OXR1 Signaling Pathway as a Possible Mechanism of Elastase-Induced Oxidative Damage in Pulmonary Cells: The Protective Role of Ellagic Acid

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher
AI-generated summary by claude@2026-07+body, 2026-07-05

This study found that neutrophil elastase induces oxidative damage in lung cells via the OXR1 pathway, which was mitigated by the antioxidant ellagic acid.

One-sentence paraphrase of the abstract; not a substitute for reading it. No clinical advice. How this works

AI-generated deep summary by claude@2026-07, 2026-07-05 · read from full text

The study examined how neutrophil elastase exposure affects oxidative stress signaling in human lung epithelial A549 cells, comparing elastase at 15, 30, or 60 mU/ml with H2O2 (100 µM) and assessing whether the antioxidant ellagic acid (10 µmol/L) can modulate these effects. Across cytotoxicity (MTT), ROS detection (DCFH-DA flow cytometry and ROS/RNS kit), lipid peroxidation (MDA), antioxidant measures (SOD/GPx activity and GSH/TAC), and gene expression, elastase increased oxidative stress in a dose-dependent manner while reducing antioxidant defense genes, whereas ellagic acid improved antioxidant enzyme activity/content and upregulated OXR1 pathway genes, including downstream targets assessed by real-time PCR. A major limitation explicitly implied by the design is the use of an in vitro lung cell line model and preprint status, without peer review. This paper is centrally about endometriosis or adenomyosis-related research only in the context that it models oxidative-stress pathways (OXR1/Nrf2 axis) that are implicated in endometriosis and adenomyosis pathophysiology, though the paper itself does not specifically discuss endometriosis or adenomyosis.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Abstract

Background: and objective: Oxidative stress is a process that occurs through free radicals on the cell membranes which causes damage to the cell and intracellular organelles especially mitochondria membranes. H2O2 induced oxidative stress in human cells is of interest in toxicological research since oxidative stress plays a main role in the etiology of several pathological conditions. Neutrophil Elastase (Serine proteinase) is involved in the pathology process of emphysema as a respiratory disease through lung inflammation, and destruction of alveolar walls. The present study investigated the direct oxidative stress effects of Elastase in comparison with H2O2 on human lung epithelial cells (A549 cells) in relation to the generation of reactive oxygen species (ROS) and modulation of oxidation resistance 1 (OXR1) and its downstream pathway using the well-known antioxidant Ellagic acid as an activator of antioxidant genes. Materials: and methods: The human pulmonary epithelial cells (A549) were divided into the 9 groups including: Negative control, Positive control (H2O2), Elastase (15, 30, and 60 mU/ml), Ellagic acid (10 μmol/L), and Elastase+Ellagic acid. Cytotoxicity, reactive oxygen spices generation, oxidative stress profile, level of reactive metabolites, and gene expression of OXR1 and its downstream genes were measured in all groups. Results: : The obtained data demonstrated that Elastase exposure caused to oxidative stress damage in a dose-depended manner which was associated with decreases in antioxidant defense system genes. Conversely, treatment with Ellagic acid as a potent antioxidant showed improved antioxidant enzyme activity and content which was in line with the upregulation of OXR1 signaling pathway genes. Conclusions: : The present findings can highlight the novel mechanism underlying the oxidative stress induces by Neutrophil Elastase through OXR1 and related genes. Moreover, the benefit of Ellagic acid on cytoprotection, resulting from its antioxidant properties was documented.
Full text 80,211 characters · extracted from preprint-html · click to expand
OXR1 Signaling Pathway as a Possible Mechanism of Elastase-Induced Oxidative Damage in Pulmonary Cells: The Protective Role of Ellagic Acid | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article OXR1 Signaling Pathway as a Possible Mechanism of Elastase-Induced Oxidative Damage in Pulmonary Cells: The Protective Role of Ellagic Acid Vahid Bayati, Maryam Radan, Mahin Dianat, Zahra Mansouri, Farzaneh Souhrabi This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-1229337/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 5 You are reading this latest preprint version Abstract Background and objective: Oxidative stress is a process that occurs through free radicals on the cell membranes which causes damage to the cell and intracellular organelles especially mitochondria membranes. H2O2 induced oxidative stress in human cells is of interest in toxicological research since oxidative stress plays a main role in the etiology of several pathological conditions. Neutrophil Elastase (Serine proteinase) is involved in the pathology process of emphysema as a respiratory disease through lung inflammation, and destruction of alveolar walls. The present study investigated the direct oxidative stress effects of Elastase in comparison with H2O2 on human lung epithelial cells (A549 cells) in relation to the generation of reactive oxygen species (ROS) and modulation of oxidation resistance 1 (OXR1) and its downstream pathway using the well-known antioxidant Ellagic acid as an activator of antioxidant genes. Materials and methods: The human pulmonary epithelial cells (A549) were divided into the 9 groups including: Negative control, Positive control (H2O2), Elastase (15, 30, and 60 mU/ml), Ellagic acid (10 μmol/L), and Elastase+Ellagic acid. Cytotoxicity, reactive oxygen spices generation, oxidative stress profile, level of reactive metabolites, and gene expression of OXR1 and its downstream genes were measured in all groups. Results: The obtained data demonstrated that Elastase exposure caused to oxidative stress damage in a dose-depended manner which was associated with decreases in antioxidant defense system genes. Conversely, treatment with Ellagic acid as a potent antioxidant showed improved antioxidant enzyme activity and content which was in line with the upregulation of OXR1 signaling pathway genes. Conclusions: The present findings can highlight the novel mechanism underlying the oxidative stress induces by Neutrophil Elastase through OXR1 and related genes. Moreover, the benefit of Ellagic acid on cytoprotection, resulting from its antioxidant properties was documented. Elastase Lung Epithelial Cell H2O2 Oxidative Stress OXR1 Ellagic Acid Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Several cellular processes, including cell metabolism, signal transduction, and regulatory pathways, cell proliferation, and programmed cell death is affected by oxidative stress. Enhanced free radicals cause changes in the structure and function of main biological molecules in the body, such as proteins, lipids, and nucleic acids, which ultimately lead to tissue damage ( 1 ). The free radicals tend to react with other molecules due to their unbounded electrons and act as electron acceptors and oxidizing agents. The most important oxidants are reactive oxygen species (ROS), nitrogen (RNS), active species chloride, and sulfur. One of the most important oxidants that damage cells in the body are reactive oxygen species, which also plays an important role in the production of other active species, such as active nitrogen species. The endogenous sources of free radicals include mitochondria, peroxisomes, inflammatory cells, Flavin, and external sources include environmental pollution, cigarette smoke, and chemical compounds ( 2 ). The most common way to measure free radicals and oxidative stress is to determine the biomarkers generation from the reaction of free radicals with biological molecules in tissue, serum, and cell extract ( 3 ). The body's cells have resistance mechanisms against oxidative stress. These systems include Catalase (CAT), Superoxide dismutase (SOD), Glutathione peroxidase (GPx), and Glutathione (GSH) ( 4 ). The eukaryotic oxidation resistance gene1 (OXR1) is a key regulatory factor that protects against free radicals ( 5 ) and was first identified during the study in the year 2000 as a gene capable of coping with oxidative stress caused by Escherichia coli ( 6 ). The OXR1 acts as an oxidative stress sensor in the cell and regulates the transcription network of genes required to detoxify oxygen free radicals and modulates the cell cycle and apoptosis process. The OXR1 factor is present in the genomes of all eukaryotes, including worms, insects, and mammals ( 7 ). However, a specific mechanism of the protective function of this gene in other oxidative stress damage is not known. The cyclin-dependent kinase inhibitor 1A (P21) and Nuclear factor (Erythroid-derived 2)-like 2 (Nrf2) proteins play an important role in controlling the level of free radicals in the body by regulating the antioxidant system ( 8 ). Under physiological conditions, factor Nrf2 is negatively regulated by Kelch-like ECH-associated protein 1 (Keap1) in low amounts in the cytoplasm. P21 activates and stabilizes the Nrf2 protein by competing with Keap1 ( 9 ). Activation of Nrf2 leads to increased expression of genes responsible for regulating the antioxidant system such as Heme oxygenase-1 (HO-1), NADH quinone oxidoreductase 1 (NQO1), and Glutamate-Cysteine Ligase (GCL) ( 10 ). Decreased Nrf2 protein is known as the first direct link between lowering the level of the antioxidant defense system and damage caused by oxidative stress in the lungs ( 11 ). On the other hand, a study has shown that OXR1 plays a key role in regulating the expression of the P21 gene as an important factor in the activation of Nrf2 protein ( 5 , 12 ). Natural antioxidants are the pivotal body's defense mechanism against oxidants that play an important role in maintaining redox status, eliminating reactive species, and balancing oxidation-reduction reactions in vital organs. Ellagic acid (C 14 H 6 O 8 ) is a natural polyphenolic compound that has a wide range of pharmaceutical and industrial applications. This molecule has shown various including anti-mutagenic, anti-oxidant, and anti-inflammatory properties ( 13 – 14 ). The in vitro test system of the human lung epithelial cell line (A549) is applied as a model for inducing oxidative modification using H2O2 as a well-known oxidant comparison with Elastase. The identified response to oxidative stress will be considered as a molecular damage mechanism leading to pulmonary diseases. According to the above documents, the aim of this study was to investigate the possible changes in the oxidative stress signaling axis in pulmonary epithelial cells exposed to Elastase. Moreover, the protective role of Ellagic acid as a natural antioxidant agent in improving Elastase-induced oxidative stress will be evaluated. Material And Method Cell treatments and preparation of cell lysates The Human pulmonary epithelial cell line (A549) was obtained from the Pasteur Institute of Iran (IPI). The grouping was as follows: Negative control group: 100 µM PBS. Positive control group: 100 µM H2O2 (well-known oxidant). Elastase group: 15 mU/ml for 24 hours. Elastase group: 30 mU/ml for 24 hours. Elastase group: 60 mU/ml for 24 hours ( 15 ). Ellagic acid group: 10 µmol/L for 24 hours ( 16 ). Elastase+Ellagic acid group: 15 mU/ml+Ellagic acid 10 µmol/L for 24 hours. Elastase+Ellagic acid group: 30 mU/ml+Ellagic acid 10 µmol/L for 24 hours. Elastase+Ellagic acid group: 60 mU/ml+Ellagic acid 10 µmol/L for 24 hours. Briefly, the cells cultured and exposed to 100 µM H2O2 (Sigma-Aldrich Co, USA) for 24 h in DMEM medium (Gibco-BRL, Germany) and at standard cultivation conditions (37°C in the presence of 5% CO2). For the experiment groups, the A549 cells were treated with various concentration of Elastase (15, 30, and 60 mU/ml) with or without 10 µmol/L Ellagic acid (Sigma-Aldrich Co, USA) for 24 h to observe its effect in comparison with H2O2 to induce oxidative stress which brings any change in the macromolecules. Then, the culture supernatant of all groups was collected, stored and cell lysate was prepared in order to biochemical measurements. Cytotoxicity assay In order to evaluate the cell viability using colorimetric MTT assay, all cell groups seeded in 24-well plates and treated with various concentrations of Elastase in FBS-free media. After overnight incubation, the MTT solution (20 µl) was added and the cells were maintained for 4 h at 37°C. Then, SDS (10%) in acidified DMSO was added and the absorbance measured and the percent of cell viability in all groups were calculated in comparison to the controls. Flow-cytometric detection of reactive oxygen spices The A549 cells incubated with 10 µM DCFH-DA as a ROS detector at 37°C for 30 min. subsequently, the cells were washed two times using a serum-free cell culture medium and detected via Flow cytometry. Measurement of ROS/RNS level The ROS levels in the supernatant fluid of A549 cells were quantified in all groups using In Vitro ROS/RNS assay Kit (Green Fluorescence; Cell Biolabs, USA). The assessments were performed three times and according to the instructions of the manufacturers. Lipid peroxidation evaluation Lipid peroxidation as an index of oxidative stress was assessed using the Malondialdehyde (MDA) commercial Kit (Zellbio GmbH, Deutschland) according to the manufacturer’s instructions. Measurement of antioxidant capacity The activity of SOD and GPx, and also the level of GSH and TAC was assessed using the special assay Kits (Zellbio GmbH, Deutschland) according to the manufacturer’s instructions. Determination of Protein Protein concentration was determined according to the Lowry method via commercial assay Kit (Bio-Rad, USA). Bovine serum albumin (BSA) was applied as the standard. Oxidative stress signaling The real time-PCR was used to evaluate the effects of Elastase and Ellagic acid on the expression of OXR1, P21, Nrf2, HO1, and NAD (P)H: quinone oxidoreductase-1 (NQO1) genes expression in human lung epithelial cells. The cell lysates were separated and immediately frozen in liquid nitrogen and stored at -80°C until assessment. The RNA extraction in cell lysates was performed using an extraction kit (RNeasy Plus Mini Kit). The cDNA synthesis step was then performed using a kit (Quantitect Reverse Transcriptase). Finally, 1 µl of cDNA and a proportional amount of each of the reciprocating primers and 10 µl of a real-Time Master mix plus a proportionate volume of RNase free water in a mixture were prepared and the real-time PCR reaction was performed. Subsequently, the expression of each of the mentioned genes in comparison with Glyceride aldehyde 3-phosphate dehydrogenase (GAPDH) as the control gene was measured by Real-Time PCR. Then, the values were calculated by the comparative Ct (threshold cycle) method. The sequences of the forward and reverse primers of the considered genes are as follows: Table 1 Primer sequences for Real-Time PCR. Genes Forward Backward OXR1 TTATGGTACTGGAGAGACCTTTGTTTT AAAACATATTATCTCCTGTCCACTTAAAGAC Nrf2 GGTTTCTTCGGCTACGTTTC CCTCCCAAACTTGCTCAATG P21 TGGAGACTCTCAGGGTCGAAA GGCGTTTGGAGTGGTAGAAATC HO1 ATGACACCAAGGACCAGAGC GTGTAAGGACCCATCGGAGA NQO1 ATGTATGACAAAGGACCCTTCC TCCCTTGCAGAGAGTACATGG GAPDH GCTCACTGTTCTCTCCCTC GAGGTCAATGAAGGGGTCAT Statistical analysis Results of the current study were analyzed using the SPSS software and the normality of data was assessed using Kolmogorov–Smirnov test. All data were expressed as Mean±SEM. Differences between experimental groups were analyzed by ANOVA and followed by post hoc Tukey's test. Finally, the p value ˂0.05 was considered significant statistically. Results Cell viability measurement The viability of the human pulmonary epithelial cells, as evaluated by MTT assay, significantly decreased following exposure to H2O2 in comparison with control cells. Exposure to Elastase for 24 hours also decreased the viability. However, statistical analysis just in the highest concentration of Elastase (60 mU/ml) showed significant differences in comparison with H2O2 exposure cells. Once the A549 cells were treated with Ellagic acid, Elastase-induced cell toxicity was remarkably diminished. These results documented the protective properties of Ellagic acid against oxidative damage (Figure. 2). Reactive oxygen species (ROS) detection The DCFH-DA as a ROS detector probe was used to evaluate the influence of Elastase on cellular free radical production. As shown in Figure. 3A, the flow cytometric assessment demonstrated significant increases in the H2O2 group in comparison with control cells. Exposure to Elastase showed a dose-dependent enhancement in the ROS level in A549 cells compare to the H2O2 which these data suggests the cytotoxic and oxidative effects of Elastase on pulmonary epithelial cells. Although the ROS production level was lower in the Ellagic acid treatment group compared to the Elastase cells. Assessment of the oxidative stress profile The reactive oxygen species can react with cell membrane lipids which lead to lipid peroxidation. Accordingly, MDA as a well-known biomarker of oxidative stress damage was considered in the current study. The MDA level significantly increased in the H2O2 group in comparison with the control. Elastase exposure also showed enhancement in MDA level in all concentrations compare to the H2O2 cells with the highest value in 60 mU/ml (Figure. 3B). On the other hand, the antioxidant profile demonstrated significant increases in response to H2O2 compare with the control group. Cells incubation with Elastase for 24 hours leads to diminishing in antioxidant capacity which showed by decreases in activity of SOD (Figure. 4A), GPx (Figure. 4B), and also GSH (Figure. 4C)and TAC(Figure. 4D)levels in a dose-dependent manner. Conversely, Ellagic acid at a concentration of 10 μmol/L showed MDA diminishes and increases in SOD, GPx activity, and GSH, TAC levels which suggest the potent antioxidant properties of this natural antioxidant. Determination of ROS/RNS level To confirm the oxidative stress in exposure to Elastase, the level of reactive metabolites was determined in all cell groups. As shown in Figure. 5 a significant increase in ROS/RNS level detected in the H2O2 group demonstrated the excessive oxidative stress to damage the cell components. A higher level of ROS/RNS showed in Elastase groups as well, with the highest significance in 60 mU/ml concentration. Co-treatment with Ellagic acid significantly diminished the level of ROS/RNS in dose depended manner which suggested the protective effect of Ellagic acid to relief the oxidative damage to the cells. Expression levels of antioxidant genes in A549 cells Following exposure to H2O2 as a well-known oxidant agent the gene expression level of antioxidant key regulators including OXR1, P21, Nrf2, HO1, and NQO1 significantly increased in comparison with the control group. In the Elastase exposure group, as the Elastase concentration increased the gene expression of OXR1, P21, Nrf2, HO1, and NQO1 gradually diminished in comparison with the H2O2 group. Treatment with Ellagic acid demonstrated the increases in antioxidant key regulator genes after 24 hours (Figure. 6). Discussion Reactive oxygen spices play a critical role in the death and survival of diseases. Previous in vivo studies have documented that excessive endogenous Elastase causes pulmonary emphysema through inflammation and oxidative stress ( 17 – 19 ). In this regard, current in vitro study identified the oxidative stress signaling pathway of Elastase to induce cell injuries in pulmonary epithelial cells. The results of the present study showed that Elastase decreased the gene expression of OXR1, P21, Nrf2, HO1, and NQO1 in a concentration-dependent manner which was associated with decreases in antioxidant enzymes activity and content. Reactive oxygen spices (ROS) and other non-radical oxygen derivatives, as by-products of metabolism, are constantly generated in biological systems and cause damage to DNA, proteins, and lipids ( 20 ). The biological antioxidant defense system effectively neutralized oxidative stress by preventing free radicals-mediated organ damage ( 21 ). OXR1 is identifying as a key regulator in resistance against the pathology of diseases which discovered first as an essential factor for inhibition of oxidative stress damage in eukaryotes organs 20 years ago ( 22 ). A study by Volkert et al. in 2000 reported that OXR1 depletion in Saccharomyces cerevisiae enhanced sensitivity to H2O2injuries ( 5 ). Nuclear factor (erythroid-derived 2)-like 2 (Nrf2) and cyclin-dependent kinase inhibitor 1A (P21) known as crucial factors for regulating ROS levels by controlling downstream antioxidant enzymes. Indeed, subsequently to oxidative stress, Nrf2 activation leads to upregulation of several antioxidant genes, including the Heme oxygenase-1 (HO-1), and NADH quinone oxidoreductase 1 (NQO1) ( 23 ). According to a study by Yang et al. in 2014, the OXR1 gene through controlling the gene expression level of P21 (as an activator of Nrf2 protein) has a key role in the antioxidant defense system which supports the hypothesis that OXR1 protect against oxidative stress damage via P21-Nrf2-HO1-NQO1 dependent manner ( 5 ). In this context, the results of the current experiment demonstrated that Elastase exposure caused to decreases in the antioxidant defense system which was showed by the lower levels of SOD, CAT, GPx activity, and GSH content. The upstream regulator's genes evaluation also revealed the downregulation of OXR1-related genes which suggested the cytotoxicity effects of Elastase on lung epithelial cells through destruction of the antioxidant protection system. Oxidative stress process seems to be involved in the pathology of emphysema process ( 24 ). As expected, in the current study the data showed a significant increase in oxidative stress biomarkers including reactive oxygen and nitrogen species (ROS/RNS) content and Malondialdehyde in response to Elastase exposure. Accordingly, it seems to antioxidant management can be considered in preventing and controlling of this destructive process. In recent years, there is a growing focus on natural antioxidants, with remarkable cytoprotective properties against cell injuries induced by oxidative stress. Ellagic acid is a polyphenolic compound found in green tea and other natural sources such as pomegranate, strawberry, raspberry, and eucalyptus bark. Ellagic acid has potent antioxidant and anti-apoptotic properties that can inhibit or prevent cellular oxidation. Ellagic acid reduces oxidative stress by scavenging free radicals and increases the antioxidant enzymes ( 25 – 27 ). Treatment with 10 µmol/L Ellagic acid for 24 hours demonstrated the inhibition effects against oxidative stress induced by Elastase which showed by increases in OXR1-P21-Nrf2-HO1-NQO1 genes expression and antioxidant factors including SOD, GPx, GSH and TAC. These data suggest the potent antioxidant properties of this natural antioxidant. In this regard, Rozentsvit et al. in the experimental study on the antioxidant effects of Ellagic acid, reported that Ellagic acid significantly diminishes free radical levels and attenuates the impairment of oxidative stress induced by high glucose medium ( 28 ). Another in vitro study by Te-Mao et al. on human bladder cancer cells showed that Ellagic acid causes to cell cycle arrest and apoptosis through P53/P21 genes expression-depended mechanism ( 29 ). These reported data are in line with the results of the current study on the positive antioxidant properties of Ellagic acid against Elastase-induced oxidative damage. In conclusion, the present findings can highlight the novel mechanism underlying the oxidative stress induces by Elastase through OXR1 and related genes. Moreover, the benefit of Ellagic acid on cytoprotection, resulting from its antioxidant properties was documented. However, further molecular and cellular studies on the cytoprotective activity of Ellagic acid are necessary. Declarations Acknowledgements This Research study was done in the Cellular and Molecular Research Center, Basic Sciences Research Institute at Ahvaz Jundishapur University of Medical Sciences in Ahvaz, Iran. The authors gratefully acknowledge the help and financial support of the Cellular and Molecular Research Center, Ahvaz Jundishapur University of Medical Sciences [Grant No. CMRC-9813]. Funding disclosures The authors received funding from the Cellular and Molecular Research Center, Medical Basic Sciences Research Institute, Ahvaz Jundishapur University of Medical Sciences [Grant No. APRC-9813]. Authors' contributions All authors contributed equally to this manuscript. We further confirm that the manuscript has been read and approved by all named authors. Ethics declarations We confirm that any aspects of this work were approved by the Ethics Committee of Ahvaz Jundishapur University of Medical Sciences (IR.AJUMS. REC.1398.717). Competing interests We know of no conflicts of interest with this publication. References Schieber M, Chandel NS ROS function in redox signaling and oxidative stress.Current biology. 2014 May19;24(10):R453-62 Domej W, Oettl K, Renner W (2014) Oxidative stress and free radicals in COPD–implications and relevance for treatment. Int J Chronic Obstr Pulm Dis 9:1207 Marrocco I, Altieri F, Peluso I (2017 Jan) Measurement and clinical significance of biomarkers of oxidative stress in humans. Oxidative medicine and cellular longevity. 1;2017. Sharma P, Jha AB, Dubey RS, Pessarakli M (2012) Reactive oxygen species, oxidative damage, and antioxidative defense mechanism in plants under stressful conditions. Journal of botany. ;2012 Yang M, Luna L, Sørbø JG, Alseth I, Johansen RF, Backe PH, Danbolt NC, Eide L, Bjørås M (2014 Dec) Human OXR1 maintains mitochondrial DNA integrity and counteracts hydrogen peroxide-induced oxidative stress by regulating antioxidant pathways involving p21. Free Radic Biol Med 77(1):41–48 Volkert MR, Elliott NA, Housman DE (2000) Functional genomics reveals a family of eukaryotic oxidation protection genes. Proceedings of the National Academy of Sciences. Dec 19;97(26):14530-5 Oliver PL, Finelli MJ, Edwards B, Bitoun E, Butts DL, Becker EB, Cheeseman MT, Davies B, Davies KE (2011 Oct) Oxr1 is essential for protection against oxidative stress-induced neurodegeneration. PLoS Genet 20;7((10):e1002338 Chen W, Sun Z, Wang XJ, Jiang T, Huang Z, Fang D, Zhang DD Direct interaction between Nrf2 and p21Cip1/WAF1 upregulates the Nrf2-mediated antioxidant response.Molecular cell. 2009 Jun26;34(6):663–73 Bellezza I, Giambanco I, Minelli A, Donato R (2018) Nrf2-Keap1 signaling in oxidative and reductive stress. Biochimica et Biophysica Acta (BBA)-Molecular Cell Research. May 1;1865(5):721-33 Saha S, Buttari B, Panieri E, Profumo E, Saso L (2020 Jan) An Overview of Nrf2 Signaling Pathway and Its Role in Inflammation. Molecules 25(22):5474 Carlson J, Price L, Deng H Nrf2 and the Nrf2-Interacting Network in Respiratory Inflammation and Diseases. InNrf2 and its Modulation in Inflammation 2020 (pp.51–76).Springer, Cham Yang M, Lin X, Rowe A, Rognes T, Eide L, Bjørås M Transcriptome analysis of human OXR1 depleted cells reveals its role in regulating the p53 signaling pathway.Scientific reports. 2015 Nov30;5(1):1–2 Priyadarsini KI, Khopde SM, Kumar SS, Mohan H Free radical studies of ellagic acid, a natural phenolic antioxidant.Journal of agricultural and food chemistry. 2002 Mar27;50(7):2200–6 Yu M, Gouvinhas I, Rocha J, Barros AI (2021) Phytochemical and antioxidant analysis of medicinal and food plants towards bioactive food and pharmaceutical resources. Scientific reports. May 11;11(1):1-4 Hou HH, Cheng SL, Liu HT, Yang FZ, Wang HC, Yu CJ (2013) Elastase induced lung epithelial cell apoptosis and emphysema through placenta growth factor. Cell Death Dis 4(9):e793 Kim YS, Zerin T, Song HY (2013) Antioxidant action of ellagic acid ameliorates paraquat-induced A549 cytotoxicity. Biological and Pharmaceutical Bulletin 36(4):609–615 Pandey KC, De S, Mishra PK Role of proteases in chronic obstructive pulmonary disease.Frontiers in pharmacology. 2017 Aug8;8:512 Hou HH, Cheng SL, Liu HT, Yang FZ, Wang HC, Yu CJ (2013 Sep) Elastase induced lung epithelial cell apoptosis and emphysema through placenta growth factor. Cell Death Dis 4(9):e793 Antunes MA, Rocco PR (2011 Dec) Elastase-induced pulmonary emphysema: insights from experimental models. Anais da Academia Brasileira de Ciencias 83(4):1385–1396 Park HS, Kim SR, Lee YC (2009 Jan) Impact of oxidative stress on lung diseases. Respirology 14(1):27–38 Biswas S, Hwang W, Kirkham JA, Rahman P (2013) I. Pharmacological and dietary antioxidant therapies for chronic obstructive pulmonary disease. Current medicinal chemistry. Jun 1;20(12):1496-530 Elliott NA, Volkert MR Stress induction and mitochondrial localization of Oxr1 proteins in yeast and humans. Molecular and cellular biology.2004 Apr15;24(8):3180–7 Tu W, Wang H, Li S, Liu Q, Sha H (2019 Jun) The anti-inflammatory and anti-oxidant mechanisms of the Keap1/Nrf2/ARE signaling pathway in chronic diseases. Aging and disease 10(3):637 Domej W, Oettl K, Renner W (2014) Oxidative stress and free radicals in COPD–implications and relevance for treatment. Int J Chronic Obstr Pulm Dis 9:1207 Ríos JL, Giner RM, Marín M, Recio MC (2018 Oct) A pharmacological update of ellagic acid. Planta Med 84(15):1068–1093 Ding Y, Zhang B, Zhou K, Chen M, Wang M, Jia Y, Song Y, Li Y, Wen A Dietary ellagic acid improves oxidant-induced endothelial dysfunction and atherosclerosis: role of Nrf2 activation. International journal of cardiology. 2014 Aug 20;175(3):508-14 Cornélio Favarin D, Martins Teixeira M, Lemos de Andrade E, de Freitas Alves C, Lazo Chica JE, Artério Sorgi C, Faccioli LH, Paula Rogerio A (2013) Anti-inflammatory effects of ellagic acid on acute lung injury induced by acid in mice. Mediators of inflammation. ;2013 Rozentsvit A, Vinokur K, Samuel S, Li Y, Gerdes AM, Carrillo-Sepulveda MA (2017) Ellagic acid reduces high glucose-induced vascular oxidative stress through ERK1/2/NOX4 signaling pathway. Cell Physiol Biochem 44(3):1174–1187 Li TM, Chen GW, Su CC, Lin JG, Yeh CC, Cheng KC, Chung JG (2005) Ellagic acid induced p53/p21 expression, G1 arrest and apoptosis in human bladder cancer T24 cells. Anticancer Research. Mar 1;25(2A):971-9 Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Major Revisions Needed 08 Apr, 2022 Reviews received at journal 05 Feb, 2022 Reviewers invited by journal 31 Jan, 2022 Editor assigned by journal 12 Jan, 2022 First submitted to journal 04 Jan, 2022 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-1229337","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":80435242,"identity":"08599ca6-81f9-453b-89b8-7cd5c3bf5a84","order_by":0,"name":"Vahid Bayati","email":"","orcid":"","institution":"Ahvaz Jundishapur University of Medical Sciences: Ahvaz Jondishapour University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Vahid","middleName":"","lastName":"Bayati","suffix":""},{"id":80435243,"identity":"ab4d2789-f602-4c29-8e80-958726cf5e04","order_by":1,"name":"Maryam Radan","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA50lEQVRIiWNgGAWjYHACAwTzAwNDAmlaGGeQrIWZhxgt5u2HN34uYNgmbz4j+elm2za7PH72BsYPH3Nwa5E5k1YsPYPhtuGcG2lmt3Pbkoslew4wS87chluLBEOOgTQPw23GGRIJIC3MiRtuJLAx8+LTwv/G+DdQi/0MifRvty3b6onQIpFjBrIlcQaQcZux7TAxWp6VWfMY3E6ewfOm7GbPueOJM3sONuP3C3/y5ts8FbdtZ7Cnb7vxo6w6sZ+9+eCHj3i0QAAoagQSgHHJBuIxNhBSDwX8B4DEHyIVj4JRMApGwYgCAOcBUYOV9SARAAAAAElFTkSuQmCC","orcid":"","institution":"Ahvaz Jundishapur University of Medical Sciences: Ahvaz Jondishapour University of Medical Sciences","correspondingAuthor":true,"prefix":"","firstName":"Maryam","middleName":"","lastName":"Radan","suffix":""},{"id":80435244,"identity":"1319b10c-7130-4f26-a671-c436a4601087","order_by":2,"name":"Mahin Dianat","email":"","orcid":"","institution":"Ahvaz Jundishapur University of Medical Sciences: Ahvaz Jondishapour University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Mahin","middleName":"","lastName":"Dianat","suffix":""},{"id":80435245,"identity":"adec9b24-f9d9-4413-af1e-9410657662d7","order_by":3,"name":"Zahra Mansouri","email":"","orcid":"","institution":"Ahvaz Jundishapur University of Medical Sciences: Ahvaz Jondishapour University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Zahra","middleName":"","lastName":"Mansouri","suffix":""},{"id":80435246,"identity":"dd01163b-9e7b-4ba1-9ec4-155f5d11d1e6","order_by":4,"name":"Farzaneh Souhrabi","email":"","orcid":"","institution":"Ahvaz Jundishapur University of Medical Sciences: Ahvaz Jondishapour University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Farzaneh","middleName":"","lastName":"Souhrabi","suffix":""}],"badges":[],"createdAt":"2022-01-04 18:33:54","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-1229337/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-1229337/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":17913432,"identity":"79db1364-809a-4240-9f8f-597cdbbc7db3","added_by":"auto","created_at":"2022-02-03 18:03:40","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":28220,"visible":true,"origin":"","legend":"\u003cp\u003eChemical structure of Ellagic acid, C\u003csub\u003e14\u003c/sub\u003eH\u003csub\u003e6\u003c/sub\u003eO\u003csub\u003e8\u003c/sub\u003e.\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"fig1.png","url":"https://assets-eu.researchsquare.com/files/rs-1229337/v1/da381b1cd2928aa521901cd0.png"},{"id":17913511,"identity":"19b99d15-b363-466b-b109-c240145b750c","added_by":"auto","created_at":"2022-02-03 18:09:40","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":235237,"visible":true,"origin":"","legend":"\u003cp\u003eCell viability assessment using Microscope images (A) and MTT assay (B) in all groups including: Negative control, Positive control (H2O2), Elastase 15 (Elastase 15 mU/ml), Elastase 30 (Elastase 30 mU/ml), Elastase 60 (Elastase 60 mU/ml), EL 15+EA (Elastase 15 mU/ml+Ellagic acid 10 μmol/L), EL 30+EA (Elastase 30 mU/ml+Ellagic acid 10 μmol/L), EL 60+EA (Elastase 60 mU/ml+Ellagic acid 10 μmol/L) and EA (Ellagic acid group: 10 μmol/L). Data are expressed as the mean ± SEM. Images were recorded at ×20 magnification [scale bar = 0.1 mm]. **\u003cem\u003eP\u003c/em\u003e\u0026nbsp;\u0026lt;\u0026nbsp;0.01 compared with Control group, \u003csup\u003e#\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e\u0026nbsp;\u0026lt;\u0026nbsp;0.05 compared with H2O2 group and \u003csup\u003e\u0026amp;\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e\u0026nbsp;\u0026lt;\u0026nbsp;0.05 and \u003csup\u003e\u0026amp;\u003cem\u003e\u0026amp;\u003c/em\u003e\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e\u0026nbsp;\u0026lt;\u0026nbsp;0.01 compared to Elastase group.\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"fig2.png","url":"https://assets-eu.researchsquare.com/files/rs-1229337/v1/2fe67200f19b153c1f9e44a9.png"},{"id":17913500,"identity":"9d8111fd-c872-483c-aa16-d105f10efaed","added_by":"auto","created_at":"2022-02-03 18:06:40","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":245599,"visible":true,"origin":"","legend":"\u003cp\u003eFlow-cytometric measurement of Reactive oxygen species (ROS) (A) and Malondialdehyde (MDA) measurement (B)in all groups including:Negative control, Positive control (H2O2), Elastase 15 (Elastase 15 mU/ml), Elastase 30 (Elastase 30 mU/ml), Elastase 60 (Elastase 60 mU/ml), EL 15+EA (Elastase 15 mU/ml+Ellagic acid 10 μmol/L), EL 30+EA (Elastase 30 mU/ml+Ellagic acid 10 μmol/L), EL 60+EA (Elastase 60 mU/ml+Ellagic acid 10 μmol/L) and EA (Ellagic acid group: 10 μmol/L). Data are expressed as the mean ± SEM. **\u003cem\u003eP\u003c/em\u003e\u0026nbsp;\u0026lt;\u0026nbsp;0.01 compared with Control group, \u003csup\u003e#\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e\u0026nbsp;\u0026lt;\u0026nbsp;0.05 and \u003csup\u003e##\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e\u0026nbsp;\u0026lt;\u0026nbsp;0.01 compared with H2O2 group and \u003csup\u003e\u0026amp;\u0026amp;\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e\u0026nbsp;\u0026lt;\u0026nbsp;0.01 and \u003csup\u003e\u0026amp;\u003cem\u003e\u0026amp;\u0026amp;\u003c/em\u003e\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e\u0026nbsp;\u0026lt;\u0026nbsp;0.001 compared to Elastase group.\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"fig3.png","url":"https://assets-eu.researchsquare.com/files/rs-1229337/v1/7d9b575598096ea8970f4d5f.png"},{"id":17913435,"identity":"108aabbc-2a27-4d8b-a8d5-730d4017e570","added_by":"auto","created_at":"2022-02-03 18:03:40","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":136229,"visible":true,"origin":"","legend":"\u003cp\u003eThe activities of Superoxide dismutase (SOD) (A) andGlutathione peroxidase (GPx) (B), and Glutathione (GSH) (C) and Total antioxidant capacity (TAC) (D) concentrationin all groups including:Negative control, Positive control (H2O2), Elastase 15 (Elastase 15 mU/ml), Elastase 30 (Elastase 30 mU/ml), Elastase 60 (Elastase 60 mU/ml), EL 15+EA (Elastase 15 mU/ml+Ellagic acid 10 μmol/L), EL 30+EA (Elastase 30 mU/ml+Ellagic acid 10 μmol/L), EL 60+EA (Elastase 60 mU/ml+Ellagic acid 10 μmol/L) and EA (Ellagic acid group: 10 μmol/L). Data are expressed as the mean ± SEM. *\u003cem\u003eP\u003c/em\u003e\u0026nbsp;\u0026lt;\u0026nbsp;0.05 compared with Control group, \u003csup\u003e#\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e\u0026nbsp;\u0026lt;\u0026nbsp;0.05, \u003csup\u003e##\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e\u0026nbsp;\u0026lt;\u0026nbsp;0.01 and \u003csup\u003e###\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e\u0026nbsp;\u0026lt;\u0026nbsp;0.001 compared with H2O2 group and \u003csup\u003e\u0026amp;\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e\u0026nbsp;\u0026lt;\u0026nbsp;0.05 and \u003csup\u003e\u0026amp;\u003cem\u003e\u0026amp;\u003c/em\u003e\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e\u0026nbsp;\u0026lt;\u0026nbsp;0.01 compared to Elastase group.\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"fig4.png","url":"https://assets-eu.researchsquare.com/files/rs-1229337/v1/2545a4dc0857929e4103f239.png"},{"id":17913271,"identity":"b6cf741b-9fb7-410c-a11c-7ed8b96ee420","added_by":"auto","created_at":"2022-02-03 18:00:40","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":43827,"visible":true,"origin":"","legend":"\u003cp\u003eLevels of ROS/RNS in all groups including: Negative control, Positive control (H2O2), Elastase 15 (Elastase 15 mU/ml), Elastase 30 (Elastase 30 mU/ml), Elastase 60 (Elastase 60 mU/ml), EL 15+EA (Elastase 15 mU/ml+Ellagic acid 10 μmol/L), EL 30+EA (Elastase 30 mU/ml+Ellagic acid 10 μmol/L), EL 60+EA (Elastase 60 mU/ml+Ellagic acid 10 μmol/L) and EA (Ellagic acid group: 10 μmol/L). Data are expressed as the mean ± SEM. ***\u003cem\u003eP\u003c/em\u003e\u0026nbsp;\u0026lt;\u0026nbsp;0.001 compared with Control group, \u003csup\u003e###\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e\u0026nbsp;\u0026lt;\u0026nbsp;0.001 compared with H2O2 group and \u003csup\u003e\u0026amp;\u0026amp;\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e\u0026nbsp;\u0026lt;\u0026nbsp;0.01 and \u003csup\u003e\u0026amp;\u0026amp;\u003cem\u003e\u0026amp;\u003c/em\u003e\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e\u0026nbsp;\u0026lt;\u0026nbsp;0.001 compared to Elastase group.\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"fig5.png","url":"https://assets-eu.researchsquare.com/files/rs-1229337/v1/47eb3f63f592dbcd5d85f33b.png"},{"id":17913276,"identity":"e014f797-41e2-4d4f-86c8-9819687786f1","added_by":"auto","created_at":"2022-02-03 18:00:40","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":207395,"visible":true,"origin":"","legend":"\u003cp\u003eThe gene expression levels of Oxidation Resistance 1 (OXR1), Cyclin dependent kinase inhibitor 1 (P21), Nuclear factor erythroid 2-related factor 2 (Nrf2), Heme Oxygenase 1 (HO1), and NAD(P)H: quinone oxidoreductase-1 (NQO1) in all groups including:Negative control, Positive control (H2O2), Elastase 15 (Elastase 15 mU/ml), Elastase 30 (Elastase 30 mU/ml), Elastase 60 (Elastase 60 mU/ml), EL 15+EA (Elastase 15 mU/ml+Ellagic acid 10 μmol/L), EL 30+EA (Elastase 30 mU/ml+Ellagic acid 10 μmol/L), EL 60+EA (Elastase 60 mU/ml+Ellagic acid 10 μmol/L) and EA (Ellagic acid group: 10 μmol/L). Data are expressed as the mean ± SEM. *\u003cem\u003eP\u003c/em\u003e\u0026nbsp;\u0026lt;\u0026nbsp;0.05 compared with Control group,\u003csup\u003e #\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e\u0026nbsp;\u0026lt;\u0026nbsp;0.05, \u003csup\u003e##\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e\u0026nbsp;\u0026lt;\u0026nbsp;0.01 and \u0026nbsp;\u003csup\u003e###\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e\u0026nbsp;\u0026lt;\u0026nbsp;0.001 compared with H2O2 group and \u003csup\u003e\u0026amp;\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e\u0026nbsp;\u0026lt;\u0026nbsp;0.05 and \u003csup\u003e\u0026amp;\u003cem\u003e\u0026amp;\u003c/em\u003e\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e\u0026nbsp;\u0026lt;\u0026nbsp;0.01 compared to Elastase group.\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"fig6.png","url":"https://assets-eu.researchsquare.com/files/rs-1229337/v1/aba081a8045bae536c45f97f.png"},{"id":17913512,"identity":"ea6b044e-23ed-4671-8aec-5b306c5a24ed","added_by":"auto","created_at":"2022-02-03 18:09:43","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":575611,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-1229337/v1/0097abce-1d7a-44ef-bd46-99ffa038e126.pdf"}],"financialInterests":"","formattedTitle":"\u003cp\u003eOXR1 Signaling Pathway as a Possible Mechanism of Elastase-Induced Oxidative Damage in Pulmonary Cells: The Protective Role of Ellagic Acid\u003c/p\u003e","fulltext":[{"header":"Introduction","content":"\u003cp\u003eSeveral cellular processes, including cell metabolism, signal transduction, and regulatory pathways, cell proliferation, and programmed cell death is affected by oxidative stress. Enhanced free radicals cause changes in the structure and function of main biological molecules in the body, such as proteins, lipids, and nucleic acids, which ultimately lead to tissue damage (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e). The free radicals tend to react with other molecules due to their unbounded electrons and act as electron acceptors and oxidizing agents. The most important oxidants are reactive oxygen species (ROS), nitrogen (RNS), active species chloride, and sulfur. One of the most important oxidants that damage cells in the body are reactive oxygen species, which also plays an important role in the production of other active species, such as active nitrogen species. The endogenous sources of free radicals include mitochondria, peroxisomes, inflammatory cells, Flavin, and external sources include environmental pollution, cigarette smoke, and chemical compounds (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e). The most common way to measure free radicals and oxidative stress is to determine the biomarkers generation from the reaction of free radicals with biological molecules in tissue, serum, and cell extract (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe body's cells have resistance mechanisms against oxidative stress. These systems include Catalase (CAT), Superoxide dismutase (SOD), Glutathione peroxidase (GPx), and Glutathione (GSH) (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e). The eukaryotic oxidation resistance gene1 (OXR1) is a key regulatory factor that protects against free radicals (\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e) and was first identified during the study in the year 2000 as a gene capable of coping with oxidative stress caused by Escherichia coli (\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e). The OXR1 acts as an oxidative stress sensor in the cell and regulates the transcription network of genes required to detoxify oxygen free radicals and modulates the cell cycle and apoptosis process. The OXR1 factor is present in the genomes of all eukaryotes, including worms, insects, and mammals (\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e). However, a specific mechanism of the protective function of this gene in other oxidative stress damage is not known. The cyclin-dependent kinase inhibitor 1A (P21) and Nuclear factor (Erythroid-derived 2)-like 2 (Nrf2) proteins play an important role in controlling the level of free radicals in the body by regulating the antioxidant system (\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e). Under physiological conditions, factor Nrf2 is negatively regulated by Kelch-like ECH-associated protein 1 (Keap1) in low amounts in the cytoplasm. P21 activates and stabilizes the Nrf2 protein by competing with Keap1 (\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e). Activation of Nrf2 leads to increased expression of genes responsible for regulating the antioxidant system such as Heme oxygenase-1 (HO-1), NADH quinone oxidoreductase 1 (NQO1), and Glutamate-Cysteine Ligase (GCL) (\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e). Decreased Nrf2 protein is known as the first direct link between lowering the level of the antioxidant defense system and damage caused by oxidative stress in the lungs (\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e). On the other hand, a study has shown that OXR1 plays a key role in regulating the expression of the P21 gene as an important factor in the activation of Nrf2 protein (\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eNatural antioxidants are the pivotal body's defense mechanism against oxidants that play an important role in maintaining redox status, eliminating reactive species, and balancing oxidation-reduction reactions in vital organs. Ellagic acid (C\u003csub\u003e14\u003c/sub\u003eH\u003csub\u003e6\u003c/sub\u003eO\u003csub\u003e8\u003c/sub\u003e) is a natural polyphenolic compound that has a wide range of pharmaceutical and industrial applications. This molecule has shown various including anti-mutagenic, anti-oxidant, and anti-inflammatory properties (\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e). The in vitro test system of the human lung epithelial cell line (A549) is applied as a model for inducing oxidative modification using H2O2 as a well-known oxidant comparison with Elastase. The identified response to oxidative stress will be considered as a molecular damage mechanism leading to pulmonary diseases.\u003c/p\u003e \u003cp\u003eAccording to the above documents, the aim of this study was to investigate the possible changes in the oxidative stress signaling axis in pulmonary epithelial cells exposed to Elastase. Moreover, the protective role of Ellagic acid as a natural antioxidant agent in improving Elastase-induced oxidative stress will be evaluated.\u003c/p\u003e"},{"header":"Material And Method","content":"\u003cdiv class=\"Section2\" id=\"Sec3\"\u003e\n \u003ch2\u003eCell treatments and preparation of cell lysates\u003c/h2\u003e\n \u003cp\u003eThe Human pulmonary epithelial cell line (A549) was obtained from the Pasteur Institute of Iran (IPI). The grouping was as follows:\u003c/p\u003e\n \u003cul\u003e\n \u003cli\u003e\n \u003cp\u003eNegative control group: 100 \u0026micro;M PBS.\u003c/p\u003e\n \u003c/li\u003e\n \u003cli\u003e\n \u003cp\u003ePositive control group: 100 \u0026micro;M H2O2 (well-known oxidant).\u003c/p\u003e\n \u003c/li\u003e\n \u003cli\u003e\n \u003cp\u003eElastase group: 15 mU/ml for 24 hours.\u003c/p\u003e\n \u003c/li\u003e\n \u003cli\u003e\n \u003cp\u003eElastase group: 30 mU/ml for 24 hours.\u003c/p\u003e\n \u003c/li\u003e\n \u003cli\u003e\n \u003cp\u003eElastase group: 60 mU/ml for 24 hours (\u003cspan class=\"CitationRef\"\u003e15\u003c/span\u003e).\u003c/p\u003e\n \u003c/li\u003e\n \u003cli\u003e\n \u003cp\u003eEllagic acid group: 10 \u0026micro;mol/L for 24 hours (\u003cspan class=\"CitationRef\"\u003e16\u003c/span\u003e).\u003c/p\u003e\n \u003c/li\u003e\n \u003cli\u003e\n \u003cp\u003eElastase+Ellagic acid group: 15 mU/ml+Ellagic acid 10 \u0026micro;mol/L for 24 hours.\u003c/p\u003e\n \u003c/li\u003e\n \u003cli\u003e\n \u003cp\u003eElastase+Ellagic acid group: 30 mU/ml+Ellagic acid 10 \u0026micro;mol/L for 24 hours.\u003c/p\u003e\n \u003c/li\u003e\n \u003cli\u003e\n \u003cp\u003eElastase+Ellagic acid group: 60 mU/ml+Ellagic acid 10 \u0026micro;mol/L for 24 hours.\u003c/p\u003e\n \u003c/li\u003e\n \u003c/ul\u003e\n \u003cp\u003eBriefly, the cells cultured and exposed to 100 \u0026micro;M H2O2 (Sigma-Aldrich Co, USA) for 24 h in DMEM medium (Gibco-BRL, Germany) and at standard cultivation conditions (37\u0026deg;C in the presence of 5% CO2). For the experiment groups, the A549 cells were treated with various concentration of Elastase (15, 30, and 60 mU/ml) with or without 10 \u0026micro;mol/L Ellagic acid (Sigma-Aldrich Co, USA) for 24 h to observe its effect in comparison with H2O2 to induce oxidative stress which brings any change in the macromolecules. Then, the culture supernatant of all groups was collected, stored and cell lysate was prepared in order to biochemical measurements.\u003c/p\u003e\n \u003ch2\u003eCytotoxicity assay\u003c/h2\u003e\n\u003c/div\u003e\n\u003cp\u003eIn order to evaluate the cell viability using colorimetric MTT assay, all cell groups seeded in 24-well plates and treated with various concentrations of Elastase in FBS-free media. After overnight incubation, the MTT solution (20 \u0026micro;l) was added and the cells were maintained for 4 h at 37\u0026deg;C. Then, SDS (10%) in acidified DMSO was added and the absorbance measured and the percent of cell viability in all groups were calculated in comparison to the controls.\u003c/p\u003e\n\u003ch2\u003eFlow-cytometric detection of reactive oxygen spices\u003c/h2\u003e\n\u003cp\u003eThe A549 cells incubated with 10 \u0026micro;M DCFH-DA as a ROS detector at 37\u0026deg;C for 30 min. subsequently, the cells were washed two times using a serum-free cell culture medium and detected via Flow cytometry.\u003c/p\u003e\n\u003ch2\u003eMeasurement of ROS/RNS level\u003c/h2\u003e\n\u003cp\u003eThe ROS levels in the supernatant fluid of A549 cells were quantified in all groups using \u003cem\u003eIn Vitro\u003c/em\u003e ROS/RNS assay Kit (Green Fluorescence; Cell Biolabs, USA). The assessments were performed three times and according to the instructions of the manufacturers.\u003c/p\u003e\n\u003ch2\u003eLipid peroxidation evaluation\u003c/h2\u003e\n\u003cp\u003eLipid peroxidation as an index of oxidative stress was assessed using the Malondialdehyde (MDA) commercial Kit (Zellbio GmbH, Deutschland) according to the manufacturer\u0026rsquo;s instructions.\u003c/p\u003e\n\u003ch2\u003eMeasurement of antioxidant capacity\u003c/h2\u003e\n\u003cp\u003eThe activity of SOD and GPx, and also the level of GSH and TAC was assessed using the special assay Kits (Zellbio GmbH, Deutschland) according to the manufacturer\u0026rsquo;s instructions.\u003c/p\u003e\n\u003ch2\u003eDetermination of Protein\u003c/h2\u003e\n\u003cp\u003eProtein concentration was determined according to the Lowry method via commercial assay Kit (Bio-Rad, USA). Bovine serum albumin (BSA) was applied as the standard.\u003c/p\u003e\n\u003ch2 id=\"isPasted\"\u003eOxidative stress signaling\u003c/h2\u003e\n\u003cp\u003eThe real time-PCR was used to evaluate the effects of Elastase and Ellagic acid on the expression of OXR1, P21, Nrf2, HO1, and NAD (P)H: quinone oxidoreductase-1 (NQO1) genes expression in human lung epithelial cells. The cell lysates were separated and immediately frozen in liquid nitrogen and stored at -80\u0026deg;C until assessment. The RNA extraction in cell lysates was performed using an extraction kit (RNeasy Plus Mini Kit). The cDNA synthesis step was then performed using a kit (Quantitect Reverse Transcriptase). Finally, 1 \u0026micro;l of cDNA and a proportional amount of each of the reciprocating primers and 10 \u0026micro;l of a real-Time Master mix plus a proportionate volume of RNase free water in a mixture were prepared and the real-time PCR reaction was performed. Subsequently, the expression of each of the mentioned genes in comparison with Glyceride aldehyde 3-phosphate dehydrogenase (GAPDH) as the control gene was measured by Real-Time PCR. Then, the values were calculated by the comparative Ct (threshold cycle) method. The sequences of the forward and reverse primers of the considered genes are as follows:\u003c/p\u003e\n\u003cdiv class=\"gridtable\"\u003e\u003ctable border=\"1\" id=\"Tab1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003ePrimer sequences for Real-Time PCR.\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eGenes\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eBackward\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eOXR1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTTATGGTACTGGAGAGACCTTTGTTTT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAAAACATATTATCTCCTGTCCACTTAAAGAC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNrf2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGGTTTCTTCGGCTACGTTTC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCCTCCCAAACTTGCTCAATG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eP21\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTGGAGACTCTCAGGGTCGAAA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGGCGTTTGGAGTGGTAGAAATC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHO1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eATGACACCAAGGACCAGAGC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGTGTAAGGACCCATCGGAGA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNQO1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eATGTATGACAAAGGACCCTTCC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTCCCTTGCAGAGAGTACATGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGAPDH\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGCTCACTGTTCTCTCCCTC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGAGGTCAATGAAGGGGTCAT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec11\"\u003e\n \u003ch2\u003eStatistical analysis\u003c/h2\u003e\n \u003cp\u003eResults of the current study were analyzed using the SPSS software and the normality of data was assessed using Kolmogorov\u0026ndash;Smirnov test. All data were expressed as Mean\u0026plusmn;SEM. Differences between experimental groups were analyzed by ANOVA and followed by post hoc Tukey\u0026apos;s test. Finally, the \u003cem\u003ep\u003c/em\u003e value ˂0.05 was considered significant statistically.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Results","content":"\u003ch3\u003eCell viability measurement\u003c/h3\u003e\n\u003cp\u003eThe viability of the human pulmonary epithelial cells, as evaluated by MTT assay, significantly decreased following exposure to H2O2 in comparison with control cells. Exposure to Elastase for 24 hours also decreased the viability. However, statistical analysis just in the highest concentration of Elastase (60 mU/ml) showed significant differences in comparison with H2O2 exposure cells. Once the A549 cells were treated with Ellagic acid, Elastase-induced cell toxicity was remarkably diminished. These results documented the protective properties of Ellagic acid against oxidative damage (Figure. 2).\u003c/p\u003e\n\u003ch3\u003eReactive oxygen species (ROS) detection\u003c/h3\u003e\n\u003cp\u003eThe DCFH-DA as a ROS detector probe was used to evaluate the influence of Elastase on cellular free radical production. As shown in Figure. 3A, the flow cytometric assessment demonstrated significant increases in the H2O2 group in comparison with control cells. Exposure to Elastase showed a dose-dependent enhancement in the ROS level in A549 cells compare to the H2O2 which these data suggests the cytotoxic and oxidative effects of Elastase on pulmonary epithelial cells. Although the ROS production level was lower in the Ellagic acid treatment group compared to the Elastase cells.\u003c/p\u003e\n\u003ch3\u003eAssessment of the oxidative stress profile\u003c/h3\u003e\n\u003cp\u003eThe reactive oxygen species can react with cell membrane lipids which lead to lipid peroxidation. Accordingly, MDA as a well-known biomarker of oxidative stress damage was considered in the current study. The MDA level significantly increased in the H2O2 group in comparison with the control. Elastase exposure also showed enhancement in MDA level in all concentrations compare to the H2O2 cells with the highest value in 60 mU/ml (Figure. 3B). On the other hand, the antioxidant profile demonstrated significant increases in response to H2O2 compare with the control group. Cells incubation with Elastase for 24 hours leads to diminishing in antioxidant capacity which showed by decreases in activity of SOD (Figure. 4A), GPx (Figure. 4B), and also GSH (Figure. 4C)and TAC(Figure. 4D)levels in a dose-dependent manner. Conversely, Ellagic acid at a concentration of 10 \u0026mu;mol/L showed MDA diminishes and increases in SOD, GPx activity, and GSH, TAC levels which suggest the potent antioxidant properties of this natural antioxidant.\u003c/p\u003e\n\u003ch3\u003eDetermination of ROS/RNS level\u003c/h3\u003e\n\u003cp\u003eTo confirm the oxidative stress in exposure to Elastase, the level of reactive metabolites was determined in all cell groups. As shown in Figure. 5 a significant increase in ROS/RNS level detected in the H2O2 group demonstrated the excessive oxidative stress to damage the cell components. A higher level of ROS/RNS showed in Elastase groups as well, with the highest significance in 60 mU/ml concentration. Co-treatment with Ellagic acid significantly diminished the level of ROS/RNS in dose depended manner which suggested the protective effect of Ellagic acid to relief the oxidative damage to the cells.\u003c/p\u003e\n\u003ch3\u003eExpression levels of antioxidant genes in A549 cells\u003c/h3\u003e\n\u003cp\u003eFollowing exposure to H2O2 as a well-known oxidant agent the gene expression level of antioxidant key regulators including OXR1, P21, Nrf2, HO1, and NQO1 significantly increased in comparison with the control group. In the Elastase exposure group, as the Elastase concentration increased the gene expression of OXR1, P21, Nrf2, HO1, and NQO1 gradually diminished in comparison with the H2O2 group. Treatment with Ellagic acid demonstrated the increases in antioxidant key regulator genes after 24 hours (Figure. 6).\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eReactive oxygen spices play a critical role in the death and survival of diseases. Previous in vivo studies have documented that excessive endogenous Elastase causes pulmonary emphysema through inflammation and oxidative stress (\u003cspan additionalcitationids=\"CR18\" citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e). In this regard, current in vitro study identified the oxidative stress signaling pathway of Elastase to induce cell injuries in pulmonary epithelial cells. The results of the present study showed that Elastase decreased the gene expression of OXR1, P21, Nrf2, HO1, and NQO1 in a concentration-dependent manner which was associated with decreases in antioxidant enzymes activity and content.\u003c/p\u003e \u003cp\u003eReactive oxygen spices (ROS) and other non-radical oxygen derivatives, as by-products of metabolism, are constantly generated in biological systems and cause damage to DNA, proteins, and lipids (\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e). The biological antioxidant defense system effectively neutralized oxidative stress by preventing free radicals-mediated organ damage (\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eOXR1 is identifying as a key regulator in resistance against the pathology of diseases which discovered first as an essential factor for inhibition of oxidative stress damage in eukaryotes organs 20 years ago (\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e). A study by Volkert et al. in 2000 reported that OXR1 depletion in \u003cem\u003eSaccharomyces cerevisiae\u003c/em\u003e enhanced sensitivity to H2O2injuries (\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eNuclear factor (erythroid-derived 2)-like 2 (Nrf2) and cyclin-dependent kinase inhibitor 1A (P21) known as crucial factors for regulating ROS levels by controlling downstream antioxidant enzymes. Indeed, subsequently to oxidative stress, Nrf2 activation leads to upregulation of several antioxidant genes, including the Heme oxygenase-1 (HO-1), and NADH quinone oxidoreductase 1 (NQO1) (\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e). According to a study by Yang et al. in 2014, the OXR1 gene through controlling the gene expression level of P21 (as an activator of Nrf2 protein) has a key role in the antioxidant defense system which supports the hypothesis that OXR1 protect against oxidative stress damage via P21-Nrf2-HO1-NQO1 dependent manner (\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e). In this context, the results of the current experiment demonstrated that Elastase exposure caused to decreases in the antioxidant defense system which was showed by the lower levels of SOD, CAT, GPx activity, and GSH content. The upstream regulator's genes evaluation also revealed the downregulation of OXR1-related genes which suggested the cytotoxicity effects of Elastase on lung epithelial cells through destruction of the antioxidant protection system.\u003c/p\u003e \u003cp\u003eOxidative stress process seems to be involved in the pathology of emphysema process (\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e). As expected, in the current study the data showed a significant increase in oxidative stress biomarkers including reactive oxygen and nitrogen species (ROS/RNS) content and Malondialdehyde in response to Elastase exposure. Accordingly, it seems to antioxidant management can be considered in preventing and controlling of this destructive process. In recent years, there is a growing focus on natural antioxidants, with remarkable cytoprotective properties against cell injuries induced by oxidative stress. Ellagic acid is a polyphenolic compound found in green tea and other natural sources such as pomegranate, strawberry, raspberry, and eucalyptus bark. Ellagic acid has potent antioxidant and anti-apoptotic properties that can inhibit or prevent cellular oxidation. Ellagic acid reduces oxidative stress by scavenging free radicals and increases the antioxidant enzymes (\u003cspan additionalcitationids=\"CR26\" citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e). Treatment with 10 \u0026micro;mol/L Ellagic acid for 24 hours demonstrated the inhibition effects against oxidative stress induced by Elastase which showed by increases in OXR1-P21-Nrf2-HO1-NQO1 genes expression and antioxidant factors including SOD, GPx, GSH and TAC. These data suggest the potent antioxidant properties of this natural antioxidant.\u003c/p\u003e \u003cp\u003eIn this regard, Rozentsvit et al. in the experimental study on the antioxidant effects of Ellagic acid, reported that Ellagic acid significantly diminishes free radical levels and attenuates the impairment of oxidative stress induced by high glucose medium (\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e). Another in vitro study by Te-Mao et al. on human bladder cancer cells showed that Ellagic acid causes to cell cycle arrest and apoptosis through P53/P21 genes expression-depended mechanism (\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e). These reported data are in line with the results of the current study on the positive antioxidant properties of Ellagic acid against Elastase-induced oxidative damage.\u003c/p\u003e \u003cp\u003eIn conclusion, the present findings can highlight the novel mechanism underlying the oxidative stress induces by Elastase through OXR1 and related genes. Moreover, the benefit of Ellagic acid on cytoprotection, resulting from its antioxidant properties was documented. However, further molecular and cellular studies on the cytoprotective activity of Ellagic acid are necessary.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis Research study was done in the Cellular and Molecular Research Center, Basic Sciences Research Institute at Ahvaz Jundishapur University of Medical Sciences in Ahvaz, Iran. The authors gratefully acknowledge the help and financial support of the Cellular and Molecular Research Center, Ahvaz Jundishapur University of Medical Sciences [Grant No. CMRC-9813].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding disclosures\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors received funding from the Cellular and Molecular Research Center, Medical Basic Sciences Research Institute, Ahvaz Jundishapur University of Medical Sciences [Grant No. APRC-9813].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026apos; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors contributed equally to this manuscript. We further confirm that the manuscript has been read and approved by all named authors.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics declarations\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe confirm that any aspects of this work were approved by the Ethics Committee of Ahvaz Jundishapur University of Medical Sciences (IR.AJUMS. REC.1398.717).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe know of no conflicts of interest with this publication.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eSchieber M, Chandel NS ROS function in redox signaling and oxidative stress.Current biology. 2014 May19;24(10):R453-62\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDomej W, Oettl K, Renner W (2014) Oxidative stress and free radicals in COPD\u0026ndash;implications and relevance for treatment. Int J Chronic Obstr Pulm Dis 9:1207\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMarrocco I, Altieri F, Peluso I (2017 Jan) Measurement and clinical significance of biomarkers of oxidative stress in humans. Oxidative medicine and cellular longevity. 1;2017.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSharma P, Jha AB, Dubey RS, Pessarakli M (2012) Reactive oxygen species, oxidative damage, and antioxidative defense mechanism in plants under stressful conditions. Journal of botany. ;2012\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang M, Luna L, S\u0026oslash;rb\u0026oslash; JG, Alseth I, Johansen RF, Backe PH, Danbolt NC, Eide L, Bj\u0026oslash;r\u0026aring;s M (2014 Dec) Human OXR1 maintains mitochondrial DNA integrity and counteracts hydrogen peroxide-induced oxidative stress by regulating antioxidant pathways involving p21. Free Radic Biol Med 77(1):41\u0026ndash;48\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVolkert MR, Elliott NA, Housman DE (2000) Functional genomics reveals a family of eukaryotic oxidation protection genes. Proceedings of the National Academy of Sciences. Dec 19;97(26):14530-5\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOliver PL, Finelli MJ, Edwards B, Bitoun E, Butts DL, Becker EB, Cheeseman MT, Davies B, Davies KE (2011 Oct) Oxr1 is essential for protection against oxidative stress-induced neurodegeneration. PLoS Genet 20;7((10):e1002338\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen W, Sun Z, Wang XJ, Jiang T, Huang Z, Fang D, Zhang DD Direct interaction between Nrf2 and p21Cip1/WAF1 upregulates the Nrf2-mediated antioxidant response.Molecular cell. 2009 Jun26;34(6):663\u0026ndash;73\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBellezza I, Giambanco I, Minelli A, Donato R (2018) Nrf2-Keap1 signaling in oxidative and reductive stress. Biochimica et Biophysica Acta (BBA)-Molecular Cell Research. May 1;1865(5):721-33\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSaha S, Buttari B, Panieri E, Profumo E, Saso L (2020 Jan) An Overview of Nrf2 Signaling Pathway and Its Role in Inflammation. Molecules 25(22):5474\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCarlson J, Price L, Deng H Nrf2 and the Nrf2-Interacting Network in Respiratory Inflammation and Diseases. InNrf2 and its Modulation in Inflammation 2020 (pp.51\u0026ndash;76).Springer, Cham\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang M, Lin X, Rowe A, Rognes T, Eide L, Bj\u0026oslash;r\u0026aring;s M Transcriptome analysis of human OXR1 depleted cells reveals its role in regulating the p53 signaling pathway.Scientific reports. 2015 Nov30;5(1):1\u0026ndash;2\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePriyadarsini KI, Khopde SM, Kumar SS, Mohan H Free radical studies of ellagic acid, a natural phenolic antioxidant.Journal of agricultural and food chemistry. 2002 Mar27;50(7):2200\u0026ndash;6\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYu M, Gouvinhas I, Rocha J, Barros AI (2021) Phytochemical and antioxidant analysis of medicinal and food plants towards bioactive food and pharmaceutical resources. Scientific reports. May 11;11(1):1-4\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHou HH, Cheng SL, Liu HT, Yang FZ, Wang HC, Yu CJ (2013) Elastase induced lung epithelial cell apoptosis and emphysema through placenta growth factor. Cell Death Dis 4(9):e793\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim YS, Zerin T, Song HY (2013) Antioxidant action of ellagic acid ameliorates paraquat-induced A549 cytotoxicity. Biological and Pharmaceutical Bulletin 36(4):609\u0026ndash;615\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePandey KC, De S, Mishra PK Role of proteases in chronic obstructive pulmonary disease.Frontiers in pharmacology. 2017 Aug8;8:512\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHou HH, Cheng SL, Liu HT, Yang FZ, Wang HC, Yu CJ (2013 Sep) Elastase induced lung epithelial cell apoptosis and emphysema through placenta growth factor. Cell Death Dis 4(9):e793\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAntunes MA, Rocco PR (2011 Dec) Elastase-induced pulmonary emphysema: insights from experimental models. Anais da Academia Brasileira de Ciencias 83(4):1385\u0026ndash;1396\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePark HS, Kim SR, Lee YC (2009 Jan) Impact of oxidative stress on lung diseases. Respirology 14(1):27\u0026ndash;38\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBiswas S, Hwang W, Kirkham JA, Rahman P (2013) I. Pharmacological and dietary antioxidant therapies for chronic obstructive pulmonary disease. Current medicinal chemistry. Jun 1;20(12):1496-530\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eElliott NA, Volkert MR Stress induction and mitochondrial localization of Oxr1 proteins in yeast and humans. Molecular and cellular biology.2004 Apr15;24(8):3180\u0026ndash;7\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTu W, Wang H, Li S, Liu Q, Sha H (2019 Jun) The anti-inflammatory and anti-oxidant mechanisms of the Keap1/Nrf2/ARE signaling pathway in chronic diseases. Aging and disease 10(3):637\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDomej W, Oettl K, Renner W (2014) Oxidative stress and free radicals in COPD\u0026ndash;implications and relevance for treatment. Int J Chronic Obstr Pulm Dis 9:1207\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eR\u0026iacute;os JL, Giner RM, Mar\u0026iacute;n M, Recio MC (2018 Oct) A pharmacological update of ellagic acid. Planta Med 84(15):1068\u0026ndash;1093\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDing Y, Zhang B, Zhou K, Chen M, Wang M, Jia Y, Song Y, Li Y, Wen A Dietary ellagic acid improves oxidant-induced endothelial dysfunction and atherosclerosis: role of Nrf2 activation. International journal of cardiology. 2014 Aug 20;175(3):508-14\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCorn\u0026eacute;lio Favarin D, Martins Teixeira M, Lemos de Andrade E, de Freitas Alves C, Lazo Chica JE, Art\u0026eacute;rio Sorgi C, Faccioli LH, Paula Rogerio A (2013) Anti-inflammatory effects of ellagic acid on acute lung injury induced by acid in mice. Mediators of inflammation. ;2013\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRozentsvit A, Vinokur K, Samuel S, Li Y, Gerdes AM, Carrillo-Sepulveda MA (2017) Ellagic acid reduces high glucose-induced vascular oxidative stress through ERK1/2/NOX4 signaling pathway. Cell Physiol Biochem 44(3):1174\u0026ndash;1187\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi TM, Chen GW, Su CC, Lin JG, Yeh CC, Cheng KC, Chung JG (2005) Ellagic acid induced p53/p21 expression, G1 arrest and apoptosis in human bladder cancer T24 cells. Anticancer Research. Mar 1;25(2A):971-9\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":true,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"molecular-biology-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mole","sideBox":"Learn more about [Molecular Biology Reports](https://www.springer.com/journal/11033)","snPcode":"11033","submissionUrl":"https://submission.nature.com/new-submission/11033/3","title":"Molecular Biology Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Elastase, Lung Epithelial Cell, H2O2, Oxidative Stress, OXR1, Ellagic Acid","lastPublishedDoi":"10.21203/rs.3.rs-1229337/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-1229337/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground and objective:\u003c/strong\u003e Oxidative stress is a process that occurs through free radicals on the cell membranes which causes damage to the cell and intracellular organelles especially mitochondria membranes. H2O2 induced oxidative stress in human cells is of interest in toxicological research since oxidative stress plays a main role in the etiology of several pathological conditions. Neutrophil Elastase (Serine proteinase) is involved in the pathology process of emphysema as a respiratory disease through lung inflammation, and destruction of alveolar walls. The present study investigated the direct oxidative stress effects of Elastase in comparison with H2O2 on human lung epithelial cells (A549 cells) in relation to the generation of reactive oxygen species (ROS) and modulation of oxidation resistance 1 (OXR1) and its downstream pathway using the well-known antioxidant Ellagic acid as an activator of antioxidant genes. \u003c/p\u003e\u003cp\u003e\u003cstrong\u003eMaterials and methods:\u003c/strong\u003e The human pulmonary epithelial cells (A549) were divided into the 9 groups including: Negative control, Positive control (H2O2), Elastase (15, 30, and 60 mU/ml), Ellagic acid (10 μmol/L), and Elastase+Ellagic acid. Cytotoxicity, reactive oxygen spices generation, oxidative stress profile, level of reactive metabolites, and gene expression of OXR1 and its downstream genes were measured in all groups. \u003c/p\u003e\u003cp\u003e\u003cstrong\u003eResults:\u003c/strong\u003e The obtained data demonstrated that Elastase exposure caused to oxidative stress damage in a dose-depended manner which was associated with decreases in antioxidant defense system genes. Conversely, treatment with Ellagic acid as a potent antioxidant showed improved antioxidant enzyme activity and content which was in line with the upregulation of OXR1 signaling pathway genes. \u003c/p\u003e\u003cp\u003e\u003cstrong\u003eConclusions:\u003c/strong\u003e The present findings can highlight the novel mechanism underlying the oxidative stress induces by Neutrophil Elastase through OXR1 and related genes. Moreover, the benefit of Ellagic acid on cytoprotection, resulting from its antioxidant properties was documented.\u003c/p\u003e","manuscriptTitle":"OXR1 Signaling Pathway as a Possible Mechanism of Elastase-Induced Oxidative Damage in Pulmonary Cells: The Protective Role of Ellagic Acid","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2022-02-03 18:00:38","doi":"10.21203/rs.3.rs-1229337/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Major Revisions Needed","date":"2022-04-08T04:50:42+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2022-02-05T14:05:25+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2022-01-31T12:48:18+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2022-01-12T15:38:52+00:00","index":"","fulltext":""},{"type":"submitted","content":"Molecular Biology Reports","date":"2022-01-04T13:33:37+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"molecular-biology-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mole","sideBox":"Learn more about [Molecular Biology Reports](https://www.springer.com/journal/11033)","snPcode":"11033","submissionUrl":"https://submission.nature.com/new-submission/11033/3","title":"Molecular Biology Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"1bba90dc-4033-4cc9-ba35-5e4e3ca50ec0","owner":[],"postedDate":"February 3rd, 2022","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2022-04-30T07:51:52+00:00","versionOfRecord":[],"versionCreatedAt":"2022-02-03 18:00:38","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-1229337","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-1229337","identity":"rs-1229337","version":["v1"]},"buildId":"J0_U0BvcaRcwD8yVFaRlm","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. The paper's references may be in our DB but unresolved to ``paper_id`` (resolution happens at ingest when the cited DOI matches a row we already have). Run the cross-source citation reconcile pass to retry.

Source provenance

europepmc
last seen: 2026-05-19T01:45:01.086888+00:00
unpaywall
last seen: 2026-05-26T02:00:01.498150+00:00
License: CC-BY-4.0