First Whole-Genome Chikungunya Virus Sequence Detected in Mosquitoes during the 2025 Foshan Outbreak: Evidence of Field Vector Infection and Transmission Potential in China

21

Since July 2025, an outbreak of mosquito-borne 22 chikungunya fever occurred in Foshan City, Guangdong Province, China. 23 This was the second outbreak in China following the one that occurred in 24 Dongguan City, Guangdong Province, in 2010. Moreover, the intensity of 25 this outbreak was significantly greater than that of the previous one. 26 Updates to 23 August, more than 10,000 human cases had been reported. 27 Here, we present the first full genome sequence of the chikungunya virus 28 (CHIKV) derived from field-trapped mosquitoes during the outbreak. 29

Adult Aedes albopictus were BG-trap captured from residences 30 and parklands in three hotspot towns with high density of confirmed 31 human cases. Mosquitoes were morphologically identified and pooled by 32 species, sex and environment types. RNA was extracted, screened by 33 CHIKV RT-qPCR, then positive pools underwent sanger and whole -34 genome sequencing for complete sequences. Lineage and mutational 35 profiles were inferred by maximum likelihood phylogenetic and 36 comparison against human and mosquito genomes. The distribution of 37 amino acid site mutations in different protein coding regions was also 38 analyzed. 39

Through 11 days of collection using 10 BG-traps, 2,803 40 mosquitoes were captured. 1569 (55.97%) female Ae. albopictus were 41 divided into 77 pools and 9.09% (7/77) of the pools tested positive for 42 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.25.672256doi: bioRxiv preprint CHIKV. The local Ae. albopictus minimum infection rate (MIR, per 1000 43 females) was 4.46, while the MIR for residences in Lecong Town was the 44 highest at 9.17. The MIR for parklands was slight higher than for 45 residences (4.60 vs. 4.30). All the 5 Ae. albopictus-derived complete 46 CHIKV genome clustered within ECSA-Indian Ocean lineage genotype, 47 closely related to human-derived genomes on 2025 Reunion Island. 48 Amino-acid mutations E1-A226V/E2-L210Q were detected in the strains, 49 which enhanced adaptability to Ae. albopictus and increased the 50 transmission capacity. Novel mutation observed on E1 and E2 were 51 totally consist to the patient-derived CHIKV in 2025 Reunion Island. 52

It was the first mosquito-derived CHIKV whole-genome 53 during the 2025 Foshan outbreak, filling a critical gap between human 54 case and entomological surveillance. Ae. albopictus was confirmed as the 55 primary vector during the outbreak. The current outbreak CHIKV strain 56 with particular amino-acid mutations had adapted to Ae. albopictus 57 transmission. Compared to previous Chikungunya outbreaks over the past 58 decade, the Foshan outbreak occurred earlier (early July), in a larger 59 urban area (with a population of over 9.5 million), and with abundant 60 breeding sites for the vector mosquito Ae. albopictus. However, the 61 outbreak was quickly brought under control, with daily case numbers 62 consistently decreasing, which is closely linked to the strong vector 63 control measures implemented by the Chinese government in the early 64 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.25.672256doi: bioRxiv preprint stages of the outbreak. Moreover, this event once again underscores the 65 necessity of early monitoring of vector mosquitoes and the importance of 66 implementing highly effective vector intervention measures as soon as 67 possible after an outbreak occurs. 68

chikungunya virus (CHIKV); Foshan city; Aedes albopictus; 69 whole-genome sequencing; outbreak genomics 70 71 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.25.672256doi: bioRxiv preprint 1. Introduction 72 The chikungunya virus (CHIKV) is a mosquito-borne single-73 stranded RNA virus (belonging to the Togaviridae family, Alphavirus 74 genus) that causes an acute febrile illness accompanied by severe and 75 debilitating arthralgia [1]. The primary vectors for CHIKV are Aedes 76 aegypti and Ae. albopictus[2]. Given the widespread distribution of Ae. 77 mosquitoes in tropical and subtropical regions, CHIKV has demonstrated 78 significant global cross-regional transmission potential[3]. Currently, 79 CHIKV is classified into four major genotypes: West African (WA), 80 East/Central/South African (ECSA), Asian, and the Indian Ocean Lineage 81 (IOL, a branch of the ECSA genotype). From the first detection from 82 Tanzania in 1952 , CHIKV was sporadically confined to Asia and Africa. 83 However, since the beginning of the 21st century, it had re-emerged in 84 over 100 countries across Asia, Africa and America. For example, the 85

of IOL had led to explosive epidemics in India and Southeast 86 Asia, posing a serious threat to public health[4-6]. 87 In 2010, Dongguan City in Guangdong witnessed China’s first large-88 scale local CHIKV outbreak, where abundant Ae. albopictus populations. 89 Dongguan CHIKV strain belonged to the ECSA-IOL genotype with the 90 E1-A226V mutation, which significantly enhances its adaptability to the 91 local primary vector Ae. albopictus [7, 8]. Subsequently, imported cases 92 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.25.672256doi: bioRxiv preprint and sporadic local transmission were reported in Yunnan, Zhejiang, and 93 other regions[9, 10]. Nowadays, the emerging outbreak in Foshan City, 94 Guangdong Province, which began in July 2025, had infected above 10 95 thousand people by August 23[11]. The subtropical climate and rapid 96 urbanization in China, combined with high Ae. mosquito activity and 97 population density, amplified the risk for CHIKV outbreaks in Pearl River 98 Delta region (Guangdong province). 99 Viral genomes was instrumental in the identification of the 100 epidemics origin and the reconstruction of transmission chains [12]. 101 However, the majority of CHIKV viral sequences from the Foshan 2025 102 outbreak were patient-derived, with no field mosquito-derived CHIKV 103 genome has been reported, which hindered comprehensive understanding 104 of the transmission ecology and the establishment of phylogenetic linkage 105 between human cases and local vector. There were several documented 106 mosquito-derived CHIKV genomes from epidemics in Asia, European 107 and Latin America countries[13-16]. Mosquito-derived CHIKV genomes 108 not only validate vector infection but also reveal potential adaptive 109 mutations. The E1-A226V mutation, first identified in the IOL strains of 110 the 2005–2006 Indian Ocean outbreak, has been shown to dramatically 111 increase CHIKV infectivity and dissemination in Ae. albopictus. In 2009, 112 a second-step mutation (E2-L210Q) emerged in India, further enhancing 113 midgut infection in Ae. albopictus without affecting fitness in Ae. aegypti. 114 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.25.672256doi: bioRxiv preprint These sequential adaptations havd enabled CHIKV to exploit Ae. 115 albopictus as a more efficient urban vector across a wider geographic and 116 climatic range, where Ae. albopictus predominates, such as in urban 117 China[17, 18]. 118 This study was conducted during the ongoing CHIKV outbreak in 119 August 2025, Foshan, China, where the CHIKV positivity rate was 120 detected in Ae. mosquitoes and first mosquito-derived CHIKV strains 121 whole genome was obtained. By assessing mosquito infection rates, 122 genotypes, and key mutation profiles, this study provided critical 123 evidence for CHIKV vector attribution and an evaluation of the mosquito 124 control efficacy during the outbreak, enabling timely responses and 125 guidance for mosquito-borne disease control measures. 126 127 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.25.672256doi: bioRxiv preprint 2. Materials and Methods 128 2.1. Sampling Sites 129 This study was conducted in the field area of Beijiao, Chencun and 130 Lecong Towns in Shunde District, Foshan City, Guangdong Province, 131 China, which were a hotspot region (over 90% of patient cases were 132 reported at the initial phase) for the CHIKV pandemic (Figure 1). The area 133 is located approximately 30 –40 kilometers from Guangzhou City 134 (international city with 19 million population) and has a subtropical humid 135 climate with an annual average temperature of 22.2°C (range 10°C to 136 33°C). The region receives approximately 1,677.3 millimeters of 137 precipitation annually, with June having the highest precipitation at 273.7 138 millimeters and an annual average relative humidity of 79% , which is 139 highly suitable for the survival of the primary vector Ae. mosquitoes. 140 2.2. Mosquito Collection and processing 141 The mosquitoes were collected outdoors with BG-Sentinel traps from 142 9 am to 8 pm during July 31st and Aug 10th. Adult mosquitoes were frozen 143 at − 20 °C for 30 min and placed on ice for morphological identification , 144 then immediately transferred in carbon dioxide ice. 145 We restricted analyses to female Ae. mosquitoes, as only females 146 blood-feed and contribute to arbovirus transmission. the Ae. albopictus 147 mosquitoes were quantified and grouped in pools, according to species, sex, 148 location. Each pool compris ed approximately 2 5 individuals. Each pool 149 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.25.672256doi: bioRxiv preprint was homogenized by motor driven tissue grinder with 1 ml of Media 150 Dulbecco's Modified Eagle Medium (DMEM) (Gibco) supplemented with 151 2% fetal bovine serum (FBS) (Gibco). Following homogenization, the 152 samples were centrifuged at 8000 × g for 10 min at 4°C. The supernatant 153 was subsequently collected and stored at -80°C until further processing. 154 2.3. Viral RNA Extraction and CHIKV molecular detection with RT-155 qPCR 156 The prepared homogenate was clarified by centrifugation and the 157 supernatant was used for viral RNA isolation. RNA was extracted from 158 pools of clarified mosquito homogenates using viral RNA isolation kit 159 (QIAGEN, Germany, catalog #52906), according to manufacturer’s 160 instructions. The RNA was eluted from the QIAspin columns in a final 161 volume of 80μl of ddH20 and was kept at −80 ℃ until processing. 162 The RT-qPCR assay was performed using the CHIKV Detection Kit 163 (SLin, China, catalog # A5 -10B), which contains specific primers and a 164 probe targeting the CHIKV E1 gene. Each 25 µL reaction contained 20 µL 165 of reaction mix and 5 µL of extracted RNA. Amplification was carried out 166 on an Applied Biosystems® QuantStudio™ 7 Flex Real-Time PCR System 167 (ThermoFisher Scientific, Waltham, MA, USA) under the following 168 conditions: reverse transcription at 50 °C for 2 min, initial denaturation at 169 95 °C for 1 min, followed by 40 cycles of denaturation at 95 °C for 2s and 170 annealing/extension at 55 °C for 19 s. A plasmid containing a fragment of 171 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.25.672256doi: bioRxiv preprint the CHIKV E1 gene was used as a positive control, and nuclease-free water 172 was included as a negative control. All samples were run in duplicate, and 173 those with an average cycle threshold (Ct) value below 37 were considered 174 positive. 175 2.4 Sanger sequencing of mosquito-derived CHIKV genomes 176 Full-length CHIKV genomes were amplified using overlapping RT-177 PCR with primer sets designed based on S27 strain reference sequences 178 from GenBank (accession GCA_000854045.1). Full viral genome 179 recovery was achieved via synthesis of complementary DNA (cDNA) 180 directly from single-stranded RNA (ssRNA). Briefly, cDNA was 181 synthesized using PrimeScript™ RT Master Mix (TAKARA, #RR036A) 182 The CHIKV genome was sequenced through overlapping PCR amplicons 183 spanning 12 genomic segments. All primers used for amplification (Table 184 1) were commercially synthesized by Sangon Biotech (Shanghai, China), 185 with subsequent PCR product sequencing performed by the same vendor. 186 Raw chromatograms were assembled into contiguous sequences using 187 SeqMan Pro (DNASTAR Lasergene v7.1) and manually curated to 188 generate the complete genome sequences. 189 Table 1. Primers for sanger sequencing of mosquito-derived CHIKV genomes 190 No Region Forward primer (5 -3 ) Reverse primer (5 -3 ) 1 1-943 ATGGCTGCGTGAGACA TCTCTTAACGACGTAGCCTT (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.25.672256doi: bioRxiv preprint 2 713-2001 TGTTCAACAGACCTGACGGA CATCGCAATATGGTGTAGCTT 3 1917-3160 CTGAAGACTTCCAGAGCCTA TTTTATCCCCGCTGTTTCGAG 4 2680-3921 GAATGAGTACAACAAGCCGAT TGATCTAAACTTGCGTCCCA 5 3762-5126 ATTATCAACAGTGCGTAGACCA CGTCAACGCTTAGATCGAAT 6 4869-6343 GTTACGCCATGACACCAGA CTCCACGTTGAATACTGCT 7 5592-6905 ATGATTTGACAGATAGCGACT AGCTGGAAATCTCTCCGAA 8 6795-8039 AGAGCCAAGATGATTCACTTGC GATGACCGCTTAAAGGCCAA 9 7994-9145 CCATCGATAACGCGGACCTG TACACTTATACCGCACCGTCT 10 8634-10046 CGTAGCACTAGAACGCATC AGAGTCTTATACGGTACTCCC 11 9803-11290 CTAAAGCGGCCACATACCAA ATAGCACCACGATTAGAATCAG 12 10778-12032 CAACAAACCCGGTAAGAGC GAAATATTAAAAACAAAATAAC ATCTCCTACGTC 2.5. Next-generation sequencing of mosquito-derived CHIKV genome 191 Due to the low viral RNA concentration, some PCR- positive pools 192 were subjected to high -throughput sequencing. cDNA libraries were 193 prepared using the NEBNext Ultra RNA Library Prep Kit for Illumina. The 194 libraries were quality checked and sequenced on an Illumina Nova Seq 195 6000 platform with 150-bp paired-end reads. 196 The analysis pipeline for high -throughput sequencing data was as 197 follows: First, Trimmomatic v0.39[19] and Fastp v0.23.4[20] were used to 198 remove sequencing adapters and low -quality sequences, completing the 199 sequencing data quality control. Next, Bowtie2 v2.5.4 [21] was employed 200 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.25.672256doi: bioRxiv preprint in conjunction with the Ae. albopictus reference genome (Accession 201 Number: GCF035046485.1)[22] to perform host sequence depletion on the 202 quality-controlled sequencing results. Subsequently, the host -depleted 203 sequences were aligned against the Chikungunya virus genome sequence 204 (Accession Number: NC_004162.2) [23] using ncbi -blast+ v2.16.0 [24], 205 and Chikungunya virus -specific sequences were isolated from the 206 alignment output. These isolated viral sequences were then assembled with 207 MEGAHIT v1.2.9[25]. For the assembled contigs, BWA v0.7.17-r1188[26] 208 was used to evaluate the sequencing coverage depth, and ncbi -blast+ 209 v2.16.0 for sequence homology alignment. Finally, the final high -quality 210 assembly results were screened and obtained through these validation steps. 211 2.6 Phylogenetic Analysis 212 Besides the 5 mosquito-derived CHIKV strains detected in Foshan, an 213 additional 125 complete genomes of Chikungunya virus were collected and 214 curated, with isolation sources including mosquitoes and humans. It should 215 be noted that, as the sudden outbreak, no sequences from local patients in 216 Foshan 2025 had been found in the database. Following codon -based 217 multiple sequence alignment using MUSCLE v3.8.1551[27], the Bayesian 218 Evolutionary Analysis Utility (BEAUti) v10.5.0 [28] was used for 219 evolutionary model selection and XML file construction. 220 Bayesian Evolutionary Analysis Sampling Trees (BEAST) v10.5.0[29] 221 was employed to estimate evolutionary rates, divergence times, population 222 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.25.672256doi: bioRxiv preprint sizes, and tree topologies. Tracer v1.7.2 [30] was utilized to assess the 223 convergence of phylogenetic tree topology parameters. 224 TreeAnnotator v10.5.0 [31] was used to summarize the posterior 225 estimates and highest posterior density (HPD) limits of node heights, as 226 well as evolutionary rates for analyses employing a relaxed molecular 227 clock model. Finally, FigTree v1.4.4 was applied to visualize and refine the 228 phylogenetic results for presentation purposes. 229 2.7 Amino acid mutation analysis 230 For sequence variant detection, the complete genomes of each Foshan 231 mosquito-derived CHIKV strain were aligned to the typical genotypes 232 from human and mosquito reference strains using ClustalW [32], and the 233 bases of each Foshan mosquito -derived CHIKV strain virus genome that 234 did not align were extracted as single -nucleotide variants (SNVs) using 235 custom-written Python scripts. These SNVs were annotated by 236 ANNOV AR software, SNVs in the coding region were divided into 237 synonymous SNVs and nonsynonymous SNVs. 238 2.8 Comparative genomic analysis 239 Predict the sequences and genomic positions of structural and non -240 structural proteins of Chikungunya virus using blastn, and plot the genome 241 structure using R package circlize v0.4.16[33]. 242 2.9 Minimum infection rate 243 For infection rate estimation, we restricted analyses to female Ae. 244 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.25.672256doi: bioRxiv preprint mosquitoes, as only females blood -feed and contribute to arbovirus 245 transmission. Pools were formed with around 25 individuals, and infection 246 rates were expressed as minimum infection rate (MIR, per 1,000 females). 247 The MIR was determined as the ratiobetween the number of virus positive 248 pools of mosquitoes detectedand the total number of mosquitoes tested, 249 multiplied by 1000 . This approach has been widely adopted in arbovirus 250 entomological surveillance to avoid dilution effects from non-vector males, 251 which may bias estimates downward. 252 3. Results 253 3.1. Mosquito Collection and Identification 254 Sampling sites were taken from three hotspot towns (Beijiao, 255 Chencun and Le cong) in Foshan city , Guangdong Province, China, 256 including 56 park lands and 34 residential areas. A total of 2,803 257 mosquitoes (1031 in Beijiao, 500 in Chencun and 1272 in Letang) were 258 trapped in the study. The majority were Ae. albopictus (2,627, or 93.72%), 259 with the others being Culex spp., with no Ae. Aegypti. There were 1087 260 female Ae. Albopictus trapped from parklands and 465 from residences. 261 (Supplementary 1). 262 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.25.672256doi: bioRxiv preprint 263 Figure 1 satellite map for sampling sites. Red points represented 90 sites 264 in Beijiao, Chencun and Lecong towns, Foshan city, Guangdong 265 Province, China 266 3.2 CHIKV infection rate in mosquito 267 We put the focus on female Ae. mosquitoes, as only females blood -268 feed and contribute to arbovirus transmission. There were 1569 (59.73%) 269 female Ae. Albopictus from 90 sites in 3 towns, which were divided into 270 77 pools by species, gender and Environmental type . There were 9.09% 271 (7/77) of the pools tested positive for CHIKV (Table 2). 272 Table 2. CHIKV Positive pool information for female Ae. albopictus mosquitoes 273 Pool No. Sampling site No. No .of female Ae. Albopictus Town Environmental type Sampling date RT-PCR value P12 S14 20 Lecong residences 250801 21.63 P15 S15,S16 23 Lecong residences 250801 20.57 P22 S25 20 Lecong parklands 250802 35.136 P23 S27 15 Lecong parklands 250802 35.679 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.25.672256doi: bioRxiv preprint P70 S83 20 Beijiao parklands 20250810 21.614 P71 S83 20 Beijiao parklands 20250810 20.389 P72 S85, S86 24 Beijiao parklands 20250810 21.396 The total minimum infection rate (MIR, per 1000 females) was 4. 46, 274 while the MIR for residences in Lecong Town was the highest at 9.17. The 275 MIR for parklands was slight higher than for residences ( 4.60 vs. 4.30, 276 Table 3). 277 Table 3. Minimum infection rate (MIR) of CHIKV in mosquito from different towns and 278 regional types 279 Town Environmental type Total of female Ae. Alcbopictus Total of the pools No. of pools positive by RT- PCR (%) MIR per 1000 female Beijiao parklands 437 c21 3 (14.28) 6.86 residences 162 8 0 0 Chencun parklands 217 11 0 0 residences 85 4 0 0 Lecong parklands 450 22 2 (9.09) 4.44 residences 218 11 2 (18.18) 9.17 Total parklands 1087 54 5 (9.26) 4.60 residences 465 23 2 (8.70) 4.30 Total 1569 77 7 (9.09) 4.46 280 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.25.672256doi: bioRxiv preprint 3.3. Phylogenetic Analysis 281 There were 5 whole genome sequence finally acquired, from the 282 PCR positive pools excluded 2 low viral load pools (CT value beyond 283 35). The initial Maximum clade credibility tree was constructed using the 284 dataset containing 135 sequences from the four distinct genotypes and the 285 Foshan mosquito-derived sequences in the study. Phylogeny based on the 286 complete genome analysis characterized the 5 Foshan mosquito-derived 287 CHIKV strains (12/15/70/71/72_Guangdong_foshan_Mosquito_2025), as 288 belonging to the ECSA-IOL genotype, with a high similarity to the 289 Réunion Island human case in 2025 (99.93%) and local human case in 290 2018 (97.01%~97.04%). It comprised a distinct sub-branch with other 291 mosquito derived samples previously detected in Guangdong, Zhejiang 292 and Yunnan (Figure 2). This showed a potential genetic origin of the 293 virus strains in this outbreak. 294 Phylogenetic results indicated that all currently circulating CHIKV 295 strains share a common ancestor that existed within the past 300 years, with 296 the 95% highest posterior density (HPD) interval for their most recent 297 common ancestor (MRCA) estimated to be 87 – 230 years ago. For 298 CHIKV strains endemic to the Asian region, the 95% HPD interval for 299 their MRCA ranges from 71 to 122 years ago. The divergence between the 300 Asian and ECSA genotypes occurred within the past 100 years. 301 Furthermore, phylogenetic results reveal ed a distinct spatiotemporal 302 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.25.672256doi: bioRxiv preprint pattern in the Southeast Asian lineage of the Asian genotype: it spread from 303 Thailand to Indonesia, subsequently to the Philippines, and most recently 304 to Malaysia. The most recent common ancestor (MRCA) of the Indian 305 Ocean lineage can be traced back to approximately 2002 (95% HPD: 2001–306 2003). 307 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.25.672256doi: bioRxiv preprint 308 Figure 2. Maximum clade credibility (MCC) tree of 130 CHIKV strains. The four 309 major lineages are highlighted with different branch colors, where the color of each 310 branch line represents the evolutionary rate of the viruses in that branch. The 311 estimated 95% HPD values for most pecent common ancestors are labeled beside the 312 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.25.672256doi: bioRxiv preprint node and are also indicated by the thick blue horizontal node bars. The numbers 313 adjacent to nodes indicate Bayesian posterior probability values. Strains are labeled as 314 follows: strain_name_location_host_date (year) of collection. The 5 Foshan 315 mosquito-derived CHIKV strains in this study were in bold. 316 3.4 Amino acid mutation analysis 317 The mutation analysis, compared to human - and mosquito -derived 318 strains, was shown in Table 4 for four genotypes of CHIKV structural 319 proteins. All consensus genomes assigned to the five Foshan 2025 320 mosquito-derived CHIKV strains (Pools 12, 15, 70, 71 and 72) displayed 321 an identical E1/E2 amino -acid signature, indicating a single predominant 322 circulating variant in local vectors. 323 Notably, this constellation include d the E1-A226V and E2 -L210Q 324 mutations, which ha d been identified as enhancing Ae. albopictus 325 adaptation and increasing infectivity. The novel E1 -326 N9S/T37I/K324R/G348E/V399I mutation together with the E2 -327 V85A/A227V/Q282K mutation were observed, which were identical to 328 those observed in two contemporaneous Réunion Island human isolates 329 (PV685524 and PV700165) in 2025, supporting a shared variant profile 330 across regions and facilitating tracing. 331 Contrasting with earlier Chinese reference strains (e.g. Dongguan 332 2010 and Zhejiang 2017), the Foshan variant consistently replace d 333 ancestral residues at multiple E1 sites ( N9S, T37I, K324R, G348E and 334 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.25.672256doi: bioRxiv preprint V399I) and E2 sites (V85A, A227V and Q282K). These changes made the 335 2025 Foshan mosquito -derived CHIKV different from former domestic 336 lineages within ECSA–IOL. 337 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.25.672256doi: bioRxiv preprint Table 4. Mutations in Foshan mosquito-derived CHIKV strains, compared with typical sequences from human and mosquito in the four 338 genotypes. 339 Virus strain Origin Location ye ar E1 mutation E2 mutation genot ype 9 3 7 2 1 1 2 2 6 2 5 0 2 8 4 3 1 7 3 2 4 3 4 8 3 9 9 7 4 8 5 1 1 8 1 4 9 2 0 5 2 1 0 2 2 2 2 2 7 2 4 6 2 6 4 2 8 2 3 1 2 3 7 5 3 8 6 Pool15 Mosqu ito China Foshan 20 25 S I K V P D V R E I T A G R G Q I V D V K T S V ECSA -IOL Pool12 Mosqu ito China Foshan 20 25 S I K V P D V R E I T A G R G Q I V D V K T S V ECSA -IOL Pool70 Mosqu ito China Foshan 20 25 S I K V P D V R E I T A G R G Q I V D V K T S V ECSA -IOL Pool71 Mosqu ito China Foshan 20 25 S I K V P D V R E I T A G R G Q I V D V K T S V ECSA -IOL Pool72 Mosqu ito China Foshan 20 25 S I K V P D V R E I T A G R G Q I V D V K T S V ECSA -IOL PV6855 24 Human Reunion Island 20 25 S I K V P D V R E I T A G R G Q I V D V K T S V ECSA -IOL PV7001 65 Human Reunion Island 20 25 S I K V P D V R E I T A G R G Q I V D V K T S V ECSA -IOL MG912 993 Human China Zhejiang 20 17 N T E A S E V K G V M V S K S L V A A A Q M T A ECSA -IOL (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.25.672256doi: bioRxiv preprint JQ0658 85 Human China Dongguan 20 10 N T K V P E I K G V M V S K G L V A A V Q M T A ECSA -IOL MN402 884 Human China 20 19 N T E A S E V K G V M V S K S L V A A A Q M T A ECSA -IOL JQ0658 90 Human China 20 10 N T E A S E I K G V M V S K G L V A A A Q M T A ECSA -IOL HQ8463 56 Human China 20 10 N T K V P E I K G V M V S K G L V A A V Q M T A ECSA -IOL PP5990 25 Human Thailand 20 23 N T E A S E V K G V M V S K S L V A A A Q M T A ECSA -IOL KX0091 68 Human Thailand 20 13 N T K V S E I K G V M V S K G L V A A V Q M T A ECSA -IOL ON8870 79 Mosqu ito India 20 22 N T E A S E I K G V M V S K G L V A A A Q M T A ECSA -IOL FN2954 85 Human Malaysia 20 08 N T K V S E I K G V M V S K G L V A A V Q M T A ECSA -IOL AB8603 01 Human Philippines 20 13 N T E A S D I K G V M V G R D L V A A V Q T S V Asian- Pacifi c HM045 820 Mosqu ito Cote d'Ivoire 19 93 N T K A S D I K G V T V S K G L I A A V Q T S V West Africa n MK286 898 Human India 20 18 N T E A S E V K G V M V S K G L V A A A Q M T A ESCA (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.25.672256doi: bioRxiv preprint The mutated sites are highlighted in bold. Amino acids (aa) abbreviations: A: Alanine; D: Aspartic acid; E: Glutamic acid; G: Glycine; I: 340 Isoleucine; K: Lysine; L: Leucine; N: Asparagine; P: Proline; Q: Glutamine; R: Arginine; S: Serine; T: Threonine; V: Valine. 341 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.25.672256doi: bioRxiv preprint 3.5 Comparative genomic analysis 342 BLAST analysis and nonsynonymous SNV were used to illustrate 343 five Foshan mosquito-derived CHIKV genomes. Furthermore, the 344 complete sequencing of the 5 Foshan isolates and other 20 sequnences 345 from patients and mosquitos were collected, allowed for a better 346 understanding of their genetic relationships. The different regions of the 347 sequences exhibited > 90.4% nucleotide similarity to the corresponding 348 regions of the prototypical isolate (Figure 3). 349 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.25.672256doi: bioRxiv preprint 350 Figure 3. Comparative genomics analysis of 25 CHIKV strains. It showed the 351 positions of gene-coding regions across different CHIKV lineages. Here, nsP stands 352 for non-structural proteins, E for Envelope proteins, C for Capsid protein, and UTR 353 for Untranslated Regions. Different background colors are used to distinguish 354 between different CHIKV genotypes. 355 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.25.672256doi: bioRxiv preprint 4. Discussion 356 This study reported the first mosquito-derived complete CHIKV 357 genome from Ae. albopictus during the ongoing 2025 Foshan China 358 outbreak, providing direct evidence of the vector mosquito Ae. albopictus 359 's role in the CHIKV transmission. The observed mosquito infection rate 360 (MIR = 4.46), together with adaptive mutations such as E1 -A226V and 361 E2-L210Q, provided a timely and effective support for public health 362 response. 363 Globally, CHIKV detection rate in Ae. mosquitoes consistently 364 increased during epidemic periods compared with inter-epidemic phases. 365 For instance, a large-scale epidemic in India from 2006 to 2010 366 reported the MIR of 2-15 per 1,000 Ae. aegypti and Ae. albopictus , while 367 while routine surveillance typically detected <1 per 1,000[34, 35]. Studies 368 from Thailand, Indonesia, Singapore and other Asia countries, similarly 369 demonstrated significant increases in Ae. albopictus positivity rates 370 during outbreaks, reaching >8% in some settings, compared to sporadic 371 detections in non-outbreak years[36-38] . The situation for Ae. aegypti 372 was quite similar. Latin American surveys, such as in Colombia (2020–373 2021), revealed very low positivity in Ae. aegypti during non-outbreak 374 periods (0.2%), whereas epidemic periods in Brazil (20 17–2020) reached 375 2–8 per 1,000[39, 40]. Higher infection levels were reported in Africa, 376 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.25.672256doi: bioRxiv preprint like Kenya exceeded 10/1000[41]. Collectively, these findings confirmed 377 that vector positivity rates rise sharply during outbreaks, and the Foshan 378 outbrek MIR falls within the range observed elsewhere, suggesting 379 comparable transmission dynamics and the efficacy of existing control 380 measures 381 Phylogenetic analysis showed that the five Foshan mosquito -derived 382 CHIKV genomes clustered with the Réunion Island human case in 2025, 383 belonging to the same ESCA-IOL genotype as Foshan Local human-384 derived CHIKV did[11]. Besides, the Foshan mosquito-derived CHIKV 385 amino-acid mutation on E1/E2 regions were identical to those observed in 386 Réunion Island human isolates in 2025, supporting a potential genetic 387 origin. Importantly, mutations such as E1-A226V and E2-L210Q, both 388 detected in this study, were documented markers of enhanced vector 389 adaptation. E1-A226V was known to increase infectivity in Ae. 390 albopictus approximately 100-fold by facilitating midgut invasion and 391 shortening the extrinsic incubation period[42]. Similarly, the E2-L210Q 392 allele had been associated with enhanced viral replication efficiency 393 within the vector[43]. These mutations, first highlighted during the 2005–394 2006 Indian Ocean epidemic, have since emerged independently in 395 multiple regions, like Thailand and Malaysia [38, 44], reflecting selective 396 pressure for Ae. albopictus adaptation. Conversely, outbreaks in the 397 Americas had largely involved Asian genotype viruses lacking E1-398 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.25.672256doi: bioRxiv preprint A226V, demonstrating regional variation in adaptive signatures [45]. The 399 Foshan mosquito-derived CHIKV strains in this study carried the E1-400 A226V and E2-L210Q mutations, which were of significant importance 401 for explaining the CHIKV adaptive transmission in local primary vector 402 Ae. albopictus. Other E2 substitutions such as R198Q, K233E, and 403 K252Q have also been shown to provide incremental fitness benefits in 404 Ae. albopictus within IOL strains[46, 47]. Other amino-acid changes 405 observed in Foshan strains had not been previously implicated in vector 406 adaptation so far. 407 Despite early implementation of large-scale vector control during the 408 Foshan outbreak, CHIKV-positive mosquitoes were still detected, which 409 was consistent with observations in Brazil, Thailand and other regions, 410 where wild-caught mosquitoes remained virus-positive even under 411 intensive interventions. This persistence likely reflected challenges such 412 as complex mosquito habitats, insecticide resistance[48, 49]. 413 Comparisons with the concurrent 2025 Reunion Island outbreak were 414 instructive: although Reunion experienced lower seasonal mosquito 415 abundance, nearly one-quarter of the population was infected, 416 with >23,000 estimated cases per week[50, 51]. In Foshan, despite higher 417 population density and favorable conditions for mosquito activity, timely 418 interventions limited the cases to 10,000, underscoring the critical role of 419 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.25.672256doi: bioRxiv preprint rapid, intensive vector management. Otherwise, the outbreak would have 420 led to greater spread and loss. 421 Our findings emphasized that mosquito-based surveillance was 422 indispensable for outbreak preparedness. Incorporating systematic 423 human/mosquito monitoring and viral genome sequencing into public 424 health responses provided an early warning system, informed on adaptive 425 mutations, and enabled real-time evaluation of intervention efficacy. MIR 426 estimates, when combined with genomic data, could guide adjustments to 427 control intensity and complement case-based surveillance. 428 Compared to previous Chikungunya outbreaks over the past decade, 429 the Foshan outbreak occurred earlier (early July), in a larger urban area 430 (with a population of over 9.5 million), and with abundant breeding sites 431 for the vector mosquito Ae. albopictus. However, the number of cases has 432 so far just exceeded 10,000, and the number of daily new cases is under 433 effective control, which is closely linked to the strong vector control 434 measures implemented by the Chinese government in the early stages of 435 the outbreak. Moreover, this event once again underscores the necessity 436 of early monitoring of vector mosquitoes and the importance of 437 implementing highly effective vector intervention measures as soon as 438 possible after an outbreak occurs. 439

440 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.25.672256doi: bioRxiv preprint This study provided the first complete CHIKV genome sequence 441 obtained from mosquitoes during an ongoing endemic outbreak in China , 442 bridging the existing gap between human and vector. Furthermore, the 443 analysis of mosquito positive rates and amino-acid mutation spectra 444 directly providing crucial support for the process of tracing and risk 445 assessment. It emphasized the importance of corporating mosquito 446 surveillance, in order to support a timely and effective public health 447 response. 448 Supplementary Information 449 Additional file 1 Mosquito collection information in 90 sampling sites, 450 Foshan, China, 2025 451 Ethics approval and consent to participate 452 Not applicable 453 Consent for publication 454 All authors read and approved the final manuscript for publication. 455 Availability of data and materials 456 Data and materials will be made available on request. 457 Declaration of competing interest 458 The authors declare that they have no known competing financial 459 interests or personal relationships that could have appeared to influence 460 the work reported in this paper. 461 Funding 462 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.25.672256doi: bioRxiv preprint This work was supported by the National Key Research and Development 463 Program of China (Grant No. 2024YFC2607800). 464 Author contributions 465 Field mosquito collection: Xinyu Zhou, Xiaoxue Xie, Wenhao Wang; 466 Sanger sequencing: Xiaoxue Xie, Xiaohui Liu, Xiaoli Chen; Whole-467 genome sequencing : Heting Gao; Developed the methodology: Dan 468 Xing, Chunxiao Li; Collected the data: Kai Wang, Yuting Jiang, Haotian 469 Yu; Analyzed the results: Heting Gao, Teng Zhao; Wrote the first draft: 470 Teng Zhao; Generated the figures: Xinyu Zhou, Wenhao Wang; 471 Conceptualization, resources and funding: Chunxiao Li. All authors read 472 and approved the final manuscript. 473

474 Not applicable 475

476 1. Bartholomeeusen K, Daniel M, LaBeaud DA, Gasque P, Peeling RW, 477 Stephenson KE, Ng LFP, Arien KK: Chikungunya fever. Nature reviews 478 Disease primers 2023, 9(1):17. 479 2. Weaver SC, Chen R, Diallo M: Chikungunya Virus: Role of Vectors in 480 Emergence from Enzootic Cycles. Annual review of entomology 2020, 481 65:313-332. 482 3. Kraemer MU, Sinka ME, Duda KA, Mylne AQ, Shearer FM, Barker CM, 483 Moore CG, Carvalho RG, Coelho GE, Van Bortel W et al: The global 484 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.25.672256doi: bioRxiv preprint distribution of the arbovirus vectors Aedes aegypti and Ae. albopictus. 485 eLife 2015, 4:e08347. 486 4. Burt FJ, Chen W, Miner JJ, Lenschow DJ, Merits A, Schnettler E, Kohl A, 487 Rudd PA, Taylor A, Herrero LJ et al: Chikungunya virus: an update on the 488 biology and pathogenesis of this emerging pathogen. The Lancet Infectious 489 diseases 2017, 17(4):e107-e117. 490 5. Zeller H, Van Bortel W, Sudre B: Chikungunya: Its History in Africa and 491 Asia and Its Spread to New Regions in 2013-2014. The Journal of infectious 492 diseases 2016, 214(suppl 5):S436-S440. 493 6. Khongwichit S, Chansaenroj J, Chirathaworn C, Poovorawan Y: 494 Chikungunya virus infection: molecular biology, clinical characteristics, 495 and epidemiology in Asian countries. Journal of biomedical science 2021, 496 28(1):84. 497 7. Wu D, Wu J, Zhang Q, Zhong H, Ke C, Deng X, Guan D, Li H, Zhang Y, 498 Zhou H et al: Chikungunya outbreak in Guangdong Province, China, 499 2010. Emerging infectious diseases 2012, 18(3):493-495. 500 8. Qiaoli Z, Jianfeng H, De W, Zijun W, Xinguang Z, Haojie Z, Fan D, Zhiquan 501 L, Shiwen W, Zhenyu H et al: Maiden outbreak of chikungunya in 502 Dongguan city, Guangdong province, China: epidemiological 503 characteristics. PloS one 2012, 7(8):e42830. 504 9. Liu LB, Li M, Gao N, Shen JY, Sheng ZY, Fan DY, Zhou HN, Yin XX, Mao 505 JR, Jiang JY et al: Epidemiological and clinical characteristics of the 506 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.25.672256doi: bioRxiv preprint chikungunya outbreak in Ruili City, Yunnan Province, China. Journal of 507 medical virology 2022, 94(2):499-506. 508 10. Pan J, Fang C, Yan J, Yan H, Zhan B, Sun Y, Liu Y, Mao H, Cao G, Lv L et 509 al: Chikungunya Fever Outbreak, Zhejiang Province, China, 2017. 510 Emerging infectious diseases 2019, 25(8):1589-1591. 511 11. Li Y, Jiang S, Zhang M, Li Y, He J, Yang Z, Huang X, Guan Q, Li Z, Xie J et 512 al: An Outbreak of Chikungunya Fever in China - Foshan City, 513 Guangdong Province, China, July 2025. China CDC weekly 2025, 514 7(32):1064-1065. 515 12. Laha E, Jena D, Biswas VK, Singh S, Raghav SK, Pattnaik AK, 516 Chattopadhyay S: Complete genome sequence of an Indian outbreak strain 517 of chikungunya virus. Microbiology resource announcements 2024, 518 13(9):e0032624. 519 13. Fabbri C, Giovanetti M, Luppo V, Fonseca V, Garcia J, Barulli C, Feroci M, 520 Perrone S, Casoni D, Giamperetti S et al: Tracing the evolution of the 521 chikungunya virus in Argentina, 2016-2023: independent introductions 522 and prominence of Latin American lineages. Emerging microbes & 523 infections 2024, 13(1):2362941. 524 14. Seok S, Vorsino AE, Collier TC, Hapairai LK, Jacobsen CM, Hasty JM, 525 Romero-Weaver AL, Buckner EA, LaPointe DA, Leong MKH et al: 526 Population genomics of Aedes albopictus across remote Pacific islands for 527 genetic biocontrol considerations. PLoS neglected tropical diseases 2025, 528 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.25.672256doi: bioRxiv preprint 19(8):e0013414. 529 15. Honorio NA, Wiggins K, Eastmond B, Camara DCP, Alto BW: Experimental 530 Vertical Transmission of Chikungunya Virus by Brazilian and Florida 531 Aedes Albopictus Populations. Viruses 2019, 11(4). 532 16. Souza-Neto JA, Powell JR, Bonizzoni M: Aedes aegypti vector competence 533 studies: A review. Infection, genetics and evolution : journal of molecular 534 epidemiology and evolutionary genetics in infectious diseases 2019, 67:191-535 209. 536 17. Su L, Lou X, Yan H, Yang Z, Mao H, Yao W, Sun Y, Pan J, Zhang Y: 537 Importation of a novel Indian Ocean lineage carrying E1-K211E and E2-538 V264A of Chikungunya Virus in Zhejiang Province, China, in 2019. Virus 539 genes 2023, 59(5):693-702. 540 18. Mascarenhas M, Garasia S, Berthiaume P, Corrin T, Greig J, Ng V, Young I, 541 Waddell L: A scoping review of published literature on chikungunya 542 virus. PloS one 2018, 13(11):e0207554. 543 19. Bolger AM, Lohse M, Usadel B: Trimmomatic: a flexible trimmer for 544 Illumina sequence data. Bioinformatics 2014, 30(15):2114-2120. 545 20. Chen S, Zhou Y, Chen Y, Gu J: fastp: an ultra-fast all-in-one FASTQ 546 preprocessor. Bioinformatics 2018, 34(17):i884-i890. 547 21. Langmead B, Salzberg SL: Fast gapped-read alignment with Bowtie 2. Nat 548

2012, 9(4):357-359. 549 22. Chen XG, Jiang X, Gu J, Xu M, Wu Y, Deng Y, Zhang C, Bonizzoni M, 550 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.25.672256doi: bioRxiv preprint Dermauw W, Vontas J et al: Genome sequence of the Asian Tiger 551 mosquito, Aedes albopictus, reveals insights into its biology, genetics, and 552 evolution. Proc Natl Acad Sci U S A 2015, 112(44):E5907-5915. 553 23. Khan AH, Morita K, Parquet MDC, Hasebe F, Mathenge EGM, Igarashi A: 554 Complete nucleotide sequence of chikungunya virus and evidence for an 555 internal polyadenylation site. J Gen Virol 2002, 83(Pt 12):3075-3084. 556 24. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ: Basic local 557 alignment search tool. J Mol Biol 1990, 215(3):403-410. 558 25. Li D, Liu CM, Luo R, Sadakane K, Lam TW: MEGAHIT: an ultra-fast 559 single-node solution for large and complex metagenomics assembly via 560 succinct de Bruijn graph. Bioinformatics 2015, 31(10):1674-1676. 561 26. Li H, Durbin R: Fast and accurate short read alignment with Burrows-562 Wheeler transform. Bioinformatics 2009, 25(14):1754-1760. 563 27. Edgar RC: Muscle5: High-accuracy alignment ensembles enable unbiased 564 assessments of sequence homology and phylogeny. Nat Commun 2022, 565 13(1):6968. 566 28. Bouckaert R, Vaughan TG, Barido-Sottani J, Duchêne S, Fourment M, 567 Gavryushkina A, Heled J, Jones G, Kühnert D, De Maio N et al: BEAST 2.5: 568 An advanced software platform for Bayesian evolutionary analysis. PLoS 569 Comput Biol 2019, 15(4):e1006650. 570 29. Bouckaert R, Heled J, Kühnert D, Vaughan T, Wu CH, Xie D, Suchard MA, 571 Rambaut A, Drummond AJ: BEAST 2: a software platform for Bayesian 572 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.25.672256doi: bioRxiv preprint evolutionary analysis. PLoS Comput Biol 2014, 10(4):e1003537. 573 30. Rambaut A, Drummond AJ, Xie D, Baele G, Suchard MA: Posterior 574 Summarization in Bayesian Phylogenetics Using Tracer 1.7. Syst Biol 575 2018, 67(5):901-904. 576 31. Suchard MA, Lemey P, Baele G, Ayres DL, Drummond AJ, Rambaut A: 577 Bayesian phylogenetic and phylodynamic data integration using BEAST 578 1.10. Virus Evol 2018, 4(1):vey016. 579 32. Thompson JD, Gibson TJ, Higgins DG: Multiple sequence alignment using 580 ClustalW and ClustalX. Curr Protoc Bioinformatics 2002, Chapter 2:Unit 581 2.3. 582 33. Gu Z, Gu L, Eils R, Schlesner M, Brors B: circlize Implements and 583 enhances circular visualization in R. Bioinformatics 2014, 30(19):2811-584 2812. 585 34. Muniaraj M: Fading chikungunya fever from India: beginning of the end 586 of another episode? The Indian journal of medical research 2014, 587 139(3):468-470. 588 35. Nyari N, Maan HS, Sharma S, Pandey SN, Dhole TN: Identification and 589 genetic characterization of chikungunya virus from Aedes mosquito 590 vector collected in the Lucknow district, North India. Acta tropica 2016, 591 158:117-124. 592 36. Rozilawati H, Faudzi AY, Rahidah AA, Azlina AH, Abdullah AG, Amal NM, 593 Mansor HW, Hani H, Apandi Y, Noor F et al: Entomological study of 594 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.25.672256doi: bioRxiv preprint chikungunya infections in the State of Kelantan, Malaysia. The Indian 595 journal of medical research 2011, 133(6):670-673. 596 37. Tan CH, Wong PS, Li MZ, Tan SY, Lee TK, Pang SC, Lam-Phua SG, 597 Maideen N, Png AB, Koou SY et al: Entomological investigation and 598 control of a chikungunya cluster in Singapore. Vector borne and zoonotic 599 diseases 2011, 11(4):383-390. 600 38. Intayot P, Phumee A, Kraivichian K, Sor-Suwan S, Boonserm R, Siriyasatien 601 P: Genetic characterization of chikungunya virus isolates from Aedes 602 aegypti mosquitoes collected during a recent outbreak in Bangkok, 603 Thailand. Archives of virology 2021, 166(12):3387-3398. 604 39. Carrasquilla MC, Ortiz MI, Leon C, Rondon S, Kulkarni MA, Talbot B, 605 Sander B, Vasquez H, Cordovez JM, Gonzalez C et al: Entomological 606 characterization of Aedes mosquitoes and arbovirus detection in Ibague, a 607 Colombian city with co-circulation of Zika, dengue and chikungunya 608 viruses. Parasites & vectors 2021, 14(1):446. 609 40. Ribeiro Cruz AC, Pinto Nunes Neto J, Patroca da Silva S, Vieira Pinto da 610 Silva E, Juscely Galvao Pereira G, Maia Santos M, Antonio de Oliveira 611 Monteiro H, Barreto Dos Santos F, Jose de Paula Souza EGR, Fortes Aragao 612 C et al: Chikungunya virus Detection in Aedes aegypti and Culex 613 quinquefasciatus during an Outbreak in the Amazon Region. Viruses 614 2020, 12(8). 615 41. Konongoi SL, Nyunja A, Ofula V, Owaka S, Koka H, Koskei E, Eyase F, 616 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.25.672256doi: bioRxiv preprint Langat D, Mancuso J, Lutomiah J et al: Human and entomologic 617 investigations of chikungunya outbreak in Mandera, Northeastern Kenya, 618 2016. PloS one 2018, 13(10):e0205058. 619 42. Wu D, Zhang Y, Zhouhui Q, Kou J, Liang W, Zhang H, Monagin C, Zhang Q, 620 Li W, Zhong H et al: Chikungunya virus with E1-A226V mutation causing 621 two outbreaks in 2010, Guangdong, China. Virology journal 2013, 10:174. 622 43. Tsetsarkin KA, Weaver SC: Sequential adaptive mutations enhance 623 efficient vector switching by Chikungunya virus and its epidemic 624 emergence. PLoS pathogens 2011, 7(12):e1002412. 625 44. Kalyanasundram J, Zawawi ZM, Kamel KA, Aroidoss ET, Ellan K, Anasir 626 MI, Azizan MA, Zulkifli MMS, Zain RM: Emergence of ECSA-IOL E1-627 K211E/E2-V264A Lineage of Chikungunya virus during Malaysian 2021 628 outbreak. BMC infectious diseases 2024, 24(1):1199. 629 45. Vega-Rua A, Lourenco-de-Oliveira R, Mousson L, Vazeille M, Fuchs S, 630 Yebakima A, Gustave J, Girod R, Dusfour I, Leparc-Goffart I et al: 631 Chikungunya virus transmission potential by local Aedes mosquitoes in 632 the Americas and Europe. PLoS neglected tropical diseases 2015, 633 9(5):e0003780. 634 46. Chen R, Plante JA, Plante KS, Yun R, Shinde D, Liu J, Haller S, 635 Mukhopadhyay S, Weaver SC: Lineage Divergence and Vector-Specific 636 Adaptation Have Driven Chikungunya Virus onto Multiple Adaptive 637 Landscapes. mBio 2021, 12(6):e0273821. 638 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.25.672256doi: bioRxiv preprint 47. Tsetsarkin KA, Chen R, Yun R, Rossi SL, Plante KS, Guerbois M, Forrester 639 N, Perng GC, Sreekumar E, Leal G et al: Multi-peaked adaptive landscape 640 for chikungunya virus evolution predicts continued fitness optimization in 641 Aedes albopictus mosquitoes. Nature communications 2014, 5:4084. 642 48. Abilio AP, Abudasse G, Kampango A, Candrinho B, Sitoi S, Luciano J, 643 Tembisse D, Sibindy S, de Almeida APG, Garcia GA et al: Distribution and 644 breeding sites of Aedes aegypti and Aedes albopictus in 32 urban/peri-645 urban districts of Mozambique: implication for assessing the risk of 646 arbovirus outbreaks. PLoS neglected tropical diseases 2018, 647 12(9):e0006692. 648 49. Zulfa R, Lo WC, Cheng PC, Martini M, Chuang TW: Updating the 649 Insecticide Resistance Status of Aedes aegypti and Aedes albopictus in 650 Asia: A Systematic Review and Meta-Analysis. Tropical medicine and 651 infectious disease 2022, 7(10). 652 50. Huits R, Libman M, Hamer DH, Javelle E, GeoSentinel n: Resurgence of 653 chikungunya in the Indian Ocean Region in 2024-2025. Journal of travel 654 medicine 2025. 655 51. Frumence E, Piorkowski G, Traversier N, Amaral R, Vincent M, Mercier A, 656 Ayhan N, Souply L, Pezzi L, Lier C et al: Genomic insights into the re-657 emergence of chikungunya virus on Reunion Island, France, 2024 to 2025. 658 Euro surveillance : bulletin Europeen sur les maladies transmissibles = 659 European communicable disease bulletin 2025, 30(22). 660 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.25.672256doi: bioRxiv preprint Supplementary 1. Mosquito collection information in 90 sampling sites, Foshan, China, 2025 661 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.25.672256doi: bioRxiv preprint Sampling site No. longitude and latitude Town Environmental type Sampling date Mosquito collection No. of mosquito No. of Ae. albopictus No. of FemaleAe. albopictus S1 22.955475,113.241928,-1.79 Chencun Parklands 2025.07.31 30 26(0.87) 17(0.65) S2 22.953634,113.229721,1.17 Chencun Parklands 2025.07.31 0 0(0) 0(0) S3 22.949833,113.230072,-2.82 Chencun Residences 2025.07.31 36 34(0.94) 15(0.42) S4 22.947151,113.233315,-2.22 Chencun Residences 2025.07.31 6 5(0.83) 5(0.83) S5 22.945978,113.238266,1.36 Chencun Parklands 2025.07.31 51 51(1) 44(0.86) S6 22.957052,113.238411,-3.34 Chencun Parklands 2025.07.31 85 84(0.99) 19(0.22) S7 22.961157,113.236382,3.09 Chencun Parklands 2025.07.31 9 7(0.78) 5(0.56) S8 22.964167,113.227379,4.74 Chencun Parklands 2025.07.31 37 30(0.81) 5(0.14) S9 22.957512,113.227165,-1.71 Chencun Parklands 2025.07.31 21 10(0.48) 5(0.24) S10 22.959925,113.221344,-4.42 Chencun Residences 2025.07.31 48 48(1) 40(0.83) S11 22.972282,113.112000,6.72 Lecong Parklands 2025.08.01 160 160(1) 59(0.37) S12 22.972204,113.107788,2.21 Lecong Parklands 2025.08.01 9 9(1) 8(0.89) S13 22.973234,113.097481,-0.84 Lecong Residences 2025.08.01 22 16(0.73) 5(0.23) S14 22.973757,113.096970,-3.98 Lecong Residences 2025.08.01 36 26(0.72) 22(0.61) S15 22.976496,113.093040,-0.01 Lecong Residences 2025.08.01 74 74(1) 54(0.73) S16 22.975836,113.092888,-4.01 Lecong Residences 2025.08.01 37 36(0.97) 29(0.78) S17 22.965343,113.089172,-2.75 Lecong Parklands 2025.08.01 23 11(0.48) 6(0.26) S18 22.959852,113.100372,0.09 Lecong Parklands 2025.08.01 45 42(0.93) 32(0.71) S19 22.963625,113.104378,-8.28 Lecong Parklands 2025.08.01 13 10(0.77) 6(0.46) S20 22.956902,113.093819,1.90 Lecong Parklands 2025.08.01 10 10(1) 8(0.8) S21 22.965977,113.085014,-1.06 Lecong Parklands 2025.08.02 9 9(1) 7(0.78) S22 22.957771,113.080109,-1.66 Lecong Parklands 2025.08.02 4 4(1) 1(0.25) (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.25.672256doi: bioRxiv preprint S23 22.957047,113.077057,0.69 Lecong Parklands 2025.08.02 14 14(1) 9(0.64) S24 22.946693,113.075287,-2.69 Lecong Residences 2025.08.02 1 1(1) 1(1) S25 22.938643,113.079262,-1.06 Lecong Parklands 2025.08.02 50 48(0.96) 27(0.54) S26 22.923597,113.070625,-1.71 Lecong Parklands 2025.08.02 34 34(1) 8(0.24) S27 22.911486,113.090263,-3.43 Lecong Parklands 2025.08.02 34 34(1) 15(0.44) S28 22.939260,113.093658,-4.03 Lecong Residences 2025.08.02 1 1(1) 1(1) S29 22.941837,113.095718,- 10.78 Lecong Parklands 2025.08.02 86 55(0.64) 19(0.22) S30 22.950142,113.094528,-11.59 Lecong Residences 2025.08.02 22 22(1) 12(0.55) S31 22.963081,113.116425,0.54 Lecong Parklands 2025.08.03 27 20(0.74) 14(0.52) S32 22.955696,113.115623,-5.01 Lecong Residences 2025.08.03 6 6(1) 5(0.83) S33 22.955128,113.117287,-4.74 Lecong Parklands 2025.08.03 31 31(1) 19(0.61) S34 22.945007,113.105316,-4.06 Lecong Residences 2025.08.03 6 6(1) 2(0.33) S35 22.940918,113.105118,-4.17 Lecong Parklands 2025.08.03 22 20(0.91) 13(0.59) S36 22.940413,113.099709,-2.79 Lecong Residences 2025.08.03 45 45(1) 24(0.53) S37 22.936750,113.110977,-5.83 Lecong Residences 2025.08.03 16 16(1) 12(0.75) S38 22.932940,113.113350,-5.53 Lecong Parklands 2025.08.03 14 13(0.93) 11(0.79) S39 22.932940,113.113350,-5.53 Lecong Parklands 2025.08.03 17 17(1) 13(0.76) S40 22.932940,113.113350,-5.53 Lecong Parklands 2025.08.03 22 22(1) 11(0.5) S41 22.963381,113.143616,3.23 Lecong Parklands 2025.08.04 19 19(1) 18(0.95) S42 22.968616,113.131584,4.26 Lecong Parklands 2025.08.04 54 54(1) 40(0.74) S43 22.969074,113.119949,-0.59 Lecong Parklands 2025.08.04 41 30(0.73) 21(0.51) S44 22.963629,113.131615,-7.78 Lecong Residences 2025.08.04 8 8(1) 5(0.63) S45 22.965038,113.127007,-5.94 Lecong Parklands 2025.08.04 47 47(1) 28(0.6) S46 22.959116,113.124023，-1.38 Lecong Residences 2025.08.04 19 14(0.74) 12(0.63) S47 22.959806,113.119278,0.45 Lecong Residences 2025.08.04 26 25(0.96) 14(0.54) S48 22.956518,113.128998,-1.48 Lecong Parklands 2025.08.04 8 8(1) 7(0.88) (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.25.672256doi: bioRxiv preprint S49 22.948227,113.131241,2.10 Lecong Parklands 2025.08.04 14 9(0.64) 9(0.64) S50 22.938456,113.122124,-0.55 Lecong Parklands 2025.08.04 23 18(0.78) 11(0.48) S51 22.952625,113.143990，-0.38 Lecong Parklands 2025.08.05 28 28(1) 18(0.64) S52 22.949583,113.137161,-2.05 Lecong Residences 2025.08.05 20 15(0.75) 13(0.65) S53 22.956423,113.132774,-1.59 Lecong Residences 2025.08.05 37 36(0.97) 21(0.57) S54 22.934568,113.134209,-2.14 Lecong Parklands 2025.08.05 1 1(1) 1(1) S55 22.933887,113.137299,-2.47 Lecong Parklands 2025.08.05 11 9(0.82) 8(0.73) S56 22.931562,113.134583,-6.87 Lecong Parklands 2025.08.05 12 12(1) 10(0.83) S57 22.929783,113.129494,-2.56 Lecong Parklands 2025.08.05 8 8(1) 7(0.88) S58 22.927799,113.131149,3.75 Lecong Parklands 2025.08.05 9 6(0.67) 5(0.56) S59 22.923870,113.141296,1.57 Lecong Parklands 2025.08.05 5 4(0.8) 3(0.6) S60 22.927221,113.141434,0.54 Lecong Residences 2025.08.05 12 12(1) 3(0.25) S61 22.958267,113.146805,3.02 Beijiao Parklands 2024.08.06 35 33(0.94) 13(0.37) S62 22.952589,113.154701,-0.96 Beijiao Parklands 2024.08.06 11 10(0.91) 6(0.55) S63 22.943665,113.147926,3.20 Beijiao Parklands 2024.08.06 8 6(0.75) 4(0.5) S64 22.942019,113.145805,-7.25 Beijiao Parklands 2024.08.06 31 30(0.97) 9(0.29) S65 22.934780,113.165100,-5.23 Beijiao Residences 2024.08.06 16 16(1) 6(0.38) S66 22.931213,113.165192,4.31 Beijiao Residences 2024.08.06 7 7(1) 3(0.43) S67 22.924730,113.158623,-1.30 Beijiao Parklands 2024.08.06 37 34(0.92) 14(0.38) S68 22.917967,113.147591,2.80 Beijiao Parklands 2024.08.06 47 46(0.98) 24(0.51) S69 22.921291,113.152603,1.91 Beijiao Residences 2024.08.06 9 9(1) 4(0.44) S70 22.912149,113.161278,1.77 Beijiao Parklands 2024.08.06 24 24(1) 19(0.79) S71 22.951502,113.176147,4.86 Beijiao Parklands 2025.08.09 28 28(1) 20(0.71) S72 22.929945,113.196190,-5.67 Beijiao Parklands 2025.08.09 141 138(0.98) 82(0.58) S73 22.919039,113.199074,-1.49 Beijiao Parklands 2025.08.09 56 56(1) 42(0.75) S74 22.919886,113.204460,-6.68 Beijiao Parklands 2025.08.09 18 17(0.94) 16(0.89) (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.25.672256doi: bioRxiv preprint S75 22.903912,113.209663,-0.82 Beijiao Residences 2025.08.09 79 78(0.99) 57(0.72) S76 22.901756,113.198616,-2.17 Beijiao Parklands 2025.08.09 15 15(1) 8(0.53) S77 22.901625,113.180038,0.27 Beijiao Parklands 2025.08.09 13 12(0.92) 10(0.77) S78 22.909956,113.180351,-7.29 Beijiao Residences 2025.08.09 125 117(0.94) 78(0.62) S79 22.926691,113.174591,-17.54 Beijiao Parklands 2025.08.09 28 25(0.89) 23(0.82) S80 22.938677,113.185883,-3.38 Beijiao Parklands 2025.08.09 57 57(1) 27(0.47) S81 22.955221,113.184517，-2.29 Beijiao Parklands 2025.08.10 30 28(0.93) 20(0.67) S82 22.947800,113.204201,-9.52 Beijiao Parklands 2025.08.10 61 61(1) 33(0.54) S83 22.940449,113.226410,-9.86 Beijiao Parklands 2025.08.10 72 69(0.96) 44(0.61) S84 22.934334,113.207855,-8.54 Beijiao Parklands 2025.08.10 27 24(0.89) 13(0.48) S85 22.930031,113.224838,-11.53 Beijiao Parklands 2025.08.10 6 3(0.5) 1(0.17) S86 22.937695,113.239998,5.73 Beijiao Parklands 2025.08.10 50 47(0.94) 23(0.46) S87 22.969385,113.187569,-0.87 Chencun Parklands 2025.08.10 88 81(0.92) 60(0.68) S88 22.982071,113.156708,-9.29 Chencun Parklands 2025.08.10 38 37(0.97) 20(0.53) S89 22.972738,113.155708,-10.71 Chencun Parklands 2025.08.10 4 3(0.75) 3(0.75) S90 22.975294,113.138359,-12.01 Chencun Parklands 2025.08.10 47 46(0.98) 25(0.53) 662 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.25.672256doi: bioRxiv preprint