Attenuated Clostridium perfringens Epsilon Toxin Mutants and Insights into the Mechanism of Attenuation

preprint OA: closed
📄 Open PDF Full text JSON View at publisher

Abstract

Clostridium perfringens epsilon toxin (ETX) is a potent pore-forming exotoxin responsible for severe enterotoxemia and necrotizing enterocolitis in ruminants. To elucidate the molecular mechanisms underlying ETX pathogenicity and attenuation, several site-directed mutants—ETX-R25A, ETX-F92A, ETX-Y133A, ETX-F206A, ETX-D210A, and ETX-G221A—were constructed based on structural analysis. Cytotoxicity assays revealed reduced virulence in ETX-Y133A, ETX-F92A, and ETX-F206A, with Y133A exhibiting the most significant attenuation. To further investigate the role of residue Y133, additional mutants (Y133E, Y133F, Y133S, Y133W, and Y133G) were generated. Selected mutants were evaluated for cytotoxicity, pathogenicity in BALB/c mice, and in vivo safety through histopathological analysis. Furthermore, their pore-forming ability, binding affinity to MDCK cells, and oligomerization properties were assessed. Results demonstrated that residue Y133 is critical for ETX activity, likely due to the necessity of its aromatic side chain for pore formation. In contrast, F92 and F206 appear to be involved in host-cell interactions via distinct mechanisms. These findings provide insights into ETX structure–function relationships and offer potential strategies for rational attenuation in vaccine development.
Full text 46,212 characters · extracted from preprint-html · click to expand
Attenuated Clostridium perfringens Epsilon Toxin Mutants and Insights into the Mechanism of Attenuation | Authorea try { document.documentElement.classList.add('js'); } catch (e) { } var _gaq = _gaq || []; _gaq.push(['_setAccount', 'G-8VDV14Y67G']); _gaq.push(['_trackPageview']); (function() { var ga = document.createElement('script'); ga.type = 'text/javascript'; ga.async = true; ga.src = ('https:' == document.location.protocol ? 'https://ssl' : 'http://www') + '.google-analytics.com/ga.js'; var s = document.getElementsByTagName('script')[0]; s.parentNode.insertBefore(ga, s); })(); Skip to main content Preprints Collections Wiley Open Research IET Open Research Ecological Society of Japan All Collections About About Authorea FAQs Contact Us Quick Search anywhere Search for preprint articles, keywords, etc. Search Search ADVANCED SEARCH SCROLL Journal of Basic Microbiology This is a preprint and has not been peer reviewed. Data may be preliminary. 4 July 2025 V1 Latest version Share on Attenuated Clostridium perfringens Epsilon Toxin Mutants and Insights into the Mechanism of Attenuation Authors : Zibei HUANG , Haiyan Wang , Jinlin Huang , and Zibei HUANG [email protected] Authors Info & Affiliations https://doi.org/10.22541/au.175161972.24940605/v1 Published Journal of Basic Microbiology Version of record Peer review timeline 299 views 144 downloads Contents Abstract Information & Authors Metrics & Citations View Options References Figures Tables Media Share Abstract Clostridium perfringens epsilon toxin (ETX) is a potent pore-forming exotoxin responsible for severe enterotoxemia and necrotizing enterocolitis in ruminants. To elucidate the molecular mechanisms underlying ETX pathogenicity and attenuation, several site-directed mutants—ETX-R25A, ETX-F92A, ETX-Y133A, ETX-F206A, ETX-D210A, and ETX-G221A—were constructed based on structural analysis. Cytotoxicity assays revealed reduced virulence in ETX-Y133A, ETX-F92A, and ETX-F206A, with Y133A exhibiting the most significant attenuation. To further investigate the role of residue Y133, additional mutants (Y133E, Y133F, Y133S, Y133W, and Y133G) were generated. Selected mutants were evaluated for cytotoxicity, pathogenicity in BALB/c mice, and in vivo safety through histopathological analysis. Furthermore, their pore-forming ability, binding affinity to MDCK cells, and oligomerization properties were assessed. Results demonstrated that residue Y133 is critical for ETX activity, likely due to the necessity of its aromatic side chain for pore formation. In contrast, F92 and F206 appear to be involved in host-cell interactions via distinct mechanisms. These findings provide insights into ETX structure–function relationships and offer potential strategies for rational attenuation in vaccine development. Attenuated Clostridium perfringens Epsilon Toxin Mutants and Insights into the Mechanism of Attenuation Zibei HUANG 1 ,Haiyan Wang 2 , Jinlin Huang 1,3* , Wenbo LIU 1,4* 1 College of Veterinary Medicine, Yangzhou University, Yangzhou, 225009, Jiangsu Province, China 2 Jiangsu Vocational College of Agricultural and Animal Husbandry, Taizhou 225300, Jiangsu Province, China 3 Key Laboratory of Prevention and Control of Biological Hazard Factors (Animal Origin) for Agrifood Safety and Quality, Ministry of Agriculture and Rural Affairs of China, Yangzhou 225009, Jiangsu Province, China 4 Jiangsu Co-innovation Center for Prevention and Control of Important Animal Infectious Diseases and Zoonoses, Yangzhou University, Yangzhou 225009, Jiangsu Province, China * These authors contributed equally to this work. Corresponding authors at Jiangsu Co-innovation Center for Prevention and Control of Important Animal Infectious Diseases and Zoonoses of Yangzhou University, Yangzhou, China (W B Liu). E-mail address: [email protected] (J L Huang), [email protected] (W B Liu) Abstract: Clostridium perfringens epsilon toxin (ETX) is a potent pore-forming exotoxin responsible for severe enterotoxemia and necrotizing enterocolitis in ruminants. To elucidate the molecular mechanisms underlying ETX pathogenicity and attenuation, several site-directed mutants—ETX-R25A, ETX-F92A, ETX-Y133A, ETX-F206A, ETX-D210A, and ETX-G221A—were constructed based on structural analysis. Cytotoxicity assays revealed reduced virulence in ETX-Y133A, ETX-F92A, and ETX-F206A, with Y133A exhibiting the most significant attenuation. To further investigate the role of residue Y133, additional mutants (Y133E, Y133F, Y133S, Y133W, and Y133G) were generated. Selected mutants were evaluated for cytotoxicity, pathogenicity in BALB/c mice, and in vivo safety through histopathological analysis. Furthermore, their pore-forming ability, binding affinity to MDCK cells, and oligomerization properties were assessed. Results demonstrated that residue Y133 is critical for ETX activity, likely due to the necessity of its aromatic side chain for pore formation. In contrast, F92 and F206 appear to be involved in host-cell interactions via distinct mechanisms. These findings provide insights into ETX structure–function relationships and offer potential strategies for rational attenuation in vaccine development. Keywords: Clostridium perfringens ; Epsilon toxin, site-directed mutagenesis, cytotoxicity, attenuation Introduction Epsilon toxin(ε toxin, ETX), produced by Clostridium perfringens ( C.perfringens ) type B and D strains[1-3], is recognized as one of the most potent bacterial protein toxins, comparable to botulinum and tetanus neurotoxins[2,4]. It causes fatal enterotoxemia in livestock, leading to significant economic losses in animal husbandry[5-7]. ETX is secreted in the intestine as an inactive precursor, or protoxin, consisting of 329 amino acids, including a 32-amino acid signal peptide[8]. This protoxin is activated through proteolytic cleavage at both termini by host digestive enzymes (e.g., trypsin, pancreatic proteases) or by λ-protease from C. perfringens, resulting in a mature toxin of 254-261 amino acids[9-10]. ETX belongs to the aerolysin-like family of pore-forming toxins, exerting its cytotoxicity by forming heptameric pores in target cell membranes[11-13]. The mechanism of action involves three sequential steps: receptor binding (primarily to the myelin and lymphocyte protein MAL), oligomerization on the cell surface, and insertion of the toxin complex into the membrane to form a β-barrel pore, leading to osmotic lysis and cell death[14-17]. Structurally, ETX comprises three domains: domain I, implicated in receptor binding[18–20]; domain II, which contains a β-hairpin structure essential for pore formation[21]; and domain III, associated with oligomerization and protease cleavage. Domains II and III are both crucial for membrane insertion[22]. Although several key residues involved in ETX toxicity have been identified—including Tyr29, Tyr30, Tyr36, Tyr196, and Phe199 in domain I; His106 in domain II; and Trp71 in domain III—the functional roles of many other residues remain unclear[23-26]. Previous studies indicate that ETX-induced pores (~2 nm wide) disrupt ion homeostasis by permitting the influx of Na⁺, Cl⁻, and Ca²⁺, and efflux of K⁺, ultimately leading to metabolic failure[27]. Madin-Darby Canine Kidney (MDCK) cells are highly sensitive to ETX and commonly used as in vitro models for toxicity studies[28-30]. In vivo, murine models are widely employed to evaluate ETX pathogenicity[31-35]. Notably, emerging evidence suggests that ETX can also induce non-pore-mediated cell death via unknown mechanisms[36-39]. Given the diverse roles of ETX residues across its three domains, this study aimed to investigate the functional significance of selected amino acids in ETX pathogenicity through a combination of mutagenesis, cytotoxicity assays, and structural-functional analyses. 2. Material and methods 2.1. Cloning, expression, and purification of wild-type and mutant ETX proteins Primers for ETX gene amplification were designed based on the published sequence (GenBank accession number: JX010451.1). The forward primer included an EcoRI restriction site (underlined) and a homologous arm for the pET32a(+) vector, while the reverse primer contained an XhoI site (underlined) and the corresponding homologous sequence. The amplified ETX fragments were cloned into the pET32a(+) vector using standard molecular cloning techniques. Residue positions for mutagenesis-R25, F92, Y133, F206, D210, and G221-were selected based on the ETX crystal structure (PDB ID: 1UYJ). Site-directed mutagenesis was performed using the Mut Express II Fast Mutagenesis Kit V2 (C214, Vazyme) according to the manufacturer’s instructions. The specific primer sequences used are listed in Table 1. The recombinant plasmids were transformed into Escherichia coli BL21(DE3) pLysS cells (CB106, TIANGEN). Cultures were grown at 37 °C to an OD 600 of 0.4-0.6, then induced with 1.0 mM isopropyl-β-D-1-thiogalactopyranoside (IPTG) (I8070, Solarbio) and incubated at 16 °C for 16-20 hours. Recombinant His₆-tagged proteins were purified using Ni-NTA affinity chromatography (His-tag Purification Resin, P2210, BeyoGold), following the manufacturer’s protocol. Protein concentrations were determined by Bradford assay using bovine serum albumin (BSA) as a standard. The purity of each protein was confirmed by SDS-PAGE followed by Coomassie Brilliant Blue staining. Unless otherwise stated, all amino acid numbering refers to the mature ETX toxin, excluding the 13-residue N-terminal signal peptide of the prototoxin. The ETX precursors and mutant proteins expressed in Escherichia coli were converted to their mature forms by trypsin digestion. Purified ETX (18.9 μg) was initially incubated with varying volumes (7.5, 15, 22.5, and 30 μL) of 0.25% trypsin (without EDTA) at 37 °C for 1 hour in a water bath to determine the optimal activation conditions. Subsequently, mutant protein precursors were treated with the optimal trypsin volume of 30 μL under the same conditions. Trypsin activity was terminated by adding 1% bovine serum albumin (BSA). The conversion to mature toxin was confirmed by 12% SDS-PAGE analysis. The cytotoxicity of trypsin-activated ETX and its mutants toward Madin-Darby Canine Kidney (MDCK) cells was assessed by measuring lactate dehydrogenase (LDH) release using the Cell Counting Kit-8 (CCK-8) assay (C0038, BeyoGold) according to the manufacturer’s instructions. MDCK cells were seeded in 96-well plates and cultured in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (FBS) for 12 hours. Cells were then divided into four groups (six wells per group) and treated with activated ETX at concentrations of 0.0125, 0.025, 0.05, and 0.1 μg/mL. Control wells received DMEM with 10% FBS without toxin (negative control), and blank wells contained DMEM with 10% FBS but no cells. After 24 hours of incubation, CCK-8 reagent was added, and absorbance was measured at 450 nm using a microplate reader. Cell viability was calculated using the formula: Cell viability rate=\(\frac{OD\ of\ experimental\ group\ -\ OD\ of\ blank\ group}{OD\ of\ negative\ control\ group\ -\ OD\ of\ blank\ group}\times 100\%\) Female BALB/c mice (n = 5 per group) were administered intraperitoneally (i.p.) with either ETX protein at doses of 0.25, 1, 4, 16, or 64 μg per mouse, or ETX-Y133A substituted protein at doses of 60, 120, 240, or 480 μg per mouse. Negative control mice received 100 μL of PBS. After administration, survival was monitored every 24 hours for 14 days. At the end of the observation period, kidneys and brains were collected, fixed in 4% formaldehyde overnight, and embedded in paraffin. Paraffin sections were stained with Masson’s trichrome and hematoxylin-eosin (H&E) for histopathological analysis. All examinations were conducted by a qualified pathologist. All animal procedures were approved by the Institutional Animal Care and Use Committee of Yangzhou University (protocol code 202104051, approved on April 15, 2021). MDCK cells were seeded in 6-well plates at 1 × 10 6 cells per well and cultured for 24 h. Cells were then treated with 250 μL of ETX-Y133A substituted protein (300 μg/mL) or PBS and incubated at 37 °C with 5% CO₂ for 15-30 min. For Western blot analysis, cells were lysed in 250 μL of RIPA buffer (R0010, Solarbio) containing protease inhibitors for 30 min on ice. After three washes with PBS, lysates were centrifuged at 4 °C for 15 min. The primary antibody was mouse monoclonal anti-His (P2135, BeyoGold), and the secondary antibody was HRP-conjugated goat anti-mouse IgG (330, MBL Beijing Biotech Co., Ltd). MDCK cells were seeded in 6-well plates at 1 × 10 5 cells per well and cultured for 24 h. Cells were treated with either trypsin-activated ETX or ETX-Y133A. After treatment, cells were washed twice with PBS and fixed with 4% paraformaldehyde for 20 min at room temperature, then washed. His Tag (C-terminal Specific) Mouse Monoclonal Antibody (HRP Conjugated) (AF2873, BeyoGold) was diluted 1:100 in PBS and incubated with cells at 37 °C for 1 h. Cells were washed with PBS and incubated with FITC-labeled goat anti-mouse IgG secondary antibody (1:100) (AP124F, Sigma-Aldrich) for 45 min at 37 °C. Following three PBS washes, cells were stained with 300 μL DAPI (C0065, Solarbio) for 30 min at room temperature. Finally, fluorescence was observed using a Zeiss LSM880 laser confocal microscope (Zeiss, Oberkochen, Germany). Intracellular calcium levels were measured using the Fluo-4 Direct™ Calcium Assay Kit (S1061, BeyoGold), a calcium-sensitive fluorescent dye. MDCK cells were seeded in 96-well plates at a density of 10,000 cells per well. After washing with PBS, Fluo-4 dye was added according to the manufacturer’s instructions. Subsequently, 100 μL of trypsin-activated ETX or its substituted protein (10 μg/mL) was added to the wells. Fluorescence intensity was measured at 20-minute intervals using a microplate reader. Results Based on molecular modeling and structural analysis, six mutation sites—R25, F92, Y133, F206, D210, and G221—were identified as targets for alanine substitution (Figure 1A). Site-directed mutagenesis was performed to replace each of these residues with alanine, which lacks a side chain, to assess their functional relevance. The ETX gene was cloned into the prokaryotic expression vector pET-32a(+) containing the pre-toxin coding region of the ETX mutant. The recombinant protein was successfully expressed in a soluble form in E. coli BL21 (DE3) pLysS. Purification was carried out using nickel affinity chromatography. SDS-PAGE analysis confirmed the expression of the recombinant protein, showing an expected molecular weight of approximately 53 kDa, including the fusion tag (Trx Tag + S Tag + His Tag, 20.4 kDa) (Figure 1B). The ETX mutant protein was also expressed in soluble form, and SDS-PAGE analysis again showed a band at 53 kDa (Figure 1C). The optimal concentration of trypsin required to activate ETX remains undetermined and needed to be experimentally evaluated. To assess this, 18.9 μg of purified ETX prototoxin was incubated with varying volumes of 0.25% trypsin (without EDTA) at 37 °C. Following activation, the samples were analyzed by 12% SDS-PAGE to observe proteolytic processing. The results are shown in Figure 2. At a concentration of 0.025 μg/mL, cell viability remained approximately 80% in the ETX-F92A- and ETX-F206A-treated groups, while cells treated with ETX-Y133A retained nearly 100% viability (Figure 3A). When the concentration of ETX-F92A and ETX-F206A was increased to 0.1 μg/mL, approximately 20% cell death was observed, indicating reduced cytotoxicity. In contrast, ETX-Y133A exhibited a nearly complete loss of cytotoxic activity. To further investigate the importance of residue Y133, several variants (ETX-Y133E, ETX-Y133S, ETX-Y133W, and ETX-Y133G) were generated. These substitutions significantly reduced cytotoxicity. At 0.1 μg/mL, ETX-Y133F and wild-type ETX showed comparable cytotoxic effects, with cell viability dropping to around 40%, indicating that the Y133F mutation retained toxicity (Figure 3B). Structural analysis (Figure 3C) revealed that when a single phenyl ring–containing residue, such as tyrosine (Y) or phenylalanine (F), was present at position 133, the protein retained its virulence. In contrast, substitutions with alanine (A), glutamic acid (E), serine (S), or glycine (G)—all lacking a phenyl ring—led to substantial attenuation of toxicity. Although tryptophan (W) contains a larger aromatic structure, it still resulted in decreased toxicity. These findings collectively demonstrate that residue Y133 plays a critical role in the cytotoxicity of ETX and that the presence of a phenyl ring at this position is essential for its virulence. The lethal doses (LD₅₀) of ETX prototoxin and activated ETX were determined to be 0.456 mg/kg and 0.0166 mg/kg, respectively. In contrast, all mice survived without exhibiting any obvious clinical symptoms following intraperitoneal injection of ETX-Y133A at a dose as high as 960 μg. Therefore, the LD₅₀ for ETX-Y133A could not be determined (Table 2), indicating that this mutant may possess a strong detoxifying effect. To further evaluate the safety of ETX-Y133A, histopathological examination of the kidneys and brains was performed in mice administered with ETX (4 μg/mouse) or ETX-Y133A (400 μg/mouse). Hematoxylin and eosin (H&E) staining revealed pathological changes in the brains of mice treated with ETX, including mild neuronal coagulation and vascular extravasation (Figure 4, blue arrow). Additionally, extensive homogeneous eosinophilic deposits were observed in the renal tubular lumen, accompanied by granular degeneration of epithelial cells (Figure 4, yellow arrow). In contrast, no histopathological alterations were detected in the kidneys or brains of mice treated with ETX-Y133A or PBS. The binding ability of ETX and its mutants to MDCK cells was examined using confocal laser scanning microscopy. As shown in Figure 5, green fluorescence was observed in all groups, indicating that each mutant retained the ability to bind to the membranes of MDCK cells. These findings suggest that the mutations did not affect the membrane-binding capacity of the toxin. ETX exerts its cytotoxic effects by forming pores in the cell membrane through oligomerization into heptameric complexes. Therefore, the ability of ETX mutants to oligomerize is a key determinant of their toxicity. Since ETX heptamers are resistant to SDS, oligomer formation was assessed based on the presence of SDS-resistant bands in Western blot analysis. As shown in Figure 6, both wild-type ETX and the Y133 mutant proteins produced bands of identical size, indicating successful oligomerization. These results demonstrate that the amino acid substitutions at position 133 did not impair the oligomerization ability of the toxin. 3.7. Comparison of the pore-forming ability of ETX and its mutants To determine whether ETX mutants influence intracellular Ca²⁺ levels, fluctuations in intracellular Ca²⁺ concentrations in MDCK cells were monitored. Wild-type ETX induced a significant influx of Ca²⁺, with the fluorescence intensity of calcium signals peaking at 30 minutes post-treatment, followed by a gradual decline due to MDCK cell death. As shown in Figure 7A, ETX-R25A exhibited a calcium influx pattern similar to that of wild-type ETX, whereas ETX-F92A, ETX-Y133A, and ETX-F206A failed to induce a notable increase in intracellular Ca²⁺ levels. Subsequently, the effects of various ETX-Y133 substituted mutants on calcium influx were further evaluated. Among the Y133 mutants, only ETX-Y133F retained the ability to elevate intracellular Ca²⁺ levels; all other substitutions at this residue did not trigger calcium influx (Figure 7B). These findings suggest that mutations at Y133, but not at F92 or F206, impair the pore-forming activity of ETX on MDCK cells. 4. Discussion Epsilon toxin (ETX), a potent cytotoxin, neurotoxin, and edematous agent, has been classified as a category B biological agent by the U.S. Centers for Disease Control and Prevention (CDC). It is the principal cause of enterotoxaemia in various domestic and wild animals, and potentially in humans[40]. Consequently, the development of vaccines or toxoids targeting ETX is of significant importance. Traditionally, vaccines have been prepared by inactivating ETX with 4% formaldehyde, which poses biosafety risks during production. To overcome these limitations, recent studies have focused on engineering ETX mutants with attenuated toxicity as vaccine candidates [41] . In this study, six ETX mutants (R25A, F92A, Y133A, F206A, D210A, and D221A) were rationally designed by site-directed mutagenesis, targeting residues associated with ETX virulence—particularly those implicated in sugar-binding. The selected residues, identified via the PDB database, were substituted with alanine to eliminate side chain-specific interactions. The resulting proteins, expressed in E. coli with a 6×His-tag, remained soluble and retained biological activity, consistent with prior evidence that the His-tag does not affect ETX toxicity [42] . Although trypsin activation significantly enhances ETX toxicity [43-44] , the optimal activation conditions remain undefined. Our data showed that 30 µL of 0.25% trypsin effectively activated 18.9 µg of ETX prototoxin after 1 hour at 37 °C. Among the mutants, ETX-Y133A, ETX-F92A, and ETX-F206A demonstrated reduced cytotoxicity in MDCK cells, a standard model for assessing ETX virulence. At 0.025 μg/mL, cell viability in the ETX, F92A, F206A, and Y133A treatment groups was approximately 50%, 80%, 80%, and 100%, respectively. Notably, ETX-Y133A exhibited no cytotoxicity even at 0.1 μg/mL, suggesting that tyrosine 133 is a key residue for ETX activity. Substitution of Y133 with residues lacking a benzene ring—glutamate, serine, tryptophan, or glycine—also resulted in loss of toxicity. However, replacement with phenylalanine, which retains the aromatic ring, restored cytotoxicity. These findings imply that the phenyl ring at position 133, located in domain II, is essential for pore formation and cytotoxic activity. Although F92A (domain III) and F206A (domain I) mutants showed attenuated cytotoxicity, their calcium influx profiles were similar to wild-type ETX, suggesting that while these residues may participate in cellular signaling, they are not essential for pore formation. Recent studies have proposed that ETX may also induce cell death via non-pore-dependent mechanisms, though the underlying pathways remain unclear [45-49] . Importantly, the consistency between calcium influx and cytotoxicity assays reinforces the critical role of Y133 and its aromatic structure in ETX-mediated pore formation. ETX-Y133A, first identified in this study, represents a promising candidate for subunit vaccine development. Further research is warranted to elucidate its attenuation mechanisms and evaluate its immunogenicity. Given its significant potential, ETX-Y133A warrants continued investigation as a candidate vaccine against Clostridium perfringens infection. Declaration of Competing Interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Author contributions Conceived and designed the experiments: ZBH WBL JLH. Performed the experiments: ZBH JYL SYS ML HYW. Wrote the paper: ZBH WBL. All authors read and approved the final manuscript. All authors attest they meet the ICMJE criteria for authorship. This research was funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD). The study was conducted according to the guidelines of the Declaration of Helsinki, and approved by the Institutional Review Board (or Ethics Committee) of Laboratory Animal Ethics Committee of Yangzhou University (protocol code 202104051 and the date of approval is April 15, 2021). Informed Consent Statement Not applicable. The data that support the findings of this study are available from the corresponding author upon reasonable request. The authors declare no conflicts of interest. References 1. Bokori-Brown M, Hall CA, Vance C, et al. Clostridium perfringens epsilon toxin mutant Y30A-Y196A as a recombinant vaccine candidate against enterotoxemia. Vaccine . 2014, 32(23), 2682-2687. DOI: 10.1016/j.vaccine.2014.03.079. 2. Garcia JP, Beingesser J, Bohorov O, et al. Prevention and treatment of Clostridium perfringens epsilon toxin intoxication in mice with a neutralizing monoclonal antibody (c4D7) produced in Nicotiana benthamiana. Toxicon . 2014, 88, 93-98. DOI: 10.1016/j.toxicon.2014.06.012. 3. McDonel JL. Clostridium perfringens toxins (type A, B, C, D, E). Pharmacol Ther . 1980, 10(3), 617-655. DOI: 10.1016/0163-7258(80)90031-5. 4. Alves GG, Machado de Ávila RA, Chávez-Olórtegui CD, et al. Clostridium perfringens epsilon toxin: the third most potent bacterial toxin known. Anaerobe . 2014, 30, 102-107. DOI: 10.1016/j.anaerobe.2014.08.016. 5. Borrmann E, Günther H, Köhler H. Effect of Clostridium perfringens epsilon toxin on MDCK cells. FEMS Immunol Med Microbiol . 2001, 31(2), 85-92. DOI: 10.1111/j.1574-695X.2001.tb00503.x. 6. Stiles BG, Barth G, Barth H, et al. Clostridium perfringens epsilon toxin: a malevolent molecule for animals and man? Toxins (Basel) . 2013, 5(11), 2138-2160. DOI: 10.3390/toxins5112138. 7. Soler-Jover A, Dorca J, Popoff MR, et al. Distribution of Clostridium perfringens epsilon toxin in the brains of acutely intoxicated mice and its effect upon glial cells. Toxicon . 2007, 50(4), 530-540. DOI: 10.1016/j.toxicon.2007.04.025. 8. Hunter SE, Clarke IN, Kelly DC, et al. Cloning and nucleotide sequencing of the Clostridium perfringens epsilon-toxin gene and its expression in Escherichia coli . Infect Immun. 1992, 60(1), 102-110. DOI: 10.1128/iai.60.1.102-110.1992. 9. Jin F, Matsushita O, Katayama S, et al. Purification, characterization, and primary structure of Clostridium perfringens lambda-toxin, a thermolysin-like metalloprotease. Infect Immun . 1996, 64(1), 230-237. DOI: 10.1128/iai.64.1.230-237.1996. 10. Minami J, Katayama S, Matsushita O, et al. Lambda-toxin of Clostridium perfringens activates the precursor of epsilon-toxin by releasing its N- and C-terminal peptides. Microbiol Immunol . 1997, 41(7), 527-535. DOI: 10.1111/j.1348-0421.1997.tb01888.x. 11. Knapp O, Maier E, Benz R, et al. Identification of the channel-forming domain of Clostridium perfringens Epsilon-toxin (ETX). Biochim Biophys Acta . 2009, 1788(12), 2584-2593. DOI: 10.1016/j.bbamem.2009.09.020. 12. Robertson SL, Li J, Uzal FA, et al. Evidence for a prepore stage in the action of Clostridium perfringens epsilon toxin. PLoS One . 2011, 6(7), e22053. DOI: 10.1371/journal.pone.0022053. 13. Miyata S, Minami J, Tamai E, et al. Clostridium perfringens epsilon-toxin forms a heptameric pore within the detergent-insoluble microdomains of Madin-Darby canine kidney cells and rat synaptosomes. J Biol Chem . 2002, 277(42), 39463-39468. DOI: 10.1074/jbc.M206731200. 14. Linden JR, Telesford K, Shetty S, et al. A Novel Panel of Rabbit Monoclonal Antibodies and Their Diverse Applications Including Inhibition of Clostridium perfringens Epsilon Toxin Oligomerization. Antibodies (Basel) . 2018, 7(4), 37. DOI: 10.3390/antib7040037. 15. Savva CG, Clark AR, Naylor CE, et al. The pore structure of Clostridium perfringens epsilon toxin. Nat Commun . 2019, 10(1), 2641. DOI: 10.1038/s41467-019-10645-8. 16. Knapp O, Maier E, Piselli C, et al. Central residues of the amphipathic β-hairpin loop control the properties of Clostridium perfringens epsilon-toxin channel. Biochim Biophys Acta Biomembr . 2020, 1862(9), 183364. DOI: 10.1016/j.bbamem.2020.183364. 17. Finnie JW, Uzal FA. Pathology and Pathogenesis of Brain Lesions Produced by Clostridium perfringens Type D Epsilon Toxin. Int J Mol Sci . 2022, 23(16), 9050. DOI: 10.1177/104063870802000301. 18. Bokori-Brown M, Kokkinidou MC, Savva CG, et al. Clostridium perfringens epsilon toxin H149A mutant as a platform for receptor binding studies. Protein Sci . 2013, 22(5), 650-659. DOI: 10.1002/pro.2250. 19. Popoff MR. Epsilon toxin: a fascinating pore-forming toxin. FEBS J . 2011, 278(23), 4602-4615. DOI: 10.1111/j.1742-4658.2011.08145.x. 20. Ivie SE, McClain MS. Identification of amino acids important for binding of Clostridium perfringens epsilon toxin to host cells and to HAVCR1. Biochemistry . 2012, 51(38), 7588-7595. DOI: 10.1021/bi300690a. 21. Bhown AS, Habeerb AF. Structural studies on epsilon-prototoxin of Clostridium perfringens type D. Localization of the site of tryptic scission necessary for activation to epsilon-toxin. Biochem Biophys Res Commun . 1977, 78(3), 889-896. DOI: 10.1016/0006-291x(77)90506-x. 22. Nestorovich EM, Karginov VA, Bezrukov SM. Polymer partitioning and ion selectivity suggest asymmetrical shape for the membrane pore formed by epsilon toxin. Biophys J . 2010, 99(3), 782-789. DOI: 10.1016/j.bpj.2010.05.014. 23. Ivie SE, Fennessey CM, Sheng J, et al. Gene-trap mutagenesis identifies mammalian genes contributing to intoxication by Clostridium perfringens ε-toxin. PLoS One . 2011, 6(3), e17787. DOI: 10.1371/journal.pone.0017787. 24. Bokori-Brown M, Savva CG, Fernandes da Costa SP, et al. Molecular basis of toxicity of Clostridium perfringens epsilon toxin. FEBS J . 2011, 278(23), 4589-4601. DOI: 10.1111/j.1742-4658.2011.08140.x. 25. Oyston PCF, Payne DW, Havard H, et al. Production of a non-toxic site-directed mutant of Clostridium perfringens epsilon-toxin which induces protective immunity in mice. Microbiology (Reading) . 1998, 144 (Pt 2), 333-341. DOI: 10.1099/00221287-144-2-333. 26. Pelish TM, McClain MS. Dominant-negative inhibitors of the Clostridium perfringens epsilon-toxin. J Biol Chem . 2009, 284(43), 29446-29453. DOI: 10.1074/jbc.M109.021782. 27. Petit L, Maier E, Gibert M, et al. Clostridium perfringens epsilon toxin induces a rapid change of cell membrane permeability to ions and forms channels in artificial lipid bilayers. J Biol Chem. 2001. 276, 15736-15740. DOI: 10.1074/jbc.M010412200. 28. Petit L, Gibert M, Gillet D, et al. Clostridium perfringens epsilon-toxin acts on MDCK cells by forming a large membrane complex. J Bacteriol . 1997, 179(20), 6480-6487. DOI: 10.1128/jb.179.20.6480-6487.1997. 29. Beal DR, Titball RW, Lindsay CD. The development of tolerance to Clostridium perfringens type D epsilon-toxin in MDCK and G-402 cells. Hum Exp Toxicol . 2003, 22, 593-605. DOI: 10.1191/0960327103ht397oa. 30. Soler-Jover A, Blasi J, Gomez de Aranda I, et al. Effect of epsilon toxin-GFP on MDCK cells and renal tubules in vivo. J Histochem Cytochem . 2004, 52, 931-42. DOI: 10.1369/jhc.4A6254.2004. 31. Fernandez-Miyakawa ME, Fisher DJ, Poon R, et al. Both epsilon-toxin and beta-toxin are important for the lethal properties of Clostridium perfringens type B isolates in the mouse intravenous injection model. Infect Immun . 2007, 75(3), 1443-1452. DOI: 10.1128/IAI.01672-06. 32. Fernandez-Miyakawa ME, Jost BH, Billington SJ, et al. Lethal effects of Clostridium perfringens epsilon toxin are potentiated by alpha and perfringolysin-O toxins in a mouse model. Vet Microbiol . 2008, 127(3-4), 379-385. DOI: 10.1016/j.vetmic.2007.09.013. 33. Fernandez-Miyakawa ME, Sayeed S, Fisher DJ, et al. Development and application of an oral challenge mouse model for studying Clostridium perfringens type D infection. Infect Immun . 2007, 75(9), 4282-4288. DOI: 10.1128/IAI.00562-07. 34. Finnie JW. Ultrastructural changes in the brain of mice given Clostridium perfringens type D epsilon toxin. J Comp Pathol . 1984, 94(3), 445-452. DOI: 10.1016/0021-9975(84)90031-8. 35. Finnie JW. Histopathological changes in the brain of mice given Clostridium perfringens type D epsilon toxin. J Comp Pathol . 1984, 94(3), 363-370. DOI: 10.1016/0021-9975(84)90024-0. 36. Ji B, Huang J, Zou K, et al. Direct Visualization of the Dynamic Process of Epsilon Toxin on Hemolysis. Small Methods . 2023, 7(7), e2300028. DOI: 10.1002/smtd.202300028. 37. Dorca-Arévalo J, Martín-Satué M, Blasi J. Characterization of the high affinity binding of epsilon toxin from Clostridium perfringens to the renal system. Vet Microbiol . 2012, 157(1-2), 179-189. DOI: 10.1016/j.vetmic.2011.12.020. 38. Wioland L, Dupont J L, Doussau F, et al. Epsilon toxin from Clostridium perfringens acts on oligodendrocytes without forming pores, and causes demyelination. Cell Microbiol . 2015, 17(3), 369-388. DOI: 10.1111/cmi.12373. 39. Linden J R, Ma Y, Zhao B, et al. Clostridium perfringens Epsilon Toxin Causes Selective Death of Mature Oligodendrocytes and Central Nervous System Demyelination. mBio . 2015, 6(3), e02513. DOI: 10.1128/mBio.02513-14. 40. Diep DB, Nelson KL, Lawrence TS, et al. Expression and properties of an aerolysin– Clostridium septicum alpha toxin hybrid protein. Mol Microbiol . 1999, 31(3), 785-794. DOI: 10.1046/j.1365-2958.1999.01217.x. 41. Li Q, Xin W, Gao S, et al. A low-toxic site-directed mutant of Clostridium perfringens ε-toxin as a potential candidate vaccine against enterotoxemia. Hum Vaccin Immunother . 2013, 9(11), 2386-2392. DOI: 10.4161/hv.25649. 42. Kang J, Gao J, Yao W, et al. F199E substitution reduced toxicity of Clostridium perfringens epsilon toxin by depriving the receptor binding capability. Hum Vaccin Immunother . 2017, 13(7), 1598-1608. DOI: 10.1080/21645515.2017.1303022. 43. Du J, Wang T, Xu L, et al. Clostridium perfringens epsilon prototoxin mutant rpETXY30A/Y71A/H106P/Y196A as a vaccine candidate against enterotoxemia. Vaccine . 2023, 41(32), 4762-4770. DOI: 10.1016/j.vaccine.2023.06.044. 44. Granum P E, Whitaker J R, Skjelkvåle R. Trypsin activation of enterotoxin from Clostridium perfringens type A: fragmentation and some physicochemical properties. Biochim Biophys Acta . 1981, 668(3), 325-332. DOI: 10.1016/0005-2795(81)90165-3. 45. Jiang Z, Chang J, Wang F, et al. Identification of tyrosine 71 as a critical residue for the cytotoxic activity of Clostridium perfringens epsilon toxin towards MDCK cells. J Microbiol . 2015, 53(2), 141-146. DOI: 10.1007/s12275-015-4523-8. 46. Chassin C, Bens M, de Barry J, et al. Pore-forming epsilon toxin causes membrane permeabilization and rapid ATP depletion-mediated cell death in renal collecting duct cells. Am J Physiol Renal Physiol . 2007, 293(3), F927-937. DOI: 10.1152/ajprenal.00199.2007. 47. Wioland L, Dupont JL, Doussau F, et al. Epsilon toxin from Clostridium perfringens acts on oligodendrocytes without forming pores and causes demyelination. Cell Microbiol . 2015, 17(3), 369-388. DOI: 10.1111/cmi.12373. 48. Petit L, Gibert M, Gourch A, et al. Clostridium perfringens epsilon toxin rapidly decreases membrane barrier permeability of polarized MDCK cells. Cell Microbiol . 2003, 5(3), 155-164. DOI: 10.1046/j.1462-5822.2003.00262.x. 49. Titball RW. The Molecular Architecture and Mode of Action of Clostridium perfringens ε-Toxin. Toxins (Basel). 2024, 16(4), 180. DOI: 10.3390/toxins16040180. Table 1. Sequences of primers. Primer Sequence (5’-3’) ETX F: 5′-gctgatatcggatccgaattcATGAAAAAAAATCTTGTAAAAAGTTTAGC-3′ R: 5′-gtggtggtggtggtgctcgagTTATTTTATTCCTGGTGCCTTAATAGA-3′ R25A F: 5’- CTTAAAGGCTATGGAAAAATATTATCCTAATGCTATGG -3’ R: 5’- TTTCCATAGCCTTTAAGTAATTATATTTTGTATTATATCTTCCTTT -3’ F92A F: 5’- CACAATCAGCTACTTGTAAAAATACTGATACAGTAACTGCAA -3’ R: 5’- ACAAGTAGCTGATTGTGATTTTAATTTTTGTTCTTGT -3’ Y133A F:5’- ACTAGTGCTAGTTTTGCAAATACAAATACAAATACTAATT -3’ R: 5’- GCAAAACTAGCACTAGTAGTTAATGATACTCCTGTTTCATTAAA -3’ F206A F:5’- GGGATGGTTATAAAGCTAGTTTATCAGATACAGTAAATAAGAGTGATTTAA -3’ R: 5’- AGCTTTATAACCATCCCTAGGAAAAGCTAAAT -3’ D210A F: 5’- GTTTATCAgctACAGTAAATAAGAGTGATTTAAATGAAGATG -3’ R: 5’- TACTGTAGCTGATAAACTAAATTTATAACCATCCCTAGG -3’ G221A F: 5’- TGAAGATGCTACTATTAATATTAATGGAAAAGGAAATTATAGTG -3’ R: 5’- TAATAGTAGCATCTTCATTTAAATCACTCTTATTTACTGTATC -3’ Y133E F: 5’- ACTAGTGAAAGTTTTGCAAATACAAATACAAATACTAATT -3’ R: 5’- GCAAAACTTTCACTAGTAGTTAATGATACTCCTGTTTCATTAAA -3’ Y133G F: 5’- ACTAGTGGCAGTTTTGCAAATACAAATACAAATACTAATT -4’ R: 5’- GCAAAACTACCACTAGTAGTTAATGATACTCCTGTTTCATTAAA -4’ Y133S F: 5’- ACTAGTTCTAGTTTTGCAAATACAAATACAAATACTAATT -3’ R: 5’- GCAAAACTAGAACTAGTAGTTAATGATACTCCTGTTTCATTAAA -3’ Y133F F: 5’- ACTAGTTTCAGTTTTGCAAATACAAATACAAATACTAATT -4’ R: 5’- GCAAAACTgaaACTAGTAGTTAATGATACTCCTGTTTCATTAAA -4’ Y133W F: 5’- ACTAGTtggAGTTTTGCAAATACAAATACAAATACTAATT -5’ R: 5’- GCAAAACTccaACTAGTAGTTAATGATACTCCTGTTTCATTAAA -5’ Table 2. Virulence test results of ETX-related toxins Toxin NO. Volume(mL) dose (μg/a mice) Number of mice Number of deaths Median lethal dose (LD50) Prototoxin ETX 1 0.2 72 5 5 0.456 mg/kg, 2 18 5 5 3 4.5 5 1 4 1.125 5 0 5 0.28125 5 0 Activated ETX 1 0.8 5 5 0.0166 mg/kg, 2 0.16 5 0 3 0.032 5 0 4 0.0064 5 0 5 0.00128 5 0 Prototoxin ETX-Y133A 1 960 5 0 / 2 480 5 0 3 240 5 0 4 120 5 0 5 60 5 0 PBS / 0 5 0 / Fig. 1. Expression and purification of ETX and its substituted mutants. (A) Ribbon representation of recombinant ETX prototoxin, highlighting key amino acid residues—R25, F92, Y133, F206, D210, and G221—shown in stick representation. Amino acid numbering corresponds to the ETX prototoxin lacking the 13-residue N-terminal peptide (PDB ID: 1UYJ). (B) SDS-PAGE analysis of purified wild-type ETX. Lane M: protein molecular weight marker (kDa); Lane W8: flow-through after washing to remove unbound proteins; Lanes E1–E4: purified ETX prototoxin fractions. Proteins were visualized by Coomassie Brilliant Blue staining. (C) SDS-PAGE analysis of purified ETX prototoxin and its mutants. Lane M: protein molecular weight marker (kDa); Lanes 1-7: purified wild-type ETX, ETX-R25A, ETX-F92A, ETX-Y133A, ETX-F206A, ETX-D210A, and ETX-G221A. Proteins were visualized by Coomassie Brilliant Blue staining. Fig. 2. Expression and activation of ETX and its single-alanine substituted mutants. (A) SDS-PAGE analysis showing trypsin-induced activation of ETX using varying doses of 0.25% trypsin solution. Lane M: protein molecular weight marker (kDa); Lane ETX: unactivated ETX prototoxin; Lanes a-d: ETX treated with 7.5 µL, 15 µL, 22.5 µL, and 30 µL of trypsin, respectively. Proteins were visualized by Coomassie Brilliant Blue staining. (B) SDS-PAGE analysis of activated wild-type ETX and its alanine-substituted mutants. Lane M: protein molecular weight marker (kDa); Lanes 1-7: activated wild-type ETX, ETX-R25A, ETX-F92A, ETX-Y133A, ETX-F206A, ETX-D210A, and ETX-G221A, respectively. Proteins were visualized by Coomassie Brilliant Blue staining. Fig. 3. Cytotoxicity of ETX and its mutants in MDCK cells. (A) Cell viability analysis of MDCK cells treated with ETX and its mutants using a CCK-8 assay. Each data point represents the mean cell viability. Results are presented as mean ± standard deviation (SD) or standard error of the mean (SEM), as indicated. (B) Comparative cytotoxicity of the Y133 series mutants on MDCK cells. (C) Chemical structures of the amino acid side chains at position 133 in the different Y133 mutants. Fig. 4. Histopathological analysis of kidneys and brains from mice injected with ETX or ETX-Y133A. Following ETX injection, marked cytotoxic effects were observed in renal epithelial cells (yellow arrows), including protein deposition in the tubular lumina and granular degeneration of renal tubular epithelial cells (inset). In the brain, ETX induced nuclear condensation (blue arrows), indicative of neuronal damage. In contrast, no pathological alterations were observed in the kidneys or brains of mice treated with ETX-Y133A or PBS. Fig. 5. Binding of ETX and its mutants to MDCK cells. MDCK cells were incubated with wild-type ETX, ETX mutants (ETX-R25A, ETX-F92A), or ETX-Y133 series mutants (ETX-Y133A, ETX-Y133E, ETX-Y133F, ETX-Y133G, ETX-Y133S, ETX-Y133W). Fluorescence signals were detected by confocal laser scanning microscopy. Fig. 6. Oligomerization ability of recombinant ETX proteins. (A) SDS-PAGE analysis of oligomerization for wild-type ETX and selected mutants. Lane M: protein molecular weight marker (kDa); Lanes 1–5: ETX, ETX-R25A, ETX-F92A, ETX-Y133A, and ETX-F206A, respectively. “o” indicates ETX polymers (oligomers), and “m” indicates ETX monomers. (B) SDS-PAGE analysis of oligomerization for wild-type ETX and Y133 series mutants. Lane M: protein molecular weight marker (kDa); Lanes 6–12: ETX, ETX-Y133A, ETX-Y133E, ETX-Y133F, ETX-Y133G, ETX-Y133S, and ETX-Y133W, respectively. “o” indicates ETX polymers (oligomers), and “m” indicates ETX monomers. Fig. 7. Pore-forming activity of ETX and its substituted mutants. (A) Changes in intracellular calcium concentration in MDCK cells induced by wild-type ETX and its substitution mutants. (B) Changes in intracellular calcium concentration in MDCK cells induced by Y133 series substitution mutants. The y-axis represents mean fluorescence intensity. Each data point corresponds to the mean fluorescence value from multiple cells. Results are presented as mean ± standard deviation (SD) or standard error of the mean (SEM), as indicated. List of Abbreviations Abbreviation Full Term BSA Bovine Serum Albumin BL21(DE3) Escherichia coli strain BL21 (DE3) Ca²⁺ Calcium Ion CDC Centers for Disease Control and Prevention Cl⁻ Chloride Ion DAPI 4′,6-Diamidino-2-Phenylindole DMEM Dulbecco’s Modified Eagle Medium DNA Deoxyribonucleic Acid ELISA Enzyme-Linked Immunosorbent Assay ETX Epsilon Toxin FBS Fetal Bovine Serum FITC Fluorescein Isothiocyanate H&E Hematoxylin and Eosin His Tag Hexahistidine Tag (6×His) HRP Horseradish Peroxidase i.p. Intraperitoneal (injection) IPTG Isopropyl-β-D-1-thiogalactopyranoside K⁺ Potassium Ion LD₅₀ Median Lethal Dose LDH Lactate Dehydrogenase MAL Myelin and Lymphocyte Protein MDCK Madin–Darby Canine Kidney (cells) Na⁺ Sodium Ion Ni-NTA Nickel–Nitrilotriacetic Acid OD600 Optical Density at 600 nm PDB Protein Data Bank PBS Phosphate-Buffered Saline PCR Polymerase Chain Reaction RIPA Radioimmunoprecipitation Assay (buffer) S Tag Solubility Tag SDS-PAGE Sodium Dodecyl Sulfate–Polyacrylamide Gel Electrophoresis Trx Tag Thioredoxin Tag μL / μg Microliter / Microgram nm Nanometer WT Wild Type Information & Authors Information Version history V1 Version 1 04 July 2025 Peer review timeline Published Journal of Basic Microbiology Version of Record 3 Oct 2025 Published Copyright This work is licensed under a Non Exclusive No Reuse License. Collection Journal of Basic Microbiology Keywords clostridium perfringens attenuation cytotoxicity epsilon toxin site-directed mutagenesis Authors Affiliations Zibei HUANG Yangzhou University Department of Preventive Veterinary Medicine View all articles by this author Haiyan Wang Jiangsu Agri-animal Husbandry Vocational College View all articles by this author Jinlin Huang Yangzhou University Department of Preventive Veterinary Medicine View all articles by this author Zibei HUANG [email protected] Yangzhou University Department of Preventive Veterinary Medicine View all articles by this author Metrics & Citations Metrics Article Usage 299 views 144 downloads .FvxKWukQNSOunydq8rnd { width: 100px; } Citations Download citation Zibei HUANG, Haiyan Wang, Jinlin Huang, et al. Attenuated Clostridium perfringens Epsilon Toxin Mutants and Insights into the Mechanism of Attenuation. Authorea . 04 July 2025. DOI: https://doi.org/10.22541/au.175161972.24940605/v1 If you have the appropriate software installed, you can download article citation data to the citation manager of your choice. Simply select your manager software from the list below and click Download. For more information or tips please see 'Downloading to a citation manager' in the Help menu . Format Please select one from the list RIS (ProCite, Reference Manager) EndNote BibTex Medlars RefWorks Direct import Tips for downloading citations document.getElementById('citMgrHelpLink').addEventListener('click', function() { popupHelp(this.href); return false; }); $(".js__slcInclude").on("change", function(e){ if ($(this).val() == 'refworks') $('#direct').prop("checked", false); $('#direct').prop("disabled", ($(this).val() == 'refworks')); }); View Options View options PDF View PDF Figures Tables Media Share Share Share article link Copy Link Copied! Copying failed. Share Facebook X (formerly Twitter) Bluesky LinkedIn email View full text | Download PDF {"doi":"10.22541/au.175161972.24940605/v1","type":"Article"} Now Reading: Share Figures Tables Close figure viewer Back to article Figure title goes here Change zoom level Go to figure location within the article Download figure Toggle share panel Toggle share panel Share Toggle information panel Toggle information panel Go to previous graphic Go to next graphic Go to previous table Go to next table All figures All tables View all material View all material xrefBack.goTo xrefBack.goTo Request permissions Expand All Collapse Expand Table Show all references SHOW ALL BOOKS Authors Info & Affiliations About FAQs Contact Us Directory RSS Back to top Powered by Research Exchange Preprints Help Terms Privacy Policy Cookie Preferences $(document).ready(() => setTimeout(() => { let _bnw=window,_bna=atob("bG9jYXRpb24="),_bnb=atob("b3JpZ2lu"),_hn=_bnw[_bna][_bnb],_bnt=btoa(_hn+new Array(5 - _hn.length % 4).join(" ")); $.get("/resource/lodash?t="+_bnt); },4000)); (function(){function c(){var b=a.contentDocument||a.contentWindow.document;if(b){var d=b.createElement('script');d.innerHTML="window.__CF$cv$params={r:'a00e1328bfc41640',t:'MTc3OTY0NDMxNA=='};var a=document.createElement('script');a.src='/cdn-cgi/challenge-platform/scripts/jsd/main.js';document.getElementsByTagName('head')[0].appendChild(a);";b.getElementsByTagName('head')[0].appendChild(d)}}if(document.body){var a=document.createElement('iframe');a.height=1;a.width=1;a.style.position='absolute';a.style.top=0;a.style.left=0;a.style.border='none';a.style.visibility='hidden';document.body.appendChild(a);if('loading'!==document.readyState)c();else if(window.addEventListener)document.addEventListener('DOMContentLoaded',c);else{var e=document.onreadystatechange||function(){};document.onreadystatechange=function(b){e(b);'loading'!==document.readyState&&(document.onreadystatechange=e,c())}}}})();

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00
unpaywall
last seen: 2026-06-13T06:42:57.164913+00:00