MUC 21 is downregulated in oral squamous cell carcinoma and associated with poor prognosis

MUC 21 is downregulated in oral squamous cell carcinoma and associated with poor prognosis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article MUC 21 is downregulated in oral squamous cell carcinoma and associated with poor prognosis Lisha Mao, Xiangpu Wang, Anna Zou, Siyuan Guo, Sijia Chen, Ying Su, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5294516/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Mucins are usually associated with more aggressive tumor behavior and poorer clinical outcomes. However, MUC21 has never been studied in oral squamous cell carcinoma (OSCC). MUC21 has been observed to contribute to the anti-adhesion effects of cancer cells in vitro. It might serve as an important molecule in OSCC. Methods Our microarray data based on 10 oral squamous cell carcinoma (OSCC) and paired adjacent normal tissue (para-OSCC), and similar data sets from GEO and TCGA RNAseq data were analyzed to screen out the differentially expressed genes including MUC21. RT-PCR analysis was carried out to further confirm the alteration of MUC21 and the epithelial differentiation related co-expressed genes in OSCC. Then, the relationship of MUC21 changes in OSCC with the corresponding clinical characteristics and outcomes was investigated using immunohistochemistry (IHC) on other 102 paired samples of OSCC and para-OSCC. OSCC cell lines SCC15 and HSC-3 with MUC21 overexpression or knockdown were studied in vitro through CCK8, Annexin V/PI assays, wound healing, and Transwell experiments. Results MUC21 was significantly downregulated in OSCC compared with normal oral tissue, as evidenced by high throughput gene expression datasets, RT-PCR and immunohistochemistry analysis. Additionally, 11 genes co-expressed with MUC21 were revealed. Among them, the mucosae differentiation related KRT4, KRT13, and CRNN were further confirmed by RT-PCR and IHC. The downregulation of MUC21 was associated with pathological lymph node metastasis, poorer tumor differentiation, and shorter survival rates. However, hardly no statistically significant changes were detected in CCK8 analysis, Annexin V/PI assays, wound healing, and Transwell experiments on the OSCC cell lines with MUC21 overexpression or knockdown. Conclusion Low MUC21 expression in OSCC is associated with less epithelial differentiation, more clinical aggressiveness and worse prognosis. MUC21 could serve as a new prognostic marker in OSCC, though it might not be a driver oncogene. Oral Squamous Cell Carcinoma Biomarker MUC21 Prognosis Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Human mucins are categorized into membrane-bound types (MUC1, MUC3A, MUC3B, MUC4, MUC12, MUC13, MUC14, MUC15, MUC16, MUC17, MUC20, MUC21, MUC22) and secreted forms (MUC2, MUC5AC, MUC5B, MUC6, MUC7, MUC8, MUC9, MUC19), based on their structural properties [ 1 ]. Physiologically, mucins are crucial for mucosal lubrication and protection, epithelial renewal, differentiation, and cellular signaling [ 2 ]. In oncology, mucins significantly influence tumor genesis and progression across various cancers. Abnormal or deregulated mucin expression is associated with enhanced cancer cell proliferation, differentiation, migration, and invasion[ 3 ]. For instances, MUC1 is overexpressed in pancreatic ductal adenocarcinoma and cervical squamous cell carcinoma and promotes cancer cell proliferation and metastasis [ 4 , 5 ]. MUC4 plays a vital role in esophageal squamous cell carcinoma cell proliferation and invasion[ 6 ] and MUC16 is overexpressed in epithelial tumors like ovarian cancer and lung adenocarcinoma, facilitates increased tumor cell migration[ 7 ] . Oral squamous cell carcinoma (OSCC) is associated with significant morbidity and a high mortality rate. Despite advances in surgical techniques, radiotherapy, and chemotherapy, the 5-year survival rate for OSCC remains around 60%[ 8 ]. This is partly due to the absence of reliable prognostic indicators that could help clinicians devise effective primary treatment strategies, as the traditional TNM staging system has shown limited utility in this context [ 9 ]. The molecular events underlying the pathogenesis and progression of OSCC contribute to its heterogeneity and are potential sources of diagnostic markers and therapeutic targets [ 10 ]. Recent studies have identified several mucin members, such as MUC1 and MUC4, as being implicated in OSCC. These mucins are associated with more aggressive tumor behavior and poorer clinical outcomes[ 11 ] . MUC21 was first identified in 2008 as the human equivalent of mouse epiglycanin, a mucin expressed in mammary carcinoma TA3-Ha cells but absent in TA3-St cells [ 12 ]. The MUC21 protein is characterized by an N-terminal signal sequence, an extracellular mucin domain containing dozens of tandem repeats 15-amino acid each, a stem domain, a transmembrane domain, and a C-terminal cytoplasmic tail [ 13 ]. Increased expression of MUC21 has been observed to contribute to the anti-adhesion effects of cancer cells in vitro. Variations in MUC21 expression have been noted in several types of malignant tumors[ 14 ]. However, its role in OSCC has not yet been explored. Previous studies have documented overexpression of MUC21 in conditions like gingival inflammation [ 15 ]. The aim of this study is to delve deeper into the potential involvement of MUC21 in OSCC. In this study, we firstly analyzed cDNA microarray data from our own research combined with additional datasets downloaded from the GEO and TCGA databases and identified a pronounced downregulation of MUC21 in OSCC and a few of its co-expressed genes. Secondly, we further confirmed the expression changes of MUC21 and some of its epithelial differentiation related co-expressed genes in OSCC by RT-PCR analyses. Thirdly, we examined the correlation between the expression profiles of MUC21 and various clinical characteristics and outcomes. Lastly, we investigated the OSCC cell lines changes following the overexpression and knockdown of MUC21. Our findings suggest that MUC21 could serve as a novel prognostic marker for OSCC. Patients and methods 1. Patients and tissue samples In this research, 10 paired samples of OSCC and adjacent normal mucosa (para-OSCC) underwent microarray analysis. Subsequently, 30 additional paired samples were analyzed using RT-PCR to validate some genes screened out by the microarray and other two gene dataset downloaded from Geo and TCGA. To explore the relationship between MUC21 expression and clinical pathological parameters, a cohort of 102 OSCC patients, who had been under regular follow-up, was included in the immunohistochemistry (IHC) analysis. Tissues from OSCC and para-OSCC were collected from patients during surgical procedures and were histologically verified via frozen sections before proceeding with microarray analysis, quantitative RT-PCR assays, and immunohistochemical studies. The study received ethical approval from the Medical Ethics Committee of the Capital Medical University School of Stomatology (No. CMUSH-IRB-KJ-PJ-2018-04), and patient consent was obtained as required. 2. Differential expressed genes’ analysis between OSCC and normal oral tissue based on our microarray data and datasets downloaded from GEO and TCGA To perform microarray hybridization, total RNA was extracted from samples of various groups. RNA labeling and microarray hybridization were carried out following the protocols outlined in the Affymetrix Expression Analysis Technical Manual (Biotechnology Company, Shanghai, China). The microarrays were scanned using the GeneChip Scanner 3000 system (Affymetrix, Santa Clara, CA, USA) with the default settings on Command Console software 3.1 (Affymetrix). In addition, GSE34105 was downloaded from GEO data base ( https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE34105 ), which comprised 62 OSCC and 16 normal oral tissue. Moreover, RNAseq data of 266 OSCC and 19 normal oral tissue was downloaded from the website of National Cancer Institute ( https://portal.gdc.cancer.gov ). The background correction and normalization of the three datasets raw data were performed using the Robust Multichip Average (RMA) algorithm. The Limma software package in the R programming language was utilized to identify differentially expressed genes, considering a fold change of > 2 and an adj-p-value of < 0.05 as statistically significant. Visualizations included a volcano plot created with ggplot2 (version 3.1.0) and a heatmap generated using the pheatmap package (version 1.0.12) in R. Furthermore, intersections of differential expressed genes (up-regulated and down-regulated) revealed by the three datasets were created by on the line tool Evenn. [ 16 ] 3. Co expression analysis of MUC21 To identify genes related with MUC21, cor.test of R language was run in the TCGA based dataset to carry out Pearson correlation analysis of MUC21 and other genes. Genes with R value more than 0.7 and P value less than 0.001 were sorted out. R language package ggplot2, ggpubr and ggExtra were used to create the correlation analysi maps; circlize and corrplot were used to generate the circos map. 4. RNA extraction and quantitative RT-PCR (real time PCR) Tissue samples were rapidly dip-frozen in liquid nitrogen and homogenized using an MX-F Vortex mixer (SCILOGEX, LLC, USA) before immediately preceding to RNA extraction. Total RNA was extracted from the homogenized frozen tissue using Trizol reagent (Invitrogen), adhering to the manufacturer's protocol. Subsequently, 500 ng of RNA was reverse-transcribed into cDNA utilizing HiScript II Reverse Transcriptase (Vazyme, Nanjing, China). For quantitative real-time PCR (Q-RT-PCR), specific primers were used as follows: MUC21 forward: GGGGCTCTTTGCTGGGCTCTT; MUC21 reverse: CCGCTGTTCCTCCCGCTCAT. KRT4 forward: CGCGAACAGATCAAGCTCCT; KRT4 reverse: GGGGCTCAAGGTTTTTGCTG. KRT13 forward: CCCCAGGCATTGACCTGAC; KRT13 reverse: GTGTTGGTAGACACCTCCTTG. CRNN forward: ATGCCTCAGTTACTGCAAAACA; CRNN reverse: TCACATCGGCAAACTCTTGCT. GAPDH forward: TCAAGAAGGTGGTGAAGCAGG; GAPDH reverse: GCGTCAAAGGTGGAGGAGTG. The data were expressed as mean ± standard deviation (S.D.). GAPDH was utilized as the internal control. All assays were conducted in triplicate using the Roche LightCycler 96 System. Relative gene expression levels were calculated using the 2–∆∆CT method. 5. Immunohistochemistry and semi-quantification of the results For immunohistochemical analysis (IHC), 4 µm-thick paraffin sections of tissue samples were prepared. The IHC procedure followed previously established protocols [ 17 ]. Initially, sections were deparaffinized and rehydrated. Endogenous peroxidase activity was quenched with a 3% hydrogen peroxide solution. Following antigen retrieval, sections were blocked with 10% normal serum and then incubated with either anti-MUC21 antibody (NBP2-31023; Polyclonal; 1:200; NOVUS Biologicals, Littleton, CO, USA) for 2 hours at 37°C. This was followed by incubation with a secondary antibody, and color development was achieved using horseradish peroxidase enzyme and diaminobenzidine (DAB) chromogen reagent. Positive immunostaining was identified by cytoplasmic and/or membrane immunoreactivity. The intensities of the immunohistochemical reactions were evaluated under a light microscope (BX-71; Olympus, Japan) by three independent trained observers who were blinded to the subjects’ clinical information. Quantification of MUC21 expression levels was conducted using a computerized image analysis system (Image-Pro Plus V6.0, Media Cybernetics Inc, Bethesda, MD, USA). Five images at low-power magnification (×200) were captured randomly from each slide using a digital camera (DP72; Olympus, Japan), focusing on areas containing squamous epithelial carcinoma cells or normal squamous epithelial cells. Staining intensity was measured by mean optical density (MOD), corresponding to the positive staining intensity of MUC21. Expression levels were classified into high and low expression groups based on the median MOD value. 6. survival analysis of MUC21 expression and other Key clinical pathological factors Clinicopathological data, including gender, age, tumor (T) classification, node (N) classification, and the overall tumor, node, metastases (TNM) stage, were extracted from clinical records and pathology reports. The TNM classification was based on the 7th edition of the American Joint Committee on Cancer Staging System for oral cancer. During the follow-up period, overall survival (OS) was measured from the date of surgery until the date of the last follow-up examination or the patient's death. Disease-free survival (DFS) was defined as the interval between the surgery and the occurrence of disease relapse, disease-related death, or other conditions. The clinicopathological variables, including the expression of MUC21, were evaluated in the analysis of survival (both OS and DFS) using the Kaplan-Meier method, providing a statistical approach to estimate the survival probability over time, taking into account various patient and disease characteristics. 7. Cell culture, lentivirus and siRNA transfection in OSCC cell lines Human OSCC cell lines SCC15 and HSC-3 were acquired from the American Type Culture Collection (ATCC, USA). These cells were cultured in Dulbecco's Modified Eagle Medium (DMEM, Gibco, USA). The culture medium was supplemented with 10% fetal bovine serum (FBS, Gibco, USA), 100 IU/mL penicillin, and 100 µg/mL streptomycin (Solarbio, China). In order to overexpress MUC21 in OSCC cell, LV-MUC21 lentivirus (NM_001010909; GeneChem, Shanghai China) was transfected into SCC15 and HSC-3. To achieve knockdown of MUC21 in OSCC cells, three siRNA sequences were designed and synthesized (GeneChem, Shanghai China) targeting different regions of the human MUC21 gene sequence, The targeted sequences of these siRNAs were as follows: MUC21-RNAi-1: CGTGGGAAATCTTCCTCATCA; MUC21-RNAi-2: GTTTGGTCTACTATTGCATTT; MUC21-RNAi-3: GCTTTGTTTGAGATCCTGAAA.The transfection of siRNAs into OSCC cells was conducted using Lipofectamine 3000 reagent (Invitrogen, USA), following the manufacturer's protocol. 8. Cell proliferation, wound healing, transwell cell invasion and apoptosis assays Cell proliferation was assessed using a Cell Counting Kit-8 (CCK-8) (Solarbio, China) following the manufacturer's instructions. Briefly, 3,000 OSCC cells were seeded into each well of a 96-well plate and incubated for three days. At designated time points, 10 µL of CCK-8 solution was added to each well and incubated at 37°C for 2 hours. Absorbance was then measured at 450 nm. An in vitro wound healing assay was employed to evaluate cell motility. Briefly, transfected OSCC cells (1 × 10 5 cells/well) were seeded into 6-well plates. Upon reaching 90% confluence, wounds were created by dragging a 10 µl pipette tip across the well from one end to the other. The cells were then cultured for up to 24 hours. Wound closure was monitored under 100X magnification, and cell migration rates were calculated by comparing images taken at 0 and 24 hours. Cell invasion was assessed using Transwell chambers (Corning, USA) equipped with 8-µm-pore polycarbonate filters. OSCC cells (2 × 10 5 cells/ml) were suspended in DMEM supplemented with 10% FBS. Subsequently, 200 µl of this suspension was placed in the upper chamber, and 700 µl of DMEM supplemented with 10% FBS was added to the lower chamber. Following a 24-hour incubation period at 37°C with 5% CO2, cells that had migrated through the polycarbonate membrane were fixed with 4% formaldehyde for 10 minutes and subsequently with 100% methanol for 20 minutes. The fixed cells were then stained with crystal violet for 15 minutes. Cells remaining on the upper surface of the membrane were removed using a cotton swab. Six random microscopic fields at 100x magnification were photographed and analyzed for cell count. The proportion of OSCC cells undergoing early and late apoptosis was assessed using Annexin V-FITC/Propidium Iodide (PI) staining, following the protocol provided by the kit manufacturer (4A Biotech, China). Cells stained with Annexin V+/PI- were categorized as early apoptotic, while those stained with Annexin V+/PI + were identified as late apoptotic. All experiments were conducted in triplicate. 9. Statistical analysis In this study, statistical analyses were performed using the SPSS 20.0 system (IBM SPSS Statistics for Windows, Version 22.0, Armonk, NY, USA) and GraphPad Prism (version 8, San Diego, CA, USA). Chi-square test, Wilcoxon Signed-Rank Test, Spearman rank correlation test, log-rank test, univariate and multivariate analyses were used respectively. A p-value of less than 0.05 or 0.01 was considered to indicate statistical significance. Result 1. MUC21 Expression decreased in OSCC and was related with KRT4, KRT13 and CRNN The microarray analysis on ten paired samples of OSCC and para-OSCC revealed a significant downregulation of MUC21 in OSCC tissues. The same result was also found in GSE34105 and the dataset from TCGA. (Fig. 1 ). Co-expression analysis of MUC21 with other genes revealed that 11 genes including KRT4, KRT13 and CRNN were closely related with MUC21 in expression levels (Fig. 2 ). Differentiation-specific genes, keratin4/13 for non-keratinizing epithelia and keratin1/10 for keratinizing epithelia, are known to be expressed in pairs within the oral squamous cell epithelium [ 18 ]. Besides, CRNN, also known as Cornulin, is related to the late epidermal differentiation. To further verify this finding, MUC21, KRT4, KRT13 and CRNN expression was assessed in additional 30 paired samples using RT-PCR analysis. The results confirmed that both MUC21 and KRT4, KRT13, CRNN were downregulated in OSCC tissues. (Fig. 3 ). The Spearman rank correlation test showed that the expressions of MUC21, KRT4, KRT13 and CRNN were related. (Fig. 3 e). 2. Decreased MUC21 Expression was associated with more clinical aggressiveness in OSCC The immunohistochemistry (IHC) staining results of MUC21 in 102 OSCC patients showed that, in normal oral squamous epithelium, MUC21 was predominantly expressed in the stratum granulosum, where it appeared as chunky staining on the cell membrane and cytoplasm (Fig. 4 a, c, e). Conversely, in cancerous tissues, MUC21 expression was reduced and the reduction was correlated with different degrees of tumor differentiation (Fig. 4 b, d, f). and MUC21 was greatly downregulated in OSCC (Fig. 4 g). The associations between MUC21 expression and the clinicopathologic characteristics of 102 patients with OSCC were detailed in Fig. 5 . Analysis using the Chi-square test revealed significant associations between low MUC21 expression and several adverse clinicopathologic features. Specifically, the presence of pathological lymph node metastasis was more frequent in the low MUC21 expression group compared to the high expression group ( P = 0.029). Similarly, poor tumor differentiation was significantly associated with low MUC21 expression ( P = 0.01). 3. Decreased MUC21 Expression was a prognostic factor for worse OS and DFS in OSCC Kaplan-Meier survival analysis, supplemented by the log-rank test, was employed to assess the differences in OS and DFS among patients with OSCC based on MUC21 expression levels. The results indicated that patients in the low MUC21 expression group had significantly lower OS and DFS rates compared to those in the high expression group (Fig. 6 ). Similarly, reduced survival rates were also observed in patients with advanced TNM stages, presence of lymph node metastasis, and poor tumor differentiation (Fig. 6 ). Further statistical analysis using Cox proportional hazards regression models in both univariate and multivariate contexts confirmed the significance of MUC21 expression as a prognostic indicator. In the univariate analysis, low MUC21 expression was associated with a negative impact on OS ( p = 0.038, Table 1 ) and was even more strongly correlated with reduced DFS ( p < 0.001, Table 2 ). Table 1 Univariate and Multivariate Analysis of Overall Survival in OSCC Variable No. of Patients(%) Univariate Analysis Multivariate Analysis Alive Dead HR 95%CI P HR 95%CI P Age, y < 60 41(56.2) 10(34.5) 1 0.090 ≥60 32(43.8) 19(65.5) 1.952 0.900-4.232 Gender Female 26(35.6) 15(51.7) 1 0.117 Male 47(64.4) 14(48.3) 0.559 0.269–1.158 P- T classification T1 or T2 69(94.5) 22(75.9) 1 0.019 0.071 T3 or T4 4(5.5) 7(24.1) 2.797 1.186–6.596 P-lymph node metastasis Negative (pN0) 50(68.5) 3(10.3) 1 0.003 1 0.046 Positive (pN1-pN3) 23(31.5) 26(89.7) 3.467 1.533–7.839 0.365 0.136–0.982 TNM tumor stage I or II 48(65.8) 3(10.3) 1 <0.001 1 <0.001 III or IV 25(34.2) 26(89.7) 11.402 3.444–37.754 10.016 2.993–33.519 Tumor differentiation Well or Moderate 64(87.7) 18(62.1) 1 0.027 0.054 Poor 9(12.3) 11(37.9) 3.259 1.500-7.079 MUC21 expression High 43(58.9) 8(27.6) 1 0.016 2.415 1.05–5.554 0.038 Low 30(41.1) 21(72.4) 2.716 1.201–6.143 Table 1 : the impact of clinical pathological factors along with MUC21 expression on the overall survival (OS)of 102 patients with oral squamous cell carcinoma (OSCC) was evaluated using Cox proportional hazards regression models. The univariate analysis identified tumor classification, pathologic lymph node metastasis, advanced TNM stage, poor tumor differentiation, and low MUC21 expression as significant negative prognostic factors. Subsequent multivariate analysis further confirmed pathologic lymph node metastasis, advanced TNM stage, and low MUC21 expression as independently significant negative prognostic factors for OS. Abbreviations: CI, confidence interval; HR, hazard ratio; OSCC, oral squamous cell carcinoma; P, pathological. Table 2 Univariate and Multivariate Analysis of Disease-Free Survival in OSCC Variable No. of Patients(%) Univariate Analysis Multivariate Analysis Disease-F Disease HR 95%CI P HR 95%CI P Age, y =60 27(44.3) 24(58.5) 1.571 0.843–2.929 Gender Female 23(37.7) 18(43.9) 1 0.109 0.053 Male 38(62.3) 23(56.1) 0.438 0.236–0.813 P-T classification T1 or T2 57(93.4) 34(82.9) 1 0.051 T3 or T4 4(6.6) 7(17.1) 2.256 0.996–5.109 P- lymph node metastasis Negative (pN0) 38(62.3) 16(39.0) 1 0.022 0.394 Positive (pN1-pN3) 23(37.7) 25(61.0) 2.082 1.110–3.905 TNM tumor stage I or II 38(62.3) 13(31.7) 1 0.002 1 0.008 III or IV 23(37.7) 28(68.3) 2.801 1.448–5.419 2.445 1.259–4.747 Tumor differentiation Well or Moderate 54(88.5) 28(68.3) 1 0.011 0.386 Poor 7(11.5) 13(31.7) 2.353 1.216–4.556 MUC21 expression High 43(70.5) 8(19.5) 1 <0.001 1 <0.001 Low 18(29.5) 33(80.5) 5.740 2.644–12.462 5..311 2.439–11.567 Table 2 the impact of clinical pathological factors along with MUC21 expression on the disease-free survival ( DFS) of 102 patients with oral squamous cell carcinoma (OSCC) was evaluated using Cox proportional hazards regression models. The univariate analysis revealed that pathologic lymph node metastasis, advanced TNM stage, poor tumor differentiation, and low MUC21 expression significantly impacted DFS rate negatively. In the multivariate analysis, advanced TNM stage and MUC21 expression emerged as independent negative prognostic factors for DFS. Abbreviations: CI, confidence interval; HR, hazard ratio; OSCC, oral squamous cell carcinoma; P, pathological. 4. Overexpression and Knockdown of MUC21 cause no obvious cell behavior change in vitro MUC21 was significantly overexpressed and knocked down in OSCC cell lines SCC15 and HSC-3 Fig. 6 a, b, c). However, except that CCK-8 assay in HSC-3 showed a statistical difference on day 3, there were no other positive results arose from all the in vitro tests performed in this study (Fig. 6 d-i). Discussion In this study, we observed that the downregulation of MUC21 is a prevalent occurrence in OSCC. Furthermore, the extent of this reduction correlates with the aggressive characteristics of OSCC, including lymph node metastasis and poor clinical outcomes. These findings suggest that MUC21 may serve as a potential novel prognostic marker for OSCC. Clinically the TNM staging system established by American joint committee on cancer has been and is now the main basis to appraise OSCC status and prognosticate its clinical outcome [ 19 ]. But it still has been being constantly improved to raise its accuracy in appraising the malignancy of OSCC to which biomarkers might provide some extra help [ 20 ]. Several dozens of biomarkers have been identified in OSCC to help predicting its clinical aggressiveness so as to choose the appropriate therapy regime or even develop the treatment targets, such as EGFR, PD-L1, [ 21 ] [ 22 ] [ 10 ]etc. More specific biomarkers in OSCC are still on the way to be elucidated. Mucins are a family of highly glycosylated protein members involved in many gastro-intestinal cancers and other cancers[ 23 , 24 ]. In OSCC, upregulation of MUC1 has been observed comparing with normal oral mucosae [ 25 ] and it promotes OSCC invasion and migration through PI3K-Akt pathway [ 26 ], silencing MUC1 inhibits OSCC proliferation invasion and migration and promotes its apoptosis at the same time[ 27 ]. MUC4 has also been found upregulation in OSCC and is a risk factor for its prognosis [ 28 ]. Elevated CA125(MUC16) in saliva has been found in OSCC patients and might be a prognostic marker[ 29 ]. Bioinformatic analysis showed that MUC7 is one of hub gene[ 30 ]. Increased MUC20 has been related with invasiveness of OSCC cells[ 31 ]. However, to our knowledge, MUC21 has never been studied in OSCC before. Our results may be the first report about MUC21 in OSCC and provide new insight into the functions of mucins in OSCC. In contrary to our result, several studies show that MUC21 is upregulated in cancer cells and promote cancer cell migration and metastasis. MUC21 can promote pancreatic cancer perineural invasion and metastasis [ 14 ]. MUC21 expression was significantly upregulated in melanoma and promote melanoma cell lines’ proliferation and migration in vitro [ 32 ]. In human glioblastoma tissues and cell lines the elevated expression of MUC21 was observed and its high expression was related with glioblastoma cell viability and motility [ 33 ]. MUC21 is also proved to inhibit both cytotoxic activity of NK cells and hinder T cell activation so that it severs as potent immunosuppressive factor in cancer [ 34 ]. It has been shown by in vitro study that over expressed MUC21 in mouse cells decrease the adhesion among cells and cells to extracellular matrix components resulting in more floating, round cells during cell culture [ 35 ], and MUC21 transfection in to HEK293 cell decreased the number of apoptotic cells [ 36 ]. However, in our study it was showed that MUC21 was expressed in non-tumor oral mucosa and its expression decreased in the corresponding squamous carcinoma cells both by microarray, bioinformatic, RT-PCR and immunohistochemistry methods. which suggests that MUC21 is not a cancer cell metastasis enhancer in OSCC. This might seem contradictory to the previous reports. However, bioinformatic analysis has shown that MUC21 is downregulated in laryngeal squamous cell carcinoma (LSCC) [ 37 ]. Furthermore, MUC21 has been found being expressed in opposite ways in malignant cells of different subtypes even in the same organ, it was expressed high in lung adenocarcinoma but low in squamous cell carcinoma [ 38 ]. Besides, contradictory functions of both membrane-bound and secretory mucins have also been reported. For example, MUC16 have been shown to facilitate pancreatic cancer metastasis via FAK-mediated upregulation of mesenchymal markers [ 39 ], while depletion of MUC16 from the cell surface led to the internalization of E-cadherin, causing enhanced expression of mesenchymal markers vimentin and N-cadherin [ 40 ]. Similar phenomenon has also been reported in MUC15 and MUC5AC [ 3 , 41 ]. Hence, the discrepancy of MUC21expression in different malignant cells might indicate that it works in different ways according to the cell types and scenarios. The immunohistochemistry and clinical findings from this study showed a significant correlation between the downregulation of MUC21 and low tumor differentiation in oral squamous cell carcinoma (OSCC). This correlation is further supported by the close association of MUC21 expression levels with those of KRT4, KRT13 and CRNN, proteins specific to the differentiation of oral squamous epithelia. Notably, KRT4 、KRT13 have also been reported to be downregulated in OSCC and downregulation of CRNN in OSCC is an independent predictor of relapse of OSCC [ 42 ] [ 43 ]. In healthy oral tissues, both secreted and membrane-bound mucins play a critical role in protecting the epithelia by forming a mucous barrier on the surface of the apical epithelial cells [ 18 ]. Though most membrane-bound mucins are upregulated and contribute to oncogenesis and malignancy development in cancers including OSCC, several of them, however, deceased in cancerous tissue than in matched non-cancerous tissue[ 44 – 46 ]. Hence, MUC21 might also protect the epithelia in the same way as some other membrane-bound mucins. During the carcinogenesis and progression of oral epithelia, MUC21 was downregulated possibly because of the dedifferentiation of squamous epithelial cells. In accordance with this, our invitro cell line experiments showed that, both overexpression and knockdown of MUC21 could not markedly affect the cell behaviors. Our results suggest that MUC21 is not a driver oncogene rather a passenger gene in OSCC. However, the extensive and deep exploration of MUC21 in OSCC and other malignancies are needed in the future in order to uncover the exact functions of MUC21 in malignant tumors. In summary, our study has meticulously analyzed the expression of MUC21 in OSCC and established that it is significantly downregulated in OSCC, relates with epithelial differentiation and correlates with more tumor aggressiveness and worse prognosis. Our results suggest that MUC21 could serve as a new marker in the prognosis of OSCC. Conclusion This study extensively explored MUC21 expression in oral squamous cell carcinoma (OSCC) by high through put dataset analysis and RT-PCR and immunohistochemistry (IHC) in paired OSCC and para-OSCC. It was confirmed that MUC21 was downregulated in OSCC. Through clinical investigation of 102 OSCC patients, it was found that MUC21 was related with more clinical aggressiveness and less survival rate. In contrary to the reported effect of MUC21 to cancer cells in vitro, our study showed that overexpression or knockdown of MUC21 posed no effect on OSCC cell lines in vitro. Our study indicates that MUC21 could serve as a new marker in the prognosis of OSCC, though it might not be a driver oncogene. Abbreviations MUC Mucins MUC21 Mucin 21 OSCC oral squamous cell carcinoma Para-OSCC paired adjacent normal tissue on OSCC patients GEO gene expression omibus TCGA the cancer genome atlas RNA-seq RNA sequencing KRT4 keratin 4 KRT13 keratin 13 CRNN Cornulin RT-PCR Revere transcription quantitative polymerase chain reaction IHC immunohistochemistry CCK-8 cell counting kit-8 RMA Robust Multichip Average GAPDH Glyceraldehyde 3-phosphate dehydrogenase DAB diaminobenzidine MOD mean optical density TNM tumor, node, metastases stage OS overall survival DFS Disease-free survival DMEM Dulbecco's Modified Eagle Medium FBS fetal bovine serum PI Propidium Iodide HTA Human Transcriptome Array CI confidence interval HR hazard ratio Declarations Ethics declarations Ethics approval and consent to participate The study received ethical approval from the Medical Ethics Committee of the Capital Medical University School of Stomatology (No. CMUSH-IRB-KJ-PJ-2018-04), and patient consent was obtained as required. Competing interests The authors have declared that no competing interest exists. Funding This research was funded by grants from the Natural Science Foundation of Beijing Municipality (Grant No. 7152067 awarded to X.W.). Author Contribution All authors have departed in Data acquisition; Quality control of data and algorithms. Xinagpu wang and Siyuan Guo have performed the bioinformatic analysis. Xuejiu Wang has conceived the study concepts, designed the study, performed data analysis and prepared the manuscript. Acknowledgements We extend our gratitude to the staff of the Pathology Department at the Capital Medical University School of Stomatology for their valuable assistance. Data availability The data that support the findings of this study are available from the corresponding author, Xuejiu wang, upon reasonable request. References Gan GL, Liu J, Chen WJ, Ye QQ, Xu Y, Wu HT, Li W. The Diverse Roles of the Mucin Gene Cluster Located on Chromosome 11p15.5 in Colorectal Cancer. Front Cell Dev Biol. 2020;8:514. Sun L, Zhang Y, Li W, Zhang J, Zhang Y. Mucin Glycans: A Target for Cancer Therapy. Molecules 2023, 28(20). Chen T, Chen Z, Lian X, Wu W, Chu L, Zhang S, Wang L. MUC 15 Promotes Osteosarcoma Cell Proliferation, Migration and Invasion through Livin, MMP-2/MMP-9 and Wnt/beta-Catenin Signal Pathway. J Cancer. 2021;12(2):467–73. Bose M, Grover P, Sanders AJ, Zhou R, Ahmad M, Shwartz S, Lala P, Nath S, Yazdanifar M, Brouwer C, et al. Overexpression of MUC1 Induces Non-Canonical TGF-beta Signaling in Pancreatic Ductal Adenocarcinoma. Front Cell Dev Biol. 2022;10:821875. Zhao A, Pan Y, Gao Y, Zhi Z, Lu H, Dong B, Zhang X, Wu M, Zhu F, Zhou S, et al. MUC1 promotes cervical squamous cell carcinoma through ERK phosphorylation-mediated regulation of ITGA2/ITGA3. BMC Cancer. 2024;24(1):559. Li S, Liu Z, Chen Q, Chen Y, Ji S. A novel fatty acid metabolism-related signature identifies MUC4 as a novel therapy target for esophageal squamous cell carcinoma. Sci Rep. 2024;14(1):12476. Schuster-Little N, Sokolovsky AD, Gentry A, Saraf A, Etzel MR, Patankar MS, Whelan RJ. Immunoaffinity-free chromatographic purification of ovarian cancer biomarker CA125 (MUC16) from blood serum enables mass spectrometry characterization. Anal Methods 2024. Dong L, Xue L, Cheng W, Tang J, Ran J, Li Y. Comprehensive survival analysis of oral squamous cell carcinoma patients undergoing initial radical surgery. BMC Oral Health. 2024;24(1):919. Tehzeeb H, Hande A, Patil S, Sonone A, Pakhale A, Chavhan A. Correlation of Clinical and Pathological TNM Staging With Histopathological Grading in Oral Squamous Cell Carcinoma. Cureus. 2024;16(5):e60912. Cheng Y, Song Z, Cheng J, Tang Z. JARID2, a novel regulatory factor, promotes cell proliferation, migration, and invasion in oral squamous cell carcinoma. BMC Cancer. 2024;24(1):793. Lan Z, Zou KL, Cui H, Zhao YY, Yu GT. Porphyromonas gingivalis suppresses oral squamous cell carcinoma progression by inhibiting MUC1 expression and remodeling the tumor microenvironment. Mol Oncol. 2024;18(5):1174–88. Itoh Y, Kamata-Sakurai M, Denda-Nagai K, Nagai S, Tsuiji M, Ishii-Schrade K, Okada K, Goto A, Fukayama M, Irimura T. Identification and expression of human epiglycanin/MUC21: a novel transmembrane mucin. Glycobiology. 2008;18(1):74–83. Fini ME, Jeong S, Gong H, Martinez-Carrasco R, Laver NMV, Hijikata M, Keicho N, Argueso P. Membrane-associated mucins of the ocular surface: New genes, new protein functions and new biological roles in human and mouse. Prog Retin Eye Res. 2020;75:100777. Chen Y, Zhang W, Zeng Y, Yang P, Li Y, Liang X, Liu K, Lin H, Dai Y, Zhou J, et al. GDNF-induced phosphorylation of MUC21 promotes pancreatic cancer perineural invasion and metastasis by activating RAC2 GTPase. Oncogene. 2024;43(34):2564–77. Bao X, Wiehe R, Dommisch H, Schaefer AS. Entamoeba gingivalis Causes Oral Inflammation and Tissue Destruction. J Dent Res. 2020;99(5):561–7. Yang M, Chen T, Liu YX, Huang L. Visualizing set relationships: EVenn's comprehensive approach to Venn diagrams. Imeta. 2024;3(3):e184. Mao L, Zhuang R, Qin L, Han Z, Huang X, Chen R, Su Y, Ge L, Yang J, Li J, et al. CCL18 overexpression predicts a worse prognosis in oral squamous cell carcinoma (OSCC). Neoplasma. 2020;67(3):700–6. Vaidya M, Dmello C, Mogre S. Utility of Keratins as Biomarkers for Human Oral Precancer and Cancer. Life (Basel) 2022, 12(3). Struckmeier AK, Eichhorn P, Agaimy A, Buchbender M, Moest T, Lutz R, Kesting M. Comparison of the 7th and revised 8th UICC editions (2020) for oral squamous cell carcinoma: How does the reclassification impact staging and survival? Virchows Arch. 2024;484(6):901–13. Subramaniam N, Clark JR, Goldstein D, de Almeida J, Abdalaty AHA, Balasubramanian D, Thankappan K, Iyer S, Batstone M, Iyer NG, et al. Geographical heterogeneity in the American Joint committee on Cancer oral cancer staging and prognostic implications. Oral Oncol. 2021;113:105122. Jin N, An Y, Tian Y, Zhang Z, He K, Chi C, Mu W, Tian J, Du Y. Multispectral fluorescence imaging of EGFR and PD-L1 for precision detection of oral squamous cell carcinoma: a preclinical and clinical study. BMC Med. 2024;22(1):342. Han Y, Peng Y, Xiong H, Zeng L, Zhang T, Xia K, Hu X, Su T. XPO1 serves as a prognostic marker involving AKT/MAPK/TGFBR1 pathway in OSCC. Cancer Med. 2024;13(16):e70076. Sheng YH, Davies JM, Wang R, Wong KY, Giri R, Yang Y, Begun J, Florin TH, Hasnain SZ, McGuckin MA. MUC1-mediated Macrophage Activation Promotes Colitis-associated Colorectal Cancer via Activating the Interleukin-6/ Signal Transducer and Activator of Transcription 3 Axis. Cell Mol Gastroenterol Hepatol 2022. Peng L, Li Y, Gu H, Xiang L, Xiong Y, Wang R, Zhou H, Wang J. Mucin 4 mutation is associated with tumor mutation burden and promotes antitumor immunity in colon cancer patients. Aging. 2021;13(6):9043–55. Abdelwhab A, Shaker O, Aggour RL. Expression of Mucin1 in saliva in oral squamous cell carcinoma and oral potentially malignant disorders (case control study). Oral Dis. 2023;29(4):1487–94. Li P, Xiao LY, Tan H. Muc-1 promotes migration and invasion of oral squamous cell carcinoma cells via PI3K-Akt signaling. Int J Clin Exp Pathol. 2015;8(9):10365–74. Zhang AM, Chi XH, Bo ZQ, Huang XF, Zhang J. MUC1 gene silencing inhibits proliferation, invasion, and migration while promoting apoptosis of oral squamous cell carcinoma cells. Biosci Rep 2019, 39(9). Abidullah M, Nahar P, Ahmed SA, Kothari H, Vakeel S. MUC4 Expression in Oral Dysplastic Epithelium and Oral Squamous Cell Carcinoma: An Immunohistochemical Study. J Int Soc Prev Community Dent. 2023;13(2):124–32. Geng XF, Du M, Han JX, Zhang M, Tang XF, Xing RD. Saliva CA125 and TPS levels in patients with oral squamous cell carcinoma. Int J Biol Markers. 2013;28(2):216–20. Wu Q, Cao R, Chen J, Xie X. Screening and identification of biomarkers associated with clinicopathological parameters and prognosis in oral squamous cell carcinoma. Exp Ther Med. 2019;18(5):3579–87. Sasahira T, Kurihara-Shimomura M, Shimomura H, Bosserhoff AK, Kirita T. Identification of oral squamous cell carcinoma markers MUC2 and SPRR1B downstream of TANGO. J Cancer Res Clin Oncol. 2021;147(6):1659–72. Liu X, Xiao Y, Xiong X, Qi X. MUC21 controls melanoma progression via regulating SLITRK5 and hedgehog signaling pathway. Cell Biol Int. 2022;46(9):1458–67. Wang L, Zhang X, Liu J, Liu Q. MUC21 induces the viability and migration of glioblastoma via the STAT3/AKT pathway. Exp Ther Med. 2022;23(5):331. Lee DH, Ahn H, Sim HI, Choi E, Choi S, Jo Y, Yun B, Song HK, Oh SJ, Denda-Nagai K, et al. A CRISPR activation screen identifies MUC-21 as critical for resistance to NK and T cell-mediated cytotoxicity. J Exp Clin Cancer Res. 2023;42(1):272. Yi Y, Kamata-Sakurai M, Denda-Nagai K, Itoh T, Okada K, Ishii-Schrade K, Iguchi A, Sugiura D, Irimura T. Mucin 21/epiglycanin modulates cell adhesion. J Biol Chem. 2010;285(28):21233–40. Tian Y, Denda-Nagai K, Tsukui T, Ishii-Schrade KB, Okada K, Nishizono Y, Matsuzaki K, Hafley M, Bresalier RS, Irimura T. Mucin 21 confers resistance to apoptosis in an O-glycosylation-dependent manner. Cell Death Discov. 2022;8(1):194. Mo BY, Li GS, Huang SN, He WY, Xie LY, Wei ZX, Su YS, Liang Y, Yang L, Ye C, et al. The underlying molecular mechanism and identification of transcription factor markers for laryngeal squamous cell carcinoma. Bioengineered. 2021;12(1):208–24. Lin S, Tian C, Li J, Liu B, Ma T, Chen K, Gong W, Wang JM, Huang J. Differential MUC22 expression by epigenetic alterations in human lung squamous cell carcinoma and adenocarcinoma. Oncol Rep 2021, 45(5). Muniyan S, Haridas D, Chugh S, Rachagani S, Lakshmanan I, Gupta S, Seshacharyulu P, Smith LM, Ponnusamy MP, Batra SK. MUC16 contributes to the metastasis of pancreatic ductal adenocarcinoma through focal adhesion mediated signaling mechanism. Genes Cancer. 2016;7(3–4):110–24. Comamala M, Pinard M, Theriault C, Matte I, Albert A, Boivin M, Beaudin J, Piche A, Rancourt C. Downregulation of cell surface CA125/MUC16 induces epithelial-to-mesenchymal transition and restores EGFR signalling in NIH:OVCAR3 ovarian carcinoma cells. Br J Cancer. 2011;104(6):989–99. Han T, Zheng H, Zhang J, Yang P, Li H, Cheng Z, Xiang D, Wang R. Downregulation of MUC15 by miR-183-5p.1 promotes liver tumor-initiating cells properties and tumorigenesis via regulating c-MET/PI3K/AKT/SOX2 axis. Cell Death Dis. 2022;13(3):200. Li X, Fang J, Tao X, Xia J, Cheng B, Wang Y. Splice site m(6)A methylation prevents binding of DGCR8 to suppress KRT4 pre-mRNA splicing in oral squamous cell carcinoma. PeerJ. 2023;11:e14824. Govindaraj PK, Kallarakkal TG, Mohd Zain R, Tilakaratne WM, Lew HL. Expression of Ki-67, Cornulin and ISG15 in non-involved mucosal surgical margins as predictive markers for relapse in oral squamous cell carcinoma (OSCC). PLoS ONE. 2021;16(12):e0261575. Matsuyama T, Ishikawa T, Mogushi K, Yoshida T, Iida S, Uetake H, Mizushima H, Tanaka H, Sugihara K. MUC12 mRNA expression is an independent marker of prognosis in stage II and stage III colorectal cancer. Int J Cancer. 2010;127(10):2292–9. Yang B, Wu A, Hu Y, Tao C, Wang JM, Lu Y, Xing R. Mucin 17 inhibits the progression of human gastric cancer by limiting inflammatory responses through a MYH9-p53-RhoA regulatory feedback loop. J Exp Clin Cancer Res. 2019;38(1):283. Wang S, Jin J, Chen J, Lou W. MUC14-Related ncRNA-mRNA Network in Breast Cancer. Genes (Basel) 2021, 12(11). Additional Declarations No competing interests reported. Supplementary Files Supplementaryfigurelists.docx supplementaryfigure1.tif supplementaryfigure2.tif supplementaryfigure3.tif supplementaryfigure4.tif supplementaryfigure5.tif supplementaryfigure6.tif supplementaryfigure7.tif Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5294516","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":369188919,"identity":"ca4b79c3-39d7-4571-90c1-680811a97359","order_by":0,"name":"Lisha Mao","email":"","orcid":"","institution":"Capital Medical University School of Stomatology","correspondingAuthor":false,"prefix":"","firstName":"Lisha","middleName":"","lastName":"Mao","suffix":""},{"id":369188920,"identity":"c452dd8e-9f89-4155-8335-280ddef26cce","order_by":1,"name":"Xiangpu Wang","email":"","orcid":"","institution":"National Clinical Research Center for Oral Disease, the Fourth Military Medical University","correspondingAuthor":false,"prefix":"","firstName":"Xiangpu","middleName":"","lastName":"Wang","suffix":""},{"id":369188921,"identity":"7f50224c-b8ca-40bd-a85f-b5645acd62f3","order_by":2,"name":"Anna Zou","email":"","orcid":"","institution":"Capital Medical University School of Stomatology","correspondingAuthor":false,"prefix":"","firstName":"Anna","middleName":"","lastName":"Zou","suffix":""},{"id":369188922,"identity":"a7f5868e-7a71-4f4c-b843-f7c396b1b3d1","order_by":3,"name":"Siyuan Guo","email":"","orcid":"","institution":"Capital Medical University School of Stomatology","correspondingAuthor":false,"prefix":"","firstName":"Siyuan","middleName":"","lastName":"Guo","suffix":""},{"id":369188923,"identity":"85f2d278-806c-4456-a402-36477f55aa60","order_by":4,"name":"Sijia Chen","email":"","orcid":"","institution":"Capital Medical University School of Stomatology","correspondingAuthor":false,"prefix":"","firstName":"Sijia","middleName":"","lastName":"Chen","suffix":""},{"id":369188924,"identity":"530a5365-111d-4bb7-bdc5-62245b2dec8a","order_by":5,"name":"Ying Su","email":"","orcid":"","institution":"Capital Medical University School of Stomatology","correspondingAuthor":false,"prefix":"","firstName":"Ying","middleName":"","lastName":"Su","suffix":""},{"id":369188925,"identity":"d08c95c0-f1a8-497c-850f-57e4a0b944f4","order_by":6,"name":"Lihua Ge","email":"","orcid":"","institution":"Capital Medical University School of Stomatology","correspondingAuthor":false,"prefix":"","firstName":"Lihua","middleName":"","lastName":"Ge","suffix":""},{"id":369188926,"identity":"15ee0579-a285-486b-b2e9-2eba1b512cc2","order_by":7,"name":"Jing Yang","email":"","orcid":"","institution":"Capital Medical University School of Stomatology","correspondingAuthor":false,"prefix":"","firstName":"Jing","middleName":"","lastName":"Yang","suffix":""},{"id":369188927,"identity":"0e8e4b3a-902d-4a8c-8801-cbfaa98ab441","order_by":8,"name":"Xuejiu Wang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA00lEQVRIiWNgGAWjYBADZjYG5gMHPlSQpoUt8eCMM6RZxGN8mLeFCHUGx88efs3bZsPOJ5Hz4QBvA4M8v9gBAlrO5KVZzmxLY2aTyN1wQHIHg+HM2Qn4tZgdyDEz+Nh2GKLF8AxDgsFtQlrOvzEzSGz7D9SS8+BAYhsxWm7kGD/42HYApIXhwEFitNjfeGPGOONcMjMbzzODgw1nJAj7RbI/x/gzT5ldsnx78uPPfyps5PmlCWgBAjYJIJEM5UgQVA4CzB+AhB1RSkfBKBgFo2BkAgAmHUXYHrnZNgAAAABJRU5ErkJggg==","orcid":"","institution":"Capital Medical University School of Stomatology","correspondingAuthor":true,"prefix":"","firstName":"Xuejiu","middleName":"","lastName":"Wang","suffix":""}],"badges":[],"createdAt":"2024-10-19 12:23:17","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5294516/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5294516/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":68157503,"identity":"b13afd30-44da-4642-a846-8caed1763a85","added_by":"auto","created_at":"2024-11-04 08:21:44","extension":"jpeg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":369229,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eMUC21 Expression by analyzing high-throughput dataset including Affymetrix GeneChip\u003c/em\u003e\u003csup\u003e\u003cem\u003e®\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e Human Transcriptome Array 2.0(HTA), GSE34105 from GEO and TCGA RNAseq data. a-e, the heatmaps of hierarchical clustering and volcano plots of differential gene expressions revealed by HTA based on 10 paired OSCC and adjacent normal oral tissue; GSE34105 based on 62 OSCC and 16 normal oral tissue; TCGA base on 266 OSCC and 19 normal oral tissue. Genes with a fold change \u0026gt;2 and adj-p-value of \u0026lt;0.05 were highlighted. g and h, the up and down regulated genes in the three datasets were intersected and it was showed that 73 was up and 102 were down regulated in the intersection which comprised only MUC15 and MUC21 from Mucin family. i, relative expression level (the median of the three datasets) comparison showed that MUC21 was more down regulated than MUC15, the chart was created from Excel (Microsoft® for Excel). Abbreviation: OSCC, oral squamous cell carcinoma.\u003c/em\u003e\u003c/p\u003e","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-5294516/v1/f873b91798068816eaf79a30.jpeg"},{"id":68156935,"identity":"aec8df90-50cf-4949-94fd-25fc09d949ef","added_by":"auto","created_at":"2024-11-04 08:13:44","extension":"jpeg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":518837,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eMUC21 co expression gene analysis by cor.test of R language in the TCGA. a-k, the correlation analysis of MUC21 to SPRR3, MAL, TMPRSS11B, CAPN14, FUT6, CEACAM7, CRNN, DYNAP, IL36A, KRT13, KRT4. R value was set at more than 0.7, and P value was set less than 0.001. l, Top five negatively or positively correlated genes were showed in circos map.\u003c/em\u003e\u003c/p\u003e","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-5294516/v1/c37ea3056f14ea9bdd95eb60.jpeg"},{"id":68157504,"identity":"cb5312c1-69b8-45b2-a1d4-cfabd9d0d1e8","added_by":"auto","created_at":"2024-11-04 08:21:44","extension":"jpeg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":272824,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eQuantitative RT-PCR analysis of MUC21, KRT4, KRT13, and CRNN in OSCC and para-OSCC. a- d showed that MUC21, KRT4, KRT13 and CRNN were down regulated in OSCC than para-OSCC (p \u0026lt; 0.0001), the expression levels were normalized against GAPDH. i, Spearman correlation analysis showed that MUC21was related with KRT4, KRT13 and CRNN at mRNA level.\u003c/em\u003e\u003c/p\u003e","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-5294516/v1/c39f68592fbd237ae1e5b809.jpeg"},{"id":68156946,"identity":"1a3113d1-0d34-4880-b229-5e26313296d9","added_by":"auto","created_at":"2024-11-04 08:13:44","extension":"jpeg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":478246,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eMUC21 expression analysis in OSCC and para-OSCC via immunohistochemistry (IHC) and its relation with critical clinical characters. a and b; c and d; e and f displayed matched para-OSCC and OSCC. b, d, and f represented well, moderate, and poor differentiation of OSCC, respectively. Scale bar = 100 μm. g, MUC21 expression between OSCC and para-OSCC in 102 paired patient samples was quantified by mean optical density (MOD) values. MUC21 decreased significantly in OSCC (P \u0026lt; 0.0001). Box plots represent the median, 25th, and 75th percentiles of the data. h, decreased MUC21 expression level was related with cervical lymphatic metastasis and OSCC differentiation. “pN0” means no lymphatic metastasis, “pN1-PN3” referred to different degrees of lymphatic metastasis; “well+moderate” and “poor” referred to different degrees of differentiation.\u003c/em\u003e\u003c/p\u003e","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-5294516/v1/098667f459eadb317ad34b87.jpeg"},{"id":68156945,"identity":"a796649c-74f4-423c-af96-6d5db032b773","added_by":"auto","created_at":"2024-11-04 08:13:44","extension":"jpeg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":239743,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eKaplan–Meier survival analyses for postoperative OSCC patients based on MUC21 expression and other clinicopathological variables. a,b, Overall Survival (OS) and disease-free survival (DFS)with low MUC21 expression were significantly shorter than those with high MUC21 expression (P = 0.012 for OS, P \u0026lt; 0.0001for DFS). c,d, OS and DFS for patients with early disease stages (TNM I+II) were significantly higher than those under advanced stages (TNM III+IV) (P \u0026lt; 0.0001for OS, \u0026nbsp;P = 0.001for DFS). e,f OS and DFS of patients without lymphatic metastasis (N0) outrange those with metastasis (N1-N3) (P = 0.001 for OS, P = 0.018 for DFS ). g, h, Patients with well or moderately differentiated tumors had better OS and DFS compared to those with poorly differentiated tumors (P = 0.002 for OS, P = 0.008 for DFS).\u003c/em\u003e\u003c/p\u003e","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-5294516/v1/6fc5cdfd06bc49d5a74405bd.jpeg"},{"id":68158162,"identity":"eadacd74-b5fd-477c-99c4-99fbeb755e43","added_by":"auto","created_at":"2024-11-04 08:29:44","extension":"jpeg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":665925,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eIn vitro cell lines experiment post overexpression and knockdown of MUC21. a, MUC21 was significantly overexpressed in SCC15 and HSC-3. b, c MUC21 was greatly decreased in SCC15 and HSC-3. d, e, CCK-8 assay on SCC15 and HSC-3 post MUC21 manipulation. f, g, Annexin V-FITC/Propidium Iodide (PI) staining results of SCC15 and HSC-3 post MUC21 manipulation h, wound-healing assay conducted at 24 hours post-MUC21 manipulation in SCC25 and HSC-3 cells. i, Transwell assay of SCC15 and HSC-3 post MUC21 manipulation. Statistical significance is denoted by **p\u0026lt;0.01.\u003c/em\u003e\u003c/p\u003e","description":"","filename":"floatimage6.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-5294516/v1/6456eed3079c90046235f7f6.jpeg"},{"id":87487575,"identity":"b1eb5708-17e4-4d4f-8404-80652ef13a31","added_by":"auto","created_at":"2025-07-24 11:16:50","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4053967,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5294516/v1/03bc2e67-788d-4f15-afc3-f9286c51ddc0.pdf"},{"id":68156934,"identity":"4d0442c1-d6e1-491c-b4d7-90017dcfeaa6","added_by":"auto","created_at":"2024-11-04 08:13:44","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":13365,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementaryfigurelists.docx","url":"https://assets-eu.researchsquare.com/files/rs-5294516/v1/fa31e3d8e1f6ef29d0de57a4.docx"},{"id":68156938,"identity":"16edf136-40f3-43fc-9618-f68357751357","added_by":"auto","created_at":"2024-11-04 08:13:44","extension":"tif","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":3019494,"visible":true,"origin":"","legend":"","description":"","filename":"supplementaryfigure1.tif","url":"https://assets-eu.researchsquare.com/files/rs-5294516/v1/7360db62b20928fe9cca9c49.tif"},{"id":68157508,"identity":"ed563eb6-6e79-4164-b31a-036b4d8ea65c","added_by":"auto","created_at":"2024-11-04 08:21:44","extension":"tif","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":3019494,"visible":true,"origin":"","legend":"","description":"","filename":"supplementaryfigure2.tif","url":"https://assets-eu.researchsquare.com/files/rs-5294516/v1/1f46e230363d5ab697124b31.tif"},{"id":68156940,"identity":"e767e852-c691-455b-be81-3f3f878149b4","added_by":"auto","created_at":"2024-11-04 08:13:44","extension":"tif","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":3019494,"visible":true,"origin":"","legend":"","description":"","filename":"supplementaryfigure3.tif","url":"https://assets-eu.researchsquare.com/files/rs-5294516/v1/683a02fd21bc057130d701e7.tif"},{"id":68156942,"identity":"38a282ff-37f4-446c-a469-54469d4ff12d","added_by":"auto","created_at":"2024-11-04 08:13:44","extension":"tif","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":8470914,"visible":true,"origin":"","legend":"","description":"","filename":"supplementaryfigure4.tif","url":"https://assets-eu.researchsquare.com/files/rs-5294516/v1/39bbe5153c3ad6a5642e5083.tif"},{"id":68157507,"identity":"da269d9c-6663-44ef-9e2c-0241a68925dd","added_by":"auto","created_at":"2024-11-04 08:21:44","extension":"tif","order_by":6,"title":"","display":"","copyAsset":false,"role":"supplement","size":8470914,"visible":true,"origin":"","legend":"","description":"","filename":"supplementaryfigure5.tif","url":"https://assets-eu.researchsquare.com/files/rs-5294516/v1/a6df9b3a04dc3835fc37ab36.tif"},{"id":68157506,"identity":"c848d707-b098-447f-979e-25d172a6bcb7","added_by":"auto","created_at":"2024-11-04 08:21:44","extension":"tif","order_by":7,"title":"","display":"","copyAsset":false,"role":"supplement","size":5983024,"visible":true,"origin":"","legend":"","description":"","filename":"supplementaryfigure6.tif","url":"https://assets-eu.researchsquare.com/files/rs-5294516/v1/3de24b0149f7c9ba84df343c.tif"},{"id":68156944,"identity":"607ec5c2-269b-4e68-a902-2eb185238ea8","added_by":"auto","created_at":"2024-11-04 08:13:44","extension":"tif","order_by":8,"title":"","display":"","copyAsset":false,"role":"supplement","size":5983024,"visible":true,"origin":"","legend":"","description":"","filename":"supplementaryfigure7.tif","url":"https://assets-eu.researchsquare.com/files/rs-5294516/v1/7e80fa5d9a0667311d93d1cd.tif"}],"financialInterests":"No competing interests reported.","formattedTitle":"MUC 21 is downregulated in oral squamous cell carcinoma and associated with poor prognosis","fulltext":[{"header":"Introduction","content":"\u003cp\u003eHuman mucins are categorized into membrane-bound types (MUC1, MUC3A, MUC3B, MUC4, MUC12, MUC13, MUC14, MUC15, MUC16, MUC17, MUC20, MUC21, MUC22) and secreted forms (MUC2, MUC5AC, MUC5B, MUC6, MUC7, MUC8, MUC9, MUC19), based on their structural properties [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Physiologically, mucins are crucial for mucosal lubrication and protection, epithelial renewal, differentiation, and cellular signaling [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. In oncology, mucins significantly influence tumor genesis and progression across various cancers. Abnormal or deregulated mucin expression is associated with enhanced cancer cell proliferation, differentiation, migration, and invasion[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. For instances, MUC1 is overexpressed in pancreatic ductal adenocarcinoma and cervical squamous cell carcinoma and promotes cancer cell proliferation and metastasis [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. MUC4 plays a vital role in esophageal squamous cell carcinoma cell proliferation and invasion[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e] and MUC16 is overexpressed in epithelial tumors like ovarian cancer and lung adenocarcinoma, facilitates increased tumor cell migration[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e] .\u003c/p\u003e \u003cp\u003eOral squamous cell carcinoma (OSCC) is associated with significant morbidity and a high mortality rate. Despite advances in surgical techniques, radiotherapy, and chemotherapy, the 5-year survival rate for OSCC remains around 60%[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. This is partly due to the absence of reliable prognostic indicators that could help clinicians devise effective primary treatment strategies, as the traditional TNM staging system has shown limited utility in this context [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. The molecular events underlying the pathogenesis and progression of OSCC contribute to its heterogeneity and are potential sources of diagnostic markers and therapeutic targets [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Recent studies have identified several mucin members, such as MUC1 and MUC4, as being implicated in OSCC. These mucins are associated with more aggressive tumor behavior and poorer clinical outcomes[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e] .\u003c/p\u003e \u003cp\u003eMUC21 was first identified in 2008 as the human equivalent of mouse epiglycanin, a mucin expressed in mammary carcinoma TA3-Ha cells but absent in TA3-St cells [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. The MUC21 protein is characterized by an N-terminal signal sequence, an extracellular mucin domain containing dozens of tandem repeats 15-amino acid each, a stem domain, a transmembrane domain, and a C-terminal cytoplasmic tail [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Increased expression of MUC21 has been observed to contribute to the anti-adhesion effects of cancer cells in vitro. Variations in MUC21 expression have been noted in several types of malignant tumors[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. However, its role in OSCC has not yet been explored. Previous studies have documented overexpression of MUC21 in conditions like gingival inflammation [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. The aim of this study is to delve deeper into the potential involvement of MUC21 in OSCC.\u003c/p\u003e \u003cp\u003eIn this study, we firstly analyzed cDNA microarray data from our own research combined with additional datasets downloaded from the GEO and TCGA databases and identified a pronounced downregulation of MUC21 in OSCC and a few of its co-expressed genes. Secondly, we further confirmed the expression changes of MUC21 and some of its epithelial differentiation related co-expressed genes in OSCC by RT-PCR analyses. Thirdly, we examined the correlation between the expression profiles of MUC21 and various clinical characteristics and outcomes. Lastly, we investigated the OSCC cell lines changes following the overexpression and knockdown of MUC21. Our findings suggest that MUC21 could serve as a novel prognostic marker for OSCC.\u003c/p\u003e "},{"header":"Patients and methods","content":"\u003ch3\u003e1. Patients and tissue samples\u003c/h3\u003e\u003cp\u003eIn this research, 10 paired samples of OSCC and adjacent normal mucosa (para-OSCC) underwent microarray analysis. Subsequently, 30 additional paired samples were analyzed using RT-PCR to validate some genes screened out by the microarray and other two gene dataset downloaded from Geo and TCGA. To explore the relationship between MUC21 expression and clinical pathological parameters, a cohort of 102 OSCC patients, who had been under regular follow-up, was included in the immunohistochemistry (IHC) analysis. Tissues from OSCC and para-OSCC were collected from patients during surgical procedures and were histologically verified via frozen sections before proceeding with microarray analysis, quantitative RT-PCR assays, and immunohistochemical studies. The study received ethical approval from the Medical Ethics Committee of the Capital Medical University School of Stomatology (No. CMUSH-IRB-KJ-PJ-2018-04), and patient consent was obtained as required.\u003c/p\u003e \u003cp\u003e \u003cb\u003e2. Differential expressed genes’ analysis between OSCC and normal oral tissue based on our microarray data and datasets downloaded from GEO and TCGA\u003c/b\u003e \u003c/p\u003e \u003cp\u003eTo perform microarray hybridization, total RNA was extracted from samples of various groups. RNA labeling and microarray hybridization were carried out following the protocols outlined in the Affymetrix Expression Analysis Technical Manual (Biotechnology Company, Shanghai, China). The microarrays were scanned using the GeneChip Scanner 3000 system (Affymetrix, Santa Clara, CA, USA) with the default settings on Command Console software 3.1 (Affymetrix). In addition, GSE34105 was downloaded from GEO data base (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE34105\u003c/span\u003e\u003cspan address=\"https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE34105\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), which comprised 62 OSCC and 16 normal oral tissue. Moreover, RNAseq data of 266 OSCC and 19 normal oral tissue was downloaded from the website of National Cancer Institute (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://portal.gdc.cancer.gov\u003c/span\u003e\u003cspan address=\"https://portal.gdc.cancer.gov\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). The background correction and normalization of the three datasets raw data were performed using the Robust Multichip Average (RMA) algorithm. The Limma software package in the R programming language was utilized to identify differentially expressed genes, considering a fold change of \u0026gt; 2 and an adj-p-value of \u0026lt; 0.05 as statistically significant. Visualizations included a volcano plot created with ggplot2 (version 3.1.0) and a heatmap generated using the pheatmap package (version 1.0.12) in R. Furthermore, intersections of differential expressed genes (up-regulated and down-regulated) revealed by the three datasets were created by on the line tool Evenn. [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]\u003c/p\u003e\u003ch2\u003e3. Co expression analysis of MUC21\u003c/h2\u003e\u003cp\u003eTo identify genes related with MUC21, cor.test of R language was run in the TCGA based dataset to carry out Pearson correlation analysis of MUC21 and other genes. Genes with R value more than 0.7 and P value less than 0.001 were sorted out. R language package ggplot2, ggpubr and ggExtra were used to create the correlation analysi maps; circlize and corrplot were used to generate the circos map.\u003c/p\u003e\u003ch3\u003e4. RNA extraction and quantitative RT-PCR (real time PCR)\u003c/h3\u003e\u003cp\u003eTissue samples were rapidly dip-frozen in liquid nitrogen and homogenized using an MX-F Vortex mixer (SCILOGEX, LLC, USA) before immediately preceding to RNA extraction. Total RNA was extracted from the homogenized frozen tissue using Trizol reagent (Invitrogen), adhering to the manufacturer's protocol. Subsequently, 500 ng of RNA was reverse-transcribed into cDNA utilizing HiScript II Reverse Transcriptase (Vazyme, Nanjing, China). For quantitative real-time PCR (Q-RT-PCR), specific primers were used as follows: \u003cem\u003eMUC21\u003c/em\u003e forward: GGGGCTCTTTGCTGGGCTCTT; \u003cem\u003eMUC21\u003c/em\u003e reverse: CCGCTGTTCCTCCCGCTCAT. \u003cem\u003eKRT4\u003c/em\u003e forward: CGCGAACAGATCAAGCTCCT; \u003cem\u003eKRT4\u003c/em\u003e reverse: GGGGCTCAAGGTTTTTGCTG. \u003cem\u003eKRT13\u003c/em\u003e forward: CCCCAGGCATTGACCTGAC; \u003cem\u003eKRT13\u003c/em\u003e reverse: GTGTTGGTAGACACCTCCTTG. \u003cem\u003eCRNN\u003c/em\u003e forward: ATGCCTCAGTTACTGCAAAACA; \u003cem\u003eCRNN\u003c/em\u003e reverse: TCACATCGGCAAACTCTTGCT. \u003cem\u003eGAPDH\u003c/em\u003e forward: TCAAGAAGGTGGTGAAGCAGG; \u003cem\u003eGAPDH\u003c/em\u003e reverse: GCGTCAAAGGTGGAGGAGTG. The data were expressed as mean ± standard deviation (S.D.). GAPDH was utilized as the internal control. All assays were conducted in triplicate using the Roche LightCycler 96 System. Relative gene expression levels were calculated using the 2–∆∆CT method.\u003c/p\u003e\u003ch3\u003e5. Immunohistochemistry and semi-quantification of the results\u003c/h3\u003e\u003cp\u003eFor immunohistochemical analysis (IHC), 4 µm-thick paraffin sections of tissue samples were prepared. The IHC procedure followed previously established protocols [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Initially, sections were deparaffinized and rehydrated. Endogenous peroxidase activity was quenched with a 3% hydrogen peroxide solution. Following antigen retrieval, sections were blocked with 10% normal serum and then incubated with either anti-MUC21 antibody (NBP2-31023; Polyclonal; 1:200; NOVUS Biologicals, Littleton, CO, USA) for 2 hours at 37°C. This was followed by incubation with a secondary antibody, and color development was achieved using horseradish peroxidase enzyme and diaminobenzidine (DAB) chromogen reagent. Positive immunostaining was identified by cytoplasmic and/or membrane immunoreactivity. The intensities of the immunohistochemical reactions were evaluated under a light microscope (BX-71; Olympus, Japan) by three independent trained observers who were blinded to the subjects’ clinical information. Quantification of MUC21 expression levels was conducted using a computerized image analysis system (Image-Pro Plus V6.0, Media Cybernetics Inc, Bethesda, MD, USA). Five images at low-power magnification (×200) were captured randomly from each slide using a digital camera (DP72; Olympus, Japan), focusing on areas containing squamous epithelial carcinoma cells or normal squamous epithelial cells. Staining intensity was measured by mean optical density (MOD), corresponding to the positive staining intensity of MUC21. Expression levels were classified into high and low expression groups based on the median MOD value.\u003c/p\u003e\u003ch3\u003e6. survival analysis of MUC21 expression and other Key clinical pathological factors\u003c/h3\u003e\u003cp\u003eClinicopathological data, including gender, age, tumor (T) classification, node (N) classification, and the overall tumor, node, metastases (TNM) stage, were extracted from clinical records and pathology reports. The TNM classification was based on the 7th edition of the American Joint Committee on Cancer Staging System for oral cancer. During the follow-up period, overall survival (OS) was measured from the date of surgery until the date of the last follow-up examination or the patient's death. Disease-free survival (DFS) was defined as the interval between the surgery and the occurrence of disease relapse, disease-related death, or other conditions. The clinicopathological variables, including the expression of MUC21, were evaluated in the analysis of survival (both OS and DFS) using the Kaplan-Meier method, providing a statistical approach to estimate the survival probability over time, taking into account various patient and disease characteristics.\u003c/p\u003e\u003ch3\u003e7. Cell culture, lentivirus and siRNA transfection in OSCC cell lines\u003c/h3\u003e\u003cp\u003eHuman OSCC cell lines SCC15 and HSC-3 were acquired from the American Type Culture Collection (ATCC, USA). These cells were cultured in Dulbecco's Modified Eagle Medium (DMEM, Gibco, USA). The culture medium was supplemented with 10% fetal bovine serum (FBS, Gibco, USA), 100 IU/mL penicillin, and 100 µg/mL streptomycin (Solarbio, China). In order to overexpress MUC21 in OSCC cell, LV-MUC21 lentivirus (NM_001010909; GeneChem, Shanghai China) was transfected into SCC15 and HSC-3. To achieve knockdown of MUC21 in OSCC cells, three siRNA sequences were designed and synthesized (GeneChem, Shanghai China) targeting different regions of the human MUC21 gene sequence, The targeted sequences of these siRNAs were as follows: MUC21-RNAi-1: CGTGGGAAATCTTCCTCATCA; MUC21-RNAi-2: GTTTGGTCTACTATTGCATTT; MUC21-RNAi-3: GCTTTGTTTGAGATCCTGAAA.The transfection of siRNAs into OSCC cells was conducted using Lipofectamine 3000 reagent (Invitrogen, USA), following the manufacturer's protocol.\u003c/p\u003e\u003ch2\u003e8. Cell proliferation, wound healing, transwell cell invasion and apoptosis assays\u003c/h2\u003e\u003cp\u003eCell proliferation was assessed using a Cell Counting Kit-8 (CCK-8) (Solarbio, China) following the manufacturer's instructions. Briefly, 3,000 OSCC cells were seeded into each well of a 96-well plate and incubated for three days. At designated time points, 10 µL of CCK-8 solution was added to each well and incubated at 37°C for 2 hours. Absorbance was then measured at 450 nm. An in vitro wound healing assay was employed to evaluate cell motility. Briefly, transfected OSCC cells (1 × 10\u003csup\u003e5\u003c/sup\u003e cells/well) were seeded into 6-well plates. Upon reaching 90% confluence, wounds were created by dragging a 10 µl pipette tip across the well from one end to the other. The cells were then cultured for up to 24 hours. Wound closure was monitored under 100X magnification, and cell migration rates were calculated by comparing images taken at 0 and 24 hours. Cell invasion was assessed using Transwell chambers (Corning, USA) equipped with 8-µm-pore polycarbonate filters. OSCC cells (2 × 10\u003csup\u003e5\u003c/sup\u003e cells/ml) were suspended in DMEM supplemented with 10% FBS. Subsequently, 200 µl of this suspension was placed in the upper chamber, and 700 µl of DMEM supplemented with 10% FBS was added to the lower chamber. Following a 24-hour incubation period at 37°C with 5% CO2, cells that had migrated through the polycarbonate membrane were fixed with 4% formaldehyde for 10 minutes and subsequently with 100% methanol for 20 minutes. The fixed cells were then stained with crystal violet for 15 minutes. Cells remaining on the upper surface of the membrane were removed using a cotton swab. Six random microscopic fields at 100x magnification were photographed and analyzed for cell count. The proportion of OSCC cells undergoing early and late apoptosis was assessed using Annexin V-FITC/Propidium Iodide (PI) staining, following the protocol provided by the kit manufacturer (4A Biotech, China). Cells stained with Annexin V+/PI- were categorized as early apoptotic, while those stained with Annexin V+/PI + were identified as late apoptotic. All experiments were conducted in triplicate.\u003c/p\u003e\u003ch2\u003e9. Statistical analysis\u003c/h2\u003e\u003cp\u003eIn this study, statistical analyses were performed using the SPSS 20.0 system (IBM SPSS Statistics for Windows, Version 22.0, Armonk, NY, USA) and GraphPad Prism (version 8, San Diego, CA, USA). Chi-square test, Wilcoxon Signed-Rank Test, Spearman rank correlation test, log-rank test, univariate and multivariate analyses were used respectively. A p-value of less than 0.05 or 0.01 was considered to indicate statistical significance.\u003c/p\u003e"},{"header":"Result","content":"\u003ch3\u003e1. MUC21 Expression decreased in OSCC and was related with KRT4, KRT13 and CRNN\u003c/h3\u003e\u003cp\u003eThe microarray analysis on ten paired samples of OSCC and para-OSCC revealed a significant downregulation of MUC21 in OSCC tissues. The same result was also found in GSE34105 and the dataset from TCGA. (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Co-expression analysis of MUC21 with other genes revealed that 11 genes including KRT4, KRT13 and CRNN were closely related with MUC21 in expression levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Differentiation-specific genes, keratin4/13 for non-keratinizing epithelia and keratin1/10 for keratinizing epithelia, are known to be expressed in pairs within the oral squamous cell epithelium [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Besides, CRNN, also known as Cornulin, is related to the late epidermal differentiation. To further verify this finding, MUC21, KRT4, KRT13 and CRNN expression was assessed in additional 30 paired samples using RT-PCR analysis. The results confirmed that both MUC21 and KRT4, KRT13, CRNN were downregulated in OSCC tissues. (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). The Spearman rank correlation test showed that the expressions of MUC21, KRT4, KRT13 and CRNN were related. (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ee).\u003c/p\u003e\u003ch2\u003e2. Decreased MUC21 Expression was associated with more clinical aggressiveness in OSCC\u003c/h2\u003e\u003cp\u003eThe immunohistochemistry (IHC) staining results of MUC21 in 102 OSCC patients showed that, in normal oral squamous epithelium, MUC21 was predominantly expressed in the stratum granulosum, where it appeared as chunky staining on the cell membrane and cytoplasm (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea, c, e). Conversely, in cancerous tissues, MUC21 expression was reduced and the reduction was correlated with different degrees of tumor differentiation (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eb, d, f). and MUC21 was greatly downregulated in OSCC (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eg). The associations between MUC21 expression and the clinicopathologic characteristics of 102 patients with OSCC were detailed in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e. Analysis using the Chi-square test revealed significant associations between low MUC21 expression and several adverse clinicopathologic features. Specifically, the presence of pathological lymph node metastasis was more frequent in the low MUC21 expression group compared to the high expression group (\u003cem\u003eP\u003c/em\u003e = 0.029). Similarly, poor tumor differentiation was significantly associated with low MUC21 expression (\u003cem\u003eP\u003c/em\u003e = 0.01).\u003c/p\u003e\u003ch2\u003e3. Decreased MUC21 Expression was a prognostic factor for worse OS and DFS in OSCC\u003c/h2\u003e\u003cp\u003eKaplan-Meier survival analysis, supplemented by the log-rank test, was employed to assess the differences in OS and DFS among patients with OSCC based on MUC21 expression levels. The results indicated that patients in the low MUC21 expression group had significantly lower OS and DFS rates compared to those in the high expression group (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e). Similarly, reduced survival rates were also observed in patients with advanced TNM stages, presence of lymph node metastasis, and poor tumor differentiation (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e). Further statistical analysis using Cox proportional hazards regression models in both univariate and multivariate contexts confirmed the significance of MUC21 expression as a prognostic indicator. In the univariate analysis, low MUC21 expression was associated with a negative impact on OS (\u003cem\u003ep\u003c/em\u003e = 0.038, Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) and was even more strongly correlated with reduced DFS (\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001, Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e \u003c/p\u003e\u003cdiv class=\"gridtable\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c9\" colnum=\"9\"\u003e\u003c/div\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eUnivariate and Multivariate Analysis of Overall Survival in OSCC\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e\u003ccolgroup cols=\"9\"\u003e\u003c/colgroup\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVariable\u003c/p\u003e \u003c/th\u003e\u003cth align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eNo. of Patients(%)\u003c/p\u003e \u003c/th\u003e\u003cth align=\"left\" colspan=\"3\" nameend=\"c6\" namest=\"c4\"\u003e \u003cp\u003eUnivariate Analysis\u003c/p\u003e \u003c/th\u003e\u003cth align=\"left\" colspan=\"3\" nameend=\"c9\" namest=\"c7\"\u003e \u003cp\u003eMultivariate Analysis\u003c/p\u003e \u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAlive\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDead\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eHR\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e95%CI\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eP\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eHR\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e95%CI\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eP\u003c/p\u003e \u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eAge, y\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u0026lt; 60\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e41(56.2)\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e10(34.5)\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.090\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e≥60\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e32(43.8)\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e19(65.5)\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.952\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.900-4.232\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eGender\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e26(35.6)\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e15(51.7)\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.117\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMale\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e47(64.4)\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e14(48.3)\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.559\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.269–1.158\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eP- T classification\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eT1 or T2\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e69(94.5)\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e22(75.9)\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.019\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.071\u003c/p\u003e \u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eT3 or T4\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4(5.5)\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e7(24.1)\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2.797\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.186–6.596\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eP-lymph node metastasis\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNegative (pN0)\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e50(68.5)\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3(10.3)\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.003\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.046\u003c/p\u003e \u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePositive (pN1-pN3)\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e23(31.5)\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e26(89.7)\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3.467\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.533–7.839\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.365\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.136–0.982\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eTNM tumor stage\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eI or II\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e48(65.8)\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3(10.3)\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u0026lt;0.001\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e\u0026lt;0.001\u003c/p\u003e \u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIII or IV\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e25(34.2)\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e26(89.7)\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e11.402\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e3.444–37.754\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e10.016\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e2.993–33.519\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eTumor differentiation\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWell or Moderate\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e64(87.7)\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e18(62.1)\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.027\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.054\u003c/p\u003e \u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePoor\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e9(12.3)\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e11(37.9)\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3.259\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.500-7.079\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eMUC21 expression\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHigh\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e43(58.9)\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e8(27.6)\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.016\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e2.415\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e1.05–5.554\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.038\u003c/p\u003e \u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLow\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e30(41.1)\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e21(72.4)\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2.716\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.201–6.143\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/table\u003e\u003c/div\u003e\u003cp\u003eTable\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e: \u003cem\u003ethe impact of clinical pathological factors along with MUC21 expression on the overall survival (OS)of 102 patients with oral squamous cell carcinoma (OSCC) was evaluated using Cox proportional hazards regression models. The univariate analysis identified tumor classification, pathologic lymph node metastasis, advanced TNM stage, poor tumor differentiation, and low MUC21 expression as significant negative prognostic factors. Subsequent multivariate analysis further confirmed pathologic lymph node metastasis, advanced TNM stage, and low MUC21 expression as independently significant negative prognostic factors for OS. Abbreviations: CI, confidence interval; HR, hazard ratio; OSCC, oral squamous cell carcinoma; P, pathological.\u003c/em\u003e\u003c/p\u003e\u003cp\u003e \u003c/p\u003e\u003cdiv class=\"gridtable\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c9\" colnum=\"9\"\u003e\u003c/div\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eUnivariate and Multivariate Analysis of Disease-Free Survival in OSCC\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e\u003ccolgroup cols=\"9\"\u003e\u003c/colgroup\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVariable\u003c/p\u003e \u003c/th\u003e\u003cth align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eNo. of Patients(%)\u003c/p\u003e \u003c/th\u003e\u003cth align=\"left\" colspan=\"3\" nameend=\"c6\" namest=\"c4\"\u003e \u003cp\u003eUnivariate Analysis\u003c/p\u003e \u003c/th\u003e\u003cth align=\"left\" colspan=\"3\" nameend=\"c9\" namest=\"c7\"\u003e \u003cp\u003eMultivariate Analysis\u003c/p\u003e \u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDisease-F\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDisease\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eHR\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e95%CI\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eP\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eHR\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e95%CI\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eP\u003c/p\u003e \u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eAge, y\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u0026lt; 60\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e34(55.7)\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e17(41.5)\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.155\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u0026gt;=60\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e27(44.3)\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e24(58.5)\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.571\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.843–2.929\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eGender\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e23(37.7)\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e18(43.9)\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.109\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.053\u003c/p\u003e \u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMale\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e38(62.3)\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e23(56.1)\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.438\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.236–0.813\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eP-T classification\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eT1 or T2\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e57(93.4)\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e34(82.9)\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.051\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eT3 or T4\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4(6.6)\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e7(17.1)\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2.256\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.996–5.109\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eP- lymph node metastasis\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNegative (pN0)\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e38(62.3)\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e16(39.0)\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.022\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.394\u003c/p\u003e \u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePositive (pN1-pN3)\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e23(37.7)\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e25(61.0)\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2.082\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.110–3.905\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eTNM tumor stage\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eI or II\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e38(62.3)\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e13(31.7)\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.002\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.008\u003c/p\u003e \u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIII or IV\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e23(37.7)\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e28(68.3)\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2.801\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.448–5.419\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e2.445\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e1.259–4.747\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eTumor differentiation\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWell or Moderate\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e54(88.5)\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e28(68.3)\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.011\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.386\u003c/p\u003e \u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePoor\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e7(11.5)\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e13(31.7)\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2.353\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.216–4.556\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eMUC21 expression\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHigh\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e43(70.5)\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e8(19.5)\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u0026lt;0.001\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e\u0026lt;0.001\u003c/p\u003e \u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLow\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e18(29.5)\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e33(80.5)\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e5.740\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2.644–12.462\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e5..311\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e2.439–11.567\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/table\u003e\u003c/div\u003e\u003cp\u003e \u003cstrong\u003eTable\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e\u003c/strong\u003e \u003c/p\u003e\u003cp\u003e \u003cem\u003ethe impact of clinical pathological factors along with MUC21 expression on the disease-free survival (\u003c/em\u003e \u003c/p\u003e\u003cp\u003e \u003cem\u003eDFS) of 102 patients with oral squamous cell carcinoma (OSCC) was evaluated using Cox proportional hazards regression models. The univariate analysis revealed that pathologic lymph node metastasis, advanced TNM stage, poor tumor differentiation, and low MUC21 expression significantly impacted DFS rate negatively. In the multivariate analysis, advanced TNM stage and MUC21 expression emerged as independent negative prognostic factors for DFS. Abbreviations: CI, confidence interval; HR, hazard ratio; OSCC, oral squamous cell carcinoma; P, pathological.\u003c/em\u003e \u003c/p\u003e\u003ch2\u003e4. Overexpression and Knockdown of MUC21 cause no obvious cell behavior change in vitro\u003c/h2\u003e\u003cp\u003eMUC21 was significantly overexpressed and knocked down in OSCC cell lines SCC15 and HSC-3 Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ea, b, c). However, except that CCK-8 assay in HSC-3 showed a statistical difference on day 3, there were no other positive results arose from all the in vitro tests performed in this study (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ed-i).\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn this study, we observed that the downregulation of MUC21 is a prevalent occurrence in OSCC. Furthermore, the extent of this reduction correlates with the aggressive characteristics of OSCC, including lymph node metastasis and poor clinical outcomes. These findings suggest that MUC21 may serve as a potential novel prognostic marker for OSCC.\u003c/p\u003e \u003cp\u003eClinically the TNM staging system established by American joint committee on cancer has been and is now the main basis to appraise OSCC status and prognosticate its clinical outcome [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. But it still has been being constantly improved to raise its accuracy in appraising the malignancy of OSCC to which biomarkers might provide some extra help [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Several dozens of biomarkers have been identified in OSCC to help predicting its clinical aggressiveness so as to choose the appropriate therapy regime or even develop the treatment targets, such as EGFR, PD-L1, [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e] [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e] [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]etc. More specific biomarkers in OSCC are still on the way to be elucidated. Mucins are a family of highly glycosylated protein members involved in many gastro-intestinal cancers and other cancers[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. In OSCC, upregulation of MUC1 has been observed comparing with normal oral mucosae [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e] and it promotes OSCC invasion and migration through PI3K-Akt pathway [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e], silencing MUC1 inhibits OSCC proliferation invasion and migration and promotes its apoptosis at the same time[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. MUC4 has also been found upregulation in OSCC and is a risk factor for its prognosis [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Elevated CA125(MUC16) in saliva has been found in OSCC patients and might be a prognostic marker[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Bioinformatic analysis showed that MUC7 is one of hub gene[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Increased MUC20 has been related with invasiveness of OSCC cells[\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. However, to our knowledge, MUC21 has never been studied in OSCC before. Our results may be the first report about MUC21 in OSCC and provide new insight into the functions of mucins in OSCC.\u003c/p\u003e \u003cp\u003eIn contrary to our result, several studies show that MUC21 is upregulated in cancer cells and promote cancer cell migration and metastasis. MUC21 can promote pancreatic cancer perineural invasion and metastasis [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. MUC21 expression was significantly upregulated in melanoma and promote melanoma cell lines\u0026rsquo; proliferation and migration in vitro [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. In human glioblastoma tissues and cell lines the elevated expression of MUC21 was observed and its high expression was related with glioblastoma cell viability and motility [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. MUC21 is also proved to inhibit both cytotoxic activity of NK cells and hinder T cell activation so that it severs as potent immunosuppressive factor in cancer [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. It has been shown by in vitro study that over expressed MUC21 in mouse cells decrease the adhesion among cells and cells to extracellular matrix components resulting in more floating, round cells during cell culture [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e], and MUC21 transfection in to HEK293 cell decreased the number of apoptotic cells [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. However, in our study it was showed that MUC21 was expressed in non-tumor oral mucosa and its expression decreased in the corresponding squamous carcinoma cells both by microarray, bioinformatic, RT-PCR and immunohistochemistry methods. which suggests that MUC21 is not a cancer cell metastasis enhancer in OSCC. This might seem contradictory to the previous reports. However, bioinformatic analysis has shown that MUC21 is downregulated in laryngeal squamous cell carcinoma (LSCC) [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. Furthermore, MUC21 has been found being expressed in opposite ways in malignant cells of different subtypes even in the same organ, it was expressed high in lung adenocarcinoma but low in squamous cell carcinoma [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. Besides, contradictory functions of both membrane-bound and secretory mucins have also been reported. For example, MUC16 have been shown to facilitate pancreatic cancer metastasis via FAK-mediated upregulation of mesenchymal markers [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e], while depletion of MUC16 from the cell surface led to the internalization of E-cadherin, causing enhanced expression of mesenchymal markers vimentin and N-cadherin [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. Similar phenomenon has also been reported in MUC15 and MUC5AC [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. Hence, the discrepancy of MUC21expression in different malignant cells might indicate that it works in different ways according to the cell types and scenarios.\u003c/p\u003e \u003cp\u003eThe immunohistochemistry and clinical findings from this study showed a significant correlation between the downregulation of MUC21 and low tumor differentiation in oral squamous cell carcinoma (OSCC). This correlation is further supported by the close association of MUC21 expression levels with those of KRT4, KRT13 and CRNN, proteins specific to the differentiation of oral squamous epithelia. Notably, KRT4 、KRT13 have also been reported to be downregulated in OSCC and downregulation of CRNN in OSCC is an independent predictor of relapse of OSCC [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e] [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. In healthy oral tissues, both secreted and membrane-bound mucins play a critical role in protecting the epithelia by forming a mucous barrier on the surface of the apical epithelial cells [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Though most membrane-bound mucins are upregulated and contribute to oncogenesis and malignancy development in cancers including OSCC, several of them, however, deceased in cancerous tissue than in matched non-cancerous tissue[\u003cspan additionalcitationids=\"CR45\" citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. Hence, MUC21 might also protect the epithelia in the same way as some other membrane-bound mucins. During the carcinogenesis and progression of oral epithelia, MUC21 was downregulated possibly because of the dedifferentiation of squamous epithelial cells. In accordance with this, our invitro cell line experiments showed that, both overexpression and knockdown of MUC21 could not markedly affect the cell behaviors. Our results suggest that MUC21 is not a driver oncogene rather a passenger gene in OSCC. However, the extensive and deep exploration of MUC21 in OSCC and other malignancies are needed in the future in order to uncover the exact functions of MUC21 in malignant tumors.\u003c/p\u003e \u003cp\u003eIn summary, our study has meticulously analyzed the expression of MUC21 in OSCC and established that it is significantly downregulated in OSCC, relates with epithelial differentiation and correlates with more tumor aggressiveness and worse prognosis. Our results suggest that MUC21 could serve as a new marker in the prognosis of OSCC.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThis study extensively explored MUC21 expression in oral squamous cell carcinoma (OSCC) by high through put dataset analysis and RT-PCR and immunohistochemistry (IHC) in paired OSCC and para-OSCC. It was confirmed that MUC21 was downregulated in OSCC. Through clinical investigation of 102 OSCC patients, it was found that MUC21 was related with more clinical aggressiveness and less survival rate. In contrary to the reported effect of MUC21 to cancer cells in vitro, our study showed that overexpression or knockdown of MUC21 posed no effect on OSCC cell lines in vitro. Our study indicates that MUC21 could serve as a new marker in the prognosis of OSCC, though it might not be a driver oncogene.\u003c/p\u003e "},{"header":"Abbreviations","content":"\u003cdiv class=\"DefinitionList\"\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eMUC\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eMucins\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eMUC21\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eMucin 21\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eOSCC\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eoral squamous cell carcinoma\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003ePara-OSCC\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003epaired adjacent normal tissue on OSCC patients\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eGEO\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003egene expression omibus\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eTCGA\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ethe cancer genome atlas\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eRNA-seq\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eRNA sequencing\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eKRT4\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ekeratin 4\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eKRT13\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ekeratin 13\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eCRNN\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eCornulin\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eRT-PCR\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eRevere transcription quantitative polymerase chain reaction\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eIHC\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eimmunohistochemistry\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eCCK-8\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ecell counting kit-8\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eRMA\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eRobust Multichip Average\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eGAPDH\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eGlyceraldehyde 3-phosphate dehydrogenase\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eDAB\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ediaminobenzidine\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eMOD\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003emean optical density\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eTNM\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003etumor, node, metastases stage\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eOS\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eoverall survival\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eDFS\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eDisease-free survival\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eDMEM\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eDulbecco's Modified Eagle Medium\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eFBS\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003efetal bovine serum\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003ePI\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ePropidium Iodide\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eHTA\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eHuman Transcriptome Array\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eCI\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003econfidence interval\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eHR\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ehazard ratio\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003ch2\u003eEthics declarations\u003c/b\u003e \u003c/h2\u003e \u003ch2\u003eEthics approval and consent to participate\u003c/strong\u003e \u003cp\u003eThe study received ethical approval from the Medical Ethics Committee of the Capital Medical University School of Stomatology (No. CMUSH-IRB-KJ-PJ-2018-04), and patient consent was obtained as required.\u003c/p\u003e \u003ch2\u003eCompeting interests\u003c/strong\u003e \u003cp\u003eThe authors have declared that no competing interest exists.\u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e \u003cp\u003eThis research was funded by grants from the Natural Science Foundation of Beijing Municipality (Grant No. 7152067 awarded to X.W.).\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eAll authors have departed in Data acquisition; Quality control of data and algorithms. Xinagpu wang and Siyuan Guo have performed the bioinformatic analysis. Xuejiu Wang has conceived the study concepts, designed the study, performed data analysis and prepared the manuscript.\u003c/p\u003e\u003ch2\u003eAcknowledgements\u003c/h2\u003e \u003cp\u003eWe extend our gratitude to the staff of the Pathology Department at the Capital Medical University School of Stomatology for their valuable assistance.\u003c/p\u003e\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eData availability\u003c/h2\u003e \u003cp\u003eThe data that support the findings of this study are available from the corresponding author, Xuejiu wang, upon reasonable request.\u003c/p\u003e \u003c/div\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eGan GL, Liu J, Chen WJ, Ye QQ, Xu Y, Wu HT, Li W. The Diverse Roles of the Mucin Gene Cluster Located on Chromosome 11p15.5 in Colorectal Cancer. Front Cell Dev Biol. 2020;8:514.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSun L, Zhang Y, Li W, Zhang J, Zhang Y. Mucin Glycans: A Target for Cancer Therapy. Molecules 2023, 28(20).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen T, Chen Z, Lian X, Wu W, Chu L, Zhang S, Wang L. MUC 15 Promotes Osteosarcoma Cell Proliferation, Migration and Invasion through Livin, MMP-2/MMP-9 and Wnt/beta-Catenin Signal Pathway. J Cancer. 2021;12(2):467\u0026ndash;73.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBose M, Grover P, Sanders AJ, Zhou R, Ahmad M, Shwartz S, Lala P, Nath S, Yazdanifar M, Brouwer C, et al. Overexpression of MUC1 Induces Non-Canonical TGF-beta Signaling in Pancreatic Ductal Adenocarcinoma. Front Cell Dev Biol. 2022;10:821875.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao A, Pan Y, Gao Y, Zhi Z, Lu H, Dong B, Zhang X, Wu M, Zhu F, Zhou S, et al. MUC1 promotes cervical squamous cell carcinoma through ERK phosphorylation-mediated regulation of ITGA2/ITGA3. BMC Cancer. 2024;24(1):559.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi S, Liu Z, Chen Q, Chen Y, Ji S. A novel fatty acid metabolism-related signature identifies MUC4 as a novel therapy target for esophageal squamous cell carcinoma. Sci Rep. 2024;14(1):12476.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchuster-Little N, Sokolovsky AD, Gentry A, Saraf A, Etzel MR, Patankar MS, Whelan RJ. Immunoaffinity-free chromatographic purification of ovarian cancer biomarker CA125 (MUC16) from blood serum enables mass spectrometry characterization. Anal Methods 2024.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDong L, Xue L, Cheng W, Tang J, Ran J, Li Y. Comprehensive survival analysis of oral squamous cell carcinoma patients undergoing initial radical surgery. BMC Oral Health. 2024;24(1):919.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTehzeeb H, Hande A, Patil S, Sonone A, Pakhale A, Chavhan A. Correlation of Clinical and Pathological TNM Staging With Histopathological Grading in Oral Squamous Cell Carcinoma. Cureus. 2024;16(5):e60912.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCheng Y, Song Z, Cheng J, Tang Z. JARID2, a novel regulatory factor, promotes cell proliferation, migration, and invasion in oral squamous cell carcinoma. BMC Cancer. 2024;24(1):793.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLan Z, Zou KL, Cui H, Zhao YY, Yu GT. Porphyromonas gingivalis suppresses oral squamous cell carcinoma progression by inhibiting MUC1 expression and remodeling the tumor microenvironment. Mol Oncol. 2024;18(5):1174\u0026ndash;88.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eItoh Y, Kamata-Sakurai M, Denda-Nagai K, Nagai S, Tsuiji M, Ishii-Schrade K, Okada K, Goto A, Fukayama M, Irimura T. Identification and expression of human epiglycanin/MUC21: a novel transmembrane mucin. Glycobiology. 2008;18(1):74\u0026ndash;83.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFini ME, Jeong S, Gong H, Martinez-Carrasco R, Laver NMV, Hijikata M, Keicho N, Argueso P. Membrane-associated mucins of the ocular surface: New genes, new protein functions and new biological roles in human and mouse. Prog Retin Eye Res. 2020;75:100777.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen Y, Zhang W, Zeng Y, Yang P, Li Y, Liang X, Liu K, Lin H, Dai Y, Zhou J, et al. GDNF-induced phosphorylation of MUC21 promotes pancreatic cancer perineural invasion and metastasis by activating RAC2 GTPase. Oncogene. 2024;43(34):2564\u0026ndash;77.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBao X, Wiehe R, Dommisch H, Schaefer AS. Entamoeba gingivalis Causes Oral Inflammation and Tissue Destruction. J Dent Res. 2020;99(5):561\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang M, Chen T, Liu YX, Huang L. Visualizing set relationships: EVenn's comprehensive approach to Venn diagrams. Imeta. 2024;3(3):e184.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMao L, Zhuang R, Qin L, Han Z, Huang X, Chen R, Su Y, Ge L, Yang J, Li J, et al. CCL18 overexpression predicts a worse prognosis in oral squamous cell carcinoma (OSCC). Neoplasma. 2020;67(3):700\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVaidya M, Dmello C, Mogre S. Utility of Keratins as Biomarkers for Human Oral Precancer and Cancer. Life (Basel) 2022, 12(3).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStruckmeier AK, Eichhorn P, Agaimy A, Buchbender M, Moest T, Lutz R, Kesting M. Comparison of the 7th and revised 8th UICC editions (2020) for oral squamous cell carcinoma: How does the reclassification impact staging and survival? Virchows Arch. 2024;484(6):901\u0026ndash;13.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSubramaniam N, Clark JR, Goldstein D, de Almeida J, Abdalaty AHA, Balasubramanian D, Thankappan K, Iyer S, Batstone M, Iyer NG, et al. Geographical heterogeneity in the American Joint committee on Cancer oral cancer staging and prognostic implications. Oral Oncol. 2021;113:105122.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJin N, An Y, Tian Y, Zhang Z, He K, Chi C, Mu W, Tian J, Du Y. Multispectral fluorescence imaging of EGFR and PD-L1 for precision detection of oral squamous cell carcinoma: a preclinical and clinical study. BMC Med. 2024;22(1):342.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHan Y, Peng Y, Xiong H, Zeng L, Zhang T, Xia K, Hu X, Su T. XPO1 serves as a prognostic marker involving AKT/MAPK/TGFBR1 pathway in OSCC. Cancer Med. 2024;13(16):e70076.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSheng YH, Davies JM, Wang R, Wong KY, Giri R, Yang Y, Begun J, Florin TH, Hasnain SZ, McGuckin MA. MUC1-mediated Macrophage Activation Promotes Colitis-associated Colorectal Cancer via Activating the Interleukin-6/ Signal Transducer and Activator of Transcription 3 Axis. Cell Mol Gastroenterol Hepatol 2022.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePeng L, Li Y, Gu H, Xiang L, Xiong Y, Wang R, Zhou H, Wang J. Mucin 4 mutation is associated with tumor mutation burden and promotes antitumor immunity in colon cancer patients. Aging. 2021;13(6):9043\u0026ndash;55.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAbdelwhab A, Shaker O, Aggour RL. Expression of Mucin1 in saliva in oral squamous cell carcinoma and oral potentially malignant disorders (case control study). Oral Dis. 2023;29(4):1487\u0026ndash;94.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi P, Xiao LY, Tan H. Muc-1 promotes migration and invasion of oral squamous cell carcinoma cells via PI3K-Akt signaling. Int J Clin Exp Pathol. 2015;8(9):10365\u0026ndash;74.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang AM, Chi XH, Bo ZQ, Huang XF, Zhang J. MUC1 gene silencing inhibits proliferation, invasion, and migration while promoting apoptosis of oral squamous cell carcinoma cells. Biosci Rep 2019, 39(9).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAbidullah M, Nahar P, Ahmed SA, Kothari H, Vakeel S. MUC4 Expression in Oral Dysplastic Epithelium and Oral Squamous Cell Carcinoma: An Immunohistochemical Study. J Int Soc Prev Community Dent. 2023;13(2):124\u0026ndash;32.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGeng XF, Du M, Han JX, Zhang M, Tang XF, Xing RD. Saliva CA125 and TPS levels in patients with oral squamous cell carcinoma. Int J Biol Markers. 2013;28(2):216\u0026ndash;20.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu Q, Cao R, Chen J, Xie X. Screening and identification of biomarkers associated with clinicopathological parameters and prognosis in oral squamous cell carcinoma. Exp Ther Med. 2019;18(5):3579\u0026ndash;87.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSasahira T, Kurihara-Shimomura M, Shimomura H, Bosserhoff AK, Kirita T. Identification of oral squamous cell carcinoma markers MUC2 and SPRR1B downstream of TANGO. J Cancer Res Clin Oncol. 2021;147(6):1659\u0026ndash;72.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu X, Xiao Y, Xiong X, Qi X. MUC21 controls melanoma progression via regulating SLITRK5 and hedgehog signaling pathway. Cell Biol Int. 2022;46(9):1458\u0026ndash;67.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang L, Zhang X, Liu J, Liu Q. MUC21 induces the viability and migration of glioblastoma via the STAT3/AKT pathway. Exp Ther Med. 2022;23(5):331.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee DH, Ahn H, Sim HI, Choi E, Choi S, Jo Y, Yun B, Song HK, Oh SJ, Denda-Nagai K, et al. A CRISPR activation screen identifies MUC-21 as critical for resistance to NK and T cell-mediated cytotoxicity. J Exp Clin Cancer Res. 2023;42(1):272.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYi Y, Kamata-Sakurai M, Denda-Nagai K, Itoh T, Okada K, Ishii-Schrade K, Iguchi A, Sugiura D, Irimura T. Mucin 21/epiglycanin modulates cell adhesion. J Biol Chem. 2010;285(28):21233\u0026ndash;40.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTian Y, Denda-Nagai K, Tsukui T, Ishii-Schrade KB, Okada K, Nishizono Y, Matsuzaki K, Hafley M, Bresalier RS, Irimura T. Mucin 21 confers resistance to apoptosis in an O-glycosylation-dependent manner. Cell Death Discov. 2022;8(1):194.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMo BY, Li GS, Huang SN, He WY, Xie LY, Wei ZX, Su YS, Liang Y, Yang L, Ye C, et al. The underlying molecular mechanism and identification of transcription factor markers for laryngeal squamous cell carcinoma. Bioengineered. 2021;12(1):208\u0026ndash;24.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLin S, Tian C, Li J, Liu B, Ma T, Chen K, Gong W, Wang JM, Huang J. Differential MUC22 expression by epigenetic alterations in human lung squamous cell carcinoma and adenocarcinoma. Oncol Rep 2021, 45(5).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMuniyan S, Haridas D, Chugh S, Rachagani S, Lakshmanan I, Gupta S, Seshacharyulu P, Smith LM, Ponnusamy MP, Batra SK. MUC16 contributes to the metastasis of pancreatic ductal adenocarcinoma through focal adhesion mediated signaling mechanism. Genes Cancer. 2016;7(3\u0026ndash;4):110\u0026ndash;24.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eComamala M, Pinard M, Theriault C, Matte I, Albert A, Boivin M, Beaudin J, Piche A, Rancourt C. Downregulation of cell surface CA125/MUC16 induces epithelial-to-mesenchymal transition and restores EGFR signalling in NIH:OVCAR3 ovarian carcinoma cells. Br J Cancer. 2011;104(6):989\u0026ndash;99.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHan T, Zheng H, Zhang J, Yang P, Li H, Cheng Z, Xiang D, Wang R. Downregulation of MUC15 by miR-183-5p.1 promotes liver tumor-initiating cells properties and tumorigenesis via regulating c-MET/PI3K/AKT/SOX2 axis. Cell Death Dis. 2022;13(3):200.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi X, Fang J, Tao X, Xia J, Cheng B, Wang Y. Splice site m(6)A methylation prevents binding of DGCR8 to suppress KRT4 pre-mRNA splicing in oral squamous cell carcinoma. PeerJ. 2023;11:e14824.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGovindaraj PK, Kallarakkal TG, Mohd Zain R, Tilakaratne WM, Lew HL. Expression of Ki-67, Cornulin and ISG15 in non-involved mucosal surgical margins as predictive markers for relapse in oral squamous cell carcinoma (OSCC). PLoS ONE. 2021;16(12):e0261575.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMatsuyama T, Ishikawa T, Mogushi K, Yoshida T, Iida S, Uetake H, Mizushima H, Tanaka H, Sugihara K. MUC12 mRNA expression is an independent marker of prognosis in stage II and stage III colorectal cancer. Int J Cancer. 2010;127(10):2292\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang B, Wu A, Hu Y, Tao C, Wang JM, Lu Y, Xing R. Mucin 17 inhibits the progression of human gastric cancer by limiting inflammatory responses through a MYH9-p53-RhoA regulatory feedback loop. J Exp Clin Cancer Res. 2019;38(1):283.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang S, Jin J, Chen J, Lou W. MUC14-Related ncRNA-mRNA Network in Breast Cancer. Genes (Basel) 2021, 12(11).\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Oral Squamous Cell Carcinoma, Biomarker, MUC21, Prognosis","lastPublishedDoi":"10.21203/rs.3.rs-5294516/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5294516/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eMucins are usually associated with more aggressive tumor behavior and poorer clinical outcomes. However, MUC21 has never been studied in oral squamous cell carcinoma (OSCC). MUC21 has been observed to contribute to the anti-adhesion effects of cancer cells in vitro. It might serve as an important molecule in OSCC.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eOur microarray data based on 10 oral squamous cell carcinoma (OSCC) and paired adjacent normal tissue (para-OSCC), and similar data sets from GEO and TCGA RNAseq data were analyzed to screen out the differentially expressed genes including MUC21. RT-PCR analysis was carried out to further confirm the alteration of MUC21 and the epithelial differentiation related co-expressed genes in OSCC. Then, the relationship of MUC21 changes in OSCC with the corresponding clinical characteristics and outcomes was investigated using immunohistochemistry (IHC) on other 102 paired samples of OSCC and para-OSCC. OSCC cell lines SCC15 and HSC-3 with MUC21 overexpression or knockdown were studied in vitro through CCK8, Annexin V/PI assays, wound healing, and Transwell experiments.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eMUC21 was significantly downregulated in OSCC compared with normal oral tissue, as evidenced by high throughput gene expression datasets, RT-PCR and immunohistochemistry analysis. Additionally, 11 genes co-expressed with MUC21 were revealed. Among them, the mucosae differentiation related KRT4, KRT13, and CRNN were further confirmed by RT-PCR and IHC. The downregulation of MUC21 was associated with pathological lymph node metastasis, poorer tumor differentiation, and shorter survival rates. However, hardly no statistically significant changes were detected in CCK8 analysis, Annexin V/PI assays, wound healing, and Transwell experiments on the OSCC cell lines with MUC21 overexpression or knockdown.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e \u003cp\u003eLow MUC21 expression in OSCC is associated with less epithelial differentiation, more clinical aggressiveness and worse prognosis. MUC21 could serve as a new prognostic marker in OSCC, though it might not be a driver oncogene.\u003c/p\u003e","manuscriptTitle":"MUC 21 is downregulated in oral squamous cell carcinoma and associated with poor prognosis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-11-04 08:13:39","doi":"10.21203/rs.3.rs-5294516/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"567eeedc-1b7d-4b4c-b7dd-83e19371e27e","owner":[],"postedDate":"November 4th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-07-24T11:08:42+00:00","versionOfRecord":[],"versionCreatedAt":"2024-11-04 08:13:39","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-5294516","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5294516","identity":"rs-5294516","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}