Demethylase ALKBH5 inhibits proliferation and promotes apoptosis of hepatocellular carcinoma cells by decreasing methylation levels and regulating SOCS3/STAT3 signaling | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Demethylase ALKBH5 inhibits proliferation and promotes apoptosis of hepatocellular carcinoma cells by decreasing methylation levels and regulating SOCS3/STAT3 signaling Tianhao Wu, Zhen Yang, Jiansheng Chen, Yihao Liu, Dongqi Li, Qiang Li, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6998555/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract In this study, we investigated the role of ALKBH5 in the pathogenesis of hepatocellular carcinoma (HCC), focusing on the underlying molecular mechanisms. Comparative analysis of ALKBH5 expression profiles between hepatocellular carcinoma (HCC) tissues and adjacent non-tumorous liver tissues revealed a significant downregulation of ALKBH5 in malignant tissues. To investigate the functional significance of ALKBH5 in HCC pathogenesis, we employed both gain-of-function and loss-of-function approaches in HCC cell lines, utilizing overexpression and RNA interference strategies. Clinical correlation studies demonstrated that decreased ALKBH5 expression levels were significantly associated with reduced overall survival rates in HCC patients, suggesting its potential role as a prognostic biomarker.Furthermore, upregulation of ALKBH5 expression inhibited HCC cell proliferation and induced apoptosis. Through mechanistic studies, we identified SOCS3 as a downstream target of ALKBH5, which negatively regulates the STAT3 signaling pathway.In conclusion, our findings suggest that ALKBH5, as a demethylase, suppresses HCC cell proliferation and promotes apoptosis by reducing methylation levels and modulating the SOCS3/STAT3 pathway. These insights deepen our understanding of the molecular mechanisms underlying HCC and provide potential avenues for future therapeutic development. Demethylase ALKBH5 methylation HCC SOCS3/STAT3 signaling pathway Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Hepatocellular carcinoma (HCC) ranks as the sixth most common cancer globally, yet it accounts for the fourth highest cancer-related mortality, reflecting its aggressive biological behavior and the limited therapeutic options available( 1 ). The prognosis of HCC is largely dependent on the stage at diagnosis, but early detection remains challenging. Clinical presentation in the early stages is often subtle, with nonspecific symptoms and minimal imaging findings, leading to late-stage diagnosis in many cases. Despite advances in diagnostic techniques and treatment modalities, the complex molecular pathogenesis of HCC is not yet fully understood, and effective strategies to prevent recurrence and metastasis are lacking( 2 ).Surgical resection and liver transplantation, along with targeted therapies and chemotherapy, remain the primary treatment options for HCC. However, tumor heterogeneity and the development of drug resistance significantly limit the efficacy of these treatments. As a result, many patients miss the opportunity for surgery due to diagnosis at an advanced stage, and recurrence rates post-surgery remain high, reaching up to 70%( 3 ).In addition to surgery, chemotherapy is a critical treatment, particularly in advanced stages of the disease. Despite recent advancements in understanding the therapeutic mechanisms and potential targets for drug development, the overall prognosis of HCC remains poor. This is largely attributed to the tumor’s insidious onset, coupled with the high susceptibility to drug resistance. Therefore, uncovering the molecular mechanisms underlying HCC development is crucial to developing novel therapeutic strategies and improving patient outcomes. ( 4 ) N6-methyladenosine (m6A) represents a fundamental post-transcriptional modification mechanism in eukaryotic cellular systems, distinguished as the most abundant, evolutionarily conserved, and functionally significant internal RNA modification in higher organisms. This epigenetic mark plays a pivotal role in regulating RNA metabolism and gene expression at the post-transcriptional level.( 5 – 7 ). This modification plays a significant role in various biological processes, including RNA metabolism, protein translation, immune homeostasis, and the regulation of tumorigenesis and development.( 8 – 10 )The process of m6A methylation is reversible and is dynamically regulated by a network of enzymes, including methyltransferases (often referred to as Writers), demethylases (referred to as Erasers), and effector proteins (known as Readers). Notably, the demethylases involved in this process include fat mass and obesity-associated protein (FTO) and ALKBH5 (ALKB homologous protein 5), which are key players in regulating m6A methylation levels.( 11 – 13 ) Recent advancements in high-throughput sequencing technologies have significantly increased the focus on m6A methylation modifications. However, the role of ALKBH5, a key demethylase involved in the development and progression of various cancers, has been less explored in hepatocellular carcinoma (HCC).In intrahepatic cholangiocarcinoma, ALKBH5 functions as a critical demethylase that regulates the expression of programmed death ligand 1 (PD-L1), thereby inhibiting T cell expansion and cytotoxicity( 14 ). In gastric cancer, ALKBH5 regulates the expression of membrane-associated tyrosine/threonine protein kinase 1 (PKMYT1) in an m6A-dependent manner. PKMYT1, as a downstream target of ALKBH5, promotes the invasion and migration of gastric cancer cells( 15 ). In pancreatic ductal adenocarcinoma (PDAC), overexpression of ALKBH5 sensitizes PDAC cells to gemcitabine treatment and suppresses tumorigenesis by reducing the m6A modification of WIF-1 and inhibiting Wnt signaling activation( 16 ). Moreover, in ovarian epithelial carcinoma, ALKBH5 promotes the activation of the EGFR-PI3KCA-AKT-mTOR signaling pathway, stabilizes BCL-2 mRNA, and facilitates the interaction between Bcl-2 and Beclin1, contributing to cancer cell survival.These findings highlight the multifaceted role of ALKBH5 in various cancers, suggesting its potential as a therapeutic target, especially in cancers like hepatocellular carcinoma, where its role remains under-investigated( 17 ). Previous studies have established that m6A methylation modifications play a significant role in the development of hepatocellular carcinoma (HCC). The involvement of ALKBH5, a key m6A demethylase, in carcinogenesis, tumor formation, and the tumor microenvironment has been well-documented in various malignancies. However, the precise role of ALKBH5 in the complex molecular mechanisms underlying HCC remains to be fully elucidated( 18 – 20 ).Interestingly, conflicting evidence has emerged regarding the effects of ALKBH5 in HCC. For instance, Zhang et al. demonstrated that the long intergenic noncoding RNA (lincRNA) LINC02551 is a downstream target of ALKBH5, with its expression being regulated by ALKBH5 in an m6A-dependent manner. LINC02551, in turn, promotes HCC progression by stabilizing the expression of DDX24( 21 ). In contrast, Chen et al. reported that ALKBH5 functions as a tumor suppressor in HCC by inhibiting the expression of LYPD1 in an m6A-dependent manner, identifying LYPD1 as a novel oncogene in HCC( 22 ).These contrasting findings suggest that ALKBH5 may exert dual, context-dependent effects in HCC, possibly influencing the disease through different molecular pathways. The complex and sometimes opposing roles of ALKBH5 in HCC development warrant further investigation to clarify its precise mechanistic contributions. The suppressor of cytokine signaling (SOCS) family plays a crucial role as a negative feedback regulator of the JAK-STAT3 signaling pathway. Persistent activation of STAT3 is commonly observed in various cancers, and its hyperactivation—often due to decreased SOCS3 expression—can induce the expression of multiple pro-tumorigenic genes, contributing to malignancy and tumor progression.In previous studies, SOCS3 has been identified as a key negative regulator of STAT3 in osteosarcoma, with evidence suggesting that it is a downstream target of ALKBH5-mediated m6A modification. Mechanistically, ALKBH5 inhibits the STAT3 pathway by enhancing SOCS3 expression in an m6A-YTHDF2-dependent manner( 24 ). However, whether a similar regulatory link exists between ALKBH5 and the SOCS3/STAT3 signaling axis in hepatocellular carcinoma (HCC) has yet to be explored. Therefore, the primary objective of this study is to investigate the relationship between ALKBH5 and the SOCS3-STAT3 axis in HCC and to elucidate the underlying molecular mechanisms involved. Materials and methods Ethical Statement Human tumor tissue samples were acquired following the ethical protocols approved by the Research Ethics Committee at Qingdao Municipal Hospital. All procedures related to specimen collection and subsequent immunohistochemical analyses were conducted under the committee’s oversight to ensure compliance with ethical and regulatory requirements.For the in vivo studies, experimental protocols were developed in alignment with the ARRIVE guidelines to ensure transparent and ethical reporting of animal research. All experimental protocols were subjected to rigorous review and received formal approval from the Institutional Research Ethics Committee of Qingdao Municipal Hospital (Approval No. [insert number]). The study was conducted in strict compliance with established ethical guidelines, with all experimental procedures being meticulously documented, monitored, and audited under the committee's supervision to ensure adherence to both ethical principles and scientific rigor. Reagents and antibodies The primary antibodies utilized in this study included anti-ALKBH5 (Catalog No. 16837-1-AP) and anti-SOCS3 (Catalog No. 14025-1-AP), both from Proteintech (Manchester, UK). Additionally, antibodies against STAT3 (Catalog No. ab68153) and GAPDH (Catalog No. ab8245) were procured from Abcam (Cambridge, UK). For secondary detection, horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG (Catalog No. M21002) and goat anti-mouse IgG (Catalog No. M21001) were obtained from Abmart (Shanghai, China). Cell lines and culture conditions The cell lines utilized in this investigation were procured from the Type Culture Collection (Shanghai, China). Cell cultures were maintained in Dulbecco's Modified Eagle Medium (DMEM; Gibco, USA) supplemented with 10% heat-inactivated fetal bovine serum (FBS; Excellbio, USA) and 1% penicillin-streptomycin solution (HyClone, UT, USA). Cells were incubated under standardized conditions at 37°C in a humidified atmosphere containing 5% CO2. ALKBH5 knockdown and overexpression The human ALKBH5 cDNA was synthesized by Jimma Gene and packaged into a lentiviral plasmid vector for cellular transfection. To knock down ALKBH5 expression, siRNA was employed. Three siRNA sequences were designed as follows: AGAAGATGGCCTCCAAGAAGCTTCATCCAGGAGGTGAA CUGCGCAACAAGUACUUCUTTAGAAGUACUUGUUUGCGCAGTT CAGUGGAUAUGCUGCUGAUTTAUCAGCAGCAUAUCCACUGTT Based on their knockdown efficiency, the first and third siRNAs were selected for subsequent experiments. Cell viability Cells were plated in 96-well culture plates at a concentration of 5 × 10³ cells per well and allowed to adhere for 24 hours.Following the initial culture period, cells were exposed to varying concentrations of Tan-IIA (0, 5, 10, 20, and 30 µg/mL) for specified time intervals (12, 24, and 48 hours). After the treatment period, cellular viability was assessed by adding 10 µL of CCK8 reagent (APExBIO, K1018, USA) to each well, followed by incubation at 37°C for 60 minutes. Optical density measurements were obtained at 450 nm using a microplate reader, and IC50 values were subsequently determined through non-linear regression analysis employing GraphPad Prism 7.0 software. Transwell invasion assay Cell migration was evaluated using a 24-well Transwell assay system. Hepatocellular carcinoma cells (5 × 10⁴ cells) were suspended in 100 µL of serum-free culture medium, quantified, and plated in the upper compartment, while the lower compartment contained 600 µL of DMEM medium enriched with 10% fetal bovine serum. Following a 24-hour incubation period, cells remaining on the upper surface of the membrane were carefully eliminated using a cotton applicator. Migrated cells attached to the lower membrane surface were subsequently fixed with methanol, subjected to crystal violet staining, and examined using an inverted light microscope. For quantitative analysis, nine randomly chosen microscopic fields were imaged, and the number of migrated cells in each field was counted and statistically analyzed. Immunohistochemistry A total of 60 paired tissue specimens, comprising hepatocellular carcinoma and corresponding adjacent non-tumorous liver tissues, were obtained from surgical resections. Tissue samples were immediately fixed in 4.0% paraformaldehyde solution, processed through standard paraffin embedding protocols, and sectioned at a thickness of 4 μm. For immunohistochemical analysis, tissue sections were first treated with 3.0% hydrogen peroxide solution to quench endogenous peroxidase activity, followed by blocking with 5.0% bovine serum albumin. Primary antibody incubation was performed using anti-ALKBH5 (16837-1-AP) at 4°C for approximately 16 hours. Following thorough PBS washes, sections were incubated with appropriate HRP-conjugated secondary antibodies at room temperature for 60 minutes. Chromogenic detection was achieved using DAB substrate, with hematoxylin counterstaining for nuclear visualization. Digital imaging was performed using the AxioVision Rel.4.6 digital pathology system (Carl Zeiss) for subsequent quantitative analysis. Detection of Apoptosis Using Annexin-V-FITC/PI Staining Cells cultured in six-well plates were harvested, washed twice with phosphate-buffered saline (PBS), and subsequently resuspended in the binding buffer supplied with the Annexin-V-FITC/PI apoptosis detection kit. The cell suspension was then sequentially stained with 5 μL of Annexin V-FITC and 5 μL of propidium iodide (PI), followed by a 15-minute incubation period in light-protected conditions. Cellular apoptosis rates were quantitatively assessed using flow cytometric analysis, which was performed immediately following the staining procedure. Western Blotting Total protein was extracted from HCC cells using RIPA lysis buffer (Beyotime), and nuclear and cytoplasmic proteins were isolated using a specific extraction kit (Beyotime). Protein concentrations were determined using a BCA protein assay kit (Beyotime). Following boiling of the samples for 10 minutes, proteins were separated by electrophoresis on 10% SDS-polyacrylamide gels and transferred to polyvinylidene fluoride (PVDF) membranes (Millipore, Bedford, MA, USA). The membranes were blocked with 5% skimmed milk for 2 hours at 25°C, then incubated overnight at 4°C with primary antibodies (1:1000 dilution, Proteintech), including ALKBH5 (Catalog No. 16837-1-AP), SOCS3 (Catalog No. 14025-1-AP), STAT3 (Catalog No. ab68153), and GAPDH (Catalog No. ab8245) as the internal control. After three washes with TBST buffer, the membranes were incubated for 2 hours at 25°C with HRP-conjugated secondary antibodies. Protein bands were detected using an ECL reagent (Millipore), and their intensities were quantified with ImageJ software. All experiments were performed in triplicate. Data Analysis Statistical analyses were conducted using GraphPad Prism 7.0 (GraphPad Software Inc., CA, USA). Data from three independent experiments are expressed as mean ± standard deviation (SD). Group comparisons were performed using a Student’s t-test, and differences between multiple groups were evaluated using one-way ANOVA. A p-value of less than 0.05 was considered statistically significant. Results Expression of ALKBH5 in hepatocellular carcinoma and its association with patient survival. Immunohistochemical analysis was performed to evaluate ALKBH5 expression patterns, revealing significantly higher ALKBH5 levels in normal hepatic tissues compared to hepatocellular carcinoma specimens (Figure 1A). Subsequent clinical correlation studies were conducted to investigate the potential association between ALKBH5 expression levels and hepatocellular carcinoma patient outcomes.Kaplan-Meier survival analysis revealed that patients with low ALKBH5 expression had a significantly shorter overall survival compared to those with high ALKBH5 expression. (Fig. 1C). Additionally, protein blot analysis was conducted on eight samples from both liver tissue and hepatocellular carcinoma tissue. ALKBH5 was detected in both tissue types, but its expression was notably reduced in hepatocellular carcinoma tissue compared to normal liver tissue. (Fig. 1B). This indicates that the dysregulation of ALKBH5 demethylase expression is strongly associated with the survival prognosis of hepatocellular carcinoma patients. ALKBH5-mediated methylation reduction inhibits HCC proliferation, migration and promotes apoptosis To investigate the functional role of ALKBH5 in hepatocellular carcinoma, we performed function acquisition experiments by introducing ALKBH5 expression vector into HCC cells. Hep3B and Huh7 cell lines, which have the highest ALKBH5 expression in hepatocellular carcinoma, were selected for overexpression experiments. We first up-regulated the expression of ALKBH5 using plasmid transfection, and western blot assay confirmed the overexpression of ALKBH5 (Fig. 2A), and at the same time, the methylation level was detected, and We observed that the methylation level of ALKBH5 was significantly reduced in cells with overexpression compared to normal cells.(Fig. 2B). Next, we demonstrated that overexpression of ALKBH5 suppressed the proliferative capacity of hepatocellular carcinoma cells, as evidenced by the CCK-8 cell proliferation assay. (Figure 2C). To comprehensively evaluate the functional role of ALKBH5 in cellular motility, we performed Transwell migration and Matrigel invasion assays using hepatocellular carcinoma cells (Hep3B and Huh7) transfected with either ALKBH5 expression constructs or corresponding empty vectors. Quantitative analysis revealed that ALKBH5 overexpression markedly attenuated both migratory and invasive capacities in both cell lines, demonstrating its potent inhibitory effect on hepatocellular carcinoma cell metastasis.(Figure 2D). We conducted an apoptosis assay using plasmid transfection after overexpressing ALKBH5 for 48 hours. Flow cytometry (FCM) analysis revealed a significant increase in apoptosis in both cell lines. (Figure 2E). This suggests that overexpression of the demethylase ALKBH5 significantly lowered its methylation level, while simultaneously inhibiting the proliferation and migration of hepatocellular carcinoma cells and promoting apoptosis. Silencing of ALKBH5 promotes proliferation, migration and reduces apoptosis in HCC To more fully understand the role of ALKBH5 in hepatocellular carcinoma, we also performed a gene knockdown assay in the Hep3B cell line. We first knocked down the expression of ALKBH5 by Si-RNA transfection, and the knockdown efficiency of ALKBH5 was confirmed by Western blot (Figure 3A). At the same time, we detected the methylation level of ALKBH5. The methylation level was significantly higher than that of normal cells after silencing ALKBH5 (Figure 3B). CCK-8 cell proliferation assay showed that silencing ALKBH5 enhanced the proliferation of hepatocellular carcinoma cells (Figure 3C). Transwell migration assays demonstrated that silencing ALKBH5 increased the migration ability of Hep3B cells.(Figure 3D). Quantitative assessment of apoptotic rates demonstrated that ALKBH5 knockdown significantly reduced cellular apoptosis (Figure 3E). Collectively, these experimental findings establish ALKBH5 as a critical regulator of hepatocellular carcinoma cell biology, exerting significant influence on multiple oncogenic processes including proliferation, migration, and programmed cell death. Silencing ALKBH5 significantly inhibited the proliferation and migration of these cells, while also reducing the apoptosis rate. SOCS3/STAT3 is a downstream regulator of ALKBH5 Extensive review of existing studies reveals a significant association between the SOCS3/STAT3 signaling cascade and ALKBH5, with their interplay playing a crucial role in various malignant cell types. Research evidence indicates that the RNA demethylation enzyme ALKBH5 exerts regulatory control over the STAT3 pathway by enhancing SOCS3 levels through a mechanism that depends on m6A-YTHDF2 interactions. [29]. To investigate the potential involvement of the SOCS3/STAT3 signaling axis in ALKBH5-regulated hepatocyte proliferation, we performed a series of molecular analyses focusing on the expression patterns of key downstream effectors. Through gain-of-function and loss-of-function approaches employing plasmid-mediated overexpression and siRNA-mediated knockdown of ALKBH5, respectively, we systematically evaluated the protein expression profiles. Western blot analysis revealed significant alterations in SOCS3 expression levels following ALKBH5 modulation, establishing SOCS3 as a downstream target of ALKBH5. Furthermore, we extended our investigation to assess STAT3-mediated signaling by quantifying the expression levels of its downstream targets. Comparative analysis demonstrated a marked reduction in the protein expression of c-Myc and Bcl-2, two critical STAT3-regulated oncoproteins, in experimental groups compared to control conditions. (Figure 4A). Subsequently, we established a genetically modified cell line by combining ALKBH5 knockdown with SOCS3 overexpression (Si-ALKBH5+LV-SOCS3) to facilitate subsequent functional investigations. The successful generation of this dual-modified cell model was confirmed through western blot analysis, which demonstrated the efficiency of co-transfection and the expected alterations in protein expression profiles. (Figure 4B), The functional consequences of SOCS3 overexpression were subsequently evaluated using CCK-8 proliferation assays. Comparative analysis revealed that ectopic expression of SOCS3 in the context of ALKBH5 knockdown significantly attenuated the proliferative capacity of hepatocellular carcinoma cells, demonstrating a more pronounced anti-proliferative effect than ALKBH5 silencing alone. (Figure 4C), Cell migration capacity was quantitatively assessed using Transwell assays, which revealed that SOCS3 overexpression significantly impaired the migratory potential of hepatocellular carcinoma cells. Notably, this inhibitory effect on cell migration was more substantial than that observed with ALKBH5 knockdown alone, suggesting an enhanced anti-migratory role of SOCS3 upregulation in the cellular context.(Figure 4D) Apoptosis analysis was concurrently performed to evaluate programmed cell death rates. The experimental data demonstrated that SOCS3 upregulation induced a more pronounced apoptotic response in hepatocellular carcinoma cells compared to the effects observed with ALKBH5 knockdown alone, indicating an enhanced pro-apoptotic function of SOCS3 overexpression in this cellular context. (Figure 4E). Collectively, our experimental findings establish the SOCS3/STAT3 axis as a downstream signaling cascade regulated by ALKBH5 in hepatocellular carcinoma pathogenesis. Importantly, SOCS3 overexpression not only counteracted but also reversed the phenotypic consequences induced by ALKBH5 knockdown, suggesting a potential regulatory feedback mechanism within this molecular pathway. Overexpression of ALKBH5 inhibits tumorigenicity of hepatocellular carcinoma cells in vivo To further elucidate the tumorigenic role of ALKBH5 in hepatocellular carcinoma progression, we conducted in vivo validation through subcutaneous xenograft transplantation experiments in immunodeficient nude mice. The experimental design involved comparative analysis between hepatocellular carcinoma cells with stable ALKBH5 overexpression and their vector control counterparts. Consistent with our in vitro findings, quantitative assessment of tumor growth kinetics revealed significant suppression of neoplastic proliferation in xenografts derived from Hep3B cells with stable ALKBH5 overexpression, compared to control groups. This in vivo evidence strongly supports the tumor-suppressive function of ALKBH5 in hepatocellular carcinoma pathogenesis. (Figure 5A). In contrast, xenograft models established with Hep3B cells harboring stable ALKBH5 knockdown exhibited markedly accelerated tumor progression, demonstrating significantly enhanced tumor growth kinetics compared to control groups. This reciprocal phenotype further substantiates the critical tumor-suppressive role of ALKBH5 in hepatocellular carcinoma development.(Figure 5B). To comprehensively evaluate the tumorigenic contributions of ALKBH5 and SOCS3 in vivo, we established xenograft models using genetically modified hepatocellular carcinoma cells with stable ALKBH5 knockdown and concurrent SOCS3 overexpression. Tumor growth dynamics were systematically monitored throughout identical experimental periods to quantify the oncogenic potential of these molecular alterations. Quantitative analysis revealed that ALKBH5 silencing substantially potentiated the tumorigenic capacity of hepatocellular carcinoma cells in the murine model. Interestingly, when SOCS3 overexpression was combined with ALKBH5 knockdown, we observed a partial but significant attenuation of tumorigenic potential, suggesting a compensatory tumor-suppressive role of SOCS3 in the context of ALKBH5 deficiency. (Figure 5C). These findings collectively demonstrate that SOCS3 overexpression functionally counteracts the tumor-promoting effects induced by ALKBH5 silencing, effectively reversing the oncogenic phenotype. Our comprehensive experimental data establish that the ALKBH5-mediated SOCS3/STAT3 signaling axis plays a crucial tumor-suppressive role in hepatocellular carcinoma, exerting significant inhibitory effects on both proliferative capacity and metastatic potential of malignant cells. Discussion This study provides the first experimental evidence demonstrating that ALKBH5 exerts tumor-suppressive functions in hepatocellular carcinoma through modulation of the SOCS3/STAT3 signaling pathway, mechanistically linking its activity to the inhibition of cellular proliferation and induction of apoptotic processes. Our clinical correlation analysis revealed significant downregulation of ALKBH5 expression in both hepatocellular carcinoma tissues and established cell lines, with lower ALKBH5 expression levels correlating with unfavorable patient prognosis, further supporting its potential role as a tumor suppressor. Functional validation experiments confirmed that ALKBH5 overexpression not only attenuated in vitro oncogenic properties, including proliferation and migratory capacity, but also significantly impaired the tumorigenic potential of hepatocellular carcinoma cells in xenograft mouse models. Our experimental data provide substantial evidence supporting the tumor-suppressive function of ALKBH5 in hepatocellular carcinoma progression, particularly through its regulatory influence on the SOCS3/STAT3 signaling cascade. This study represents the first comprehensive investigation establishing a mechanistic link between ALKBH5, a crucial m6A RNA demethylase in epigenetic regulation, and the SOCS3/STAT3 pathway, both of which play pivotal roles in hepatocellular carcinoma pathogenesis. These findings significantly advance our understanding of the molecular mechanisms underlying hepatocellular carcinoma development and highlight the critical importance of ALKBH5-mediated epigenetic regulation in tumor progression. The identification of this novel regulatory axis not only expands the current knowledge of hepatocellular carcinoma biology but also provides new insights into potential therapeutic targets for this malignancy. Extensive research has firmly established that m6A RNA methylation plays a critical regulatory role in tumor cell growth and proliferation processes (25). Accumulating evidence from recent studies demonstrates that abnormal m6A modification patterns are intricately associated with the molecular pathogenesis of diverse human diseases (26). The complex m6A methylation process represents a precisely regulated molecular cascade, where dysregulation or mutational alterations in any component of this pathway can disrupt cellular homeostasis and contribute to disease pathogenesis. Emerging evidence has demonstrated that m6A methyltransferases, including METTL3 and METTL14, contribute to tumorigenesis through distinct molecular mechanisms (27-29). The RNA demethylase ALKBH5, which utilizes iron ions and 2-oxoglutarate (2-OG) as essential cofactors, has been identified as a critical regulator in various pathological conditions, with its dysregulation playing a pivotal role in disease development (30,31). Functionally, ALKBH5 primarily mediates the dynamic regulation of m6A modifications in eukaryotic transcriptomes, exerting its biological effects through precise modulation of RNA metabolism, translational efficiency, and transcript stability at the post-transcriptional level (32-34). ALKBH5 has emerged as a focal point in contemporary cancer research, with numerous studies elucidating its multifaceted roles in tumor biology. In hepatocellular carcinoma, ALKBH5 has been identified as a tumor suppressor that modulates LYPD1 expression through m6A-dependent mechanisms (22). Furthermore, research across various malignancies has revealed that ALKBH5 deficiency is associated with tumor progression and unfavorable clinicopathological features in prostate cancer. Mechanistically, ALKBH5 exerts its tumor-suppressive function by post-transcriptionally activating PER1 through m6A-YTHDF2-dependent demethylation, subsequently triggering the ATM-CHK2-P53/CDC25C signaling cascade to inhibit tumor proliferation (35). Our investigation reveals that m6A-mediated RNA methylation exerts regulatory control over the STAT3 signaling pathway, thereby influencing cellular proliferation and growth dynamics in hepatocellular carcinoma. The STAT3 pathway, known to play pivotal roles in diverse biological processes, has been extensively documented to contribute to tumorigenesis when aberrantly activated (36-38). The m6A modification system modulates STAT3 signaling through multiple molecular mechanisms, with different m6A-associated enzymes capable of either activating or suppressing this pathway. The observed reduction in STAT3 activation may represent a key mechanism underlying the inhibition of cellular proliferation, as evidenced by studies demonstrating that STAT3 upregulation can effectively counteract growth suppression (24,39).Recent studies have identified the RNA-binding protein MEX3C as a critical regulator that accelerates SOCS3 mRNA degradation, consequently enhancing JAK2/STAT3 pathway activation and facilitating hepatocellular carcinoma metastasis (40). In pancreatic cancer biology, loss-of-function mutations or inactivation of p53 have been shown to trigger JAK2/STAT3 pathway activation, leading to structural phosphorylation of STAT3 (41,42). Furthermore, the JAK2/STAT3 signaling cascade has been implicated as a key driver in the pathological progression from chronic pancreatitis to pancreatic ductal adenocarcinoma (43). While our study provides significant insights, several limitations should be acknowledged. The current experimental design does not fully exclude the possibility that ALKBH5 might exert its effects through additional signaling pathways, potentially influencing our results through direct or indirect mechanisms. This limitation is particularly relevant considering previous findings in osteosarcoma, where ALKBH5 has been shown to modulate STAT3 pathway activity through m6A-YTHDF2-dependent upregulation of SOCS3 expression. (24).In subsequent investigations, we plan to systematically examine whether the RNA demethylase ALKBH5 similarly regulates SOCS3 expression through analogous mechanisms in hepatocellular carcinoma. While our current findings demonstrate that ALKBH5-mediated m6A demethylation inhibits hepatocellular carcinoma progression via the SOCS3/STAT3 signaling axis, it is noteworthy that m6A methylation modifications can exhibit tumor-promoting effects in other malignancies, resulting in contrasting biological outcomes (44-46). Accumulating evidence suggests that m6A methylation exerts tumor-specific regulatory functions through distinct molecular mechanisms, highlighting the necessity for comprehensive, in-depth studies to elucidate these context-dependent effects. Notwithstanding these considerations, our study provides compelling evidence that the RNA demethylase ALKBH5 exerts tumor-suppressive effects in hepatocellular carcinoma through dual mechanisms: reduction of global m6A methylation levels and modulation of the SOCS3-STAT3 signaling cascade. To our knowledge, this investigation represents the first comprehensive demonstration of the functional interplay between ALKBH5 and the SOCS3/STAT3 pathway in hepatocellular carcinoma, establishing a novel molecular mechanism underlying the inhibition of tumor proliferation and induction of apoptosis. These findings position ALKBH5 as both a promising prognostic biomarker and a potential therapeutic target for hepatocellular carcinoma intervention strategies. Abbreviations HCC Hepatocellular carcinoma M6A N6-methyladenosine ALKBH5 ALKB homologous protein 5 ALKB homologous protein 5 (ALKBH5) suppressor of cytokine signaling 3 (SOCS3) signal transducer and activator of transcription 3 (STAT3) Hepatocellular carcinoma (HCC) N6-methyladenosine (M6A) fat mass and obesity-related protein (FTO) programmed death ligand 1 (PD-L1) suppressor of cytokine signaling (SOCS) Declarations Ethics approval and consent to participate Human tumor tissue samples were acquired following the ethical protocols approved by the Research Ethics Committee at Qingdao Municipal Hospital. All procedures related to specimen collection and subsequent immunohistochemical analyses were conducted under the committee’s oversight to ensure compliance with ethical and regulatory requirements.For the in vivo studies, experimental protocols were developed in alignment with the ARRIVE guidelines to ensure transparent and ethical reporting of animal research. Availability of data and materials The data supporting this study are available upon reasonable request to the corresponding author. Consent for publication All the authors agreed to publish the article in the magazine. Competing Interests The authors declare no competing interests. Funding This work has been supported by the Qingdao Municipal Bureau of science and technology (No.2209-01-06-05-10) Authors' contributions QL and XX conceived the study,. TH,W, and ZY performed laboratory work.JC,YL and DL conducted data analysis. Acknowledgements We gratefully acknowledge Qiang Li and Xue Xing for their expert guidance and insightful suggestions throughout this study. We also extend our thanks to Zhen Yang,Jiansheng Chen,Yihao Liu,Dongqi Li for their assistance in data analysis and sample preparation References BROWN Z, TSILIMIGRAS D, RUFF S, et al. Management of Hepatocellular Carcinoma: A Review [J]. JAMA surgery, 2023, 158(4): 410-20. NORERO B, DUFOUR J-F. Should we undertake surveillance for HCC in patients with MAFLD? [J]. Therapeutic Advances in Endocrinology and Metabolism, 2023, 14. BIN G, QIAN C, ZHICHENG L, et al. Adjuvant therapy following curative treatments for hepatocellular carcinoma: current dilemmas and prospects [J]. Frontiers in Oncology, 2023. YINGYING S, RUI-BIN S, YU W, et al. Drug co-administration in the HCC tumor immune microenvironment [J]. Acupuncture and herbal medicine, 2023. YANG J D, HAINAUT P, GORES G J, et al. A global view of hepatocellular carcinoma: trends, risk, prevention and management [J]. Nature Reviews Gastroenterology & Hepatology, 2019, 16(10): 589-604. WANG T, KONG S, TAO M, et al. The potential role of RNA N6-methyladenosine in Cancer progression [J]. Molecular Cancer, 2020, 19(1). XIAOYU C, JING Z, JINGDE Z. The role of m6A RNA methylation in human cancer [J]. Molecular Cancer, 2019. XIULIN J, BAIYANG L, ZHI N, et al. The role of m6A modification in the biological functions and diseases [J]. Signal Transduction and Targeted Therapy, 2021. YUNRU G, XI W, JINGXIN Z, et al. The evolving landscape of N6-methyladenosine modification in the tumor microenvironment [J]. Molecular Therapy, 2021. YUANYUAN A, HUA D. The role of m6A RNA methylation in cancer metabolism [J]. Molecular Cancer, 2022. BIN S, WEIWEI L, KE Y, et al. The role, mechanism, and application of RNA methyltransferase METTL14 in gastrointestinal cancer [J]. Molecular Cancer, 2022. YUMIN W, YAN W, HARSH P, et al. Epigenetic modification of m6A regulator proteins in cancer [J]. Molecular Cancer, 2023. TIANYI W, SHAN K, TAO M, et al. The potential role of RNA N6-methyladenosine in Cancer progression [J]. Molecular Cancer, 2020. XINYAO Q, SHUAI Y, SHAN W, et al. M6A Demethylase ALKBH5 Regulates PD-L1 Expression and Tumor Immunoenvironment in Intrahepatic Cholangiocarcinoma [J]. Cancer Research, 2021. YIYANG H, CHANG G, ZHIBIN L, et al. Demethylase ALKBH5 suppresses invasion of gastric cancer via PKMYT1 m6A modification [J]. Molecular Cancer, 2022. JUNGE D, JIALIANG Z, YING Y, et al. N6-methyladenosine–Mediated Upregulation of WTAPP1 Promotes WTAP Translation and Wnt Signaling to Facilitate Pancreatic Cancer Progression [J]. Cancer Research, 2021. ZHU H, XIAOLIANG G, XINGWEI J, et al. ALKBH5 inhibited autophagy of epithelial ovarian cancer through miR-7 and BCL-2 [J]. Journal of Experimental & Clinical Cancer Research, 2019. ZHANG W, WU W, MENG Q, et al. Research Progress on Long Noncoding RNAs and N6-Methyladenosine in Hepatocellular Carcinoma [J]. Front Oncol, 2022, 12: 907399. YATING X, MENGGANG Z, QIYAO Z, et al. Role of Main RNA Methylation in Hepatocellular Carcinoma: N6-Methyladenosine, 5-Methylcytosine, and N1-Methyladenosine [J]. Frontiers in Cell and Developmental Biology, 2021. WEI L, CUIQING Z, DEGUAN L, et al. N6-Methyladenosine RNA Methylation Regulators Have Clinical Prognostic Values in Hepatocellular Carcinoma [J]. Frontiers in Genetics, 2020. ZHANG H, LIU Y, WANG W, et al. ALKBH5-mediated mA modification of lincRNA LINC02551 enhances the stability of DDX24 to promote hepatocellular carcinoma growth and metastasis [J]. Cell death & disease, 2022, 13(11): 926. YUNHAO C, YUECHAO Z, JUNRU C, et al. ALKBH5 suppresses malignancy of hepatocellular carcinoma via m6A-guided epigenetic inhibition of LYPD1 [J]. Molecular Cancer, 2020. QINJUN C, DAN S, LIANGMEI H, et al. Prognostic significance of SOCS3 and its biological function in colorectal cancer [J]. Gene, 2017. ZECHUAN Y, ZHUO C, CHUN Y, et al. ALKBH5 regulates STAT3 activity to affect the proliferation and tumorigenicity of osteosarcoma via an m6A-YTHDF2-dependent manner [J]. EBioMedicine, 2022. BOXUAN SIMEN Z, IAN A R, CHUAN H. Post-transcriptional gene regulation by mRNA modifications [J]. Nature Reviews Molecular Cell Biology, 2016. WENBO M, TONG W. RNA m6A modification in liver biology and its implication in hepatic diseases and carcinogenesis [J]. American Journal of Physiology-cell Physiology, 2022. ANQI W, YUNXIA H, YAO X, et al. Methyltransferase-Like 3-Mediated m6A Methylation of Hsa_circ_0058493 Accelerates Hepatocellular Carcinoma Progression by Binding to YTH Domain-Containing Protein 1 [J]. Frontiers in Cell and Developmental Biology, 2021. TING L, PEI-SHAN H, ZHIXIANG Z, et al. IDDF2018-ABS-0233 N6-adenosine methyltransferase METTL3 promotes tumour metastasis via SOX2 MRNA M6A modification in colorectal carcinoma [J]. null, 2018. LIHUI D, CHUANYUAN C, YAWEI Z, et al. The loss of RNA N6-adenosine methyltransferase Mettl14 in tumor-associated macrophages promotes CD8+ T cell dysfunction and tumor growth [J]. Cancer Cell, 2021. FUDA X, BONAN C, ALVIN HO-KWAN C, et al. The crosstalk between the RNA demethylase, non‐coding RNAs, and transcription factors in gastric cancer: An ALKBH5 perspective [J]. Clinical and translational discovery, 2023. RAJU K, FENG G, RUAN C, et al. Abstract 3321: Dysregulation of m6A RNA methylation regulators in colorectal cancer: Clinical implication as prognostic biomarkers and potential therapeutic targets [J]. Cancer Research, 2018. YAXU L, HUAN W, BIAO W, et al. The emerging role of N6-methyladenine RNA methylation in metal ion metabolism and metal-induced carcinogenesis [J]. Environmental Pollution, 2023. WEI Z, QIAN Y, GUIFANG J. The detection and functions of RNA modification m6A based on m6A writers and erasers [J]. Journal of Biological Chemistry, 2021. SHANSHAN W, WEI L, TAO L, et al. Dynamic regulation and functions of mRNA m6A modification [J]. Cancer Cell International, 2022. GUO X, LI K, JIANG W, et al. RNA demethylase ALKBH5 prevents pancreatic cancer progression by posttranscriptional activation of PER1 in an m6A-YTHDF2-dependent manner [J]. Molecular cancer, 2020, 19(1): 91. FEN Z, KEVIN BOYANG W, RUI L. STAT3 Activation and Oncogenesis in Lymphoma [J]. Cancers, 2019. BEI H, XIAOLING L, XIHONG L. The role of IL-6/JAK2/STAT3 signaling pathway in cancers [J]. Frontiers in Oncology, 2022. QINGQING Z, WEI T, ZHIYUAN J, et al. A Positive Feedback Loop of AKR1C3-Mediated Activation of NF-κB and STAT3 Facilitates Proliferation and Metastasis in Hepatocellular Carcinoma [J]. Cancer Research, 2021. RUIFAN W, YOUHUA L, YOUBING Z, et al. m6A methylation controls pluripotency of porcine induced pluripotent stem cells by targeting SOCS3/JAK2/STAT3 pathway in a YTHDF1/YTHDF2-orchestrated manner [J]. Cell Death and Disease, 2019. YUNYUN X, YUE L, DONGNI S, et al. MEX3C-Mediated Decay of SOCS3 mRNA Promotes JAK2/STAT3 Signaling to Facilitate Metastasis in Hepatocellular Carcinoma [J]. Cancer Research, 2022. SONJA M W, LUN S, JIAOYU A, et al. Loss of P53 Function Activates JAK2–STAT3 Signaling to Promote Pancreatic Tumor Growth, Stroma Modification, and Gemcitabine Resistance in Mice and Is Associated With Patient Survival [J]. Gastroenterology, 2016. THU-HUYEN P, HYO-MIN P, JINJU K, et al. STAT3 and p53: Dual Target for Cancer Therapy [J]. Biomedicines, 2020. CHUNYAN L, YONG H, CUI Y. Research progress of the relationship between chronic inflammation and pancreatic ductal adenocarcinoma [J]. Chinese Journal of Hepatobiliary Surgery, 2019. WU L, WU D, NING J, et al. Changes of N6-methyladenosine modulators promote breast cancer progression [J]. BMC cancer, 2019, 19(1): 326. YU H, ZHANG Z. ALKBH5-mediated m6A demethylation of lncRNA RMRP plays an oncogenic role in lung adenocarcinoma [J]. Mammalian genome : official journal of the International Mammalian Genome Society, 2021, 32(3): 195-203. ZHU H, GAN X, JIANG X, et al. ALKBH5 inhibited autophagy of epithelial ovarian cancer through miR-7 and BCL-2 [J]. Journal of experimental & clinical cancer research : CR, 2019, 38(1): 163. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6998555","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":478834760,"identity":"99055f1e-534c-460a-86f9-6926f11dae7f","order_by":0,"name":"Tianhao Wu","email":"","orcid":"","institution":"Qingdao Hiser Hospital Affiliated of Qingdao University(Qingdao Traditional Chinese Medicine Hospital)","correspondingAuthor":false,"prefix":"","firstName":"Tianhao","middleName":"","lastName":"Wu","suffix":""},{"id":478834761,"identity":"ccddd475-8f38-4667-ad5b-8239d54ad450","order_by":1,"name":"Zhen Yang","email":"","orcid":"","institution":"Qingdao University","correspondingAuthor":false,"prefix":"","firstName":"Zhen","middleName":"","lastName":"Yang","suffix":""},{"id":478834762,"identity":"ddcc46b3-6791-42db-b57c-0576b23e70fa","order_by":2,"name":"Jiansheng Chen","email":"","orcid":"","institution":"Qingdao Hiser Hospital Affiliated of Qingdao University(Qingdao Traditional Chinese Medicine Hospital)","correspondingAuthor":false,"prefix":"","firstName":"Jiansheng","middleName":"","lastName":"Chen","suffix":""},{"id":478834763,"identity":"ff1d2ab4-8aaa-4d6a-a8d3-39a856acb6eb","order_by":3,"name":"Yihao Liu","email":"","orcid":"","institution":"Scientific Research Center of Qingdao Hiser Hospital Affiliated of Qingdao University(Qingdao Traditional Chinese Medicine Hospital)","correspondingAuthor":false,"prefix":"","firstName":"Yihao","middleName":"","lastName":"Liu","suffix":""},{"id":478834764,"identity":"682b1bcf-599c-4122-b266-5d65ecc37dee","order_by":4,"name":"Dongqi Li","email":"","orcid":"","institution":"Qingdao Hiser Hospital Affiliated of Qingdao University(Qingdao Traditional Chinese Medicine Hospital)","correspondingAuthor":false,"prefix":"","firstName":"Dongqi","middleName":"","lastName":"Li","suffix":""},{"id":478834765,"identity":"56cc6b29-10ef-4cf2-be20-743e2e90d92a","order_by":5,"name":"Qiang Li","email":"","orcid":"","institution":"Qingdao Hiser Hospital Affiliated of Qingdao University(Qingdao Traditional Chinese Medicine Hospital)","correspondingAuthor":false,"prefix":"","firstName":"Qiang","middleName":"","lastName":"Li","suffix":""},{"id":478834766,"identity":"38a19ae1-c172-4040-ae5a-f15faaf38f55","order_by":6,"name":"Xue Xing","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA4UlEQVRIiWNgGAWjYDACZgjFw8/ekPggoaKGeC0ykj0HHhs8OHOMeMtsDG44PpN82MJMWKnBcd7Dr3nbbHgMbjCnVSQ2sDHwt3cn4NUi2cyXZjmzLY1H8nZb2o3EHTIMEmfObsCrhZ+Zx8zgY9thHr47Z4BazrAxGEjk4tfCBtKS2Pafh+FG/reCxDZmwlqAthg/+Nh2gEfgRkIaA1FaJJt5zBhnnEvmAQZyskTCmWM8BP1icP6M8WeeMjt7UFR+/FFRI8ff3otfC8g7Esg8HkLKQYD5AzGqRsEoGAWjYAQDACVzSCsFzenyAAAAAElFTkSuQmCC","orcid":"","institution":"Qingdao University","correspondingAuthor":true,"prefix":"","firstName":"Xue","middleName":"","lastName":"Xing","suffix":""}],"badges":[],"createdAt":"2025-06-28 14:53:21","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6998555/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6998555/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":85992358,"identity":"86d86dce-7e2e-4d52-be87-65e4d9ec4a02","added_by":"auto","created_at":"2025-07-04 05:34:17","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":492104,"visible":true,"origin":"","legend":"\u003cp\u003eALKBH5 expression in Hepatocellular carcinoma and its relationship to patient survival.A. Representative images showing low or high expression of ALKBH5 by IHC staining. C.Kaplan-Meier survival analysis showed that the overall survival time of patients with low ALKBH5 expression was significantly shorter than that of patients with high ALKBH5 expression (logrank p = 0.015,n = 185 low group,n=179 high group)B. Representative western blot showed the expression of ALKBH5 was markedly decreased in Hepatocellular carcinoma (HCC) compared with the normal hepatocyte (N).\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-6998555/v1/4ac16acb0db8a2db637998b0.png"},{"id":85992360,"identity":"f4d28473-7ee6-4d49-8b19-d25a0436a2ea","added_by":"auto","created_at":"2025-07-04 05:34:17","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":442277,"visible":true,"origin":"","legend":"\u003cp\u003eReduced m6A methylation-mediated by ALKBH5 suppresses Hepatocellular carcinoma cell growth and promotes cell apoptosis.A. ALKBH5 overexpression was confirmed by western blot in Hep3B and Huh7 cell lines.B. ALKBH5 up-regulation reduced m6A mRNA Methylation.C. Cell viability was assessed by CKK-8 assay.D. Transwell assay to detect cell migration ability.E. The percentage of apoptosis was determined by FCM analysis.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-6998555/v1/a468aa82d339acef52fefba6.png"},{"id":85992361,"identity":"b22665a0-d5f9-445b-91a1-162e6c939017","added_by":"auto","created_at":"2025-07-04 05:34:17","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":631795,"visible":true,"origin":"","legend":"\u003cp\u003eKnockdown of ALKBH5 promotes proliferation and reduces apoptosis in hepatocellular carcinoma. A. Western blot assay was used to detect the transfection effect after transient transfection using SiRNA. B. Knockdown of ALKBH5 increased the methylation level of m6A mRNA. C. Cell viability was detected using CCK-8 assay. D. Transwell migration assay was used to detect the migratory ability of the cells. e. Apoptosis was detected using the FCM assay.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-6998555/v1/14405386adb3130315e6e838.png"},{"id":85993711,"identity":"ee16713c-20b0-427c-8a28-98c3112f8909","added_by":"auto","created_at":"2025-07-04 05:42:17","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":546080,"visible":true,"origin":"","legend":"\u003cp\u003eA.The expression of SOCS3, a downstream target of ALKBH5, and the expression of STAT3 downstream targets (c-Myc and Bcl-2) were detected by Western blot assay.B. Western blot assay showed the co-transfection efficiency of overexpression of SOCS3 after knockdown of ALKBH5.C. Cell viability was detected by CCK-8 assay.D. Cell migration ability was detected by Transwell migration assay.E. Cell apoptosis was detected by FCM assay. Transwell migration assay to detect the migration ability of cells.E. Apoptosis rate was detected using FCM assay.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-6998555/v1/a7b2749290116924064c6b92.png"},{"id":85992369,"identity":"05255f6f-650d-4ab8-87b0-9d4ebb1ce638","added_by":"auto","created_at":"2025-07-04 05:34:18","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":491579,"visible":true,"origin":"","legend":"\u003cp\u003eFurther validation of the tumorigenic role of ALKBH5 in vivo by subcutaneous transplantation in nude mice. A.Hepatocellular carcinoma growth in vivo after overexpression of ALKBH5, compared with control, ***P \u0026lt; 0.001. B. Hepatocellular carcinoma growth in vivo after silencing ALKBH5, compared with control, ****P \u0026lt; 0.0001. C. Tumors showing growth in vivo after silencing ALKBH5 after overexpression of SOCS3, overexpression of SOCS3 reversed the tumor growth-promoting effect brought about by silencing ALKBH5.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-6998555/v1/2e987558404d470e3acdce59.png"},{"id":85993713,"identity":"c60b42a8-41b6-4578-af92-0427adc092e7","added_by":"auto","created_at":"2025-07-04 05:42:18","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":154251,"visible":true,"origin":"","legend":"\u003cp\u003eSchematic representation of the function of ALKBH5 in HCC cells.ALKBH5 in HCC cells affects hepatocellular carcinoma proliferation and apoptosis by decreasing methylation levels and regulating SOCS3/STAT3 signaling pathway.\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-6998555/v1/0ef490443ad5be23f3d0b4dd.png"},{"id":90635504,"identity":"9b916de4-f6a0-44bb-b4ed-7c1a99dba52a","added_by":"auto","created_at":"2025-09-05 04:31:49","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3003694,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6998555/v1/744b8156-955c-4e88-b59f-f5e0ea7e209f.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Demethylase ALKBH5 inhibits proliferation and promotes apoptosis of hepatocellular carcinoma cells by decreasing methylation levels and regulating SOCS3/STAT3 signaling","fulltext":[{"header":"Introduction","content":"\u003cp\u003eHepatocellular carcinoma (HCC) ranks as the sixth most common cancer globally, yet it accounts for the fourth highest cancer-related mortality, reflecting its aggressive biological behavior and the limited therapeutic options available(\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e). The prognosis of HCC is largely dependent on the stage at diagnosis, but early detection remains challenging. Clinical presentation in the early stages is often subtle, with nonspecific symptoms and minimal imaging findings, leading to late-stage diagnosis in many cases. Despite advances in diagnostic techniques and treatment modalities, the complex molecular pathogenesis of HCC is not yet fully understood, and effective strategies to prevent recurrence and metastasis are lacking(\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e).Surgical resection and liver transplantation, along with targeted therapies and chemotherapy, remain the primary treatment options for HCC. However, tumor heterogeneity and the development of drug resistance significantly limit the efficacy of these treatments. As a result, many patients miss the opportunity for surgery due to diagnosis at an advanced stage, and recurrence rates post-surgery remain high, reaching up to 70%(\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e).In addition to surgery, chemotherapy is a critical treatment, particularly in advanced stages of the disease. Despite recent advancements in understanding the therapeutic mechanisms and potential targets for drug development, the overall prognosis of HCC remains poor. This is largely attributed to the tumor\u0026rsquo;s insidious onset, coupled with the high susceptibility to drug resistance. Therefore, uncovering the molecular mechanisms underlying HCC development is crucial to developing novel therapeutic strategies and improving patient outcomes. (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e)\u003c/p\u003e \u003cp\u003eN6-methyladenosine (m6A) represents a fundamental post-transcriptional modification mechanism in eukaryotic cellular systems, distinguished as the most abundant, evolutionarily conserved, and functionally significant internal RNA modification in higher organisms. This epigenetic mark plays a pivotal role in regulating RNA metabolism and gene expression at the post-transcriptional level.(\u003cspan additionalcitationids=\"CR6\" citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e). This modification plays a significant role in various biological processes, including RNA metabolism, protein translation, immune homeostasis, and the regulation of tumorigenesis and development.(\u003cspan additionalcitationids=\"CR9\" citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e)The process of m6A methylation is reversible and is dynamically regulated by a network of enzymes, including methyltransferases (often referred to as Writers), demethylases (referred to as Erasers), and effector proteins (known as Readers). Notably, the demethylases involved in this process include fat mass and obesity-associated protein (FTO) and ALKBH5 (ALKB homologous protein 5), which are key players in regulating m6A methylation levels.(\u003cspan additionalcitationids=\"CR12\" citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e)\u003c/p\u003e \u003cp\u003eRecent advancements in high-throughput sequencing technologies have significantly increased the focus on m6A methylation modifications. However, the role of ALKBH5, a key demethylase involved in the development and progression of various cancers, has been less explored in hepatocellular carcinoma (HCC).In intrahepatic cholangiocarcinoma, ALKBH5 functions as a critical demethylase that regulates the expression of programmed death ligand 1 (PD-L1), thereby inhibiting T cell expansion and cytotoxicity(\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e). In gastric cancer, ALKBH5 regulates the expression of membrane-associated tyrosine/threonine protein kinase 1 (PKMYT1) in an m6A-dependent manner. PKMYT1, as a downstream target of ALKBH5, promotes the invasion and migration of gastric cancer cells(\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e). In pancreatic ductal adenocarcinoma (PDAC), overexpression of ALKBH5 sensitizes PDAC cells to gemcitabine treatment and suppresses tumorigenesis by reducing the m6A modification of WIF-1 and inhibiting Wnt signaling activation(\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e). Moreover, in ovarian epithelial carcinoma, ALKBH5 promotes the activation of the EGFR-PI3KCA-AKT-mTOR signaling pathway, stabilizes BCL-2 mRNA, and facilitates the interaction between Bcl-2 and Beclin1, contributing to cancer cell survival.These findings highlight the multifaceted role of ALKBH5 in various cancers, suggesting its potential as a therapeutic target, especially in cancers like hepatocellular carcinoma, where its role remains under-investigated(\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e).\u003c/p\u003e \u003cp\u003ePrevious studies have established that m6A methylation modifications play a significant role in the development of hepatocellular carcinoma (HCC). The involvement of ALKBH5, a key m6A demethylase, in carcinogenesis, tumor formation, and the tumor microenvironment has been well-documented in various malignancies. However, the precise role of ALKBH5 in the complex molecular mechanisms underlying HCC remains to be fully elucidated(\u003cspan additionalcitationids=\"CR19\" citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e).Interestingly, conflicting evidence has emerged regarding the effects of ALKBH5 in HCC. For instance, Zhang et al. demonstrated that the long intergenic noncoding RNA (lincRNA) LINC02551 is a downstream target of ALKBH5, with its expression being regulated by ALKBH5 in an m6A-dependent manner. LINC02551, in turn, promotes HCC progression by stabilizing the expression of DDX24(\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e). In contrast, Chen et al. reported that ALKBH5 functions as a tumor suppressor in HCC by inhibiting the expression of LYPD1 in an m6A-dependent manner, identifying LYPD1 as a novel oncogene in HCC(\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e).These contrasting findings suggest that ALKBH5 may exert dual, context-dependent effects in HCC, possibly influencing the disease through different molecular pathways. The complex and sometimes opposing roles of ALKBH5 in HCC development warrant further investigation to clarify its precise mechanistic contributions.\u003c/p\u003e \u003cp\u003eThe suppressor of cytokine signaling (SOCS) family plays a crucial role as a negative feedback regulator of the JAK-STAT3 signaling pathway. Persistent activation of STAT3 is commonly observed in various cancers, and its hyperactivation\u0026mdash;often due to decreased SOCS3 expression\u0026mdash;can induce the expression of multiple pro-tumorigenic genes, contributing to malignancy and tumor progression.In previous studies, SOCS3 has been identified as a key negative regulator of STAT3 in osteosarcoma, with evidence suggesting that it is a downstream target of ALKBH5-mediated m6A modification. Mechanistically, ALKBH5 inhibits the STAT3 pathway by enhancing SOCS3 expression in an m6A-YTHDF2-dependent manner(\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e). However, whether a similar regulatory link exists between ALKBH5 and the SOCS3/STAT3 signaling axis in hepatocellular carcinoma (HCC) has yet to be explored. Therefore, the primary objective of this study is to investigate the relationship between ALKBH5 and the SOCS3-STAT3 axis in HCC and to elucidate the underlying molecular mechanisms involved.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cp\u003eEthical Statement\u003c/p\u003e\n\u003cp\u003eHuman tumor tissue samples were acquired following the ethical protocols approved by the Research Ethics Committee at Qingdao Municipal Hospital. All procedures related to specimen collection and subsequent immunohistochemical analyses were conducted under the committee\u0026rsquo;s oversight to ensure compliance with ethical and regulatory requirements.For the in vivo studies, experimental protocols were developed in alignment with the ARRIVE guidelines to ensure transparent and ethical reporting of animal research. All experimental protocols were subjected to rigorous review and received formal approval from the Institutional Research Ethics Committee of Qingdao Municipal Hospital (Approval No. [insert number]). The study was conducted in strict compliance with established ethical guidelines, with all experimental procedures being meticulously documented, monitored, and audited under the committee\u0026apos;s supervision to ensure adherence to both ethical principles and scientific rigor.\u003c/p\u003e\n\u003cp\u003eReagents and antibodies\u003c/p\u003e\n\u003cp\u003eThe primary antibodies utilized in this study included anti-ALKBH5 (Catalog No. 16837-1-AP) and anti-SOCS3 (Catalog No. 14025-1-AP), both from Proteintech (Manchester, UK). Additionally, antibodies against STAT3 (Catalog No. ab68153) and GAPDH (Catalog No. ab8245) were procured from Abcam (Cambridge, UK). For secondary detection, horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG (Catalog No. M21002) and goat anti-mouse IgG (Catalog No. M21001) were obtained from Abmart (Shanghai, China).\u003c/p\u003e\n\u003cp\u003eCell lines and culture conditions\u003c/p\u003e\n\u003cp\u003eThe cell lines utilized in this investigation were procured from the Type Culture Collection (Shanghai, China). Cell cultures were maintained in Dulbecco\u0026apos;s Modified Eagle Medium (DMEM; Gibco, USA) supplemented with 10% heat-inactivated fetal bovine serum (FBS; Excellbio, USA) and 1% penicillin-streptomycin solution (HyClone, UT, USA). Cells were incubated under standardized conditions at 37\u0026deg;C in a humidified atmosphere containing 5% CO2.\u003c/p\u003e\n\u003cp\u003eALKBH5 knockdown and\u0026nbsp;overexpression\u003c/p\u003e\n\u003cp\u003eThe human ALKBH5 cDNA was synthesized by Jimma Gene and packaged into a lentiviral plasmid vector for cellular transfection. To knock down ALKBH5 expression, siRNA was employed. Three siRNA sequences were designed as follows:\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAGAAGATGGCCTCCAAGAAGCTTCATCCAGGAGGTGAA\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eCUGCGCAACAAGUACUUCUTTAGAAGUACUUGUUUGCGCAGTT\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eCAGUGGAUAUGCUGCUGAUTTAUCAGCAGCAUAUCCACUGTT\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eBased on their knockdown efficiency, the first and third siRNAs were selected for subsequent experiments.\u003c/p\u003e\n\u003cp\u003eCell viability\u003c/p\u003e\n\u003cp\u003eCells were plated in 96-well culture plates at a concentration of 5 \u0026times; 10\u0026sup3; cells per well and allowed to adhere for 24 hours.Following the initial culture period, cells were exposed to varying concentrations of Tan-IIA (0, 5, 10, 20, and 30 \u0026micro;g/mL) for specified time intervals (12, 24, and 48 hours). After the treatment period, cellular viability was assessed by adding 10 \u0026micro;L of CCK8 reagent (APExBIO, K1018, USA) to each well, followed by incubation at 37\u0026deg;C for 60 minutes. Optical density measurements were obtained at 450 nm using a microplate reader, and IC50 values were subsequently determined through non-linear regression analysis employing GraphPad Prism 7.0 software.\u003c/p\u003e\n\u003cp\u003eTranswell invasion assay\u003c/p\u003e\n\u003cp\u003eCell migration was evaluated using a 24-well Transwell assay system. Hepatocellular carcinoma cells (5 \u0026times; 10⁴ cells) were suspended in 100 \u0026micro;L of serum-free culture medium, quantified, and plated in the upper compartment, while the lower compartment contained 600 \u0026micro;L of DMEM medium enriched with 10% fetal bovine serum. Following a 24-hour incubation period, cells remaining on the upper surface of the membrane were carefully eliminated using a cotton applicator. Migrated cells attached to the lower membrane surface were subsequently fixed with methanol, subjected to crystal violet staining, and examined using an inverted light microscope. For quantitative analysis, nine randomly chosen microscopic fields were imaged, and the number of migrated cells in each field was counted and statistically analyzed.\u003c/p\u003e\n\u003cp\u003eImmunohistochemistry\u003c/p\u003e\n\u003cp\u003eA total of 60 paired tissue specimens, comprising hepatocellular carcinoma and corresponding adjacent non-tumorous liver tissues, were obtained from surgical resections. Tissue samples were immediately fixed in 4.0% paraformaldehyde solution, processed through standard paraffin embedding protocols, and sectioned at a thickness of 4 \u0026mu;m. For immunohistochemical analysis, tissue sections were first treated with 3.0% hydrogen peroxide solution to quench endogenous peroxidase activity, followed by blocking with 5.0% bovine serum albumin. Primary antibody incubation was performed using anti-ALKBH5 (16837-1-AP) at 4\u0026deg;C for approximately 16 hours. Following thorough PBS washes, sections were incubated with appropriate HRP-conjugated secondary antibodies at room temperature for 60 minutes. Chromogenic detection was achieved using DAB substrate, with hematoxylin counterstaining for nuclear visualization. Digital imaging was performed using the AxioVision Rel.4.6 digital pathology system (Carl Zeiss) for subsequent quantitative analysis.\u003c/p\u003e\n\u003cp\u003eDetection of Apoptosis Using Annexin-V-FITC/PI Staining\u003c/p\u003e\n\u003cp\u003eCells cultured in six-well plates were harvested, washed twice with phosphate-buffered saline (PBS), and subsequently resuspended in the binding buffer supplied with the Annexin-V-FITC/PI apoptosis detection kit. The cell suspension was then sequentially stained with 5 \u0026mu;L of Annexin V-FITC and 5 \u0026mu;L of propidium iodide (PI), followed by a 15-minute incubation period in light-protected conditions. Cellular apoptosis rates were quantitatively assessed using flow cytometric analysis, which was performed immediately following the staining procedure.\u003c/p\u003e\n\u003cp\u003eWestern Blotting\u003c/p\u003e\n\u003cp\u003eTotal protein was extracted from HCC cells using RIPA lysis buffer (Beyotime), and nuclear and cytoplasmic proteins were isolated using a specific extraction kit (Beyotime). Protein concentrations were determined using a BCA protein assay kit (Beyotime). Following boiling of the samples for 10 minutes, proteins were separated by electrophoresis on 10% SDS-polyacrylamide gels and transferred to polyvinylidene fluoride (PVDF) membranes (Millipore, Bedford, MA, USA). The membranes were blocked with 5% skimmed milk for 2 hours at 25\u0026deg;C, then incubated overnight at 4\u0026deg;C with primary antibodies (1:1000 dilution, Proteintech), including ALKBH5 (Catalog No. 16837-1-AP), SOCS3 (Catalog No. 14025-1-AP), STAT3 (Catalog No. ab68153), and GAPDH (Catalog No. ab8245) as the internal control. After three washes with TBST buffer, the membranes were incubated for 2 hours at 25\u0026deg;C with HRP-conjugated secondary antibodies. Protein bands were detected using an ECL reagent (Millipore), and their intensities were quantified with ImageJ software. All experiments were performed in triplicate.\u003c/p\u003e\n\u003cp\u003eData Analysis\u003c/p\u003e\n\u003cp\u003eStatistical analyses were conducted using GraphPad Prism 7.0 (GraphPad Software Inc., CA, USA). Data from three independent experiments are expressed as mean \u0026plusmn; standard deviation (SD). Group comparisons were performed using a Student\u0026rsquo;s t-test, and differences between multiple groups were evaluated using one-way ANOVA. A p-value of less than 0.05 was considered statistically significant.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003eExpression of ALKBH5 in hepatocellular carcinoma and its association with patient survival.\u003c/p\u003e\n\u003cp\u003eImmunohistochemical analysis was performed to evaluate ALKBH5 expression patterns, revealing significantly higher ALKBH5 levels in normal hepatic tissues compared to hepatocellular carcinoma specimens (Figure 1A). Subsequent clinical correlation studies were conducted to investigate the potential association between ALKBH5 expression levels and hepatocellular carcinoma patient outcomes.Kaplan-Meier survival analysis revealed that patients with low ALKBH5 expression had a significantly shorter overall survival compared to those with high ALKBH5 expression. (Fig. 1C). Additionally, protein blot analysis was conducted on eight samples from both liver tissue and hepatocellular carcinoma tissue. ALKBH5 was detected in both tissue types, but its expression was notably reduced in hepatocellular carcinoma tissue compared to normal liver tissue. (Fig. 1B). This indicates that the dysregulation of ALKBH5 demethylase expression is strongly associated with the survival prognosis of hepatocellular carcinoma patients.\u003c/p\u003e\n\u003cp\u003eALKBH5-mediated methylation reduction inhibits HCC proliferation, migration and promotes apoptosis\u003c/p\u003e\n\u003cp\u003eTo investigate the functional role of ALKBH5 in hepatocellular carcinoma, we performed function acquisition experiments by introducing ALKBH5 expression vector into HCC cells. Hep3B and Huh7 cell lines, which have the highest ALKBH5 expression in hepatocellular carcinoma, were selected for overexpression experiments. We first up-regulated the expression of ALKBH5 using plasmid transfection, and western blot assay confirmed the overexpression of ALKBH5 (Fig. 2A), and at the same time, the methylation level was detected, and We observed that the methylation level of ALKBH5 was significantly reduced in cells with overexpression compared to normal cells.(Fig. 2B). Next, we demonstrated that overexpression of ALKBH5 suppressed the proliferative capacity of hepatocellular carcinoma cells, as evidenced by the CCK-8 cell proliferation assay. (Figure 2C). To comprehensively evaluate the functional role of ALKBH5 in cellular motility, we performed Transwell migration and Matrigel invasion assays using hepatocellular carcinoma cells (Hep3B and Huh7) transfected with either ALKBH5 expression constructs or corresponding empty vectors. Quantitative analysis revealed that ALKBH5 overexpression markedly attenuated both migratory and invasive capacities in both cell lines, demonstrating its potent inhibitory effect on hepatocellular carcinoma cell metastasis.(Figure 2D). We conducted an apoptosis assay using plasmid transfection after overexpressing ALKBH5 for 48 hours. Flow cytometry (FCM) analysis revealed a significant increase in apoptosis in both cell lines. (Figure 2E). This suggests that overexpression of the demethylase ALKBH5 significantly lowered its methylation level, while simultaneously inhibiting the proliferation and migration of hepatocellular carcinoma cells and promoting apoptosis.\u003c/p\u003e\n\u003cp\u003eSilencing of ALKBH5 promotes proliferation, migration and reduces apoptosis in HCC\u003c/p\u003e\n\u003cp\u003eTo more fully understand the role of ALKBH5 in hepatocellular carcinoma, we also performed a gene knockdown assay in the Hep3B cell line. \u0026nbsp;We first knocked down the expression of ALKBH5 by Si-RNA transfection, and the knockdown efficiency of ALKBH5 was confirmed by Western blot (Figure 3A). \u0026nbsp;At the same time, we detected the methylation level of ALKBH5. The methylation level was significantly higher than that of normal cells after silencing ALKBH5 (Figure 3B). CCK-8 cell proliferation assay showed that silencing ALKBH5 enhanced the proliferation of hepatocellular carcinoma cells (Figure 3C). Transwell migration assays demonstrated that silencing ALKBH5 increased the migration ability of Hep3B cells.(Figure 3D). Quantitative assessment of apoptotic rates demonstrated that ALKBH5 knockdown significantly reduced cellular apoptosis (Figure 3E). Collectively, these experimental findings establish ALKBH5 as a critical regulator of hepatocellular carcinoma cell biology, exerting significant influence on multiple oncogenic processes including proliferation, migration, and programmed cell death. Silencing ALKBH5 significantly inhibited the proliferation and migration of these cells, while also reducing the apoptosis rate.\u003c/p\u003e\n\u003cp\u003eSOCS3/STAT3 is a downstream regulator of ALKBH5\u003c/p\u003e\n\u003cp\u003eExtensive review of existing studies reveals a significant association between the SOCS3/STAT3 signaling cascade and ALKBH5, with their interplay playing a crucial role in various malignant cell types. Research evidence indicates that the RNA demethylation enzyme ALKBH5 exerts regulatory control over the STAT3 pathway by enhancing SOCS3 levels through a mechanism that depends on m6A-YTHDF2 interactions. [29]. To investigate the potential involvement of the SOCS3/STAT3 signaling axis in ALKBH5-regulated hepatocyte proliferation, we performed a series of molecular analyses focusing on the expression patterns of key downstream effectors. Through gain-of-function and loss-of-function approaches employing plasmid-mediated overexpression and siRNA-mediated knockdown of ALKBH5, respectively, we systematically evaluated the protein expression profiles. Western blot analysis revealed significant alterations in SOCS3 expression levels following ALKBH5 modulation, establishing SOCS3 as a downstream target of ALKBH5. Furthermore, we extended our investigation to assess STAT3-mediated signaling by quantifying the expression levels of its downstream targets. Comparative analysis demonstrated a marked reduction in the protein expression of c-Myc and Bcl-2, two critical STAT3-regulated oncoproteins, in experimental groups compared to control conditions. (Figure 4A). Subsequently, we established a genetically modified cell line by combining ALKBH5 knockdown with SOCS3 overexpression (Si-ALKBH5+LV-SOCS3) to facilitate subsequent functional investigations. The successful generation of this dual-modified cell model was confirmed through western blot analysis, which demonstrated the efficiency of co-transfection and the expected alterations in protein expression profiles. (Figure 4B), The functional consequences of SOCS3 overexpression were subsequently evaluated using CCK-8 proliferation assays. Comparative analysis revealed that ectopic expression of SOCS3 in the context of ALKBH5 knockdown significantly attenuated the proliferative capacity of hepatocellular carcinoma cells, demonstrating a more pronounced anti-proliferative effect than ALKBH5 silencing alone. (Figure 4C), Cell migration capacity was quantitatively assessed using Transwell assays, which revealed that SOCS3 overexpression significantly impaired the migratory potential of hepatocellular carcinoma cells. Notably, this inhibitory effect on cell migration was more substantial than that observed with ALKBH5 knockdown alone, suggesting an enhanced anti-migratory role of SOCS3 upregulation in the cellular context.(Figure 4D) Apoptosis analysis was concurrently performed to evaluate programmed cell death rates. The experimental data demonstrated that SOCS3 upregulation induced a more pronounced apoptotic response in hepatocellular carcinoma cells compared to the effects observed with ALKBH5 knockdown alone, indicating an enhanced pro-apoptotic function of SOCS3 overexpression in this cellular context. (Figure 4E). Collectively, our experimental findings establish the SOCS3/STAT3 axis as a downstream signaling cascade regulated by ALKBH5 in hepatocellular carcinoma pathogenesis. Importantly, SOCS3 overexpression not only counteracted but also reversed the phenotypic consequences induced by ALKBH5 knockdown, suggesting a potential regulatory feedback mechanism within this molecular pathway.\u003c/p\u003e\n\u003cp\u003eOverexpression of ALKBH5 inhibits tumorigenicity of hepatocellular carcinoma cells in vivo\u003c/p\u003e\n\u003cp\u003eTo further elucidate the tumorigenic role of ALKBH5 in hepatocellular carcinoma progression, we conducted in vivo validation through subcutaneous xenograft transplantation experiments in immunodeficient nude mice. The experimental design involved comparative analysis between hepatocellular carcinoma cells with stable ALKBH5 overexpression and their vector control counterparts. Consistent with our in vitro findings, quantitative assessment of tumor growth kinetics revealed significant suppression of neoplastic proliferation in xenografts derived from Hep3B cells with stable ALKBH5 overexpression, compared to control groups. This in vivo evidence strongly supports the tumor-suppressive function of ALKBH5 in hepatocellular carcinoma pathogenesis. (Figure 5A). In contrast, xenograft models established with Hep3B cells harboring stable ALKBH5 knockdown exhibited markedly accelerated tumor progression, demonstrating significantly enhanced tumor growth kinetics compared to control groups. This reciprocal phenotype further substantiates the critical tumor-suppressive role of ALKBH5 in hepatocellular carcinoma development.(Figure 5B). To comprehensively evaluate the tumorigenic contributions of ALKBH5 and SOCS3 in vivo, we established xenograft models using genetically modified hepatocellular carcinoma cells with stable ALKBH5 knockdown and concurrent SOCS3 overexpression. Tumor growth dynamics were systematically monitored throughout identical experimental periods to quantify the oncogenic potential of these molecular alterations. Quantitative analysis revealed that ALKBH5 silencing substantially potentiated the tumorigenic capacity of hepatocellular carcinoma cells in the murine model. Interestingly, when SOCS3 overexpression was combined with ALKBH5 knockdown, we observed a partial but significant attenuation of tumorigenic potential, suggesting a compensatory tumor-suppressive role of SOCS3 in the context of ALKBH5 deficiency. (Figure 5C). These findings collectively demonstrate that SOCS3 overexpression functionally counteracts the tumor-promoting effects induced by ALKBH5 silencing, effectively reversing the oncogenic phenotype. Our comprehensive experimental data establish that the ALKBH5-mediated SOCS3/STAT3 signaling axis plays a crucial tumor-suppressive role in hepatocellular carcinoma, exerting significant inhibitory effects on both proliferative capacity and metastatic potential of malignant cells.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eThis study provides the first experimental evidence demonstrating that ALKBH5 exerts tumor-suppressive functions in hepatocellular carcinoma through modulation of the SOCS3/STAT3 signaling pathway, mechanistically linking its activity to the inhibition of cellular proliferation and induction of apoptotic processes. Our clinical correlation analysis revealed significant downregulation of ALKBH5 expression in both hepatocellular carcinoma tissues and established cell lines, with lower ALKBH5 expression levels correlating with unfavorable patient prognosis, further supporting its potential role as a tumor suppressor. Functional validation experiments confirmed that ALKBH5 overexpression not only attenuated in vitro oncogenic properties, including proliferation and migratory capacity, but also significantly impaired the tumorigenic potential of hepatocellular carcinoma cells in xenograft mouse models. Our experimental data provide substantial evidence supporting the tumor-suppressive function of ALKBH5 in hepatocellular carcinoma progression, particularly through its regulatory influence on the SOCS3/STAT3 signaling cascade. This study represents the first comprehensive investigation establishing a mechanistic link between ALKBH5, a crucial m6A RNA demethylase in epigenetic regulation, and the SOCS3/STAT3 pathway, both of which play pivotal roles in hepatocellular carcinoma pathogenesis. These findings significantly advance our understanding of the molecular mechanisms underlying hepatocellular carcinoma development and highlight the critical importance of ALKBH5-mediated epigenetic regulation in tumor progression. The identification of this novel regulatory axis not only expands the current knowledge of hepatocellular carcinoma biology but also provides new insights into potential therapeutic targets for this malignancy.\u003c/p\u003e\n\u003cp\u003eExtensive research has firmly established that m6A RNA methylation plays a critical regulatory role in tumor cell growth and proliferation processes (25). Accumulating evidence from recent studies demonstrates that abnormal m6A modification patterns are intricately associated with the molecular pathogenesis of diverse human diseases (26). The complex m6A methylation process represents a precisely regulated molecular cascade, where dysregulation or mutational alterations in any component of this pathway can disrupt cellular homeostasis and contribute to disease pathogenesis. Emerging evidence has demonstrated that m6A methyltransferases, including METTL3 and METTL14, contribute to tumorigenesis through distinct molecular mechanisms (27-29). The RNA demethylase ALKBH5, which utilizes iron ions and 2-oxoglutarate (2-OG) as essential cofactors, has been identified as a critical regulator in various pathological conditions, with its dysregulation playing a pivotal role in disease development (30,31). Functionally, ALKBH5 primarily mediates the dynamic regulation of m6A modifications in eukaryotic transcriptomes, exerting its biological effects through precise modulation of RNA metabolism, translational efficiency, and transcript stability at the post-transcriptional level (32-34). ALKBH5 has emerged as a focal point in contemporary cancer research, with numerous studies elucidating its multifaceted roles in tumor biology. In hepatocellular carcinoma, ALKBH5 has been identified as a tumor suppressor that modulates LYPD1 expression through m6A-dependent mechanisms (22). Furthermore, research across various malignancies has revealed that ALKBH5 deficiency is associated with tumor progression and unfavorable clinicopathological features in prostate cancer. Mechanistically, ALKBH5 exerts its tumor-suppressive function by post-transcriptionally activating PER1 through m6A-YTHDF2-dependent demethylation, subsequently triggering the ATM-CHK2-P53/CDC25C signaling cascade to inhibit tumor proliferation (35).\u003c/p\u003e\n\u003cp\u003eOur investigation reveals that m6A-mediated RNA methylation exerts regulatory control over the STAT3 signaling pathway, thereby influencing cellular proliferation and growth dynamics in hepatocellular carcinoma. The STAT3 pathway, known to play pivotal roles in diverse biological processes, has been extensively documented to contribute to tumorigenesis when aberrantly activated (36-38). The m6A modification system modulates STAT3 signaling through multiple molecular mechanisms, with different m6A-associated enzymes capable of either activating or suppressing this pathway. The observed reduction in STAT3 activation may represent a key mechanism underlying the inhibition of cellular proliferation, as evidenced by studies demonstrating that STAT3 upregulation can effectively counteract growth suppression (24,39).Recent studies have identified the RNA-binding protein MEX3C as a critical regulator that accelerates SOCS3 mRNA degradation, consequently enhancing JAK2/STAT3 pathway activation and facilitating hepatocellular carcinoma metastasis (40). In pancreatic cancer biology, loss-of-function mutations or inactivation of p53 have been shown to trigger JAK2/STAT3 pathway activation, leading to structural phosphorylation of STAT3 (41,42). Furthermore, the JAK2/STAT3 signaling cascade has been implicated as a key driver in the pathological progression from chronic pancreatitis to pancreatic ductal adenocarcinoma (43).\u003c/p\u003e\n\u003cp\u003eWhile our study provides significant insights, several limitations should be acknowledged. The current experimental design does not fully exclude the possibility that ALKBH5 might exert its effects through additional signaling pathways, potentially influencing our results through direct or indirect mechanisms. This limitation is particularly relevant considering previous findings in osteosarcoma, where ALKBH5 has been shown to modulate STAT3 pathway activity through m6A-YTHDF2-dependent upregulation of SOCS3 expression. (24).In subsequent investigations, we plan to systematically examine whether the RNA demethylase ALKBH5 similarly regulates SOCS3 expression through analogous mechanisms in hepatocellular carcinoma. While our current findings demonstrate that ALKBH5-mediated m6A demethylation inhibits hepatocellular carcinoma progression via the SOCS3/STAT3 signaling axis, it is noteworthy that m6A methylation modifications can exhibit tumor-promoting effects in other malignancies, resulting in contrasting biological outcomes (44-46). Accumulating evidence suggests that m6A methylation exerts tumor-specific regulatory functions through distinct molecular mechanisms, highlighting the necessity for comprehensive, in-depth studies to elucidate these context-dependent effects.\u003c/p\u003e\n\u003cp\u003eNotwithstanding these considerations, our study provides compelling evidence that the RNA demethylase ALKBH5 exerts tumor-suppressive effects in hepatocellular carcinoma through dual mechanisms: reduction of global m6A methylation levels and modulation of the SOCS3-STAT3 signaling cascade. To our knowledge, this investigation represents the first comprehensive demonstration of the functional interplay between ALKBH5 and the SOCS3/STAT3 pathway in hepatocellular carcinoma, establishing a novel molecular mechanism underlying the inhibition of tumor proliferation and induction of apoptosis. These findings position ALKBH5 as both a promising prognostic biomarker and a potential therapeutic target for hepatocellular carcinoma intervention strategies.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eHCC \u0026nbsp; \u0026nbsp; \u0026nbsp; Hepatocellular carcinoma\u003c/p\u003e\n\u003cp\u003eM6A \u0026nbsp; \u0026nbsp; \u0026nbsp;N6-methyladenosine\u003c/p\u003e\n\u003cp\u003eALKBH5 \u0026nbsp;ALKB homologous protein 5\u003c/p\u003e\n\u003cp skip=\"true\"\u003eALKB homologous protein 5 (ALKBH5)\u003c/p\u003e\n\u003cp skip=\"true\"\u003esuppressor of cytokine signaling 3 (SOCS3)\u003c/p\u003e\n\u003cp skip=\"true\"\u003esignal transducer and activator of transcription 3 (STAT3)\u003c/p\u003e\n\u003cp skip=\"true\"\u003eHepatocellular carcinoma (HCC)\u003c/p\u003e\n\u003cp skip=\"true\"\u003eN6-methyladenosine (M6A)\u003c/p\u003e\n\u003cp skip=\"true\"\u003efat mass and obesity-related protein (FTO)\u003c/p\u003e\n\u003cp skip=\"true\"\u003eprogrammed death ligand 1 (PD-L1)\u003c/p\u003e\n\u003cp skip=\"true\"\u003esuppressor of cytokine signaling (SOCS)\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003eEthics approval and consent to participate\u003c/p\u003e\n\u003cp skip=\"true\"\u003eHuman tumor tissue samples were acquired following the ethical protocols approved by the Research Ethics Committee at Qingdao Municipal Hospital. All procedures related to specimen collection and subsequent immunohistochemical analyses were conducted under the committee\u0026rsquo;s oversight to ensure compliance with ethical and regulatory requirements.For the in vivo studies, experimental protocols were developed in alignment with the ARRIVE guidelines to ensure transparent and ethical reporting of animal research.\u003c/p\u003e\n\u003cp skip=\"true\"\u003eAvailability of data and materials\u003c/p\u003e\n\u003cp skip=\"true\"\u003eThe data supporting this study are available upon reasonable request to the corresponding author.\u003c/p\u003e\n\u003cp skip=\"true\"\u003eConsent for publication\u003c/p\u003e\n\u003cp skip=\"true\"\u003eAll the authors agreed to publish the article in the magazine.\u003c/p\u003e\n\u003cp skip=\"true\"\u003eCompeting Interests\u003c/p\u003e\n\u003cp skip=\"true\"\u003eThe authors declare no competing interests.\u003c/p\u003e\n\u003cp skip=\"true\"\u003eFunding\u003c/p\u003e\n\u003cp skip=\"true\"\u003eThis work has been supported by the Qingdao Municipal Bureau of science and technology (No.2209-01-06-05-10)\u003c/p\u003e\n\u003cp skip=\"true\"\u003eAuthors\u0026apos; contributions\u003c/p\u003e\n\u003cp skip=\"true\"\u003eQL and XX conceived the study,. TH,W, and ZY performed laboratory work.JC,YL and DL conducted data analysis.\u003c/p\u003e\n\u003cp skip=\"true\"\u003eAcknowledgements\u003c/p\u003e\n\u003cp skip=\"true\"\u003eWe gratefully acknowledge Qiang Li and Xue Xing for their expert guidance and insightful suggestions throughout this study. We also extend our thanks to Zhen Yang,Jiansheng Chen,Yihao Liu,Dongqi Li for their assistance in data analysis and sample preparation\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eBROWN Z, TSILIMIGRAS D, RUFF S, et al. Management of Hepatocellular Carcinoma: A Review [J]. JAMA surgery, 2023, 158(4): 410-20.\u003c/li\u003e\n\u003cli\u003eNORERO B, DUFOUR J-F. Should we undertake surveillance for HCC in patients with MAFLD? [J]. Therapeutic Advances in Endocrinology and Metabolism, 2023, 14.\u003c/li\u003e\n\u003cli\u003eBIN G, QIAN C, ZHICHENG L, et al. Adjuvant therapy following curative treatments for hepatocellular carcinoma: current dilemmas and prospects [J]. Frontiers in Oncology, 2023.\u003c/li\u003e\n\u003cli\u003eYINGYING S, RUI-BIN S, YU W, et al. Drug co-administration in the HCC tumor immune microenvironment [J]. Acupuncture and herbal medicine, 2023.\u003c/li\u003e\n\u003cli\u003eYANG J D, HAINAUT P, GORES G J, et al. A global view of hepatocellular carcinoma: trends, risk, prevention and management [J]. Nature Reviews Gastroenterology \u0026amp; Hepatology, 2019, 16(10): 589-604.\u003c/li\u003e\n\u003cli\u003e\u003cins cite=\"mailto:Mia%20San%20Mia!\" datetime=\"2024-08-23T22:28\"\u003e \u003c/ins\u003eWANG T, KONG S, TAO M, et al. The potential role of RNA N6-methyladenosine in Cancer progression [J]. Molecular Cancer, 2020, 19(1).\u003c/li\u003e\n\u003cli\u003eXIAOYU C, JING Z, JINGDE Z. The role of m6A RNA methylation in human cancer [J]. Molecular Cancer, 2019.\u003c/li\u003e\n\u003cli\u003eXIULIN J, BAIYANG L, ZHI N, et al. The role of m6A modification in the biological functions and diseases [J]. Signal Transduction and Targeted Therapy, 2021.\u003c/li\u003e\n\u003cli\u003eYUNRU G, XI W, JINGXIN Z, et al. The evolving landscape of N6-methyladenosine modification in the tumor microenvironment [J]. Molecular Therapy, 2021.\u003c/li\u003e\n\u003cli\u003eYUANYUAN A, HUA D. The role of m6A RNA methylation in cancer metabolism [J]. Molecular Cancer, 2022.\u003c/li\u003e\n\u003cli\u003eBIN S, WEIWEI L, KE Y, et al. The role, mechanism, and application of RNA methyltransferase METTL14 in gastrointestinal cancer [J]. Molecular Cancer, 2022.\u003c/li\u003e\n\u003cli\u003eYUMIN W, YAN W, HARSH P, et al. Epigenetic modification of m6A regulator proteins in cancer [J]. Molecular Cancer, 2023.\u003c/li\u003e\n\u003cli\u003eTIANYI W, SHAN K, TAO M, et al. The potential role of RNA N6-methyladenosine in Cancer progression [J]. Molecular Cancer, 2020.\u003c/li\u003e\n\u003cli\u003eXINYAO Q, SHUAI Y, SHAN W, et al. M6A Demethylase ALKBH5 Regulates PD-L1 Expression and Tumor Immunoenvironment in Intrahepatic Cholangiocarcinoma [J]. Cancer Research, 2021.\u003c/li\u003e\n\u003cli\u003eYIYANG H, CHANG G, ZHIBIN L, et al. Demethylase ALKBH5 suppresses invasion of gastric cancer via PKMYT1 m6A modification [J]. Molecular Cancer, 2022.\u003c/li\u003e\n\u003cli\u003eJUNGE D, JIALIANG Z, YING Y, et al. N6-methyladenosine\u0026ndash;Mediated Upregulation of WTAPP1 Promotes WTAP Translation and Wnt Signaling to Facilitate Pancreatic Cancer Progression [J]. Cancer Research, 2021.\u003c/li\u003e\n\u003cli\u003eZHU H, XIAOLIANG G, XINGWEI J, et al. ALKBH5 inhibited autophagy of epithelial ovarian cancer through miR-7 and BCL-2 [J]. Journal of Experimental \u0026amp; Clinical Cancer Research, 2019.\u003c/li\u003e\n\u003cli\u003eZHANG W, WU W, MENG Q, et al. Research Progress on Long Noncoding RNAs and N6-Methyladenosine in Hepatocellular Carcinoma [J]. Front Oncol, 2022, 12: 907399.\u003c/li\u003e\n\u003cli\u003eYATING X, MENGGANG Z, QIYAO Z, et al. Role of Main RNA Methylation in Hepatocellular Carcinoma: N6-Methyladenosine, 5-Methylcytosine, and N1-Methyladenosine [J]. Frontiers in Cell and Developmental Biology, 2021.\u003c/li\u003e\n\u003cli\u003eWEI L, CUIQING Z, DEGUAN L, et al. N6-Methyladenosine RNA Methylation Regulators Have Clinical Prognostic Values in Hepatocellular Carcinoma [J]. Frontiers in Genetics, 2020.\u003c/li\u003e\n\u003cli\u003eZHANG H, LIU Y, WANG W, et al. ALKBH5-mediated mA modification of lincRNA LINC02551 enhances the stability of DDX24 to promote hepatocellular carcinoma growth and metastasis [J]. Cell death \u0026amp; disease, 2022, 13(11): 926.\u003c/li\u003e\n\u003cli\u003eYUNHAO C, YUECHAO Z, JUNRU C, et al. ALKBH5 suppresses malignancy of hepatocellular carcinoma via m6A-guided epigenetic inhibition of LYPD1 [J]. Molecular Cancer, 2020.\u003c/li\u003e\n\u003cli\u003eQINJUN C, DAN S, LIANGMEI H, et al. Prognostic significance of SOCS3 and its biological function in colorectal cancer [J]. Gene, 2017.\u003c/li\u003e\n\u003cli\u003eZECHUAN Y, ZHUO C, CHUN Y, et al. ALKBH5 regulates STAT3 activity to affect the proliferation and tumorigenicity of osteosarcoma via an m6A-YTHDF2-dependent manner [J]. EBioMedicine, 2022.\u003c/li\u003e\n\u003cli\u003eBOXUAN SIMEN Z, IAN A R, CHUAN H. Post-transcriptional gene regulation by mRNA modifications [J]. Nature Reviews Molecular Cell Biology, 2016.\u003c/li\u003e\n\u003cli\u003eWENBO M, TONG W. RNA m6A modification in liver biology and its implication in hepatic diseases and carcinogenesis [J]. American Journal of Physiology-cell Physiology, 2022.\u003c/li\u003e\n\u003cli\u003eANQI W, YUNXIA H, YAO X, et al. Methyltransferase-Like 3-Mediated m6A Methylation of Hsa_circ_0058493 Accelerates Hepatocellular Carcinoma Progression by Binding to YTH Domain-Containing Protein 1 [J]. Frontiers in Cell and Developmental Biology, 2021.\u003c/li\u003e\n\u003cli\u003eTING L, PEI-SHAN H, ZHIXIANG Z, et al. IDDF2018-ABS-0233 N6-adenosine methyltransferase METTL3 promotes tumour metastasis via SOX2 MRNA M6A modification in colorectal carcinoma [J]. null, 2018.\u003c/li\u003e\n\u003cli\u003eLIHUI D, CHUANYUAN C, YAWEI Z, et al. The loss of RNA N6-adenosine methyltransferase Mettl14 in tumor-associated macrophages promotes CD8+ T cell dysfunction and tumor growth [J]. Cancer Cell, 2021.\u003c/li\u003e\n\u003cli\u003eFUDA X, BONAN C, ALVIN HO-KWAN C, et al. The crosstalk between the RNA demethylase, non‐coding RNAs, and transcription factors in gastric cancer: An ALKBH5 perspective [J]. Clinical and translational discovery, 2023.\u003c/li\u003e\n\u003cli\u003eRAJU K, FENG G, RUAN C, et al. Abstract 3321: Dysregulation of m6A RNA methylation regulators in colorectal cancer: Clinical implication as prognostic biomarkers and potential therapeutic targets [J]. Cancer Research, 2018.\u003c/li\u003e\n\u003cli\u003eYAXU L, HUAN W, BIAO W, et al. The emerging role of N6-methyladenine RNA methylation in metal ion metabolism and metal-induced carcinogenesis [J]. Environmental Pollution, 2023.\u003c/li\u003e\n\u003cli\u003eWEI Z, QIAN Y, GUIFANG J. The detection and functions of RNA modification m6A based on m6A writers and erasers [J]. Journal of Biological Chemistry, 2021.\u003c/li\u003e\n\u003cli\u003eSHANSHAN W, WEI L, TAO L, et al. Dynamic regulation and functions of mRNA m6A modification [J]. Cancer Cell International, 2022.\u003c/li\u003e\n\u003cli\u003eGUO X, LI K, JIANG W, et al. RNA demethylase ALKBH5 prevents pancreatic cancer progression by posttranscriptional activation of PER1 in an m6A-YTHDF2-dependent manner [J]. Molecular cancer, 2020, 19(1): 91.\u003c/li\u003e\n\u003cli\u003eFEN Z, KEVIN BOYANG W, RUI L. STAT3 Activation and Oncogenesis in Lymphoma [J]. Cancers, 2019.\u003c/li\u003e\n\u003cli\u003eBEI H, XIAOLING L, XIHONG L. The role of IL-6/JAK2/STAT3 signaling pathway in cancers [J]. Frontiers in Oncology, 2022.\u003c/li\u003e\n\u003cli\u003eQINGQING Z, WEI T, ZHIYUAN J, et al. A Positive Feedback Loop of AKR1C3-Mediated Activation of NF-\u0026kappa;B and STAT3 Facilitates Proliferation and Metastasis in Hepatocellular Carcinoma [J]. Cancer Research, 2021.\u003c/li\u003e\n\u003cli\u003eRUIFAN W, YOUHUA L, YOUBING Z, et al. m6A methylation controls pluripotency of porcine induced pluripotent stem cells by targeting SOCS3/JAK2/STAT3 pathway in a YTHDF1/YTHDF2-orchestrated manner [J]. Cell Death and Disease, 2019.\u003c/li\u003e\n\u003cli\u003eYUNYUN X, YUE L, DONGNI S, et al. MEX3C-Mediated Decay of SOCS3 mRNA Promotes JAK2/STAT3 Signaling to Facilitate Metastasis in Hepatocellular Carcinoma [J]. Cancer Research, 2022.\u003c/li\u003e\n\u003cli\u003eSONJA M W, LUN S, JIAOYU A, et al. Loss of P53 Function Activates JAK2\u0026ndash;STAT3 Signaling to Promote Pancreatic Tumor Growth, Stroma Modification, and Gemcitabine Resistance in Mice and Is Associated With Patient Survival [J]. Gastroenterology, 2016.\u003c/li\u003e\n\u003cli\u003eTHU-HUYEN P, HYO-MIN P, JINJU K, et al. STAT3 and p53: Dual Target for Cancer Therapy [J]. Biomedicines, 2020.\u003c/li\u003e\n\u003cli\u003eCHUNYAN L, YONG H, CUI Y. Research progress of the relationship between chronic inflammation and pancreatic ductal adenocarcinoma [J]. Chinese Journal of Hepatobiliary Surgery, 2019.\u003c/li\u003e\n\u003cli\u003eWU L, WU D, NING J, et al. Changes of N6-methyladenosine modulators promote breast cancer progression [J]. BMC cancer, 2019, 19(1): 326.\u003c/li\u003e\n\u003cli\u003eYU H, ZHANG Z. ALKBH5-mediated m6A demethylation of lncRNA RMRP plays an oncogenic role in lung adenocarcinoma [J]. Mammalian genome : official journal of the International Mammalian Genome Society, 2021, 32(3): 195-203.\u003c/li\u003e\n\u003cli\u003eZHU H, GAN X, JIANG X, et al. ALKBH5 inhibited autophagy of epithelial ovarian cancer through miR-7 and BCL-2 [J]. Journal of experimental \u0026amp; clinical cancer research : CR, 2019, 38(1): 163.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Demethylase ALKBH5, methylation, HCC, SOCS3/STAT3 signaling pathway","lastPublishedDoi":"10.21203/rs.3.rs-6998555/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6998555/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eIn this study, we investigated the role of ALKBH5 in the pathogenesis of hepatocellular carcinoma (HCC), focusing on the underlying molecular mechanisms. Comparative analysis of ALKBH5 expression profiles between hepatocellular carcinoma (HCC) tissues and adjacent non-tumorous liver tissues revealed a significant downregulation of ALKBH5 in malignant tissues. To investigate the functional significance of ALKBH5 in HCC pathogenesis, we employed both gain-of-function and loss-of-function approaches in HCC cell lines, utilizing overexpression and RNA interference strategies. Clinical correlation studies demonstrated that decreased ALKBH5 expression levels were significantly associated with reduced overall survival rates in HCC patients, suggesting its potential role as a prognostic biomarker.Furthermore, upregulation of ALKBH5 expression inhibited HCC cell proliferation and induced apoptosis. Through mechanistic studies, we identified SOCS3 as a downstream target of ALKBH5, which negatively regulates the STAT3 signaling pathway.In conclusion, our findings suggest that ALKBH5, as a demethylase, suppresses HCC cell proliferation and promotes apoptosis by reducing methylation levels and modulating the SOCS3/STAT3 pathway. These insights deepen our understanding of the molecular mechanisms underlying HCC and provide potential avenues for future therapeutic development.\u003c/p\u003e","manuscriptTitle":"Demethylase ALKBH5 inhibits proliferation and promotes apoptosis of hepatocellular carcinoma cells by decreasing methylation levels and regulating SOCS3/STAT3 signaling","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-07-04 05:34:13","doi":"10.21203/rs.3.rs-6998555/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"5a5b60a2-37e2-4429-b543-1bf8084aea9c","owner":[],"postedDate":"July 4th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2026-01-29T07:39:29+00:00","versionOfRecord":[],"versionCreatedAt":"2025-07-04 05:34:13","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-6998555","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6998555","identity":"rs-6998555","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.