresh et al., 2018 . The use of molecular markers linked to male sterility has been reported in crops such as rice (Wang et al., 2004 ), rapeseed (Hong et al., 2006 ) and lettuce Hayashi et al., 2011 ). Marker systems such as SCAR (He et al., 2009 ) AFLP ((He et al., 2010 ) and SSR (Asha et al., 2019 ) linked to apetaloid sterility have been reported. Though sufficient work has been reported with apetaloid sterility in marigold, there is not much information available on seed-propagated petaloid male sterility either in terms of gene action or in terms of a molecular marker associated with that. Apetaloid flowers are not marketable as the petals are absent. Hybrids produced from petaloid male sterile lines exhibit good combining ability for increased flower weight and biochemical components compared to apetaloid sterile lines (Santosh et al. , 2018). In this study, we tried to unravel the gene action associated with seed-propagated petaloid male sterility and the marker associated with that, in an attempt to widen the genetic base of male sterility in marigold. MATERIALS AND METHODS Plant materials for the present study were selected from the progeny population of an ongoing marigold breeding program at ICAR-Indian Institute of Horticultural Research, Bengaluru, India. Thousands of progeny plants resulting from distant hybridization and selected inter-breeding during 2010-2018 were screened. The petaloid male sterility governed by nuclear genes was fixed by intercrossing within male sterile lines and stabilized over generations during marigold breeding programme. Plant material Three male sterile lines viz., IIHRMOP 1111, IIHRMOP 22 and IIHRMOP 228, were used for the present experiment. Each one of these male sterile lines consisted of both fertile and male sterile plants. Intercrossing between sterile and fertile plants within the individual line was attempted along with the selfing of fertile plants of the same line. Observations on the number of fertile and sterile plants resulting from intercrossing as well as selfing were recorded in the F 1 generation, and a segregating ratio was worked out for each one of the three male sterile lines under study (Table 1). Line IIHRMOP 1111 is selected based on the stability in segregation. For confirmation of genes governing the sterility and to ensure the stability of the segregation, repeated intercrossing between sterile and fertile plants of the selected line IIHRMOP 1111, along with the selfing of fertile plants for three consecutive seasons, was performed. Observations on the segregation of fertile and sterile plants were recorded in progenies from intercrossing as well as selfing.. Development of F 1 , F 2 , BC 1 and BC 2 (Six generation mean analysis) The petaloid male sterile line (IIHRMOP 1111) crossed with a fertile variety Pusa Narangi Gainda to derive F 1 , and F 1 s were further selfed to obtain F 2 s. F 1 s were backcrossed to obtain BC 1 (IIHRMOP 1111 x F 1 ) and BC 2 (F 1 x Pusa Narangi Gainda). All six generations (P 1 , P 2 , F 1 , F 2 , BC 1 and BC 2 ) were evaluated to study the male sterile gene inheritance pattern. The progenies were phenotyped for male sterility based on floral characteristics. The segregation pattern of fertile and sterile plants was worked out by manual counting. DNA isolation The DNA was isolated from the young leaves of both the parents, and 96 samples of DNA were isolated from the F 1 population (petaloid sterile x PNG) by using the CTAB method as described by Doyle and Doyle (1990) with some minor modifications, including RNAase treatment. The quality was analyzed by using 0.8% agarose gel and quantity by using a UV-Vis spectrophotometer. The final DNA concentration was adjusted to 60 ηg/ul. Genotyping The eleven SSR microsatellite markers linked to apetaloid male sterility viz CPSSR4, CPSSR7, CPSSR11, CPSSR16, CPSSR26, CPSSR33, CPSSR37, CPSSR39, CPSSR47, CPSSR53 and CPSSR66 shortlisted in the previous report (Asha et al., 2019) were used in the present study (Table 4). The parental polymorphic SSR markers were utilized for screening the F 1 population to evaluate the co-segregating nature and confirm the linkage with sterile loci. PCR analysis Genotyping was carried out in an Eppendorf Thermocycler (Eppendorf master cycler Germany) with an initial denaturation at 94ºC for 2 minutes, followed by 35 cycles; each cycle consisting of denaturation at 94ºC for 45 seconds, primer annealing at 60ºC for 45 seconds and primer extension at 72ºC for 45 seconds and a final extension for 10 minutes at 72º C and hold at 12 ºC. The 20 μl reaction mixture contains 60 ηg of template DNA, 0.2 X buffer, 0.2 mM dNTPs, 0.5 mM of MgCl2, 0.3 U of Taq DNA polymerase, and 0.025 pM each of forward and reverse primers. The PCR product was separated by using 45 agarose or 8% PAGE. The results were documented by using the UV gel documentation unit. The allele sizes are calculated by using Uv-pro software. Statistical analysis The statistical analysis was performed using Statistical Analysis System Version 9.3 software (SAS, 2012). Phenotypic and genotypic data were analyzed by the Chi-square test to check the co-segregation and to determine the goodness–of–fit (Quinn and Keough 2002). Genotypic data were subjected to single marker–ANOVA to determine an independent assortment of markers with that of phenotype. RESULTS Identification of the stable genic male sterile lines The intercrossing between fertile and sterile plants in all three petaloid lines (IIHRMOP 1111, IIHRMOP 22 and IIHRMOP 228), resulted in progenies with fertile and sterile plants of 22:21, 15:19, and 15:23 respectively with the segregation ratio of 1:1 while selfing of fertile plants resulted in progenies consisting of all fertile plants (Table 1). Out of three lines, IIHRMOP 1111 is selected based on the probability (87%) of the chi-square value for further analysis. Inter-cross and selfing performed over three different seasons in petaloid male sterile line IIHRMOP 1111 confirmed the stable performance of the line. The segregating patterns across the seasons resulted in 27-23, 63-55, and 25-28 sterile and fertile plants segregating in a 1:1 ratio in intercrossing and selfing of fertile plants, resulted in progenies comprised of all fertile plants (Table 2). This clearly showed the male sterile line is stable across three generations. Genetics of male sterility in petaloid male sterile system In six generations out of 96 plants in F1 resulting from IIHRMOP 1111(P 1 ) crossed with Pusa Narangi Gainda (P 2 .), 40 were petaloid sterile, and 56 were fertile with the segregation ratio of 1:1. The fertile plants in the F 1 are selfed to produce the F 2 . All 210 plants of F 2 were observed to be fertile, while the BC 1 34 sterile and 24 fertile plants were observed, and BC 2 generation plants segregated into 21 sterile and 24 fertile plants in a ratio of 1:1 (Table 3). Molecular markers for petaloid sterility The parent IIHRMOP 1111 and Pusa Narangi Gainda were assessed for polymorphism with eleven molecular markers earlier shortlisted (Table 4). Among the eleven markers assessed, CPSSR 39 was found to be polymorphic and could differentiate sterile and fertile genotypes. Validation of CPSSR-39 association with sterility trait The PCR amplification using CPSSR 39 marker in petaloid sterile line resulted in two amplicons with size 350 bp and 290 bp and a single amplicon with size 280 bp in fertile pollen parent Pusa Narangi Gainda. This showed a clear polymorphism between the two parents. Genotyping of 96 individual population of the F 1 population using CPSSR 39 resulted in a heterozygous banding pattern in 40 sterile individuals and a homozygous banding pattern in 56 fertile individuals with the same amplification PCR products sizes as of parents, co-segregating in accordance with the phenotype of each individual as per expectation; differentiating sterile and fertile individuals in 1:1 ratio (X2 p<0.05, 2.66) (Figure 2(i, ii, iii)). The segregation of the polymorphism fitted into the expected 1:1 ratio with a probability of 0.10% confirms the linkage of these markers to petaloid male sterility. The single marker–ANOVA revealed the association between SSR marker with sterility in a segregated F 1 population of marigold at a 1% level of significance with an F value of 133. Since CPSSR 39 followed the mendelian segregation ratio, we presume CPSSR 39 is linked to male sterility loci in the petaloid genotype. Hence this marker CPSSR 39 can be efficiently used for the selection of parents in marker-assisted breeding programs. DISCUSSION Diversification of male sterility sources in hybrid seed production is essential to avoid the possibility of disease and pest attack and to reduce the impact of loss (Levings 1990 ). Easy maintenance of male sterility is another issue of concern, as vegetative propagation reported in marigold has its own limitations (Kumar et al., 2017 ; Tejaswini et al., 2016a). In this study, work was carried out using a genic petaloid male sterile line to understand the inheritance pattern of genes controlling it. Based on the segregation pattern observed (Table 1 , Table 2 ), the segregating progeny of 1:1 fertile and sterile plants observed under intercross and all fertile plants resulting from the selfed progeny of fertile plants explains petaloid sterile plants being heterozygous and fertile plants of the sterile line being homozygous recessive in nature. Hence we can assume that the male type of male sterility in the lines is GMS and governed by a single dominant gene Pp for petaloid sterility. Assuming the heterozygous status of petaloid male sterility as confirmed from the first experiment, line IIHRMOP 1111 is expected to have male sterile plants with ‘Pp’ and fertile plants with pp genetic composition. Pusa Narangi Gainda, a well-established variety with all fertile flowers, is expected to be of ‘pp’. The observed phenotypic data over the six generations consistently fitted to the Chi-square ratios as per the expectations is with in accordance with the assumption. All the results across the season and across multiple generations confirmed the existence of a single dominant gene governing petaloid male sterility. The PCR amplification patterns are with respect to the Pp and pp confirming the gene action at the genotypic level. Hence we propose a single dominant gene controlling petaloid male sterility and CPSSR 39 is linked to male sterility loci in petaloid genotype. Irrespective of crops, most of the reported male sterility was either monogenic recessive or dominant (Reddy et al., 2002 ; Joshi and Nabi, 2018 ; Hundal and Khurana, 2001 ). In marigold, apetaloid sterility was reported to be controlled by a single recessive gene (He et al., 2009 ; Tejaswini et al., 2016b). In contrast to apetaloid male sterility, it is now confirmed the presence a single dominant gene governing petaloid male sterility in IIHRMOP 1111 genotype. With this present study, the presence of different genes responsible for different types of male sterility in marigold is confirmed. More than one gene is known to exist governing male sterility in different crops. For instance, in the case of pigeon pea, ms1 and ms2 genes were non-allelic and monogenic recessive reported to be governing male sterility (Saxena et al., 2010 ). The most important aspect of the identified male sterile line in the present work is the easily distinguishable character of male sterile plants wherein flowers consist of only ray florets, unlike the presence of disc florets in fertile flowers (Fig. 1 ). In general, male sterile plants are morphologically not distinguishable from the sister fertile plants, except in a few cases where the male sterile flower size is smaller than that of fertile flowers, e.g. tomato, chilli (Sawhney 1983 ). Classical A, B, C, D, and E model explains the genetic regulation of floral organ development. Accordingly, Class B genes in combination with A govern petal formation, while B and C group together govern stamen formation (Theissen 2001 ; Weigel and Meyerowltz 1994 ). Homeotic mutation in these genes explains any abnormalities seen in floral organs, including male sterility due to the absence of stamens. Petaloid sterile flowers studied in the present work indicate the possible conversion of stamens into petals. In carrots, it has been reported that the anthers of individual florets are replaced by petal-like structures that don’t release pollen, resulting in petaloid male sterility (Morelock et al., 1996 ). Roses of double-flowered forms with many extra petals display a significant contraction in the domain of C gene expression, allowing for a much larger domain of A + B expression and concomitant extra petals (Bowman et al., 2012 ). Similarly, petaloid marigold types may be a result of similar ABC expression as of double-flowered roses. Homeotic conversion of ray and disc florets into sepal and style-like structures corresponding to abnormality of androecium and differential expression of B-class genes in floral development have been reported in apetaloid male sterile flowers of T. erecta (Ai et al., 2016 ; He et al., 2010 ). The petaloid sterile line reported announces that T. erecta is an ideal material for the study of homeotic genes as well as serving as an important breeding material for hybrid seed production. The results suggested the CPSSR 39 marker linked to petaloid sterility as a selection marker in MAS breeding that facilitates the identification of petaloid sterile types enabling the removal of fertile plants at the seedling stage, retaining only sterile progenies during the hybridization programme in marigold. The markers identified to be linked to apetaloid male sterility in marigold using SCAR marker SCS48, reported by He et al., 2009 ; Asha et al., 2019 validated the same SCAR marker in 12 apetaloid male-sterile lines and confirmed the efficiency of the MAS. Similarly, markers linked to male sterility in various crops like sunflower (Pérez-Vich et al., 2005 ), rape seed (Lu et al., 2004 , Lee et al 2010 , and Hong et al., 2008 ), Chinese cabbage by Ying et al., 2003 and Hui et al., ( 2011 ), Carnation by Yagi et al., ( 2014 ), rice by Bhati et al., ( 2018 ) and Raghavendra and Hittalmani ( 2015 ), tomato by Kumar et al., ( 2018 ), chilli by Aulakh et al., ( 2017 ), Onion by Dhanya et al., ( 2014 ), welsh onion by Gai et al. , (2010), Barley by Emebiri (2010) was reported which explains the significance of markers in breeding of male sterile hybrids. CONCLUSION The present study confirmed petaloid male sterility in the marigold is governed by a single dominant gene based on its inheritance pattern. Apetaloid and petaloid male sterility are the two different types of male sterility in marigold based on flower structure and the present study suggests the existence of two different genes responsible for the expression of structurally variable male sterility in marigold. This study also indicated the possibility of considering marigold ( T. erecta ) as a candidate species for the study of the homeotic conversion of floral structure. Identification of marker CPSSR 39 associated with petaloid male sterility has the potential application in the marker-assisted selection breeding programmes in marigold. MAS enable accurate selection regardless of environmental factors, and it has been applied in the breeding of various crops, but to the best of our survey, the development of a commercial marigold cultivar through MAS has not been reported. Male sterility linked markers in the present study indicate the possibility of MAS and the potential use of CPSSR 39 in the hybrid breeding programme of marigold. In conclusion, once molecular markers have been linked to a trait of interest, these markers can be used to select desired plants from a large population through marker-assisted selection (MAS), which saves both costs and time in hybrid breeding programmes. Declarations ACKNOWLEDGEMENT We acknowledge the financial support provided by the Science & Engineering Research Board, CII, Government of India, and I&B Seeds, Pvt. Ltd., Bengaluru, India, to Akkalareddy Sumalatha during the study period. References Ai Y, Zhang Q, Wang W, Zhang C, Cao Z, Bao M, He Y (2016) Transcriptomic analysis of differentially expressed genes during flower organ development in genetic male sterile and male fertile Tagetes erecta by digital gene-expression profiling. PLoS ONE 11(3):0150892 Asha KM, Sane A, Tejaswini DC, Lakshaman Reddy SR, Patil SS, Cholin, Mahantesha BN, Naika, Raghavendra Gunnaiah (2019) Validation of SCAR Marker Linked to Genic Male Sterility in Marigold: As a Forward Step towards Marker Assisted Breeding Programme. Int J Curr Microbiol App Sci 8(02):3373–3383 Aulakh PS, Dhaliwal MS, Jindal SK (2017) Validation of molecular marker AVRDC-PP12 linked to male sterility gene ms 10 of chilli. Indian J Hortic 74(4):126–135 Berman J, Zorrilla-López U, Farré G, Zhu C, Sandmann G, Twyman RM, Christou P (2015) Nutritionally important carotenoids as consumer products. Phytochem Rev 14(5):727–743 Bhati PK, Singh SK, Kumar U (2018) Screening and validation of Fertility Restoration Genes ( Rf ) in Wild Abortive CMS system Rice ( Oryza sativa L.) using microsatellite markers. Indian J Genet Plant Breed 78(2):270–274 Bowman JL, Smyth DR, Meyerowitz EM (2012) The ABC model of flower development: then and now. Development 139(22):4095–4098 Chen L, Liu YG (2014) Male sterility and fertility restoration in crops. Annu Rev Plant Biol 65(1):579–606 Dhanya VS, Shetty HV, Gowda RV, Reddy DCL (2014) Screening of Molecular markers linked to male sterility in Onion ( Allium cepa L.) genotypes and its validation. Plant Archives 14(1):301–305 Doyle JJ, Doyle JL (1990) Isolation of plant DNA from fresh tissue. Focus 12:13–15 Du M, Zhou K, Liu Y, Deng L, Zhang X, Lin L, Li C (2020) A biotechnology based male sterility system for hybrid seed production in tomato. Plant J 102(5):1090–1100 Emebiri LC (2010) An EST-SSR marker tightly linked to the Barley male sterility Gene ( msg6 ) located on chromosome 6H. Journal of Heredity , 101 : 769–774. Gai, S. P., & Meng, X. D. (2010). Application of Molecular Markers linking to cytoplasmic male sterile loci to Assist Maintainer Line Selection and their Selection Efficiency in Welsh Onion ( Allium fistulosum L.). Journal of Integrative Agriculture , 9(11): 1571–1576 Gupta YC, Raghava SPS, Misra RL (1999) Inheritance of male-sterile apetalous inflorescence in African marigold. J Ornam Hort 2(2):65–66 Hayashi M, Kakui H, Ujiie A, Oda T, Serizawa H, Koba T, Sassa H (2011) Development of SCAR and CAPS markers linked to a recessive male sterility gene in lettuce ( Lactuca sativa L). Euphytica 180:429–436 He YH, Ning GG, Sun YL, Hu Y, Zhao XY, Bao MZ (2010) Cytological and mapping analysis of a novel male sterile type resulting from spontaneous floral organ homeotic conversion in marigold ( Tagetes erecta L). Mol Breed 26:19–29 He YH, Ning GG, Sun YL, Qi YC, Bao MZ (2009) Identification of a SCAR marker linked to a recessive male sterile gene ( Tems ) and its application in breeding of marigold ( Tagetes erecta ). Plant Breeding 128(1):92–96 Hong DF, Liu J, Yang GS, He QB (2008) Development and characterization of SCAR markers associated with a dominant genic male sterility in rapeseed. Plant Breeding 127(1):69–73 Hong D, Wan L, Liu P, Yang G, He Q (2006) AFLP and SCAR markers linked to the suppressor gene (Rf) of a dominant genetic male sterility in rapeseed (Brassica napus L). Euphytica 151:401–409 Hui F, Ning Y, Zhiyong L, Hao W (2011) A genetic Male Sterile Line Developed by Molecular marker- assisted selection in Chinese cabbage ( Brassica rapa ssp. pekinensis ). Afr J Biotechnol 10(77):17706–17711 Hundal JS, Khurana DS (2001) A new hybrid of chilli ‘CH-3’–suitable for processing. J Res Punjab Agric Univ 39(2):326 Joshi AK, Nabi A (2018) Genetics of Inheritance of growth, yield and male sterility in Capsicum annuum L. J Pharmacognosy Phytochem 7(1):1682–1688 Kim YJ, Zhang D (2018) Molecular control of male fertility for crop hybrid breeding. Trends Plant Sci 23(1):53–65 Kumar KR, Singh KP, Raju DVS, Panwar S, Bhatia R, Jain PK, Kumar V (2017) Standardization of rapid multiplication protocol in petaloid male sterile lines of African marigold ( Tagetes erecta ) through in vitro culture. Indian J Agr Sci 87:31–38 Kumar S, Gowda PHR, Saikia B, Debbarma J, Velmurugan N (2018) Screening of tomato genotypes against bacterial wilt ( Ralstonia solanacearum ) and validation of resistance linked DNA markers. Australas Plant Pathol 47:365–374 Lee J, Yoon JB, Han JH, Lee WP, Do JW, Ryu H, Park HG (2010) A codominant SCAR marker linked to the genic male sterility gene (ms1) in chili pepper (Capsicum annuum). Plant Breeding 129(1):35–38 Levings CS (1990) The Texas cytoplasm of maize: cytoplasmic male sterility and disease susceptibility. Science 250(4983):942–947 Lu GY, Yang GS, Fu TD (2004) Molecular mapping of a dominant genic male sterility gene Ms in rapeseed (Brassica napus). Plant Breeding 123(3):262–265 Morelock TE, Simon PW, Peterson CE (1996) Wisconsin wild: another petaloid male-sterile cytoplasm for carrot. HortScience 31(5):887–888 Naresh P, Lin SW, Lin CY, Wang YW, Schafleitner R, Kilian A, Kumar S (2018) Molecular markers associated to two non-allelic genic male sterility genes in peppers (Capsicum annuum L). Front Plant Sci 9:1343 Pérez-Vich B, Berry ST, Velasco L, Fernández-Martínez JM, Gandhi S, Freeman C, Leon AJ (2005) Molecular mapping of nuclear male sterility genes in sunflower. Crop Sci 45(5):1851–1857 Quinn GP, Keough MJ (2002) Experimental Design and Data Analysis for Biologists. Cambridge University Press, Cambridge Raghavendra P, Hittalmani S (2015) Identification of Maintainer Lines and Validation of SSR markers for development of New Rice Hybrids for Aerobic Situation. Int J Rice 52(3):173–180 Reddy KM, Deshpande AA, Sadashiva AT (2002) Cytoplasmic genetic male sterility in chilli ( Capsicum annuum L). Indian J Genet 62(4):363–364 Rodrigues DB, Mercadante AZ, Mariutti LRB (2019) Marigold carotenoids: Much more than lutein esters. Food Res Int 119:653–664 Sandmann G (2014) Carotenoids of biotechnological importance. Biotechnol Isoprenoids, pp. 449–467 Santosh N (2018) Published P.hD thesis, Genetic and biochemical analysis of yield and quality parameters in marigold. University of Horticultural Sciences, Bhagalkot SAS 9.3 (2012) Statistical Analysis System Version 9.3 SAS institute, Cary NC Sawhney VK (1983) Temperature control of male sterility in a tomato mutant. J Hered 74:51–54 Saxena KB, Sultana R, Mallikarjuna N, Saxena RK, Kumar RV, Sawargaonkar SL, Varshney RK (2010) Male sterility systems in pigeon pea and their role in enhancing yield. Plant Breeding 129(2):125–134 Tejaswini., Anuradha S, Archana G (2016) b. IIHRMGYP-1 (IC0613361; INGR15036), a marigold ( Tagetes erecta L.) germplasm with petaloid sterility flowers; ability to be multiplied by cuttings. Indian J Plant Genet Resoures 29(2):221–222 Tejaswini., Anuradha S, Archana G, Ghatke M (2016) a. Characterisation and utilization of three distinct male sterile systems in marigold ( Tagetes erecta L ). Indian J Agri Sci 86(10):1271–1275 Theissen G (2001) Development of floral organ identity: stories from the MADS house. Curr Opin Plant Bio 4(1):75–85 Wang C, Zhang P, Ma Z, Zhang M, Sun G, Ling D (2004) Development of a genetic marker linked to a new thermo-sensitive male sterile gene in rice (Oryza sativa L). Euphytica 140:217–222 Weigel D, Meyerowltz EM (1994) The ABCs of floral homeotic genes. Cell 78:203–209 Yagi M, Yamamoto T, Isobe S, Tabata S, Hirakawa H, Yamaguchi H, Tanase K, Onozaki T (2014) Identification of tightly linked SSR markers for flower type in carnation ( Dianthus caryophyllus L). Theor Appl Genet 312:542–551 Ying M, Dreyer F, Cai D, Jung C (2003) Molecular markers for genic male sterility in Chinese cabbage. Euphytica 132(2):227–234 Tables Table 1. Segregation pattern observed in intercross and selfed progeny of stabilised petaloid male sterile lines. S.No Intercross and selfing of petaloid sterile lines Number of sterile plants observed Number of fertile plants observed Expected ratio of sterile to fertile plants Chi-square value Probability 1 IIHRMOP 1111 a IIHRMOP 1111-s X IIHRMOP 1111-f 22 21 1:1 0.02 0.87 b Self of IIHRMOP 1111-f - 25 0:1 - 2 IIHRMOP 22 a IIHRMOP 22-s X IIHRMOP22-f 15 19 1:1 0.47 0.49 b Self of IIHRMOP 22-f - 8 0:1 - 3 IIHRMOP 228 a IIHRMP 228-s X IIHRMOP 228-f 15 23 1:1 1.68 0.19 b Self of IIHRMOP 228-f - 5 0:1 - * s-sterile; f-fertile Table 2. Segregation pattern observed in intercross and selfed population of petaloid male sterile line IIHRMOP 1111 (IIHRMOP 1111-s + IIHRMOP 1111-f) in different seasons. S.NO Intercross and selfing of petaloid male sterile lines Number of sterile plants observed Number of fertile plants observed Expected chi- square ratio Chi-square value Probability Season-1 a IIHRMOP1111-s X IIHRMOP 1111-f 27 23 1:1 0.32 0.57 b Self of IIHRMOP 1111-f - 35 0:1 - Season-2 a IIHRMOP1111-s X IIHRMOP 1111-f 63 55 1:1 0.54 0.46 b Self of IIHRMOP 1111-f - 125 0:1 - Season-3 a IIHRMOP 1111-s X IIHRMOP 1111-f 25 28 1:1 0.16 0.68 b Self of IIHRMOP 1111-f - 45 0:1 - * s-sterile; f-fertile Table 3. Segregation pattern observed in six-generations of crossing program between IIHRMOP 1111 and Pusa Narangi Gainda for confirmation of genes involved in petaloid male sterility. S.No Initialmaterial maintained/crossed Resulting progeny Chi- square value p=0.05 Probability Lines/varieties used in crossing Genotype (Sterile: Fertile) Gene ration Expected phenotypic ratio (sterile:fertile) Expected genotypic ratio (sterile:fertile) Number of sterile plants- observed Number of fertile plants- observed 1 IIHRMOP 1111 (IIHRMOP 1111-s + IIHRMOP 1111-f) 1Pp:1pp P 1 1:1 1Pp:1pp 25 28 0.16 0.68 2 Pusa Narangi Gainda (PNG) 0:pp P 2 0:1 0:pp 0 45 - - 3 IIHRMOP 1111-s X PNG Pp x pp F 1 1:1 1Pp:1pp 40 56 2.66 0.10 4 Self of fertile F 1 pp x pp F 2 1:0 pp:0 0 210 - - 5 IIHRMOP 1111-s X Fertile F 1 Pp x pp BC 1 1:1 1Pp:1pp 34 24 1.72 0.18 6 Sterile F 1 X PNG Pp x pp BC 2 1:1 1Pp:1pp 21 24 0.2 0.65 *s-sterile; f-fertile Table. 4. The sequences of markers used in the present study are as follows: SI. No Markers name Primer sequence (5’ – 3’) Forward primer Reverse primer 1 CPSSR 4 TCCACATCAAATTCTTGGTCCCT GGGGAGGGTCGTTGCATATT 2 CPSSR 7 CGTGATGTCGAAACGTTGTGG TGAAGGTGGTGGTGCCTTTT 3 CPSSR 11 AGAGAGAGAGACCACTGTTGT TCACAACATCACAGCTCAACAC 4 CPSSR 16 CCATTAAAGGGCTCGACGGA GGACTTGCTCCGCTACCTAC 5 CPSSR 26 GCTGTTGGAGCCACTGATCT ACATCAATCCCTACAAAACCCT 6 CPSSR 33 CAATTTTCGTTCCGGCTGCA GAGCATGTTGCCTCAGAGGT 7 CPSSR 37 ACCCGTACCCAATCCCAATT GCAGCACTACTACAACCACCA 8 CPSSR 39 ACTCACGGGAGGAGAAATGC CAGAAGCAGAGACCGGTCTG 9 CPSSR 47 TCGGGGAGATGTCTGAATTTGG CGTCACGCATAAACGAATGT 10 CPSSR 53 TGGGATGATCTGGGAGCTGA AGTGTCCAACCAAAAGCCCTA 11 CPSSR 66 CGATGACGTTGACGGACTTTG AGGCCGAATTGAAGGTGATGT Additional Declarations The authors declare no competing interests. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6810176","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":465804033,"identity":"d4a00513-c627-4b68-a50d-e36c0f27c859","order_by":0,"name":"Akkalareddy Sumalatha","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABBElEQVRIie3PsWrDMBCAYQlDuhSyaqpfQSFLx75HFx2FLOW6dPHgBk3OEtrVQ3FewcHg2cagLIKugnRQH6DgqXgopUrHgON0C0T/IDi4D0mE+HynmiVEkIuXthKRm4JADhNBuCCX1cRavSP0WMJuppOPZDcOkDC9h1bE3w/jlMwYZE+344UjXVT2Em6wYELxR7aVikG5wbShki71tp8wzJkYcZDvdeKIQulIQJN+EqZYdOKHw8rcjRi8KlwNEWKwZJBwyM0scHfFmA8Rrj/La3iewlpraoWqcO1Ifegv4QIL035dQbZZkrqL55i9NbXtogMP26v5O6uj913z/yz7fD7fmfQLZhRnrQLJ5CAAAAAASUVORK5CYII=","orcid":"https://orcid.org/0000-0003-2846-7561","institution":"Indian Agricultural Research Institute","correspondingAuthor":true,"prefix":"","firstName":"Akkalareddy","middleName":"","lastName":"Sumalatha","suffix":""}],"badges":[],"createdAt":"2025-06-03 10:24:27","currentVersionCode":1,"declarations":{"humanSubjects":false,"vertebrateSubjects":true,"conflictsOfInterestStatement":false,"humanSubjectEthicalGuidelines":false,"humanSubjectConsent":false,"humanSubjectClinicalTrial":false,"humanSubjectCaseReport":false,"vertebrateSubjectEthicalGuidelines":true},"doi":"10.21203/rs.3.rs-6810176/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6810176/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":83901332,"identity":"d45bc6a1-8c7c-4336-8218-794bb2fa682e","added_by":"auto","created_at":"2025-06-04 09:34:42","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":285077,"visible":true,"origin":"","legend":"\u003cp\u003ePetaloid sterile flower with only ray florets, apetaloid sterile flower with only gynoecium, fertile flower with both ray and disc florets.\u003c/p\u003e\n\u003cp\u003e(i) Male Parent (Pusa Narangi Gainda)\u003c/p\u003e\n\u003cp\u003e(ii) IIHRMOP 1111 (Petaloid sterile)\u003c/p\u003e\n\u003cp\u003e(iii) (Apetaloid sterile)\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-6810176/v1/5926a175aacadffc83615461.png"},{"id":83901333,"identity":"9894d1cf-2046-4f4f-9c29-46eba58e5cd4","added_by":"auto","created_at":"2025-06-04 09:34:42","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":699850,"visible":true,"origin":"","legend":"\u003cp\u003eThe PCR amplification of CPSSR 39 with sterile, fertile parents and F\u003csub\u003e1\u003c/sub\u003e population of 1-96 individuals; the sterile parent with heterozygous amplified at 350 and 290 bp; fertile parent at 280 bp. The population co-segregating with in accordance to parents with 40 sterile and 56 fertile individuals in 1:1 ratio.\u003c/p\u003e\n\u003cp\u003e(i)\u003cstrong\u003e \u003c/strong\u003eThe PCR amplification of CPSSR 39 for petaloid F\u003csub\u003e1\u003c/sub\u003e population with sterile, fertile parent and 1-32 individuals.\u003c/p\u003e\n\u003cp\u003e(ii)\u003cstrong\u003e \u003c/strong\u003eThe PCR amplification of CPSSR 39 for petaloid F\u003csub\u003e1\u003c/sub\u003e population 33-64 individuals.\u003c/p\u003e\n\u003cp\u003e(iii)\u003cstrong\u003e \u003c/strong\u003eThe PCR amplification of CPSSR 39 for petaloid F\u003csub\u003e1\u003c/sub\u003e population 65-96 individuals\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-6810176/v1/d332454c2992c55c8797fdd6.png"},{"id":83902493,"identity":"ad837b9e-11f4-4dc1-bf86-2ba07dd712d4","added_by":"auto","created_at":"2025-06-04 09:42:42","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1498033,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6810176/v1/ad8a740d-7c24-4048-b757-8fe13e0e61dd.pdf"}],"financialInterests":"The authors declare no competing interests.","formattedTitle":"\u003cp\u003e\u003cstrong\u003eGenetic inheritance and identification of molecular markers linked to male sterility in African marigold (\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eTagetes erecta \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eL.)\u003c/strong\u003e\u003c/p\u003e","fulltext":[{"header":"INTRODUCTION","content":"\u003cp\u003eAmong flower crops, marigold (\u003cem\u003eTagetes erecta\u003c/em\u003e L.), a member of the Asteraceae family, is gaining popularity due to the rising demand for loose flowers in the market as well as an industrial input for the extraction of carotenoids. There is a global market for carotenoids as food colourants, animal feed, and nutraceuticals (Berman et al., \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Carotenoids are natural pigments with antioxidative properties that guard against oxidative stress (Sandmann, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). Some carotenoids are chemically synthesized, while marigold is the major natural source of carotene (Rodrigues et al., \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2019\u003c/span\u003e) and hence area under cultivation of marigold has been increasing over the years, and so is the rise in demand for hybrid seeds of marigold.\u003c/p\u003e \u003cp\u003eMarigold flower has a capitulum inflorescence consisting of ray and disc florets. Functional anthers in marigold are hidden within disc florets in the centre of the flower, making emasculation a difficult process. Male sterility is the major approach to avoid emasculation to cut down the labour and cost of hybrid seed production and ensures varietal purity (Chen and Liu, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Kim and Zhang, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2018\u003c/span\u003e, Du et al., \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). In marigold, apetaloid and petaloid are the two types of male sterility reported. The absence of ray florets is associated with apetaloid male sterility (Gupta et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e1999\u003c/span\u003e, He et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Tejaswini \u003cem\u003eet al.\u003c/em\u003e, 2016a), while flowers with only ray florets are associated with petaloid male sterility (Tejaswini \u003cem\u003eet al.\u003c/em\u003e, 2016a).\u003c/p\u003e \u003cp\u003eIn marigold, apetaloid male sterility is reported to be controlled by a single recessive gene (Gupta et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e1999\u003c/span\u003e, He et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Tejaswini \u003cem\u003eet al\u003c/em\u003e., 2016a) while petaloids are reported to be cytoplasmic inheritance and maintained by vegetative propagation (Kumar et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2017\u003c/span\u003e, Tejaswini \u003cem\u003eet al.\u003c/em\u003e, 2016b). In the GMS system of apetaloid male sterility, the segregation occurs at a 1:1 ratio necessitating the removal of 50% fertile plants, which is time and labour-consuming and also difficult to identify prior to flowering. Identifying molecular markers tightly linked to the male sterility locus helps in the early and accurate identification of male sterile genotypes at the seedling stage itself (Hayashi et al., \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2011\u003c/span\u003e, Naresh et al., \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2018\u003c/span\u003e. The use of molecular markers linked to male sterility has been reported in crops such as rice (Wang et al., \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2004\u003c/span\u003e), rapeseed (Hong et al., \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2006\u003c/span\u003e) and lettuce Hayashi et al., \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2011\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eMarker systems such as SCAR (He et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2009\u003c/span\u003e) AFLP ((He et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2010\u003c/span\u003e) and SSR (Asha et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2019\u003c/span\u003e) linked to apetaloid sterility have been reported. Though sufficient work has been reported with apetaloid sterility in marigold, there is not much information available on seed-propagated petaloid male sterility either in terms of gene action or in terms of a molecular marker associated with that. Apetaloid flowers are not marketable as the petals are absent. Hybrids produced from petaloid male sterile lines exhibit good combining ability for increased flower weight and biochemical components compared to apetaloid sterile lines (Santosh \u003cem\u003eet al.\u003c/em\u003e, 2018). In this study, we tried to unravel the gene action associated with seed-propagated petaloid male sterility and the marker associated with that, in an attempt to widen the genetic base of male sterility in marigold.\u003c/p\u003e"},{"header":"MATERIALS AND METHODS","content":"\u003cp\u003ePlant materials for the present study were selected from the progeny population of an ongoing marigold breeding program at ICAR-Indian Institute of Horticultural Research, Bengaluru, India. Thousands of progeny plants resulting from distant hybridization and selected inter-breeding during 2010-2018 were screened. The petaloid male sterility governed by nuclear genes was fixed by intercrossing within male sterile lines and stabilized over generations during marigold breeding programme.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cem\u003ePlant material\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eThree male sterile lines viz., IIHRMOP 1111, IIHRMOP 22 and IIHRMOP 228, were used for the present experiment. Each one of these male sterile lines consisted of both fertile and male sterile plants. Intercrossing between sterile and fertile plants within the individual line was attempted along with the selfing of fertile plants of the same line. Observations on the number of fertile and sterile plants resulting from intercrossing as well as selfing were recorded in the F\u003csub\u003e1\u003c/sub\u003e generation, and a segregating ratio was worked out for each one of the three male sterile lines under study (Table 1). Line IIHRMOP 1111 is selected based on the stability in segregation. For confirmation of genes governing the sterility and to ensure the stability of the segregation, repeated intercrossing between sterile and fertile plants of the selected line IIHRMOP 1111, along with the selfing of fertile plants for three consecutive seasons, was performed. Observations on the segregation of fertile and sterile plants were recorded in progenies from intercrossing as well as selfing..\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eDevelopment of F\u003c/em\u003e\u003cem\u003e\u003csub\u003e1\u003c/sub\u003e\u003c/em\u003e\u003cem\u003e, F\u003c/em\u003e\u003cem\u003e\u003csub\u003e2\u003c/sub\u003e\u003c/em\u003e\u003cem\u003e, BC\u003c/em\u003e\u003cem\u003e\u003csub\u003e1\u003c/sub\u003e\u003c/em\u003e\u003cem\u003e\u0026nbsp;and BC\u003c/em\u003e\u003cem\u003e\u003csub\u003e2\u003c/sub\u003e\u003c/em\u003e\u003cem\u003e\u0026nbsp;(Six generation mean analysis)\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eThe petaloid male sterile line (IIHRMOP 1111) crossed with a fertile variety Pusa Narangi Gainda to derive F\u003csub\u003e1\u003c/sub\u003e, and F\u003csub\u003e1\u003c/sub\u003es were further selfed to obtain F\u003csub\u003e2\u003c/sub\u003es. F\u003csub\u003e1\u003c/sub\u003es were backcrossed to obtain BC\u003csub\u003e1\u003c/sub\u003e (IIHRMOP 1111 x F\u003csub\u003e1\u003c/sub\u003e) and BC\u003csub\u003e2\u003c/sub\u003e (F\u003csub\u003e1\u003c/sub\u003e x Pusa Narangi Gainda). All six generations (P\u003csub\u003e1\u003c/sub\u003e, P\u003csub\u003e2\u003c/sub\u003e, F\u003csub\u003e1\u003c/sub\u003e, F\u003csub\u003e2\u003c/sub\u003e, BC\u003csub\u003e1\u003c/sub\u003e and BC\u003csub\u003e2\u003c/sub\u003e) were evaluated to study the male sterile gene inheritance pattern. The progenies were phenotyped for male sterility based on floral characteristics. The segregation pattern of fertile and sterile plants was worked out by manual counting.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eDNA isolation\u0026nbsp;\u003c/em\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe DNA was isolated from the young leaves of both the parents, and 96 samples of DNA were isolated from the F\u003csub\u003e1\u003c/sub\u003e population (petaloid sterile x PNG) by using the CTAB method as described by Doyle and Doyle (1990) with some minor modifications, including RNAase treatment. The quality was analyzed by using 0.8% agarose gel and quantity by using a UV-Vis spectrophotometer. The final DNA concentration was adjusted to 60 \u0026eta;g/ul.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eGenotyping\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eThe eleven SSR microsatellite markers linked to apetaloid male sterility viz CPSSR4, CPSSR7, CPSSR11, CPSSR16, CPSSR26, CPSSR33, CPSSR37, CPSSR39, CPSSR47, CPSSR53 and CPSSR66 shortlisted in the previous report (Asha\u0026nbsp;\u003cem\u003eet al.,\u003c/em\u003e 2019) were used in the present study (Table 4). The parental polymorphic SSR markers were utilized for screening the F\u003csub\u003e1\u003c/sub\u003e population to evaluate the co-segregating nature and confirm the linkage with sterile loci.\u003c/p\u003e\n\u003cp\u003ePCR analysis\u003c/p\u003e\n\u003cp\u003eGenotyping was carried out in an Eppendorf Thermocycler (Eppendorf master cycler Germany) with an initial denaturation at 94\u0026ordm;C for 2 minutes, followed by 35 cycles; each cycle consisting of denaturation at 94\u0026ordm;C for 45 seconds, primer annealing at 60\u0026ordm;C for 45 seconds and primer extension at 72\u0026ordm;C for 45 seconds and a final extension for 10 minutes at 72\u0026ordm; C and hold at 12 \u0026ordm;C. The 20 \u0026mu;l reaction mixture contains 60 \u0026eta;g of template DNA, 0.2 X buffer, 0.2 mM dNTPs, 0.5 mM of MgCl2, 0.3 U of Taq DNA polymerase, and 0.025 pM each of forward and reverse primers. The PCR product was separated by using 45 agarose or 8% PAGE. The results were documented by using the UV gel documentation unit. The allele sizes are calculated by using Uv-pro software.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eStatistical analysis\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eThe statistical analysis was performed using Statistical Analysis System Version 9.3 software (SAS, 2012). Phenotypic and genotypic data were analyzed by the Chi-square test to check the co-segregation and to determine the goodness\u0026ndash;of\u0026ndash;fit (Quinn and Keough 2002). Genotypic data were subjected to single marker\u0026ndash;ANOVA to determine an independent assortment of markers with that of phenotype.\u0026nbsp;\u003c/p\u003e"},{"header":"RESULTS","content":"\u003cp\u003e\u003cem\u003eIdentification of the stable genic male sterile lines\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eThe intercrossing between fertile and sterile plants in all three petaloid lines (IIHRMOP 1111, IIHRMOP 22 and IIHRMOP 228), resulted in progenies with fertile and sterile plants of 22:21, 15:19, and 15:23 respectively with the segregation ratio of 1:1 while selfing of fertile plants resulted in progenies consisting of all fertile plants (Table 1). Out of three lines, IIHRMOP 1111 is selected based on the probability (87%) of the chi-square value for further analysis. Inter-cross and selfing performed over three different seasons in petaloid male sterile line IIHRMOP 1111 confirmed the stable performance of the line. The segregating patterns across the seasons resulted in 27-23, 63-55, and 25-28 sterile and fertile plants segregating in a 1:1 ratio in intercrossing and selfing of fertile plants, resulted in progenies comprised of all fertile plants (Table 2). This clearly showed the male sterile line is stable across three generations.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eGenetics of male sterility in petaloid male sterile system\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eIn six generations out of 96 plants in F1 resulting from IIHRMOP 1111(P\u003csub\u003e1\u003c/sub\u003e) crossed with Pusa Narangi Gainda (P\u003csub\u003e2\u003c/sub\u003e.), 40 were petaloid sterile, and 56 were fertile with the segregation ratio of 1:1. The fertile plants in the F\u003csub\u003e1\u003c/sub\u003e are selfed to produce the F\u003csub\u003e2\u003c/sub\u003e. All 210 plants of F\u003csub\u003e2\u003c/sub\u003e were observed to be fertile, while the BC\u003csub\u003e1\u003c/sub\u003e 34 sterile and 24 fertile plants were observed, and BC\u003csub\u003e2\u003c/sub\u003e generation plants segregated into 21 sterile and 24 fertile plants in a ratio of 1:1 (Table 3).\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eMolecular markers for petaloid sterility\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eThe parent IIHRMOP 1111 and Pusa Narangi Gainda were assessed for polymorphism with eleven molecular markers earlier shortlisted (Table 4). Among the eleven markers assessed, CPSSR 39 was found to be polymorphic and could differentiate sterile and fertile genotypes.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eValidation of CPSSR-39 association with sterility trait\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eThe PCR amplification using CPSSR 39 marker in petaloid sterile line resulted in two amplicons with size 350 bp and 290 bp and a single amplicon with size 280 bp in fertile pollen parent Pusa Narangi Gainda. This showed a clear polymorphism between the two parents. Genotyping of 96 individual population of the F\u003csub\u003e1\u003c/sub\u003e population using CPSSR 39 resulted in a heterozygous banding pattern in 40 sterile individuals and a homozygous banding pattern in 56 fertile individuals with the same amplification PCR products sizes as of parents, co-segregating in accordance with the phenotype of each individual as per expectation; differentiating sterile and fertile individuals in 1:1 ratio (X2 p\u0026lt;0.05, 2.66) (Figure 2(i, ii, iii)). The segregation of the polymorphism fitted into the expected 1:1 ratio with a probability of 0.10% confirms the linkage of these markers to petaloid male sterility. The single marker\u0026ndash;ANOVA revealed the association between SSR marker with sterility in a segregated F\u003csub\u003e1\u0026nbsp;\u003c/sub\u003epopulation of marigold at a 1% level of significance with an F value of 133. Since CPSSR 39 followed the mendelian segregation ratio, we presume CPSSR 39 is linked to male sterility loci in the petaloid genotype. Hence this marker CPSSR 39 can be efficiently used for the selection of parents in marker-assisted breeding programs.\u003c/p\u003e"},{"header":"DISCUSSION","content":"\u003cp\u003eDiversification of male sterility sources in hybrid seed production is essential to avoid the possibility of disease and pest attack and to reduce the impact of loss (Levings \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e1990\u003c/span\u003e). Easy maintenance of male sterility is another issue of concern, as vegetative propagation reported in marigold has its own limitations (Kumar et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Tejaswini et al., 2016a). In this study, work was carried out using a genic petaloid male sterile line to understand the inheritance pattern of genes controlling it.\u003c/p\u003e \u003cp\u003eBased on the segregation pattern observed (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e, Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e2\u003c/span\u003e), the segregating progeny of 1:1 fertile and sterile plants observed under intercross and all fertile plants resulting from the selfed progeny of fertile plants explains petaloid sterile plants being heterozygous and fertile plants of the sterile line being homozygous recessive in nature. Hence we can assume that the male type of male sterility in the lines is GMS and governed by a single dominant gene Pp for petaloid sterility. Assuming the heterozygous status of petaloid male sterility as confirmed from the first experiment, line IIHRMOP 1111 is expected to have male sterile plants with \u0026lsquo;Pp\u0026rsquo; and fertile plants with pp genetic composition. Pusa Narangi Gainda, a well-established variety with all fertile flowers, is expected to be of \u0026lsquo;pp\u0026rsquo;. The observed phenotypic data over the six generations consistently fitted to the Chi-square ratios as per the expectations is with in accordance with the assumption. All the results across the season and across multiple generations confirmed the existence of a single dominant gene governing petaloid male sterility. The PCR amplification patterns are with respect to the Pp and pp confirming the gene action at the genotypic level. Hence we propose a single dominant gene controlling petaloid male sterility and CPSSR 39 is linked to male sterility loci in petaloid genotype.\u003c/p\u003e \u003cp\u003eIrrespective of crops, most of the reported male sterility was either monogenic recessive or dominant (Reddy et al., \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2002\u003c/span\u003e; Joshi and Nabi, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Hundal and Khurana, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2001\u003c/span\u003e). In marigold, apetaloid sterility was reported to be controlled by a single recessive gene (He et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Tejaswini et al., 2016b). In contrast to apetaloid male sterility, it is now confirmed the presence a single dominant gene governing petaloid male sterility in IIHRMOP 1111 genotype. With this present study, the presence of different genes responsible for different types of male sterility in marigold is confirmed. More than one gene is known to exist governing male sterility in different crops. For instance, in the case of pigeon pea, ms1 and ms2 genes were non-allelic and monogenic recessive reported to be governing male sterility (Saxena et al., \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2010\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe most important aspect of the identified male sterile line in the present work is the easily distinguishable character of male sterile plants wherein flowers consist of only ray florets, unlike the presence of disc florets in fertile flowers (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). In general, male sterile plants are morphologically not distinguishable from the sister fertile plants, except in a few cases where the male sterile flower size is smaller than that of fertile flowers, e.g. tomato, chilli (Sawhney \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e1983\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eClassical A, B, C, D, and E model explains the genetic regulation of floral organ development. Accordingly, Class B genes in combination with A govern petal formation, while B and C group together govern stamen formation (Theissen \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2001\u003c/span\u003e; Weigel and Meyerowltz \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e1994\u003c/span\u003e). Homeotic mutation in these genes explains any abnormalities seen in floral organs, including male sterility due to the absence of stamens. Petaloid sterile flowers studied in the present work indicate the possible conversion of stamens into petals. In carrots, it has been reported that the anthers of individual florets are replaced by petal-like structures that don\u0026rsquo;t release pollen, resulting in petaloid male sterility (Morelock et al., \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e1996\u003c/span\u003e). Roses of double-flowered forms with many extra petals display a significant contraction in the domain of C gene expression, allowing for a much larger domain of A\u0026thinsp;+\u0026thinsp;B expression and concomitant extra petals (Bowman et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). Similarly, petaloid marigold types may be a result of similar ABC expression as of double-flowered roses.\u003c/p\u003e \u003cp\u003eHomeotic conversion of ray and disc florets into sepal and style-like structures corresponding to abnormality of androecium and differential expression of B-class genes in floral development have been reported in apetaloid male sterile flowers of \u003cem\u003eT. erecta\u003c/em\u003e (Ai et al., \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; He et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). The petaloid sterile line reported announces that \u003cem\u003eT. erecta\u003c/em\u003e is an ideal material for the study of homeotic genes as well as serving as an important breeding material for hybrid seed production.\u003c/p\u003e \u003cp\u003eThe results suggested the CPSSR 39 marker linked to petaloid sterility as a selection marker in MAS breeding that facilitates the identification of petaloid sterile types enabling the removal of fertile plants at the seedling stage, retaining only sterile progenies during the hybridization programme in marigold. The markers identified to be linked to apetaloid male sterility in marigold using SCAR marker SCS48, reported by He et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Asha et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2019\u003c/span\u003e validated the same SCAR marker in 12 apetaloid male-sterile lines and confirmed the efficiency of the MAS. Similarly, markers linked to male sterility in various crops like sunflower (P\u0026eacute;rez-Vich et al., \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2005\u003c/span\u003e), rape seed (Lu et al., \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2004\u003c/span\u003e, Lee et al \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2010\u003c/span\u003e, and Hong et al., \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2008\u003c/span\u003e), Chinese cabbage by Ying et al., \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2003\u003c/span\u003e and Hui et al., (\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2011\u003c/span\u003e), Carnation by Yagi et al., (\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2014\u003c/span\u003e), rice by Bhati et al., (\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2018\u003c/span\u003e) and Raghavendra and Hittalmani (\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2015\u003c/span\u003e), tomato by Kumar et al., (\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2018\u003c/span\u003e), chilli by Aulakh et al., (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2017\u003c/span\u003e), Onion by Dhanya et al., (\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2014\u003c/span\u003e), welsh onion by Gai \u003cem\u003eet al.\u003c/em\u003e, (2010), Barley by Emebiri (2010) was reported which explains the significance of markers in breeding of male sterile hybrids.\u003c/p\u003e"},{"header":"CONCLUSION","content":"\u003cp\u003eThe present study confirmed petaloid male sterility in the marigold is governed by a single dominant gene based on its inheritance pattern. Apetaloid and petaloid male sterility are the two different types of male sterility in marigold based on flower structure and the present study suggests the existence of two different genes responsible for the expression of structurally variable male sterility in marigold. This study also indicated the possibility of considering marigold (\u003cem\u003eT. erecta\u003c/em\u003e) as a candidate species for the study of the homeotic conversion of floral structure.\u003c/p\u003e \u003cp\u003eIdentification of marker CPSSR 39 associated with petaloid male sterility has the potential application in the marker-assisted selection breeding programmes in marigold. MAS enable accurate selection regardless of environmental factors, and it has been applied in the breeding of various crops, but to the best of our survey, the development of a commercial marigold cultivar through MAS has not been reported. Male sterility linked markers in the present study indicate the possibility of MAS and the potential use of CPSSR 39 in the hybrid breeding programme of marigold. In conclusion, once molecular markers have been linked to a trait of interest, these markers can be used to select desired plants from a large population through marker-assisted selection (MAS), which saves both costs and time in hybrid breeding programmes.\u003c/p\u003e"},{"header":"Declarations","content":"\u003ch2\u003eACKNOWLEDGEMENT\u003c/h2\u003e \u003cp\u003eWe acknowledge the financial support provided by the Science \u0026amp; Engineering Research Board, CII, Government of India, and I\u0026amp;B Seeds, Pvt. Ltd., Bengaluru, India, to Akkalareddy Sumalatha during the study period.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAi Y, Zhang Q, Wang W, Zhang C, Cao Z, Bao M, He Y (2016) Transcriptomic analysis of differentially expressed genes during flower organ development in genetic male sterile and male fertile \u003cem\u003eTagetes erecta\u003c/em\u003e by digital gene-expression profiling. PLoS ONE 11(3):0150892\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAsha KM, Sane A, Tejaswini DC, Lakshaman Reddy SR, Patil SS, Cholin, Mahantesha BN, Naika, Raghavendra Gunnaiah (2019) Validation of SCAR Marker Linked to Genic Male Sterility in Marigold: As a Forward Step towards Marker Assisted Breeding Programme. Int J Curr Microbiol App Sci 8(02):3373\u0026ndash;3383\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAulakh PS, Dhaliwal MS, Jindal SK (2017) Validation of molecular marker AVRDC-PP12 linked to male sterility gene \u003cem\u003ems 10\u003c/em\u003e of chilli. Indian J Hortic 74(4):126\u0026ndash;135\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBerman J, Zorrilla-L\u0026oacute;pez U, Farr\u0026eacute; G, Zhu C, Sandmann G, Twyman RM, Christou P (2015) Nutritionally important carotenoids as consumer products. Phytochem Rev 14(5):727\u0026ndash;743\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBhati PK, Singh SK, Kumar U (2018) Screening and validation of Fertility Restoration Genes (\u003cem\u003eRf\u003c/em\u003e) in Wild Abortive CMS system Rice (\u003cem\u003eOryza sativa\u003c/em\u003e L.) using microsatellite markers. Indian J Genet Plant Breed 78(2):270\u0026ndash;274\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBowman JL, Smyth DR, Meyerowitz EM (2012) The ABC model of flower development: then and now. Development 139(22):4095\u0026ndash;4098\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen L, Liu YG (2014) Male sterility and fertility restoration in crops. Annu Rev Plant Biol 65(1):579\u0026ndash;606\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDhanya VS, Shetty HV, Gowda RV, Reddy DCL (2014) Screening of Molecular markers linked to male sterility in Onion (\u003cem\u003eAllium cepa\u003c/em\u003e L.) genotypes and its validation. Plant Archives 14(1):301\u0026ndash;305\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDoyle JJ, Doyle JL (1990) Isolation of plant DNA from fresh tissue. Focus 12:13\u0026ndash;15\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDu M, Zhou K, Liu Y, Deng L, Zhang X, Lin L, Li C (2020) A biotechnology based male sterility system for hybrid seed production in tomato. Plant J 102(5):1090\u0026ndash;1100\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEmebiri LC (2010) An EST-SSR marker tightly linked to the Barley male sterility Gene (\u003cem\u003emsg6\u003c/em\u003e) located on chromosome 6H. \u003cem\u003eJournal of Heredity\u003c/em\u003e, \u003cem\u003e101\u003c/em\u003e: 769\u0026ndash;774. Gai, S. P., \u0026amp; Meng, X. D. (2010). Application of Molecular Markers linking to cytoplasmic male sterile loci to Assist Maintainer Line Selection and their Selection Efficiency in Welsh Onion (\u003cem\u003eAllium fistulosum\u003c/em\u003e L.). \u003cem\u003eJournal of Integrative Agriculture\u003c/em\u003e, 9(11): 1571\u0026ndash;1576\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGupta YC, Raghava SPS, Misra RL (1999) Inheritance of male-sterile apetalous inflorescence in African marigold. J Ornam Hort 2(2):65\u0026ndash;66\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHayashi M, Kakui H, Ujiie A, Oda T, Serizawa H, Koba T, Sassa H (2011) Development of SCAR and CAPS markers linked to a recessive male sterility gene in lettuce (\u003cem\u003eLactuca sativa\u003c/em\u003e L). Euphytica 180:429\u0026ndash;436\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHe YH, Ning GG, Sun YL, Hu Y, Zhao XY, Bao MZ (2010) Cytological and mapping analysis of a novel male sterile type resulting from spontaneous floral organ homeotic conversion in marigold (\u003cem\u003eTagetes erecta\u003c/em\u003e L). Mol Breed 26:19\u0026ndash;29\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHe YH, Ning GG, Sun YL, Qi YC, Bao MZ (2009) Identification of a SCAR marker linked to a recessive male sterile gene (\u003cem\u003eTems\u003c/em\u003e) and its application in breeding of marigold (\u003cem\u003eTagetes erecta\u003c/em\u003e). Plant Breeding 128(1):92\u0026ndash;96\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHong DF, Liu J, Yang GS, He QB (2008) Development and characterization of SCAR markers associated with a dominant genic male sterility in rapeseed. Plant Breeding 127(1):69\u0026ndash;73\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHong D, Wan L, Liu P, Yang G, He Q (2006) AFLP and SCAR markers linked to the suppressor gene (Rf) of a dominant genetic male sterility in rapeseed (Brassica napus L). Euphytica 151:401\u0026ndash;409\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHui F, Ning Y, Zhiyong L, Hao W (2011) A genetic Male Sterile Line Developed by Molecular marker- assisted selection in Chinese cabbage (\u003cem\u003eBrassica rapa ssp. pekinensis\u003c/em\u003e). Afr J Biotechnol 10(77):17706\u0026ndash;17711\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHundal JS, Khurana DS (2001) A new hybrid of chilli \u0026lsquo;CH-3\u0026rsquo;\u0026ndash;suitable for processing. J Res Punjab Agric Univ 39(2):326\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJoshi AK, Nabi A (2018) Genetics of Inheritance of growth, yield and male sterility in \u003cem\u003eCapsicum annuum\u003c/em\u003e L. J Pharmacognosy Phytochem 7(1):1682\u0026ndash;1688\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim YJ, Zhang D (2018) Molecular control of male fertility for crop hybrid breeding. Trends Plant Sci 23(1):53\u0026ndash;65\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKumar KR, Singh KP, Raju DVS, Panwar S, Bhatia R, Jain PK, Kumar V (2017) Standardization of rapid multiplication protocol in petaloid male sterile lines of African marigold (\u003cem\u003eTagetes erecta\u003c/em\u003e) through in vitro culture. Indian J Agr Sci 87:31\u0026ndash;38\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKumar S, Gowda PHR, Saikia B, Debbarma J, Velmurugan N (2018) Screening of tomato genotypes against bacterial wilt (\u003cem\u003eRalstonia solanacearum\u003c/em\u003e) and validation of resistance linked DNA markers. Australas Plant Pathol 47:365\u0026ndash;374\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee J, Yoon JB, Han JH, Lee WP, Do JW, Ryu H, Park HG (2010) A codominant SCAR marker linked to the genic male sterility gene (ms1) in chili pepper (Capsicum annuum). Plant Breeding 129(1):35\u0026ndash;38\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLevings CS (1990) The Texas cytoplasm of maize: cytoplasmic male sterility and disease susceptibility. Science 250(4983):942\u0026ndash;947\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLu GY, Yang GS, Fu TD (2004) Molecular mapping of a dominant genic male sterility gene Ms in rapeseed (Brassica napus). Plant Breeding 123(3):262\u0026ndash;265\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMorelock TE, Simon PW, Peterson CE (1996) Wisconsin wild: another petaloid male-sterile cytoplasm for carrot. HortScience 31(5):887\u0026ndash;888\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNaresh P, Lin SW, Lin CY, Wang YW, Schafleitner R, Kilian A, Kumar S (2018) Molecular markers associated to two non-allelic genic male sterility genes in peppers (Capsicum annuum L). Front Plant Sci 9:1343\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eP\u0026eacute;rez-Vich B, Berry ST, Velasco L, Fern\u0026aacute;ndez-Mart\u0026iacute;nez JM, Gandhi S, Freeman C, Leon AJ (2005) Molecular mapping of nuclear male sterility genes in sunflower. Crop Sci 45(5):1851\u0026ndash;1857\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQuinn GP, Keough MJ (2002) Experimental Design and Data Analysis for Biologists. Cambridge University Press, Cambridge\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRaghavendra P, Hittalmani S (2015) Identification of Maintainer Lines and Validation of SSR markers for development of New Rice Hybrids for Aerobic Situation. Int J Rice 52(3):173\u0026ndash;180\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eReddy KM, Deshpande AA, Sadashiva AT (2002) Cytoplasmic genetic male sterility in chilli (\u003cem\u003eCapsicum annuum\u003c/em\u003e L). Indian J Genet 62(4):363\u0026ndash;364\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRodrigues DB, Mercadante AZ, Mariutti LRB (2019) Marigold carotenoids: Much more than lutein esters. Food Res Int 119:653\u0026ndash;664\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSandmann G (2014) Carotenoids of biotechnological importance. Biotechnol Isoprenoids, pp. 449\u0026ndash;467\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSantosh N (2018) Published P.hD thesis, Genetic and biochemical analysis of yield and quality parameters in marigold. University of Horticultural Sciences, Bhagalkot\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSAS 9.3 (2012) Statistical Analysis System Version 9.3 SAS institute, Cary NC\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSawhney VK (1983) Temperature control of male sterility in a tomato mutant. J Hered 74:51\u0026ndash;54\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSaxena KB, Sultana R, Mallikarjuna N, Saxena RK, Kumar RV, Sawargaonkar SL, Varshney RK (2010) Male sterility systems in pigeon pea and their role in enhancing yield. Plant Breeding 129(2):125\u0026ndash;134\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTejaswini., Anuradha S, Archana G (2016) b. IIHRMGYP-1 (IC0613361; INGR15036), a marigold (\u003cem\u003eTagetes erecta\u003c/em\u003e L.) germplasm with petaloid sterility flowers; ability to be multiplied by cuttings. Indian J Plant Genet Resoures 29(2):221\u0026ndash;222\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTejaswini., Anuradha S, Archana G, Ghatke M (2016) a. Characterisation and utilization of three distinct male sterile systems in marigold (\u003cem\u003eTagetes erecta L\u003c/em\u003e). Indian J Agri Sci 86(10):1271\u0026ndash;1275\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTheissen G (2001) Development of floral organ identity: stories from the MADS house. Curr Opin Plant Bio 4(1):75\u0026ndash;85\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang C, Zhang P, Ma Z, Zhang M, Sun G, Ling D (2004) Development of a genetic marker linked to a new thermo-sensitive male sterile gene in rice (Oryza sativa L). Euphytica 140:217\u0026ndash;222\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWeigel D, Meyerowltz EM (1994) The ABCs of floral homeotic genes. Cell 78:203\u0026ndash;209\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYagi M, Yamamoto T, Isobe S, Tabata S, Hirakawa H, Yamaguchi H, Tanase K, Onozaki T (2014) Identification of tightly linked SSR markers for flower type in carnation (\u003cem\u003eDianthus caryophyllus\u003c/em\u003e L). Theor Appl Genet 312:542\u0026ndash;551\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYing M, Dreyer F, Cai D, Jung C (2003) Molecular markers for genic male sterility in Chinese cabbage. Euphytica 132(2):227\u0026ndash;234\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003eTable 1. Segregation pattern observed in intercross and selfed progeny of stabilised petaloid male sterile lines.\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"651\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 38px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eS.No\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 215px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eIntercross and selfing of petaloid sterile lines\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 77px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eNumber of sterile plants observed\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 76px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eNumber of fertile plants observed\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 104px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eExpected ratio of\u003c/p\u003e\n \u003cp\u003esterile to\u003c/p\u003e\n \u003cp\u003efertile plants\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 66px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eChi-square value\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 76px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eProbability\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 38px;\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"6\" valign=\"top\" style=\"width: 613px;\"\u003e\n \u003cp\u003eIIHRMOP 1111\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 38px;\"\u003e\n \u003cp\u003ea\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 215px;\"\u003e\n \u003cp\u003eIIHRMOP 1111-s X\u003c/p\u003e\n \u003cp\u003eIIHRMOP 1111-f\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 77px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e22\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 76px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e21\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 104px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e1:1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 66px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e0.02\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 76px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e0.87\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 38px;\"\u003e\n \u003cp\u003eb\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 215px;\"\u003e\n \u003cp\u003eSelf of IIHRMOP 1111-f\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 77px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 76px;\"\u003e\n \u003cp\u003e25\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 104px;\"\u003e\n \u003cp\u003e0:1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 66px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 76px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 38px;\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"6\" valign=\"top\" style=\"width: 613px;\"\u003e\n \u003cp\u003eIIHRMOP 22\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 38px;\"\u003e\n \u003cp\u003ea\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 215px;\"\u003e\n \u003cp\u003eIIHRMOP 22-s X\u003c/p\u003e\n \u003cp\u003eIIHRMOP22-f\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 77px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e15\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 76px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e19\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 104px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e1:1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 66px;\"\u003e\n \u003cp\u003e0.47\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 76px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e0.49\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 38px;\"\u003e\n \u003cp\u003eb\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 215px;\"\u003e\n \u003cp\u003eSelf of IIHRMOP 22-f\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 77px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 76px;\"\u003e\n \u003cp\u003e8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 104px;\"\u003e\n \u003cp\u003e0:1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 66px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 76px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 38px;\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"6\" valign=\"top\" style=\"width: 613px;\"\u003e\n \u003cp\u003eIIHRMOP 228\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 38px;\"\u003e\n \u003cp\u003ea\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 215px;\"\u003e\n \u003cp\u003eIIHRMP 228-s X\u003c/p\u003e\n \u003cp\u003eIIHRMOP 228-f\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 77px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e15\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 76px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e23\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 104px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e1:1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 66px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e1.68\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 76px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e0.19\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 38px;\"\u003e\n \u003cp\u003eb\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 215px;\"\u003e\n \u003cp\u003eSelf of IIHRMOP 228-f\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 77px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 76px;\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 104px;\"\u003e\n \u003cp\u003e0:1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 66px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 76px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e* s-sterile; f-fertile\u003c/p\u003e\n\u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n\u003cp\u003eTable 2. Segregation pattern observed in intercross and selfed population of petaloid male sterile line IIHRMOP 1111 (IIHRMOP 1111-s + IIHRMOP 1111-f) in different seasons.\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"654\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 85px;\"\u003e\n \u003cp\u003eS.NO\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 189px;\"\u003e\n \u003cp\u003eIntercross and selfing of petaloid male sterile lines\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 68px;\"\u003e\n \u003cp\u003eNumber of sterile plants\u003c/p\u003e\n \u003cp\u003eobserved\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 95px;\"\u003e\n \u003cp\u003eNumber of fertile plants observed\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 66px;\"\u003e\n \u003cp\u003eExpected\u003c/p\u003e\n \u003cp\u003echi- square ratio\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 66px;\"\u003e\n \u003cp\u003eChi-square value\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 85px;\"\u003e\n \u003cp\u003eProbability\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"7\" valign=\"top\" style=\"width: 654px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eSeason-1\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 85px;\"\u003e\n \u003cp\u003ea\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 189px;\"\u003e\n \u003cp\u003eIIHRMOP1111-s X\u003c/p\u003e\n \u003cp\u003eIIHRMOP 1111-f\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 68px;\"\u003e\n \u003cp\u003e27\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 95px;\"\u003e\n \u003cp\u003e23\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 66px;\"\u003e\n \u003cp\u003e1:1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 66px;\"\u003e\n \u003cp\u003e0.32\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 85px;\"\u003e\n \u003cp\u003e0.57\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 85px;\"\u003e\n \u003cp\u003eb\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 189px;\"\u003e\n \u003cp\u003eSelf of IIHRMOP 1111-f\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 68px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 95px;\"\u003e\n \u003cp\u003e35\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 66px;\"\u003e\n \u003cp\u003e0:1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 66px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 85px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"7\" valign=\"top\" style=\"width: 654px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eSeason-2\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 85px;\"\u003e\n \u003cp\u003ea\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 189px;\"\u003e\n \u003cp\u003eIIHRMOP1111-s X\u003c/p\u003e\n \u003cp\u003eIIHRMOP 1111-f\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 68px;\"\u003e\n \u003cp\u003e63\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 95px;\"\u003e\n \u003cp\u003e55\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 66px;\"\u003e\n \u003cp\u003e1:1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 66px;\"\u003e\n \u003cp\u003e0.54\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 85px;\"\u003e\n \u003cp\u003e0.46\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 85px;\"\u003e\n \u003cp\u003eb\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 189px;\"\u003e\n \u003cp\u003eSelf of IIHRMOP 1111-f\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 68px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 95px;\"\u003e\n \u003cp\u003e125\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 66px;\"\u003e\n \u003cp\u003e0:1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 66px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 85px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"7\" valign=\"top\" style=\"width: 654px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eSeason-3\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 85px;\"\u003e\n \u003cp\u003ea\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 189px;\"\u003e\n \u003cp\u003eIIHRMOP 1111-s X\u003c/p\u003e\n \u003cp\u003eIIHRMOP 1111-f\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 68px;\"\u003e\n \u003cp\u003e25\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 95px;\"\u003e\n \u003cp\u003e28\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 66px;\"\u003e\n \u003cp\u003e1:1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 66px;\"\u003e\n \u003cp\u003e0.16\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 85px;\"\u003e\n \u003cp\u003e0.68\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 85px;\"\u003e\n \u003cp\u003eb\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 189px;\"\u003e\n \u003cp\u003eSelf of IIHRMOP 1111-f\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 68px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 95px;\"\u003e\n \u003cp\u003e45\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 66px;\"\u003e\n \u003cp\u003e0:1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 66px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 85px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e* s-sterile; f-fertile\u003c/p\u003e\n\u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n\u003cp\u003eTable 3. Segregation pattern observed in six-generations of crossing program between IIHRMOP 1111 and Pusa Narangi Gainda for confirmation of genes involved in petaloid male sterility.\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"652\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 46px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eS.No\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"3\" valign=\"top\" style=\"width: 184px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eInitialmaterial maintained/crossed\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"4\" valign=\"top\" style=\"width: 289px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eResulting progeny\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 57px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eChi- square value\u003c/p\u003e\n \u003cp\u003ep=0.05\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 76px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eProbability\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 46px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 85px;\"\u003e\n \u003cp\u003eLines/varieties used\u003c/p\u003e\n \u003cp\u003ein crossing\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 60px;\"\u003e\n \u003cp\u003eGenotype (Sterile: Fertile)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 40px;\"\u003e\n \u003cp\u003eGene ration\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 90px;\"\u003e\n \u003cp\u003eExpected phenotypic ratio (sterile:fertile)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 95px;\"\u003e\n \u003cp\u003eExpected genotypic ratio (sterile:fertile)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 47px;\"\u003e\n \u003cp\u003eNumber of sterile plants-\u003c/p\u003e\n \u003cp\u003eobserved\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 57px;\"\u003e\n \u003cp\u003eNumber of fertile plants-\u003c/p\u003e\n \u003cp\u003eobserved\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 57px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 76px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 46px;\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 85px;\"\u003e\n \u003cp\u003eIIHRMOP 1111\u003c/p\u003e\n \u003cp\u003e(IIHRMOP 1111-s + IIHRMOP 1111-f)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 60px;\"\u003e\n \u003cp\u003e1Pp:1pp\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 40px;\"\u003e\n \u003cp\u003eP\u003csub\u003e1\u003c/sub\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 90px;\"\u003e\n \u003cp\u003e1:1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 95px;\"\u003e\n \u003cp\u003e1Pp:1pp\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 47px;\"\u003e\n \u003cp\u003e25\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 57px;\"\u003e\n \u003cp\u003e28\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 57px;\"\u003e\n \u003cp\u003e0.16\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 76px;\"\u003e\n \u003cp\u003e0.68\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 46px;\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 85px;\"\u003e\n \u003cp\u003ePusa Narangi\u003c/p\u003e\n \u003cp\u003eGainda\u003c/p\u003e\n \u003cp\u003e(PNG)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 60px;\"\u003e\n \u003cp\u003e0:pp\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 40px;\"\u003e\n \u003cp\u003eP\u003csub\u003e2\u003c/sub\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 90px;\"\u003e\n \u003cp\u003e0:1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 95px;\"\u003e\n \u003cp\u003e0:pp\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 47px;\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 57px;\"\u003e\n \u003cp\u003e45\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 57px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 76px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 46px;\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 85px;\"\u003e\n \u003cp\u003eIIHRMOP 1111-s X\u003c/p\u003e\n \u003cp\u003ePNG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 60px;\"\u003e\n \u003cp\u003ePp x pp\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 40px;\"\u003e\n \u003cp\u003eF\u003csub\u003e1\u003c/sub\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 90px;\"\u003e\n \u003cp\u003e1:1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 95px;\"\u003e\n \u003cp\u003e1Pp:1pp\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 47px;\"\u003e\n \u003cp\u003e40\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 57px;\"\u003e\n \u003cp\u003e56\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 57px;\"\u003e\n \u003cp\u003e2.66\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 76px;\"\u003e\n \u003cp\u003e0.10\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 46px;\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 85px;\"\u003e\n \u003cp\u003eSelf of fertile\u003c/p\u003e\n \u003cp\u003eF\u003csub\u003e1\u003c/sub\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 60px;\"\u003e\n \u003cp\u003epp x pp\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 40px;\"\u003e\n \u003cp\u003eF\u003csub\u003e2\u003c/sub\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 90px;\"\u003e\n \u003cp\u003e1:0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 95px;\"\u003e\n \u003cp\u003epp:0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 47px;\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 57px;\"\u003e\n \u003cp\u003e210\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 57px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 76px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 46px;\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 85px;\"\u003e\n \u003cp\u003eIIHRMOP 1111-s X\u003c/p\u003e\n \u003cp\u003eFertile F\u003csub\u003e1\u003c/sub\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 60px;\"\u003e\n \u003cp\u003ePp x pp\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 40px;\"\u003e\n \u003cp\u003eBC\u003csub\u003e1\u003c/sub\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 90px;\"\u003e\n \u003cp\u003e1:1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 95px;\"\u003e\n \u003cp\u003e1Pp:1pp\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 47px;\"\u003e\n \u003cp\u003e34\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 57px;\"\u003e\n \u003cp\u003e24\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 57px;\"\u003e\n \u003cp\u003e1.72\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 76px;\"\u003e\n \u003cp\u003e0.18\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 46px;\"\u003e\n \u003cp\u003e6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 85px;\"\u003e\n \u003cp\u003eSterile F\u003csub\u003e1\u003c/sub\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;X PNG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 60px;\"\u003e\n \u003cp\u003ePp x pp\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 40px;\"\u003e\n \u003cp\u003eBC\u003csub\u003e2\u003c/sub\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 90px;\"\u003e\n \u003cp\u003e1:1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 95px;\"\u003e\n \u003cp\u003e1Pp:1pp\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 47px;\"\u003e\n \u003cp\u003e21\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 57px;\"\u003e\n \u003cp\u003e24\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 57px;\"\u003e\n \u003cp\u003e0.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 76px;\"\u003e\n \u003cp\u003e0.65\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp;*s-sterile; f-fertile\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTable. 4. The sequences of markers used in the present study are as follows:\u003c/p\u003e\n \u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"645\"\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 52px;\"\u003e\n \u003cp\u003eSI. No\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 85px;\"\u003e\n \u003cp\u003eMarkers name\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 509px;\"\u003e\n \u003cp\u003ePrimer sequence (5\u0026rsquo; \u0026ndash; 3\u0026rsquo;)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 52px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 85px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 255px;\"\u003e\n \u003cp\u003eForward primer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 253px;\"\u003e\n \u003cp\u003eReverse primer\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 52px;\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 85px;\"\u003e\n \u003cp\u003eCPSSR 4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 255px;\"\u003e\n \u003cp\u003eTCCACATCAAATTCTTGGTCCCT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 253px;\"\u003e\n \u003cp\u003eGGGGAGGGTCGTTGCATATT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 52px;\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 85px;\"\u003e\n \u003cp\u003eCPSSR 7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 255px;\"\u003e\n \u003cp\u003eCGTGATGTCGAAACGTTGTGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 253px;\"\u003e\n \u003cp\u003eTGAAGGTGGTGGTGCCTTTT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 52px;\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 85px;\"\u003e\n \u003cp\u003eCPSSR 11\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 255px;\"\u003e\n \u003cp\u003eAGAGAGAGAGACCACTGTTGT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 253px;\"\u003e\n \u003cp\u003eTCACAACATCACAGCTCAACAC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 52px;\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 85px;\"\u003e\n \u003cp\u003eCPSSR 16\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 255px;\"\u003e\n \u003cp\u003eCCATTAAAGGGCTCGACGGA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 253px;\"\u003e\n \u003cp\u003eGGACTTGCTCCGCTACCTAC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 52px;\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 85px;\"\u003e\n \u003cp\u003eCPSSR 26\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 255px;\"\u003e\n \u003cp\u003eGCTGTTGGAGCCACTGATCT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 253px;\"\u003e\n \u003cp\u003eACATCAATCCCTACAAAACCCT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 52px;\"\u003e\n \u003cp\u003e6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 85px;\"\u003e\n \u003cp\u003eCPSSR 33\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 255px;\"\u003e\n \u003cp\u003eCAATTTTCGTTCCGGCTGCA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 253px;\"\u003e\n \u003cp\u003eGAGCATGTTGCCTCAGAGGT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 52px;\"\u003e\n \u003cp\u003e7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 85px;\"\u003e\n \u003cp\u003eCPSSR 37\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 255px;\"\u003e\n \u003cp\u003eACCCGTACCCAATCCCAATT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 253px;\"\u003e\n \u003cp\u003eGCAGCACTACTACAACCACCA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 52px;\"\u003e\n \u003cp\u003e8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 85px;\"\u003e\n \u003cp\u003eCPSSR 39\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 255px;\"\u003e\n \u003cp\u003eACTCACGGGAGGAGAAATGC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 253px;\"\u003e\n \u003cp\u003eCAGAAGCAGAGACCGGTCTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 52px;\"\u003e\n \u003cp\u003e9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 85px;\"\u003e\n \u003cp\u003eCPSSR 47\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 255px;\"\u003e\n \u003cp\u003eTCGGGGAGATGTCTGAATTTGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 253px;\"\u003e\n \u003cp\u003eCGTCACGCATAAACGAATGT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 52px;\"\u003e\n \u003cp\u003e10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 85px;\"\u003e\n \u003cp\u003eCPSSR 53\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 255px;\"\u003e\n \u003cp\u003eTGGGATGATCTGGGAGCTGA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 253px;\"\u003e\n \u003cp\u003eAGTGTCCAACCAAAAGCCCTA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 52px;\"\u003e\n \u003cp\u003e11\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 85px;\"\u003e\n \u003cp\u003eCPSSR 66\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 255px;\"\u003e\n \u003cp\u003eCGATGACGTTGACGGACTTTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 253px;\"\u003e\n \u003cp\u003eAGGCCGAATTGAAGGTGATGT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e"}],"fulltextSource":"","fullText":"","funders":[{"identity":"65faad37-0608-48e2-a71c-db5293e2a9e2","identifier":"10.13039/501100001843","name":"Science and Engineering Research Board","awardNumber":"2020","order_by":0}],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":true,"highlight":"","institution":"indian institure of Horticultural research","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"African marigold, Mendelian Genetics, Petaloid flower, Male sterility, SSR markers","lastPublishedDoi":"10.21203/rs.3.rs-6810176/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6810176/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThe demand for hybrid varieties of African marigold (\u003cem\u003eTagetes erecta\u003c/em\u003e L.) is on the rise due to the increased productivity and uniformity exhibited by F\u003csub\u003e1\u003c/sub\u003e hybrids. To simplify the hybridization process, the use of a male sterile line is essential, as emasculation can be complicated due to the unique flower structure of marigold. In this study, seed-propagated petaloid male sterile lines with a genetic inheritance were employed. The inheritance of sterility was investigated across six generations (P\u003csub\u003e1\u003c/sub\u003e, P\u003csub\u003e2\u003c/sub\u003e, F\u003csub\u003e1\u003c/sub\u003e, F\u003csub\u003e2\u003c/sub\u003e, BC\u003csub\u003e1\u003c/sub\u003e and BC\u003csub\u003e2\u003c/sub\u003e) and confirmed a single dominant gene governing petaloid male sterility over multiple seasons. The identification of molecular markers closely linked to the male sterility locus is crucial for accurately identifying genotypes with the desired traits within breeding populations. The marker CPSSR-39 exhibited clear and consistent segregation, following a Mendelian 1:1 ratio in accordance with the genes governing petaloid male sterility. This study represents the first report of genic petaloid male sterility and demonstrates the validation of linked markers, highlighting the potential use of CPSSR-39 in marker-assisted selection in marigold. This breakthrough opens up numerous opportunities for the commercial hybrid seed production of marigold, marking a significant advancement in marigold breeding.\u003c/p\u003e","manuscriptTitle":"Genetic inheritance and identification of molecular markers linked to male sterility in African marigold (Tagetes erecta L.)","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-06-04 09:34:37","doi":"10.21203/rs.3.rs-6810176/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"4bf22bf7-a8ff-4508-8648-be72d2b16397","owner":[],"postedDate":"June 4th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":49451895,"name":"Molecular Genetics"}],"tags":[],"updatedAt":"2025-06-04T09:34:37+00:00","versionOfRecord":[],"versionCreatedAt":"2025-06-04 09:34:37","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-6810176","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6810176","identity":"rs-6810176","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00
unpaywall
last seen: 2026-05-27T02:00:06.600101+00:00
License: CC-BY-4.0