Pathophysiological Effects of Titanium Dioxide... | F1000Research "use strict";function _typeof(t){return(_typeof="function"==typeof Symbol&&"symbol"==typeof Symbol.iterator?function(t){return typeof t}:function(t){return t&&"function"==typeof Symbol&&t.constructor===Symbol&&t!==Symbol.prototype?"symbol":typeof t})(t)}!function(){var t=function(){var t,e,o=[],n=window,r=n;for(;r;){try{if(r.frames.__tcfapiLocator){t=r;break}}catch(t){}if(r===n.top)break;r=r.parent}t||(!function t(){var e=n.document,o=!!n.frames.__tcfapiLocator;if(!o)if(e.body){var r=e.createElement("iframe");r.style.cssText="display:none",r.name="__tcfapiLocator",e.body.appendChild(r)}else setTimeout(t,5);return!o}(),n.__tcfapi=function(){for(var t=arguments.length,n=new Array(t),r=0;r 3&&2===parseInt(n[1],10)&&"boolean"==typeof n[3]&&(e=n[3],"function"==typeof n[2]&&n[2]("set",!0)):"ping"===n[0]?"function"==typeof n[2]&&n[2]({gdprApplies:e,cmpLoaded:!1,cmpStatus:"stub"}):o.push(n)},n.addEventListener("message",(function(t){var e="string"==typeof t.data,o={};if(e)try{o=JSON.parse(t.data)}catch(t){}else o=t.data;var n="object"===_typeof(o)&&null!==o?o.__tcfapiCall:null;n&&window.__tcfapi(n.command,n.version,(function(o,r){var a={__tcfapiReturn:{returnValue:o,success:r,callId:n.callId}};t&&t.source&&t.source.postMessage&&t.source.postMessage(e?JSON.stringify(a):a,"*")}),n.parameter)}),!1))};"undefined"!=typeof module?module.exports=t:t()}(); dataLayer = dataLayer || []; // Standard GTM initialization - Google Consent Mode handles consent automatically (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start': new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0], j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src= 'https://www.googletagmanager.com/gtm.js?id='+i+dl+ '>m_auth=hzk0Vc3qFsQYhCrIoHz68A>m_preview=env-1>m_cookies_win=x';f.parentNode.insertBefore(j,f); })(window,document,'script','dataLayer','GTM-MWFK8L5J'); ;window.NREUM||(NREUM={});NREUM.init={distributed_tracing:{enabled:true},privacy:{cookies_enabled:true},ajax:{deny_list:["bam.nr-data.net"]}}; ;NREUM.loader_config={accountID:"438030",trustKey:"438030",agentID:"772317073",licenseKey:"97f8f67f26",applicationID:"772317073"} ;NREUM.info={beacon:"bam.nr-data.net",errorBeacon:"bam.nr-data.net",licenseKey:"97f8f67f26",applicationID:"772317073",sa:1} ;/*! For license information please see nr-loader-spa-1.236.0.min.js.LICENSE.txt */ (()=>{"use strict";var e,t,r={5763:(e,t,r)=>{r.d(t,{P_:()=>l,Mt:()=>g,C5:()=>s,DL:()=>v,OP:()=>T,lF:()=>D,Yu:()=>y,Dg:()=>h,CX:()=>c,GE:()=>b,sU:()=>_});var n=r(8632),i=r(9567);const o={beacon:n.ce.beacon,errorBeacon:n.ce.errorBeacon,licenseKey:void 0,applicationID:void 0,sa:void 0,queueTime:void 0,applicationTime:void 0,ttGuid:void 0,user:void 0,account:void 0,product:void 0,extra:void 0,jsAttributes:{},userAttributes:void 0,atts:void 0,transactionName:void 0,tNamePlain:void 0},a={};function s(e){if(!e)throw new Error("All info objects require an agent identifier!");if(!a[e])throw new Error("Info for ".concat(e," was never set"));return a[e]}function c(e,t){if(!e)throw new Error("All info objects require an agent identifier!");a[e]=(0,i.D)(t,o),(0,n.Qy)(e,a[e],"info")}var u=r(7056);const d=()=>{const e={blockSelector:"[data-nr-block]",maskInputOptions:{password:!0}};return{allow_bfcache:!0,privacy:{cookies_enabled:!0},ajax:{deny_list:void 0,enabled:!0,harvestTimeSeconds:10},distributed_tracing:{enabled:void 0,exclude_newrelic_header:void 0,cors_use_newrelic_header:void 0,cors_use_tracecontext_headers:void 0,allowed_origins:void 0},session:{domain:void 0,expiresMs:u.oD,inactiveMs:u.Hb},ssl:void 0,obfuscate:void 0,jserrors:{enabled:!0,harvestTimeSeconds:10},metrics:{enabled:!0},page_action:{enabled:!0,harvestTimeSeconds:30},page_view_event:{enabled:!0},page_view_timing:{enabled:!0,harvestTimeSeconds:30,long_task:!1},session_trace:{enabled:!0,harvestTimeSeconds:10},harvest:{tooManyRequestsDelay:60},session_replay:{enabled:!1,harvestTimeSeconds:60,sampleRate:.1,errorSampleRate:.1,maskTextSelector:"*",maskAllInputs:!0,get blockClass(){return"nr-block"},get ignoreClass(){return"nr-ignore"},get maskTextClass(){return"nr-mask"},get blockSelector(){return e.blockSelector},set blockSelector(t){e.blockSelector+=",".concat(t)},get maskInputOptions(){return e.maskInputOptions},set maskInputOptions(t){e.maskInputOptions={...t,password:!0}}},spa:{enabled:!0,harvestTimeSeconds:10}}},f={};function l(e){if(!e)throw new Error("All configuration objects require an agent identifier!");if(!f[e])throw new Error("Configuration for ".concat(e," was never set"));return f[e]}function h(e,t){if(!e)throw new Error("All configuration objects require an agent identifier!");f[e]=(0,i.D)(t,d()),(0,n.Qy)(e,f[e],"config")}function g(e,t){if(!e)throw new Error("All configuration objects require an agent identifier!");var r=l(e);if(r){for(var n=t.split("."),i=0;i {r.d(t,{D:()=>i});var n=r(50);function i(e,t){try{if(!e||"object"!=typeof e)return(0,n.Z)("Setting a Configurable requires an object as input");if(!t||"object"!=typeof t)return(0,n.Z)("Setting a Configurable requires a model to set its initial properties");const r=Object.create(Object.getPrototypeOf(t),Object.getOwnPropertyDescriptors(t)),o=0===Object.keys(r).length?e:r;for(let a in o)if(void 0!==e[a])try{"object"==typeof e[a]&&"object"==typeof t[a]?r[a]=i(e[a],t[a]):r[a]=e[a]}catch(e){(0,n.Z)("An error occurred while setting a property of a Configurable",e)}return r}catch(e){(0,n.Z)("An error occured while setting a Configurable",e)}}},6818:(e,t,r)=>{r.d(t,{Re:()=>i,gF:()=>o,q4:()=>n});const n="1.236.0",i="PROD",o="CDN"},385:(e,t,r)=>{r.d(t,{FN:()=>a,IF:()=>u,Nk:()=>f,Tt:()=>s,_A:()=>o,il:()=>n,pL:()=>c,v6:()=>i,w1:()=>d});const n="undefined"!=typeof window&&!!window.document,i="undefined"!=typeof WorkerGlobalScope&&("undefined"!=typeof self&&self instanceof WorkerGlobalScope&&self.navigator instanceof WorkerNavigator||"undefined"!=typeof globalThis&&globalThis instanceof WorkerGlobalScope&&globalThis.navigator instanceof WorkerNavigator),o=n?window:"undefined"!=typeof WorkerGlobalScope&&("undefined"!=typeof self&&self instanceof WorkerGlobalScope&&self||"undefined"!=typeof globalThis&&globalThis instanceof WorkerGlobalScope&&globalThis),a=""+o?.location,s=/iPad|iPhone|iPod/.test(navigator.userAgent),c=s&&"undefined"==typeof SharedWorker,u=(()=>{const e=navigator.userAgent.match(/Firefox[/\s](\d+\.\d+)/);return Array.isArray(e)&&e.length>=2?+e[1]:0})(),d=Boolean(n&&window.document.documentMode),f=!!navigator.sendBeacon},1117:(e,t,r)=>{r.d(t,{w:()=>o});var n=r(50);const i={agentIdentifier:"",ee:void 0};class o{constructor(e){try{if("object"!=typeof e)return(0,n.Z)("shared context requires an object as input");this.sharedContext={},Object.assign(this.sharedContext,i),Object.entries(e).forEach((e=>{let[t,r]=e;Object.keys(i).includes(t)&&(this.sharedContext[t]=r)}))}catch(e){(0,n.Z)("An error occured while setting SharedContext",e)}}}},8e3:(e,t,r)=>{r.d(t,{L:()=>d,R:()=>c});var n=r(2177),i=r(1284),o=r(4322),a=r(3325);const s={};function c(e,t){const r={staged:!1,priority:a.p[t]||0};u(e),s[e].get(t)||s[e].set(t,r)}function u(e){e&&(s[e]||(s[e]=new Map))}function d(){let e=arguments.length>0&&void 0!==arguments[0]?arguments[0]:"",t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:"feature";if(u(e),!e||!s[e].get(t))return a(t);s[e].get(t).staged=!0;const r=[...s[e]];function a(t){const r=e?n.ee.get(e):n.ee,a=o.X.handlers;if(r.backlog&&a){var s=r.backlog[t],c=a[t];if(c){for(var u=0;s&&u {let[t,r]=e;return r.staged}))&&(r.sort(((e,t)=>e[1].priority-t[1].priority)),r.forEach((e=>{let[t]=e;a(t)})))}function f(e,t){var r=e[1];(0,i.D)(t[r],(function(t,r){var n=e[0];if(r[0]===n){var i=r[1],o=e[3],a=e[2];i.apply(o,a)}}))}},2177:(e,t,r)=>{r.d(t,{c:()=>f,ee:()=>u});var n=r(8632),i=r(2210),o=r(1284),a=r(5763),s="nr@context";let c=(0,n.fP)();var u;function d(){}function f(e){return(0,i.X)(e,s,l)}function l(){return new d}function h(){u.aborted=!0,u.backlog={}}c.ee?u=c.ee:(u=function e(t,r){var n={},c={},f={},g=!1;try{g=16===r.length&&(0,a.OP)(r).isolatedBacklog}catch(e){}var p={on:b,addEventListener:b,removeEventListener:y,emit:v,get:x,listeners:w,context:m,buffer:A,abort:h,aborted:!1,isBuffering:E,debugId:r,backlog:g?{}:t&&"object"==typeof t.backlog?t.backlog:{}};return p;function m(e){return e&&e instanceof d?e:e?(0,i.X)(e,s,l):l()}function v(e,r,n,i,o){if(!1!==o&&(o=!0),!u.aborted||i){t&&o&&t.emit(e,r,n);for(var a=m(n),s=w(e),d=s.length,f=0;fn,p:()=>i});var n=r(2177).ee.get("handle");function i(e,t,r,i,o){o?(o.buffer([e],i),o.emit(e,t,r)):(n.buffer([e],i),n.emit(e,t,r))}},4322:(e,t,r)=>{r.d(t,{X:()=>o});var n=r(5546);o.on=a;var i=o.handlers={};function o(e,t,r,o){a(o||n.E,i,e,t,r)}function a(e,t,r,i,o){o||(o="feature"),e||(e=n.E);var a=t[o]=t[o]||{};(a[r]=a[r]||[]).push([e,i])}},3239:(e,t,r)=>{r.d(t,{bP:()=>s,iz:()=>c,m$:()=>a});var n=r(385);let i=!1,o=!1;try{const e={get passive(){return i=!0,!1},get signal(){return o=!0,!1}};n._A.addEventListener("test",null,e),n._A.removeEventListener("test",null,e)}catch(e){}function a(e,t){return i||o?{capture:!!e,passive:i,signal:t}:!!e}function s(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2],n=arguments.length>3?arguments[3]:void 0;window.addEventListener(e,t,a(r,n))}function c(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2],n=arguments.length>3?arguments[3]:void 0;document.addEventListener(e,t,a(r,n))}},4402:(e,t,r)=>{r.d(t,{Ht:()=>u,M:()=>c,Rl:()=>a,ky:()=>s});var n=r(385);const i="xxxxxxxx-xxxx-4xxx-yxxx-xxxxxxxxxxxx";function o(e,t){return e?15&e[t]:16*Math.random()|0}function a(){const e=n._A?.crypto||n._A?.msCrypto;let t,r=0;return e&&e.getRandomValues&&(t=e.getRandomValues(new Uint8Array(31))),i.split("").map((e=>"x"===e?o(t,++r).toString(16):"y"===e?(3&o()|8).toString(16):e)).join("")}function s(e){const t=n._A?.crypto||n._A?.msCrypto;let r,i=0;t&&t.getRandomValues&&(r=t.getRandomValues(new Uint8Array(31)));const a=[];for(var s=0;s {r.d(t,{Bq:()=>n,Hb:()=>o,oD:()=>i});const n="NRBA",i=144e5,o=18e5},7894:(e,t,r)=>{function n(){return Math.round(performance.now())}r.d(t,{z:()=>n})},7243:(e,t,r)=>{r.d(t,{e:()=>o});var n=r(385),i={};function o(e){if(e in i)return i[e];if(0===(e||"").indexOf("data:"))return{protocol:"data"};let t;var r=n._A?.location,o={};if(n.il)t=document.createElement("a"),t.href=e;else try{t=new URL(e,r.href)}catch(e){return o}o.port=t.port;var a=t.href.split("://");!o.port&&a[1]&&(o.port=a[1].split("/")[0].split("@").pop().split(":")[1]),o.port&&"0"!==o.port||(o.port="https"===a[0]?"443":"80"),o.hostname=t.hostname||r.hostname,o.pathname=t.pathname,o.protocol=a[0],"/"!==o.pathname.charAt(0)&&(o.pathname="/"+o.pathname);var s=!t.protocol||":"===t.protocol||t.protocol===r.protocol,c=t.hostname===r.hostname&&t.port===r.port;return o.sameOrigin=s&&(!t.hostname||c),"/"===o.pathname&&(i[e]=o),o}},50:(e,t,r)=>{function n(e,t){"function"==typeof console.warn&&(console.warn("New Relic: ".concat(e)),t&&console.warn(t))}r.d(t,{Z:()=>n})},2587:(e,t,r)=>{r.d(t,{N:()=>c,T:()=>u});var n=r(2177),i=r(5546),o=r(8e3),a=r(3325);const s={stn:[a.D.sessionTrace],err:[a.D.jserrors,a.D.metrics],ins:[a.D.pageAction],spa:[a.D.spa],sr:[a.D.sessionReplay,a.D.sessionTrace]};function c(e,t){const r=n.ee.get(t);e&&"object"==typeof e&&(Object.entries(e).forEach((e=>{let[t,n]=e;void 0===u[t]&&(s[t]?s[t].forEach((e=>{n?(0,i.p)("feat-"+t,[],void 0,e,r):(0,i.p)("block-"+t,[],void 0,e,r),(0,i.p)("rumresp-"+t,[Boolean(n)],void 0,e,r)})):n&&(0,i.p)("feat-"+t,[],void 0,void 0,r),u[t]=Boolean(n))})),Object.keys(s).forEach((e=>{void 0===u[e]&&(s[e]?.forEach((t=>(0,i.p)("rumresp-"+e,[!1],void 0,t,r))),u[e]=!1)})),(0,o.L)(t,a.D.pageViewEvent))}const u={}},2210:(e,t,r)=>{r.d(t,{X:()=>i});var n=Object.prototype.hasOwnProperty;function i(e,t,r){if(n.call(e,t))return e[t];var i=r();if(Object.defineProperty&&Object.keys)try{return Object.defineProperty(e,t,{value:i,writable:!0,enumerable:!1}),i}catch(e){}return e[t]=i,i}},1284:(e,t,r)=>{r.d(t,{D:()=>n});const n=(e,t)=>Object.entries(e||{}).map((e=>{let[r,n]=e;return t(r,n)}))},4351:(e,t,r)=>{r.d(t,{P:()=>o});var n=r(2177);const i=()=>{const e=new WeakSet;return(t,r)=>{if("object"==typeof r&&null!==r){if(e.has(r))return;e.add(r)}return r}};function o(e){try{return JSON.stringify(e,i())}catch(e){try{n.ee.emit("internal-error",[e])}catch(e){}}}},3960:(e,t,r)=>{r.d(t,{K:()=>a,b:()=>o});var n=r(3239);function i(){return"undefined"==typeof document||"complete"===document.readyState}function o(e,t){if(i())return e();(0,n.bP)("load",e,t)}function a(e){if(i())return e();(0,n.iz)("DOMContentLoaded",e)}},8632:(e,t,r)=>{r.d(t,{EZ:()=>u,Qy:()=>c,ce:()=>o,fP:()=>a,gG:()=>d,mF:()=>s});var n=r(7894),i=r(385);const o={beacon:"bam.nr-data.net",errorBeacon:"bam.nr-data.net"};function a(){return i._A.NREUM||(i._A.NREUM={}),void 0===i._A.newrelic&&(i._A.newrelic=i._A.NREUM),i._A.NREUM}function s(){let e=a();return e.o||(e.o={ST:i._A.setTimeout,SI:i._A.setImmediate,CT:i._A.clearTimeout,XHR:i._A.XMLHttpRequest,REQ:i._A.Request,EV:i._A.Event,PR:i._A.Promise,MO:i._A.MutationObserver,FETCH:i._A.fetch}),e}function c(e,t,r){let i=a();const o=i.initializedAgents||{},s=o[e]||{};return Object.keys(s).length||(s.initializedAt={ms:(0,n.z)(),date:new Date}),i.initializedAgents={...o,[e]:{...s,[r]:t}},i}function u(e,t){a()[e]=t}function d(){return function(){let e=a();const t=e.info||{};e.info={beacon:o.beacon,errorBeacon:o.errorBeacon,...t}}(),function(){let e=a();const t=e.init||{};e.init={...t}}(),s(),function(){let e=a();const t=e.loader_config||{};e.loader_config={...t}}(),a()}},7956:(e,t,r)=>{r.d(t,{N:()=>i});var n=r(3239);function i(e){let t=arguments.length>1&&void 0!==arguments[1]&&arguments[1],r=arguments.length>2?arguments[2]:void 0,i=arguments.length>3?arguments[3]:void 0;return void(0,n.iz)("visibilitychange",(function(){if(t)return void("hidden"==document.visibilityState&&e());e(document.visibilityState)}),r,i)}},1214:(e,t,r)=>{r.d(t,{em:()=>v,u5:()=>N,QU:()=>S,_L:()=>I,Gm:()=>L,Lg:()=>M,gy:()=>U,BV:()=>Q,Kf:()=>ee});var n=r(2177);const i="nr@original";var o=Object.prototype.hasOwnProperty,a=!1;function s(e,t){return e||(e=n.ee),r.inPlace=function(e,t,n,i,o){n||(n="");var a,s,c,u="-"===n.charAt(0);for(c=0;c 2?n-2:0),o=2;o {r(A[T],e,w),r(E[T],e,w)})),r(l._A,"fetch",y),t.on(y+"end",(function(e,r){var n=this;if(r){var i=r.headers.get("content-length");null!==i&&(n.rxSize=i),t.emit(y+"done",[null,r],n)}else t.emit(y+"done",[e],n)})),t}const O={},j=["pushState","replaceState"];function S(e){const t=function(e){return(e||n.ee).get("history")}(e);return!l.il||O[t.debugId]++||(O[t.debugId]=1,s(t).inPlace(window.history,j,"-")),t}var P=r(3239);const C={},R=["appendChild","insertBefore","replaceChild"];function I(e){const t=function(e){return(e||n.ee).get("jsonp")}(e);if(!l.il||C[t.debugId])return t;C[t.debugId]=!0;var r=s(t),i=/[?&](?:callback|cb)=([^&#]+)/,o=/(.*)\.([^.]+)/,a=/^(\w+)(\.|$)(.*)$/;function c(e,t){var r=e.match(a),n=r[1],i=r[3];return i?c(i,t[n]):t[n]}return r.inPlace(Node.prototype,R,"dom-"),t.on("dom-start",(function(e){!function(e){if(!e||"string"!=typeof e.nodeName||"script"!==e.nodeName.toLowerCase())return;if("function"!=typeof e.addEventListener)return;var n=(a=e.src,s=a.match(i),s?s[1]:null);var a,s;if(!n)return;var u=function(e){var t=e.match(o);if(t&&t.length>=3)return{key:t[2],parent:c(t[1],window)};return{key:e,parent:window}}(n);if("function"!=typeof u.parent[u.key])return;var d={};function f(){t.emit("jsonp-end",[],d),e.removeEventListener("load",f,(0,P.m$)(!1)),e.removeEventListener("error",l,(0,P.m$)(!1))}function l(){t.emit("jsonp-error",[],d),t.emit("jsonp-end",[],d),e.removeEventListener("load",f,(0,P.m$)(!1)),e.removeEventListener("error",l,(0,P.m$)(!1))}r.inPlace(u.parent,[u.key],"cb-",d),e.addEventListener("load",f,(0,P.m$)(!1)),e.addEventListener("error",l,(0,P.m$)(!1)),t.emit("new-jsonp",[e.src],d)}(e[0])})),t}var k=r(5763);const H={};function L(e){const t=function(e){return(e||n.ee).get("mutation")}(e);if(!l.il||H[t.debugId])return t;H[t.debugId]=!0;var r=s(t),i=k.Yu.MO;return i&&(window.MutationObserver=function(e){return this instanceof i?new i(r(e,"fn-")):i.apply(this,arguments)},MutationObserver.prototype=i.prototype),t}const z={};function M(e){const t=function(e){return(e||n.ee).get("promise")}(e);if(z[t.debugId])return t;z[t.debugId]=!0;var r=n.c,o=s(t),a=k.Yu.PR;return a&&function(){function e(r){var n=t.context(),i=o(r,"executor-",n,null,!1);const s=Reflect.construct(a,[i],e);return t.context(s).getCtx=function(){return n},s}l._A.Promise=e,Object.defineProperty(e,"name",{value:"Promise"}),e.toString=function(){return a.toString()},Object.setPrototypeOf(e,a),["all","race"].forEach((function(r){const n=a[r];e[r]=function(e){let i=!1;[...e||[]].forEach((e=>{this.resolve(e).then(a("all"===r),a(!1))}));const o=n.apply(this,arguments);return o;function a(e){return function(){t.emit("propagate",[null,!i],o,!1,!1),i=i||!e}}}})),["resolve","reject"].forEach((function(r){const n=a[r];e[r]=function(e){const r=n.apply(this,arguments);return e!==r&&t.emit("propagate",[e,!0],r,!1,!1),r}})),e.prototype=a.prototype;const n=a.prototype.then;a.prototype.then=function(){var e=this,i=r(e);i.promise=e;for(var a=arguments.length,s=new Array(a),c=0;c e())),t};function m(e,t){i.inPlace(t,["onreadystatechange"],"fn-",E)}function b(){var e=this,t=r.context(e);e.readyState>3&&!t.resolved&&(t.resolved=!0,r.emit("xhr-resolved",[],e)),i.inPlace(e,f,"fn-",E)}if(function(e,t){for(var r in e)t[r]=e[r]}(o,p),p.prototype=o.prototype,i.inPlace(p.prototype,J,"-xhr-",E),r.on("send-xhr-start",(function(e,t){m(e,t),function(e){h.push(e),a&&(y?y.then(A):u?u(A):(w=-w,x.data=w))}(t)})),r.on("open-xhr-start",m),a){var y=c&&c.resolve();if(!u&&!c){var w=1,x=document.createTextNode(w);new a(A).observe(x,{characterData:!0})}}else t.on("fn-end",(function(e){e[0]&&e[0].type===d||A()}));function A(){for(var e=0;e {r.d(t,{t:()=>n});const n=r(3325).D.ajax},6660:(e,t,r)=>{r.d(t,{A:()=>i,t:()=>n});const n=r(3325).D.jserrors,i="nr@seenError"},3081:(e,t,r)=>{r.d(t,{gF:()=>o,mY:()=>i,t9:()=>n,vz:()=>s,xS:()=>a});const n=r(3325).D.metrics,i="sm",o="cm",a="storeSupportabilityMetrics",s="storeEventMetrics"},4649:(e,t,r)=>{r.d(t,{t:()=>n});const n=r(3325).D.pageAction},7633:(e,t,r)=>{r.d(t,{Dz:()=>i,OJ:()=>a,qw:()=>o,t9:()=>n});const n=r(3325).D.pageViewEvent,i="firstbyte",o="domcontent",a="windowload"},9251:(e,t,r)=>{r.d(t,{t:()=>n});const n=r(3325).D.pageViewTiming},3614:(e,t,r)=>{r.d(t,{BST_RESOURCE:()=>i,END:()=>s,FEATURE_NAME:()=>n,FN_END:()=>u,FN_START:()=>c,PUSH_STATE:()=>d,RESOURCE:()=>o,START:()=>a});const n=r(3325).D.sessionTrace,i="bstResource",o="resource",a="-start",s="-end",c="fn"+a,u="fn"+s,d="pushState"},7836:(e,t,r)=>{r.d(t,{BODY:()=>A,CB_END:()=>E,CB_START:()=>u,END:()=>x,FEATURE_NAME:()=>i,FETCH:()=>_,FETCH_BODY:()=>v,FETCH_DONE:()=>m,FETCH_START:()=>p,FN_END:()=>c,FN_START:()=>s,INTERACTION:()=>l,INTERACTION_API:()=>d,INTERACTION_EVENTS:()=>o,JSONP_END:()=>b,JSONP_NODE:()=>g,JS_TIME:()=>T,MAX_TIMER_BUDGET:()=>a,REMAINING:()=>f,SPA_NODE:()=>h,START:()=>w,originalSetTimeout:()=>y});var n=r(5763);const i=r(3325).D.spa,o=["click","submit","keypress","keydown","keyup","change"],a=999,s="fn-start",c="fn-end",u="cb-start",d="api-ixn-",f="remaining",l="interaction",h="spaNode",g="jsonpNode",p="fetch-start",m="fetch-done",v="fetch-body-",b="jsonp-end",y=n.Yu.ST,w="-start",x="-end",A="-body",E="cb"+x,T="jsTime",_="fetch"},5938:(e,t,r)=>{r.d(t,{W:()=>o});var n=r(5763),i=r(2177);class o{constructor(e,t,r){this.agentIdentifier=e,this.aggregator=t,this.ee=i.ee.get(e,(0,n.OP)(this.agentIdentifier).isolatedBacklog),this.featureName=r,this.blocked=!1}}},9144:(e,t,r)=>{r.d(t,{j:()=>m});var n=r(3325),i=r(5763),o=r(5546),a=r(2177),s=r(7894),c=r(8e3),u=r(3960),d=r(385),f=r(50),l=r(3081),h=r(8632);function g(){const e=(0,h.gG)();["setErrorHandler","finished","addToTrace","inlineHit","addRelease","addPageAction","setCurrentRouteName","setPageViewName","setCustomAttribute","interaction","noticeError","setUserId"].forEach((t=>{e[t]=function(){for(var r=arguments.length,n=new Array(r),i=0;i 1?r-1:0),i=1;i {e.exposed&&e.api[t]&&o.push(e.api[t](...n))})),o.length>1?o:o[0]}(t,...n)}}))}var p=r(2587);function m(e){let t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:{},m=arguments.length>2?arguments[2]:void 0,v=arguments.length>3?arguments[3]:void 0,{init:b,info:y,loader_config:w,runtime:x={loaderType:m},exposed:A=!0}=t;const E=(0,h.gG)();y||(b=E.init,y=E.info,w=E.loader_config),(0,i.Dg)(e,b||{}),(0,i.GE)(e,w||{}),(0,i.sU)(e,x),y.jsAttributes??={},d.v6&&(y.jsAttributes.isWorker=!0),(0,i.CX)(e,y),g();const T=function(e,t){t||(0,c.R)(e,"api");const h={};var g=a.ee.get(e),p=g.get("tracer"),m="api-",v=m+"ixn-";function b(t,r,n,o){const a=(0,i.C5)(e);return null===r?delete a.jsAttributes[t]:(0,i.CX)(e,{...a,jsAttributes:{...a.jsAttributes,[t]:r}}),x(m,n,!0,o||null===r?"session":void 0)(t,r)}function y(){}["setErrorHandler","finished","addToTrace","inlineHit","addRelease"].forEach((e=>h[e]=x(m,e,!0,"api"))),h.addPageAction=x(m,"addPageAction",!0,n.D.pageAction),h.setCurrentRouteName=x(m,"routeName",!0,n.D.spa),h.setPageViewName=function(t,r){if("string"==typeof t)return"/"!==t.charAt(0)&&(t="/"+t),(0,i.OP)(e).customTransaction=(r||"http://custom.transaction")+t,x(m,"setPageViewName",!0)()},h.setCustomAttribute=function(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2];if("string"==typeof e){if(["string","number"].includes(typeof t)||null===t)return b(e,t,"setCustomAttribute",r);(0,f.Z)("Failed to execute setCustomAttribute.\nNon-null value must be a string or number type, but a type of was provided."))}else(0,f.Z)("Failed to execute setCustomAttribute.\nName must be a string type, but a type of was provided."))},h.setUserId=function(e){if("string"==typeof e||null===e)return b("enduser.id",e,"setUserId",!0);(0,f.Z)("Failed to execute setUserId.\nNon-null value must be a string type, but a type of was provided."))},h.interaction=function(){return(new y).get()};var w=y.prototype={createTracer:function(e,t){var r={},i=this,a="function"==typeof t;return(0,o.p)(v+"tracer",[(0,s.z)(),e,r],i,n.D.spa,g),function(){if(p.emit((a?"":"no-")+"fn-start",[(0,s.z)(),i,a],r),a)try{return t.apply(this,arguments)}catch(e){throw p.emit("fn-err",[arguments,this,"string"==typeof e?new Error(e):e],r),e}finally{p.emit("fn-end",[(0,s.z)()],r)}}}};function x(e,t,r,i){return function(){return(0,o.p)(l.xS,["API/"+t+"/called"],void 0,n.D.metrics,g),i&&(0,o.p)(e+t,[(0,s.z)(),...arguments],r?null:this,i,g),r?void 0:this}}function A(){r.e(439).then(r.bind(r,7438)).then((t=>{let{setAPI:r}=t;r(e),(0,c.L)(e,"api")})).catch((()=>(0,f.Z)("Downloading runtime APIs failed...")))}return["actionText","setName","setAttribute","save","ignore","onEnd","getContext","end","get"].forEach((e=>{w[e]=x(v,e,void 0,n.D.spa)})),h.noticeError=function(e,t){"string"==typeof e&&(e=new Error(e)),(0,o.p)(l.xS,["API/noticeError/called"],void 0,n.D.metrics,g),(0,o.p)("err",[e,(0,s.z)(),!1,t],void 0,n.D.jserrors,g)},d.il?(0,u.b)((()=>A()),!0):A(),h}(e,v);return(0,h.Qy)(e,T,"api"),(0,h.Qy)(e,A,"exposed"),(0,h.EZ)("activatedFeatures",p.T),T}},3325:(e,t,r)=>{r.d(t,{D:()=>n,p:()=>i});const n={ajax:"ajax",jserrors:"jserrors",metrics:"metrics",pageAction:"page_action",pageViewEvent:"page_view_event",pageViewTiming:"page_view_timing",sessionReplay:"session_replay",sessionTrace:"session_trace",spa:"spa"},i={[n.pageViewEvent]:1,[n.pageViewTiming]:2,[n.metrics]:3,[n.jserrors]:4,[n.ajax]:5,[n.sessionTrace]:6,[n.pageAction]:7,[n.spa]:8,[n.sessionReplay]:9}}},n={};function i(e){var t=n[e];if(void 0!==t)return t.exports;var o=n[e]={exports:{}};return r[e](o,o.exports,i),o.exports}i.m=r,i.d=(e,t)=>{for(var r in t)i.o(t,r)&&!i.o(e,r)&&Object.defineProperty(e,r,{enumerable:!0,get:t[r]})},i.f={},i.e=e=>Promise.all(Object.keys(i.f).reduce(((t,r)=>(i.f[r](e,t),t)),[])),i.u=e=>(({78:"page_action-aggregate",147:"metrics-aggregate",242:"session-manager",317:"jserrors-aggregate",348:"page_view_timing-aggregate",412:"lazy-feature-loader",439:"async-api",538:"recorder",590:"session_replay-aggregate",675:"compressor",733:"session_trace-aggregate",786:"page_view_event-aggregate",873:"spa-aggregate",898:"ajax-aggregate"}[e]||e)+"."+{78:"ac76d497",147:"3dc53903",148:"1a20d5fe",242:"2a64278a",317:"49e41428",348:"bd6de33a",412:"2f55ce66",439:"30bd804e",538:"1b18459f",590:"cf0efb30",675:"ae9f91a8",733:"83105561",786:"06482edd",860:"03a8b7a5",873:"e6b09d52",898:"998ef92b"}[e]+"-1.236.0.min.js"),i.o=(e,t)=>Object.prototype.hasOwnProperty.call(e,t),e={},t="NRBA:",i.l=(r,n,o,a)=>{if(e[r])e[r].push(n);else{var s,c;if(void 0!==o)for(var u=document.getElementsByTagName("script"),d=0;d {s.onerror=s.onload=null,clearTimeout(h);var i=e[r];if(delete e[r],s.parentNode&&s.parentNode.removeChild(s),i&&i.forEach((e=>e(n))),t)return t(n)},h=setTimeout(l.bind(null,void 0,{type:"timeout",target:s}),12e4);s.onerror=l.bind(null,s.onerror),s.onload=l.bind(null,s.onload),c&&document.head.appendChild(s)}},i.r=e=>{"undefined"!=typeof Symbol&&Symbol.toStringTag&&Object.defineProperty(e,Symbol.toStringTag,{value:"Module"}),Object.defineProperty(e,"__esModule",{value:!0})},i.j=364,i.p="https://js-agent.newrelic.com/",(()=>{var e={364:0,953:0};i.f.j=(t,r)=>{var n=i.o(e,t)?e[t]:void 0;if(0!==n)if(n)r.push(n[2]);else{var o=new Promise(((r,i)=>n=e[t]=[r,i]));r.push(n[2]=o);var a=i.p+i.u(t),s=new Error;i.l(a,(r=>{if(i.o(e,t)&&(0!==(n=e[t])&&(e[t]=void 0),n)){var o=r&&("load"===r.type?"missing":r.type),a=r&&r.target&&r.target.src;s.message="Loading chunk "+t+" failed.\n("+o+": "+a+")",s.name="ChunkLoadError",s.type=o,s.request=a,n[1](s)}}),"chunk-"+t,t)}};var t=(t,r)=>{var n,o,[a,s,c]=r,u=0;if(a.some((t=>0!==e[t]))){for(n in s)i.o(s,n)&&(i.m[n]=s[n]);if(c)c(i)}for(t&&t(r);u {i.r(o);var e=i(3325),t=i(5763);const r=Object.values(e.D);function n(e){const n={};return r.forEach((r=>{n[r]=function(e,r){return!1!==(0,t.Mt)(r,"".concat(e,".enabled"))}(r,e)})),n}var a=i(9144);var s=i(5546),c=i(385),u=i(8e3),d=i(5938),f=i(3960),l=i(50);class h extends d.W{constructor(e,t,r){let n=!(arguments.length>3&&void 0!==arguments[3])||arguments[3];super(e,t,r),this.auto=n,this.abortHandler,this.featAggregate,this.onAggregateImported,n&&(0,u.R)(e,r)}importAggregator(){let e=arguments.length>0&&void 0!==arguments[0]?arguments[0]:{};if(this.featAggregate||!this.auto)return;const r=c.il&&!0===(0,t.Mt)(this.agentIdentifier,"privacy.cookies_enabled");let n;this.onAggregateImported=new Promise((e=>{n=e}));const o=async()=>{let t;try{if(r){const{setupAgentSession:e}=await Promise.all([i.e(860),i.e(242)]).then(i.bind(i,3228));t=e(this.agentIdentifier)}}catch(e){(0,l.Z)("A problem occurred when starting up session manager. This page will not start or extend any session.",e)}try{if(!this.shouldImportAgg(this.featureName,t))return void(0,u.L)(this.agentIdentifier,this.featureName);const{lazyFeatureLoader:r}=await i.e(412).then(i.bind(i,8582)),{Aggregate:o}=await r(this.featureName,"aggregate");this.featAggregate=new o(this.agentIdentifier,this.aggregator,e),n(!0)}catch(e){(0,l.Z)("Downloading and initializing ".concat(this.featureName," failed..."),e),this.abortHandler?.(),n(!1)}};c.il?(0,f.b)((()=>o()),!0):o()}shouldImportAgg(r,n){return r!==e.D.sessionReplay||!1!==(0,t.Mt)(this.agentIdentifier,"session_trace.enabled")&&(!!n?.isNew||!!n?.state.sessionReplay)}}var g=i(7633),p=i(7894);class m extends h{static featureName=g.t9;constructor(r,n){let i=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];if(super(r,n,g.t9,i),("undefined"==typeof PerformanceNavigationTiming||c.Tt)&&"undefined"!=typeof PerformanceTiming){const n=(0,t.OP)(r);n[g.Dz]=Math.max(Date.now()-n.offset,0),(0,f.K)((()=>n[g.qw]=Math.max((0,p.z)()-n[g.Dz],0))),(0,f.b)((()=>{const t=(0,p.z)();n[g.OJ]=Math.max(t-n[g.Dz],0),(0,s.p)("timing",["load",t],void 0,e.D.pageViewTiming,this.ee)}))}this.importAggregator()}}var v=i(1117),b=i(1284);class y extends v.w{constructor(e){super(e),this.aggregatedData={}}store(e,t,r,n,i){var o=this.getBucket(e,t,r,i);return o.metrics=function(e,t){t||(t={count:0});return t.count+=1,(0,b.D)(e,(function(e,r){t[e]=w(r,t[e])})),t}(n,o.metrics),o}merge(e,t,r,n,i){var o=this.getBucket(e,t,n,i);if(o.metrics){var a=o.metrics;a.count+=r.count,(0,b.D)(r,(function(e,t){if("count"!==e){var n=a[e],i=r[e];i&&!i.c?a[e]=w(i.t,n):a[e]=function(e,t){if(!t)return e;t.c||(t=x(t.t));return t.min=Math.min(e.min,t.min),t.max=Math.max(e.max,t.max),t.t+=e.t,t.sos+=e.sos,t.c+=e.c,t}(i,a[e])}}))}else o.metrics=r}storeMetric(e,t,r,n){var i=this.getBucket(e,t,r);return i.stats=w(n,i.stats),i}getBucket(e,t,r,n){this.aggregatedData[e]||(this.aggregatedData[e]={});var i=this.aggregatedData[e][t];return i||(i=this.aggregatedData[e][t]={params:r||{}},n&&(i.custom=n)),i}get(e,t){return t?this.aggregatedData[e]&&this.aggregatedData[e][t]:this.aggregatedData[e]}take(e){for(var t={},r="",n=!1,i=0;i t.max&&(t.max=e),e 2&&void 0!==arguments[2])||arguments[2];super(e,r,j.t,n),c.il&&((0,t.OP)(e).initHidden=Boolean("hidden"===document.visibilityState),(0,N.N)((()=>(0,s.p)("docHidden",[(0,p.z)()],void 0,j.t,this.ee)),!0),(0,O.bP)("pagehide",(()=>(0,s.p)("winPagehide",[(0,p.z)()],void 0,j.t,this.ee))),this.importAggregator())}}var P=i(3081);class C extends h{static featureName=P.t9;constructor(e,t){let r=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];super(e,t,P.t9,r),this.importAggregator()}}var R,I=i(2210),k=i(1214),H=i(2177),L={};try{R=localStorage.getItem("__nr_flags").split(","),console&&"function"==typeof console.log&&(L.console=!0,-1!==R.indexOf("dev")&&(L.dev=!0),-1!==R.indexOf("nr_dev")&&(L.nrDev=!0))}catch(e){}function z(e){try{L.console&&z(e)}catch(e){}}L.nrDev&&H.ee.on("internal-error",(function(e){z(e.stack)})),L.dev&&H.ee.on("fn-err",(function(e,t,r){z(r.stack)})),L.dev&&(z("NR AGENT IN DEVELOPMENT MODE"),z("flags: "+(0,b.D)(L,(function(e,t){return e})).join(", ")));var M=i(6660);class B extends h{static featureName=M.t;constructor(r,n){let i=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];super(r,n,M.t,i),this.skipNext=0;try{this.removeOnAbort=new AbortController}catch(e){}const o=this;o.ee.on("fn-start",(function(e,t,r){o.abortHandler&&(o.skipNext+=1)})),o.ee.on("fn-err",(function(t,r,n){o.abortHandler&&!n[M.A]&&((0,I.X)(n,M.A,(function(){return!0})),this.thrown=!0,(0,s.p)("err",[n,(0,p.z)()],void 0,e.D.jserrors,o.ee))})),o.ee.on("fn-end",(function(){o.abortHandler&&!this.thrown&&o.skipNext>0&&(o.skipNext-=1)})),o.ee.on("internal-error",(function(t){(0,s.p)("ierr",[t,(0,p.z)(),!0],void 0,e.D.jserrors,o.ee)})),this.origOnerror=c._A.onerror,c._A.onerror=this.onerrorHandler.bind(this),c._A.addEventListener("unhandledrejection",(t=>{const r=function(e){let t="Unhandled Promise Rejection: ";if(e instanceof Error)try{return e.message=t+e.message,e}catch(t){return e}if(void 0===e)return new Error(t);try{return new Error(t+(0,D.P)(e))}catch(e){return new Error(t)}}(t.reason);(0,s.p)("err",[r,(0,p.z)(),!1,{unhandledPromiseRejection:1}],void 0,e.D.jserrors,this.ee)}),(0,O.m$)(!1,this.removeOnAbort?.signal)),(0,k.gy)(this.ee),(0,k.BV)(this.ee),(0,k.em)(this.ee),(0,t.OP)(r).xhrWrappable&&(0,k.Kf)(this.ee),this.abortHandler=this.#e,this.importAggregator()}#e(){this.removeOnAbort?.abort(),this.abortHandler=void 0}onerrorHandler(t,r,n,i,o){"function"==typeof this.origOnerror&&this.origOnerror(...arguments);try{this.skipNext?this.skipNext-=1:(0,s.p)("err",[o||new F(t,r,n),(0,p.z)()],void 0,e.D.jserrors,this.ee)}catch(t){try{(0,s.p)("ierr",[t,(0,p.z)(),!0],void 0,e.D.jserrors,this.ee)}catch(e){}}return!1}}function F(e,t,r){this.message=e||"Uncaught error with no additional information",this.sourceURL=t,this.line=r}let U=1;const q="nr@id";function G(e){const t=typeof e;return!e||"object"!==t&&"function"!==t?-1:e===c._A?0:(0,I.X)(e,q,(function(){return U++}))}function V(e){if("string"==typeof e&&e.length)return e.length;if("object"==typeof e){if("undefined"!=typeof ArrayBuffer&&e instanceof ArrayBuffer&&e.byteLength)return e.byteLength;if("undefined"!=typeof Blob&&e instanceof Blob&&e.size)return e.size;if(!("undefined"!=typeof FormData&&e instanceof FormData))try{return(0,D.P)(e).length}catch(e){return}}}var X=i(7243);class W{constructor(e){this.agentIdentifier=e,this.generateTracePayload=this.generateTracePayload.bind(this),this.shouldGenerateTrace=this.shouldGenerateTrace.bind(this)}generateTracePayload(e){if(!this.shouldGenerateTrace(e))return null;var r=(0,t.DL)(this.agentIdentifier);if(!r)return null;var n=(r.accountID||"").toString()||null,i=(r.agentID||"").toString()||null,o=(r.trustKey||"").toString()||null;if(!n||!i)return null;var a=(0,_.M)(),s=(0,_.Ht)(),c=Date.now(),u={spanId:a,traceId:s,timestamp:c};return(e.sameOrigin||this.isAllowedOrigin(e)&&this.useTraceContextHeadersForCors())&&(u.traceContextParentHeader=this.generateTraceContextParentHeader(a,s),u.traceContextStateHeader=this.generateTraceContextStateHeader(a,c,n,i,o)),(e.sameOrigin&&!this.excludeNewrelicHeader()||!e.sameOrigin&&this.isAllowedOrigin(e)&&this.useNewrelicHeaderForCors())&&(u.newrelicHeader=this.generateTraceHeader(a,s,c,n,i,o)),u}generateTraceContextParentHeader(e,t){return"00-"+t+"-"+e+"-01"}generateTraceContextStateHeader(e,t,r,n,i){return i+"@nr=0-1-"+r+"-"+n+"-"+e+"----"+t}generateTraceHeader(e,t,r,n,i,o){if(!("function"==typeof c._A?.btoa))return null;var a={v:[0,1],d:{ty:"Browser",ac:n,ap:i,id:e,tr:t,ti:r}};return o&&n!==o&&(a.d.tk=o),btoa((0,D.P)(a))}shouldGenerateTrace(e){return this.isDtEnabled()&&this.isAllowedOrigin(e)}isAllowedOrigin(e){var r=!1,n={};if((0,t.Mt)(this.agentIdentifier,"distributed_tracing")&&(n=(0,t.P_)(this.agentIdentifier).distributed_tracing),e.sameOrigin)r=!0;else if(n.allowed_origins instanceof Array)for(var i=0;i 2&&void 0!==arguments[2])||arguments[2];super(r,n,Z.t,i),(0,t.OP)(r).xhrWrappable&&(this.dt=new W(r),this.handler=(e,t,r,n)=>(0,s.p)(e,t,r,n,this.ee),(0,k.u5)(this.ee),(0,k.Kf)(this.ee),function(r,n,i,o){function a(e){var t=this;t.totalCbs=0,t.called=0,t.cbTime=0,t.end=E,t.ended=!1,t.xhrGuids={},t.lastSize=null,t.loadCaptureCalled=!1,t.params=this.params||{},t.metrics=this.metrics||{},e.addEventListener("load",(function(r){_(t,e)}),(0,O.m$)(!1)),c.IF||e.addEventListener("progress",(function(e){t.lastSize=e.loaded}),(0,O.m$)(!1))}function s(e){this.params={method:e[0]},T(this,e[1]),this.metrics={}}function u(e,n){var i=(0,t.DL)(r);i.xpid&&this.sameOrigin&&n.setRequestHeader("X-NewRelic-ID",i.xpid);var a=o.generateTracePayload(this.parsedOrigin);if(a){var s=!1;a.newrelicHeader&&(n.setRequestHeader("newrelic",a.newrelicHeader),s=!0),a.traceContextParentHeader&&(n.setRequestHeader("traceparent",a.traceContextParentHeader),a.traceContextStateHeader&&n.setRequestHeader("tracestate",a.traceContextStateHeader),s=!0),s&&(this.dt=a)}}function d(e,t){var r=this.metrics,i=e[0],o=this;if(r&&i){var a=V(i);a&&(r.txSize=a)}this.startTime=(0,p.z)(),this.listener=function(e){try{"abort"!==e.type||o.loadCaptureCalled||(o.params.aborted=!0),("load"!==e.type||o.called===o.totalCbs&&(o.onloadCalled||"function"!=typeof t.onload)&&"function"==typeof o.end)&&o.end(t)}catch(e){try{n.emit("internal-error",[e])}catch(e){}}};for(var s=0;s 1?e[1]=i:e.push(i)}else e[0]&&e[0].headers&&s(e[0].headers,n)&&(this.dt=n);function s(e,t){var r=!1;return t.newrelicHeader&&(e.set("newrelic",t.newrelicHeader),r=!0),t.traceContextParentHeader&&(e.set("traceparent",t.traceContextParentHeader),t.traceContextStateHeader&&e.set("tracestate",t.traceContextStateHeader),r=!0),r}}function x(e,t){this.params={},this.metrics={},this.startTime=(0,p.z)(),this.dt=t,e.length>=1&&(this.target=e[0]),e.length>=2&&(this.opts=e[1]);var r,n=this.opts||{},i=this.target;"string"==typeof i?r=i:"object"==typeof i&&i instanceof Y?r=i.url:c._A?.URL&&"object"==typeof i&&i instanceof URL&&(r=i.href),T(this,r);var o=(""+(i&&i instanceof Y&&i.method||n.method||"GET")).toUpperCase();this.params.method=o,this.txSize=V(n.body)||0}function A(t,r){var n;this.endTime=(0,p.z)(),this.params||(this.params={}),this.params.status=r?r.status:0,"string"==typeof this.rxSize&&this.rxSize.length>0&&(n=+this.rxSize);var o={txSize:this.txSize,rxSize:n,duration:(0,p.z)()-this.startTime};i("xhr",[this.params,o,this.startTime,this.endTime,"fetch"],this,e.D.ajax)}function E(t){var r=this.params,n=this.metrics;if(!this.ended){this.ended=!0;for(var o=0;o 2&&void 0!==arguments[2])||arguments[2];super(e,t,we.t,r),this.importAggregator()}}new class{constructor(e){let t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:(0,_.ky)(16);c._A?(this.agentIdentifier=t,this.sharedAggregator=new y({agentIdentifier:this.agentIdentifier}),this.features={},this.desiredFeatures=new Set(e.features||[]),this.desiredFeatures.add(m),Object.assign(this,(0,a.j)(this.agentIdentifier,e,e.loaderType||"agent")),this.start()):(0,l.Z)("Failed to initial the agent. Could not determine the runtime environment.")}get config(){return{info:(0,t.C5)(this.agentIdentifier),init:(0,t.P_)(this.agentIdentifier),loader_config:(0,t.DL)(this.agentIdentifier),runtime:(0,t.OP)(this.agentIdentifier)}}start(){const t="features";try{const r=n(this.agentIdentifier),i=[...this.desiredFeatures];i.sort(((t,r)=>e.p[t.featureName]-e.p[r.featureName])),i.forEach((t=>{if(r[t.featureName]||t.featureName===e.D.pageViewEvent){const n=function(t){switch(t){case e.D.ajax:return[e.D.jserrors];case e.D.sessionTrace:return[e.D.ajax,e.D.pageViewEvent];case e.D.sessionReplay:return[e.D.sessionTrace];case e.D.pageViewTiming:return[e.D.pageViewEvent];default:return[]}}(t.featureName);n.every((e=>r[e]))||(0,l.Z)("".concat(t.featureName," is enabled but one or more dependent features has been disabled (").concat((0,D.P)(n),"). This may cause unintended consequences or missing data...")),this.features[t.featureName]=new t(this.agentIdentifier,this.sharedAggregator)}})),(0,T.Qy)(this.agentIdentifier,this.features,t)}catch(e){(0,l.Z)("Failed to initialize all enabled instrument classes (agent aborted) -",e);for(const e in this.features)this.features[e].abortHandler?.();const r=(0,T.fP)();return delete r.initializedAgents[this.agentIdentifier]?.api,delete r.initializedAgents[this.agentIdentifier]?.[t],delete this.sharedAggregator,r.ee?.abort(),delete r.ee?.get(this.agentIdentifier),!1}}}({features:[J,m,S,class extends h{static featureName=oe;constructor(t,r){if(super(t,r,oe,!(arguments.length>2&&void 0!==arguments[2])||arguments[2]),!c.il)return;const n=this.ee;let i;(0,k.QU)(n),this.eventsEE=(0,k.em)(n),this.eventsEE.on(se,(function(e,t){this.bstStart=(0,p.z)()})),this.eventsEE.on(ae,(function(t,r){(0,s.p)("bst",[t[0],r,this.bstStart,(0,p.z)()],void 0,e.D.sessionTrace,n)})),n.on(ce+ne,(function(e){this.time=(0,p.z)(),this.startPath=location.pathname+location.hash})),n.on(ce+ie,(function(t){(0,s.p)("bstHist",[location.pathname+location.hash,this.startPath,this.time],void 0,e.D.sessionTrace,n)}));try{i=new PerformanceObserver((t=>{const r=t.getEntries();(0,s.p)(te,[r],void 0,e.D.sessionTrace,n)})),i.observe({type:re,buffered:!0})}catch(e){}this.importAggregator({resourceObserver:i})}},C,xe,B,class extends h{static featureName=de;constructor(e,r){if(super(e,r,de,!(arguments.length>2&&void 0!==arguments[2])||arguments[2]),!c.il)return;if(!(0,t.OP)(e).xhrWrappable)return;try{this.removeOnAbort=new AbortController}catch(e){}let n,i=0;const o=this.ee.get("tracer"),a=(0,k._L)(this.ee),s=(0,k.Lg)(this.ee),u=(0,k.BV)(this.ee),d=(0,k.Kf)(this.ee),f=this.ee.get("events"),l=(0,k.u5)(this.ee),h=(0,k.QU)(this.ee),g=(0,k.Gm)(this.ee);function m(e,t){h.emit("newURL",[""+window.location,t])}function v(){i++,n=window.location.hash,this[ve]=(0,p.z)()}function b(){i--,window.location.hash!==n&&m(0,!0);var e=(0,p.z)();this[pe]=~~this[pe]+e-this[ve],this[ye]=e}function y(e,t){e.on(t,(function(){this[t]=(0,p.z)()}))}this.ee.on(ve,v),s.on(be,v),a.on(be,v),this.ee.on(ye,b),s.on(ge,b),a.on(ge,b),this.ee.buffer([ve,ye,"xhr-resolved"],this.featureName),f.buffer([ve],this.featureName),u.buffer(["setTimeout"+le,"clearTimeout"+fe,ve],this.featureName),d.buffer([ve,"new-xhr","send-xhr"+fe],this.featureName),l.buffer([me+fe,me+"-done",me+he+fe,me+he+le],this.featureName),h.buffer(["newURL"],this.featureName),g.buffer([ve],this.featureName),s.buffer(["propagate",be,ge,"executor-err","resolve"+fe],this.featureName),o.buffer([ve,"no-"+ve],this.featureName),a.buffer(["new-jsonp","cb-start","jsonp-error","jsonp-end"],this.featureName),y(l,me+fe),y(l,me+"-done"),y(a,"new-jsonp"),y(a,"jsonp-end"),y(a,"cb-start"),h.on("pushState-end",m),h.on("replaceState-end",m),window.addEventListener("hashchange",m,(0,O.m$)(!0,this.removeOnAbort?.signal)),window.addEventListener("load",m,(0,O.m$)(!0,this.removeOnAbort?.signal)),window.addEventListener("popstate",(function(){m(0,i>1)}),(0,O.m$)(!0,this.removeOnAbort?.signal)),this.abortHandler=this.#e,this.importAggregator()}#e(){this.removeOnAbort?.abort(),this.abortHandler=void 0}}],loaderType:"spa"})})(),window.NRBA=o})(); window.jQuery || document.write(' ') CKEDITOR_BASEPATH='https://f1000research.com/js/vendor/ckeditor/' window.reactTheme = 'research'; window.MathJax = { CommonHTML: { linebreaks: { automatic: true } }, 'HTML-CSS': { linebreaks: { automatic: true } }, SVG: { linebreaks: { automatic: true } }, AuthorInit: function() { MathJax.Hub.Register.MessageHook('End Process', function () { let timeout = false; // holder for timeout id const delay = 250; // delay after event is "complete" to run callback const reflowMath = function() { const dispFormulas = document.querySelectorAll('.disp-formula.panel'); if (!dispFormulas) { return; } for (const dispFormula of dispFormulas) { const child = dispFormula.querySelector('.MathJax_Preview').nextSibling.firstChild; const isMultiline = MathJax.Hub.getAllJax(dispFormula)[0].root.isMultiline; if (dispFormula.offsetWidth < child.offsetWidth || isMultiline) { MathJax.Hub.Queue(['Rerender', MathJax.Hub, dispFormula]); } } }; window.addEventListener('resize', function() { clearTimeout(timeout); // clear the timeout timeout = setTimeout(reflowMath, delay); // start timing for event "completion" }); }); }, }; if (window.location.hash == '#_=_'){ window.location = window.location.href.split('#')[0] } !function(f,b,e,v,n,t,s){if(f.fbq)return;n=f.fbq=function() {n.callMethod? n.callMethod.apply(n,arguments):n.queue.push(arguments)} ;if(!f._fbq)f._fbq=n; n.push=n;n.loaded=!0;n.version='2.0';n.queue=[];t=b.createElement(e);t.async=!0; t.src=v;s=b.getElementsByTagName(e)[0];s.parentNode.insertBefore(t,s)}(window, document,'script','https://connect.facebook.net/en_US/fbevents.js'); fbq('init', '1641728616063202'); fbq('track', "PixelInitialized", {}); (function(h,o,t,j,a,r){ h.hj=h.hj||function(){(h.hj.q=h.hj.q||[]).push(arguments)}; h._hjSettings={hjid:2318163,hjsv:6}; a=o.getElementsByTagName('head')[0]; r=o.createElement('script');r.async=1; r.src=t+h._hjSettings.hjid+j+h._hjSettings.hjsv; a.appendChild(r); })(window,document,'https://static.hotjar.com/c/hotjar-','.js?sv='); search file_upload Submit your research search menu close search Browse Gateways & Collections How to Publish Submit your Research My Submissions Article Guidelines Article Guidelines (New Versions) Open Data, Software and Code Guidelines Open Data and Accessible Source Materials Guidelines (HSS) Open Data, Software and Code Guidelines (PSE) Prepublication Checks Production Process Posters and Slides Guidelines Document Guidelines Article Processing Charges Peer Review Finding Article Reviewers About How it Works For Reviewers Our Advisors Policies Glossary FAQs For Developers Newsroom Contact My Research Submissions Content and Tracking Alerts My Details Sign In file_upload Submit your research { "@context": "https://schema.org", "@type": "ScholarlyArticle", "mainEntityOfPage": { "@type": "WebPage", "@id": "https://f1000research.com/articles/15-99" }, "headline": "Pathophysiological Effects of Titanium Dioxide Nanoparticles and the Protective Role of Piperine and a...", "datePublished": "2026-01-21T07:12:47", "dateModified": "2026-01-21T07:12:47", "author": [ { "@type": "Person", "name": "Ahmed Jasim Nawfal" }, { "@type": "Person", "name": "Zahraa S. Mahdi" }, { "@type": "Person", "name": "Rafid Khalid Ali" } ], "publisher": { "@type": "Organization", "name": "F1000Research", "logo": { "@type": "ImageObject", "url": "https://f1000research.com/img/AMP/F1000Research_image.png", "height": 480, "width": 60 } }, "image": { "@type": "ImageObject", "url": "https://f1000research.com/img/AMP/F1000Research_image.png", "height": 1200, "width": 150 }, "description": " Background This study aimed to evaluate the protective role of piperine and piperine-loaded titanium dioxide nanoparticles on oxidative and biochemical parameters, antioxidant levels, and cytogenetic parameters in the brain. Methods forty rats were randomly divided into four equal groups for 35 days as follow: the control group was administered DW/IP; the G1 group received 40 mg/kg B.W. of piperine orally; The G2 group was given TiO2NPs (50 mg/kg B.W.)/i.p. received; and the G3 group received 75 mg/kg B.W. /I. P. of PIP-TiO2NPs. Results A significant increase in serum TAO-C and a significant decrease in ROS were observed in G1 and G3 compared to G2 and the control groups. A significant reduction in serum neurotransmitter concentration was found in the G2 group compared to the G1, control, and G3 groups, while a significant increase was observed in the G1 group. Gene expression data for cyclooxygenase showed upregulation in the G2 group and was significantly higher than in the G3, G1, and control groups. Histopathological examination showed normal brain layers, hippocampus, and thalamus appearance in G1, G2, G3, and the control groups. The G2 group showed mild vascular congestion, hyperplasia, and mild disruption in the molecular cell layer of the cerebral cortex. The hippocampus of the G3 group showed moderate vacuolation with glial reduction. Conclusions These findings indicate that piperine, combined with TiO2NPs (PIP-TiO2NPs), provides neuroprotection by reducing oxidative stress and inflammatory responses induced by TiO2NPs in the rat brain. " } { "@context": "http://schema.org", "@type": "BreadcrumbList", "itemListElement": [ { "@type": "ListItem", "position": "1", "item": { "@id": "https://f1000research.com/", "name": "Home" } }, { "@type": "ListItem", "position": "2", "item": { "@id": "https://f1000research.com/browse/articles", "name": "Browse" } }, { "@type": "ListItem", "position": "3", "item": { "@id": "https://f1000research.com/articles/15-99", "name": "Pathophysiological Effects of Titanium Dioxide Nanoparticles and the..." } } ] } Home Browse Pathophysiological Effects of Titanium Dioxide Nanoparticles and the... ALL Metrics - Views Downloads Get PDF Get XML Cite How to cite this article Jasim Nawfal A, S. Mahdi Z and Khalid Ali R. Pathophysiological Effects of Titanium Dioxide Nanoparticles and the Protective Role of Piperine and a Piperine-TiO₂NP Combination in Rats. [version 1; peer review: 1 not approved] . F1000Research 2026, 15 :99 ( https://doi.org/10.12688/f1000research.173446.1 ) NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article. Close Copy Citation Details Export Export Citation Sciwheel EndNote Ref. Manager Bibtex ProCite Sente EXPORT Select a format first Track Share ▬ ✚ Research Article Pathophysiological Effects of Titanium Dioxide Nanoparticles and the Protective Role of Piperine and a Piperine-TiO₂NP Combination in Rats. [version 1; peer review: 1 not approved] Ahmed Jasim Nawfal https://orcid.org/0009-0002-9076-0013 1 , Zahraa S. Mahdi 2 , Rafid Khalid Ali 3 Ahmed Jasim Nawfal https://orcid.org/0009-0002-9076-0013 1 , Zahraa S. Mahdi 2 , Rafid Khalid Ali 3 PUBLISHED 21 Jan 2026 Author details Author details 1 Department of Physiology and Medical Physics, College of Medicine, University of Fallujah, Al-Fallujah, Al Anbar Governorate, Iraq 2 Department of Pathology and Poultry Disease, College of Veterinary Medicine, University of Kerbala College of Veterinary Medicine, Karbala, Karbala Governorate, Iraq 3 Department of Pathology and Poultry Disease, College of Veterinary Medicine, University of Fallujah, Al-Fallujah, Al Anbar Governorate, Iraq Ahmed Jasim Nawfal Roles: Formal Analysis, Investigation, Methodology, Supervision, Writing – Review & Editing Zahraa S. Mahdi Roles: Conceptualization, Data Curation, Resources, Validation Rafid Khalid Ali Roles: Formal Analysis, Investigation, Project Administration, Software OPEN PEER REVIEW DETAILS REVIEWER STATUS This article is included in the Nanoscience & Nanotechnology gateway. This article is included in the Fallujah Multidisciplinary Science and Innovation gateway. Abstract Background This study aimed to evaluate the protective role of piperine and piperine-loaded titanium dioxide nanoparticles on oxidative and biochemical parameters, antioxidant levels, and cytogenetic parameters in the brain. Methods forty rats were randomly divided into four equal groups for 35 days as follow: the control group was administered DW/IP; the G1 group received 40 mg/kg B.W. of piperine orally; The G2 group was given TiO2NPs (50 mg/kg B.W.)/i.p. received; and the G3 group received 75 mg/kg B.W. /I. P. of PIP-TiO2NPs. Results A significant increase in serum TAO-C and a significant decrease in ROS were observed in G1 and G3 compared to G2 and the control groups. A significant reduction in serum neurotransmitter concentration was found in the G2 group compared to the G1, control, and G3 groups, while a significant increase was observed in the G1 group. Gene expression data for cyclooxygenase showed upregulation in the G2 group and was significantly higher than in the G3, G1, and control groups. Histopathological examination showed normal brain layers, hippocampus, and thalamus appearance in G1, G2, G3, and the control groups. The G2 group showed mild vascular congestion, hyperplasia, and mild disruption in the molecular cell layer of the cerebral cortex. The hippocampus of the G3 group showed moderate vacuolation with glial reduction. Conclusions These findings indicate that piperine, combined with TiO 2 NPs (PIP-TiO 2 NPs), provides neuroprotection by reducing oxidative stress and inflammatory responses induced by TiO 2 NPs in the rat brain. READ ALL READ LESS Keywords Antioxidants, Brain, Cerebral Cortex, Cyclooxygenase, Hippocampus, Nanoparticles, Neuroinflammation, Neurotransmitters Corresponding Author(s) Ahmed Jasim Nawfal ( [email protected] ) Close Corresponding author: Ahmed Jasim Nawfal Competing interests: No competing interests were disclosed. Grant information: The author(s) declared that no grants were involved in supporting this work. Copyright: © 2026 Jasim Nawfal A et al . This is an open access article distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. How to cite: Jasim Nawfal A, S. Mahdi Z and Khalid Ali R. Pathophysiological Effects of Titanium Dioxide Nanoparticles and the Protective Role of Piperine and a Piperine-TiO₂NP Combination in Rats. [version 1; peer review: 1 not approved] . F1000Research 2026, 15 :99 ( https://doi.org/10.12688/f1000research.173446.1 ) First published: 21 Jan 2026, 15 :99 ( https://doi.org/10.12688/f1000research.173446.1 ) Latest published: 21 Jan 2026, 15 :99 ( https://doi.org/10.12688/f1000research.173446.1 ) Introduction Exposure to titanium dioxide nanoparticles (TiO 2 NPs) is associated with several systemic toxic effects. Titanium is extensively used in biomedical applications owing to its high biocompatibility. Titanium implants may release titanium dioxide (TiO 2 ) nanoparticles (NP), which can enter the bloodstream and reach different organs including the brain. 1 , 2 Despite the precise processes and particle quantities that penetrate the blood-brain barrier being unclear, TiO 2 NPs can enter the brain after ingestion. According to Ref. 3 , exposure to titanium dioxide nanoparticles induces oxidative stress, neuroinflammation, brain chemistry alterations, and impairment of neuronal structure and functionality. Neural damage may result in behavioral disturbances and contribute to the development of neurodevelopmental and neurodegenerative diseases. Such neuronal injury and the neurodevelopment or neurodegenerative disorders that follow, along with any behavioral disorders that may be present, can be partially attributed to oxidative stress and inflammation. 4 Although Ref. 5 noted that inflammation levels in mineral miners exposed to titanium dioxide nanoparticles were significantly higher, the specific details surrounding the neurotoxicity of such exposure remain nebulous. The central nervous system responds to TiO 2 NPs exposure by activating the neuroinflammatory pathway, as reported by Ref. 6 . TiO 2 NPs can induce genotoxicity through both direct and indirect mechanisms. Direct genotoxicity occurs when nanoparticles penetrate the nucleus, interact with the DNA, and inhibit replication. Indirect genotoxicity arises from ROS generation, suppression of antioxidant defenses, and releasing toxic ions from NPs. 7 , 8 Following cellular uptake, TiO 2 NPs accumulate in lysosomes, leading to lysosomal damage and cytosolic enzyme release, which combines with other cell components to produce inflammation, oxidative stress, DNA damage, and altered gene expression. 9 , 10 Piperine is a bioactive alkaloid responsible for the pungency of black pepper (Piper nigrum) and long pepper (Piper longum). 11 , 12 Chronic administration of piperine has demonstrated antioxidant properties and cognitive benefits. 13 Accumulating evidence supports the therapeutic potential of piperine and its metabolites in treating cancer, cardiovascular and hepatic diseases, and neurological diseases. In the case of piperine, to understand the tradeoffs in its use, particularly in the Central Nervous System, it is vital to evaluate the pharmacological profile alongside the associated toxicity. In a model of PD (Parkinson’s Disease), it was shown that the administration of piperine prevented the death of neuronal cells 14 and in a model of AD (Alzheimer’s Disease), enhanced cognition, 15 while also reducing depression, as seen in the works of 16 and associated with Huntington’s Disease. 17 According to the World Health Organization,450 million individuals worldwide suffer from mental or cognitive disorders. Like other plants of the Piperaceae family, the fruits of black pepper (Piper nigrum), long pepper (Piper longum), and some other piper plants contain an alkaloid piperine (1-piperoylpiperidine) that has a nitrogenous and pungent characteristic. Current studies in pharmacology suggest that piperine exerts anti-inflammatory and analgesic properties, 18 anticonvulsant, 19 and antiulcer 20 activities, as well as depression, 21 and cytoprotection and antioxidant effects. 22 This study aims to evaluate the harmful effects of titanium dioxide nanoparticles (TiO 2 NPs) and assess the potential protective roles of piperine alone or in combination with TiO 2 NPs (PIP-TiO 2 NPs) to alleviate TiO 2 NP-induced physiological neurological disorders. Methods Preparation of an aqueous solution of titanium dioxide According to the instructions provided by Ref. 23 , titanium tetrachloride (TiCl 4 ) and 99.9% ethanol are mixed at room temperature for 30 minutes while stirring at 600 rpm under a fume hood. The clear solution that resulted was used for manufacturing nanoparticles. Preparation of an aqueous solution of black pepper extract (piperine) Two and a half grams of black pepper extract (piperine) was dissolved in 25 mL of deionized desalinated water according to Ref. 24 , stirred at 300 rpm for 10 to 20 minutes with a magnetic hotplate stirrer at room temperature, and then filtered through Whatman ® filter paper. The resulting clear solution was used to produce nanoparticles. Biosynthesis of titanium dioxide (TiO 2 ) nanoparticles using black pepper extract Green titanium dioxide (TiO 2 ) nanoparticles were synthesized by adding 14 mL of titanium tetrachloride (ACROS Organics, France) TiCl 4 99.99% to 140 mL of absolute ethanol CH 3 CH 2 OH 99.99% (Ferak, Germany) with an ethanol ratio. The reaction was carried out at room temperature with stirring (600 rpm) and continued for 30 minutes under a hood due to the large amount of Cl 2 and HCl produced. The solution was allowed to rest and cool to room temperature, and then the solution’s pH was measured in the range 1–2. 23 Two and a half grams of piperine powder was dispersed in 25 ml of DD water at a ratio of 1:10 24 and filtered through Whatman ® filter paper. The resulting clear solution was used for the synthesis of nanoparticles. Then, the piperine solution was mixed with titanium in a ratio of 2:1 under stirring (700 rpm) for 3 hours at room temperature, where a clear yellow solution was formed. After that, the mixture was stirred for 30 minutes while 10–15 mL of ammonia (BDH, England) was added dropwise to maintain pH 6–7. 25 After centrifuging and rinsing three times with deionized water to get rid of contaminants, the mixture was dried for three hours at 100 °C and calcined for two hours at 500 °C. 26 Characterization of piperine-TiO 2 nanoparticles UV-visible (ultraviolet-visible) spectroscopic The stability and optical properties of nanoparticles were analyzed using UV-visible spectroscopy (Shimadzu, Japan). After diluting a small amount of the sample in distilled water, the UV-visible spectrum of the reducing agent was measured. To detect the bioreduction of piperine-TiO 2 nanoparticles, a UV-visible spectrophotometer was used to measure surface plasmon resonance (SPR) in the wavelength range 200–800 nm. Electromagnetic waves were analyzed spectroscopically in the wavelength range of 190–1100 nm. Surface plasmon resonance is represented as peaks in the UV-visible absorption spectra of nanoscale particles. 27 Diffraction of X-rays (XRD) To characterize the formation, size and crystallinity of piperine-TiO 2 nanoparticles, an XRD pattern (Philips, Holland) was obtained after measuring the Bragg angle at 2θ. After centrifuging the nanoparticles for 30 minutes at 10,000 rpm, they were cleaned repeatedly using 20 milliliters of deionized water. A simultaneous theta-2 theta scan with a scan rate of 0.2000°/min was employed to acquire XRD patterns in the 10,000–90,000° range. The Debye–Scherrer equation was used to determine the crystallite size 28 : D = Kλ / β cosθ where D is the nanoparticle diameter, K is a constant (0.94), FWHM is full width at half maximum, and θ is the Bragg diffraction angle. XRD testing was performed using the Rietveld method 29 at Tehran University Central Lab. Fourier transform infrared spectroscopy (FTIR) The prepared piperine-TiO 2 nanoparticles in dry pellet form were subjected to FTIR spectroscopy (ABB/Spectro Lab, England). The number of scans was approximately 24, and the laser phase, F and D amplitudes were 35. Conventional KBr pellet technique was used for FTIR studies. The ratio between infrared light intensity and wave number was measured in the range 400–4000 cm −1 . This analysis is important for elucidating functional groups in organic solutions involved in nanoparticle synthesis. The calculated spectra show optically dependent properties of nanoparticles, such as extinction cross section, scattering-to-absorption ratio, nanoparticle size and resonance wavelength. 30 The work was carried out in the laboratories of the Ministry of Science and Technology, the Institute for Materials Research and the Medical Materials and Equipment Research Centre. Scanning Electron Microscopy (SEM) Scanning electron microscopy (TESCAN MIRA3, Czech Republic) was used to detect the size and morphology of titanium dioxide nanoparticles. Dry piperine-TiO 2 nanoparticle thin films were prepared by dropping a small amount of the solution onto a cover glass grid and allowing it to dry at ambient temperature before observation. SEM was performed under the following parameters: Mag = 2305 × , signal A = SE2, HV = 30.00 kV and WD = 12.6 mm. 31 Transmission Electron Microscopy (TEM) A transmission electron microscope (Philips EM208S, Holland) was used to examine the size and shape of piperine-TiO 2 nanoparticles. The procedure of dropping dried materials onto TEM grids and letting them dry frequently results in nanoparticle accumulation. 32 EDX (energy-dispersive X-ray) spectroscopy The elemental composition of the particles under SEM analysis was evaluated using EDX spectroscopy. 33 This work was completed at Tehran University Central Lab. Study design Forty adult male rats weighing 185 ± 15 g were obtained from the College of veterinary medicine, University of Baghdad. The animals were housed in cages, each cage housed five rats and was cleaned daily, in the animal facility of the College of Medicine, University of Fallujah. They were maintained under standard laboratory conditions (temperature 22 ± 2°C, relative humidity 55 ± 10%, and a 12 h light/dark cycle) and had free access to tap water and a standard commercial pellet diet throughout the experiment. The rats were randomly divided into four equal groups (n = 10 per group) and treated for 35 days, as shown: Control group: Rats were injected intraperitoneally (i/p) with sterile distilled water, G1 group: Rats were administered piperine orally 40 mg/kg. B.w. 34 (Piperine was obtained as Black Pepper Extract from Charge Products/United Kingdom), G2 group: Rats were administered TiO2 NPs (i/p) of 50 mg/kg. B.w., 35 , 36 G3 group: Rats received a combined 75 mg/kg treatment. B.w. i/p of Piperine- TiO2NPs, 37 TiO 2 nanoparticles and the combined piperine – TiO 2 formulation were prepared in the laboratory according to the referenced methods cited for each compound. Randomization was performed using simple random allocation, and all doses were calculated relative to body weight (mg/kg). Blood collection and analysis Blood samples were collected via the Retro-orbital sinus technique, from anesthetized rats by intramuscular injection of 16 mg Xylazine + 60 mg ketamine i.m./kg B.W. 38 (Rambon/Germany), sample were placed in non-heparinized gel tubes and allowed to stand for 30 minutes before being centrifuged (for 15 minutes at 3000 rpm) and stored in firmly sealed tubes for further analysis at -20°C until analysis for the following parameters: Noradrenalin, glutamate, and gamma-aminobutyric acid (GABA) (Cloud-Clone Corp/USA). Serum total antioxidant capacity (TAO-C, U/mL) was measured calorimetrically using a Kit (YL Biotech/ China). Serum reactive oxygen species concentration was determined calorimetrically using an ELISA kit (SUNLONG/China) following the manufacturer’s instructions. Serum malondialdehyde (MDA) levels were determined colorimetrically. 39 Molecular study of Cyclooxygenase Cyclooxygenase (COX) Gene expression in brain tissues was determined using quantitative real-time PCR (qRT-PCR). Relative transcript levels were calculated using the comparative Ct methodology (ΔΔCt), normalized to 12S-rRNA, and expressed relative to the control group. 40 The COX gene was amplified using the following primers ( Table 1 ), as previously described by reference. 41 Table 1. Primer sequences used for COX and 12S-rRNA gene in brain rats tissues. Name of Primer ‘5---------3’ Sequence Target gene Rat-CO-F CCACCAAACCCATGCATACC Gene of interest (COX) Rat-CO-R CAGTATCATGCTGCGGCTTC Rat-12S-rRNA-F AGGTTTGGTCCTGGCCTT Internal reference gene (normalizer) Rat-12S-rRNA-R GGCGGTGTGTGCGTACTTCATT Histopathological study At the end of the experiment, euthanasia was performed using an overdose of anesthetic, which is an AVMA-approved method. After euthanasia, the rats remained under deep anesthesia and their brains were carefully removed from the skull for histological examination. The cerebral cortex and hippocampus were dissected, blotted, and fixed in 10% neutral buffered formalin for histological processing. Paraffin-embedded brain sections were stained with Hematoxylin-Eosin (H and E) stains according to Bancroft’s methods. 42 Statistical analysis Data were analyzed using SPSS statistical software (version 31). 43 One-way ANOVA followed by the Least Significant Difference (LSD) test assessed differences among groups at a significance level of P < 0.05. Results The mean serum total antioxidant capacity (TAO-C) concentration in all treated groups is shown in Figure 1 . Significant (P < 0.05) increases in serum TAO-C were observed following treatment with piperine (G1) alone (A17.01±0.70a) or PIP-TiO 2 NPs (G3) (B11.09±0.27c) compared to TiO 2 NPs (G2) (B 8.77 ± 0.15d) at the 5th weeks of experiment However, when compared with the control group (A17.01±0.70a), all treated groups exhibited a significant (P < 0.05) decrease in TAO-C levels. Figure 1. Effect of Piperine, TiO2NPs, PIP-TiO2NPs treatment on serum total antioxidant capacity (TAO-C) concentration (U/mL). Values are expressed as mean ± SE (n = 10). C: control; G1: piperine 40 mg/kg B.W.; G2: TiO 2 NPs 50 mg/kg i.p.; G3: PIP – TiO 2 NPs 75 mg/kg i.p. for 5 weeks. Figure 2 shows all experimental groups’ serum reactive oxygen species (ROS)levels. The G2 treatment group (intraperitoneal titanium dioxide nanoparticles at a dose of 50 mg/kg/day) showed a significant (P < 0.05) decrease in serum ROS levels (A 530.66 ± 2.19 a) compared to other treatment groups. The result also showed that treatment with G1 (orally piperine 40 mg/kg B.W) (A 434.61 ± 6.42 c) or its incorporation with G3 (i.p PIP-TiO 2 NPs 75 mg/kg. B.W), a significant (P < 0.05) reduction in this parameter (A 481.71 ± 10.03 b) as contrasted with the G2 treated group. In contrast, the results indicated that these groups (G1 and G3) had a significant (P < 0.05) decline as contrasted with the control group (A 396.45 ± 9.43 d), and a significant (P < 0.05) difference was also observed between G1 and G3. Figure 2. Effect of Piperine, TiO 2 NPs, and PIP-TiO 2 NPs treatment on serum reactive oxygen species (ROS) concentration (pg/mL) in treated rats. Values are expressed as mean ± SE (n = 10). C: control; G1: piperine 40 mg/kg B.W.; G2: TiO 2 NPs 50 mg/kg i.p.; G3: PIP – TiO 2 NPs 75 mg/kg i.p. for 5 weeks. Figures 3 , 4 , and 5 illustrate the mean serum concentration of neurotransmitters (glutamate, noradrenaline and gamma-aminobutyric acid (GABA)) concentrations of the control and other groups, the result exhibits a significant (P < 0.05) decrease in serum neurotransmitter concentrations in rats treated with TiO2NPs (G2) compared with control and other treated animal groups (Piperine and pip-TiO 2 NPs). On the contrary, rats treated with piperine (G1) exhibit the highest mean value, indicating a pronounced effect compared to those treated in the G2 and G3 groups after five weeks of the experiment. Also, the rats treated with PIP-Tio2NPs (G3) show an increase in the mean value compared to Tio2NPs alone (G2). Figure 3. After five weeks, serum glutamate concentration (nmol/ml) in four experimental groups. Values are expressed as mean ± SE (n = 10). C: control; G1: piperine 40 mg/kg B.W.; G2: TiO 2 NPs 50 mg/kg i.p.; G3: PIP – TiO 2 NPs 75 mg/kg i.p. for 5 weeks. Figure 4. After five weeks, serum noradrenaline concentration (pg/ml) in four experimental groups. Values are expressed as mean ± SE (n = 10). C: control; G1: piperine 40 mg/kg B.W.; G2: TiO 2 NPs 50 mg/kg i.p.; G3: PIP–TiO 2 NPs 75 mg/kg i.p. for 5 weeks. Figure 5. After five weeks, serum GABA concentration (pg/ml) in four experimental groups. Values are expressed as mean ± SE (n = 10). C: control; G1: piperine 40 mg/kg B.W.; G2: TiO 2 NPs 50 mg/kg i.p.; G3: PIP – TiO 2 NPs 75 mg/kg i.p. for 5 weeks. Gene expression of the rats’ brain tissue of Cyclooxygenase (COX) in all experiment groups was clarified in Figure 6 (Using the internal reference gene (12S-rRNA) as a sample normalizer). Figure 7 (This indicates a successful RNA extraction and cDNA synthesis), while Figure 9 shows the fold change comparison between the groups expressing the COX gene in the brain. A significant upregulation of COX expression was observed in the TiO2NPs group (G2) compared with the control, and a significant increase in expression of Piperine-TiOeNPs (G3) and piperine (G1) groups. However, Piperine alone produced a moderate yet significant difference in COX relative to the G2 and Control groups regarding gene expression ( Figure 8 ). Figure 6. Amplification curves of the tested samples representing the internal reference gene (12S-rRNA) as a normalizer to the assay. Figure 7. The amplification curve of the tested samples represents the COX gene. Figure 8. Fold change comparison between the groups expressing the COX gene in the brain. Values are expressed as mean ± SE (n = 10). C: control; G1: piperine 40 mg/kg B.W.; G2: TiO 2 NPs 50 mg/kg i.p.; G3: PIP – TiO 2 NPs 75 mg/kg i.p. for 5 weeks. Figure 9. Control group shows histopathological section of (A): The cerebral cortex, normal appearance of meningeal pia mater (Arrow), molecular cells layer (1), external granular cells layer (2), external pyramidal cells layer (3) (H&E stain.100x), (B): Section of hippocampus shows crest of denta gyrus (C) with its supra pyramidal (S) & infra pyramidal blade (I), granular cells layer (G), molecular layer (M), polymorphic layer (P) of denta gyrus. The supra pyramidal blade with its layers (I), hilus of denta gyrus surrounding area of cornu ammonis (CA1, 2 & 3) of proper hippocampus (H&E stain.100x), and (C): Section of thalamus region with normal neurons of nuclei (H&E stain. 100x). The result of the histopathological examination of the cerebral layers of the control and G1 groups ( Figures 9-A and 10-A ) demonstrated the typical appearance of the ganglionic, multiform, pyramidal, granular layers as well as the molecular layer, and normal glial cells with axon tracts of subcortical white matter. The hippocampus revealed a normal, distinct C-shape that reveals its layered structure, including the encompassing the Dentate Gyrus (DG) and the Cornu Ammonis (CA) areas (CA1, CA2, CA3, CA4), these areas are consistent with densely packed pyramidal neurons in the stratum pyramidale ( Figures 9-B and 10-B ). The thalamus also showed commonly appearing nuclei ( Figures 9-C and 10-C ). The histopathological results in the G2 group figures showed the cerebral layers, mild vascular congestion with little hyperplasia of glial cells within the external pyramidal cells layer, and mild demyelination of the molecular cells layer ( Figure 11-A ). The figures of hippocampus showed normal neurons of CA1, two areas, normal molecular layer, granular layer, and polymorphous layer (P) of dentate gyrus, and congestion of choroid plexuses ( Figure 11-B ). The thalamus also showed normal-appearing nuclei ( Figure 11-C ). The G3 group histopathological figures of the cerebral layers showed normal appearance of meningeal pia mater and other cortical cerebral cell layers ( Figure 12-A ). The figures of the hippocampus showed normal neurons of CA1, 2, and 3, and the figures showed moderate vaculation with glial depletion of the molecular strata of the CA1 proper hippocampus ( Figure 12-B ). The thalamus also showed normal-appearing nuclei ( Figure 12-C ). Figure 10. G1 group shows histopathological section of (A): the cerebral cortex normal appearance of meningeal pia mater (Arrow), molecular cells layer (1), external granular cells layer (2), external pyramidal cells layer (3) (H&E stain.100x), (B) Section of hippocampus (G1) shows crest of denta gyrus (C) with normal supra pyramidal & infra pyramidal blade, granular cells layer (G), molecular layer (M), polymorphic layer (P) of denta gyrus. normal area of cornu ammonis (CA1) of proper hippocampus (H&E stain.100x), and (C) Section of thalamus (G1) shows normal neurons of nuclei with normal glial cells (H&E stain.100x). Figure 11. G2 group shows histopathological section of: (A) cerebral cortex mild vascular congestion (Red arrow) with little hyperplasia of glial cells within external pyramidal cells layer (black arrow), little demyelination of molecular cells layer (m) (H&E stain.100x), (B) Section of hippocampus (G2) shows normal neurons of CA1 & 2 areas, normal molecular layer (m), granular layer (G) and polymorphous layer (P) of denta gyrus and congestion of choroid plexuses (red arrow) (H&E stain.100x), and (C) Section of thalamus (G2) shows normal neurons of nuclei with normal glial cells (H&E stain.100x). Figure 12. G3 group shows histopathological section of: (A) the cerebral cortex normal appearance of meningeal pia mater (Arrow), molecular cells layer (1) and external granular cells layer (2) (H&E stain.100x), (B) Section of hippocampus (G3) shows moderate vaculation of molecular strata of CA1 proper hippocampus with glial depletion (red arrow) (H&E stain.100x), and (C) Section of thalamus (G3) shows normal neurons of nuclei with normal glial cells (H&E stain.100x). Discussion A significant decrease in TAO-C and an elevation in ROS levels in the TiO 2 NPs (G2) treated group in the current study indicated TiO 2 toxicity and a case of oxidative stress documented by Refs. 44 and 45 . The following can be used to explain how TiO 2 NPs cause toxicity in organisms: LPO, the generation of ROS, and the electrostatic attachment of TiO 2 nanoparticles to the cell membrane. 46 Due to the surface area and other physical and chemical properties, TiO 2 has a high capacity to generate reactive oxygen species (ROS). 47 , 48 In addition, the toxicity of the TiO 2 NPPS may result from different doses, particle size, cultural medium, or test techniques. 49 , 50 Due to their small size, large surface area, and hydrodynamic diameter, a small nanoparticle was more harmful than a large one. 51 TiO 2 NPS is added to oxidative damage, protein oxidation, antioxidant function deficiency, and elevated brain oxidative stress. 52 , 53 Apoptosis, 54 nuclear envelope shrinkage, 55 changes in the structure of macromolecules and microelements, such as copper (Cu), potassium (K), and zinc (Zn). 56 The outcomes in Figures 1 and 2 confirmed a high TAO-C level and low ROS levels in the organization handled with PIP, indicating its antioxidant impact. These findings were consistent with a few studies. 57 – 59 Besides, the capability to lessen oxidative stress is more for piperine amino acid derivatives than PIP itself. 60 Numerous investigations have revealed that PIP can defend against high ranges of oxidative markers. 61 – 63 who pronounced the co-administration of piperine with curcumin, showed reduced lipid peroxidation (LPO) and growing endogenous antioxidant enzyme levels. The capability of PIP to decrease in LPO of the mitochondrial membrane, similarly to an increase in antioxidant enzymes, PIP became utilized to deal with issues related to mitochondrial oxidative stress. 64 It needs to be stated that the antioxidant property of PIP will be attributed to its antiradical and loose radical scavenging capability. 65 Serum neurotransmitters concentrations analysis (Glutamate, Noradrenaline and GABA) in this study confirmed a significant differences in the values of these parameters in group of rats dealt with PIP (G1) by myself or as mixture with Tio2NPs (G3), these findings imply the function of piperine or their aggregate with TiO 2 NPs (PIP-TiO 2 NPs) in attenuated the damaging effects of TiO 2 NPs on a few physiological mind features, these result agreed with Ref. 55 who suggested using 2.5 mg/kg/day of PIP for 4 weeks, enhanced rats’ persistent potentiation and memory test performance; chronic PIP treatment also produced more effective synaptic plasticity compared to the achieved with donepezil. 66 In the meanwhile, PIP therapy for 23 days also improved neurotransmission and locomotor activity by lowering oxidative-nitrosative stress in the hippocampus and cerebrospinal fluid and improving cholinergic function in a rat model of Alzheimer’s disease (AD). 14 , 66 Ref. 14 who documented how piperine affected the redox state of CSF and hippocampus neurones, may undoubtedly be a factor in the medication’s ability to improve cognition. Additionally, by lowering acetylcholinesterase function, a plaque, and tangles, PIP solid lipid nano-formulation enhanced blood–brain barrier permeability and increased mobility in AD mice, 67 these finding agreed with results in this experiment of G3 treated rats with piperine or piperine-Tio2NPs combination (i.p PIP-TiO 2 NPs 75 mg/Kg. B.W) and this may be result in enhance its potentiality in some brain dysfunctions treatment as mentioned in many studies as 68 indicates that PIP administration lowered lipid peroxidation and raised antioxidants in the striatum of 6-hydroxydopamine (6-OHDA)-lesioned rats 69 ; also found that PIP usage diminished neuronal damage in the substantia nigra in rotenone-injected PD mice and generated atuophagolysosome via Akt/mTOR pathway activation; a PIP-mediated increase in protein phosphatase 2A (PP2A) improved mitochondrial injury, mitochondrial membrane permeability transition pore dysfunction, and oxidative stress. 70 , 71 According to Ref. 72 , this alteration also increased the effectiveness of PIP derivatives in activating the Nrf2/Keap1 pathway, which provided neuroprotection in the Parkinson’s disease model and subsequently regulated brain activities. In Huntington’s disease rats, PIP therapy improved motor characteristics, striatal degeneration inside the basal ganglia, and ATP production. 73 PIP therapy improved serotonin stages and adjusted the glutamate, noradrenaline, monoamine oxidase, and gamma-aminobutyric acid (GABA-ergic) pathways. 74 Additionally, within the brain and serum of a pilocarpine-precipitated epileptic mouse model, PIP remedy decreased nitrite and multiplied GABA, glycine, and taurine. 75 The current experiment saw a significant reduction in serum neurotransmitter concentrations in mice administered TiO 2 NPs (G2) compared to control and other treated groups treated groups. These results have been linked to neurodegenerative disorders, and exposure has been shown to interfere with presynaptic production and reduce the release of neurotransmitters. TiO 2 NPs poisoning must mainly be seen as targeting the brain, according to the growing research part. 76 , 77 According to several studies, 78 , 79 the TiO 2 NPs can form in the brain after risk. Similar to this, TiO 2 has been demonstrated to easily build up in the brain after oral exposure because of its capacity to penetrate the blood-brain barrier. Consequently, it may trigger oxidative stress, apoptosis, neuronal degeneration, and neuroinflammation; these findings agree with results that showed in this study, which indicate the significant decreases in serum concentrations of neurotransmitters (G2) as a result of this exposure. 80 Besides, 81 showed that while oral TiO2NPs have been proven to cause oxidative stress, neuroinflammation, and altered neurotransmitter metabolism, they also are known to promote apoptosis in hippocampus, cortical, and cerebellar neurones. It has been demonstrated that TiO2NPs affect the metabolism of neurotransmitters, particularly dopamine and glutamate/glutamine. 82 When mice were exposed to TiO2NPs, glutamine levels and glutamine synthetase activity decreased, but hippocampus glutamate release and phosphate-activated glutaminase activity significantly increased. Furthermore, it has been demonstrated that different types of TiO2NPs, in conjunction with oxidative stress and mitochondrial dysfunction, cause primary astrocytes to have reduced glutamate uptake. 83 When combined, these results suggest that rats given Tio2NPs (G2) throughout the experiment had reduced glutaminergic neurotransmission. Likewise, it has been demonstrated that exposure to TiO 2 NPs alters the metabolism of various neurotransmitters, including catecholamines in the brain. In particular, TiO 2 exposure raised the levels of monoamine neurotransmitter metabolites, which are a sign of increased neurotransmitter catabolism, while significantly lowering noradrenaline and serotonin levels in the hippocampus, cerebral cortex, cerebellum, and striatum as well as dopamine content in these regions. 84 , 85 Despite this Ref. 86 , showed that oral gavage of TiO 2 NPs resulted in a substantial change in the adrenergic, cholinergic, dopaminergic, and serotonergic neurotransmitter systems by lowering brain levels of noradrenaline, serotonin, and dopamine. As demonstrated in this study, titanium promotes the generation of free radicals, which is expected to induce tissue inflammation. The purpose of this study is to investigate the physiological effects of titanium on the brain, particularly its impact on neural tissue activity and cellular function, by analyzing neurotransmitter concentrations in addition to the study assesses tissue-level damage in the brain as evidenced by COX-2 (cyclooxygenase) expression and its levels in brain tissue. Numerous intrinsic and external stimuli can cause the inflammatory response, which is catalysed by the primary enzyme cyclooxygenase-2 (COX-2). 87 , 88 It acts as an important chemical bridge between the development of chronic inflammation and the reactive oxygen species (ROS) (ROS). 89 In the treated group (G2), mice showed a significant elevation of COX-2 gene expression in their brain tissue, which supports it. This result corresponds to previous research and shows that an increase in COX-2 expression promotes prostonoid production. 90 , 91 According to Ref. 92 are powerful regulators for brain inflammation and vascular activity. Although neurons are constitutively COX-2, other brain cells, including astrocytes, microglia and vascular endothelial cells, usually have low basic levels of COX-2, but increase strongly under inflammatory conditions. 93 In addition, increased COX-2 expression is promoted in the brain by pathological conditions such as cerebral ischemia and hypoxia. 94 Piperine or its combination (PIP-TiO2NPS) treated mice in groups (G1 and G3), so a significant reduction in the level of COX-2. These findings correspond to these studies, which have shown that Piperine prevents large inflammatory enzymes such as 5 -lipoxinas and cycloxicinez -1, suggesting its potential role in modifying inflammation. 22 , 95 In addition, Piperine has cytoprotective, antioxidant and neuroprotective activities, as shown in TAO-C and ROS results. 96 Despite these promising medical effects, data on Piperine painkillers, anti-inflammatory and antipyretic properties are limited. 97 Also Ref. 98 , demonstrated that piperine may act as a potent COX-2 inhibitor, contributing to its anti-inflammatory effects. According to Ref. 99 , piperine decreased the expression of the COX-2 gene and protein in tumor cells. The formation of prostaglandin E2 (PGE2) is catalyzed by the enzyme COX-2, which binds to its corresponding G protein-coupled membrane receptors. All cell tumors showed decreased gene expression in these receptors, suggesting that COX-2’s effect on these receptors is diminished. These findings showed why the COX-2 gene expression decreases in the animals treated with piperine or their combination (PIP-TiO2NPs), followed by enhanced physiological functions of brain cells, antioxidants and neuroprotective effects. The findings of the histopathological study in the PIP-treated group (G1) showed normal architecture of brain tissues (cerebral cortex, Hippocampus, and Thalamus) and enhancement of cellular activity as compared with rats treated with PIP-TiO 2 NPs or with TiO 2 NPs; this is consistent with the above tests for neurotransmitters and antioxidant parameters, this finding align with 100 reported that the Piperine dramatically boosts quercetin’s antioxidant, anti-inflammatory, and neuroprotective benefits in rats given iron supplements and rotenone to cause Parkinson’s disease. 101 The presented histopathological results from the G2 group, treated with titanium dioxide-nanoparticles (TiO 2 -NPs), reveal a nuanced picture of early-stage neurotoxicity characterized by selective damage and a clear glial response. The conclusions are fine because of their mild and specific nature, an exposure model with underwear or low-khurak suggests. There is increasing evidence that titanium-based products can be neurotoxic. For example, memory loss in the mouse model after intravascular delivery of titanium implantation or titanium nanoparticles (TiO 2 NPs) was reported by Ref. 102 . Blood-brain barrier (BBB) is compromised. This is a theory that is excluded to explain this effect. This is confirmed by research by Ref. 103 , where it was found that TINAP improved paracellular permeability in the in vitro human BBB model. This discovery is compatible with the lower level of the significant BBB band in the hippocampus of mice treated with TiO 2 NP. Many ways can cause tiotoxicity. In addition, new research by Ref. 104 indicates that other procedures are likely to include, such as the regulation of the intestinal brain axis through epigenetic modification and intestinal microbiota changes. Some studies, including Ref. 105 no average amount of tension in brain tissue, which indicates that the basic perception of brain translation is not widely accepted. Histopathological consequences in a combined mouse combined by PIP-TiO 2 NPS (G3 group) showed the protective effect of Piperine to reduce the toxic effects of TiO 2 NPs on brain tissue, which was not the same by reducing tissue damage compared to TiO 2 NPs alone, because it did not show that it did not show that it showed on the tissue of the tissues. Piperine-titanium dioxide nanoparticle (TiO 2 NP) shows neuroprotective properties against induced brain damage, mainly by reducing oxidative stress. This discovery matches, 106 which showed that TiO 2 NPS causes brain injury, triggers neuroinflammation, and leads to neuronal apoptosis, while Piperine can reverse these effects, improve cognitive function, and restore redox balance. 107 suggest that in different types of brain cells, there were noticeable variations in sensitivity to the harmful effects of TiO2NPS. Especially compared to the study, it was shown that both acute and long-lasting low dosage risk for TiO 2 NP made neuronal cells more resistant than the human glial cell line. 108 In the animal model for AD, both control checks control both lipid peroxidation of piperine enzymes and non-enzymatic antioxidant levels as well as hippocampus pyramidal cells. 109 In addition, it was noted that Piperine increased the amount of brain-derived neurotrophic factor (BDNF) and the growth of the hippocampus precursor cells. This means that it puts tissue and neuron cells in one or a combination due to damage caused by TiO 2 NPS. 97 The findings indicate that piperine, either alone or in combination with TiO 2 NPs (PIP-TiO 2 NPs), is protective and reduces the damaging effects of TiO 2 NPs on some physiological brain functions and oxidative stress. Ethical considerations This study was conducted in the Animal House of the College of Veterinary Medicine and was approved by the Ethical Committee of the College of Medicine, University of Fallujah (ethical approval number: 11, dated 5/01/2025) before commencing the research work. All animals were treated according to the standards of the Ethical Committee. All information was anonymized and used for research purposes only. Data availability Each the scientific information generated and analyzed throughout the current study are included in the study’s article. The article includes a detailed description of every testing technique, methodology, dose, and laboratory environment. Replicating the study doesn’t require any more unreported data. As a consequence, the reader may easily access all pertinent information in the book. Researchers can reach the corresponding author at [email protected] and with any additional questions. Reporting guidelines The ARRIVE (Animal Research: Reporting of in vivo Experiments) principles were followed in the planning and documentation of this inquiry in order to guarantee reproducibility and transparency in animal research. For this publication, Pathophysiological Effects of Titanium Dioxide Nanoparticles and the Protective Role of Piperine and a Piperine-TiO 2 NP Combination in Rats, the completed ARRIVE checklist has been posted to an online archive. ARRIVE 2.0 checklist for Pathophysiological Effects of Titanium Dioxide Nanoparticles and the Protective Role of Piperine and a Piperine-TiO 2 NP Combination in Rats. [DOI 10.5281/zenodo.18220968 ]. Data are available under the terms of the Creative Commons Zero “No rights reserved” data waiver (CC0 1.0 Public domain dedication). Acknowledgements The authors wish to express their deepest gratitude to the College of Veterinary Medicine and the College of Medicine, Fallujah University for their valuable support in providing the necessary animal housing facilities and scientific laboratories to conduct this study. References 1. Ferraro SA, Domingo MG, Etcheverrito A, et al. : Neurotoxicity mediated by oxidative stress caused by titanium dioxide nanoparticles in human neuroblastoma (SH-SY5Y) cells. J. Trace Elem. Med. Biol. 2020; 57 : 126413. PubMed Abstract | Publisher Full Text 2. Fouad A, Mohamed L, Mohamed G, et al. : Dose-Related Effects of Titanium Dioxide Nanoparticles on the Cerebellar Cortex of Adult Male Albino Rats and the Possible Neuroprotection of β-carotene: A Biochemical and Histological Study. Egypt. J. Histol. 2024. Publisher Full Text 3. Zhang X, Song Y, Gong H, et al. : Neurotoxicity of Titanium Dioxide Nanoparticles: A Comprehensive Review. Int. J. Nanomedicine. 2023; 18 : 7183–7204. PubMed Abstract | Publisher Full Text | Free Full Text 4. Ziental D, Czarczynska-Goslinska B, Mlynarczyk DT, et al. : Titanium Dioxide Nanoparticles: Prospects and Applications in Medicine. Nanomaterials (Basel, Switzerland). 2020; 10 (2): 387. PubMed Abstract | Publisher Full Text | Free Full Text 5. Khedr MA, El-Kazaz SE, Rashed RR, et al. : Neuroprotective Effects of Alpha-Lipoic Acid Against Behavioral Toxicity, Oxidative and Inflammatory Damage Caused by Titanium Dioxide Nanoparticles. Biol. Trace Elem. Res. 2025. Advance online publication. PubMed Abstract | Publisher Full Text 6. Mao Y, Bajinka O, Tang Z, et al. : Lung-brain axis: metabolomics and pathological changes in lungs and brain of respiratory syncytial virus-infected mice. J. Med. Virol. 2022; 94 (12): 5885–5893. PubMed Abstract | Publisher Full Text 7. Golbamaki N, Rasulev B, Cassano A, et al. : Correction: Genotoxicity of metal oxide nanomaterials: review of recent data and discussion of possible mechanisms. Nanoscale. 2015; 7 (14): 6388. PubMed Abstract | Publisher Full Text 8. Ling C, An H, Li L, et al. : Genotoxicity Evaluation of Titanium Dioxide Nanoparticles In Vitro: a Systematic Review of the Literature and Meta-analysis. Biol. Trace Elem. Res. 2021; 199 (5): 2057–2076. PubMed Abstract | Publisher Full Text 9. Kansara K, Kumar A, Karakoti AS: Combination of humic acid and clay reduce the ecotoxic effect of TiO2 NPs: A combined physico-chemical and genetic study using zebrafish embryo. Sci. Total Environ. 2020; 698 : 134133. PubMed Abstract | Publisher Full Text 10. Luo Z, Li Z, Xie Z, et al. : Rethinking Nano-TiO2 Safety: Overview of Toxic Effects in Humans and Aquatic Animals. Small (Weinheim an der Bergstrasse, Germany). 2020; 16 (36): e2002019. PubMed Abstract | Publisher Full Text 11. Gorgani L, Mohammadi M, Najafpour GD, et al. : Piperine-The Bioactive Compound of Black Pepper: From Isolation to Medicinal Formulations. Compr. Rev. Food Sci. Food Saf. 2017; 16 (1): 124–140. PubMed Abstract | Publisher Full Text 12. Sahranavard T, Ghorani V, Forouzanfar F, et al. : Piperine relieves neuropathic pain induced by paclitaxel in mice. Acta Neurobiol. Exp. 2025; 84 (4): 332–340. PubMed Abstract | Publisher Full Text 13. Khalili-Fomeshi M, Azizi MG, Esmaeili MR, et al. : Piperine restores streptozotocin-induced cognitive impairments: Insights into oxidative balance in cerebrospinal fluid and hippocampus. Behav. Brain Res. 2018; 337 : 131–138. PubMed Abstract | Publisher Full Text 14. Shen L, Yang Y, Lu L, et al. : Design and synthesis of piperine-based photoaffinity probes for revealing potential targets of piperine in neurological disease. Chem. Commun. (Camb.). 2025; 61 (4): 669–672. PubMed Abstract | Publisher Full Text 15. Guo F, Qin X, Mao J, et al. : Potential Protective Effects of Pungent Flavor Components in Neurodegenerative Diseases. Molecules (Basel, Switzerland). 2024; 29 (23): 5700. PubMed Abstract | Publisher Full Text | Free Full Text 16. Azam S, Park JY, Kim IS, et al. : Piperine and Its Metabolite’s Pharmacology in Neurodegenerative and Neurological Diseases. Biomedicine. 2022; 10 (1): 154. PubMed Abstract | Publisher Full Text | Free Full Text 17. Haq IU, Imran M, Nadeem M, et al. : Piperine: A review of its biological effects. Phytother. Res. 2021; 35 (2): 680–700. Publisher Full Text 18. Rahimi-Dehkordi N, Heidari-Soureshjani S, Rostamian S: A Systematic Review of the Anti-seizure and Antiepileptic Effects and Mechanisms of Piperine. Cent. Nerv. Syst. Agents Med. Chem. 2025; 25 (2): 143–156. PubMed Abstract | Publisher Full Text 19. Ghasemi A, Saadinezhad A, Halalkhor S, et al. : Piperine improves learning deficit through modulation of Wnt/β-catenin signaling pathway: Involvement of the dorsal hippocampus serotonin-1A receptors. Eur. J. Pharmacol. 2025; 1003 : 177922. PubMed Abstract | Publisher Full Text 20. Hu Y, Wang Y, Gao H, et al. : Piperine Improves DSS-Induced Colitis in Mice via Inhibition of Inflammation and Modulation of Gut Microbiota. Phytother. Res. 2025; 39 (7): 3197–3211. PubMed Abstract | Publisher Full Text 21. Nasrnezhad R, Halalkhor S, Sadeghi F, et al. : Piperine Improves Experimental Autoimmune Encephalomyelitis (EAE) in Lewis Rats Through its Neuroprotective, Anti-inflammatory, and Antioxidant Effects. Mol. Neurobiol. 2021; 58 (11): 5473–5493. PubMed Abstract | Publisher Full Text 22. Hosseini H, Bagherniya M, Sahebkar A, et al. : The effect of curcumin-piperine supplementation on lipid profile, glycemic index, inflammation, and blood pressure in patients with type 2 diabetes mellitus and hypertriglyceridemia. Phytother. Res. 2024; 38 (11): 5150–5161. PubMed Abstract | Publisher Full Text 23. Jameel ZN, Haider AJ, Taha SY: Synthesis of TiO2 nanoparticles by using sol-gel method and its applications as antibacterial agents. Eng. Technol. J. 2014; 32 (3): 418–426. 24. Prabakaran M, Nithya P, Kalaiarasi V, et al. : Green synthesis of piperine loaded gold/triton X-100 nanoconjugates: In-vitro evaluation of biocompatibility and anti-oxidant activity. Nano Biomed. Eng. 2019; 11 (2): 192–199. 25. Goutam SP, Saxena G, Singh V, et al. : Green synthesis of TiO2 nanoparticles using leaf extract of Jatropha curcas L. for photocatalytic degradation of tannery wastewater. Chem. Eng. J. 2018; 336 : 386–396. 26. Rao KG, Ashok CH, Rao KV, et al. : Green synthesis of TiO2 nanoparticles using Aloe vera extract. Int. J. Adv. Res. Phys. Sci. 2015; 2 (1A): 28–34. 27. Banerjee P, Satapathy M, Mukhopahayay A, et al. : Leaf extract mediated green synthesis of silver nanoparticles from widely available Indian plants: synthesis, characterization, antimicrobial property and toxicity analysis. Bioresour. Bioprocess. 2014; 1 : 1–10. 28. Holzwarth U, Gibson N: The Scherrer equation versus the Debye-Scherrer equation. Nat. Nanotechnol. 2011; 6 (9): 534–534. PubMed Abstract | Publisher Full Text 29. Rietveld HM: A profile refinement method for nuclear and magnetic structures. J. Appl. Crystallogr. 1969; 2 (2): 65–71. 30. Alagesan V, Venugopal S: Green synthesis of selenium nanoparticle using leaves extract of withania somnifera and its biological applications and photocatalytic activities. BioNanoScience. 2019; 9 (1): 105–116. 31. Khoshnamvand M, Huo C, Liu J: Silver nanoparticles synthesized using Allium ampeloprasum L. leaf extract: characterization and performance in catalytic reduction of 4- nitrophenol and antioxidant activity. J. Mol. Struct. 2019; 1175 : 90–96. 32. Bell NC, Minelli C, Tompkins J, et al. : Emerging techniques for submicrometer particle sizing applied to Stober silica. Langmuir. 2012; 28 (29): 10860–10872. PubMed Abstract | Publisher Full Text 33. Rusli NS, Embong Z, Nor Hashim NZ, et al. : Assessment of Trace Element (Mg, Al, K and Mo) in 14 Types of Raw Herbs and Spices using SEM-EDX Analysis. ASM Sci. J. 2022; 17 : 1–9. 34. Atal S, Agrawal RP, Vyas S, et al. : Evaluation of the effect of piperine per se on blood glucose level in alloxan-induced diabetic mice. Acta Pol. Pharm. 2012; 69 (5): 965–969. PubMed Abstract 35. El-Daly AA: The histopathological, ultrastructural and immunohistochemical effects of intraperitoneal injection with titanium dioxide nanoparticles and titanium dioxide bulk on the liver of the albino Mice. J. Anim. Health Behav. Sci. 2017; 1 (1): 1–10. Reference Source 36. Jia X, Wang S, Zhou L, et al. : The Potential Liver, Brain, and Embryo Toxicity of Titanium Dioxide Nanoparticles on Mice. Nanoscale Res. Lett. 2017; 12 (1): 478. PubMed Abstract | Publisher Full Text | Free Full Text 37. Yassen AT, Khudair KK, Hassan MAM: Piperine Loaded Titanium Dioxide Nanoparticles: Development, Characterisation and Biomedical Application. Nano Biomed. Eng. 2022; 14 (2): 192–200. Publisher Full Text 38. Parasuraman S, Raveendran R, Kesavan R: Blood sample collection in small laboratory animals. J. Pharmacol. Pharmacother. 2010; 1 (2): 87–93. PubMed Abstract | Publisher Full Text | Free Full Text 39. Alam MN, Bristi NJ, Rafiquzzaman M: Review on in vivo and in vitro methods evaluation of antioxidant activity. Saudi Pharm. J. 2013; 21 (2): 143–152. PubMed Abstract | Publisher Full Text | Free Full Text 40. Schmittgen TD, Livak KJ: Analyzing real-time PCR data by the comparative CT method. Nat. Protoc. 2008; 3 : 1101–1108. Publisher Full Text 41. Huang H, Li F, Alvarez RA, et al. : Downregulation of ATP Synthase Subunit-6, Cytochrome c Oxidase-III, and NADH Dehydrogenase-3 by Bright Cyclic Light in the Rat Retina. Investig. Opthalmol. Vis. Sci. 2004; 45 : 2489–2496. PubMed Abstract | Publisher Full Text 42. Bancroft’s J: Theory and Practice Of Histological Technique. 8th ed.USA: Elsevier; 2019. Reference Source 43. SPSS: Statistical Packages of Social Sciences-SPSS/IBM Statistics 26 step by step. 16th ed.2019. Publisher Full Text 44. Chen Z, Zheng P, Han S, et al. : Tissue-specific oxidative stress and element distribution after oral exposure to titanium dioxide nanoparticles in rats. Nanoscale. 2020; 12 (38): 20033–20046. PubMed Abstract | Publisher Full Text 45. Shirdare M, Jabbari F, Salehzadeh M, et al. : Curcuma reduces kidney and liver damage induced by titanium dioxide nanoparticles in male Wistar rats. Avicenna J. Phytomed. 2022; 12 (5): 537–547. PubMed Abstract | Publisher Full Text | Free Full Text 46. Hou J, Wang L, Wang C, et al. : Toxicity and mechanisms of action of titanium dioxide nanoparticles in living organisms. J. Environ. Sci. (China). 2019; 75 : 40–53. PubMed Abstract | Publisher Full Text 47. Nesci S, Pagliarani A: Emerging Roles for the Mitochondrial ATP Synthase Supercomplexes. Trends Biochem. Sci. 2019; 44 (10): 821–823. PubMed Abstract | Publisher Full Text 48. Sharma J, Kumari R, Bhargava A, et al. : Mitochondrial-induced Epigenetic Modifications: From Biology to Clinical Translation. Curr. Pharm. Des. 2021; 27 (2): 159–176. PubMed Abstract | Publisher Full Text 49. Kazimirova A, El Yamani N, Rubio L, et al. : Effects of Titanium Dioxide Nanoparticles on the Hprt Gene Mutations in V79 Hamster Cells. Nanomaterials (Basel, Switzerland). 2020; 10 (3): 465. PubMed Abstract | Publisher Full Text | Free Full Text 50. Fresegna AM, Ursini CL, Ciervo A, et al. : Assessment of the Influence of Crystalline Form on Cyto-Genotoxic and Inflammatory Effects Induced by TiO2 Nanoparticles on Human Bronchial and Alveolar Cells. Nanomaterials (Basel, Switzerland). 2021; 11 (1): 253. PubMed Abstract | Publisher Full Text | Free Full Text 51. DeLoid GM, Cohen JM, Pyrgiotakis G, et al. : Preparation, characterization, and in vitro dosimetry of dispersed, engineered nanomaterials. Nat. Protoc. 2017; 12 (2): 355–371. PubMed Abstract | Publisher Full Text | Free Full Text 52. Feng X, Chen A, Zhang Y, et al. : Central nervous system toxicity of metallic nanoparticles. Int. J. Nanomedicine. 2015; 10 : 4321–4340. PubMed Abstract | Publisher Full Text | Free Full Text 53. Li C, Tang M: The toxicological effects of nano titanium dioxide on target organs and mechanisms of toxicity. J. Appl. Toxicol. 2024; 44 (2): 152–164. PubMed Abstract | Publisher Full Text 54. Márquez-Ramírez SG, Delgado-Buenrostro NL, Chirino YI, et al. : Titanium dioxide nanoparticles inhibit proliferation and induce morphological changes and apoptosis in glial cells. Toxicology. 2012; 302 : 146–156. PubMed Abstract | Publisher Full Text 55. Hu R, Zheng L, Zhang T, et al. : Molecular mechanism of hippocampal apoptosis of mice following exposure to titanium dioxide nanoparticles. J. Hazard. Mater. 2011; 191 : 32–40. PubMed Abstract | Publisher Full Text 56. Federici G, Shaw BJ, Handy RD: Toxicity of titanium dioxide nanoparticles to rainbow trout (Oncorhynchus mykiss): gill injury, oxidative stress, and other physiological effects. Aquat. Toxicol. 2007; 84 : 415–430. PubMed Abstract | Publisher Full Text 57. Tupe RS, Bangar N, Nisar A, et al. : Piperine exhibits preventive and curative effect on erythrocytes membrane modifications and oxidative stress against in vitro albumin glycation. J. Food Biochem. 2021; e13846. Advance online publication. PubMed Abstract | Publisher Full Text 58. Vurmaz A, Atay E: Antioxidant effects of piperine on steroid-induced hepatotoxicity. Eur. Rev. Med. Pharmacol. Sci. 2021; 25 (17): 5500–5506. PubMed Abstract | Publisher Full Text 59. Verma N, Bal S, Gupta R, et al. : Antioxidative Effects of Piperine against Cadmium-Induced Oxidative Stress in Cultured Human Peripheral Blood Lymphocytes. J. Diet. Suppl. 2020; 17 (1): 41–52. PubMed Abstract | Publisher Full Text 60. Qin B, Yang K, Cao R: Synthesis, radical-scavenging activities, and protective effects against AAPH-induced oxidative damage in DNA and erythrocytes of piperine derivatives. J. Chem. 2020; 2020 : 1–12. Publisher Full Text 61. Mohammadi M, Najafi H, Mohamadi Yarijani Z, et al. : Piperine pretreatment attenuates renal ischemia-reperfusion induced liver injury. Heliyon. 2019; 5 (8): e02180. PubMed Abstract | Publisher Full Text | Free Full Text 62. Adeyemo OA, Ore A, Ajisafe EO: The protective effect of piperine on oxidative stress and hepatic damage induced by diisononyl phthalate in rat. Egypt. J. Basic Appl. Sci. 2021; 8 (1): 293–301. Publisher Full Text 63. Makhov P, Golovine K, Canter D, et al. : Co-administration of piperine and docetaxel results in improved anti-tumor efficacy via inhibition of CYP3A4 activity. Prostate. 2012; 72 (6): 661–667. PubMed Abstract | Publisher Full Text | Free Full Text 64. Dutta M, Ghosh AK, Mishra P, et al. : Protective effects of piperine against copper-ascorbate induced toxic injury to goat cardiac mitochondria in vitro. Food Funct. 2014; 5 (9): 2252–2267. PubMed Abstract | Publisher Full Text 65. Dhiman P, Malik N, Khatkar A: Natural based piperine derivatives as potent monoamine oxidase inhibitors: an in silico ADMET analysis and molecular docking studies. BMC Chem. 2020; 14 (1): 12. PubMed Abstract | Publisher Full Text | Free Full Text 66. Nazifi M, Oryan S, Esfahani DE, et al. : The functional effects of piperine and piperine plus donepezil on hippocampal synaptic plasticity impairment in rat model of Alzheimer’s disease. Life Sci. 2021; 265 : 118802. PubMed Abstract | Publisher Full Text 67. Takada-Takatori Y, Nakagawa S, Kimata R, et al. : Donepezil modulates amyloid precursor protein endocytosis and reduction by up-regulation of SNX33 expression in primary cortical neurons. Sci. Rep. 2019; 9 (1): 11922. PubMed Abstract | Publisher Full Text | Free Full Text 68. Wang C, Cai Z, Wang W, et al. : Piperine attenuates cognitive impairment in an experimental mouse model of sporadic Alzheimer’s disease. J. Nutr. Biochem. 2019; 70 : 147–155. PubMed Abstract | Publisher Full Text 69. Alam MZ, Bagabir HA, Zaher MAF, et al. : Black Seed Oil-Based Curcumin Nanoformulations Ameliorated Cuprizone-Induced Demyelination in the Mouse Hippocampus. Mol. Neurobiol. 2025; 62 (1): 604–625. PubMed Abstract | Publisher Full Text 70. Shrivastava P, Vaibhav K, Tabassum R, et al. : Anti-apoptotic and anti-inflammatory effect of Piperine on 6-OHDA induced Parkinson’s rat model. J. Nutr. Biochem. 2013; 24 (4): 680–687. PubMed Abstract | Publisher Full Text 71. Liu J, Chen M, Wang X, et al. : Piperine induces autophagy by enhancing protein phosphotase 2A activity in a rotenone-induced Parkinson’s disease model. Oncotarget. 2016; 7 (38): 60823–60843. PubMed Abstract | Publisher Full Text | Free Full Text 72. Wang H, Liu J, Gao G, et al. : Protection effect of piperine and piperlonguminine from Piper longum L. alkaloids against rotenone-induced neuronal injury. Brain Res. 2016; 1639 : 214–227. PubMed Abstract | Publisher Full Text 73. Wang L, Cai X, Shi M, et al. : Identification and optimization of piperine analogues as neuroprotective agents for the treatment of Parkinson’s disease via the activation of Nrf2/keap1 pathway. Eur. J. Med. Chem. 2020; 199 : 112385. PubMed Abstract | Publisher Full Text 74. Salman M, Tabassum H, Parvez S: Piperine mitigates behavioral impairments and provides neuroprotection against 3-nitropropinoic acid-induced Huntington disease-like symptoms. Nutr. Neurosci. 2022; 25 (1): 100–109. PubMed Abstract | Publisher Full Text 75. Li G, Ruan L, Chen R, et al. : Synergistic antidepressant-like effect of ferulic acid in combination with piperine: involvement of monoaminergic system. Metab. Brain Dis. 2015; 30 (6): 1505–1514. PubMed Abstract | Publisher Full Text | Free Full Text 76. da Cruz GM , Felipe CF, Scorza FA, et al. : Piperine decreases pilocarpine-induced convulsions by GABAergic mechanisms. Pharmacol. Biochem. Behav. 2013; 104 : 144–153. PubMed Abstract | Publisher Full Text 77. Song B, Liu J, Feng X, et al. : A review on potential neurotoxicity of titanium dioxide nanoparticles. Nanoscale Res. Lett. 2015; 10 (1): 1042. PubMed Abstract | Publisher Full Text | Free Full Text 78. Czajka M, Sawicki K, Sikorska K, et al. : Toxicity of titanium dioxide nanoparticles in central nervous system. Toxicol. In Vitro. 2015; 29 (5): 1042–1052. Publisher Full Text 79. Yamashita K, Yoshioka Y, Higashisaka K, et al. : Silica and titanium dioxide nanoparticles cause pregnancy complications in mice. Nat. Nanotechnol. 2011; 6 (5): 321–328. PubMed Abstract | Publisher Full Text 80. Irshad MA, Nawaz R, Rehman MZU, et al. : Synthesis, characterization and advanced sustainable applications of titanium dioxide nanoparticles: A review. Ecotoxicol. Environ. Saf. 2021; 212 : 111978. PubMed Abstract | Publisher Full Text 81. Grissa I, ElGhoul J, Mrimi R, et al. : In deep evaluation of the neurotoxicity of orally administered TiO2 nanoparticles. Brain Res. Bull. 2020; 155 : 119–128. PubMed Abstract | Publisher Full Text 82. Halawa A, Elshopakey G, El-Adl M, et al. : Chitosan attenuated the neurotoxicity-induced titanium dioxide nanoparticles in brain of adult rats. Environ. Toxicol. 2022; 37 (3): 612–626. PubMed Abstract | Publisher Full Text 83. Heidari Z, Mohammadipour A, Haeri P, et al. : The effect of titanium dioxide nanoparticles on mice midbrain substantia nigra. Iran. J. Basic Med. Sci. 2019; 22 (7): 745–751. PubMed Abstract | Publisher Full Text | Free Full Text 84. Wilson CL, Natarajan V, Hayward SL, et al. : Mitochondrial dysfunction and loss of glutamate uptake in primary astrocytes exposed to titanium dioxide nanoparticles. Nanoscale. 2015; 7 (44): 18477–18488. PubMed Abstract | Publisher Full Text | Free Full Text 85. Zhang L, Bai R, Li B, et al. : Rutile TiO 2 particles exert size and surface coating dependent retention and lesions on the murine brain. Toxicol. Lett. 2011; 207 (1): 73–81. PubMed Abstract | Publisher Full Text 86. Ze X, Su M, Zhao X, et al. : TiO2 nanoparticle-induced neurotoxicity may be involved in dysfunction of glutamate metabolism and its receptor expression in mice. Environ. Toxicol. 2016; 31 (6): 655–662. PubMed Abstract | Publisher Full Text 87. Hu R, Gong X, Duan Y, et al. : Neurotoxicological effects and the impairment of spatial recognition memory in mice caused by exposure to TiO2 nanoparticles. Biomaterials. 2010; 31 (31): 8043–8050. PubMed Abstract | Publisher Full Text 88. Ricciotti E, FitzGerald GA: Prostaglandins and inflammation. Arterioscler. Thromb. Vasc. Biol. 2011; 31 (5): 986–1000. PubMed Abstract | Publisher Full Text | Free Full Text 89. Kumar S, Chowdhury S, Razdan A, et al. : Downregulation of Candidate Gene Expression and Neuroprotection by Piperine in Streptozotocin-Induced Hyperglycemia and Memory Impairment in Rats. Front. Pharmacol. 2021; 11 : 595471. PubMed Abstract | Publisher Full Text | Free Full Text 90. Kundu JK, Surh YJ: Emerging avenues linking inflammation and cancer. Free Radic. Biol. Med. 2012; 52 (9): 2013–2037. Publisher Full Text 91. Beyan H, Buckley LR, Bustin SA, et al. : Altered monocyte cyclo-oxygenase response in non-obese diabetic mice. Clin. Exp. Immunol. 2009; 155 (2): 304–310. PubMed Abstract | Publisher Full Text | Free Full Text 92. Cui J, Jia J: Natural COX-2 Inhibitors as Promising Anti-inflammatory Agents: An Update. Curr. Med. Chem. 2021; 28 (18): 3622–3646. PubMed Abstract | Publisher Full Text 93. Czigler A, Toth L, Szarka N, et al. : Prostaglandin E2, a postulated mediator of neurovascular coupling, at low concentrations dilates whereas at higher concentrations constricts human cerebral parenchymal arterioles. Prostaglandins Other Lipid Mediat. 2020; 146 : 106389. PubMed Abstract | Publisher Full Text 94. Shojo H, Borlongan CV, Mabuchi T: Genetic and Histological Alterations Reveal Key Role of Prostaglandin Synthase and Cyclooxygenase 1 and 2 in Traumatic Brain Injury-Induced Neuroinflammation in the Cerebral Cortex of Rats Exposed to Moderate Fluid Percussion Injury. Cell Transplant. 2017; 26 (7): 1301–1313. PubMed Abstract | Publisher Full Text | Free Full Text 95. Li L, Sluter MN, Yu Y, et al. : Prostaglandin E receptors as targets for ischemic stroke: Novel evidence and molecular mechanisms of efficacy. Pharmacol. Res. 2021; 163 : 105238. PubMed Abstract | Publisher Full Text | Free Full Text 96. Bukhari IA, Pivac N, Alhumayyd MS, et al. : The analgesic and anticonvulsant effects of piperine in mice. J. Physiol. Pharmacol. 2013; 64 (6): 789–794. PubMed Abstract Reference Source 97. Roshanbakhsh H, Elahdadi Salmani M, Dehghan S, et al. : Piperine ameliorated memory impairment and myelin damage in lysolecethin induced hippocampal demyelination. Life Sci. 2020; 253 : 117671. PubMed Abstract | Publisher Full Text 98. Ariyanasab R, Askari VR, Askari R, et al. : The interactive effect of seven weeks aerobic exercise training and piperine against paraquat-induced lung damage in male Wistar rats: Investigating role of oxidative and inflammatory indices. Heliyon. 2024; 10 (12): e33241. PubMed Abstract | Publisher Full Text | Free Full Text 99. Gueroui M, Benembarek K, Kerrada A, et al. : Analysis of the Molecular Docking of Piperine with Cyclooxygenase-2, Followed by an In-Vivo Study of Its Anti-Inflammatory and Analgesic Properties. Int. Pharm. Acta. 2025; 8 (1): e2. Publisher Full Text 100. Cardoso LP, de Sousa SO , Gusson-Zanetoni JP, et al. : Piperine Reduces Neoplastic Progression in Cervical Cancer Cells by Downregulating the Cyclooxygenase 2 Pathway. Pharmaceuticals. 2023; 16 (1): 103. PubMed Abstract | Publisher Full Text | Free Full Text 101. Sharma R, Sarkar A, Jha R, et al. : Sol-gel – mediated synthesis of TiO2 nanocrystals: Structural, optical, and electrochemical properties. Int. J. Appl. Ceram. Technol. 2020; 17 (3): 1400–1409. Publisher Full Text 102. Shelly S, Liraz Zaltsman S, Ben-Gal O, et al. : Potential neurotoxicity of titanium implants: Prospective, in-vivo and in-vitro study. Biomaterials. 2021; 276 : 121039. PubMed Abstract | Publisher Full Text 103. Aschner M, Skalny AV, Gritsenko VA, et al. : Role of gut microbiota in the modulation of the health effects of advanced glycation end-products (Review). Int. J. Mol. Med. 2023; 51 (5): 44. PubMed Abstract | Publisher Full Text | Free Full Text 104. Pogribna M, Koonce NA, Mathew A, et al. : Effect of titanium dioxide nanoparticles on DNA methylation in multiple human cell lines. Nanotoxicology. 2020; 14 (4): 534–553. PubMed Abstract | Publisher Full Text 105. Shinohara RT, Sweeney EM, Goldsmith J, et al. : Statistical normalization techniques for magnetic resonance imaging. NeuroImage. Clin. 2014; 6 : 9–19. PubMed Abstract | Publisher Full Text | Free Full Text 106. Eid A, Ghaleb SS, Zaki A, et al. : Hesperidin Attenuates Titanium Dioxide Nanoparticle-Induced Neurotoxicity in Rats by Regulating Nrf-2/TNF-α Signaling Pathway, the Suppression of Oxidative Stress, and Inflammation. ACS Omega. 2023; 8 (40): 37584–37591. PubMed Abstract | Publisher Full Text | Free Full Text 107. Coccini T, Grandi S, Lonati D, et al. : Comparative cellular toxicity of titanium dioxide nanoparticles on human astrocyte and neuronal cells after acute and prolonged exposure. Neurotoxicology. 2015; 48 : 77–89. PubMed Abstract | Publisher Full Text 108. Baranowska-Wójcik E, Szwajgier D, Oleszczuk P, et al. : Effects of Titanium Dioxide Nanoparticles Exposure on Human Health-a Review. Biol. Trace Elem. Res. 2020; 193 (1): 118–129. PubMed Abstract | Publisher Full Text | Free Full Text 109. Balakrishnan R, Azam S, Kim IS, et al. : Neuroprotective Effects of Black Pepper and Its Bioactive Compounds in Age-Related Neurological Disorders. Aging Dis. 2023; 14 (3): 750–777. PubMed Abstract | Publisher Full Text | Free Full Text Comments on this article Comments (0) Version 1 VERSION 1 PUBLISHED 21 Jan 2026 ADD YOUR COMMENT Comment Author details Author details 1 Department of Physiology and Medical Physics, College of Medicine, University of Fallujah, Al-Fallujah, Al Anbar Governorate, Iraq 2 Department of Pathology and Poultry Disease, College of Veterinary Medicine, University of Kerbala College of Veterinary Medicine, Karbala, Karbala Governorate, Iraq 3 Department of Pathology and Poultry Disease, College of Veterinary Medicine, University of Fallujah, Al-Fallujah, Al Anbar Governorate, Iraq Ahmed Jasim Nawfal Roles: Formal Analysis, Investigation, Methodology, Supervision, Writing – Review & Editing Zahraa S. Mahdi Roles: Conceptualization, Data Curation, Resources, Validation Rafid Khalid Ali Roles: Formal Analysis, Investigation, Project Administration, Software Competing interests No competing interests were disclosed. Grant information The author(s) declared that no grants were involved in supporting this work. Article Versions (1) version 1 Published: 21 Jan 2026, 15:99 https://doi.org/10.12688/f1000research.173446.1 Copyright © 2026 Jasim Nawfal A et al . This is an open access article distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Download Export To Sciwheel Bibtex EndNote ProCite Ref. Manager (RIS) Sente metrics Views Downloads F1000Research - - PubMed Central info_outline Data from PMC are received and updated monthly. - - Citations open_in_new 0 open_in_new 0 open_in_new SEE MORE DETAILS CITE how to cite this article Jasim Nawfal A, S. Mahdi Z and Khalid Ali R. Pathophysiological Effects of Titanium Dioxide Nanoparticles and the Protective Role of Piperine and a Piperine-TiO₂NP Combination in Rats. [version 1; peer review: 1 not approved] . F1000Research 2026, 15 :99 ( https://doi.org/10.12688/f1000research.173446.1 ) NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS track receive updates on this article Track an article to receive email alerts on any updates to this article. TRACK THIS ARTICLE Share Open Peer Review Current Reviewer Status: ? Key to Reviewer Statuses VIEW HIDE Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Version 1 VERSION 1 PUBLISHED 21 Jan 2026 Views 0 Cite How to cite this report: Alam MZ. Reviewer Report For: Pathophysiological Effects of Titanium Dioxide Nanoparticles and the Protective Role of Piperine and a Piperine-TiO₂NP Combination in Rats. [version 1; peer review: 1 not approved] . F1000Research 2026, 15 :99 ( https://doi.org/10.5256/f1000research.191266.r455085 ) The direct URL for this report is: https://f1000research.com/articles/15-99/v1#referee-response-455085 NOTE: it is important to ensure the information in square brackets after the title is included in this citation. Close Copy Citation Details Reviewer Report 11 Feb 2026 Mohammad Zubair Alam , King Abdulaziz University, Jeddah, Makkah Province, Saudi Arabia Not Approved VIEWS 0 https://doi.org/10.5256/f1000research.191266.r455085 This manuscript investigates the neurotoxic effects of titanium dioxide nanoparticles (TiO₂NPs) and evaluates the neuroprotective potential of piperine alone and in combination with TiO₂NPs in a rat model. The study integrates nanoparticle synthesis and characterization, biochemical oxidative ... Continue reading READ ALL This manuscript investigates the neurotoxic effects of titanium dioxide nanoparticles (TiO₂NPs) and evaluates the neuroprotective potential of piperine alone and in combination with TiO₂NPs in a rat model. The study integrates nanoparticle synthesis and characterization, biochemical oxidative stress markers, neurotransmitter analysis, gene expression (COX), and histopathology, which together provide a broad experimental framework. The topic is relevant to nanotoxicology and neuroprotection research, and the dataset is substantial. However, despite these strengths, the manuscript has major issues related to experimental logic, data interpretation, statistical clarity, and language quality that currently limit its suitability for acceptance. Major Issues: The combined treatment group (PIP–TiO₂NPs) is conceptually confusing. If TiO₂NPs are toxic, administering piperine conjugated with the same nanoparticles requires stronger justification. It is unclear whether this formulation reduces toxicity, alters biodistribution, or introduces additional nanoparticle exposure. There is no group receiving TiO₂NPs + free piperine (co-administration without conjugation), which would be essential to distinguish formulation effects from pharmacological effects. The TiO₂NPs group (G2) shows lower ROS levels than some treated groups, which contradicts both the introduction and discussion claiming oxidative stress induction. The relationship between TAO-C, ROS, and MDA is not coherently interpreted, and some conclusions appear overstated given the actual trends in the figures. Neurotransmitters are measured in serum, not brain tissue. This is a critical limitation because serum neurotransmitter levels do not directly reflect synaptic or central nervous system neurotransmission. Strong claims regarding “neuroprotection,” “synaptic function,” and “brain activity” are therefore not fully supported by the presented data. Only COX gene expression is measured. There is no distinction between COX-1 and COX-2 at the protein level, nor confirmation by Western blot or immunohistochemistry. The manuscript frequently interprets COX changes as neuroinflammation, but no cytokines (e.g., TNF-α, IL-1β, IL-6) or microglial markers are assessed. Histological changes are described as mild to moderate, yet the discussion sometimes implies robust neurodegeneration. The presence of vacuolation and glial depletion in the G3 group contradicts the claim that the combined formulation is clearly protective. Quantitative scoring or blinded histological assessment is not reported. Use of LSD post-hoc testing without justification raises concerns about inflated type-I error. Figures use letter-based significance labeling, but comparisons are not always clearly explained in the legends. Effect sizes and confidence intervals are not reported. The manuscript contains extensive grammatical errors, awkward phrasing, repetition, and unclear sentences, especially in the Discussion. Several paragraphs are overly long, unfocused, and difficult to follow. The Discussion frequently restates results instead of critically interpreting them. Minor Issues Abstract contains inconsistencies such as “significant decrease in ROS” in G2 conflicts with the hypothesis. Units and symbols are sometimes inconsistent like spacing, capitalization. Some references are cited repeatedly without adding new interpretive value. Figure numbering and cross-referencing could be clearer. In introduction the third paragraph should have been placed at first position. Some citations refer to ….. as reported by Reference 6 or so on…. This is not the way of writing scientific papers. Please follow the standard way of citing references. For Editor: Major Revision The manuscript addresses an important topic and contains valuable experimental data, but substantial revisions are necessary before it can be considered reliable and interpretable for indexing. Is the work clearly and accurately presented and does it cite the current literature? Partly Is the study design appropriate and is the work technically sound? Yes Are sufficient details of methods and analysis provided to allow replication by others? Yes If applicable, is the statistical analysis and its interpretation appropriate? Partly Are all the source data underlying the results available to ensure full reproducibility? Yes Are the conclusions drawn adequately supported by the results? Yes Competing Interests: No competing interests were disclosed. Reviewer Expertise: Neuroscience, Multiple Sclerosis I confirm that I have read this submission and believe that I have an appropriate level of expertise to state that I do not consider it to be of an acceptable scientific standard, for reasons outlined above. Close READ LESS CITE CITE HOW TO CITE THIS REPORT Alam MZ. Reviewer Report For: Pathophysiological Effects of Titanium Dioxide Nanoparticles and the Protective Role of Piperine and a Piperine-TiO₂NP Combination in Rats. [version 1; peer review: 1 not approved] . F1000Research 2026, 15 :99 ( https://doi.org/10.5256/f1000research.191266.r455085 ) The direct URL for this report is: https://f1000research.com/articles/15-99/v1#referee-response-455085 NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS Report a concern Respond or Comment COMMENT ON THIS REPORT Comments on this article Comments (0) Version 1 VERSION 1 PUBLISHED 21 Jan 2026 ADD YOUR COMMENT Comment keyboard_arrow_left keyboard_arrow_right Open Peer Review Reviewer Status info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Reviewer Reports Invited Reviewers 1 Version 1 21 Jan 26 read Mohammad Zubair Alam , King Abdulaziz University, Jeddah, Saudi Arabia Comments on this article All Comments (0) Add a comment Sign up for content alerts Sign Up You are now signed up to receive this alert Browse by related subjects keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2026 Alam M. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 11 Feb 2026 | for Version 1 Mohammad Zubair Alam , King Abdulaziz University, Jeddah, Makkah Province, Saudi Arabia 0 Views copyright © 2026 Alam M. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (0) Not Approved info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions This manuscript investigates the neurotoxic effects of titanium dioxide nanoparticles (TiO₂NPs) and evaluates the neuroprotective potential of piperine alone and in combination with TiO₂NPs in a rat model. The study integrates nanoparticle synthesis and characterization, biochemical oxidative stress markers, neurotransmitter analysis, gene expression (COX), and histopathology, which together provide a broad experimental framework. The topic is relevant to nanotoxicology and neuroprotection research, and the dataset is substantial. However, despite these strengths, the manuscript has major issues related to experimental logic, data interpretation, statistical clarity, and language quality that currently limit its suitability for acceptance. Major Issues: The combined treatment group (PIP–TiO₂NPs) is conceptually confusing. If TiO₂NPs are toxic, administering piperine conjugated with the same nanoparticles requires stronger justification. It is unclear whether this formulation reduces toxicity, alters biodistribution, or introduces additional nanoparticle exposure. There is no group receiving TiO₂NPs + free piperine (co-administration without conjugation), which would be essential to distinguish formulation effects from pharmacological effects. The TiO₂NPs group (G2) shows lower ROS levels than some treated groups, which contradicts both the introduction and discussion claiming oxidative stress induction. The relationship between TAO-C, ROS, and MDA is not coherently interpreted, and some conclusions appear overstated given the actual trends in the figures. Neurotransmitters are measured in serum, not brain tissue. This is a critical limitation because serum neurotransmitter levels do not directly reflect synaptic or central nervous system neurotransmission. Strong claims regarding “neuroprotection,” “synaptic function,” and “brain activity” are therefore not fully supported by the presented data. Only COX gene expression is measured. There is no distinction between COX-1 and COX-2 at the protein level, nor confirmation by Western blot or immunohistochemistry. The manuscript frequently interprets COX changes as neuroinflammation, but no cytokines (e.g., TNF-α, IL-1β, IL-6) or microglial markers are assessed. Histological changes are described as mild to moderate, yet the discussion sometimes implies robust neurodegeneration. The presence of vacuolation and glial depletion in the G3 group contradicts the claim that the combined formulation is clearly protective. Quantitative scoring or blinded histological assessment is not reported. Use of LSD post-hoc testing without justification raises concerns about inflated type-I error. Figures use letter-based significance labeling, but comparisons are not always clearly explained in the legends. Effect sizes and confidence intervals are not reported. The manuscript contains extensive grammatical errors, awkward phrasing, repetition, and unclear sentences, especially in the Discussion. Several paragraphs are overly long, unfocused, and difficult to follow. The Discussion frequently restates results instead of critically interpreting them. Minor Issues Abstract contains inconsistencies such as “significant decrease in ROS” in G2 conflicts with the hypothesis. Units and symbols are sometimes inconsistent like spacing, capitalization. Some references are cited repeatedly without adding new interpretive value. Figure numbering and cross-referencing could be clearer. In introduction the third paragraph should have been placed at first position. Some citations refer to ….. as reported by Reference 6 or so on…. This is not the way of writing scientific papers. Please follow the standard way of citing references. For Editor: Major Revision The manuscript addresses an important topic and contains valuable experimental data, but substantial revisions are necessary before it can be considered reliable and interpretable for indexing. Is the work clearly and accurately presented and does it cite the current literature? Partly Is the study design appropriate and is the work technically sound? Yes Are sufficient details of methods and analysis provided to allow replication by others? Yes If applicable, is the statistical analysis and its interpretation appropriate? Partly Are all the source data underlying the results available to ensure full reproducibility? Yes Are the conclusions drawn adequately supported by the results? Yes Competing Interests No competing interests were disclosed. Reviewer Expertise Neuroscience, Multiple Sclerosis I confirm that I have read this submission and believe that I have an appropriate level of expertise to state that I do not consider it to be of an acceptable scientific standard, for reasons outlined above. reply Respond to this report Responses (0) Alam MZ. Peer Review Report For: Pathophysiological Effects of Titanium Dioxide Nanoparticles and the Protective Role of Piperine and a Piperine-TiO₂NP Combination in Rats. [version 1; peer review: 1 not approved] . F1000Research 2026, 15 :99 ( https://doi.org/10.5256/f1000research.191266.r455085) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/15-99/v1#referee-response-455085 Alongside their report, reviewers assign a status to the article: Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions Adjust parameters to alter display View on desktop for interactive features Includes Interactive Elements View on desktop for interactive features Competing Interests Policy Provide sufficient details of any financial or non-financial competing interests to enable users to assess whether your comments might lead a reasonable person to question your impartiality. Consider the following examples, but note that this is not an exhaustive list: Examples of 'Non-Financial Competing Interests' Within the past 4 years, you have held joint grants, published or collaborated with any of the authors of the selected paper. You have a close personal relationship (e.g. parent, spouse, sibling, or domestic partner) with any of the authors. You are a close professional associate of any of the authors (e.g. scientific mentor, recent student). You work at the same institute as any of the authors. You hope/expect to benefit (e.g. favour or employment) as a result of your submission. You are an Editor for the journal in which the article is published. Examples of 'Financial Competing Interests' You expect to receive, or in the past 4 years have received, any of the following from any commercial organisation that may gain financially from your submission: a salary, fees, funding, reimbursements. You expect to receive, or in the past 4 years have received, shared grant support or other funding with any of the authors. You hold, or are currently applying for, any patents or significant stocks/shares relating to the subject matter of the paper you are commenting on. Stay Updated Sign up for content alerts and receive a weekly or monthly email with all newly published articles Register with F1000Research Already registered? Sign in Not now, thanks close PLEASE NOTE If you are an AUTHOR of this article, please check that you signed in with the account associated with this article otherwise we cannot automatically identify your role as an author and your comment will be labelled as a “User Comment”. If you are a REVIEWER of this article, please check that you have signed in with the account associated with this article and then go to your account to submit your report, please do not post your review here. If you do not have access to your original account, please contact us . All commenters must hold a formal affiliation as per our Policies . The information that you give us will be displayed next to your comment. User comments must be in English, comprehensible and relevant to the article under discussion. We reserve the right to remove any comments that we consider to be inappropriate, offensive or otherwise in breach of the User Comment Terms and Conditions . Commenters must not use a comment for personal attacks. When criticisms of the article are based on unpublished data, the data should be made available. I accept the User Comment Terms and Conditions Please confirm that you accept the User Comment Terms and Conditions. Affiliation ✕ refresh Please enter your institution. Note: To add your institution or organisation, start typing the name and then select the correct name from the list. Where applicable, the name will appear in both the original language and in English. Do not paste in the name. If the name does not appear in the drop-down list, we will display the information you have entered. ✕ refresh Country/Region * USA UK Canada China France Germany Afghanistan Aland Islands Albania Algeria American Samoa Andorra Angola Anguilla Antarctica Antigua and Barbuda Argentina Armenia Aruba Australia Austria Azerbaijan Bahamas Bahrain Bangladesh Barbados Belarus Belgium Belize Benin Bermuda Bhutan Bolivia Bosnia and Herzegovina Botswana Bouvet Island Brazil British Indian Ocean Territory British Virgin Islands Brunei Bulgaria Burkina Faso Burundi Cambodia Cameroon Canada Cape Verde Cayman Islands Central African Republic Chad Chile China Christmas Island Cocos (Keeling) Islands Colombia Comoros Congo Cook Islands Costa Rica Cote d'Ivoire Croatia Cuba Cyprus Czech Republic Democratic Republic of the Congo Denmark Djibouti Dominica Dominican Republic Ecuador Egypt El Salvador Equatorial Guinea Eritrea Estonia Ethiopia Falkland Islands Faroe Islands Federated States of Micronesia Fiji Finland France French Guiana French Polynesia French Southern Territories Gabon Georgia Germany Ghana Gibraltar Greece Greenland Grenada Guadeloupe Guam Guatemala Guernsey Guinea Guinea-Bissau Guyana Haiti Heard Island and Mcdonald Islands Holy See (Vatican City State) Honduras Hong Kong Hungary Iceland India Indonesia Iran Iraq Ireland Israel Italy Jamaica Japan Jersey Jordan Kazakhstan Kenya Kiribati Kosovo (Serbia and Montenegro) Kuwait Kyrgyzstan Lao People's Democratic Republic Latvia Lebanon Lesotho Liberia Libya Liechtenstein Lithuania Luxembourg Macao Madagascar Malawi Malaysia Maldives Mali Malta Marshall Islands Martinique Mauritania Mauritius Mayotte Mexico Minor Outlying Islands of the United States Moldova Monaco Mongolia Montenegro Montserrat Morocco Mozambique Myanmar Namibia Nauru Nepal Netherlands Antilles New Caledonia New Zealand Nicaragua Niger Nigeria Niue Norfolk Island North Korea North Macedonia Northern Mariana Islands Norway Oman Pakistan Palau Palestinian Territory Panama Papua New Guinea Paraguay Peru Philippines Pitcairn Poland Portugal Puerto Rico Qatar Reunion Romania Russian Federation Rwanda Saint Helena Saint Kitts and Nevis Saint Lucia Saint Pierre and Miquelon Saint Vincent and the Grenadines Samoa San Marino Sao Tome and Principe Saudi Arabia Senegal Serbia Seychelles Sierra Leone Singapore Slovakia Slovenia Solomon Islands Somalia South Africa South Georgia and the South Sandwich Is South Korea South Sudan Spain Sri Lanka Sudan Suriname Svalbard and Jan Mayen Swaziland Sweden Switzerland Syria Taiwan Tajikistan Tanzania Thailand The Gambia The Netherlands Timor-Leste Togo Tokelau Tonga Trinidad and Tobago Tunisia Turkey Turkmenistan Turks and Caicos Islands Tuvalu UK USA Uganda Ukraine United Arab Emirates United States Virgin Islands Uruguay Uzbekistan Vanuatu Venezuela Vietnam Wallis and Futuna West Bank and Gaza Strip Western Sahara Yemen Zambia Zimbabwe Please select your country/region. You must enter a comment. Competing Interests Please disclose any competing interests that might be construed to influence your judgment of the article's or peer review report's validity or importance. Competing Interests Policy Provide sufficient details of any financial or non-financial competing interests to enable users to assess whether your comments might lead a reasonable person to question your impartiality. Consider the following examples, but note that this is not an exhaustive list: Examples of 'Non-Financial Competing Interests' Within the past 4 years, you have held joint grants, published or collaborated with any of the authors of the selected paper. You have a close personal relationship (e.g. parent, spouse, sibling, or domestic partner) with any of the authors. You are a close professional associate of any of the authors (e.g. scientific mentor, recent student). You work at the same institute as any of the authors. You hope/expect to benefit (e.g. favour or employment) as a result of your submission. You are an Editor for the journal in which the article is published. Examples of 'Financial Competing Interests' You expect to receive, or in the past 4 years have received, any of the following from any commercial organisation that may gain financially from your submission: a salary, fees, funding, reimbursements. You expect to receive, or in the past 4 years have received, shared grant support or other funding with any of the authors. You hold, or are currently applying for, any patents or significant stocks/shares relating to the subject matter of the paper you are commenting on. Please state your competing interests The comment has been saved. An error has occurred. Please try again. Cancel Post var lTitle = "Pathophysiological Effects of Titanium Dioxide...".replace("'", ''); var linkedInUrl = "http://www.linkedin.com/shareArticle?url=https://f1000research.com/articles/15-99/v1" + "&title=" + encodeURIComponent(lTitle) + "&summary=" + encodeURIComponent('Read the article by '); var deliciousUrl = "https://del.icio.us/post?url=https://f1000research.com/articles/15-99/v1&title=" + encodeURIComponent(lTitle); var redditUrl = "http://reddit.com/submit?url=https://f1000research.com/articles/15-99/v1" + "&title=" + encodeURIComponent(lTitle); linkedInUrl += encodeURIComponent('Jasim Nawfal A et al.'); var offsetTop = /chrome/i.test( navigator.userAgent ) ? 4 : -10; var addthis_config = { ui_offset_top: offsetTop, services_compact : "facebook,twitter,www.linkedin.com,www.mendeley.com,reddit.com", services_expanded : "facebook,twitter,www.linkedin.com,www.mendeley.com,reddit.com", services_custom : [ { name: "LinkedIn", url: linkedInUrl, icon:"/img/icon/at_linkedin.svg" }, { name: "Mendeley", url: "http://www.mendeley.com/import/?url=https://f1000research.com/articles/15-99/v1/mendeley", icon:"/img/icon/at_mendeley.svg" }, { name: "Reddit", url: redditUrl, icon:"/img/icon/at_reddit.svg" }, ] }; var addthis_share = { url: "https://f1000research.com/articles/15-99", templates : { twitter : "Pathophysiological Effects of Titanium Dioxide Nanoparticles.... Jasim Nawfal A et al., published by " + "@F1000Research" + ", https://f1000research.com/articles/15-99/v1" } }; if (typeof(addthis) != "undefined"){ addthis.addEventListener('addthis.ready', checkCount); addthis.addEventListener('addthis.menu.share', checkCount); } $(".f1r-shares-twitter").attr("href", "https://twitter.com/intent/tweet?text=" + addthis_share.templates.twitter); $(".f1r-shares-facebook").attr("href", "https://www.facebook.com/sharer/sharer.php?u=" + addthis_share.url); $(".f1r-shares-linkedin").attr("href", addthis_config.services_custom[0].url); $(".f1r-shares-reddit").attr("href", addthis_config.services_custom[2].url); $(".f1r-shares-mendelay").attr("href", addthis_config.services_custom[1].url); function checkCount(){ setTimeout(function(){ $(".addthis_button_expanded").each(function(){ var count = $(this).text(); if (count !== "" && count != "0") $(this).removeClass("is-hidden"); else $(this).addClass("is-hidden"); }); }, 1000); } close How to cite this report {{reportCitation}} Cancel Copy Citation Details $(function(){R.ui.buttonDropdowns('.dropdown-for-downloads');}); $(function(){R.ui.toolbarDropdowns('.toolbar-dropdown-for-downloads');}); $.get("/articles/acj/173446/191266") new F1000.Clipboard(); new F1000.ThesaurusTermsDisplay("articles", "article", "191266"); $(document).ready(function() { $( "#frame1" ).on('load', function() { var mydiv = $(this).contents().find("div"); var h = mydiv.height(); console.log(h) }); var tooltipLivingFigure = jQuery(".interactive-living-figure-label .icon-more-info"), titleLivingFigure = tooltipLivingFigure.attr("title"); tooltipLivingFigure.simpletip({ fixed: true, position: ["-115", "30"], baseClass: 'small-tooltip', content:titleLivingFigure + " " }); tooltipLivingFigure.removeAttr("title"); $("body").on("click", ".cite-living-figure", function(e) { e.preventDefault(); var ref = $(this).attr("data-ref"); $(this).closest(".living-figure-list-container").find("#" + ref).fadeIn(200); }); $("body").on("click", ".close-cite-living-figure", function(e) { e.preventDefault(); $(this).closest(".popup-window-wrapper").fadeOut(200); }); $(document).on("mouseup", function(e) { var metricsContainer = $(".article-metrics-popover-wrapper"); if (!metricsContainer.is(e.target) && metricsContainer.has(e.target).length === 0) { $(".article-metrics-close-button").click(); } }); var articleId = $('#articleId').val(); if($("#main-article-count-box").attachArticleMetrics) { $("#main-article-count-box").attachArticleMetrics(articleId, { articleMetricsView: true }); } }); var figshareWidget = $(".new_figshare_widget"); if (figshareWidget.length > 0) { window.figshare.load("f1000", function(Widget) { // Select a tag/tags defined in your page. In this tag we will place the widget. _.map(figshareWidget, function(el){ var widget = new Widget({ articleId: $(el).attr("figshare_articleId") //height:300 // this is the height of the viewer part. [Default: 550] }); widget.initialize(); // initialize the widget widget.mount(el); // mount it in a tag that's on your page // this will save the widget on the global scope for later use from // your JS scripts. This line is optional. //window.widget = widget; }); }); } close Error Close Add Reset F1000.MICROSERVICES.AFFILIATION = ''; $(document).ready(function () { $('.js-affiliations-form').each((index, form) => { new AffiliationForm({ formId: form.id, institutionErrorSelector: '.comment-enter-institution', departmentErrorSelector: '.comment-enter-department', placeSelector: '.js-add-comment-place', stateSelector: '.js-add-comment-state', zipCodeSelector: '.js-add-comment-zipcode', countrySelector: '.js-add-comment-country', countryErrorSelector: '.comment-enter-country', }); }); }); $(document).ready(function () { var reportIds = { "474903": 0, "474902": 0, "474901": 0, "474910": 0, "474909": 0, "474908": 0, "474907": 0, "474906": 0, "474905": 0, "474904": 0, "455086": 0, "455087": 0, "455084": 0, "455085": 3, "455083": 0, "455092": 0, "455090": 0, "455091": 0, "455088": 0, "455089": 0, "457046": 0, "457047": 0, "457045": 0, "457054": 0, "470367": 0, "473055": 0, "470366": 0, "473054": 0, "457052": 0, "470365": 0, "473053": 0, "457053": 0, "470364": 0, "457050": 0, "470363": 0, "457051": 0, "470362": 0, "457048": 0, "457049": 0, "473062": 0, "473061": 0, "473060": 0, "470371": 0, "473059": 0, "470370": 0, "473058": 0, "470369": 0, "473057": 0, "470368": 0, "473056": 0, "471799": 0, "471798": 0, "471797": 0, "471796": 0, "471795": 0, "471794": 0, "471803": 0, "471802": 0, "471801": 0, "471800": 0, }; $(".referee-response-container,.js-referee-report").each(function(index, el) { var reportId = $(el).attr("data-reportid"), reportCount = reportIds[reportId] || 0; $(el).find(".comments-count-container,.js-referee-report-views").html(reportCount); }); var uuidInput = $("#article_uuid"), oldUUId = uuidInput.val(), newUUId = "60a7d77b-b507-441d-a5d3-e1b78f7dfd27"; uuidInput.val(newUUId); $("a[href*='article_uuid=']").each(function(index, el) { var newHref = $(el).attr("href").replace(oldUUId, newUUId); $(el).attr("href", newHref); }); }); An innovative open access publishing platform offering rapid publication and open peer review, whilst supporting data deposition and sharing. Browse Gateways Collections How it Works Contact For Developers Cookie Notice Privacy Notice RSS Submit Your Research Follow us © 2012-2026 F1000 Research Ltd. ISSN 2046-1402 | Legal | Partner of Research4Life • CrossRef • ORCID • FAIRSharing R.templateTests.simpleTemplate = R.template(' $text $text $text $text $text '); R.templateTests.runTests(); var F1000platform = new F1000.Platform({ name: "f1000research", displayName: "F1000Research", hostName: "f1000research.com", id: "1", editorialEmail: "
[email protected]", infoEmail: "
[email protected]", usePmcStats: true }); $(function(){R.ui.dropdowns('.dropdown-for-authors, .dropdown-for-about, .dropdown-for-myresearch');}); // $(function(){R.ui.dropdowns('.dropdown-for-referees');}); $(document).ready(function () { if ($(".cookie-warning").is(":visible")) { $(".sticky").css("margin-bottom", "35px"); $(".devices").addClass("devices-and-cookie-warning"); } $(".cookie-warning .close-button").click(function (e) { $(".devices").removeClass("devices-and-cookie-warning"); $(".sticky").css("margin-bottom", "0"); }); $("#tweeter-feed .tweet-message").each(function (i, message) { var self = $(message); self.html(linkify(self.html())); }); $(".partner").on("mouseenter mouseleave", function() { $(this).find(".gray-scale, .colour").toggleClass("is-hidden"); }); }); Sign In Remember me Forgotten your password? Sign In Cancel Email or password not correct. Please try again Please wait... $(function(){ // Note: All the setup needs to run against a name attribute and *not* the id due the clonish // nature of facebox... $("a[id=googleSignInButton]").click(function(event){ event.preventDefault(); $("input[id=oAuthSystem]").val("GOOGLE"); $("form[id=oAuthForm]").submit(); }); $("a[id=facebookSignInButton]").click(function(event){ event.preventDefault(); $("input[id=oAuthSystem]").val("FACEBOOK"); $("form[id=oAuthForm]").submit(); }); $("a[id=orcidSignInButton]").click(function(event){ event.preventDefault(); $("input[id=oAuthSystem]").val("ORCID"); $("form[id=oAuthForm]").submit(); }); }); If you've forgotten your password, please enter your email address below and we'll send you instructions on how to reset your password. The email address should be the one you originally registered with F1000. Email address not valid, please try again You registered with F1000 via Google, so we cannot reset your password. To sign in, please click here . If you still need help with your Google account password, please click here . You registered with F1000 via Facebook, so we cannot reset your password. To sign in, please click here . If you still need help with your Facebook account password, please click here . Code not correct, please try again Reset password Cancel Email us for further assistance. Server error, please try again. If your email address is registered with us, we will email you instructions to reset your password. If you think you should have received this email but it has not arrived, please check your spam filters and/or contact for further assistance. Please wait... Register $(document).ready(function () { signIn.createSignInAsRow($("#sign-in-form-gfb-popup")); $(".target-field").each(function () { var uris = $(this).val().split("/"); if (uris.pop() === "login") { $(this).val(uris.toString().replace(",","/")); } }); });
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.