Altered Peripheral Blood mRNA and Salivary Biomarkers in Dental Anxiety: A Cross-Sectional Study | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Altered Peripheral Blood mRNA and Salivary Biomarkers in Dental Anxiety: A Cross-Sectional Study Liu Wenlong, Tao Huai, Wang Shichen, Liu Chao, Hou Xianggang, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7905570/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 12 You are reading this latest preprint version Abstract Introduction: Previous studies show that the hypothalamic pituitary adrenal (HPA) axis and sympathetic adrenal medulla (SAM) in saliva of patients with dental anxiety (DA) exhibit elevated salivary cortisol and amylase. However, underlying molecular mechanisms remain unclear. This study quantitatively analyzed the mRNA expression of glucocorticoid receptor (GR), GR transcripts containing exons 1B (GR-1B), GRIA1 (Glutamate Ionotropic Receptor AMPA Type Subunit 1), oxytocin (OT), oxytocin receptor (OTR), and Poly ADP-Ribose Polymerase 1 (PARP1) in peripheral blood, and measured salivary cortisol and alpha-amylase to explore their correlation with dental anxiety. Methods This study included a total of 30 DA patients and 28 non-DA patients. The peripheral blood mRNA expressions for GR, GR-1B, GRIA1, OT, OTR, PARP1 genes were determined by real-time quantitative polymerase chain reaction. Salivary cortisol and alpha-amylase concentrations were determined via Enzyme linked immunosorbent assay. Results The expression levels of GR-1B mRNA in DA were significantly higher than those in non-DA, while the expression levels of GRIA1 and OT mRNA were lower than those in non-DA. Concurrently, salivary cortisol and alpha-amylase levels were significantly higher in DA. Conclusion Dental anxiety may be related to HPA axis related expression. Salivary biomarkers (cortisol/α-amylase) and peripheral blood mRNA markers (GR1B, GRIA1, OT) may serve as potential screening tools. Dental anxiety The Modified Dental Anxiety Scale (MDAS) GR-1B GRIA1 OT cortisol alpha-amylase Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 1. Introduction Dental anxiety (DA) refers to the patient's varying degrees of fear and nervousness about the oral diagnosis and treatment process or some of these aspects [ 1 ] . Physiologically, respiratory rate, heart rate, sweating, etc. are increased during waiting for treatment before oral treatment. Behaviors are manifested as various evasive behaviors for oral treatment, such as crying, refusing to open their mouths, and interfering with the doctor's operation with their hands, and adults may not see a doctor on time, interrupting treatment, etc. High dental anxiety has been defined as dental phobia (DP) [ 2 ] . The terms dental anxiety and dental phobia are often used interchangeably [ 3 ] , but there are differences: dental anxiety is a specific stress response to oral treatment in which the object of anxiety is unknown, modular, or absent [ 4 ] , while dental phobia is characterized by an extreme and persistent fear of a definite object or treatment process in the dental environment, leading individuals to avoid going to the dentist at all costs unless oral health concerns become urgent [ 5 – 7 ] . Patients who often avoid treatment not only delay the best time for treatment, but also may cause greater losses, such as spending more expensive treatment, increasing treatment time, bearing more pain, and spending more energy to overcome psychological fear. Therefore, it is particularly important to be able to accurately and quickly detect the presence of dental anxiety in patients before dental treatment, and to provide timely intervention and psychological counseling. The body's physiological response to stress involves two major systems: the hypothalamic-pituitary-adrenal axis (HPA) and the sympathetic-adrenal medulla (SAM) system [ 8 – 10 ] . Activation of the HPA axis in a state of stress can lead to an increase in glucocorticoids, which have anti-inflammatory, vasodilating effects and help the organism resist life-threatening challenges. The glucocorticoid receptor GR is one of the possible mediators of the maladaptive stress response, which binds to the HPA axial stress hormone cortisol [ 11 ] . GR gene polymorphisms have been shown to affect HPA axial stress reactivity [ 12 , 13 ] . GR-1B, a subtype of GR mRNA containing exon 1B. GRIA1 is a GluA1 subunit encoding α-amino-3-hydroxy-5-methyl-4-isoxazole propionate (AMPA) receptors, which are ligand-gated ion channels that act as excitatory receptors for the neurotransmitter L-glutamate. GRIA1 plays an important role in neurotransmitter signaling, which may be related to the nervousness and fear of patients during oral treatment. Oxytocin is a neuropeptide synthesized by neurons in the posterior hypothalamus that binds to oxytocin receptors (OTR) to exert biological effects and plays an important role in social behavior, parent-child relationships, emotional connections, and sexual behavior. In the psychological realm, oxytocin has an anti-stress effect, being able to regulate stress, anxiety, fear, and pain tolerance. Its anti-stress effect is mainly produced through the regulation of the HPA axis. Oxytocin enhances the negative feedback loop of the HPA axis by enhancing corticotropin releasing factor (CRF) induced adrenocorticotropic hormone (ACTH) secretion, reducing the response of the HPA axis to stress. Studies have shown that oxytocin intranasal spray can help reduce anxiety in adults [ 14 ] . Poly ADP-ribose polymerase 1 (PARP1) is a versatile human ADP-ribosyl transferase that plays a role in DNA repair and cell death, and PARP1 also plays a key role in inflammation, metabolism, tumor development and progression, chromatin modification and transcription, mRNA stability, and alternative splicing. Studies have shown that patients with depression have lower levels of PARP1 expression in blood samples than healthy people [ 15 ] . Beyond genetic markers, stress-responsive biomarkers provide direct physiological insights into anxiety states. Salivary cortisol, the primary HPA axis effector [ 16 , 17 ] , and alpha-amylase, a sensitive indicator of SAM activation [ 18 ] , are established non-invasive biomarkers for stress quantification. In dental contexts, these biomarkers objectively reflect autonomic responses during anxiety-provoking procedures [ 19 ] . Dental anxiety disorder not only affects how patients feel during oral treatment, but also potentially increases the difficulty of the doctor's treatment procedure, such as increasing the duration of treatment and unexpected risks. Therefore, it is of great significance for both doctors and patients to effectively detect dental anxiety before oral treatment and give timely intervention. This study will analyze the mRNA expression levels of GR, GR1B, GRIA1, OT, OTR, PARP1 in peripheral blood along with salivary cortisol and alpha-amylase levels, to find potential genetic and physiological markers for dental anxiety disorder. 2. Materials and Methods 2.1 Subjects For orthodontic patients who seek treatment in the Orthodontic Department of Stomatology Hospital Affiliated to Hunan University of Chinese Medicine from July 2021 to March 2023, the general situation questionnaire and the Modified Dental Anxiety Scale (MDAS) were issued before starting treatment. Guidelines were unified and explanations were given if necessary. The questionnaire should be completed by the patients themselves. After completing the questionnaire, the questionnaires should be collected and the questionnaires with omissions and those with recent use of anti-anxiety drugs or sedatives should be excluded. All patients signed informed consent prior to participating in the study. Patients were excluded from the study if they met one or more of the following criteria: a co-existing psychiatric disorder, another blood disorder, or a short period (1 week) of use of anti-anxiety medications, sedatives, or analgesics prior to study. Patients were divided into DA and non-DA groups based on MDAS scores. 2.2 Anxiety Assessment Dental anxiety was assessed using the Modified Dental Anxiety Scale, a previously published and validated instrument [ 20 ] . The validated Chinese version was administered [ 21 ] . The MDAS consists of five items, each with five response options: "Relaxed" (scored 1), "a little uneasy" (scored 2), "nervous" (scored 3), "afraid or anxious" (scored 4), and "so afraid that I feel physically ill" (scored 5). The total score ranges from 5 to 25. Based on established criteria. participants were categorized as follows: MDAS score 5–9 indicated no dental anxiety, MDAS score ≥ 10 is classified as having dental anxiety, and patients with MDAS score ≥ 19 can be diagnosed with high dental anxiety, that is, dental phobia. 2.3 RT-qPCR Blood samples were collected from participants between 7.00 a.m. and 8.00 a.m. before food consumption. Peripheral blood mononuclear cells (PBMCs) were isolated from the samples and stored at − 80°C until RNA extraction. Total RNA was extracted from PBMCs using the MagNA Pure LC Total Nucleic Acid Isolation Kit–High Performance on a MagNA Pure LC2.0 Automatic extractor (Roche Diagnostics, Indianapolis, IN, USA). Complementary DNA (cDNA) was synthesized from the extracted RNA using the Transcriptor First Strand cDNA Synthesis Kit (Roche Applied Science, Penzberg, Germany). Gene expression levels of GR, GR1B, GRIA1, OT, OTR, and PARP1 were quantified by reverse transcription quantitative polymerase chain reaction (RT-qPCR). Primer sequences are shown in Table 1 . Each 20 µl reaction contained 10 µl 2× SYBR Green Master mix (Roche Applied Science), 1 µl of primer pair (5 µM), and 5 µl of template cDNA. Amplification and detection were performed on a Roche Light Cycler 480 using the Light Cycler 480 SYBR Green I Master (Roche). The thermal cycling conditions were: initial denaturation at 95°C for 10 min, followed by 40 cycles of denaturation at 95°C for 10 s, annealing at 60°C for 10 s, and extension at 72°C for 20 s. Fluorescence was measured at the end of each extension step. Melting curve analysis was performed to confirm amplification specificity. Each sample was analyzed in three technical replicates. The average cycle threshold (Ct) value of the replicates for each sample was determined. The relative mRNA expression levels of the target genes were calculated using the 2^−ΔΔCt method, with β-actin and GAPDH serving as internal reference genes. Table 1 Primer sequences of the target genes and reference gene. Gene Primer sequences (5’→3’) Amplicon length (bp) GR F-CAGCTCCTCAACAGCAACAACA 139 R-GTGCTGTCCTTCCACTGCTC GR-1B F-CCGGGCCCAAATTGATATTCACT 205 R-GTCTTCGCTGCTTGGAGTCTG GRIA1 F-TGCTTTGTCGCAACTCACAGA 121 R- GGCATAGACTCCTTTGGAGAAC OT F-GCTGAAACTTGATGGCTCCG 67 R-TTCTGGGGTGGCTATGGG OTR F-CTGAACATCCCGAGGAACTG 84 R- CTCTGAGCCACTGCAAATGA PARP1 F-TGGAGAAGATAGAAAAGGGCCAG 247 R-TCGCCTTTTCTCTTTCCTTCAC 2.4 Salivary Biomarker Analysis Saliva samples were collected from participants between 7:00–8:00 a.m. after overnight fasting, centrifuged at 1000 × g for 15 min at 4°C, aliquoted, and stored at ≤-20°C. Cortisol concentrations were quantified using a competitive ELISA (R&D Systems® KGE008B) with 5-fold diluted samples in Calibrator Diluent RD5-43; samples were incubated with HRP-conjugate and antibody for 2 h at 25°C with 500-rpm orbital shaking, developed with TMB substrate (30 min, dark), and measured at 450 nm against a 4-parameter logistic standard curve (0–10 ng/mL). alpha-amylase was measured via sandwich ELISA (Novus Biologicals® NBP2-68204) using undiluted samples: captured with pre-coated antibody (37°C, 90 min), detected with biotinylated antibody (37°C, 60 min) and HRP-streptavidin (37°C, 30 min), developed with TMB (15 min, 37°C), and quantified at 450 nm against a standard curve (1.56–100 ng/mL). Both assays used duplicate wells with intra-assay CV < 10%. 2.5 Statistical Analysis Statistical analyses were performed using SPSS 26.0 and GraphPad Prism version 8.0. Continuous variables were assessed for normality with the Shapiro-Wilk test; normally distributed data are presented as mean ± standard deviation (SD), non-normally distributed data as median and interquartile range (IQR). Between-group comparisons used independent samples t-test for normally distributed continuous variables and Mann-Whitney U test for non-normally distributed variables. Categorical variables are reported as frequencies and analyzed using χ² test. Spearman's correlation assessed relationships between continuous variables. Statistical significance was defined as two-sided P < 0.05. In graphical representations, statistical significance is indicated as follows: *p < 0.05; **p < 0.01; ***p < 0.001. 3. Result 3.1 Demographic Characteristics The demographic and clinical profiles of the two participant groups—non-DA (n = 28) and DA (n = 30)—are summarized in Table 2 . There were no statistically significant differences among the two groups in terms of age (t = 0.261, p = 0.795) or gender (χ² = 18.71, p = 0.410), as assessed using the chi-square test. Table 2 Demographic characteristics of the study participants Diagnostic groups non-DA (n = 28) DA (n = 30) t/χ 2 a p Age (years) 23.43 ± 4.96 23.10 ± 4.62 0.261 0.795 Gender (F/M) 14/14 19/11 18.71 0.410 MDAS 7.5 (5,9) 12.50 ± 1.94 a: Age was examined with independent samples t-test, Gender was analyzed using the Chi-square test (χ²). MDAS scores were used to categorize participants into groups; only descriptive statistics are presented for these scores here. 3.2 Distribution of MDAS Scores Figure 1 presents the frequency distribution of MDAS scores using the established clinical cut-off of ≥ 10 for dental anxiety. Among 58 participants, 28 (48.3%) comprised the non-DA group (MDAS < 10), with scores predominantly clustered at 5 and 9 points (n = 8 each). The DA group (MDAS ≥ 10, n = 30, 51.7%) showed highest frequencies at 10 and 12 points (n = 7 each), with scores ranging from 10 to 17 points. Critically, no participants scored ≥ 19, confirming all anxiety cases represented dental anxiety without phobic severity. 3.3 Peripheral Blood mRNA Expression Levels 3.3.1 Human GR mRNA Expression Levels The semiquantitative evaluation of GR mRNA expression was performed using real-time PCR with β-actin as the internal control in peripheral blood samples. Independent samples t-test revealed no significant difference in GR mRNA levels between the non-DA group (1.02 ± 0.19) and DA group (1.06 ± 0.32) (t = 0.5523, df = 56, p = 0.5830) in Fig. 2 . 3.3.2 Human GR-1B mRNA Expression Levels For GR-1B mRNA, Fig. 3 demonstrates significantly elevated expression in the DA group (1.16 ± 0.19) versus non-DA (1.02 ± 0.19) (t = 2.930, df = 56, p = 0.0049). 3.3.3 Human GRIA1 mRNA Expression Levels For GRIA1 mRNA, Mann-Whitney U-test revealed significant decrease expression in the DA group (median = 0.56, IQR 0.35–0.97) versus non-DA (median = 1.08, IQR 0.58–1.70) (U = 235, p = 0.0036) in Fig. 4 . 3.3.4 Human OT mRNA Expression Levels For OT mRNA, Mann-Whitney U-test revealed significant decrease expression in the DA group (median = 0.59, IQR 0.37–0.92) versus non-DA (median = 0.88, IQR 0.59–1.49) (U = 251, p = 0.0080) in Fig. 5 . 3.3.5 Human OTR mRNA Expression Levels Mann-Whitney U-test revealed no significant difference in OTR mRNA levels between the DA group (median = 0.44, IQR 0.26–1.95) versus non-DA (median = 0.99, IQR 0.57–1.55) (U = 366.5, p = 0.4102) in Fig. 6 . 3.3.6 Human PARP1 mRNA Expression Levels Mann-Whitney U-test revealed no significant difference in PARP1 mRNA levels between the DA group (median = 1.08, IQR 0.86–1.26) versus non-DA (median = 1.02, IQR 0.86–1.20) (U = 396, p = 0.7167) in Fig. 7 . 3.4 Salivary Cortisol Levels Salivary cortisol levels were measured by ELISA. The Mann-Whitney U test indicated significantly higher levels in DA (median = 4.64, IQR 3.90–5.56) compared to non-DA group (median = 2.76 ng/mL, IQR = 2.01–4.00) (U = 164, p < 0.001; Fig. 8 ). 3.5 Salivary alpha-amylase Levels Similarly, Salivary alpha-amylase levels were also measured by ELISA. The independent samples t-test indicated significantly higher levels in DA (28.11 ± 11.66) compared to non-DA group (20.75 ± 11.67) (t = 2.401, df = 56, p = 0.0197; Fig. 9 ). 4. Discussion Patients who suffer from dental anxiety are more likely to postpone or neglect dental treatment, resulting in the deterioration of their oral health. The progression of untreated oral infections, combined with feelings of remorse, humiliation, or worthlessness, contributes to an increase in dental anxiety, and the vicious cycle continues [ 22 ] . Consistent with this stress response, we observed significantly elevated salivary cortisol levels, reflecting HPA axis hyperactivity during dental anticipation. Similarly, higher salivary alpha-amylase in DA patients indicates enhanced SAM activation. This may be related to the milder degree of pain during orthodontic treatment, as studies have shown that pain during previous treatment is an important factor leading to dental anxiety. The expression level of GR mRNA in the peripheral blood of DA patients is slightly higher than that of non-DA patients, but there is no significant difference between the two groups. The expression level of GR-1B mRNA is higher than that of non-DA patients, which may be related to the decreased transcription of other GR mRNA (including GR-1C). Therefore, we speculate that the expression level of GR-1B in the peripheral blood of DA patients may be related to their body's response to stimuli during oral clinical visits GRIA1 plays an important role in neurotransmitter signaling. It forms ion channels on the postsynaptic membrane, and when glutamate binds to it, the ion channels open, allowing sodium and calcium ions to enter neurons, leading to depolarization and excitation of the neurons. The expression level of GRIA1mRNA in the peripheral blood of patients in the DA group is lower than that in the non-DA group, which may be related to the fact that non-DA patients can adapt well to various situations and actively cooperate with treatment during oral diagnosis and treatment. However, DA patients exhibit phenomena such as accelerated heartbeat, lack of cooperation with treatment, and even avoidance of treatment during oral treatment. This study tested peripheral blood samples and compared the expression levels of OT mRNA and OTR mRNA between patients with and without dental anxiety. The results showed that the expression level of OT mRNA in the peripheral blood of patients with dental anxiety was significantly lower than that of patients without dental anxiety. Oxytocin, as a neurotransmitter with anti-anxiety effects, has an anti-stress effect and can regulate stress, anxiety, fear, and pain tolerance [ 23 ] . Its anti-stress effect is mainly achieved by regulating the HPA axis. Oxytocin enhances CRF induced ACTH secretion, thereby strengthening the negative feedback loop of the HPA axis and reducing its response to stress [ 24 ] . When the expression of oxytocin is insufficient, patients may be more prone to negative emotions such as anxiety and fear. The results of this study suggest that oxytocin may be involved in regulating the emotional response of dental anxiety patients, thereby affecting their acceptance and cooperation in oral treatment. Nash used oxytocin intranasal spray for adults and children who need dental treatment, and found that oxytocin intranasal spray is helpful to reduce adult anxiety and improve children's coordination in oral treatment, which is consistent with the conclusion of this study [ 25 ] . Studies have shown that PARP1 has an impact on the transcriptional response of skeletal muscles to glucocorticoids, and steroid hormones have a controlling effect on muscle protein synthesis and metabolic rate [ 26 ] . The expression level of PARP1 mRNA in peripheral blood of patients in the DA group was higher than that in the non-DA group, but there was no statistically significant difference between the two groups. In the process of oral diagnosis and treatment, we can easily observe that DA patients are more prone to muscle tension than non-DA patients. In our current study, we found that patients with dental anxiety had higher levels of GR1B mRNA compared to the non-DA group, while GRIA1 and OT mRNA were lower in the non-DA group. Combined with elevated cortisol and amylase, we speculate that this expression difference may be related to dysregulation of the HPA axis and SAM system. Therefore, we believe that GR1B, GRIA1, OT, along with salivary cortisol and alpha-amylase, may serve as potential genetic and physiological markers for detecting dental anxiety. 5. Limitations This study has several limitations. First, as a single-center investigation recruiting outpatients exclusively from the Stomatology Hospital of Hunan University of Chinese Medicine, the geographic homogeneity of participants may restrict generalizability to broader populations. Second, the cross-sectional design with a limited sample size reduces statistical power. Third, undocumented use of medicine in some participants could confound stress biomarker measurements. Fourth, needle-induced distress during venipuncture may transiently elevate stress markers, potentially interfering with dental anxiety-specific responses. 6. Conclusion Dental anxiety may be related to HPA axis and SAM system dysregulation, with elevated salivary cortisol and alpha-amylase levels. GR1B, GRIA1, and OT alongside these physiological biomarkers can serve as potential markers for detecting dental anxiety in patients. Abbreviations HPA: Hypothalamic Pituitary Adrenal SAM: Sympathetic Adrenal Medulla DA: Dental Anxiety GR: Glucocorticoid Receptor GR-1B: Glucocorticoid Receptor Transcripts Containing Exons 1B AMPA: α-Amino-3-Hydroxy-5-Methyl-4-Isoxazole Propionate GRIA1: Glutamate Ionotropic Receptor AMPA Type Subunit 1 OT: Oxytocin OTR: Oxytocin Receptor PARP1: Poly ADP-Ribose Polymerase 1 DP: Dental Phobia CRF: Corticotropin Releasing Factor ACTH: Adrenocorticotropic Hormone MDAS: Modified Dental Anxiety Scale PBMCs: Peripheral Blood Mononuclear Cells cDNA: Complementary DNA RT-qPCR: Reverse Transcription Quantitative Polymerase Chain Reaction SD: Standard Deviation IQR: Interquartile Range Declarations Ethics approval and consent to participate The study protocol involving orthodontic patients seeking treatment at the Orthodontic Department of the Stomatology Hospital Affiliated to Hunan University of Chinese Medicine (July 2021 to March 2023) was reviewed and approved by the Institutional Ethics Committee. Each participant provided written informed consent after receiving detailed verbal and written information about the study design. All patients signed informed consent forms for the publication of their data. All methods were performed in accordance with relevant guidelines. All methods used in this study comply with the ethical standards of the institutional and/or national research committees and the Declaration of Helsinki and its subsequent amendments or comparable ethical standards. Consent for publication Not applicable. This manuscript does not contain any individual person’s data in any form (including images, videos, or identifiable details) Availability of data and materials The de-identified patient-level questionnaire datasets (MDAS scores and general information) generated and/or analysed during the current study are not publicly available due to institutional ethics restrictions and participant privacy, but are available from the corresponding author on reasonable request. Competing interests The authors declare that they have no competing interests Funding This research was funded by the Hunan University of Chinese Medicine (No. 2022XYLH131). Authors' contributions W.L. (Wenlong Liu) contributed to conceptualization, methodology, investigation, data curation, formal analysis, and writing—original draft. T.H. (Tao Huai) contributed to conceptualization, methodology, data curation, validation, visualization, and writing—original draft. S.W. (Shichen Wang) contributed to writing—original draft and data curation. C.L. (Chao Liu) contributed to investigation, data acquisition, and visualization. X.H. (Xianggang Hou) contributed to investigation, data acquisition, and validation. H.Z. (Hongshuang Zhu) contributed to laboratory support, validation, and visualization. Y.D. (Yige Duan) contributed to data acquisition, formal analysis, and figure preparation. M.B. (Minghai Bai) and Y.L. (Yong Liu) provided supervision, resources, and writing—review & editing. All authors read and approved the final manuscript. Acknowledgements We thank all patients who participated in this study for their time and cooperation. References Samorodnitzky GR, Levin L. Self-assessed dental status, oral behavior, DMF, and dental anxiety. J Dent Educ. 2005;69(12):1385–9. Liinavuori A, Tolvanen M, Pohjola V, Lahti S. Longitudinal interrelationships between dental fear and dental attendance among adult Finns in 2000–2011. Community Dent Oral Epidemiol. 2019;47(4):309–15. Mohammad NS, Nazli R, Zafar H, Fatima S. Effects of lipid based Multiple Micronutrients Supplement on the birth outcome of underweight pre-eclamptic women: A randomized clinical trial. Pak J Med Sci. 2022;38(1):219–26. Humphris GM, Dyer TA, Robinson PG. The modified dental anxiety scale: UK general public population norms in 2008 with further psychometrics and effects of age. BMC Oral Health. 2009;9:20. Thomson WM, Stewart JF, Carter KD, Spencer AJ. Dental anxiety among Australians. Int Dent J. 1996;46(4):320–4. Armfield JM, Stewart JF, Spencer AJ. The vicious cycle of dental fear: exploring the interplay between oral health, service utilization and dental fear. BMC Oral Health. 2007;7:1. Asl AN, Shokravi M, Jamali Z, Shirazi S. Barriers and Drawbacks of the Assessment of Dental Fear, Dental Anxiety and Dental Phobia in Children: A Critical Literature Review. J Clin Pediatr Dent. 2017;41(6):399–423. Tananska VT. Salivary α-Amylase And Chromogranin A In Anxiety-Related Research. Folia Med (Plovdiv). 2014;56(4):233–6. Hellhammer DH, Wüst S, Kudielka BM. Salivary cortisol as a biomarker in stress research. Psychoneuroendocrinology. 2009;34(2):163–71. Wadsworth ME, Broderick AV, Loughlin-Presnal JE, et al. Co-activation of SAM and HPA responses to acute stress: A review of the literature and test of differential associations with preadolescents' internalizing and externalizing. Dev Psychobiol. 2019;61(7):1079–93. Sinclair D, Fullerton JM, Webster MJ, Shannon Weickert C. Glucocorticoid receptor 1B and 1C mRNA transcript alterations in schizophrenia and bipolar disorder, and their possible regulation by GR gene variants. PLoS ONE. 2012;7(3):e31720. Wüst S, Van Rossum EF, Federenko IS, Koper JW, Kumsta R, Hellhammer DH. Common polymorphisms in the glucocorticoid receptor gene are associated with adrenocortical responses to psychosocial stress. J Clin Endocrinol Metab. 2004;89(2):565–73. Kumsta R, Entringer S, Koper JW, van Rossum EF, Hellhammer DH, Wüst S. Sex specific associations between common glucocorticoid receptor gene variants and hypothalamus-pituitary-adrenal axis responses to psychosocial stress. Biol Psychiatry. 2007;62(8):863–9. de Oliveira DC, Zuardi AW, Graeff FG, Queiroz RH, Crippa JA. Anxiolytic-like effect of oxytocin in the simulated public speaking test. J Psychopharmacol. 2012;26(4):497–504. Ryan KM, McLoughlin DM. PARP1 and OGG1 in Medicated Patients With Depression and the Response to ECT. Int J Neuropsychopharmacol. 2023;26(2):107–15. Clow A, Smyth N. Salivary cortisol as a non-invasive window on the brain. Int Rev Neurobiol. 2020;150:1–16. Törnhage CJ. Salivary cortisol for assessment of hypothalamic-pituitary-adrenal axis function. Neuroimmunomodulation. 2009;16(5):284–9. Bosch JA, Veerman EC, de Geus EJ, Proctor GB. α-Amylase as a reliable and convenient measure of sympathetic activity: don't start salivating just yet. Psychoneuroendocrinology. 2011;36(4):449–53. AlMaummar M, AlThabit HO, Pani S. The impact of dental treatment and age on salivary cortisol and alpha-amylase levels of patients with varying degrees of dental anxiety. BMC Oral Health. 2019;19(1):211. Humphris GM, Morrison T, Lindsay SJ. The Modified Dental Anxiety Scale: validation and United Kingdom norms [J]. Community Dent Health. 1995;12(3):143–50. Yuan S, Freeman R, Lahti S, et al. Some psychometric properties of the Chinese version of the Modified Dental Anxiety Scale with cross validation [J]. Health Qual Life Outcomes. 2008;6(1):22. Kassem El Hajj H, Fares Y, Abou-Abbas L. Assessment of dental anxiety and dental phobia among adults in Lebanon. BMC Oral Health. 2021;21(1):48. Carter CS, Kenkel WM, MacLean EL, et al. Is Oxytocin Nature's Medicine. Pharmacol Rev. 2020;72(4):829–61. Yoon S, Kim YK. The Role of the Oxytocin System in Anxiety Disorders. Adv Exp Med Biol. 2020;1191:103–20. Nash DA. Translating neuroscience research to oral medicine: oxytocin and human behavior. Oral Dis. 2015;21(7):913–7. Tan A, Younis AZ, Evans A, et al. PARP1 mediated PARylation contributes to myogenic progression and glucocorticoid transcriptional response. Cell Death Discov. 2023;9(1):133. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Revision requested 09 Feb, 2026 Reviews received at journal 03 Feb, 2026 Reviewers agreed at journal 28 Jan, 2026 Reviews received at journal 18 Dec, 2025 Reviews received at journal 18 Dec, 2025 Reviewers agreed at journal 15 Dec, 2025 Reviewers agreed at journal 08 Dec, 2025 Reviewers invited by journal 08 Dec, 2025 Editor invited by journal 03 Nov, 2025 Editor assigned by journal 03 Nov, 2025 Submission checks completed at journal 01 Nov, 2025 First submitted to journal 01 Nov, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7905570","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":557447384,"identity":"161652a4-25d9-470d-96a7-92061482ee62","order_by":0,"name":"Liu Wenlong","email":"","orcid":"","institution":"Changsha Stomatological Hospital","correspondingAuthor":false,"prefix":"","firstName":"Liu","middleName":"","lastName":"Wenlong","suffix":""},{"id":557447388,"identity":"180e0686-183c-4ac6-8c3b-884af24124ba","order_by":1,"name":"Tao Huai","email":"","orcid":"","institution":"Hunan University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Tao","middleName":"","lastName":"Huai","suffix":""},{"id":557447389,"identity":"61ccd60d-71b9-4285-9c1a-dd3c85f41916","order_by":2,"name":"Wang Shichen","email":"","orcid":"","institution":"National Clinical Research Center for Mental Disorders, The Second Xiangya Hospital of Central South University","correspondingAuthor":false,"prefix":"","firstName":"Wang","middleName":"","lastName":"Shichen","suffix":""},{"id":557447390,"identity":"13b1667f-3394-4d18-9281-213e914d54e5","order_by":3,"name":"Liu Chao","email":"","orcid":"","institution":"Changsha Stomatological Hospital","correspondingAuthor":false,"prefix":"","firstName":"Liu","middleName":"","lastName":"Chao","suffix":""},{"id":557447391,"identity":"73777fc7-6532-4322-ac17-5a3774d74e43","order_by":4,"name":"Hou Xianggang","email":"","orcid":"","institution":"Hunan University of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Hou","middleName":"","lastName":"Xianggang","suffix":""},{"id":557447393,"identity":"4cf2cd80-15e6-45c1-bd58-75d3b452fbcd","order_by":5,"name":"Zhu Hongshuang","email":"","orcid":"","institution":"Hunan University of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Zhu","middleName":"","lastName":"Hongshuang","suffix":""},{"id":557447394,"identity":"d77272af-a201-438c-b864-e8f6e561661c","order_by":6,"name":"Duan Yige","email":"","orcid":"","institution":"Changsha Stomatological Hospital","correspondingAuthor":false,"prefix":"","firstName":"Duan","middleName":"","lastName":"Yige","suffix":""},{"id":557447395,"identity":"c21a6764-6be0-4cab-938e-a1773d4eecb9","order_by":7,"name":"Bai Minghai","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA0ElEQVRIiWNgGAWjYBACxvbm4x8+VNjU97M3EKmFuedYGuOMM2mMM3sOEKmFfUaOGTNvy2HGDTMSiNTC25Bj9oC3IY3ZQPLxxhsMNTbRBLVINhwrN5DcYcNmLp1WbMFwLC23gZAWw8bmDRKGZ9J4LGfnmEkwNhwmrMX+MIOBRGLbYQmDm2eI1MLYxmImcbDtsIHBDR5itfSwJRs2nElLkOwB+iWBGL8wzn988PGfCpsEfvbDG298qLEhrAUZGEgkkKIcooVUHaNgFIyCUTAyAADLa0TCKZ1jdQAAAABJRU5ErkJggg==","orcid":"","institution":"Changsha Stomatological Hospital","correspondingAuthor":true,"prefix":"","firstName":"Bai","middleName":"","lastName":"Minghai","suffix":""},{"id":557447396,"identity":"a1436bbd-49c5-4b68-92ce-a3c245259eaf","order_by":8,"name":"Yong Liu","email":"","orcid":"","institution":"National Clinical Research Center for Mental Disorders, The Second Xiangya Hospital of Central South University","correspondingAuthor":false,"prefix":"","firstName":"Yong","middleName":"","lastName":"Liu","suffix":""}],"badges":[],"createdAt":"2025-10-20 12:23:10","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7905570/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7905570/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":98421636,"identity":"19e3e318-313b-4f25-ac1c-302fe1da2370","added_by":"auto","created_at":"2025-12-17 16:28:45","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":564939,"visible":true,"origin":"","legend":"","description":"","filename":"ManuscriptFile.docx","url":"https://assets-eu.researchsquare.com/files/rs-7905570/v1/a7be3bdc96c178f4f6650f7e.docx"},{"id":98421753,"identity":"4f82cd8b-6620-4022-a729-b12c4620b8ba","added_by":"auto","created_at":"2025-12-17 16:29:17","extension":"json","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":10295,"visible":true,"origin":"","legend":"","description":"","filename":"2213dd2d546d4576b99efff5d2a90abd.json","url":"https://assets-eu.researchsquare.com/files/rs-7905570/v1/3d4ad3b106b9b5836094c2bc.json"},{"id":98421787,"identity":"25d80c63-d394-4ddf-8784-5ad48af3146f","added_by":"auto","created_at":"2025-12-17 16:29:28","extension":"xml","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":83334,"visible":true,"origin":"","legend":"","description":"","filename":"2213dd2d546d4576b99efff5d2a90abd1enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7905570/v1/390244f864a865a16d33f0fd.xml"},{"id":98423416,"identity":"6d507b39-8db2-4615-8bee-85c3b29080ac","added_by":"auto","created_at":"2025-12-17 16:32:12","extension":"jpeg","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":93182,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7905570/v1/99f6ffb8ddb3c7e9772171f5.jpeg"},{"id":98422876,"identity":"f24f3ea2-f932-4d3a-9f17-77b1e2992c82","added_by":"auto","created_at":"2025-12-17 16:31:36","extension":"jpeg","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":63936,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7905570/v1/db8790f8da959e9c2b8ffb0c.jpeg"},{"id":97933009,"identity":"530ade4b-7f66-44f5-bbb5-ca6fe16f14f7","added_by":"auto","created_at":"2025-12-11 00:48:03","extension":"jpeg","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":63968,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7905570/v1/12ae84314461e43ae9cc0fd7.jpeg"},{"id":98421696,"identity":"4b11175a-c505-4e0e-8c8a-c5cba7e57e66","added_by":"auto","created_at":"2025-12-17 16:29:00","extension":"jpeg","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":51562,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7905570/v1/904926aaecf7d64c79f424c5.jpeg"},{"id":98423055,"identity":"9967cf69-2862-414c-bc3e-86cdcb31b500","added_by":"auto","created_at":"2025-12-17 16:31:47","extension":"jpeg","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":48918,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7905570/v1/81cbf49370f8a5892ec89409.jpeg"},{"id":98422001,"identity":"a1a64d61-d837-4338-b3c0-83af37c20e5b","added_by":"auto","created_at":"2025-12-17 16:30:13","extension":"jpeg","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":49496,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage6.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7905570/v1/48d29dcaa018a955cec9b35c.jpeg"},{"id":97933014,"identity":"cd63c1c8-cd9a-43b0-9659-2d10233ee5e4","added_by":"auto","created_at":"2025-12-11 00:48:03","extension":"jpeg","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":55562,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage7.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7905570/v1/5eb19669d22e8b9352a37fcc.jpeg"},{"id":98422055,"identity":"e4e73955-e065-435f-a659-be12c430a2c0","added_by":"auto","created_at":"2025-12-17 16:30:23","extension":"jpeg","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":38448,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage8.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7905570/v1/caa6a8f22eff7ddec4b74aeb.jpeg"},{"id":97933026,"identity":"8eb6018a-7e8a-46e6-a4b7-36cd77a6c62f","added_by":"auto","created_at":"2025-12-11 00:48:04","extension":"jpeg","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":37910,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage9.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7905570/v1/51270f4f7a7970f94cff7f23.jpeg"},{"id":97933017,"identity":"8281db29-0999-43f8-8e43-dff0edc9e2c9","added_by":"auto","created_at":"2025-12-11 00:48:03","extension":"png","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":20421,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7905570/v1/f38fb9212516522d591750e9.png"},{"id":98423074,"identity":"03cd2313-165a-4c87-bbd6-13855b1e0207","added_by":"auto","created_at":"2025-12-17 16:31:48","extension":"png","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":18103,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7905570/v1/d8d48c13cf10d31b07106087.png"},{"id":97933027,"identity":"b5d1d056-9d7b-49b4-bc00-22308b4c31ef","added_by":"auto","created_at":"2025-12-11 00:48:04","extension":"png","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":10163,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7905570/v1/9d6b5aec891fb0811871e1ba.png"},{"id":98423135,"identity":"63692d4f-56e7-4fb0-87b1-4b97c36c1000","added_by":"auto","created_at":"2025-12-17 16:31:52","extension":"png","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":8182,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7905570/v1/d5688910180e447100072bcb.png"},{"id":97933021,"identity":"2b3d8947-f1e1-4cdb-926c-327cb3b39307","added_by":"auto","created_at":"2025-12-11 00:48:03","extension":"png","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":6659,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-7905570/v1/9d21ea8078059d11e5166e42.png"},{"id":97933023,"identity":"2d5c6e54-f3ed-4313-9013-c5b3861e98c7","added_by":"auto","created_at":"2025-12-11 00:48:03","extension":"png","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":14483,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-7905570/v1/48221c07a9ce63d3f21224a8.png"},{"id":97933024,"identity":"9292a1d8-4a94-4342-895a-c6436e56dc71","added_by":"auto","created_at":"2025-12-11 00:48:04","extension":"png","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":15897,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-7905570/v1/aee985912854a68ab2a9e480.png"},{"id":98423457,"identity":"f933b412-6a2b-4b47-8f8d-3d9f94e5e971","added_by":"auto","created_at":"2025-12-17 16:32:15","extension":"png","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":5492,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage8.png","url":"https://assets-eu.researchsquare.com/files/rs-7905570/v1/118f8e8f2eaf8de0cba1cb9d.png"},{"id":97933025,"identity":"097acb1c-129d-4433-a1ab-43be94d35762","added_by":"auto","created_at":"2025-12-11 00:48:04","extension":"png","order_by":20,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":7364,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage9.png","url":"https://assets-eu.researchsquare.com/files/rs-7905570/v1/324efaa440f126148c468fef.png"},{"id":97933029,"identity":"b001ad87-e271-4315-a525-88f029e9d45c","added_by":"auto","created_at":"2025-12-11 00:48:04","extension":"xml","order_by":21,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":80186,"visible":true,"origin":"","legend":"","description":"","filename":"2213dd2d546d4576b99efff5d2a90abd1structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7905570/v1/32e6eac89a5de7fcbf0d4f26.xml"},{"id":98422900,"identity":"08343edc-d5ba-4f65-8526-795a5c721e49","added_by":"auto","created_at":"2025-12-17 16:31:38","extension":"html","order_by":22,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":91085,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7905570/v1/3315f709bca4b1f34ece546d.html"},{"id":97932998,"identity":"55a79b58-7e58-452e-9411-376491d26fa0","added_by":"auto","created_at":"2025-12-11 00:48:03","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":208723,"visible":true,"origin":"","legend":"\u003cp\u003eDistribution of MDAS Scores\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7905570/v1/ab0f780d1462ac10963f6c45.png"},{"id":98421675,"identity":"5cfb1818-5470-40f8-b1b3-e0553397eefd","added_by":"auto","created_at":"2025-12-17 16:28:56","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":158603,"visible":true,"origin":"","legend":"\u003cp\u003eRepresentative of the relative mRNA expression of GR gene Error bars denote mean and SEM. DA, dental anxiety; non-DA, no dental anxiety; GR, glucocorticoid receptor.\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7905570/v1/9946565cfee66011745e3ed9.png"},{"id":97933001,"identity":"9d11fdf4-7103-4fa2-b8db-805c1c31c587","added_by":"auto","created_at":"2025-12-11 00:48:03","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":158910,"visible":true,"origin":"","legend":"\u003cp\u003eRepresentative of the relative mRNA expression of GR1B gene.** means P\u0026lt; 0.01. Error bars denote mean and SEM. DA, dental anxiety; non-DA, no dental anxiety; GR-1B, GR transcripts containing exons 1B.\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7905570/v1/ea4368da091d90ae379f5964.png"},{"id":98422018,"identity":"151c8785-66a8-47f3-ba1b-a1e8e411263d","added_by":"auto","created_at":"2025-12-17 16:30:18","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":122370,"visible":true,"origin":"","legend":"\u003cp\u003eRepresentative of the relative mRNA expression of GRIA1 gene. Error bars denote mean and SEM. DA, dental anxiety; non-DA, no dental anxiety; GRIA1, glutamate receptor 1.\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7905570/v1/45df8abae19747cfc0710820.png"},{"id":98421775,"identity":"5ca82ca6-06f7-4775-a412-6774209f4b87","added_by":"auto","created_at":"2025-12-17 16:29:23","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":114966,"visible":true,"origin":"","legend":"\u003cp\u003eRepresentative of the relative mRNA expression of OT gene. Error bars denote mean and SEM. DA, dental anxiety; non-DA, no dental anxiety; OT, oxytocin.\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-7905570/v1/40f59836ba38b27ea0839ceb.png"},{"id":98422022,"identity":"faa2acc1-7e39-4276-b5c6-e33c5d5b569e","added_by":"auto","created_at":"2025-12-17 16:30:19","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":125575,"visible":true,"origin":"","legend":"\u003cp\u003eRepresentative of the relative mRNA expression of OTR gene. Error bars denote mean and SEM. DA, dental anxiety; non-DA, no dental anxiety; OTR, oxytocin receptor.\u003c/p\u003e","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-7905570/v1/753b500cbd0a6a569cc852cf.png"},{"id":98421409,"identity":"1727087c-735b-4518-98ca-48aee71673f7","added_by":"auto","created_at":"2025-12-17 16:27:10","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":136788,"visible":true,"origin":"","legend":"\u003cp\u003eRepresentative of the relative mRNA expression of PARP1 gene. Error bars denote mean and SEM. DA, dental anxiety; non-DA, no dental anxiety; PARP1, Poly ADP-Ribose Polymerase 1.\u003c/p\u003e","description":"","filename":"floatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-7905570/v1/bb38f709adf535107040db13.png"},{"id":98422004,"identity":"6a816348-79e1-4c78-97ea-68d1bb713261","added_by":"auto","created_at":"2025-12-17 16:30:15","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":119939,"visible":true,"origin":"","legend":"\u003cp\u003eSalivary cortisol levels quantified by ELISA. Error bars denote mean and SEM. DA, dental anxiety; non-DA, no dental anxiety.\u003c/p\u003e","description":"","filename":"floatimage8.png","url":"https://assets-eu.researchsquare.com/files/rs-7905570/v1/cce4b64184e51c9a9f0ecd9d.png"},{"id":98421733,"identity":"5b9bbf44-b439-4c29-9818-2d25b44d0434","added_by":"auto","created_at":"2025-12-17 16:29:08","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":120429,"visible":true,"origin":"","legend":"\u003cp\u003eSalivary alpha-amylase levels quantified by ELISA. Error bars denote mean and SEM. DA, dental anxiety; non-DA, no dental anxiety.\u003c/p\u003e","description":"","filename":"floatimage9.png","url":"https://assets-eu.researchsquare.com/files/rs-7905570/v1/93aad00150ae65d11b6376cc.png"},{"id":98622064,"identity":"380e69d7-c00f-4698-80bd-acde790cf533","added_by":"auto","created_at":"2025-12-19 16:43:46","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2096192,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7905570/v1/334561f3-1514-446a-8226-7aa4ea0d087f.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Altered Peripheral Blood mRNA and Salivary Biomarkers in Dental Anxiety: A Cross-Sectional Study","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eDental anxiety (DA) refers to the patient's varying degrees of fear and nervousness about the oral diagnosis and treatment process or some of these aspects \u003csup\u003e[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]\u003c/sup\u003e. Physiologically, respiratory rate, heart rate, sweating, etc. are increased during waiting for treatment before oral treatment. Behaviors are manifested as various evasive behaviors for oral treatment, such as crying, refusing to open their mouths, and interfering with the doctor's operation with their hands, and adults may not see a doctor on time, interrupting treatment, etc. High dental anxiety has been defined as dental phobia (DP) \u003csup\u003e[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]\u003c/sup\u003e. The terms dental anxiety and dental phobia are often used interchangeably \u003csup\u003e[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]\u003c/sup\u003e, but there are differences: dental anxiety is a specific stress response to oral treatment in which the object of anxiety is unknown, modular, or absent\u003csup\u003e[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]\u003c/sup\u003e, while dental phobia is characterized by an extreme and persistent fear of a definite object or treatment process in the dental environment, leading individuals to avoid going to the dentist at all costs unless oral health concerns become urgent\u003csup\u003e[\u003cspan additionalcitationids=\"CR6\" citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]\u003c/sup\u003e. Patients who often avoid treatment not only delay the best time for treatment, but also may cause greater losses, such as spending more expensive treatment, increasing treatment time, bearing more pain, and spending more energy to overcome psychological fear. Therefore, it is particularly important to be able to accurately and quickly detect the presence of dental anxiety in patients before dental treatment, and to provide timely intervention and psychological counseling.\u003c/p\u003e\u003cp\u003eThe body's physiological response to stress involves two major systems: the hypothalamic-pituitary-adrenal axis (HPA) and the sympathetic-adrenal medulla (SAM) system\u003csup\u003e[\u003cspan additionalcitationids=\"CR9\" citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]\u003c/sup\u003e. Activation of the HPA axis in a state of stress can lead to an increase in glucocorticoids, which have anti-inflammatory, vasodilating effects and help the organism resist life-threatening challenges. The glucocorticoid receptor GR is one of the possible mediators of the maladaptive stress response, which binds to the HPA axial stress hormone cortisol\u003csup\u003e[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]\u003c/sup\u003e. GR gene polymorphisms have been shown to affect HPA axial stress reactivity \u003csup\u003e[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]\u003c/sup\u003e. GR-1B, a subtype of GR mRNA containing exon 1B. GRIA1 is a GluA1 subunit encoding α-amino-3-hydroxy-5-methyl-4-isoxazole propionate (AMPA) receptors, which are ligand-gated ion channels that act as excitatory receptors for the neurotransmitter L-glutamate. GRIA1 plays an important role in neurotransmitter signaling, which may be related to the nervousness and fear of patients during oral treatment.\u003c/p\u003e\u003cp\u003eOxytocin is a neuropeptide synthesized by neurons in the posterior hypothalamus that binds to oxytocin receptors (OTR) to exert biological effects and plays an important role in social behavior, parent-child relationships, emotional connections, and sexual behavior. In the psychological realm, oxytocin has an anti-stress effect, being able to regulate stress, anxiety, fear, and pain tolerance. Its anti-stress effect is mainly produced through the regulation of the HPA axis. Oxytocin enhances the negative feedback loop of the HPA axis by enhancing corticotropin releasing factor (CRF) induced adrenocorticotropic hormone (ACTH) secretion, reducing the response of the HPA axis to stress. Studies have shown that oxytocin intranasal spray can help reduce anxiety in adults\u003csup\u003e[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003ePoly ADP-ribose polymerase 1 (PARP1) is a versatile human ADP-ribosyl transferase that plays a role in DNA repair and cell death, and PARP1 also plays a key role in inflammation, metabolism, tumor development and progression, chromatin modification and transcription, mRNA stability, and alternative splicing. Studies have shown that patients with depression have lower levels of PARP1 expression in blood samples than healthy people\u003csup\u003e[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]\u003c/sup\u003e. Beyond genetic markers, stress-responsive biomarkers provide direct physiological insights into anxiety states. Salivary cortisol, the primary HPA axis effector\u003csup\u003e[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]\u003c/sup\u003e, and alpha-amylase, a sensitive indicator of SAM activation\u003csup\u003e[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]\u003c/sup\u003e, are established non-invasive biomarkers for stress quantification. In dental contexts, these biomarkers objectively reflect autonomic responses during anxiety-provoking procedures\u003csup\u003e[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003e Dental anxiety disorder not only affects how patients feel during oral treatment, but also potentially increases the difficulty of the doctor's treatment procedure, such as increasing the duration of treatment and unexpected risks. Therefore, it is of great significance for both doctors and patients to effectively detect dental anxiety before oral treatment and give timely intervention. This study will analyze the mRNA expression levels of GR, GR1B, GRIA1, OT, OTR, PARP1 in peripheral blood along with salivary cortisol and alpha-amylase levels, to find potential genetic and physiological markers for dental anxiety disorder.\u003c/p\u003e"},{"header":"2. Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003e2.1 Subjects\u003c/h2\u003e\u003cp\u003eFor orthodontic patients who seek treatment in the Orthodontic Department of Stomatology Hospital Affiliated to Hunan University of Chinese Medicine from July 2021 to March 2023, the general situation questionnaire and the Modified Dental Anxiety Scale (MDAS) were issued before starting treatment. Guidelines were unified and explanations were given if necessary. The questionnaire should be completed by the patients themselves. After completing the questionnaire, the questionnaires should be collected and the questionnaires with omissions and those with recent use of anti-anxiety drugs or sedatives should be excluded. All patients signed informed consent prior to participating in the study. Patients were excluded from the study if they met one or more of the following criteria: a co-existing psychiatric disorder, another blood disorder, or a short period (1 week) of use of anti-anxiety medications, sedatives, or analgesics prior to study. Patients were divided into DA and non-DA groups based on MDAS scores.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\u003ch2\u003e2.2 Anxiety Assessment\u003c/h2\u003e\u003cp\u003eDental anxiety was assessed using the Modified Dental Anxiety Scale, a previously published and validated instrument\u003csup\u003e[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]\u003c/sup\u003e. The validated Chinese version was administered\u003csup\u003e[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]\u003c/sup\u003e. The MDAS consists of five items, each with five response options: \"Relaxed\" (scored 1), \"a little uneasy\" (scored 2), \"nervous\" (scored 3), \"afraid or anxious\" (scored 4), and \"so afraid that I feel physically ill\" (scored 5). The total score ranges from 5 to 25. Based on established criteria. participants were categorized as follows: MDAS score 5\u0026ndash;9 indicated no dental anxiety, MDAS score\u0026thinsp;\u0026ge;\u0026thinsp;10 is classified as having dental anxiety, and patients with MDAS score\u0026thinsp;\u0026ge;\u0026thinsp;19 can be diagnosed with high dental anxiety, that is, dental phobia.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\u003ch2\u003e2.3 RT-qPCR\u003c/h2\u003e\u003cp\u003eBlood samples were collected from participants between 7.00 a.m. and 8.00 a.m. before food consumption. Peripheral blood mononuclear cells (PBMCs) were isolated from the samples and stored at \u0026minus;\u0026thinsp;80\u0026deg;C until RNA extraction. Total RNA was extracted from PBMCs using the MagNA Pure LC Total Nucleic Acid Isolation Kit\u0026ndash;High Performance on a MagNA Pure LC2.0 Automatic extractor (Roche Diagnostics, Indianapolis, IN, USA). Complementary DNA (cDNA) was synthesized from the extracted RNA using the Transcriptor First Strand cDNA Synthesis Kit (Roche Applied Science, Penzberg, Germany). Gene expression levels of GR, GR1B, GRIA1, OT, OTR, and PARP1 were quantified by reverse transcription quantitative polymerase chain reaction (RT-qPCR). Primer sequences are shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. Each 20 \u0026micro;l reaction contained 10 \u0026micro;l 2\u0026times; SYBR Green Master mix (Roche Applied Science), 1 \u0026micro;l of primer pair (5 \u0026micro;M), and 5 \u0026micro;l of template cDNA. Amplification and detection were performed on a Roche Light Cycler 480 using the Light Cycler 480 SYBR Green I Master (Roche). The thermal cycling conditions were: initial denaturation at 95\u0026deg;C for 10 min, followed by 40 cycles of denaturation at 95\u0026deg;C for 10 s, annealing at 60\u0026deg;C for 10 s, and extension at 72\u0026deg;C for 20 s. Fluorescence was measured at the end of each extension step. Melting curve analysis was performed to confirm amplification specificity. Each sample was analyzed in three technical replicates. The average cycle threshold (Ct) value of the replicates for each sample was determined. The relative mRNA expression levels of the target genes were calculated using the 2^\u0026minus;ΔΔCt method, with β-actin and GAPDH serving as internal reference genes.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003ePrimer sequences of the target genes and reference gene.\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"3\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGene\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePrimer sequences (5\u0026rsquo;\u0026rarr;3\u0026rsquo;)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAmplicon length (bp)\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eGR\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF-CAGCTCCTCAACAGCAACAACA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e139\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eR-GTGCTGTCCTTCCACTGCTC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eGR-1B\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF-CCGGGCCCAAATTGATATTCACT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e205\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eR-GTCTTCGCTGCTTGGAGTCTG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eGRIA1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF-TGCTTTGTCGCAACTCACAGA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e121\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eR- GGCATAGACTCCTTTGGAGAAC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eOT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF-GCTGAAACTTGATGGCTCCG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e67\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eR-TTCTGGGGTGGCTATGGG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eOTR\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF-CTGAACATCCCGAGGAACTG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e84\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eR- CTCTGAGCCACTGCAAATGA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003ePARP1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF-TGGAGAAGATAGAAAAGGGCCAG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e247\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eR-TCGCCTTTTCTCTTTCCTTCAC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e\u003ch2\u003e2.4 Salivary Biomarker Analysis\u003c/h2\u003e\u003cp\u003e Saliva samples were collected from participants between 7:00\u0026ndash;8:00 a.m. after overnight fasting, centrifuged at 1000 \u0026times; g for 15 min at 4\u0026deg;C, aliquoted, and stored at \u0026le;-20\u0026deg;C. Cortisol concentrations were quantified using a competitive ELISA (R\u0026amp;D Systems\u0026reg; KGE008B) with 5-fold diluted samples in Calibrator Diluent RD5-43; samples were incubated with HRP-conjugate and antibody for 2 h at 25\u0026deg;C with 500-rpm orbital shaking, developed with TMB substrate (30 min, dark), and measured at 450 nm against a 4-parameter logistic standard curve (0\u0026ndash;10 ng/mL). alpha-amylase was measured via sandwich ELISA (Novus Biologicals\u0026reg; NBP2-68204) using undiluted samples: captured with pre-coated antibody (37\u0026deg;C, 90 min), detected with biotinylated antibody (37\u0026deg;C, 60 min) and HRP-streptavidin (37\u0026deg;C, 30 min), developed with TMB (15 min, 37\u0026deg;C), and quantified at 450 nm against a standard curve (1.56\u0026ndash;100 ng/mL). Both assays used duplicate wells with intra-assay CV\u0026thinsp;\u0026lt;\u0026thinsp;10%.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e\u003ch2\u003e2.5 Statistical Analysis\u003c/h2\u003e\u003cp\u003eStatistical analyses were performed using SPSS 26.0 and GraphPad Prism version 8.0. Continuous variables were assessed for normality with the Shapiro-Wilk test; normally distributed data are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (SD), non-normally distributed data as median and interquartile range (IQR). Between-group comparisons used independent samples t-test for normally distributed continuous variables and Mann-Whitney U test for non-normally distributed variables. Categorical variables are reported as frequencies and analyzed using χ\u0026sup2; test. Spearman's correlation assessed relationships between continuous variables. Statistical significance was defined as two-sided P\u0026thinsp;\u0026lt;\u0026thinsp;0.05. In graphical representations, statistical significance is indicated as follows: *p\u0026thinsp;\u0026lt;\u0026thinsp;0.05; **p\u0026thinsp;\u0026lt;\u0026thinsp;0.01; ***p\u0026thinsp;\u0026lt;\u0026thinsp;0.001.\u003c/p\u003e\u003c/div\u003e"},{"header":"3. Result","content":"\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e\u003ch2\u003e3.1 Demographic Characteristics\u003c/h2\u003e\u003cp\u003eThe demographic and clinical profiles of the two participant groups\u0026mdash;non-DA (n\u0026thinsp;=\u0026thinsp;28) and DA (n\u0026thinsp;=\u0026thinsp;30)\u0026mdash;are summarized in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. There were no statistically significant differences among the two groups in terms of age (t\u0026thinsp;=\u0026thinsp;0.261, p\u0026thinsp;=\u0026thinsp;0.795) or gender (χ\u0026sup2; = 18.71, p\u0026thinsp;=\u0026thinsp;0.410), as assessed using the chi-square test.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eDemographic characteristics of the study participants\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"5\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eDiagnostic\u003c/p\u003e\u003cp\u003egroups\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003enon-DA\u003c/p\u003e\u003cp\u003e(n\u0026thinsp;=\u0026thinsp;28)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eDA\u003c/p\u003e\u003cp\u003e(n\u0026thinsp;=\u0026thinsp;30)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003et/χ\u003csup\u003e2 a\u003c/sup\u003e\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003ep\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eAge (years)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e23.43\u0026thinsp;\u0026plusmn;\u0026thinsp;4.96\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e23.10\u0026thinsp;\u0026plusmn;\u0026thinsp;4.62\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e0.261\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e0.795\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGender (F/M)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e14/14\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e19/11\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e18.71\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e0.410\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eMDAS\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e7.5 (5,9)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e12.50\u0026thinsp;\u0026plusmn;\u0026thinsp;1.94\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003ea: Age was examined with independent samples t-test, Gender was analyzed using the Chi-square test (χ\u0026sup2;). MDAS scores were used to categorize participants into groups; only descriptive statistics are presented for these scores here.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e\u003ch2\u003e3.2 Distribution of MDAS Scores\u003c/h2\u003e\u003cp\u003eFigure \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e presents the frequency distribution of MDAS scores using the established clinical cut-off of \u0026ge;\u0026thinsp;10 for dental anxiety. Among 58 participants, 28 (48.3%) comprised the non-DA group (MDAS\u0026thinsp;\u0026lt;\u0026thinsp;10), with scores predominantly clustered at 5 and 9 points (n\u0026thinsp;=\u0026thinsp;8 each). The DA group (MDAS\u0026thinsp;\u0026ge;\u0026thinsp;10, n\u0026thinsp;=\u0026thinsp;30, 51.7%) showed highest frequencies at 10 and 12 points (n\u0026thinsp;=\u0026thinsp;7 each), with scores ranging from 10 to 17 points. Critically, no participants scored\u0026thinsp;\u0026ge;\u0026thinsp;19, confirming all anxiety cases represented dental anxiety without phobic severity.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003e3.3 Peripheral Blood mRNA Expression Levels\u003c/h2\u003e\u003cdiv id=\"Sec12\" class=\"Section3\"\u003e\u003ch2\u003e3.3.1 Human GR mRNA Expression Levels\u003c/h2\u003e\u003cp\u003eThe semiquantitative evaluation of GR mRNA expression was performed using real-time PCR with β-actin as the internal control in peripheral blood samples. Independent samples t-test revealed no significant difference in GR mRNA levels between the non-DA group (1.02\u0026thinsp;\u0026plusmn;\u0026thinsp;0.19) and DA group (1.06\u0026thinsp;\u0026plusmn;\u0026thinsp;0.32) (t\u0026thinsp;=\u0026thinsp;0.5523, df\u0026thinsp;=\u0026thinsp;56, p\u0026thinsp;=\u0026thinsp;0.5830) in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section3\"\u003e\u003ch2\u003e3.3.2 Human GR-1B mRNA Expression Levels\u003c/h2\u003e\u003cp\u003eFor GR-1B mRNA, Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e demonstrates significantly elevated expression in the DA group (1.16\u0026thinsp;\u0026plusmn;\u0026thinsp;0.19) versus non-DA (1.02\u0026thinsp;\u0026plusmn;\u0026thinsp;0.19) (t\u0026thinsp;=\u0026thinsp;2.930, df\u0026thinsp;=\u0026thinsp;56, p\u0026thinsp;=\u0026thinsp;0.0049).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec14\" class=\"Section3\"\u003e\u003ch2\u003e3.3.3 Human GRIA1 mRNA Expression Levels\u003c/h2\u003e\u003cp\u003eFor GRIA1 mRNA, Mann-Whitney U-test revealed significant decrease expression in the DA group (median\u0026thinsp;=\u0026thinsp;0.56, IQR 0.35\u0026ndash;0.97) versus non-DA (median\u0026thinsp;=\u0026thinsp;1.08, IQR 0.58\u0026ndash;1.70) (U\u0026thinsp;=\u0026thinsp;235, p\u0026thinsp;=\u0026thinsp;0.0036) in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec15\" class=\"Section3\"\u003e\u003ch2\u003e3.3.4 Human OT mRNA Expression Levels\u003c/h2\u003e\u003cp\u003eFor OT mRNA, Mann-Whitney U-test revealed significant decrease expression in the DA group (median\u0026thinsp;=\u0026thinsp;0.59, IQR 0.37\u0026ndash;0.92) versus non-DA (median\u0026thinsp;=\u0026thinsp;0.88, IQR 0.59\u0026ndash;1.49) (U\u0026thinsp;=\u0026thinsp;251, p\u0026thinsp;=\u0026thinsp;0.0080) in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec16\" class=\"Section3\"\u003e\u003ch2\u003e3.3.5 Human OTR mRNA Expression Levels\u003c/h2\u003e\u003cp\u003eMann-Whitney U-test revealed no significant difference in OTR mRNA levels between the DA group (median\u0026thinsp;=\u0026thinsp;0.44, IQR 0.26\u0026ndash;1.95) versus non-DA (median\u0026thinsp;=\u0026thinsp;0.99, IQR 0.57\u0026ndash;1.55) (U\u0026thinsp;=\u0026thinsp;366.5, p\u0026thinsp;=\u0026thinsp;0.4102) in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec17\" class=\"Section3\"\u003e\u003ch2\u003e3.3.6 Human PARP1 mRNA Expression Levels\u003c/h2\u003e\u003cp\u003eMann-Whitney U-test revealed no significant difference in PARP1 mRNA levels between the DA group (median\u0026thinsp;=\u0026thinsp;1.08, IQR 0.86\u0026ndash;1.26) versus non-DA (median\u0026thinsp;=\u0026thinsp;1.02, IQR 0.86\u0026ndash;1.20) (U\u0026thinsp;=\u0026thinsp;396, p\u0026thinsp;=\u0026thinsp;0.7167) in Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\u003ch2\u003e3.4 Salivary Cortisol Levels\u003c/h2\u003e\u003cp\u003eSalivary cortisol levels were measured by ELISA. The Mann-Whitney U test indicated significantly higher levels in DA (median\u0026thinsp;=\u0026thinsp;4.64, IQR 3.90\u0026ndash;5.56) compared to non-DA group (median\u0026thinsp;=\u0026thinsp;2.76 ng/mL, IQR\u0026thinsp;=\u0026thinsp;2.01\u0026ndash;4.00) (U\u0026thinsp;=\u0026thinsp;164, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001; Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e\u003ch2\u003e3.5 Salivary alpha-amylase Levels\u003c/h2\u003e\u003cp\u003eSimilarly, Salivary alpha-amylase levels were also measured by ELISA. The independent samples t-test indicated significantly higher levels in DA (28.11\u0026thinsp;\u0026plusmn;\u0026thinsp;11.66) compared to non-DA group (20.75\u0026thinsp;\u0026plusmn;\u0026thinsp;11.67) (t\u0026thinsp;=\u0026thinsp;2.401, df\u0026thinsp;=\u0026thinsp;56, p\u0026thinsp;=\u0026thinsp;0.0197; Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003ePatients who suffer from dental anxiety are more likely to postpone or neglect dental treatment, resulting in the deterioration of their oral health. The progression of untreated oral infections, combined with feelings of remorse, humiliation, or worthlessness, contributes to an increase in dental anxiety, and the vicious cycle continues\u003csup\u003e[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]\u003c/sup\u003e. Consistent with this stress response, we observed significantly elevated salivary cortisol levels, reflecting HPA axis hyperactivity during dental anticipation. Similarly, higher salivary alpha-amylase in DA patients indicates enhanced SAM activation. This may be related to the milder degree of pain during orthodontic treatment, as studies have shown that pain during previous treatment is an important factor leading to dental anxiety.\u003c/p\u003e\u003cp\u003eThe expression level of GR mRNA in the peripheral blood of DA patients is slightly higher than that of non-DA patients, but there is no significant difference between the two groups. The expression level of GR-1B mRNA is higher than that of non-DA patients, which may be related to the decreased transcription of other GR mRNA (including GR-1C). Therefore, we speculate that the expression level of GR-1B in the peripheral blood of DA patients may be related to their body's response to stimuli during oral clinical visits\u003c/p\u003e\u003cp\u003eGRIA1 plays an important role in neurotransmitter signaling. It forms ion channels on the postsynaptic membrane, and when glutamate binds to it, the ion channels open, allowing sodium and calcium ions to enter neurons, leading to depolarization and excitation of the neurons. The expression level of GRIA1mRNA in the peripheral blood of patients in the DA group is lower than that in the non-DA group, which may be related to the fact that non-DA patients can adapt well to various situations and actively cooperate with treatment during oral diagnosis and treatment. However, DA patients exhibit phenomena such as accelerated heartbeat, lack of cooperation with treatment, and even avoidance of treatment during oral treatment.\u003c/p\u003e\u003cp\u003eThis study tested peripheral blood samples and compared the expression levels of OT mRNA and OTR mRNA between patients with and without dental anxiety. The results showed that the expression level of OT mRNA in the peripheral blood of patients with dental anxiety was significantly lower than that of patients without dental anxiety. Oxytocin, as a neurotransmitter with anti-anxiety effects, has an anti-stress effect and can regulate stress, anxiety, fear, and pain tolerance\u003csup\u003e[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]\u003c/sup\u003e. Its anti-stress effect is mainly achieved by regulating the HPA axis. Oxytocin enhances CRF induced ACTH secretion, thereby strengthening the negative feedback loop of the HPA axis and reducing its response to stress\u003csup\u003e[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]\u003c/sup\u003e. When the expression of oxytocin is insufficient, patients may be more prone to negative emotions such as anxiety and fear. The results of this study suggest that oxytocin may be involved in regulating the emotional response of dental anxiety patients, thereby affecting their acceptance and cooperation in oral treatment. Nash used oxytocin intranasal spray for adults and children who need dental treatment, and found that oxytocin intranasal spray is helpful to reduce adult anxiety and improve children's coordination in oral treatment, which is consistent with the conclusion of this study\u003csup\u003e[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003eStudies have shown that PARP1 has an impact on the transcriptional response of skeletal muscles to glucocorticoids, and steroid hormones have a controlling effect on muscle protein synthesis and metabolic rate\u003csup\u003e[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]\u003c/sup\u003e. The expression level of PARP1 mRNA in peripheral blood of patients in the DA group was higher than that in the non-DA group, but there was no statistically significant difference between the two groups. In the process of oral diagnosis and treatment, we can easily observe that DA patients are more prone to muscle tension than non-DA patients.\u003c/p\u003e\u003cp\u003eIn our current study, we found that patients with dental anxiety had higher levels of GR1B mRNA compared to the non-DA group, while GRIA1 and OT mRNA were lower in the non-DA group. Combined with elevated cortisol and amylase, we speculate that this expression difference may be related to dysregulation of the HPA axis and SAM system. Therefore, we believe that GR1B, GRIA1, OT, along with salivary cortisol and alpha-amylase, may serve as potential genetic and physiological markers for detecting dental anxiety.\u003c/p\u003e"},{"header":"5. Limitations","content":"\u003cp\u003eThis study has several limitations. First, as a single-center investigation recruiting outpatients exclusively from the Stomatology Hospital of Hunan University of Chinese Medicine, the geographic homogeneity of participants may restrict generalizability to broader populations. Second, the cross-sectional design with a limited sample size reduces statistical power. Third, undocumented use of medicine in some participants could confound stress biomarker measurements. Fourth, needle-induced distress during venipuncture may transiently elevate stress markers, potentially interfering with dental anxiety-specific responses.\u003c/p\u003e"},{"header":"6. Conclusion","content":"\u003cp\u003eDental anxiety may be related to HPA axis and SAM system dysregulation, with elevated salivary cortisol and alpha-amylase levels. GR1B, GRIA1, and OT alongside these physiological biomarkers can serve as potential markers for detecting dental anxiety in patients.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eHPA: Hypothalamic Pituitary Adrenal\u003c/p\u003e\n\u003cp\u003eSAM: Sympathetic Adrenal Medulla\u003c/p\u003e\n\u003cp\u003eDA: Dental Anxiety\u003c/p\u003e\n\u003cp\u003eGR: Glucocorticoid Receptor\u003c/p\u003e\n\u003cp\u003eGR-1B: Glucocorticoid Receptor Transcripts Containing Exons 1B\u003c/p\u003e\n\u003cp\u003eAMPA: \u0026alpha;-Amino-3-Hydroxy-5-Methyl-4-Isoxazole Propionate\u003c/p\u003e\n\u003cp\u003eGRIA1: Glutamate Ionotropic Receptor AMPA Type Subunit 1\u003c/p\u003e\n\u003cp\u003eOT: Oxytocin\u003c/p\u003e\n\u003cp\u003eOTR:\u0026nbsp;Oxytocin Receptor\u003c/p\u003e\n\u003cp\u003ePARP1: Poly ADP-Ribose Polymerase 1\u003c/p\u003e\n\u003cp\u003eDP: Dental Phobia\u003c/p\u003e\n\u003cp\u003eCRF:\u0026nbsp;Corticotropin Releasing Factor\u003c/p\u003e\n\u003cp\u003eACTH: Adrenocorticotropic Hormone\u003c/p\u003e\n\u003cp\u003eMDAS: Modified Dental Anxiety Scale\u003c/p\u003e\n\u003cp\u003ePBMCs: Peripheral Blood Mononuclear Cells\u003c/p\u003e\n\u003cp\u003ecDNA:\u0026nbsp;Complementary DNA\u003c/p\u003e\n\u003cp\u003eRT-qPCR: Reverse Transcription Quantitative Polymerase Chain Reaction\u003c/p\u003e\n\u003cp\u003eSD: Standard Deviation\u003c/p\u003e\n\u003cp\u003eIQR: Interquartile Range\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe study protocol involving orthodontic patients seeking treatment at the Orthodontic Department of the Stomatology Hospital Affiliated to Hunan University of Chinese Medicine (July 2021 to March 2023) was reviewed and approved by the Institutional Ethics Committee. Each participant provided written informed consent after receiving detailed verbal and written information about the study design. All patients signed informed consent forms for the publication of their data. All methods were performed in accordance with relevant guidelines. All methods used in this study comply with the ethical standards of the institutional and/or national research committees and the Declaration of Helsinki and its subsequent amendments or comparable ethical standards.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable. This manuscript does not contain any individual person\u0026rsquo;s data in any form (including images, videos, or identifiable details)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe de-identified patient-level questionnaire datasets (MDAS scores and general information) generated and/or analysed during the current study are not publicly available due to institutional ethics restrictions and participant privacy, but are available from the corresponding author on reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research was funded by the Hunan University of Chinese Medicine (No. 2022XYLH131).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026apos; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eW.L. (Wenlong Liu) contributed to conceptualization, methodology, investigation, data curation, formal analysis, and writing\u0026mdash;original draft. T.H. (Tao Huai) contributed to conceptualization, methodology, data curation, validation, visualization, and writing\u0026mdash;original draft. S.W. (Shichen Wang) contributed to writing\u0026mdash;original draft and data curation. C.L. (Chao Liu) contributed to investigation, data acquisition, and visualization. X.H. (Xianggang Hou) contributed to investigation, data acquisition, and validation. H.Z. (Hongshuang Zhu) contributed to laboratory support, validation, and visualization. Y.D. (Yige Duan) contributed to data acquisition, formal analysis, and figure preparation. M.B. (Minghai Bai) and Y.L. (Yong Liu) provided supervision, resources, and writing\u0026mdash;review \u0026amp; editing. All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe thank all patients who participated in this study for their time and cooperation.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eSamorodnitzky GR, Levin L. Self-assessed dental status, oral behavior, DMF, and dental anxiety. J Dent Educ. 2005;69(12):1385\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiinavuori A, Tolvanen M, Pohjola V, Lahti S. Longitudinal interrelationships between dental fear and dental attendance among adult Finns in 2000\u0026ndash;2011. Community Dent Oral Epidemiol. 2019;47(4):309\u0026ndash;15.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMohammad NS, Nazli R, Zafar H, Fatima S. Effects of lipid based Multiple Micronutrients Supplement on the birth outcome of underweight pre-eclamptic women: A randomized clinical trial. Pak J Med Sci. 2022;38(1):219\u0026ndash;26.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHumphris GM, Dyer TA, Robinson PG. The modified dental anxiety scale: UK general public population norms in 2008 with further psychometrics and effects of age. BMC Oral Health. 2009;9:20.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eThomson WM, Stewart JF, Carter KD, Spencer AJ. Dental anxiety among Australians. Int Dent J. 1996;46(4):320\u0026ndash;4.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eArmfield JM, Stewart JF, Spencer AJ. The vicious cycle of dental fear: exploring the interplay between oral health, service utilization and dental fear. BMC Oral Health. 2007;7:1.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAsl AN, Shokravi M, Jamali Z, Shirazi S. Barriers and Drawbacks of the Assessment of Dental Fear, Dental Anxiety and Dental Phobia in Children: A Critical Literature Review. J Clin Pediatr Dent. 2017;41(6):399\u0026ndash;423.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTananska VT. Salivary α-Amylase And Chromogranin A In Anxiety-Related Research. Folia Med (Plovdiv). 2014;56(4):233\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHellhammer DH, W\u0026uuml;st S, Kudielka BM. Salivary cortisol as a biomarker in stress research. Psychoneuroendocrinology. 2009;34(2):163\u0026ndash;71.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWadsworth ME, Broderick AV, Loughlin-Presnal JE, et al. Co-activation of SAM and HPA responses to acute stress: A review of the literature and test of differential associations with preadolescents' internalizing and externalizing. Dev Psychobiol. 2019;61(7):1079\u0026ndash;93.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSinclair D, Fullerton JM, Webster MJ, Shannon Weickert C. Glucocorticoid receptor 1B and 1C mRNA transcript alterations in schizophrenia and bipolar disorder, and their possible regulation by GR gene variants. PLoS ONE. 2012;7(3):e31720.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eW\u0026uuml;st S, Van Rossum EF, Federenko IS, Koper JW, Kumsta R, Hellhammer DH. Common polymorphisms in the glucocorticoid receptor gene are associated with adrenocortical responses to psychosocial stress. J Clin Endocrinol Metab. 2004;89(2):565\u0026ndash;73.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKumsta R, Entringer S, Koper JW, van Rossum EF, Hellhammer DH, W\u0026uuml;st S. Sex specific associations between common glucocorticoid receptor gene variants and hypothalamus-pituitary-adrenal axis responses to psychosocial stress. Biol Psychiatry. 2007;62(8):863\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ede Oliveira DC, Zuardi AW, Graeff FG, Queiroz RH, Crippa JA. Anxiolytic-like effect of oxytocin in the simulated public speaking test. J Psychopharmacol. 2012;26(4):497\u0026ndash;504.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRyan KM, McLoughlin DM. PARP1 and OGG1 in Medicated Patients With Depression and the Response to ECT. Int J Neuropsychopharmacol. 2023;26(2):107\u0026ndash;15.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eClow A, Smyth N. Salivary cortisol as a non-invasive window on the brain. Int Rev Neurobiol. 2020;150:1\u0026ndash;16.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eT\u0026ouml;rnhage CJ. Salivary cortisol for assessment of hypothalamic-pituitary-adrenal axis function. Neuroimmunomodulation. 2009;16(5):284\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBosch JA, Veerman EC, de Geus EJ, Proctor GB. α-Amylase as a reliable and convenient measure of sympathetic activity: don't start salivating just yet. Psychoneuroendocrinology. 2011;36(4):449\u0026ndash;53.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAlMaummar M, AlThabit HO, Pani S. The impact of dental treatment and age on salivary cortisol and alpha-amylase levels of patients with varying degrees of dental anxiety. BMC Oral Health. 2019;19(1):211.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHumphris GM, Morrison T, Lindsay SJ. The Modified Dental Anxiety Scale: validation and United Kingdom norms [J]. Community Dent Health. 1995;12(3):143\u0026ndash;50.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYuan S, Freeman R, Lahti S, et al. Some psychometric properties of the Chinese version of the Modified Dental Anxiety Scale with cross validation [J]. Health Qual Life Outcomes. 2008;6(1):22.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKassem El Hajj H, Fares Y, Abou-Abbas L. Assessment of dental anxiety and dental phobia among adults in Lebanon. BMC Oral Health. 2021;21(1):48.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCarter CS, Kenkel WM, MacLean EL, et al. Is Oxytocin Nature's Medicine. Pharmacol Rev. 2020;72(4):829\u0026ndash;61.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYoon S, Kim YK. The Role of the Oxytocin System in Anxiety Disorders. Adv Exp Med Biol. 2020;1191:103\u0026ndash;20.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNash DA. Translating neuroscience research to oral medicine: oxytocin and human behavior. Oral Dis. 2015;21(7):913\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTan A, Younis AZ, Evans A, et al. PARP1 mediated PARylation contributes to myogenic progression and glucocorticoid transcriptional response. Cell Death Discov. 2023;9(1):133.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"bmc-oral-health","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"ohea","sideBox":"Learn more about [BMC Oral Health](http://bmcoralhealth.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/ohea/default.aspx","title":"BMC Oral Health","twitterHandle":"BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Dental anxiety, The Modified Dental Anxiety Scale (MDAS), GR-1B, GRIA1, OT, cortisol, alpha-amylase","lastPublishedDoi":"10.21203/rs.3.rs-7905570/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7905570/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cb\u003eIntroduction:\u003c/b\u003e\u003c/p\u003e\u003cp\u003ePrevious studies show that the hypothalamic pituitary adrenal (HPA) axis and sympathetic adrenal medulla (SAM) in saliva of patients with dental anxiety (DA) exhibit elevated salivary cortisol and amylase. However, underlying molecular mechanisms remain unclear. This study quantitatively analyzed the mRNA expression of glucocorticoid receptor (GR), GR transcripts containing exons 1B (GR-1B), GRIA1 (Glutamate Ionotropic Receptor AMPA Type Subunit 1), oxytocin (OT), oxytocin receptor (OTR), and Poly ADP-Ribose Polymerase 1 (PARP1) in peripheral blood, and measured salivary cortisol and alpha-amylase to explore their correlation with dental anxiety.\u003c/p\u003e\u003cp\u003e\u003cb\u003eMethods\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThis study included a total of 30 DA patients and 28 non-DA patients. The peripheral blood mRNA expressions for GR, GR-1B, GRIA1, OT, OTR, PARP1 genes were determined by real-time quantitative polymerase chain reaction. Salivary cortisol and alpha-amylase concentrations were determined via Enzyme linked immunosorbent assay.\u003c/p\u003e\u003cp\u003e\u003cb\u003eResults\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe expression levels of GR-1B mRNA in DA were significantly higher than those in non-DA, while the expression levels of GRIA1 and OT mRNA were lower than those in non-DA. Concurrently, salivary cortisol and alpha-amylase levels were significantly higher in DA.\u003c/p\u003e\u003cp\u003e\u003cb\u003eConclusion\u003c/b\u003e\u003c/p\u003e\u003cp\u003eDental anxiety may be related to HPA axis related expression. Salivary biomarkers (cortisol/α-amylase) and peripheral blood mRNA markers (GR1B, GRIA1, OT) may serve as potential screening tools.\u003c/p\u003e","manuscriptTitle":"Altered Peripheral Blood mRNA and Salivary Biomarkers in Dental Anxiety: A Cross-Sectional Study","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-12-11 00:47:58","doi":"10.21203/rs.3.rs-7905570/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2026-02-09T18:17:32+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-02-03T14:06:38+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"284726554794412466799446259095801936959","date":"2026-01-28T13:15:48+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-12-18T19:22:55+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-12-18T06:31:03+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"65706264601668926525285953127700941958","date":"2025-12-15T16:19:40+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"269486731778573146870323581934046153358","date":"2025-12-08T12:27:24+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-12-08T12:21:07+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2025-11-03T06:03:20+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-11-03T06:02:50+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-11-01T09:09:27+00:00","index":"","fulltext":""},{"type":"submitted","content":"BMC Oral Health","date":"2025-11-01T09:05:32+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"bmc-oral-health","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"ohea","sideBox":"Learn more about [BMC Oral Health](http://bmcoralhealth.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/ohea/default.aspx","title":"BMC Oral Health","twitterHandle":"BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"a49d5f93-e98e-4059-9a7f-39e53c322d1b","owner":[],"postedDate":"December 11th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2026-05-12T10:18:47+00:00","versionOfRecord":[],"versionCreatedAt":"2025-12-11 00:47:58","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7905570","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7905570","identity":"rs-7905570","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.