16S rRNA gene-based genetic diversity of Wolbachia strains infecting Anopheles gambiae s.s. and Anopheles coluzzii in Côte d’Ivoire

preprint OA: gold CC-BY-4.0
📄 Open PDF Full text JSON View at publisher

Abstract

Abstract Wolbachia is an endosymbiont bacterium found Anopheles gambiae s.l., the main vector of malaria in Côte d’Ivoire. It’s a bacteria species that is involved in many metabolic reactions of its arthropods host. The interactions of this bacteria and its host depends on bacterial strain and arthropods host. Our study aims to analyze the genetic diversity of Wolbachiastrains infecting Anopheles gambiaecomplex in Côte d’Ivoire. Anopheles gambiae s.l. larvae were collected in Boundiali, Korhogo, Bouaké, Abidjan and Bingerville from November to December 2024 and reared in laboratory. At adult stage, the Anopheles gambiaecomplex were discriminated by specific allelic PCR. Then Wolbachia was screened from female of different species identified and confirmed by sequencing of 16S rRNA gene through sanger method. Evolutionary divergence of the 16S rRNA sequence was estimated using Kimura 2-parameter before phylogenetic tree construction. Overall, 74.57 % of Anopheles gambiae s.s., 21.73 % of Anopheles coluzzii and 3.46 % of hybrids were identified. The infection prevalence of Anopheles gambiaecomplex by Wolbachia depends on mosquito species with higher infection rate (25.84 %) in Anopheles coluzzii. than Anopheles gambiae s.s. (12.42 %). Phylogenetic analysis allowed the identification of different clones of the same Wolbachia strain, named wAnga_CI, which is clustered with supergroup B. Our results show a very low divergence, less than 1 %, between 16S rRNA sequences of wAnga_CI and these are divided into two haplotypes. Our results show that all species of Anopheles gambiae s.l. in Côte d’Ivoire are infected by the same strain of Wolbachia.
Full text 147,776 characters · extracted from preprint-html · click to expand
16S rRNA gene-based genetic diversity of Wolbachia strains infecting Anopheles gambiae s.s. and Anopheles coluzzii in Côte d’Ivoire | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article 16S rRNA gene-based genetic diversity of Wolbachia strains infecting Anopheles gambiae s.s. and Anopheles coluzzii in Côte d’Ivoire Raymond Karlhis YAO, Etienne BILGO, Berenger Aristide AKO, Ibrahima Zanakoungo COULIBALY, and 6 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7501016/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Wolbachia is an endosymbiont bacterium found Anopheles gambiae s.l., the main vector of malaria in Côte d’Ivoire. It’s a bacteria species that is involved in many metabolic reactions of its arthropods host. The interactions of this bacteria and its host depends on bacterial strain and arthropods host. Our study aims to analyze the genetic diversity of Wolbachia strains infecting Anopheles gambiae complex in Côte d’Ivoire. Anopheles gambiae s.l. larvae were collected in Boundiali, Korhogo, Bouaké, Abidjan and Bingerville from November to December 2024 and reared in laboratory. At adult stage, the Anopheles gambiae complex were discriminated by specific allelic PCR. Then Wolbachia was screened from female of different species identified and confirmed by sequencing of 16S rRNA gene through sanger method. Evolutionary divergence of the 16S rRNA sequence was estimated using Kimura 2-parameter before phylogenetic tree construction. Overall, 74.57 % of Anopheles gambiae s.s., 21.73 % of Anopheles colu zzii and 3.46 % of hybrids were identified. The infection prevalence of Anopheles gambiae complex by Wolbachia depends on mosquito species with higher infection rate (25.84 %) in Anopheles coluzzii. than Anopheles gambiae s.s. (12.42 %). Phylogenetic analysis allowed the identification of different clones of the same Wolbachia strain, named wAnga _CI, which is clustered with supergroup B. Our results show a very low divergence, less than 1 %, between 16S rRNA sequences of w Anga_CI and these are divided into two haplotypes. Our results show that all species of Anopheles gambiae s.l. in Côte d’Ivoire are infected by the same strain of Wolbachia . Molecular Biology Entomology Anopheles gambiae s.l. Wolbachia Phylogenetic natural Infection Côte d’Ivoire Figures Figure 1 Figure 2 Introduction Malaria is a long-standing parasitic disease that has a significant impact on public health in many parts of the world. According to the World Health Organization (WHO), 263 million people were affected by malaria worldwide in 2023. This number has increased by approximately 11 million cases compared to the previous year. The majority of malaria cases, approximately 246 million cases including 569 000 deaths, were reported in the WHO African region, where malaria is endemic (WHO 2024 ). In 2023, approximately 7 836 000 cases of malaria were reported in Côte d'Ivoire; where the main vectors of the plasmodial agent responsible for malaria are the members of Anopheles ( An ) gambiae complex (Gouamene et al. 2024 ). Malaria management represents a significant economic burden on the African continent, with estimated costs reaching up to $ 39.06 per person per year (Shretta et al. 2016 ) ; which represents a major challenge for low-income countries. This management involves vector control strategies that focus primarily on the use of insecticide molecules, whose effectiveness is limited in time and is quickly surpassed by the emergence of vector resistance (Kouamé et al. 2024 ; Somda et al. 2025 ). Therefore, the development of long-lasting and effective vector control strategies is necessary. An emerging integrated biological control strategy based on the Wolbachia bacterium is proposed to control vector population density (O’Connor et al. 2012 ) and hinder pathogen transmission by mosquitoes (Pinto et al. 2021 ). Wolbachia is an endosymbiotic bacterium that infects arthropods, including several mosquito species (Clervil et al. 2024 ). It interferes with several physiological mechanisms of its host, such as those related to the immune system (Kambris et al. 2009 , 2010 ), mosquito behavior (Shemshadian et al. 2021 ) and the reproductive system (Kaur et al. 2021 ). In the system of the reproduction, the cytoplasmic incompatibility is the main mechanism used to combate harmful arthopods. Wolbachia is diversified into several supergroups ranging from A to S (Landmann 2019 ). However, supergroups A and B are the ones most frequently found in mosquitoes (Jeffries et al. 2018b ). Generally, mosquitoes of the genus Anopheles were once considered naturally uninfected by Wolbachia (Walker and Moreira 2011 ). However, natural Wolbachia infection has been demonstrated in a wide range of species of the genus Anopheles using new and more sensitive diagnostic methods (Gomes et al. 2017; Ayala et al. 2019 ) ; including species known for their vector competence in malaria transmission such as An. gambiae s.l. (Baldini et al. 2014 , 2018 ; Gomes et al. 2017 ; Jeffries et al. 2018), An. funestus (Niang et al. 2018 ), An. culicifacies s.l. and An. stephensi (Sankar et al. 2021 ). Except for two Wolbachia strains namely w AnD and w AnM infecting An. demeilloni and An. moucheti respectively (Walker et al. 2021 ), for which cytoplasmic incompatibility (CI) factors have been identified in their genome (Quek et al. 2022 ), almost all Wolbachia strains infecting Anopheles genus are incapable of inducing CI (Shaw et al. 2016 ; Gomes et al. 2017). Complete genome sequencing data for w Anga identified in Burkina Faso failed to reveal the presence of cytoplasmic incompatibility factor (Cif) genes (Baldini et al. 2014 ). However, Wolbachia strain w Anga infecting the An. gambiae complex have demonstrated an antagonism effect on the development of Plasmodium falciparum (Hughes et al. 2011 ). Several factors, including the low prevalence of Wolbachia infection (Ahouandjinou et al. 2024 ; Yao et al. 2025 ), the low infection density (Baldini et al. 2014 ; Jeffries et al. 2018a ), the diversity of Wolbachia strains, and a lack of congruence between host and symbiont phylogenies (Baldini et al. 2018 ; Chrostek and Gerth 2019 ; Jeffries et al. 2021 ), suggest an environmental origin of w Anga. Thus, the nature of Wolbachia in An. gambiae would depend on the mosquito's ecological niche. This study aimed to determine the phylogenetic relationships between Wolbachia strains infecting different mosquito species of the An. gambiae complex, captured in different ecosystems and in different climatic areas. This was done to identify Wolbachia ecotypes in An. gambiae s.l. in Côte d’Ivoire. Material and Methods Study areas, collection, and identification of mosquitoes The mosquitoes sample were collected during two months (November to December 2024) in five cities of Côte d’Ivoire namely Boundialy ( 9°31'18" N, 6°29'13" W) and Korhogo (9°34'60" N, 5°55'0" W) in northern, Bouaké (7°41′37″ N, 5°01′49″ W) in the center, Abidjan (5°20′56″ N, 4°0′13″ W) and Bingervielle (5°21'21" N, 3°53'24" W) in southern (Fig. 1 ). In this study, only larvae of mosquitoes were collected on vegetable farms and/or in rice fields in baffles, and on breeding sites (abandoned tires, used containers and standing water) in the vicinity of mixed animal farms. Then, the larvae were maintained in the medical entomology’s laboratory of Institut Pasteur of Côte d’Ivoire under a 12h:12h photoperiod at 28°C. After the emergence of the adults, the mosquito species were identified morphologically using a portable binocular magnifying glass (Optika SFX-33, Ponteranica, Italy) according to the identification key of the Anophelina e (Coetzee 2021 ). All mosquito samples were then preserved in silica gel before DNA extraction as described previously (Yao et al. 2025 ). Molecular identification of species belonging to complex An. gambiae s.l. were performed by specific allele PCR using primers (Santolamazza et al. 2008 ). PCR was performed on T100 thermal cycler (Bio-Rad, California, US) using the FIREPol® Master Mix Ready to Load (Solis BioDyne, Tartu, Estonie). Screening and sequencing of Wolbachia 16S rRNA gene Overall, 264 female mosquitoes from the five cities were analyzed for detecting Wolbachia . For each species of An. gambiae s.l. 50 samples were analyzed per study area. However, for less abundant species, all samples were analyzed. The screening of Wolbachia was performed by quantitative PCR (qPCR) using the primer pair sense 5' CATACCTATTCGAAGGGATAG 3' and anti-sense 5'TTGCGGGACTTAACCCAACA 3' specific for Wolbachia 16S rRNA (Gomes et al. 2017) according to protocol described previously (Yao et al. 2024). PCR was performed on the CFX96 system (Bio-Rad, California, US) using the 5x HOT FIREPol EvaGreen qPCR Mix Plus (ROX) kit (Solis BioDyne, Tartu, Estonie). PCR conditions were as follows: initial denaturation at 95°C for 12 minutes, followed by 40 cycles of 15s denaturation at 95°C, 20s hybridization at 58°C, and 20s elongation at 72°C. Samples are considered positive when the Cycles threshold (Ct) value is under or equal to 38. The specificity of the reaction was checked through the melting curve during Wolbachia’s detection by varying the temperature from 65°C to 95°C. The melting temperature is equal to 84°C ± 2°C. Then, the 16S rRNA gene has been amplified by nested PCR to described by shaw et al . (Shaw et al. 2016 ). PCR was performed on T100 thermal cycler (Bio-Rad, California, US) using the FIREPol ® Master Mix Ready to Load (Solis BioDyne, Tartu, Estonie). Nested PCR products of one or two samples per site have been sent to GenoScreen (Lile, France) for sequencing by the Sanger method in both sense. Phylogenetic analysis The chromatograms of the 16S rRNA gene sequences were manually edited using BioEdit Software version 7.0.5. Contig sequences were aligned using ClustalW in BioEdit software ( https://bioedit.software.informer.com/7.7/ ). The consensus sequence of each sample has been compared with other sequences available in GenBank database (NCBI) using Nucleotide Basic Local Alignment Search Tool (BLAST) ( https://blast.ncbi.nlm.nih.gov/Blast.cgi ), to determine the percentage identity and confirm Wolbachia identification. 16S rRNA gene sequences that have high similarity with 16S rRNA gene sequences in this study were downloaded and using as references sequence. This included two sequences of Wolbachia infecting An. gambiae in Burkina Faso (KJ728744, KJ728742), six sequences (MN123070, AM999887, OZ034723, MK277390, PQ625811, PV187299) of Wolbachia infecting respectively Tetranychus urticae, Culex quinquefasciatus, Phasia obesa, Trioza erytreae, Culex tritaeniorhynchus and Culex pipiens . Other sequences of Wolbachia infecting An. gambiae s.l. identified in Ghana (MH605280, MH605279) and Mali (MF944114) have been included for studding the evolutionary divergence between 16S rRNA gene sequences of Wolbachia in An. gambiae s.l. Several Wolbachia 16S rRNA gene sequences of strains belonging to supergroup A (OZ183482), B (OZ034723), C (CP046578), D (CP034333), E (OZ034692), F (DQ115537), H (AY764279), I (AY335924), and J (AJ548802) have been used to build phylogenetic tree, in the purpose to fund at what supergroup belong different strains identified in Côte d’Ivoire. Other sequences have allowed us to obtain some outgroups. The alignment of all 16S rRNA gene sequences was carried out using MUSCLE in MEGA 12 software version 12.0.11 (Kumar et al. 2024 ). The Akaike Information Criterion (AIC) scores has been used to select the optimal substitution model through the option Find the Best DNA/Protein Models by maximum-likelihood (ML) in MEGA 12. The sequence analysis, such as the interspecific variation of 16S rRNA gene sequences was estimated using the Tamura-Nei model (Tamura and Nei 1993 ). The phylogenetic tree was constructed using the Likelihood and invariant sites (T92 + I). The phylogenetic relationship was tested with 1000 replicates (Felsenstein 1985 ). Then, the phylogenetic tree was edited online using the Interactive Tree Of Life (iTOL) platform ( https://itol.embl.de/ ) (Letunic and Bork 2024 ). Results Identification of adult mosquito species of the Anopheles gambiae complex Overall, 405 adult mosquitoes belonging to An. gambiae complex have been obtained from larvae collected on all studies sites. The molecular identification confirmed two species namely An. gambiae s.s 74.57% and An. collizzi 21.73%. hybrid species from crossing between An. gambiae s.s. et An. collizzi were 3.46% (Table 1 ). Table 1 Composition of mosquito species of An. gambiae s.l. Areas Site Species An. gambiae s.s. %(n/N) An. collizzi %(n/N) Hybrid %(n/N) North Boundiali 100.0 (114/114) 0.0 (0/114) 0.0 (0/114) Korhogo 78.57 (121/154) 15.58 (24/154) 05.84 (9/154) Center Bouaké 57.73 (56/97) 38.14 (37/97) 04.12 (4/97) South Abidjan (Abobo) 35.71 (5/14) 64.29 (9/14) 0.0 (0/14) Abidjan (Cocody) 100.0 (6/6) 0.0 (0/6) 0.0 (0/6) Bingerville (Anan) 0.0 (0/20) 95.0 (19/20) 05.0 (1/20) Total 74.57 (302/405) 21.73 (88/405) 3.46 (14/405) Mosquito species composition varied strongly according to the geographical areas of the country. In northern Côte d’Ivoire, An. gambiae s.l. population is largely dominated by An. gambiae s.s. 87.69%. In Bouaké city located in the center, both species namely An. gambiae s.s. and An. coluzzii are well represented at 57.73% and 38.14% respectively. As for the south, An. coluzzii is the main species 82.35% of the complex An. gambiae s.l. Prevalence of Wolbachia The overall prevalence of infection with Wolbachia in An. gambiae s.l. population for all study sites was 17.05%. The prevalence of infection according to mosquito species belonging to An. gambiae s.l. per site is summarized in Table 2 . The results show that the population of An. coluzzii species is higher infected by Wolbachia 25.84% than An. gambiae s.s. 12.42%. Table 2 Prevalence of Wolbachia in An. gambiae s.l. Areas Site 16S rRNA gene Total %(n/N) An. gambiae s.s. %(n/N) An. collizzi %(n/N) Hybrid %(n/N) North Boundiaki 8 (4/50) NA NA 8 (4/50) Korhogo 12 (6/50) 16.67 (4/24) 0 (0/9) 11.90 (10/83) Center Bouaké 10 (5/50) 10 (4/37) 25 (1/4) 10.99 (10/91) South Abidjan 45 (5/11) 44.44 (4/9) NA 45 (9/20) Bingerville NA 47.37 (9/19) 100 (1/1) 50 (10/20) Total 12.42% (20/161) 23.60 (21/89) 14.29 (2/14) 16.29 (43/264) N.A : Not Applicable 16S rRNA gene sequencing Following sequencing, except for the sample from Korhogo whose sequence couldn’t be analyzed because of the bad quality of the chromatogram, all samples of Wolbachia 16s rRNA gene were identified as Wolbachia sp , with identification scores ranging from 99.23–100.00%. Seven strains were found and named in function of the collect site of mosquito samples such as w Anga_CI BDL (Boundiali), w Anga_CI BK 1 and w Anga_CI BK 2 (Bouaké), w Anga_CI Abo 1 and w Anga_CI Abo 2 (Abobo), w Anga_CI CCD (Cocody) and w Anga_CI Anan (Bengerville). Sequences of those strains (Online Resource 1) will then put in GenBank database. Figure 2 displays the phylogenetic tree indicating a relationship between sequences identified in this study and other reference sequences obtained from the line database. The seven sequences of Wolbachia 16S rRNA clustered with supergroup B. The Wolbachia strains wAnga_CI could be grouped into two haplotypes. The haplotype 1 included w Anga_CI_BDL and w Anga_CI_Abo_2. The haplotype 2 included w Anga_CI_Anan, w Anga_CI_BK_1, w Anga_CI_BK_2, w Anga_CI_CCD and w Anga_CI_Abo_1. The Table 3 shows a strong resemblance between haplotype 1 and 2 with a divergence ranging from 0.0000 to 0.0080. However, overall analysis shows a large diversity of w Anga strains clustered in many different super groups of Wolbachia (Fig. 2 ). The phylogeny was inferred using the Maximum Likelihood method and Tamura-Nei (1993) model (Tamura and Nei 1993 ) of nucleotide substitutions and the tree with the highest log likelihood (-4 970.83) is shown. The percentage of replicate trees in which the associated taxa clustered together (1 000 replicates) is shown next to the branches (Felsenstein 1985 ).The initial tree for the heuristic search was selected by choosing the tree with the superior log-likelihood between a Neighbor-Joining (NJ) tree (Saitou and Nei 1987 ) and a Maximum Parsimony (MP) tree. The NJ tree was generated using a matrix of pairwise distances computed using the Tamura-Nei (1993) model (Tamura and Nei 1993 ).The MP tree had the shortest length among 10 MP tree searches, each performed with a randomly generated starting tree. The rate model allowed for 41.10% of sites to be evolutionarily invariable. The analytical procedure encompassed 32 nucleotide sequences with 2 382 positions in the final dataset. Evolutionary analyses were conducted in MEGA12 version 12.0.11 (Kumar et al. 2024 ). Utilizing up to 4 parallel computing threads. The OTUs marked in blue represent Wolbachia strains infecting An. gambiae s.s. and the green-marked OTUs represent Wolbachia strains infecting An. coluzzii . Table 3 Estimates of evolutionary divergence between Wolbachia 16S rRNA sequences Wolbachia 16S rRNA 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 1. wAnga_CI_BDL 0.0047 0.0047 0.0040 0.0036 0.0046 0.0047 0.0059 0.0058 0.0060 0.0136 0.0091 0.0120 0.0127 0.0132 0.0130 0.0000 0.0000 2. wAnga_CI_BK_1 0,0080 0.0000 0.0000 0.0028 0.0000 0.0000 0.0000 0.0000 0.0000 0.0125 0.0074 0.0113 0.0109 0.0126 0.0127 0.0046 0.0056 3. wAnga_CI_BK_2 0,0080 0,0000 0.0000 0.0027 0.0000 0.0000 0.0000 0.0000 0.0000 0.0125 0.0075 0.0113 0.0110 0.0123 0.0125 0.0046 0.0056 4. wAnga_CI_Abo_1 0,0059 0,0000 0,0000 0.0000 0.0000 0.0000 0.0000 0.0000 0.0000 0.0125 0.0084 0.0120 0.0123 0.0127 0.0112 0.0040 0.0043 5. wAnga_CI_Abo_2 0,0053 0,0026 0,0026 0,0000 0.0027 0.0027 0.0028 0.0027 0.0029 0.0128 0.0071 0.0113 0.0111 0.0126 0.0126 0.0036 0.0042 6. wAnga_CI_CCD 0,0080 0,0000 0,0000 0,0000 0,0026 0.0000 0.0000 0.0000 0.0000 0.0125 0.0074 0.0113 0.0109 0.0123 0.0126 0.0046 0.0055 7. wAnga_CI_Anan 0,0080 0,0000 0,0000 0,0000 0,0026 0,0000 0.0000 0.0000 0.0000 0.0125 0.0075 0.0113 0.0110 0.0123 0.0126 0.0046 0.0055 8. MH605280_wAnga-Ghana_DOG1 0,0106 0,0000 0,0000 0,0000 0,0026 0,0000 0,0000 0.0000 0.0000 0.0126 0.0074 0.0114 0.0109 0.0126 0.0128 0.0046 0.0056 9. MH605279_wAnga-Ghana_DOG1 0,0104 0,0000 0,0000 0,0000 0,0026 0,0000 0,0000 0,0000 0.0000 0.0125 0.0073 0.0113 0.0108 0.0123 0.0125 0.0046 0.0055 10. MH596703_wAnga_Tanzania 1 0,0111 0,0000 0,0000 0,0000 0,0028 0,0000 0,0000 0,0000 0,0000 0.0125 0.0102 0.0114 0.0127 0.0107 0.0131 0.0039 0.0048 11. MH596696_wAnga_Tanzanie 2 0,0474 0,0400 0,0400 0,0402 0,0437 0,0400 0,0400 0,0405 0,0400 0,0400 0.0142 0.0075 0.0000 0.0000 0.0033 0.0136 0.0136 12. MH596695_wAnga_Tanzania 3 0,0309 0,0198 0,0199 0,0222 0,0226 0,0196 0,0199 0,0196 0,0194 0,0329 0,0521 0.0133 0.0138 0.0123 0.0154 0.0074 0.0090 13. MF944114_Anga-Mali 0,0491 0,0425 0,0424 0,0449 0,0457 0,0424 0,0424 0,0429 0,0424 0,0427 0,0142 0,0526 0.0062 0.0064 0.0075 0.0120 0.0130 14. KJ728755_wAnga_BF_VK5_STP_ML 0,0530 0,0421 0,0423 0,0472 0,0449 0,0418 0,0424 0,0418 0,0414 0,0495 0,0000 0,0661 0,0118 0.0040 0.0081 0.0114 0.0136 15. KJ728750_wAnga_BF_SMS_5.1_MC 0,0502 0,0471 0,0462 0,0479 0,0493 0,0465 0,0465 0,0473 0,0462 0,0374 0,0000 0,0504 0,0121 0,0059 0.0059 0.0131 0.0135 16. KJ728748_wAnga_BF_VK7_13.5_O 0,0574 0,0544 0,0534 0,0448 0,0564 0,0537 0,0537 0,0546 0,0534 0,0517 0,0035 0,0645 0,0179 0,0201 0,0106 0.0129 0.0117 17. KJ728744_wAnga_BF_VK5_3.1b_T 0,0000 0,0079 0,0079 0,0058 0,0052 0,0079 0,0079 0,0079 0,0079 0,0056 0,0474 0,0254 0,0487 0,0475 0,0497 0,0569 0.0000 18. KJ728742_wAnga_BF_VK5_7.6a_T 0,0000 0,0094 0,0092 0,0062 0,0061 0,0093 0,0093 0,0094 0,0092 0,0067 0,0474 0,0306 0,0515 0,0540 0,0498 0,0464 0,0000 The number of base substitutions per site between sequences are shown. Standard error estimates are shown above the diagonal and were obtained by a bootstrap procedure (1 000 replicates). Analyses were conducted using the Tamura-Nei model (Tamura and Nei 1993 ). The analytical procedure encompassed 18 coding nucleotide sequences using 1st, 2nd, 3rd, and non-coding positions. The pairwise deletion option was applied to all ambiguous positions for each sequence pair resulting in a final data set comprising 2 382 positions. Evolutionary analyses were conducted in MEGA12 version 12.0.11 (Kumar et al. 2024 ). Discussion In this study, the natural infection with Wolbachia in a wild population of An. gambiae s.l. caught on different sites has been demonstrated though qPCR and sequencing of Wolbachia 16S rRNA gene. Actually, 16S rRNA gene is a good genetic marker for screening Wolbachia infection in An. gambiae s.l. according to many studies (Gomes et al. 2017; Jeffries et al. 2018). It has been shown that another genetic marker like Wolbachia surface protein gene ( wsp ) that is frequently used for screening Wolbachia , can be inappropriate for detecting infection with Wolbachia in An. gambiae complex. The open reading frame (ORF) of wsp gene is often changed by some transposon belonging to the same family as those identified in Wolbachia strain infecting An. gambiae s.l. (Baldini et al. 2014 ). The Wolbachia infection in An. gambiae s.l. population has been previously reported in Côte d’Ivoire (Yao et al. 2024). This study allowed us to identify three Wolbachia strains infecting different mosquito species of complex An. gambiae. The molecular discrimination of mosquito species belonging to An. gambiae s.l. allowed to identify two species namely An. gambiae s.s., An. coluzzii. and the hybrid from crossing between both species. Those two species were spread on almost all study sites, however the proportion of each one depends on geographical areas. In the north An. gambiae s.l. population is largely dominated by An. gambiae s.s., whereas in the south, An. coluzzii is more represented. As for the center, both species are strongly represented. This result can be explained by environmental conditions. In fact, An. coluzzii is known to be a mosquito species that is well adapted in forestry areas; as for the species An. gambiae s.s., it’s well adapted savanna areas (Tia et al. 2017 ). This geographical distribution of these species is in accordance with the climatic zone of Côte d’Ivoire. Other studies carried out previously in Côte d’Ivoire present the same result with a predominance of An. gambiae s.s., in cities located in the northern and a predominance of An. coluzzii in cities located in the southern country (Yokoly et al. 2020 ; Kouamé et al. 2024 ). The results of this study present the same tendency as those of Wolie et al. ( 2021 ), obtained in Bouaké and those of Gouamene et al. ( 2024 ), obtained in Béoumi, a city located in the center and near Bouaké; which showed a high proportion of both species. The screening of Wolbachia in An. gambiae s.l. allowed us to have an infection prevalence of 16.29%. This prevalence is higher than the previous study, which was 13.46% (Yao et al., 2024). This increase in prevalence can be explained by the species composition of the An. gambiae s.l. In fact, the present study shows the species An. coluzzii have a statistically higher prevalence (23.60%) than An. gambiae s.s. (12.42%). It is noteworthy that in this study, the proportion of An. gambiae s.l. collected in the central and the southern areas accounted for 16.39% of the overall mosquitoes analyzed and were composed of 26.15% An. coluzzii . However, in the previous study, only 8.91% of An. gambiae s.l. has been collected in the same area. Therefore, 91.09% of mosquitoes were collected in the northern zone, which is heavily colonized by An. gambiae s.s. which has a relatively low prevalence of Wolbachia infection. Thus, the high proportion of An. coluzzii has impacted the prevalence of Wolbachia . However, it is noteworthy that the prevalence of infection obtained previously is substantially equal to that of An. gambiae s.s. obtained in the present study. Many studies show the infection of Wolbachia in An. gambiae s.l. depend on the species composition. In Burkina, a study showed An. coluzzii has higher infection rate (46%) than that of another species sush as An. arabiensis (33%) (Shaw et al. 2016 ). Also in Guinea, An. melas is the main species from An. gambiae s.l. that is infected by Wolbachia (Jeffries et al. 2021 ). In our study, the prevalence of Wolbachia infection is higher with a different tendency than those reported in Benin, which show prevalences of 5.1% and 1.3% respectively for An. gambiae s.s. and An. coluzzii . (Ahouandjinou et al. 2024 ). Despite the infection rate has been upgraded in the study, it stays lower than the prevalence reported in Burkina Faso (ranging between 19 and 46%) (Shaw et al. 2016 ), in Mali (ranging between 46 and 78%) (Gomes et al. 2017). Moreover, the phylogenetic relationship of 16S rRNA gene shows that all strains identified in different study areas in Côte d’Ivoire are clustered in the supergroup B with those identified in Burkina Faso and Ghana; which are unable to induct cytoplasmic incompatibility (Shaw et al. 2016 ; Jeffries et al. 2018a ). Therefore, the low prevalence observed can be due to the inability of these strains to promote the proliferation of the infected host. Based on the very low divergence (less than 1%) obtained between Wolbachia 16S rRNA sequences of strain found in different areas of Côte d’Ivoire, we can deduce that these strains are different clonal of the same strain of Wolbachia . However, it’s very difficult to make a robust phylogenetic analysis with one alone genetic marker; so, our perspective is whole genome study. Our result about the evolutionary divergence of Wolbachia 16S rRNA sequences involves that the evolutionary ecology of w Anga_CI is the same at all study sites; which could suggest the intracellular environment of An. gambiae s.l. However, a more general analysis of Wolbachia strain diversity in An. gambiae s.l. calls for more caution regarding this inference. The high Ct values​​ (from 33.86 to 37.99) for Wolbachia detection comparatively to Ct values (from 23.81 to 29.17) of mosquito gene (Online Resource 3) in this study involve a low infection density as reported in An. gambiae s.l. (Baldini et al. 2014 ; Jeffries et al. 2018a ). Indeed, Wolbachia acquisition can occur through mosquito feeding from a source contaminated by the bacterium. Experiments have shown that after ingestion of a meal infested with Wolbachia , the bacterium can multiply within the new organism until it infests the sexual organs in a stable manner but at a low density (Le Clec’h et al. 2013 ). An explanation that may be plausible in An. gambiae s.l. However, the question that remains is how is it that the different strains identified in the case of this present study have less than 1% divergence. Thus, a more in-depth study should investigate the composition of the larval habitats in terms of sympatric arthropods and characterize their endosymbiont Wolbachia in search of a phylogenetic rapprochement with w Anga. It will also be beneficial to study the vertical transmission of wAnga_CI through successive generations of An. gambiae s.l. to determine the stability of the infection. w Anga can be compared to the w Au strain of supergroup A and infecting Drosophila simulans , which is unable to induce cytoplasmic incompatibility but can impede the vector competence of host arthropods (Shaw et al. 2016 ; Mancini et al. 2020 ). Knowing that the Wolbachia bacterium can influence many aspects such as metabolic (insecticide resistance) (Algamdi et al. 2023 ), physiological (feminization of genetic males) (Kageyama et al. 2017 ) and behavioral (sexual preference) of the host arthropod (Bagheri et al. 2019 ), the impact of Wolbachia strains w Anga_CI on the fitness of An. gambiae s.l. will be determined in future studies. Conclusion Sequencing of 16S rRNA gene of Wolbachia from different study areas of Côte d’Ivoire allowed us to confirm the natural infection of An. gambiae s.l. by only one strain of Wolbachia that is clustered in supergroup B. This strain has limited abilities in the management of vector-borne diseases. However, it has an impact on the biology of the host mosquito. Additional studies will be necessary to determine the involvement of this strain in the transmission of malaria and the species composition of An. gambiae complex. Declarations Acknowledgment The authors would like to thank the Institut Pasteur de Côte d'Ivoire for making its mosquito capture equipment and entomology platform available to us; the Centre MURAZ and the Institut de Recherche en Sciences de la Santé for the Molecular Biology Platform. Our thanks to the entomology team for their active contribution. We appreciate the active contribution of local volunteers to this study. Our thanks to Tarwendpanga François Xavier Ouedraogo for her help to the design of the map of the study sites. We would like to thank AvH, BAYER Foundation, AGNES and Wellcome Trust for supporting this study. Author contributions Conceptualization: Raymond Karlhis YAO, Etienne BILGO, Michel Kiréopori GOMGNIMBOU and Abdoulaye DIABATE. Investigation: Raymond Karlhis YAO, Ibrahima Zanakoungo COULIBALY, Louis Robert Wendyam and Miriam Félicité AMARA. Funding Acquisition: Raymond Karlhis YAO, Etienne BILGO . Project Administration: Raymond Karlhis YAO, Etienne BILGO. Methodology: Raymond Karlhis YAO, Etienne BILGO, Michel Kiréopori GOMGNIMBOU and Berenger Aristide AKO. Validation: Etienne BILGO, Michel Kiréopori GOMGNIMBOU. Visualization: Raymond Karlhis YAO, Etienne BILGO, Michel Kiréopori GOMGNIMBOU and Berenger Aristide AKO. Writing – Original Draft Preparation: Raymond Karlhis YAO. Writing – Review & Editing: Raymond Karlhis YAO, Etienne BILGO, Berenger Aristide AKO, Louis Robert Wendyam, Ibrahima Zanakoungo COULIBALY, Christian You ESSOH, Kobo GNADA, Michel Kiréopori GOMGNIMBOU Data availability The datasets generated during and/or analysed during the current study are available in the Zenodo repository, https://doi.org/10.5281/zenodo.15809306 Conflict of interest The authors declare no competing interests. Funding Raymond Karlhis YAO PhD scholarship were funded by the Centre d'Excellence Africain en Innovations Biotechnologiques pour l'Elimination des Maladies à Transmission Vectorielle (CEA/ITECH-MTV) of the Université Nazi Boni, Bobo-Dioulasso, Burkina Faso, grant ref/letter acceptation CEA/ITECH-MTV du 04/02/2021 à YAO R. Karlhis. This study was funded by AvH, BAYER Foundation, AGNES and by Wellcome Trust grant ref 218771/Z/19/Z. References Ahouandjinou MJ, Sovi A, Sidick A, et al (2024) First report of natural infection of Anopheles gambiae s.s. and Anopheles coluzzii by Wolbachia and Microsporidia in Benin: a cross-sectional study. Malar J 23:72. https://doi.org/10.1186/s12936-024-04906-1 Algamdi AG, Shaher FM, Mahyoub JA (2023) Biological comparative study between Wolbachia-infected Aedes aegypti mosquito and Wolbachia-uninfected strain, Jeddah city, Saudi Arabia. Saudi J Biol Sci 30:103581. https://doi.org/10.1016/j.sjbs.2023.103581 Ayala D, Akone‐Ella O, Rahola N, et al (2019) Natural Wolbachia infections are common in the major malaria vectors in Central Africa. Evol Appl 12:1583–1594. https://doi.org/10.1111/eva.12804 Bagheri Z, Talebi AA, Asgari S, Mehrabadi M (2019) Wolbachia induce cytoplasmic incompatibility and affect mate preference in Habrobracon hebetor to increase the chance of its transmission to the next generation. J Invertebr Pathol 163:1–7. https://doi.org/10.1016/j.jip.2019.02.005 Baldini F, Rougé J, Kreppel K, et al (2018) First report of natural Wolbachia infection in the malaria mosquito Anopheles arabiensis in Tanzania. Parasit Vectors 11:635. https://doi.org/10.1186/s13071-018-3249-y Baldini F, Segata N, Pompon J, et al (2014) Evidence of natural Wolbachia infections in field populations of Anopheles gambiae. Nat Commun 5:3985. https://doi.org/10.1038/ncomms4985 Chrostek E, Gerth M (2019) Is Anopheles gambiae a Natural Host of Wolbachia? mBio 10:e00784-19. https://doi.org/10.1128/mBio.00784-19 Clervil E, Guidez A, Talaga S, et al (2024) Wolbachia Natural Infection of Mosquitoes in French Guiana: Prevalence, Distribution, and Genotyping. Microorganisms 12:1994. https://doi.org/10.3390/microorganisms12101994 Coetzee (2021)Clé d’identification des moustiques anophèles femelles de la région afrotropicale (Diptera : Culicidae). https://www.who.int/fr/publications-detail/WHO-UCN-GMP-2021.04. Accessed 29 Jun 2023b Felsenstein J (1985) CONFIDENCE LIMITS ON PHYLOGENIES: AN APPROACH USING THE BOOTSTRAP. Evol Int J Org Evol 39:783–791. https://doi.org/10.1111/j.1558-5646.1985.tb00420.x Gomes FM, Hixson BL, Tyner MDW, et al (2017a) Effect of naturally occurring Wolbachia in Anopheles gambiae s.l. mosquitoes from Mali on Plasmodium falciparum malaria transmission. Proc Natl Acad Sci 114:12566–12571. https://doi.org/10.1073/pnas.1716181114 Gomes FM, Hixson BL, Tyner MDW, et al (2017b) Effect of naturally occurring Wolbachia in Anopheles gambiae s.l. mosquitoes from Mali on Plasmodium falciparum malaria transmission. Proc Natl Acad Sci 114:12566–12571. https://doi.org/10.1073/pnas.1716181114 Gouamene TJR, Edi CAV, Kwadio E, et al (2024) Malaria transmission in the coastal zone and in the Centre of Côte d’Ivoire during the dry season. Malar J 23:400. https://doi.org/10.1186/s12936-024-05176-7 Hughes GL, Koga R, Xue P, et al (2011) Wolbachia Infections Are Virulent and Inhibit the Human Malaria Parasite Plasmodium Falciparum in Anopheles Gambiae. PLoS Pathog 7:e1002043. https://doi.org/10.1371/journal.ppat.1002043 Jeffries CL, Cansado-Utrilla C, Beavogui AH, et al (2021) Evidence for natural hybridization and novel Wolbachia strain superinfections in the Anopheles gambiae complex from Guinea. R Soc Open Sci 8:202032. https://doi.org/10.1098/rsos.202032 Jeffries CL, Lawrence GG, Golovko G, et al (2018a) Novel Wolbachia strains in Anopheles malaria vectors from Sub-Saharan Africa. Wellcome Open Res 3: Jeffries CL, Tantely LM, Raharimalala FN, et al (2018b) Diverse novel resident Wolbachia strains in Culicine mosquitoes from Madagascar. Sci Rep 8:17456. https://doi.org/10.1038/s41598-018-35658-z Kageyama D, Ohno M, Sasaki T, et al (2017) Feminizing Wolbachia endosymbiont disrupts maternal sex chromosome inheritance in a butterfly species. Evol Lett 1:232–244. https://doi.org/10.1002/evl3.28 Kambris Z, Blagborough AM, Pinto SB, et al (2010) Wolbachia Stimulates Immune Gene Expression and Inhibits Plasmodium Development in Anopheles gambiae. PLOS Pathog 6:e1001143. https://doi.org/10.1371/journal.ppat.1001143 Kambris Z, Cook PE, Phuc HK, Sinkins SP (2009) Immune Activation by Life-Shortening Wolbachia and Reduced Filarial Competence in Mosquitoes. Science 326:134–136. https://doi.org/10.1126/science.1177531 Kaur R, Shropshire JD, Cross KL, et al (2021) Living in the endosymbiotic world of Wolbachia: A centennial review. Cell Host Microbe 29:879–893. https://doi.org/10.1016/j.chom.2021.03.006 Kouamé JKI, Edi CVA, Zahouli JBZ, et al (2024) Assessing species composition and insecticide resistance of Anopheles gambiae complex members in three coastal health districts of Côte d’Ivoire. PLOS ONE 19:e0297604. https://doi.org/10.1371/journal.pone.0297604 Kumar S, Stecher G, Suleski M, et al (2024) MEGA12: Molecular Evolutionary Genetic Analysis Version 12 for Adaptive and Green Computing. Mol Biol Evol 41:msae263. https://doi.org/10.1093/molbev/msae263 Landmann F (2019) The Wolbachia Endosymbionts. Microbiol Spectr 7:10.1128/microbiolspec.bai-0018–2019. https://doi.org/10.1128/microbiolspec.bai-0018-2019 Le Clec’h W, Chevalier FD, Genty L, et al (2013) Cannibalism and Predation as Paths for Horizontal Passage of Wolbachia between Terrestrial Isopods. PLoS ONE 8:e60232. https://doi.org/10.1371/journal.pone.0060232 Letunic I, Bork P (2024) Interactive Tree of Life (iTOL) v6: recent updates to the phylogenetic tree display and annotation tool. Nucleic Acids Res 52:W78–W82. https://doi.org/10.1093/nar/gkae268 Mancini MV, Herd CS, Ant TH, et al (2020) Wolbachia strain wAu efficiently blocks arbovirus transmission in Aedes albopictus. PLoS Negl Trop Dis 14:e0007926. https://doi.org/10.1371/journal.pntd.0007926 Niang EHA, Bassene H, Makoundou P, et al (2018) First report of natural Wolbachia infection in wild Anopheles funestus population in Senegal. Malar J 17:408. https://doi.org/10.1186/s12936-018-2559-z O’Connor L, Plichart C, Sang AC, et al (2012) Open Release of Male Mosquitoes Infected with a Wolbachia Biopesticide: Field Performance and Infection Containment. PLoS Negl Trop Dis 6:e1797. https://doi.org/10.1371/journal.pntd.0001797 Pinto SB, Riback TIS, Sylvestre G, et al (2021) Effectiveness of Wolbachia-infected mosquito deployments in reducing the incidence of dengue and other Aedes-borne diseases in Niterói, Brazil: A quasi-experimental study. PLoS Negl Trop Dis 15:e0009556. https://doi.org/10.1371/journal.pntd.0009556 Quek S, Cerdeira L, Jeffries CL, et al (2022) Wolbachia endosymbionts in two Anopheles species indicates independent acquisitions and lack of prophage elements. Microb Genomics 8:000805. https://doi.org/10.1099/mgen.0.000805 Saitou N, Nei M (1987) The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol 4:406–425. https://doi.org/10.1093/oxfordjournals.molbev.a040454 Sankar SG, Sundari TM, Anand AAP (2021) Low prevalence of natural Wolbachia in major malarial vectors Anopheles culicifacies s.l., and Anopheles stephensi: a first report. 2020.11.22.393652 Santolamazza F, Mancini E, Simard F, et al (2008) Insertion polymorphisms of SINE200 retrotransposons within speciation islands of Anopheles gambiae molecular forms. Malar J 7:163. https://doi.org/10.1186/1475-2875-7-163 Shaw WR, Marcenac P, Childs LM, et al (2016) Wolbachia infections in natural Anopheles populations affect egg laying and negatively correlate with Plasmodium development. Nat Commun 7:11772. https://doi.org/10.1038/ncomms11772 Shemshadian A, Vatandoost H, Oshaghi MA, et al (2021) Relationship between Wolbachia infection in Culex quinquefasciatus and its resistance to insecticide. Heliyon 7:e06749. https://doi.org/10.1016/j.heliyon.2021.e06749 Shretta R, Avanceña ALV, Hatefi A (2016) The economics of malaria control and elimination: a systematic review. Malar J 15:593. https://doi.org/10.1186/s12936-016-1635-5 Somda Z, Zanré N, Wangrawa DW, et al (2025) High pyrethroid resistance is associated with high frequencies of 1014F and 1014S kdr mutations in Anopheles arabiensis (Diptera: Culicidae) from Ouagadougou, Burkina Faso. J Med Entomol 62:381–388. https://doi.org/10.1093/jme/tjae135 Tamura K, Nei M (1993) Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Mol Biol Evol 10:512–526. https://doi.org/10.1093/oxfordjournals.molbev.a040023 Tia E, Chouaibou M, Gbalégba CNG, et al (2017) [Distribution of species and kdr gene frequency among Anopheles gambiae s.s. and Anopheles coluzzii populations in five agricultural sites in Côte d’Ivoire]. Bull Soc Pathol Exot 1990 110:130–134. https://doi.org/10.1007/s13149-017-0554-1 Walker T, Moreira LA (2011) Can Wolbachia be used to control malaria? Mem Inst Oswaldo Cruz 106:212–217. https://doi.org/10.1590/S0074-02762011000900026 Walker T, Quek S, Jeffries CL, et al (2021) Stable high-density and maternally inherited Wolbachia infections in Anopheles moucheti and Anopheles demeilloni mosquitoes. Curr Biol 31:2310-2320.e5. https://doi.org/10.1016/j.cub.2021.03.056 WHO (2024) World malaria report 2024. https://www.who.int/teams/global-malaria-programme/reports/world-malaria-report-2024. Accessed 28 Mar 2025a Wolie RZ, Koffi AA, Ahoua Alou LP, et al (2021) Evaluation of the interaction between insecticide resistance-associated genes and malaria transmission in Anopheles gambiae sensu lato in central Côte d’Ivoire. Parasit Vectors 14:581. https://doi.org/10.1186/s13071-021-05079-5 Yao RK, Gomgnimbou MK, Coulibaly IZ, et al (2025) Molecular detection of Wolbachia sp. and Cytoplasmic incompatibility factors (CifA/B) in wild caught mosquitoes in Côte d’Ivoire. Mol Biol Rep 52:181. https://doi.org/10.1007/s11033-025-10280-1 Yokoly FN, Zahouli JBZ, Méite A, et al (2020) Low transmission of Wuchereria bancrofti in cross-border districts of Côte d’Ivoire: A great step towards lymphatic filariasis elimination in West Africa. PLoS ONE 15:e0231541. https://doi.org/10.1371/journal.pone.0231541 Additional Declarations The authors declare no competing interests. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7501016","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":508065573,"identity":"87af01d5-e9e9-47b5-843c-4c286a5dfe02","order_by":0,"name":"Raymond Karlhis YAO","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA5klEQVRIiWNgGAWjYBACCQYGxsMMBiAm8wEQX4YYLQxQLWwJID4PkVrAgAeskbAWyfazDw4XFNQl9rf3fH51o8aCh4H98NEN+LRI86QbHJ5hcDhxxpmz26xzjgEdxpOWdgOfFjmGNIbDPAYHEhtu5G4zzmEDapHgMcOvhf8ZSEtd4vwbOc+Mc/4RoUVaAmwLc+KGGznMj3PbiNAiOQNsy2HjjWeOmTHn9knwsBHyi8T5NMbHPH/qZOcdb378OedbnRw/++FjeLXAgGMDMC5BkcTARoxyELAHYuYPxKoeBaNgFIyCkQUAnVxIVwk/BzAAAAAASUVORK5CYII=","orcid":"https://orcid.org/0009-0003-1941-676X","institution":"Ecole Doctorale Sciences Naturelles et Agronomiques, Université Nazi Boni, Bobo-Dioulasso, Burkina Faso","correspondingAuthor":true,"prefix":"","firstName":"Raymond","middleName":"Karlhis","lastName":"YAO","suffix":""},{"id":508065574,"identity":"f356a70b-806e-45d8-90d9-d50bd3727cbd","order_by":1,"name":"Etienne BILGO","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAz0lEQVRIiWNgGAWjYBACA2bmBiBpI8fAwAPiyxGjhRGopSLNGKrFmAgtDCAtZw4nNhCtxZydsfnFxzbm9A3Hzx588IHBIJ+gFstmxjbLmW1suRvO5CUbzmAwsGwg6LDDjG3GvG08uRsO5JhJ8zD8MSDsF4gWiXSD829AWgyI0tL8mOeMQYLBjRwitYD8wjijIsFw5o03xoYzDIjQYs5/+PCHDwb/5fnO5xg++FBBhBYgYJMAkQoHwO4kRgMDA/MHECnfQJzqUTAKRsEoGIEAAAUMOv0mNXGmAAAAAElFTkSuQmCC","orcid":"https://orcid.org/0000-0003-2350-9339","institution":"Institut de Recherche en Sciences de la Santé (IRSS), Direction Régionale de l’Ouest, Bobo-Dioulasso, Burkina Faso","correspondingAuthor":true,"prefix":"","firstName":"Etienne","middleName":"","lastName":"BILGO","suffix":""},{"id":508065575,"identity":"4dec282a-6ca3-46c0-92a1-9d02e1d7de0c","order_by":2,"name":"Berenger Aristide AKO","email":"","orcid":"","institution":"Département de paludisme, Institut Pasteur de Côte-d’Ivoire, Abidjan, Côte d’Ivoire","correspondingAuthor":false,"prefix":"","firstName":"Berenger","middleName":"Aristide","lastName":"AKO","suffix":""},{"id":508065576,"identity":"ec4d4756-1654-4fd5-890c-49129a12757f","order_by":3,"name":"Ibrahima Zanakoungo COULIBALY","email":"","orcid":"","institution":"Unité d’Entomologie et Herpetologie, Pasteur Institute de Côte d’Ivoire, Abidjan, Côte d’Ivoire","correspondingAuthor":false,"prefix":"","firstName":"Ibrahima","middleName":"Zanakoungo","lastName":"COULIBALY","suffix":""},{"id":508065577,"identity":"5de86cc8-ad47-4de3-abba-3a7b50fdbd4e","order_by":4,"name":"Christiane You ESSOH","email":"","orcid":"","institution":"Département de Biochemie-Genetique, UFR Sciences Biologique, Université Péléforo Gon Coulibaly, Korhogo, Côte d’Ivoire","correspondingAuthor":false,"prefix":"","firstName":"Christiane","middleName":"You","lastName":"ESSOH","suffix":""},{"id":508065578,"identity":"92668c0b-e929-4bbc-98b8-94eb4b6f8eed","order_by":5,"name":"Louis Robert Wendyam BELEM","email":"","orcid":"","institution":"Ecole Doctorale Sciences Naturelles et Agronomiques, Université Nazi Boni, Bobo-Dioulasso, Burkina Faso","correspondingAuthor":false,"prefix":"","firstName":"Louis","middleName":"Robert Wendyam","lastName":"BELEM","suffix":""},{"id":508065579,"identity":"c59c9475-a25b-4528-b3f9-be6e9628b8b9","order_by":6,"name":"Miriam Félicité AMARA","email":"","orcid":"https://orcid.org/0009-0008-9893-7892","institution":"Ecole Doctorale Sciences Naturelles et Agronomiques, Université Nazi Boni, Bobo-Dioulasso, Burkina Faso","correspondingAuthor":false,"prefix":"","firstName":"Miriam","middleName":"Félicité","lastName":"AMARA","suffix":""},{"id":508065580,"identity":"a184e01f-fcb0-4673-bfc4-7087938c28a3","order_by":7,"name":"Kobo GNADA","email":"","orcid":"","institution":"Ecole Doctorale Sciences Naturelles et Agronomiques, Université Nazi Boni, Bobo-Dioulasso, Burkina Faso","correspondingAuthor":false,"prefix":"","firstName":"Kobo","middleName":"","lastName":"GNADA","suffix":""},{"id":508065581,"identity":"37abae68-a10f-49ac-97e1-c993b7d350eb","order_by":8,"name":"Abdoulaye DIABATE","email":"","orcid":"","institution":"Institut de Recherche en Sciences de la Santé (IRSS), Direction Régionale de l’Ouest, Bobo-Dioulasso, Burkina Faso","correspondingAuthor":false,"prefix":"","firstName":"Abdoulaye","middleName":"","lastName":"DIABATE","suffix":""},{"id":508065582,"identity":"93ce8022-0daa-4ba7-a5a9-d8c68dcdea7a","order_by":9,"name":"Michel Kiréopori GOMGNIMBOU","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAv0lEQVRIiWNgGAWjYJCCgw0GDHIMDDwgthzxWoyhWoyJ08LYwMCQ2EC0Fnn37sSDMwrupW84fvbggw8MBvkEtRieObvh4AaD4twNZ/KSDWcwGFg2ENQyI3fDwQcGCbkbDuSYSfMw/DEgbAtUS7rB+TcgLQaEtchL5IIclpBgcCOHSC0GPEC/zDBIMJx5442x4QwDYmxp7938sedPgjzf+RzDBx8qiLHlAJShAGYQ1gC0pQGdMQpGwSgYBaMAHQAAxN1A+7uZwTgAAAAASUVORK5CYII=","orcid":"https://orcid.org/0009-0009-5214-8895","institution":"Equipe Biologie Moléculaire et Biotechnologies, Laboratoire de Recherche, Centre MURAZ, Institut National de Santé Publique, Bobo-Dioulasso, Burkina Faso","correspondingAuthor":true,"prefix":"","firstName":"Michel","middleName":"Kiréopori","lastName":"GOMGNIMBOU","suffix":""}],"badges":[],"createdAt":"2025-08-31 13:55:51","currentVersionCode":1,"declarations":{"humanSubjects":false,"vertebrateSubjects":false,"conflictsOfInterestStatement":false,"humanSubjectEthicalGuidelines":false,"humanSubjectConsent":false,"humanSubjectClinicalTrial":false,"humanSubjectCaseReport":false,"vertebrateSubjectEthicalGuidelines":false},"doi":"10.21203/rs.3.rs-7501016/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7501016/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":90468403,"identity":"be2b48bd-2aee-467f-b35b-e420e7688878","added_by":"auto","created_at":"2025-09-03 06:06:37","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":191859,"visible":true,"origin":"","legend":"\u003cp\u003eMap of studies sites\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-7501016/v1/b60667273e9eabdfbda14b1d.png"},{"id":90468372,"identity":"59f8432a-203d-4d52-8ddb-10d92843be54","added_by":"auto","created_at":"2025-09-03 06:06:34","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":139866,"visible":true,"origin":"","legend":"\u003cp\u003eEvolutionary analysis by Maximum Likelihood method\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-7501016/v1/c8e26b7813feb4fea6b7a019.png"},{"id":90468448,"identity":"cf359918-22fb-4d1a-94a9-05766cf94e31","added_by":"auto","created_at":"2025-09-03 06:06:45","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1356271,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7501016/v1/5fadae3c-315f-4b46-b03e-202ae74f0c78.pdf"}],"financialInterests":"The authors declare no competing interests.","formattedTitle":"\u003cp\u003e\u003cstrong\u003e16S rRNA gene-based genetic diversity of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eWolbachia\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e strains infecting \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eAnopheles gambiae \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003es.s. and \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eAnopheles coluzzii \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003ein Côte d’Ivoire\u003c/strong\u003e\u003c/p\u003e","fulltext":[{"header":"Introduction","content":"\u003cp\u003eMalaria is a long-standing parasitic disease that has a significant impact on public health in many parts of the world. According to the World Health Organization (WHO), 263\u0026nbsp;million people were affected by malaria worldwide in 2023. This number has increased by approximately 11\u0026nbsp;million cases compared to the previous year. The majority of malaria cases, approximately 246\u0026nbsp;million cases including 569 000 deaths, were reported in the WHO African region, where malaria is endemic (WHO \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). In 2023, approximately 7 836 000 cases of malaria were reported in C\u0026ocirc;te d'Ivoire; where the main vectors of the plasmodial agent responsible for malaria are the members of \u003cem\u003eAnopheles\u003c/em\u003e (\u003cem\u003eAn\u003c/em\u003e) \u003cem\u003egambiae\u003c/em\u003e complex (Gouamene et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Malaria management represents a significant economic burden on the African continent, with estimated costs reaching up to \u003cspan\u003e$\u003c/span\u003e39.06 per person per year (Shretta et al. \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2016\u003c/span\u003e) ; which represents a major challenge for low-income countries. This management involves vector control strategies that focus primarily on the use of insecticide molecules, whose effectiveness is limited in time and is quickly surpassed by the emergence of vector resistance (Kouam\u0026eacute; et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Somda et al. \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). Therefore, the development of long-lasting and effective vector control strategies is necessary. An emerging integrated biological control strategy based on the \u003cem\u003eWolbachia\u003c/em\u003e bacterium is proposed to control vector population density (O\u0026rsquo;Connor et al. \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2012\u003c/span\u003e) and hinder pathogen transmission by mosquitoes (Pinto et al. \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003cem\u003eWolbachia\u003c/em\u003e is an endosymbiotic bacterium that infects arthropods, including several mosquito species (Clervil et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). It interferes with several physiological mechanisms of its host, such as those related to the immune system (Kambris et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2009\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2010\u003c/span\u003e), mosquito behavior (Shemshadian et al. \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2021\u003c/span\u003e) and the reproductive system (Kaur et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). In the system of the reproduction, the cytoplasmic incompatibility is the main mechanism used to combate harmful arthopods. Wolbachia is diversified into several supergroups ranging from A to S (Landmann \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). However, supergroups A and B are the ones most frequently found in mosquitoes (Jeffries et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2018b\u003c/span\u003e). Generally, mosquitoes of the genus \u003cem\u003eAnopheles\u003c/em\u003e were once considered naturally uninfected by \u003cem\u003eWolbachia\u003c/em\u003e (Walker and Moreira \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). However, natural \u003cem\u003eWolbachia\u003c/em\u003e infection has been demonstrated in a wide range of species of the genus \u003cem\u003eAnopheles\u003c/em\u003e using new and more sensitive diagnostic methods (Gomes et al. 2017; Ayala et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2019\u003c/span\u003e) ; including species known for their vector competence in malaria transmission such as \u003cem\u003eAn. gambiae\u003c/em\u003e s.l. (Baldini et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2014\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Gomes et al. 2017 ; Jeffries et al. 2018), \u003cem\u003eAn. funestus\u003c/em\u003e (Niang et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2018\u003c/span\u003e), \u003cem\u003eAn. culicifacies\u003c/em\u003e s.l. and \u003cem\u003eAn. stephensi\u003c/em\u003e (Sankar et al. \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Except for two \u003cem\u003eWolbachia\u003c/em\u003e strains namely \u003cem\u003ew\u003c/em\u003eAnD and \u003cem\u003ew\u003c/em\u003eAnM infecting \u003cem\u003eAn. demeilloni\u003c/em\u003e and \u003cem\u003eAn. moucheti\u003c/em\u003e respectively (Walker et al. \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2021\u003c/span\u003e), for which cytoplasmic incompatibility (CI) factors have been identified in their genome (Quek et al. \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2022\u003c/span\u003e), almost all \u003cem\u003eWolbachia\u003c/em\u003e strains infecting \u003cem\u003eAnopheles\u003c/em\u003e genus are incapable of inducing CI (Shaw et al. \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Gomes et al. 2017). Complete genome sequencing data for \u003cem\u003ew\u003c/em\u003eAnga identified in Burkina Faso failed to reveal the presence of cytoplasmic incompatibility factor (Cif) genes (Baldini et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). However, \u003cem\u003eWolbachia\u003c/em\u003e strain \u003cem\u003ew\u003c/em\u003eAnga infecting the \u003cem\u003eAn. gambiae\u003c/em\u003e complex have demonstrated an antagonism effect on the development of \u003cem\u003ePlasmodium falciparum\u003c/em\u003e (Hughes et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2011\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eSeveral factors, including the low prevalence of \u003cem\u003eWolbachia\u003c/em\u003e infection (Ahouandjinou et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Yao et al. \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2025\u003c/span\u003e), the low infection density (Baldini et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Jeffries et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2018a\u003c/span\u003e), the diversity of \u003cem\u003eWolbachia\u003c/em\u003e strains, and a lack of congruence between host and symbiont phylogenies (Baldini et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Chrostek and Gerth \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Jeffries et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2021\u003c/span\u003e), suggest an environmental origin of \u003cem\u003ew\u003c/em\u003eAnga. Thus, the nature of \u003cem\u003eWolbachia\u003c/em\u003e in \u003cem\u003eAn. gambiae\u003c/em\u003e would depend on the mosquito's ecological niche. This study aimed to determine the phylogenetic relationships between \u003cem\u003eWolbachia\u003c/em\u003e strains infecting different mosquito species of the \u003cem\u003eAn. gambiae\u003c/em\u003e complex, captured in different ecosystems and in different climatic areas. This was done to identify \u003cem\u003eWolbachia\u003c/em\u003e ecotypes in \u003cem\u003eAn. gambiae\u003c/em\u003e s.l. in C\u0026ocirc;te d\u0026rsquo;Ivoire.\u003c/p\u003e"},{"header":"Material and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003eStudy areas, collection, and identification of mosquitoes\u003c/h2\u003e\u003cp\u003eThe mosquitoes sample were collected during two months (November to December 2024) in five cities of C\u0026ocirc;te d\u0026rsquo;Ivoire namely Boundialy \u003cb\u003e(\u003c/b\u003e9\u0026deg;31'18\" N, 6\u0026deg;29'13\" W) and Korhogo (9\u0026deg;34'60\" N, 5\u0026deg;55'0\" W) in northern, Bouak\u0026eacute; (7\u0026deg;41\u0026prime;37\u0026Prime; N, 5\u0026deg;01\u0026prime;49\u0026Prime; W) in the center, Abidjan (5\u0026deg;20\u0026prime;56\u0026Prime; N, 4\u0026deg;0\u0026prime;13\u0026Prime; W) and Bingervielle (5\u0026deg;21'21\" N, 3\u0026deg;53'24\" W) in southern (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). In this study, only larvae of mosquitoes were collected on vegetable farms and/or in rice fields in baffles, and on breeding sites (abandoned tires, used containers and standing water) in the vicinity of mixed animal farms. Then, the larvae were maintained in the medical entomology\u0026rsquo;s laboratory of Institut Pasteur of C\u0026ocirc;te d\u0026rsquo;Ivoire under a 12h:12h photoperiod at 28\u0026deg;C. After the emergence of the adults, the mosquito species were identified morphologically using a portable binocular magnifying glass (Optika SFX-33, Ponteranica, Italy) according to the identification key of the \u003cem\u003eAnophelina\u003c/em\u003ee (Coetzee \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). All mosquito samples were then preserved in silica gel before DNA extraction as described previously (Yao et al. \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). Molecular identification of species belonging to complex \u003cem\u003eAn. gambiae\u003c/em\u003e s.l. were performed by specific allele PCR using primers (Santolamazza et al. \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). PCR was performed on T100 thermal cycler (Bio-Rad, California, US) using the FIREPol\u0026reg; Master Mix Ready to Load (Solis BioDyne, Tartu, Estonie).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eScreening and sequencing of\u003c/b\u003e \u003cb\u003eWolbachia\u003c/b\u003e \u003cb\u003e16S rRNA gene\u003c/b\u003e\u003c/p\u003e\u003cp\u003eOverall, 264 female mosquitoes from the five cities were analyzed for detecting \u003cem\u003eWolbachia\u003c/em\u003e. For each species of \u003cem\u003eAn. gambiae\u003c/em\u003e s.l. 50 samples were analyzed per study area. However, for less abundant species, all samples were analyzed. The screening of \u003cem\u003eWolbachia\u003c/em\u003e was performed by quantitative PCR (qPCR) using the primer pair sense 5' CATACCTATTCGAAGGGATAG 3' and anti-sense 5'TTGCGGGACTTAACCCAACA 3' specific for \u003cem\u003eWolbachia\u003c/em\u003e 16S rRNA (Gomes et al. 2017) according to protocol described previously (Yao et al. 2024). PCR was performed on the CFX96 system (Bio-Rad, California, US) using the 5x HOT FIREPol EvaGreen qPCR Mix Plus (ROX) kit (Solis BioDyne, Tartu, Estonie). PCR conditions were as follows: initial denaturation at 95\u0026deg;C for 12 minutes, followed by 40 cycles of 15s denaturation at 95\u0026deg;C, 20s hybridization at 58\u0026deg;C, and 20s elongation at 72\u0026deg;C. Samples are considered positive when the Cycles threshold (Ct) value is under or equal to 38. The specificity of the reaction was checked through the melting curve during \u003cem\u003eWolbachia\u0026rsquo;s\u003c/em\u003e detection by varying the temperature from 65\u0026deg;C to 95\u0026deg;C. The melting temperature is equal to 84\u0026deg;C\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C. Then, the 16S rRNA gene has been amplified by nested PCR to described by shaw et \u003cem\u003eal\u003c/em\u003e. (Shaw et al. \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). PCR was performed on T100 thermal cycler (Bio-Rad, California, US) using the FIREPol \u003csup\u003e\u0026reg;\u003c/sup\u003e Master Mix Ready to Load (Solis BioDyne, Tartu, Estonie). Nested PCR products of one or two samples per site have been sent to GenoScreen (Lile, France) for sequencing by the Sanger method in both sense.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003ePhylogenetic analysis\u003c/h3\u003e\n\u003cp\u003eThe chromatograms of the 16S rRNA gene sequences were manually edited using BioEdit Software version 7.0.5. Contig sequences were aligned using ClustalW in BioEdit software (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://bioedit.software.informer.com/7.7/\u003c/span\u003e\u003cspan address=\"https://bioedit.software.informer.com/7.7/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). The consensus sequence of each sample has been compared with other sequences available in GenBank database (NCBI) using Nucleotide Basic Local Alignment Search Tool (BLAST) (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://blast.ncbi.nlm.nih.gov/Blast.cgi\u003c/span\u003e\u003cspan address=\"https://blast.ncbi.nlm.nih.gov/Blast.cgi\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), to determine the percentage identity and confirm \u003cem\u003eWolbachia\u003c/em\u003e identification. 16S rRNA gene sequences that have high similarity with 16S rRNA gene sequences in this study were downloaded and using as references sequence. This included two sequences of \u003cem\u003eWolbachia\u003c/em\u003e infecting \u003cem\u003eAn. gambiae\u003c/em\u003e in Burkina Faso (KJ728744, KJ728742), six sequences (MN123070, AM999887, OZ034723, MK277390, PQ625811, PV187299) of \u003cem\u003eWolbachia\u003c/em\u003e infecting respectively \u003cem\u003eTetranychus urticae, Culex quinquefasciatus, Phasia obesa, Trioza erytreae, Culex tritaeniorhynchus\u003c/em\u003e and \u003cem\u003eCulex pipiens\u003c/em\u003e. Other sequences of \u003cem\u003eWolbachia\u003c/em\u003e infecting \u003cem\u003eAn. gambiae\u003c/em\u003e s.l. identified in Ghana (MH605280, MH605279) and Mali (MF944114) have been included for studding the evolutionary divergence between 16S rRNA gene sequences of \u003cem\u003eWolbachia\u003c/em\u003e in \u003cem\u003eAn. gambiae\u003c/em\u003e s.l. Several \u003cem\u003eWolbachia\u003c/em\u003e 16S rRNA gene sequences of strains belonging to supergroup A (OZ183482), B (OZ034723), C (CP046578), D (CP034333), E (OZ034692), F (DQ115537), H (AY764279), I (AY335924), and J (AJ548802) have been used to build phylogenetic tree, in the purpose to fund at what supergroup belong different strains identified in C\u0026ocirc;te d\u0026rsquo;Ivoire. Other sequences have allowed us to obtain some outgroups. The alignment of all 16S rRNA gene sequences was carried out using MUSCLE in MEGA 12 software version 12.0.11 (Kumar et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). The Akaike Information Criterion (AIC) scores has been used to select the optimal substitution model through the option Find the Best DNA/Protein Models by maximum-likelihood (ML) in MEGA 12. The sequence analysis, such as the interspecific variation of 16S rRNA gene sequences was estimated using the Tamura-Nei model (Tamura and Nei \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e1993\u003c/span\u003e). The phylogenetic tree was constructed using the Likelihood and invariant sites (T92\u0026thinsp;+\u0026thinsp;I). The phylogenetic relationship was tested with 1000 replicates (Felsenstein \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e1985\u003c/span\u003e). Then, the phylogenetic tree was edited online using the Interactive Tree Of Life (iTOL) platform (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://itol.embl.de/\u003c/span\u003e\u003cspan address=\"https://itol.embl.de/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) (Letunic and Bork \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2024\u003c/span\u003e).\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eIdentification of adult mosquito species of the\u003c/strong\u003e \u003cstrong\u003eAnopheles gambiae\u003c/strong\u003e \u003cstrong\u003ecomplex\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eOverall, 405 adult mosquitoes belonging to \u003cem\u003eAn. gambiae\u003c/em\u003e complex have been obtained from larvae collected on all studies sites. The molecular identification confirmed two species namely \u003cem\u003eAn. gambiae\u003c/em\u003e s.s 74.57% and \u003cem\u003eAn. collizzi\u003c/em\u003e 21.73%. hybrid species from crossing between \u003cem\u003eAn. gambiae\u003c/em\u003e s.s. \u003cem\u003eet An. collizzi\u003c/em\u003e were 3.46% (Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e\n\u003cdiv class=\"gridtable\"\u003e\n \u003ctable id=\"Tab1\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eComposition of mosquito species of \u003cem\u003eAn. gambiae\u003c/em\u003e s.l.\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eAreas\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eSite\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colspan=\"3\"\u003e\n \u003cp\u003eSpecies\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eAn. gambiae\u003c/em\u003e s.s. %(n/N)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eAn. collizzi\u003c/em\u003e %(n/N)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eHybrid %(n/N)\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eNorth\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eBoundiali\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e100.0 (114/114)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0 (0/114)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0 (0/114)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eKorhogo\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e78.57 (121/154)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e15.58 (24/154)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e05.84 (9/154)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCenter\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eBouak\u0026eacute;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e57.73 (56/97)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e38.14 (37/97)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e04.12 (4/97)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"3\"\u003e\n \u003cp\u003eSouth\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAbidjan (Abobo)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e35.71 (5/14)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e64.29 (9/14)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0 (0/14)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAbidjan (Cocody)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e100.0 (6/6)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0 (0/6)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0 (0/6)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eBingerville (Anan)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0 (0/20)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e95.0 (19/20)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e05.0 (1/20)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003eTotal\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e74.57 (302/405)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e21.73 (88/405)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3.46 (14/405)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003eMosquito species composition varied strongly according to the geographical areas of the country. In northern C\u0026ocirc;te d\u0026rsquo;Ivoire, \u003cem\u003eAn. gambiae\u003c/em\u003e s.l. population is largely dominated by \u003cem\u003eAn. gambiae\u003c/em\u003e s.s. 87.69%. In Bouak\u0026eacute; city located in\u003c/p\u003e\n\u003cp\u003ethe center, both species namely \u003cem\u003eAn. gambiae\u003c/em\u003e s.s. and \u003cem\u003eAn. coluzzii\u003c/em\u003e are well represented at 57.73% and 38.14% respectively. As for the south, \u003cem\u003eAn. coluzzii\u003c/em\u003e is the main species 82.35% of the complex \u003cem\u003eAn. gambiae\u003c/em\u003e s.l.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePrevalence of\u003c/strong\u003e \u003cstrong\u003eWolbachia\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe overall prevalence of infection with \u003cem\u003eWolbachia\u003c/em\u003e in \u003cem\u003eAn. gambiae\u003c/em\u003e s.l. population for all study sites was 17.05%. The prevalence of infection according to mosquito species belonging to \u003cem\u003eAn. gambiae\u003c/em\u003e s.l. per site is summarized in Table \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e. The results show that the population of \u003cem\u003eAn. coluzzii\u003c/em\u003e species is higher infected by \u003cem\u003eWolbachia\u003c/em\u003e 25.84% than\u0026nbsp;\u003cem\u003eAn. gambiae\u003c/em\u003e s.s. 12.42%.\u003c/p\u003e\n\u003cdiv class=\"gridtable\"\u003e\n \u003ctable id=\"Tab2\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003ePrevalence of \u003cem\u003eWolbachia\u003c/em\u003e in \u003cem\u003eAn. gambiae\u003c/em\u003e s.l.\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eAreas\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eSite\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colspan=\"3\"\u003e\n \u003cp\u003e16S rRNA gene\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eTotal %(n/N)\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eAn. gambiae\u003c/em\u003e s.s. %(n/N)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eAn. collizzi\u003c/em\u003e %(n/N)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eHybrid %(n/N)\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eNorth\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eBoundiaki\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e8 (4/50)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e8 (4/50)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eKorhogo\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e12 (6/50)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e16.67 (4/24)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0 (0/9)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e11.90 (10/83)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCenter\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eBouak\u0026eacute;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e10 (5/50)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e10 (4/37)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e25 (1/4)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e10.99 (10/91)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eSouth\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAbidjan\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e45 (5/11)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e44.44 (4/9)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e45 (9/20)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eBingerville\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e47.37 (9/19)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e100 (1/1)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e50 (10/20)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003eTotal\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e12.42% (20/161)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e23.60 (21/89)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e14.29 (2/14)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e16.29 (43/264)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003ctfoot\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"6\"\u003eN.A : Not Applicable\u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tfoot\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003e\u003cstrong\u003e16S rRNA gene sequencing\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFollowing sequencing, except for the sample from Korhogo whose sequence couldn\u0026rsquo;t be analyzed because of the bad quality of the chromatogram, all samples of \u003cem\u003eWolbachia\u003c/em\u003e 16s rRNA gene were identified as \u003cem\u003eWolbachia sp\u003c/em\u003e, with identification scores ranging from 99.23\u0026ndash;100.00%. Seven strains were found and named in function of the collect site of mosquito samples such as \u003cem\u003ew\u003c/em\u003eAnga_CI BDL (Boundiali), \u003cem\u003ew\u003c/em\u003eAnga_CI BK 1 and \u003cem\u003ew\u003c/em\u003eAnga_CI BK 2 (Bouak\u0026eacute;), \u003cem\u003ew\u003c/em\u003eAnga_CI Abo 1 and \u003cem\u003ew\u003c/em\u003eAnga_CI Abo 2 (Abobo), \u003cem\u003ew\u003c/em\u003eAnga_CI CCD (Cocody) and \u003cem\u003ew\u003c/em\u003eAnga_CI Anan (Bengerville). Sequences of those strains (Online Resource 1) will then put in GenBank database. Figure \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e displays the phylogenetic tree indicating a relationship between sequences identified in this study and other reference sequences obtained from the line database. The seven sequences of \u003cem\u003eWolbachia\u003c/em\u003e 16S rRNA clustered with supergroup B. The Wolbachia strains wAnga_CI could be grouped into two haplotypes. The haplotype 1 included \u003cem\u003ew\u003c/em\u003eAnga_CI_BDL and \u003cem\u003ew\u003c/em\u003eAnga_CI_Abo_2. The haplotype 2 included \u003cem\u003ew\u003c/em\u003eAnga_CI_Anan, \u003cem\u003ew\u003c/em\u003eAnga_CI_BK_1, \u003cem\u003ew\u003c/em\u003eAnga_CI_BK_2, \u003cem\u003ew\u003c/em\u003eAnga_CI_CCD and \u003cem\u003ew\u003c/em\u003eAnga_CI_Abo_1. The Table \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e shows a strong resemblance between haplotype 1 and 2 with a divergence ranging from 0.0000 to 0.0080. However, overall analysis shows a large diversity of \u003cem\u003ew\u003c/em\u003eAnga strains clustered in many different super groups of \u003cem\u003eWolbachia\u003c/em\u003e (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e\n\u003cp\u003eThe phylogeny was inferred using the Maximum Likelihood method and Tamura-Nei (1993) model (Tamura and Nei \u003cspan class=\"CitationRef\"\u003e1993\u003c/span\u003e) of nucleotide substitutions and the tree with the highest log likelihood (-4 970.83) is shown. The percentage of replicate trees in which the associated taxa clustered together (1 000 replicates) is shown next to the branches (Felsenstein \u003cspan class=\"CitationRef\"\u003e1985\u003c/span\u003e).The initial tree for the heuristic search was selected by choosing the tree with the superior log-likelihood between a Neighbor-Joining (NJ) tree (Saitou and Nei \u003cspan class=\"CitationRef\"\u003e1987\u003c/span\u003e) and a Maximum Parsimony (MP) tree. The NJ tree was generated using a matrix of pairwise distances computed using the Tamura-Nei (1993) model (Tamura and Nei \u003cspan class=\"CitationRef\"\u003e1993\u003c/span\u003e).The MP tree had the shortest length among 10 MP tree searches, each performed with a randomly generated starting tree. The rate model allowed for 41.10% of sites to be evolutionarily invariable. The analytical procedure encompassed 32 nucleotide sequences with 2 382 positions in the final dataset. Evolutionary analyses were conducted in MEGA12 version 12.0.11 (Kumar et al. \u003cspan class=\"CitationRef\"\u003e2024\u003c/span\u003e). Utilizing up to 4 parallel computing threads. The OTUs marked in blue represent \u003cem\u003eWolbachia\u003c/em\u003e strains infecting \u003cem\u003eAn. gambiae\u003c/em\u003e s.s. and the green-marked OTUs represent \u003cem\u003eWolbachia\u003c/em\u003e strains infecting \u003cem\u003eAn. coluzzii\u003c/em\u003e.\u003c/p\u003e\n\u003cdiv class=\"gridtable\"\u003e\n \u003ctable id=\"Tab3\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eEstimates of evolutionary divergence between \u003cem\u003eWolbachia\u003c/em\u003e 16S rRNA sequences\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eWolbachia\u003c/em\u003e 16S rRNA\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e6\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e7\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e8\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e9\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e10\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e11\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e12\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e13\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e14\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e15\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e16\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e17\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e18\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1. \u003cstrong\u003ewAnga_CI_BDL\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0047\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0047\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0040\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0036\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0046\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0047\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0059\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0058\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0060\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0136\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0091\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0120\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0127\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0132\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0130\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0000\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2. \u003cstrong\u003ewAnga_CI_BK_1\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0080\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0028\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0125\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0074\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0113\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0109\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0126\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0127\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0046\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0056\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3. \u003cstrong\u003ewAnga_CI_BK_2\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0080\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0027\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0125\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0075\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0113\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0110\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0123\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0125\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0046\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0056\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e4. \u003cstrong\u003ewAnga_CI_Abo_1\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0059\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0125\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0084\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0120\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0123\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0127\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0112\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0040\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0043\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5. \u003cstrong\u003ewAnga_CI_Abo_2\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0053\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0026\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0026\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0027\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0027\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0028\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0027\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0029\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0128\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0071\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0113\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0111\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0126\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0126\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0036\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0042\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e6. \u003cstrong\u003ewAnga_CI_CCD\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0080\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0026\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0125\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0074\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0113\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0109\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0123\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0126\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0046\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0055\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e7. \u003cstrong\u003ewAnga_CI_Anan\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0080\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0026\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0125\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0075\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0113\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0110\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0123\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0126\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0046\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0055\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e8. \u003cstrong\u003eMH605280_wAnga-Ghana_DOG1\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0106\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0026\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0126\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0074\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0114\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0109\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0126\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0128\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0046\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0056\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e9. \u003cstrong\u003eMH605279_wAnga-Ghana_DOG1\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0104\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0026\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0125\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0073\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0113\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0108\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0123\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0125\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0046\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0055\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e10. \u003cstrong\u003eMH596703_wAnga_Tanzania 1\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0111\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0028\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0125\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0102\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0114\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0127\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0107\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0131\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0039\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0048\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e11. \u003cstrong\u003eMH596696_wAnga_Tanzanie 2\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0474\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0400\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0400\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0402\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0437\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0400\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0400\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0405\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0400\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0400\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0142\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0075\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0033\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0136\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0136\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e12. \u003cstrong\u003eMH596695_wAnga_Tanzania 3\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0309\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0198\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0199\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0222\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0226\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0196\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0199\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0196\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0194\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0329\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0521\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0133\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0138\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0123\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0154\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0074\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0090\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e13. \u003cstrong\u003eMF944114_Anga-Mali\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0491\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0425\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0424\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0449\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0457\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0424\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0424\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0429\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0424\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0427\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0142\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0526\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0062\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0064\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0075\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0120\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0130\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e14. \u003cstrong\u003eKJ728755_wAnga_BF_VK5_STP_ML\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0530\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0421\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0423\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0472\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0449\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0418\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0424\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0418\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0414\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0495\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0661\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0118\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0040\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0081\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0114\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0136\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e15. \u003cstrong\u003eKJ728750_wAnga_BF_SMS_5.1_MC\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0502\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0471\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0462\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0479\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0493\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0465\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0465\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0473\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0462\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0374\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0504\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0121\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0059\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0059\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0131\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0135\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e16. \u003cstrong\u003eKJ728748_wAnga_BF_VK7_13.5_O\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0574\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0544\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0534\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0448\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0564\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0537\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0537\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0546\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0534\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0517\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0035\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0645\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0179\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0201\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0106\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0129\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0117\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e17. \u003cstrong\u003eKJ728744_wAnga_BF_VK5_3.1b_T\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0079\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0079\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0058\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0052\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0079\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0079\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0079\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0079\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0056\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0474\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0254\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0487\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0475\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0497\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0569\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.0000\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e18. \u003cstrong\u003eKJ728742_wAnga_BF_VK5_7.6a_T\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0094\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0092\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0062\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0061\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0093\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0093\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0094\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0092\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0067\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0474\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0306\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0515\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0540\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0498\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0464\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0,0000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003eThe number of base substitutions per site between sequences are shown. Standard error estimates are shown above the diagonal and were obtained by a bootstrap procedure (1 000 replicates). Analyses were conducted using the Tamura-Nei model (Tamura and Nei \u003cspan class=\"CitationRef\"\u003e1993\u003c/span\u003e). The analytical procedure encompassed 18 coding nucleotide sequences using 1st, 2nd, 3rd, and non-coding positions. The pairwise deletion option was applied to all ambiguous positions for each sequence pair resulting in a final data set comprising 2 382 positions. Evolutionary analyses were conducted in MEGA12 version 12.0.11 (Kumar et al. \u003cspan class=\"CitationRef\"\u003e2024\u003c/span\u003e).\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn this study, the natural infection with \u003cem\u003eWolbachia\u003c/em\u003e in a wild population of \u003cem\u003eAn. gambiae\u003c/em\u003e s.l. caught on different sites has been demonstrated though qPCR and sequencing of \u003cem\u003eWolbachia\u003c/em\u003e 16S rRNA gene. Actually, 16S rRNA gene is a good genetic marker for screening \u003cem\u003eWolbachia\u003c/em\u003e infection in \u003cem\u003eAn. gambiae\u003c/em\u003e s.l. according to many studies (Gomes et al. 2017; Jeffries et al. 2018). It has been shown that another genetic marker like \u003cem\u003eWolbachia\u003c/em\u003e surface protein gene (\u003cem\u003ewsp\u003c/em\u003e) that is frequently used for screening \u003cem\u003eWolbachia\u003c/em\u003e, can be inappropriate for detecting infection with \u003cem\u003eWolbachia\u003c/em\u003e in \u003cem\u003eAn. gambiae\u003c/em\u003e complex. The open reading frame (ORF) of \u003cem\u003ewsp\u003c/em\u003e gene is often changed by some transposon belonging to the same family as those identified in \u003cem\u003eWolbachia\u003c/em\u003e strain infecting \u003cem\u003eAn. gambiae\u003c/em\u003e s.l. (Baldini et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). The \u003cem\u003eWolbachia\u003c/em\u003e infection in \u003cem\u003eAn. gambiae\u003c/em\u003e s.l. population has been previously reported in C\u0026ocirc;te d\u0026rsquo;Ivoire (Yao et al. 2024). This study allowed us to identify three \u003cem\u003eWolbachia\u003c/em\u003e strains infecting different mosquito species of complex \u003cem\u003eAn. gambiae.\u003c/em\u003e\u003c/p\u003e\u003cp\u003eThe molecular discrimination of mosquito species belonging to \u003cem\u003eAn. gambiae\u003c/em\u003e s.l. allowed to identify two species namely \u003cem\u003eAn. gambiae\u003c/em\u003e s.s., \u003cem\u003eAn. coluzzii.\u003c/em\u003e and the hybrid from crossing between both species. Those two species were spread on almost all study sites, however the proportion of each one depends on geographical areas. In the north \u003cem\u003eAn. gambiae\u003c/em\u003e s.l. population is largely dominated by \u003cem\u003eAn. gambiae\u003c/em\u003e s.s., whereas in the south, \u003cem\u003eAn. coluzzii\u003c/em\u003e is more represented. As for the center, both species are strongly represented. This result can be explained by environmental conditions. In fact, \u003cem\u003eAn. coluzzii\u003c/em\u003e is known to be a mosquito species that is well adapted in forestry areas; as for the species \u003cem\u003eAn. gambiae\u003c/em\u003e s.s., it\u0026rsquo;s well adapted savanna areas (Tia et al. \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2017\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eThis geographical distribution of these species is in accordance with the climatic zone of C\u0026ocirc;te d\u0026rsquo;Ivoire. Other studies carried out previously in C\u0026ocirc;te d\u0026rsquo;Ivoire present the same result with a predominance of \u003cem\u003eAn. gambiae\u003c/em\u003e s.s., in cities located in the northern and a predominance of \u003cem\u003eAn. coluzzii\u003c/em\u003e in cities located in the southern country (Yokoly et al. \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Kouam\u0026eacute; et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). The results of this study present the same tendency as those of Wolie et al. (\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2021\u003c/span\u003e), obtained in Bouak\u0026eacute; and those of Gouamene et al. (\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2024\u003c/span\u003e), obtained in B\u0026eacute;oumi, a city located in the center and near Bouak\u0026eacute;; which showed a high proportion of both species.\u003c/p\u003e\u003cp\u003eThe screening of \u003cem\u003eWolbachia\u003c/em\u003e in \u003cem\u003eAn. gambiae\u003c/em\u003e s.l. allowed us to have an infection prevalence of 16.29%. This prevalence is higher than the previous study, which was 13.46% (Yao et al., 2024). This increase in prevalence can be explained by the species composition of the \u003cem\u003eAn. gambiae\u003c/em\u003e s.l. In fact, the present study shows the species \u003cem\u003eAn. coluzzii\u003c/em\u003e have a statistically higher prevalence (23.60%) than \u003cem\u003eAn. gambiae\u003c/em\u003e s.s. (12.42%). It is noteworthy that in this study, the proportion of \u003cem\u003eAn. gambiae\u003c/em\u003e s.l. collected in the central and the southern areas accounted for 16.39% of the overall mosquitoes analyzed and were composed of 26.15% \u003cem\u003eAn. coluzzii\u003c/em\u003e. However, in the previous study, only 8.91% of \u003cem\u003eAn. gambiae\u003c/em\u003e s.l. has been collected in the same area. Therefore, 91.09% of mosquitoes were collected in the northern zone, which is heavily colonized by \u003cem\u003eAn. gambiae\u003c/em\u003e s.s. which has a relatively low prevalence of \u003cem\u003eWolbachia\u003c/em\u003e infection. Thus, the high proportion of \u003cem\u003eAn. coluzzii\u003c/em\u003e has impacted the prevalence of \u003cem\u003eWolbachia\u003c/em\u003e. However, it is noteworthy that the prevalence of infection obtained previously is substantially equal to that of \u003cem\u003eAn. gambiae\u003c/em\u003e s.s. obtained in the present study. Many studies show the infection of \u003cem\u003eWolbachia\u003c/em\u003e in \u003cem\u003eAn. gambiae\u003c/em\u003e s.l. depend on the species composition. In Burkina, a study showed \u003cem\u003eAn. coluzzii\u003c/em\u003e has higher infection rate (46%) than that of another species sush as \u003cem\u003eAn. arabiensis\u003c/em\u003e (33%) (Shaw et al. \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Also in Guinea, \u003cem\u003eAn. melas\u003c/em\u003e is the main species from \u003cem\u003eAn. gambiae\u003c/em\u003e s.l. that is infected by \u003cem\u003eWolbachia\u003c/em\u003e (Jeffries et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). In our study, the prevalence of \u003cem\u003eWolbachia\u003c/em\u003e infection is higher with a different tendency than those reported in Benin, which show prevalences of 5.1% and 1.3% respectively for \u003cem\u003eAn. gambiae\u003c/em\u003e s.s. and \u003cem\u003eAn. coluzzii\u003c/em\u003e. (Ahouandjinou et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Despite the infection rate has been upgraded in the study, it stays lower than the prevalence reported in Burkina Faso (ranging between 19 and 46%) (Shaw et al. \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2016\u003c/span\u003e), in Mali (ranging between 46 and 78%) (Gomes et al. 2017). Moreover, the phylogenetic relationship of 16S rRNA gene shows that all strains identified in different study areas in C\u0026ocirc;te d\u0026rsquo;Ivoire are clustered in the supergroup B with those identified in Burkina Faso and Ghana; which are unable to induct cytoplasmic incompatibility (Shaw et al. \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Jeffries et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2018a\u003c/span\u003e). Therefore, the low prevalence observed can be due to the inability of these strains to promote the proliferation of the infected host. Based on the very low divergence (less than 1%) obtained between \u003cem\u003eWolbachia\u003c/em\u003e 16S rRNA sequences of strain found in different areas of C\u0026ocirc;te d\u0026rsquo;Ivoire, we can deduce that these strains are different clonal of the same strain of \u003cem\u003eWolbachia\u003c/em\u003e. However, it\u0026rsquo;s very difficult to make a robust phylogenetic analysis with one alone genetic marker; so, our perspective is whole genome study. Our result about the evolutionary divergence of \u003cem\u003eWolbachia\u003c/em\u003e 16S rRNA sequences involves that the evolutionary ecology of \u003cem\u003ew\u003c/em\u003eAnga_CI is the same at all study sites; which could suggest the intracellular environment of \u003cem\u003eAn. gambiae\u003c/em\u003e s.l. However, a more general analysis of \u003cem\u003eWolbachia\u003c/em\u003e strain diversity in \u003cem\u003eAn. gambiae\u003c/em\u003e s.l. calls for more caution regarding this inference. The high Ct values​​ (from 33.86 to 37.99) for \u003cem\u003eWolbachia\u003c/em\u003e detection comparatively to Ct values (from 23.81 to 29.17) of mosquito gene (Online Resource 3) in this study involve a low infection density as reported in \u003cem\u003eAn. gambiae\u003c/em\u003e s.l. (Baldini et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Jeffries et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2018a\u003c/span\u003e). Indeed, \u003cem\u003eWolbachia\u003c/em\u003e acquisition can occur through mosquito feeding from a source contaminated by the bacterium. Experiments have shown that after ingestion of a meal infested with \u003cem\u003eWolbachia\u003c/em\u003e, the bacterium can multiply within the new organism until it infests the sexual organs in a stable manner but at a low density (Le Clec\u0026rsquo;h et al. \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). An explanation that may be plausible in \u003cem\u003eAn. gambiae\u003c/em\u003e s.l. However, the question that remains is how is it that the different strains identified in the case of this present study have less than 1% divergence. Thus, a more in-depth study should investigate the composition of the larval habitats in terms of sympatric arthropods and characterize their endosymbiont \u003cem\u003eWolbachia\u003c/em\u003e in search of a phylogenetic rapprochement with \u003cem\u003ew\u003c/em\u003eAnga. It will also be beneficial to study the vertical transmission of wAnga_CI through successive generations of \u003cem\u003eAn. gambiae\u003c/em\u003e s.l. to determine the stability of the infection.\u003c/p\u003e\u003cp\u003e\u003cem\u003ew\u003c/em\u003eAnga can be compared to the \u003cem\u003ew\u003c/em\u003eAu strain of supergroup A and infecting \u003cem\u003eDrosophila simulans\u003c/em\u003e, which is unable to induce cytoplasmic incompatibility but can impede the vector competence of host arthropods (Shaw et al. \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Mancini et al. \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Knowing that the \u003cem\u003eWolbachia\u003c/em\u003e bacterium can influence many aspects such as metabolic (insecticide resistance) (Algamdi et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2023\u003c/span\u003e), physiological (feminization of genetic males) (Kageyama et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2017\u003c/span\u003e) and behavioral (sexual preference) of the host arthropod (Bagheri et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2019\u003c/span\u003e), the impact of \u003cem\u003eWolbachia\u003c/em\u003e strains \u003cem\u003ew\u003c/em\u003eAnga_CI on the fitness of \u003cem\u003eAn. gambiae\u003c/em\u003e s.l. will be determined in future studies.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eSequencing of 16S rRNA gene of \u003cem\u003eWolbachia\u003c/em\u003e from different study areas of C\u0026ocirc;te d\u0026rsquo;Ivoire allowed us to confirm the natural infection of \u003cem\u003eAn. gambiae\u003c/em\u003e s.l. by only one strain of \u003cem\u003eWolbachia\u003c/em\u003e that is clustered in supergroup B. This strain has limited abilities in the management of vector-borne diseases. However, it has an impact on the biology of the host mosquito. Additional studies will be necessary to determine the involvement of this strain in the transmission of malaria and the species composition of \u003cem\u003eAn. gambiae\u003c/em\u003e complex.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003eAcknowledgment\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe authors would like to\u0026nbsp;thank the Institut Pasteur de C\u0026ocirc;te d\u0026apos;Ivoire for making its mosquito capture equipment and entomology platform available to us; the Centre MURAZ and the Institut de Recherche en Sciences de la Sant\u0026eacute; for the Molecular Biology Platform. Our thanks to the entomology team for their active contribution. We appreciate the active contribution of local volunteers to this study. Our thanks to Tarwendpanga Fran\u0026ccedil;ois Xavier Ouedraogo for her help to the design of the map of the study sites. We would like to thank\u0026nbsp;AvH, BAYER Foundation, AGNES and\u0026nbsp;Wellcome Trust for supporting this study.\u003c/p\u003e\n\u003cp\u003eAuthor contributions\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConceptualization:\u0026nbsp;\u003c/strong\u003eRaymond Karlhis YAO, Etienne BILGO, Michel Kir\u0026eacute;opori GOMGNIMBOU and Abdoulaye DIABATE. \u003cstrong\u003eInvestigation:\u0026nbsp;\u003c/strong\u003eRaymond Karlhis YAO, Ibrahima Zanakoungo COULIBALY, Louis Robert Wendyam and Miriam F\u0026eacute;licit\u0026eacute; AMARA. \u003cstrong\u003eFunding Acquisition:\u0026nbsp;\u003c/strong\u003eRaymond Karlhis YAO, Etienne BILGO\u003cstrong\u003e. Project Administration:\u0026nbsp;\u003c/strong\u003eRaymond Karlhis YAO, Etienne BILGO.\u003cstrong\u003e\u0026nbsp;Methodology:\u003c/strong\u003e Raymond Karlhis YAO, Etienne BILGO, Michel Kir\u0026eacute;opori GOMGNIMBOU and Berenger Aristide AKO. \u003cstrong\u003eValidation:\u0026nbsp;\u003c/strong\u003eEtienne BILGO, Michel Kir\u0026eacute;opori GOMGNIMBOU. \u003cstrong\u003eVisualization:\u0026nbsp;\u003c/strong\u003eRaymond Karlhis YAO, Etienne BILGO, Michel Kir\u0026eacute;opori GOMGNIMBOU and Berenger Aristide AKO. \u003cstrong\u003eWriting \u0026ndash; Original Draft Preparation:\u0026nbsp;\u003c/strong\u003eRaymond Karlhis YAO. \u003cstrong\u003eWriting \u0026ndash; Review \u0026amp; Editing:\u0026nbsp;\u003c/strong\u003eRaymond Karlhis YAO, Etienne BILGO, Berenger Aristide AKO, Louis Robert Wendyam, Ibrahima Zanakoungo COULIBALY, Christian You ESSOH, Kobo GNADA, Michel Kir\u0026eacute;opori GOMGNIMBOU\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets generated during and/or analysed during the current study are available in the Zenodo repository, https://doi.org/10.5281/zenodo.15809306 \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of interest\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e\n\u003cp\u003eFunding\u003c/p\u003e\n\u003cp\u003eRaymond Karlhis YAO PhD scholarship were funded by the Centre d\u0026apos;Excellence Africain en Innovations Biotechnologiques pour l\u0026apos;Elimination des Maladies \u0026agrave; Transmission Vectorielle (CEA/ITECH-MTV) of the Universit\u0026eacute; Nazi Boni, Bobo-Dioulasso, Burkina Faso, grant ref/letter acceptation CEA/ITECH-MTV du 04/02/2021 \u0026agrave; YAO R. Karlhis. This study was funded by AvH, BAYER Foundation, AGNES and by Wellcome Trust grant ref 218771/Z/19/Z.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAhouandjinou MJ, Sovi A, Sidick A, et al (2024) First report of natural infection of Anopheles gambiae s.s. and Anopheles coluzzii by Wolbachia and Microsporidia in Benin: a cross-sectional study. Malar J 23:72. https://doi.org/10.1186/s12936-024-04906-1\u003c/li\u003e\n\u003cli\u003eAlgamdi AG, Shaher FM, Mahyoub JA (2023) Biological comparative study between Wolbachia-infected Aedes aegypti mosquito and Wolbachia-uninfected strain, Jeddah city, Saudi Arabia. Saudi J Biol Sci 30:103581. https://doi.org/10.1016/j.sjbs.2023.103581\u003c/li\u003e\n\u003cli\u003eAyala D, Akone‐Ella O, Rahola N, et al (2019) Natural \u003cem\u003eWolbachia\u003c/em\u003e infections are common in the major malaria vectors in Central Africa. Evol Appl 12:1583\u0026ndash;1594. https://doi.org/10.1111/eva.12804\u003c/li\u003e\n\u003cli\u003eBagheri Z, Talebi AA, Asgari S, Mehrabadi M (2019) Wolbachia induce cytoplasmic incompatibility and affect mate preference in Habrobracon hebetor to increase the chance of its transmission to the next generation. J Invertebr Pathol 163:1\u0026ndash;7. https://doi.org/10.1016/j.jip.2019.02.005\u003c/li\u003e\n\u003cli\u003eBaldini F, Roug\u0026eacute; J, Kreppel K, et al (2018) First report of natural Wolbachia infection in the malaria mosquito Anopheles arabiensis in Tanzania. Parasit Vectors 11:635. https://doi.org/10.1186/s13071-018-3249-y\u003c/li\u003e\n\u003cli\u003eBaldini F, Segata N, Pompon J, et al (2014) Evidence of natural Wolbachia infections in field populations of Anopheles gambiae. Nat Commun 5:3985. https://doi.org/10.1038/ncomms4985\u003c/li\u003e\n\u003cli\u003eChrostek E, Gerth M (2019) Is Anopheles gambiae a Natural Host of Wolbachia? mBio 10:e00784-19. https://doi.org/10.1128/mBio.00784-19\u003c/li\u003e\n\u003cli\u003eClervil E, Guidez A, Talaga S, et al (2024) Wolbachia Natural Infection of Mosquitoes in French Guiana: Prevalence, Distribution, and Genotyping. Microorganisms 12:1994. https://doi.org/10.3390/microorganisms12101994\u003c/li\u003e\n\u003cli\u003eCoetzee (2021)Cl\u0026eacute; d\u0026rsquo;identification des moustiques anoph\u0026egrave;les femelles de la r\u0026eacute;gion afrotropicale (Diptera : Culicidae). https://www.who.int/fr/publications-detail/WHO-UCN-GMP-2021.04. Accessed 29 Jun 2023b\u003c/li\u003e\n\u003cli\u003eFelsenstein J (1985) CONFIDENCE LIMITS ON PHYLOGENIES: AN APPROACH USING THE BOOTSTRAP. Evol Int J Org Evol 39:783\u0026ndash;791. https://doi.org/10.1111/j.1558-5646.1985.tb00420.x\u003c/li\u003e\n\u003cli\u003eGomes FM, Hixson BL, Tyner MDW, et al (2017a) Effect of naturally occurring \u003cem\u003eWolbachia\u003c/em\u003e in \u003cem\u003eAnopheles gambiae s.l.\u003c/em\u003e mosquitoes from Mali on \u003cem\u003ePlasmodium falciparum\u003c/em\u003e malaria transmission. Proc Natl Acad Sci 114:12566\u0026ndash;12571. https://doi.org/10.1073/pnas.1716181114\u003c/li\u003e\n\u003cli\u003eGomes FM, Hixson BL, Tyner MDW, et al (2017b) Effect of naturally occurring \u003cem\u003eWolbachia\u003c/em\u003e in \u003cem\u003eAnopheles gambiae s.l.\u003c/em\u003e mosquitoes from Mali on \u003cem\u003ePlasmodium falciparum\u003c/em\u003e malaria transmission. Proc Natl Acad Sci 114:12566\u0026ndash;12571. https://doi.org/10.1073/pnas.1716181114\u003c/li\u003e\n\u003cli\u003eGouamene TJR, Edi CAV, Kwadio E, et al (2024) Malaria transmission in the coastal zone and in the Centre of C\u0026ocirc;te d\u0026rsquo;Ivoire during the dry season. Malar J 23:400. https://doi.org/10.1186/s12936-024-05176-7\u003c/li\u003e\n\u003cli\u003eHughes GL, Koga R, Xue P, et al (2011) Wolbachia Infections Are Virulent and Inhibit the Human Malaria Parasite Plasmodium Falciparum in Anopheles Gambiae. PLoS Pathog 7:e1002043. https://doi.org/10.1371/journal.ppat.1002043\u003c/li\u003e\n\u003cli\u003eJeffries CL, Cansado-Utrilla C, Beavogui AH, et al (2021) Evidence for natural hybridization and novel Wolbachia strain superinfections in the Anopheles gambiae complex from Guinea. R Soc Open Sci 8:202032. https://doi.org/10.1098/rsos.202032\u003c/li\u003e\n\u003cli\u003eJeffries CL, Lawrence GG, Golovko G, et al (2018a) Novel Wolbachia strains in Anopheles malaria vectors from Sub-Saharan Africa. Wellcome Open Res 3:\u003c/li\u003e\n\u003cli\u003eJeffries CL, Tantely LM, Raharimalala FN, et al (2018b) Diverse novel resident Wolbachia strains in Culicine mosquitoes from Madagascar. Sci Rep 8:17456. https://doi.org/10.1038/s41598-018-35658-z\u003c/li\u003e\n\u003cli\u003eKageyama D, Ohno M, Sasaki T, et al (2017) Feminizing Wolbachia endosymbiont disrupts maternal sex chromosome inheritance in a butterfly species. Evol Lett 1:232\u0026ndash;244. https://doi.org/10.1002/evl3.28\u003c/li\u003e\n\u003cli\u003eKambris Z, Blagborough AM, Pinto SB, et al (2010) Wolbachia Stimulates Immune Gene Expression and Inhibits Plasmodium Development in Anopheles gambiae. PLOS Pathog 6:e1001143. https://doi.org/10.1371/journal.ppat.1001143\u003c/li\u003e\n\u003cli\u003eKambris Z, Cook PE, Phuc HK, Sinkins SP (2009) Immune Activation by Life-Shortening \u003cem\u003eWolbachia\u003c/em\u003e and Reduced Filarial Competence in Mosquitoes. Science 326:134\u0026ndash;136. https://doi.org/10.1126/science.1177531\u003c/li\u003e\n\u003cli\u003eKaur R, Shropshire JD, Cross KL, et al (2021) Living in the endosymbiotic world of Wolbachia: A centennial review. Cell Host Microbe 29:879\u0026ndash;893. https://doi.org/10.1016/j.chom.2021.03.006\u003c/li\u003e\n\u003cli\u003eKouam\u0026eacute; JKI, Edi CVA, Zahouli JBZ, et al (2024) Assessing species composition and insecticide resistance of Anopheles gambiae complex members in three coastal health districts of C\u0026ocirc;te d\u0026rsquo;Ivoire. PLOS ONE 19:e0297604. https://doi.org/10.1371/journal.pone.0297604\u003c/li\u003e\n\u003cli\u003eKumar S, Stecher G, Suleski M, et al (2024) MEGA12: Molecular Evolutionary Genetic Analysis Version 12 for Adaptive and Green Computing. Mol Biol Evol 41:msae263. https://doi.org/10.1093/molbev/msae263\u003c/li\u003e\n\u003cli\u003eLandmann F (2019) The Wolbachia Endosymbionts. Microbiol Spectr 7:10.1128/microbiolspec.bai-0018\u0026ndash;2019. https://doi.org/10.1128/microbiolspec.bai-0018-2019\u003c/li\u003e\n\u003cli\u003eLe Clec\u0026rsquo;h W, Chevalier FD, Genty L, et al (2013) Cannibalism and Predation as Paths for Horizontal Passage of Wolbachia between Terrestrial Isopods. PLoS ONE 8:e60232. https://doi.org/10.1371/journal.pone.0060232\u003c/li\u003e\n\u003cli\u003eLetunic I, Bork P (2024) Interactive Tree of Life (iTOL) v6: recent updates to the phylogenetic tree display and annotation tool. Nucleic Acids Res 52:W78\u0026ndash;W82. https://doi.org/10.1093/nar/gkae268\u003c/li\u003e\n\u003cli\u003eMancini MV, Herd CS, Ant TH, et al (2020) Wolbachia strain wAu efficiently blocks arbovirus transmission in Aedes albopictus. PLoS Negl Trop Dis 14:e0007926. https://doi.org/10.1371/journal.pntd.0007926\u003c/li\u003e\n\u003cli\u003eNiang EHA, Bassene H, Makoundou P, et al (2018) First report of natural Wolbachia infection in wild Anopheles funestus population in Senegal. Malar J 17:408. https://doi.org/10.1186/s12936-018-2559-z\u003c/li\u003e\n\u003cli\u003eO\u0026rsquo;Connor L, Plichart C, Sang AC, et al (2012) Open Release of Male Mosquitoes Infected with a Wolbachia Biopesticide: Field Performance and Infection Containment. PLoS Negl Trop Dis 6:e1797. https://doi.org/10.1371/journal.pntd.0001797\u003c/li\u003e\n\u003cli\u003ePinto SB, Riback TIS, Sylvestre G, et al (2021) Effectiveness of Wolbachia-infected mosquito deployments in reducing the incidence of dengue and other Aedes-borne diseases in Niter\u0026oacute;i, Brazil: A quasi-experimental study. PLoS Negl Trop Dis 15:e0009556. https://doi.org/10.1371/journal.pntd.0009556\u003c/li\u003e\n\u003cli\u003eQuek S, Cerdeira L, Jeffries CL, et al (2022) Wolbachia endosymbionts in two Anopheles species indicates independent acquisitions and lack of prophage elements. Microb Genomics 8:000805. https://doi.org/10.1099/mgen.0.000805\u003c/li\u003e\n\u003cli\u003eSaitou N, Nei M (1987) The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol 4:406\u0026ndash;425. https://doi.org/10.1093/oxfordjournals.molbev.a040454\u003c/li\u003e\n\u003cli\u003eSankar SG, Sundari TM, Anand AAP (2021) Low prevalence of natural Wolbachia in major malarial vectors Anopheles culicifacies s.l., and Anopheles stephensi: a first report. 2020.11.22.393652\u003c/li\u003e\n\u003cli\u003eSantolamazza F, Mancini E, Simard F, et al (2008) Insertion polymorphisms of SINE200 retrotransposons within speciation islands of Anopheles gambiae molecular forms. Malar J 7:163. https://doi.org/10.1186/1475-2875-7-163\u003c/li\u003e\n\u003cli\u003eShaw WR, Marcenac P, Childs LM, et al (2016) Wolbachia infections in natural Anopheles populations affect egg laying and negatively correlate with Plasmodium development. Nat Commun 7:11772. https://doi.org/10.1038/ncomms11772\u003c/li\u003e\n\u003cli\u003eShemshadian A, Vatandoost H, Oshaghi MA, et al (2021) Relationship between Wolbachia infection in Culex quinquefasciatus and its resistance to insecticide. Heliyon 7:e06749. https://doi.org/10.1016/j.heliyon.2021.e06749\u003c/li\u003e\n\u003cli\u003eShretta R, Avance\u0026ntilde;a ALV, Hatefi A (2016) The economics of malaria control and elimination: a systematic review. Malar J 15:593. https://doi.org/10.1186/s12936-016-1635-5\u003c/li\u003e\n\u003cli\u003eSomda Z, Zanr\u0026eacute; N, Wangrawa DW, et al (2025) High pyrethroid resistance is associated with high frequencies of 1014F and 1014S kdr mutations in Anopheles arabiensis (Diptera: Culicidae) from Ouagadougou, Burkina Faso. J Med Entomol 62:381\u0026ndash;388. https://doi.org/10.1093/jme/tjae135\u003c/li\u003e\n\u003cli\u003eTamura K, Nei M (1993) Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Mol Biol Evol 10:512\u0026ndash;526. https://doi.org/10.1093/oxfordjournals.molbev.a040023\u003c/li\u003e\n\u003cli\u003eTia E, Chouaibou M, Gbal\u0026eacute;gba CNG, et al (2017) [Distribution of species and kdr gene frequency among Anopheles gambiae s.s. and Anopheles coluzzii populations in five agricultural sites in C\u0026ocirc;te d\u0026rsquo;Ivoire]. Bull Soc Pathol Exot 1990 110:130\u0026ndash;134. https://doi.org/10.1007/s13149-017-0554-1\u003c/li\u003e\n\u003cli\u003eWalker T, Moreira LA (2011) Can Wolbachia be used to control malaria? Mem Inst Oswaldo Cruz 106:212\u0026ndash;217. https://doi.org/10.1590/S0074-02762011000900026\u003c/li\u003e\n\u003cli\u003eWalker T, Quek S, Jeffries CL, et al (2021) Stable high-density and maternally inherited Wolbachia infections in Anopheles moucheti and Anopheles demeilloni mosquitoes. Curr Biol 31:2310-2320.e5. https://doi.org/10.1016/j.cub.2021.03.056\u003c/li\u003e\n\u003cli\u003eWHO (2024) World malaria report 2024. https://www.who.int/teams/global-malaria-programme/reports/world-malaria-report-2024. Accessed 28 Mar 2025a\u003c/li\u003e\n\u003cli\u003eWolie RZ, Koffi AA, Ahoua Alou LP, et al (2021) Evaluation of the interaction between insecticide resistance-associated genes and malaria transmission in Anopheles gambiae sensu lato in central C\u0026ocirc;te d\u0026rsquo;Ivoire. Parasit Vectors 14:581. https://doi.org/10.1186/s13071-021-05079-5\u003c/li\u003e\n\u003cli\u003eYao RK, Gomgnimbou MK, Coulibaly IZ, et al (2025) Molecular detection of Wolbachia sp. and Cytoplasmic incompatibility factors (CifA/B) in wild caught mosquitoes in C\u0026ocirc;te d\u0026rsquo;Ivoire. Mol Biol Rep 52:181. https://doi.org/10.1007/s11033-025-10280-1\u003c/li\u003e\n\u003cli\u003eYokoly FN, Zahouli JBZ, M\u0026eacute;ite A, et al (2020) Low transmission of Wuchereria bancrofti in cross-border districts of C\u0026ocirc;te d\u0026rsquo;Ivoire: A great step towards lymphatic filariasis elimination in West Africa. PLoS ONE 15:e0231541. https://doi.org/10.1371/journal.pone.0231541\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Anopheles gambiae s.l., Wolbachia, Phylogenetic, natural Infection, Côte d’Ivoire","lastPublishedDoi":"10.21203/rs.3.rs-7501016/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7501016/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cem\u003eWolbachia\u003c/em\u003e is an endosymbiont bacterium found \u003cem\u003eAnopheles gambiae\u003c/em\u003e s.l., the main vector of malaria in Côte d’Ivoire. It’s a bacteria species that is involved in many metabolic reactions of its arthropods host. The interactions of this bacteria and its host depends on bacterial strain and arthropods host. Our study aims to analyze the genetic diversity of \u003cem\u003eWolbachia\u003c/em\u003estrains infecting \u003cem\u003eAnopheles gambiae\u003c/em\u003ecomplex in Côte d’Ivoire. \u003cem\u003eAnopheles gambiae\u003c/em\u003e s.l. larvae were collected in Boundiali, Korhogo, Bouaké, Abidjan and Bingerville from November to December 2024 and reared in laboratory. At adult stage, the \u003cem\u003eAnopheles gambiae\u003c/em\u003ecomplex were discriminated by specific allelic PCR. Then \u003cem\u003eWolbachia\u003c/em\u003e was screened from female of different species identified and confirmed by sequencing of 16S rRNA gene through sanger method. Evolutionary divergence of the 16S rRNA sequence was estimated using Kimura 2-parameter before phylogenetic tree construction. Overall, 74.57 % of \u003cem\u003eAnopheles gambiae \u003c/em\u003es.s., 21.73 % of \u003cem\u003eAnopheles colu\u003c/em\u003ezzii and 3.46 % of hybrids were identified. The infection prevalence of \u003cem\u003eAnopheles gambiae\u003c/em\u003ecomplex by \u003cem\u003eWolbachia\u003c/em\u003e depends on mosquito species with higher infection rate (25.84 %) in \u003cem\u003eAnopheles coluzzii. \u003c/em\u003e\u0026nbsp;than \u003cem\u003eAnopheles gambiae \u003c/em\u003es.s. (12.42 %). Phylogenetic analysis allowed the identification of different clones of the same \u003cem\u003eWolbachia\u003c/em\u003e strain, named \u003cem\u003ewAnga\u003c/em\u003e_CI, which is clustered with supergroup B. Our results show a very low divergence, less than 1 %, between 16S rRNA sequences of \u003cem\u003ew\u003c/em\u003eAnga_CI and these are divided into two haplotypes. Our results show that all species of \u003cem\u003eAnopheles gambiae\u003c/em\u003e s.l. in Côte d’Ivoire are infected by the same strain of \u003cem\u003eWolbachia\u003c/em\u003e.\u003c/p\u003e","manuscriptTitle":"16S rRNA gene-based genetic diversity of Wolbachia strains infecting Anopheles gambiae s.s. and Anopheles coluzzii in Côte d’Ivoire","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-09-03 06:06:23","doi":"10.21203/rs.3.rs-7501016/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"fe97127c-0d47-4426-b5be-120cf33f94ee","owner":[],"postedDate":"September 3rd, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":53958798,"name":"Molecular Biology"},{"id":53958799,"name":"Entomology"}],"tags":[],"updatedAt":"2025-09-03T06:06:23+00:00","versionOfRecord":[],"versionCreatedAt":"2025-09-03 06:06:23","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7501016","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7501016","identity":"rs-7501016","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00
unpaywall
last seen: 2026-05-21T05:10:58.409756+00:00
License: CC-BY-4.0