Taf1 expression in mouse: novel transcripts and protein distribution

Taf1 expression in mouse: novel transcripts and protein distribution | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results Taf1 expression in mouse: novel transcripts and protein distribution View ORCID Profile Peihang Li , View ORCID Profile Karen Cleverley , View ORCID Profile Elisa M. Crombie , View ORCID Profile Jan Bieschke , View ORCID Profile Elizabeth M.C. Fisher , View ORCID Profile Anna-Leigh Brown doi: https://doi.org/10.1101/2025.09.08.674157 Peihang Li 1 Department of Neuromuscular Diseases and Queen Square Motor Neuron Disease Centre, UCL Queen Square Institute of Neurology, University College London , London WC1N 3BG, UK Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Peihang Li Karen Cleverley 1 Department of Neuromuscular Diseases and Queen Square Motor Neuron Disease Centre, UCL Queen Square Institute of Neurology, University College London , London WC1N 3BG, UK Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Karen Cleverley Elisa M. Crombie 1 Department of Neuromuscular Diseases and Queen Square Motor Neuron Disease Centre, UCL Queen Square Institute of Neurology, University College London , London WC1N 3BG, UK 2 LifeArc, Francis Crick Institute , 1 Midland Road, London NW1 1AT, UK Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Elisa M. Crombie Jan Bieschke 3 Institute of Prion Diseases, MRC Prion Unit at UCL, University College London , London W1W 7FF, UK Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Jan Bieschke Elizabeth M.C. Fisher 1 Department of Neuromuscular Diseases and Queen Square Motor Neuron Disease Centre, UCL Queen Square Institute of Neurology, University College London , London WC1N 3BG, UK Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Elizabeth M.C. Fisher For correspondence: elizabeth.fisher{at}ucl.ac.uk anna-leigh.brown{at}ucl.ac.uk Anna-Leigh Brown 1 Department of Neuromuscular Diseases and Queen Square Motor Neuron Disease Centre, UCL Queen Square Institute of Neurology, University College London , London WC1N 3BG, UK Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Anna-Leigh Brown For correspondence: elizabeth.fisher{at}ucl.ac.uk anna-leigh.brown{at}ucl.ac.uk Abstract Full Text Info/History Metrics Data/Code Preview PDF Abstract TATA-box binding protein associated factor 1 (TAF1) is the largest component of transcription factor IID (TFIID), a fundamental multiprotein complex for RNA polymerase II-mediated transcription. TAF1 is essential for promoter recognition, coactivator interaction, and normal development. Mutations in TAF1 cause developmental disorders and the lethal neurodegenerative disease X-linked dystonia-Parkinsonism (XDP). Our previous work suggested that this ∼170 kb gene has a more complex set of transcripts than currently catalogued. We therefore undertook a systematic assessment of Taf1 transcription in mouse, given its widespread use as a model organism and its high genetic homology with humans. Using targeted nanopore sequencing, we reveal extensive transcriptional diversity and differential abundance of Taf1 mRNAs across brain and body regions. We identify 19 novel transcript variants and multiple novel exons, and we predicted their protein domain architectures and modelled them using AlphaFold. Notably, we observed elevated RNA and protein expression in cerebellum compared to other brain regions. These findings substantially expand the transcriptional landscape of Taf1 and provide crucial insights to guide investigation of transcript-specific mechanisms in neurodevelopmental and neurodegenerative disorders, enabling the creation of more accurate disease models. Download figure Open in new tab Introduction The TATA box binding-protein (TBP)-associated factor 1 gene ( TAF1 ) is fundamental for the initiation of RNA polymerase II (pol II)-dependent transcription 1 . TAF1 lies on the X chromosome and encodes a ∼250 kDa protein that is the largest constituent and key scaffold protein of the TFIID complex, a basal transcription factor for all polymerase II-mediated transcription in eukaryotes 2 – 4 . TAF1 has many functions involving protein-protein interactions 3 , 5 , 6 and has DNA binding activity 4 , 7 , 8 . For example: the N-terminal domain of TAF1 binds TBP to inhibit DNA binding in its non-promoter bound state 9 – 11 ; TAF1 has a specific TAF7-binding domain, and within this region a small winged-helix domain binds promoter DNA 12 ; a zinc finger domain in TAF1 is involved in recruiting TFIID to endogenous promoters 13 . Furthermore, near the C-terminal of TAF1 lies a double bromodomain that recognises post-translational modifications – including acetylation, butyrylation, crotonylation – on histones and transcription factors 14 – 16 . Thus, through its diverse protein-domains, TAF1 plays an essential role in the regulation of transcription. TAF1 is required for embryonic development 17 – 19 ; female and male null mice die before E9.5 20 . Postnatally, gene editing and knockdown of Taf1 in rat and mouse result in behavioural and neuronal deficits 21 – 23 . In humans, mutations in TAF1 primarily affect males and missense and frameshift mutations cause the congenital disorder X-linked syndromic mental retardation−33 (MRXS33, X-linked intellectual disability, XLID), which presents with heterogeneous clinical features including facial dysmorphologies and cardiac defects 1 , 18 , 24 – 27 . In contrast, the adult-onset progressive neurodegenerative disorder XDP typically starts with dystonia (male mean age of onset 39 years of age) that generalises over 5-10 years then transitions into Parkinsonism, with a mean age of death of 56 years of age 28 – 30 . XDP arises from the insertion of a ∼2.6 kb SINE-VNTR-Alu (SVA) type F retroposon, into intron 32 of TAF1 . This SVA carries between 30-55 CCCTCT repeats in its 5′ region and the number of these hexameric repeats is inversely correlated with the age of XDP onset 28 , 29 . The SVA insertion has a profound effect on transcription, producing aberrant mRNA variants; excision of the SVA in XDP iPSCs rescues TAF1 expression, intron retention and aberrant splicing 28 , 31 . While it remains unknown how altered splicing leads to neurodegeneration, XDP is not thought to arise from a simple loss-of-function 28 , 29 , 32 . Full knowledge of mRNA transcripts and protein isoforms within different cell types/life stages is essential for understanding gene function in health and disease. In writing a recent review of TAF1 1 we realised that considerably more remains to be discovered about TAF1 mRNA variants. The TAF1 gene spans >166 kb on Xq13.1, and more than 38 exons have been annotated in NCBI GenBank/Ensembl. However, in humans at least, clearly more variants exist than have been described so far. For example, Capponi and colleagues amplified human prefrontal cortex cDNA between exons 30 to 38 only and sequenced the ten most abundant products, finding previously unreported exons and transcripts 33 . Alternative splicing (AS) is a feature of 95% of human pre-mRNAs from multi-exon genes, resulting in variants with different UTRs, retained introns, skiptic exons, cryptic exons, mutually exclusive exons, and alternative polyadenylation sites. This process leads to immense transcriptional complexity for each cell type 34 , with highest splicing diversity seen in the central nervous system 35 , 36 , perhaps reflecting the massive variety of cell types in this tissue 37 . Humans average >8 mRNA variants per protein coding gene 38 ; AS is highly species specific and this average is likely lower in mice 37 , 39 . To comprehend the biology of each gene, it is essential to understand the role each mRNA transcript/protein isoform plays in an individual cell type, noting that proteins from a single gene can play opposing roles to control specific pathways. For example, depending on the mRNA transcript, the BCL2L1 gene can encode either a pro- or anti-apoptotic protein isoform 40 . Furthermore, individual protein isoforms have their own independent interactomes 38 . Thus, we need a systematic classification of TAF1 protein-coding transcripts, spatially and temporally. With the advent of long-read sequencing it is becoming easier – although still not straightforward – to define the transcriptional complexity of a single gene 41 . Challenges include the high error rates of sequencing reads, and, for example, the difficulty in detecting microexons (exons <30 bp) 36 within mRNAs/cDNAs of several kb. Using the mouse, a key model for human disease, we catalogued Taf1 transcripts across male and female brain and non-brain tissues from young adults. By amplifying long cDNAs between the Taf1 5′ and 3′ UTRs and sequencing them with nanopore technology, we developed a bioinformatics pipeline for analysing novel transcripts and predicting protein structures, discovered new exons and mRNA transcripts, evaluated their expression patterns across tissues, and identified inconsistencies in existing annotations that warrant further experimental validation. This work builds on our previous description of mouse Taf1 transcripts 1 , adding semi-quantitative data, including the unexpected finding of particularly high transcript and protein abundance in the cerebellum. Together, these results contribute to a more complete understanding of TAF1 and highlight the complexity of this essential gene/protein that has multiple functions. Results Generation of mouse Taf1 cDNAs from brain and non-brain tissues and long-read nanopore sequencing While the TAF1 gene is ubiquitously expressed, TAF1 mutations show selective tissue pathology; notably, XDP is reported to primarily affect the striatum, and congenital TAF1 mutations affect the heart and other tissues. Therefore, to assess tissue-specific splicing patterns, we collected RNA from multiple brain (striatum, cerebellum, hippocampus, cortex) and body (heart, spleen, quadricep muscle) regions of 3-month-old (young adult) male and female C57BL/6J mice, n=2 per sex ( Supplementary Table S1 ). We created cDNA by reverse transcribing from oligo-dT primers, then amplified the product between PCR primers that bound to the 5′ UTR and 3′ UTR at chrX:100.576.386 and chrX:100.643.185, respectively ( Figure 1A ). Amplification between these primers gives a product of 5,856 bp based on GenBank Taf1 ‘mouse canonical transcript’ (NM_001405959.2). Long-read nanopore sequencing generated a total of 2 million reads, with an average of 72,411 reads per tissue and average read length of 4,700 bp, mean read quality was 20 – representing a base call accuracy of 99% ( Supplementary Table S2 ) View this table: View inline View popup Download powerpoint Supplementary Table S1. C57BL/6J Mouse Biological Samples View this table: View inline View popup Download powerpoint Supplementary Table S2. Summary statistics of sequencing Download figure Open in new tab Figure 1. Sequencing strategy and bioinformatics pipeline for identifying and quantifying Taf1 transcripts using long-read sequencing ( A ) RNA was extracted from brain and body tissues and used for cDNA synthesis from oligo-dT primers. cDNA was amplified by PCR using primers designed to the 5′ and 3′ UTRs based on mouse genome assembly GRCm39. ( B ) Long-read nanopore sequencing of PCR products generated data that were aligned to GRCm39 via minimap2. Alignments were filtered with samtools and visualized in IGV to verify primer specificity and exon-intron structures. Misaligned reads, particularly those indicating the potential presence of microexon 34′ (6 bp), were corrected using MisER. Transcript analysis was conducted using Swish to assess differential transcript usage (DTU) and differential transcript expression (DTE) across specific tissue regions. Protein domain prediction was performed through IsoformSwitchAnalyzeR, integrating open reading frame (ORF) predictions and PFAM domain annotations. Protein structure prediction employed IUPred2A. PTC: premature termination codon. Targeted long-read analyses reveal novel Taf1 transcripts in brain and non-brain tissues To comprehensively analyse Taf1 transcript expression, long-read sequencing data were aligned to GRCm39 using minimap2. Given the challenge of aligning microexons with minimap2, noting the 6 bp microexon 34′ within Taf1 , MiSER was incorporated to improve mapping accuracy for microexons. Following alignment, IsoQuant was employed for transcript assembly and then assembled transcripts across samples were merged using StringTie2. Transcripts that appeared in multiple samples were kept for downstream analyses and expression quantification. After assembling a single set of known and novel Taf1 transcripts, Oarfish was used for transcript quantification and Swish for DTU and DTE. Further functional interpretation, including ORF and protein domain prediction, was performed using IsoformSwitchAnalyzeR ( Figure 1B ). This integrated pipeline enabled robust identification and quantification of annotated and novel Taf1 transcripts, tissue specific expression, and prediction of their protein-coding consequences and domain architectures. Ensembl currently shows three full-length Taf1 mRNA variants ( Taf1 -201, Taf1 -205, Taf1 -207), while GenBank lists five (Variants 1-5) 1 . These variants primarily differ in whether: exon 5 is full-length or shortened by 63 bp at its 5′ end; the presence of the 6 bp microexon, 34′, which is observed exclusively in the neuronal form of Taf1 (n- Taf1 ); an interruption within exon 38, noted only in GenBank Variants 4 and 5. This exon 38 interruption likely results from an amino acid sequencing or alignment artefact, as it lacks support from genomic DNA sequencing. Curiously, it is not clear where the TAF1 / Taf1 ORF begins. For example, Ensembl annotates two human mRNA variants, TAF1 -204 (c TAF1 , NM_004606.5, GenBank ‘Variant 1’) and TAF1 -228, which have identical DNA sequences. However, TAF1 -228 possesses a predicted start codon (ATG, methionine) 60 bp (20 amino acids) upstream of the predicted start ATG in TAF1 -204. Currently, there is no experimental evidence from human, mouse, or other species to confirm which of these potential start ATGs is used in vivo . The downstream ATG (as found in TAF1 -204) is associated with a more favourable Kozak sequence 42 , 43 , which typically enhances translational efficiency. Mouse Taf1 transcripts similarly contain two potential N-terminal start codons, separated by 60 bp (20 amino acids), and it remains unclear if one or both are active. Our 5′ primer was designed to terminate 19 nucleotides upstream of the first annotated start codon, and so all novel transcript sequences identified in this study encompass both potential start codons. Across the tissues we analysed, four known Taf1 transcripts were expressed in at least two tissue types, three maintaining the ORF (GenBank reference ‘canonical’ transcript cTaf1 , nTaf1, Taf1-207 ) and one (Taf1-20 4, Figure 2 ) is predicted to result in nonsense-mediated decay (NMD). Download figure Open in new tab Figure 2. Intron-exon structures of novel and known Taf1 transcripts The top panel (yellow) depicts 19 novel Taf1 transcripts identified through our analysis of mouse brain and body regions. Exons are represented as boxes, with exons differing from the canonical GenBank reference transcript (c Taf1 , NM_001045959.2) highlighted in red. Alternative exons repeatedly identified across multiple transcripts are color-coded by the boxes at the start of the line: truncated exon 5 (grey), neuron-specific microexon 34′ (brown), novel long exon 34′′ (yellow), and novel short exon 34′′ (purple). Variants marked with a red star maintain an intact ORF without premature termination codons (PTCs), indicating potential functional, full-length transcripts. Red vertical bars indicate positions of stop codons at the end of the ORFs in the full-length transcripts. The lower panel (green) shows four known Taf1 transcripts in GenBank/Ensembl databases. Transcript n Taf1 (NM_001290792.3) incorporates microexon 34′, Taf1 -207 (ENSMUST00000209949.1) contains truncated exon 5, and Taf1 -204 (ENSMUST00000143908.8) is likely subject to NMD. ‘ MSTRG ’ is a transcript identifier assigned by StringTie software during transcript assembly. Supplementary Table S5 shows the length of the novel exons. View this table: View inline View popup Download powerpoint Supplementary Table S3. Antibodies Antibodies used for immunofluorescent staining (IF) and western blots (WB). Dilutions are described in Materials and Methods View this table: View inline View popup Download powerpoint Supplementary Table S4. Coding region similarity: novel vs c Taf1 (%) View this table: View inline View popup Download powerpoint Supplementary Table S5: Length of novel coding exons Beyond the known transcripts in Ensembl/GenBank, we identified 19 novel Taf1 transcripts ( Figure 2 ). Six of these novel transcripts ( MSTRG.1.1, 1.3, 1.7, 1.8, 1.11, 1.14 ) contain an ORF extending from exon 1 to exon 38. Exon 38 is the most 3′ exon identified in our analysis and includes the 3′ UTR. MSTRG.1.1, 1.3, 1.7, 1.8, and 1.14 comprise 39 or 40 exons, resulting in predicted protein translations between 1,890 and 1,952 amino acids. These translations exhibit high sequence similarity (96.1% to 97.7%) to the canonical cTAF1 protein. In contrast, MSTRG.1.11 features an ORF from exon 1 to exon 38 but skips exons 3 through 11, leading to a shorter predicted translation of 1,358 amino acids. Two novel transcripts ( MSTRG.1.17, MSTRG.1.19 ) have markedly few internal exons and an upstream stop codon in a truncated exon 38 giving rise to a shorter ORF. While these transcripts use an upstream stop codon from cTaf1 , they are not predicted to undergo NMD. Percentage similarities of MSTRG.1.11, 1.17 and 1.19 to cTaf1 are shown in Supplementary Table S4 . Alternative exons incorporated into the new eight likely coding variants include truncated versions of exons 4, 5, 6, microexon 34′ (6 bp) and a long or short form of a new exon, 34′′. In addition to skipping internal exons, transcript MSTRG.1.11 has a 3′ truncation of exon 2 and a 5′ truncation of exon 12. Thus, we have identified both short (42 bp) and long (120 bp) forms of exon 4, short (179 bp) and long forms (242 bp) of exon 5 – all of which maintain the ORF, and found a new exon, 34’′, which also has short (105 bp) and long (172bp) forms but only the short form maintains the ORF. Based on their sequences, novel mRNA transcripts MSTRG.1.4, MSTRG.1.5, MSTRG.1.12 and MSTRG.1.13 are predicted to undergo NMD. Mouse Taf1 splicing transcripts and abundance vary across tissues To investigate the tissue-specific expression pattern of Taf1 transcripts, we calculated DTU and DTE using the R package Swish. DTU reflects shifts in transcript proportions within a region, whereas DTE indicates differences in the absolute expression levels of individual transcripts 44 . In Figure 3 we show Taf1 transcript abundance in seven tissues in female and male mice. We went on to compare DTU and DTE between specific tissues, for example, cerebellum values versus the three other brain regions as well as with combined body/brain regions; only significant differential expression is shown ( Figure 4 ). In this analysis we did not find significant sex differences. Download figure Open in new tab Figure 3 DTU and DTE for Taf1 The top DTU panel illustrates transcript abundance (red gradient), quantified from normalized Oxford Nanopore Technology (ONT) transcript reads, for both annotated and novel Taf1 transcripts across seven distinct tissues (striatum, cerebellum, hippocampus, cortex, heart, muscle, and spleen) in male and female mice. The bottom DTE panel presents transcript fractions (blue gradient), indicating the proportional representation of each transcript within these tissues. Red stars denote transcripts that maintain ORFs. Download figure Open in new tab Figure 4. Lollipop plots of significant DTU (red) and DTE (blue) data across selected tissue comparisons ( A ) Transcript-level comparisons between the cerebellum and brain regions (cortex, hippocampus, and striatum). ( B ) Heart tissue compared with brain regions. ( C ) Muscle tissue compared with brain regions. ( D ) Spleen tissue compared with brain regions. Log2 fold changes are presented along with corresponding q-values, indicated by colour gradient intensity. Asterisks indicate significance: **q < 0.01, *q < 0.05, •q < 0.1. Full length real transcripts (red star). Surprisingly, we found that cerebellum had the highest overall expression of Taf1 mRNA as well as transcript diversity in the brain regions (9 out of 19 novel transcripts detected had expression levels of 0.5 to 5.5 DTE fold change, therefore we chose to use this region as the baseline tissue for additional transcript analyses). For the four known Taf1 transcripts, we confirmed that nTaf1 (NM_001290792.3) is neuronally enriched ( Figure 3A ; B) and furthermore, is enriched in the cerebellum compared to the other brain regions, as shown by significant DTU differences in hippocampus and striatum (q-value < 0.05) and significant DTE differences in cortex, hippocampus, and striatum (q-value < 0.01) ( Figure 4A ). Both Taf1-207 and cTaf1 , lacking exon 34′, are the major protein-coding transcripts in body regions ( Figure 3 ; Figure 4 ). However, Taf1-207, which has a truncated exon 5, not cTaf1 , is the most abundant protein coding variant in the body regions ( Figure 3 ; Figure 4 ). The known NMD-inducing transcript, Taf1-204, shows lower expression in the cerebellum with significantly higher usage observed in the striatum (DTU, q-value < 0.05; Figure 4A ). Among the 19 novel Taf1 transcripts, MSTRG.1.1 and MSTRG.1.2 have brain-specific expression when compared to heart, muscle, and spleen, with highly significant DTU and DTE values in brain compared to peripheral body regions (q-value < 0.01; Figure 4B-D ). Of the novel transcripts, MSTRG.1.1 has the highest expression across most tissues ( Figure 3 ). Six novel transcripts ( MSTRG.1.1 , 1.2 , 1.3 , 1.5 , 1.8 , 1.15 ) have markedly high expression in the cerebellum relative to the other brain regions, showing log2 fold changes ranging from ∼1.5 to >5.5, all with highly significant DTE (q-values < 0.01). Three of these six transcripts ( MSTRG.1.1 , MSTRG.1.3 , and MSTRG.1.8 ) are full-length and predicted to encode functional TAF1 proteins. Intriguingly we find microexon 34′ is present in eight transcripts: nTaf1 , MSTRG.1.1, 1.2, 1.3, 1.5, 1.9, 1.14, 1.16 only four of which likely produce full-length proteins ( nTaf1 , MSTRG.1.1, 1.3, 1.14 ). These transcripts tend to be expressed in brain rather than body tissues ( Figure 3 ; Figure 4 ). Mouse TAF1 protein expression is higher in cerebellum To assess TAF1 protein distribution in mouse brain, we performed western blotting with antibody TAF1 [177-4] raised to the epitope TPGPYTPQPPDLY, derived from peptides encoded by exons 34 and 35 of TAF1 / Taf1 ( Taf1 -201 and Taf1 -202) 45 ( Figure 5A ; Supplementary Table S3 ). At the resolution of our gels, this antibody detected a single TAF1 band of ∼250 kDa (we could not separate proteins with/without the possible 20 amino acids at the carboxy terminus). Reproducible results were obtained through multiple blots; a representative blot of 3-month-old male tissue is shown with quantification in Figure 5 (n=3). We analysed data from 6 males and 6 females, at 3-, 6-, and 12-months old, to assess changes over lifespan – noting our limited ability to detect different isoforms ( Supplementary Figure S1A ; S1B ). Download figure Open in new tab Figure S1: TAF1 protein expression in mouse brain Comparison of TAF1 protein expression in striatum, cerebellum, hippocampus and cortex in littermates at 3-months, 6-months and 12-months of age, n =3/brain region/sex). Error bars show mean ± standard deviation of the relative expression levels. Statistical analysis using one-way ANOVA was performed; p -values are indicated. The experiment was replicated three times or more. For each age and sex, representative blots are shown on the left, with a β-tubulin loading control. Data for each brain region are color-coded; striatum (black), cerebellum (pink), hippocampus (blue), cortex (purple). Significant differences between brain regions within the same sex and age group are indicated by asterisks, with statistical significance denoted as * p < 0.05, ** p < 0.01, and *** p < 0.001. Download figure Open in new tab Figure 5. Differential Expression of TAF1 in brain regions of 3-month-old male mice ( A ) Detection of TAF1 protein expression in striatum, cerebellum, hippocampus and cortex by western blot (n=3). Representative blot with β-tubulin used as a loading control. ( B ) Quantification of western blots (n=3), bar graphs represent the mean ± standard deviation (SD) of the relative expression levels. The data for each brain region are: striatum (black), cerebellum (pink), hippocampus (blue), and cortex (purple). Significant differences between brain regions are indicated by asterisks, with statistical significance denoted as * p < 0.05, ** p < 0.01. In line with our mRNA results, cerebellum consistently exhibited the highest levels of TAF1 protein across all ages and both sexes: expression was significantly elevated in 3-month-old males ( Figure 5A ; 5B) and 6-month-old male and female groups ( Supplementary Figure S1A ; S1B ) and peaked at almost three times the relative level compared to striatum. Cerebellum showed the most statistically significant differences compared to the other brain regions, particularly cerebellum and cortex, where the difference reached the highest statistical significance in 6-month-old males [F(3,8) 27 = 19.40, p = 0.0005] and 6-month-old females [F(3,7) = 5.20, p = 0.0324] ( Supplementary Figure S1A ; S1B ). TAF1 expression in the cerebellum was also markedly higher compared to striatum and hippocampus, particularly in 3-month-old males ( Figure 5A ; 5B ), where it was 3.6 times higher than in the striatum [F(3,8) = 7.80, p = 0.0203] and 3.8 times higher than in the hippocampus [F(3,8) = 7.80, p = 0.0089]. Interestingly, in 12-month-old males and females, the difference between the cerebellum and cortex was less pronounced ( Supplementary Figure S1A ; S1B ). The hippocampus also had relatively high TAF1 expression, especially in male mature adult mice (6 months of age). The difference between hippocampus and cortex was statistically significant, with TAF1 expression in hippocampus being ∼1.5 times higher than in cortex [F(3,8) = 19.40, p = 0.0014] ( Supplementary Figure S1A ; S1B ). However, in older adult mice (12 months), hippocampal TAF1 expression was much lower than in cerebellum and cortex, which contrasts with its expression trend in younger and mature mice. In contrast, the cortex and striatum showed relatively lower levels of TAF1 expression compared to cerebellum (less than 2-3 times lower) and hippocampus (less than 0.5-2 times lower), except in 12-month-old male mice. Interestingly, the striatum generally exhibited slightly higher TAF1 expression than the cortex, in all age groups of females and with statistical significance in 6-month-old males [F(3,8) = 19.40, p = 0.0055] ( Supplementary Figure S1A ; S1B ). To validate the significant relative TAF1 expression observed in the cerebellum compared to other brain regions, immunohistochemistry was conducted on the left hemisphere of 3-month-old male and female C57BL/6J mice (n=3/sex) ( Supplementary Figure S2 ); sagittal sections allowed the cerebellum to be visualized with other brain regions. DAPI staining identified nuclei, with immunofluorescent staining for TAF1 and DARPP-32 [H-3] – a marker of medium spiny neurons in the striatum ( Supplementary Table S3 ). This analysis verified that nuclear TAF1 protein expression was elevated in the cerebellum compared to hippocampus and striatum, as indicated by co-localization of DAPI with TAF1 ( Supplementary Figure S2A ; S2B ). We detected no significant differences between males and females. These immunohistochemistry findings align with the western blot data, confirming that TAF1 is highly expressed in the cerebellum, relative to other brain regions. Download figure Open in new tab Figure S2. TAF1 expression in female mouse brain Immunofluorescent staining of 3-month-old female C57BL/6J mice. (A) Sagittal brain sections, (B) sections of cerebellum and hippocampus. Sections are stained for TAF1 (red), DARPP-32 (green), and DAPI (blue), with the merged images showing the colocalization of these markers. White arrow indicates cerebellum. The experiment was repeated twice with reproducible results. This was not a quantitative experiment. Novel TAF1 isoforms may have different protein interactions We conducted protein domain prediction analysis for the novel transcripts predicted to maintain ORFs ( MSTRG.1.1, MSTRG.1.3, MSTRG.1.7, MSTRG.1.8, MSTRG.1.11, MSTRG.1.14, MSTRG.1.17, MSTRG.1.19 ). Using PFAM domain analysis, these novel Taf1 transcripts – except MSTRG.1.17 and MSTRG.1.19 – share conserved features with the canonical GenBank cTAF1 transcript (NM_001045959.2): two bromodomains; one TBP-binding domain; one zf-CCHC_6 zinc finger domain. The variations between MSTRG.1.1 and MSTRG.1.14 were primarily in the intrinsic disordered regions (IDRs) and IDRs with binding regions ( Figure 6A ). Both MSTRG.1.17 and MSTRG.1.19 lack bromodomains, DUF3591, and zinc finger domains, with MSTRG.1.19 additionally lacking an IDR binding region. Download figure Open in new tab Figure 6. TAF1 predicted protein domains ( A ) Predicted protein domains (using PFAM) for predicted ORFs within novel Taf1 transcripts (Bromodomains; Domain of Unknown Function, DUF3591; Intrinsic Disordered Region, IDR; Intrinsically Disordered Region with a binding region, IDRwdr; Tata-Box Protein binding domain, TBP; zinc finger domain, zf-CCHC_6). MSTRG.1.1 (light blue box) and MSTRG.1.4 (blue box) are highlighted, which were used for protein–protein interaction analysis shown in panel (B). ( B ) Complex of mouse TAF1 (amino acids 1-300, yellow), TBP (amino acids 141-320, green), TAF11 (amino acids 50-211, grey) and TAF13 (full length, orange) modelled in Alphafold 3. Regions deleted in TAF1.1 (light blue) and TAF1.14 (blue) both lie in an unstructured loop between the TAF1 N-terminal domain (TAND) and the putative interaction motif of TAF1 with TAF11 and TAF13. Dashed lines indicate putative interactions between TAF1 and TBP derived from chemical crosslinking 3 . We next sought to predict if any of these protein isoforms might affect TAF1 protein-protein interactions. Most predicted TAF1 isoforms varied in the C-terminal IDRs, which are notoriously difficult to model, and for which interaction partners are often unknown. We therefore focused on the variation in the N-terminus region of TAF1, for which protein structures of the putative protein complex between TAF1, TAF11, TAF13 and TBP are available 3 , 4 . Amongst these, known transcript Taf1-207 and novel transcript MSTRG.1.1 contain a truncated exon 5 and MSTRG.1.14 contains a truncated exon 4. These two exons code for amino acids that lie in the intrinsically disordered loop region between TAND and TAF11/13 interacting domains of TAF1 and would shorten the loop by either 23 amino acids (truncated exon 4, MSTRG.1.14 ) or 20 amino acids (truncated exon 5, Taf1-207 ; MSTRG.1.1 ; Figure 6B ) 47 . Discussion RNA splicing allows a single gene to produce numerous RNA transcripts and protein isoforms which can have profound effects on a protein’s interaction partners, localisation, and function. TAF1 is an essential protein for healthy development, and results in wide-ranging phenotypes when mutated. Little is known of its transcripts and protein isoforms, or its regulation. To characterise Taf1 gene expression in male and female adult mice we created long mRNA, reverse transcribed long cDNA from oligo-dT primers, amplified cDNA between 5′ and 3′ UTRs and then used nanopore sequencing to assess transcripts in mouse brain and non-brain tissues chosen for their relevance to TAF1 disease in humans. This provides us with a snapshot of the complexity of Taf1 expression, given that we are looking at one age (3-months old) and could not detect transcripts with alternative 5′ or 3′ UTRs or polyadenylation sites. Nevertheless, we have now identified 23 transcripts in mouse, of which only four are described in GenBank/Ensembl. Taf1 splicing presented a bioinformatic challenge because transcripts are predicted to be up to 5.9 kb and can include the neuronally-enriched microexon 34′ which is only 6 bp in length. Microexons shorter than 20 nucleotides are especially prone to being missed in standard long-read sequencing analyses without dedicated correction strategies 46 . In our analyses of Taf1 diversity, we aimed to both identify and accurately quantify differential transcript usage across tissues. Thus, we implemented a strategy that combined reference-guided transcript assembly with transcript-level quantification, using a tool specifically optimized for long-read data. This approach allowed us to capture subtle but biologically meaningful differences in transcript expression that might be missed by methods focusing solely on annotation or quantification alone. Several novel transcripts were identified with low expression levels, consistent with the general trend that novel mRNA variants exhibit lower expression compared to annotated transcripts 47 – 49 . We identified 19 novel mRNAs, of which eight are predicted to encode ORFs, two of these encode notably short proteins, which only contain the TBP-binding and IDR domains of the TAF1 protein. The other novel transcripts are predicted to undergo NMD and therefore are likely important for controlling TAF1 protein levels 50 . Of the four known variants, three maintain a full-length ORF and one, Taf1 -204, has a PTC. Overall, we have identified short and long forms of known and novel exons and found typical AS events such as intron skipping/retention, that indicate considerable complexity for Taf1 regulation and function. Our expression analysis of the 23 transcripts in 3-month-old mice showed notable differences in their tissue distribution, with some largely brain specific (for example, MSTRG.1.1 and nTaf1 - NM_001290792.3) whereas others appear present in all tissues (for example, Taf1 -204). The four mRNA variants previously described tended to be more abundant than the 19 novel variants. Overall, in the brain tissues, cerebellum was the site of highest Taf1 expression. This was a surprise as data from human brains affected by XDP indicate that striatum is the key site of pathology 51 – 53 . Intriguingly, the NMD-associated Taf1 -204 transcript showed highest abundance in the striatum relative to cerebellum, perhaps indicating a regional specific vulnerability for loss of function mutations as a potential pathogenic mechanism in XDP. Heart is consistently affected in congenital cases of human TAF1 mutation, and we note the relatively high expression of Taf1 -204 in this tissue as well. We analysed overall protein expression in mouse brain, and though currently available TAF1 antibodies do not allow us to distinguish protein isoforms, we determined that cerebellum showed consistently higher expression of TAF1 than other brain regions. This increased protein abundance was consistent across ages and sex in 3-, 6- and 12-month-old male and female mice. Some variation was apparent in expression levels in cortex, striatum, and hippocampus, but immunohistochemistry of male and female mouse brain at 3-months of age supported higher TAF1 expression in the cerebellum. Our results do not allow us to address cell type for AS, but such events and the resulting protein isoforms may be entirely cell-specific and related to key cellular functions 54 . We aligned Taf1 transcripts with known protein domains and determined that in novel transcripts MSTRG.1.1 and MSTRG.1.14 truncations in exons 4 and 5 both shorten the loop connecting TAND and TAF11/13 interacting domains of TAF1, possibly stopping interaction with TBP, TAF11 or TAF3 3 . There may be other interaction partners in the full TFIID complex, which could be affected by these deletions 4 . The shortened loop may reduce the conformational flexibility of TAF1 within TFIID and impair tethering of TBP by TAF1 in the absence of TAF11/13 binding. Furthermore, the deletions could interfere with a putative interaction between K168/K170 of TAF1 and K220/K310 (K243/K333 in human TBP) 3 , potentially altering TFIID function. In summary, we find considerably more complexity in transcription from the mouse Taf1 locus than previously reported. This includes transcripts that have full-length ORFs but different domain composition and those that likely regulate TAF1 levels through NMD. We confirm that microexon 34′, which lies within an IDR and is also present in human TAF1 , is present within approximately a third of our transcripts including nTaf1 and seven other transcripts. Of these eight transcripts, seven show significantly elevated expression in brain regions/nervous system-specific compared to body regions. The inclusion of microexons in mature mRNAs is frequent in the CNS and the encoded residues are often located on protein surfaces to regulate protein-protein interactions 36 . We note that many of the protein-coding predicted protein isoforms varied primarily in the length of the IDR region and that two of our protein-coding isoforms contained only the TBP-binding region and IDR domains. IDRs in transcription factors drive the formation of liquid-liquid phase separation necessary for transcriptional machinery assembly 55 , 56 and a disease associated repeat expansion in the IDR of the Taf1 binding partner TBP likely exerts its pathogenic mechanism through changing phase separation capacity 57 . IDRs have also been suggested to be crucial for determining transcription factor binding specificity 58 . Therefore, given the observed protein diversity in this region and neuronal specificity of a microexon in the Taf1 IDR, future work into how different Taf1 IDRs influence its transcriptional function and phase-separation capacity will be critical to understanding both its normal and pathogenic roles. To understand the function of individual genes it is essential to catalogue their RNA and protein outputs, spatially and temporally, ideally from each cell type, in healthy tissue. In addition, patterns of association between different exons and promoters can give new insight into gene function. AS can have a profound effect on gene/protein function for example, by altering stability, localisation and interactions 59 , 60 . Much remains to be experimentally determined about TAF1, a large and fundamentally important protein, including the roles of its multiple mRNA variants and protein isoforms. Materials and methods Mouse strain, welfare and husbandry Female and male C57BL/6J wild-type mice (from The Jackson Laboratory) were maintained in Specific Pathogen-Free (SPF) conditions, in individually ventilated cages; mice were kept in adherence to the Home Office Code of Practice and licensed by the Home Office under the Animals (Scientific Procedures) Act 1986 Amendment Regulations 2012 (SI 4 2012/3039), UK. All experiments had Institutional Ethical Review Committee approval. Mice had access to a mouse house with bedding material, wood chips, and continual access to water and RM1 (Special Diet Services) (stock animals) chow. Animals were euthanized at 3-months, 6-months and 12-months of age by exposure to rising carbon dioxide, followed by confirmation of death by dislocation of the neck, in accordance with the Animals (Scientific Procedures) Act 1986 (UK). Total RNA extraction and First-Strand cDNA synthesis Total RNA was extracted from 3-month-old mouse brain from four brain regions: cerebellum, cortex, hippocampus and striatum ( Supplementary Table S1 ) using the RNeasy Mini Kit (Qiagen). Total RNA was extracted from 3-month-old mouse spleen, heart and quadricep muscle ( Supplementary Table S1 ) using the RNeasy Fibrous Tissue Mini Kit (Qiagen); all tissue was homogenised on ice using a TissueRuptor II (QIAGEN) in Buffer RLT with 1% β-mercaptoethanol, following the manufacturer’s instructions for both kits. The final extracted RNA was eluted in DNase- and RNase-free water. RNA was quantified using a NanoDrop spectrophotometer followed by RNA Integrity Analysis. cDNA synthesis was carried out using Superscript™ IV First-Strand Synthesis System (11904-018; Thermo Fisher Scientific). 2 μg RNA was used as input for annealing of oligo-dT primers. Final clean-up was performed with 1 μL of RNase H. RNA integrity analysis A volume of 1μL of undiluted RNA from each sample was run on the Agilent 4200 TapeStation using RNA screen tape (Agilent, Santa Clara, CA, USA cat #5067-5576). The concentrations of the samples ranged from 92.1 ng/μL to 1368.0 ng/μL, samples of >500 ng/μL were diluted to fall within the quantitative range for the assay (25–500 ng/μL). RINe was recorded from the TapeStation 4200 and assigned to the sample automatically. A cut-off value of RINe 7.5 determined whether samples could then be used. Long-range PCR amplification of mouse Taf1 cDNA PCR was performed using LongAmp® Taq DNA Polymerase (New England Biolabs). Optimal annealing temperature was determined using a gradient thermocycler. Primers were designed and screened for specificity using NCBI’s Primer-BLAST. Primers annealled to non-coding regions (5′ and 3′ UTRs) flanking the longest common sequence of c Taf1 (GenBank (NM_001045959.2). 5′ UTR Forward primer sequence: AAGTCACCCGTGTGCGACTGACG, through to 3′ UTR Reverse primer sequence: AGCTGGGGGGAAAGGTAATAGACC. For each sample, duplicate PCRs were performed in 50 μL volumes with 0.1 mM of each primer. Thermocycling conditions were: initial denaturation step at 94 °C for 30 seconds, followed by 29 cycles of 94 °C for 30 seconds for denaturation, 61 °C for 30 seconds for annealing, and 65 °C for 12 min for extension. This was followed by a final extension at 65 °C for 10 min, and reactions were held at 4 °C indefinitely. The number of cycles was optimized at 29 to ensure adequate amplification of the target sequences while minimizing non-specific products. Following amplification, duplicate samples were pooled and the size of the RT-PCR product verified by agarose gel electrophoresis in 1x TAE buffer using SYBR Safe DNA stain for visualisation. The remaining PCR product (∼80 μL) was sent to Full Circle Laboratories and purified using 0.5x AMPure XP beads (Beckman Coulter, Fullerton, USA) before proceeding to library construction. Library preparation and nanopore sequencing Nanopore sequencing libraries were prepared and barcoded using the Native Barcoding Kit 96 V14 (SQK-NBD114.96). 4.15 μL of purified amplicon DNA was subjected to an end-prep reaction using the NEBNext Ultra II End Repair/dA-tailing Module (New England BioLabs, MA). End-prepped amplicons were taken forward to the native barcode ligation step; a total of 0.75 μL of end-prepped amplicons were mixed with 1.25 μL of native barcode, 5 μL of blunt/TA ligase master mix, and 3 μL H 2 O and then incubated at room temperature for 20 min. After incubation 2 μL of 0.25 M EDTA was added to each sample to stop the ligation reaction. The barcoded amplicons were pooled, and a 0.5x AMPure XP bead (Beckman Coulter, CA) purification was carried out with two subsequent 500 μL 80% ethanol washes. The barcoded library was eluted in 30 μL nuclease-free water, then subjected to ligation of the sequencing adapter; 10 μL of 5× NEBNext quick ligation reaction buffer, 5 μL ONT Adapter Mix II ( AMII ), and 5 μL Quick T4 DNA ligase were mixed with 30 μL of the barcoded library and then incubated at room temperature for 20 min. The library was purified using 0.4× AMPure XP beads with two subsequent 125 μL Long Fragment Buffer (LFB) washes and eluted in 30 μL EB buffer (ONT). The final library was quantified with the Qubit 1× dsDNA high-sensitivity assay kit (Invitrogen) and a Qubit 4 fluorometer (Invitrogen). Approximately 60 ng of the final library was loaded onto the FLO-PRO114M (R10.4.1) flow cell on an ONT PromethION 2 Solo platform for 10 h. Long-read cDNA-seq bioinformatics: alignment and microexon refinement Raw ONT sequencing reads in BAM files were aligned to the Mus musculus GRCm39 primary assembly reference genome using minimap2 (v2.17) with the spliced alignment preset, optimized for long-read transcriptomic data. To improve alignment accuracy for microexons, particularly Taf1 microexon 34′, alignments were refined using MisER. Resulting alignments in SAM format were converted to BAM and indexed by samtools (v1.15). For targeted inspection of the Taf1 locus, alignments were filtered for reads mapping specifically to chromosome X coordinates chrX:100576335-100644635 (GRCm39). Manual inspection of exon-intron architectures, primer binding sites, and candidate novel exons was conducted using the Integrative Genomics Viewer (IGV v2.18.4). Summary of sequence data: Supplementary Table 2. Long-read cDNA-seq bioinformatics: transcript identification and quantification Transcript identification was performed using IsoQuant (v3.2.0), optimized for transcript-level analysis of long-read sequencing data. IsoQuant was executed with the ONT sequencing data flag and configured to generate SQANTI-compatible outputs. Novel transcripts identified by IsoQuant were organized in sample-specific directories and merged across samples using StringTie2. The merged annotation in GTF format was converted to FASTA format using gffread for quantification. Long-read transcript quantification was performed using Oarfish (v0.9.0) with model coverage applied and no filters, employing the merged transcript reference FASTA file. All computational analyses were conducted within a dedicated, reproducible Conda environment. Transcript expression analysis Differential transcript usage and differential transcript expression were conducted using the R packages tximeta and Swish method (with fishpond v2.14.0). Transcript quantification files from Oarfish were imported into R using tximeta. For DTU and DTE, Swish, using scaling based on library size and effective transcript length, yielded log2-scaled counts for nonparametric differential analysis. Protein isolation and western blotting of mouse brain For protein isolation, one brain hemisphere was dissected in ice-cold PBS to isolate cerebellum, cortex, hippocampus and striatum ( Supplementary Table S1 ). All tissues were then snap frozen in liquid nitrogen. Samples were homogenised in ice-cold RIPA Lysis Buffer (Millipore) plus Protease Inhibitor Cocktail I (Millipore, MA, USA) by mechanical disruption using a TissueRuptor II (QIAGEN). Homogenates were shaken on ice at 70 rpm for 2 h at 4 °C, then centrifuged for 20 min at 15,000 g at 4°C. Supernatants were removed and stored at −80 °C until use. Total protein concentration was determined by Bradford assay using Protein Assay Dye Reagent (Bio-Rad, CA, USA). Equal amounts of total brain protein were denatured in LDS denaturing buffer (Thermo Fisher Scientific) and β-mercaptoethanol and incubated at 95°C for 5 min prior to separation by SDS-PAGE gel electrophoresis. Protein samples (40 μg) were loaded onto precast NuPAGE 7% Tris-Acetate gels (Thermo Fisher Scientific) and electrophoresed at 80 V for 4 h in an ice bath using NuPAGE Tris-Acetate Running Buffer (Thermo Fisher Scientific). Proteins were transferred to 0.2 μm nitrocellulose membranes using a Trans-Blot Turbo transfer system (Bio-Rad) High Molecular Weight Program at 1.3 A for 30 min. Membranes were stained for total protein with 0.1 % (w/v) Ponceau S in 1 % (v/v) acetic acid for 5 min prior to blocking for 1 h at room temperature in Intercept PBS Blocking Buffer (LI-COR Biosciences, NE, USA). Membranes were incubated overnight in primary antibodies diluted in Intercept PBS Blocking Buffer (LI-COR Biosciences) at 4 °C (TAF1 [177-4], 1:1000; β-tubulin, 1:10,000). Membranes were then washed three times for 10 min in PBS containing 0.05 % Tween-20 (PBS-T) and incubated for 1 h at room temperature with the relevant IRDye secondary antibody (LI-COR Biosciences) diluted in Intercept PBS Blocking Buffer. Finally, membranes were washed three times for 10 min in PBS-T and once for 10 min in PBS. Antibody binding was visualised using the Odyssey CLx Imaging System (LI-COR Biosciences) and ImageJ was used for band density analysis and total protein quantification. All antibodies used are described in Supplementary Table S3 . Reproducible results were obtained through multiple blots, and the experiment was repeated for samples that showed large variation in protein expression, which, following quantification, were excluded as outliers in the Grubb’s outliers test, but no samples were excluded from the analysis. No randomisation was used, and the investigator was aware of the genotype. Relative signal of the TAF1 antibody compared to an internal loading control (β-tubulin) was calculated and the values were normalised to the mean relative signal of control samples electrophoresed on the same gel. The mean of technical replicates was calculated and used for ANOVA, for which biological replicates were used as the experimental unit and the assumptions for this test were met. Protein domain prediction To characterise novel transcripts identified in the Oarfish transcriptome, protein structural analyses were conducted utilizing the IsoformSwitchAnalyzeR package (v2.8.0) in R using a custom GTF file, integrating novel Isoquant transcripts and known Taf1 transcripts. ORFs were predicted with reference to the mouse genome (BSgenome.Mmusculus.UCSC.mm39, Gencode). The “mostUpstream” parameter was employed to select ORFs, ensuring identification of the earliest start codon and minimizing the incorporation of downstream sequences potentially encoding unrelated proteins. Transcripts were subsequently evaluated for potential NMD through detection of predicted PTCs. Amino acid sequences derived from predicted-ORFs were extracted via the “extractSequence()” function and subjected to domain annotation. Protein domains were identified using PFAM scan (v1.6) with default parameters. Intrinsically disordered regions (IDRs) were predicted using IUPred2A ( https://iupred2a.elte.hu/ ). Signal peptide sequences, indicating potential subcellular localization or secretion, were predicted using SignalP (v6.0). TAF1 protein complex modelling The complex between TAF1 (Uniprot Q80UV9), TBP (P29037), TAF11 (Q99JX1) and TAF13 (P61216) was modelled using the Alphafold 3 server 61 and visualized in Pymol 3.1.6. Complexes containing the truncated TAF1.1 and TAF1.14 splicing transcripts produced the same structural model with shortened loop regions. Immunohistochemistry Three male and three female mice, 3-months of age, were euthanised and perfused with PBS to ensure complete removal of blood. This was followed by perfusion with 50 ml 4% paraformaldehyde. Brains were extracted and fixed in 4% paraformaldehyde for 24 h at 4°C. Post-fixation, samples were washed twice in PBS and stored in PBS containing 0.05% sodium azide at 4°C. Brains were sagittally sectioned using a vibrating microtome (Leica VT1000S) at a thickness of 40 μm and maintained in PBS with 0.05% sodium azide at 4°C until staining. Immunohistochemistry was conducted following the protocol outlined by Crombie et al. 1 Sections were blocked and permeabilized in a solution of 5% goat serum with 0.25% Triton X-100 for 1 h. Sections were then incubated with primary antibodies (TAF1 [177-4] at 1:200; DARPP-32 [H-3] at 1:1000) in 5% goat serum overnight at 4°C. Negative control sections were treated with 5% goat serum alone. Following primary antibody incubation, all samples were washed three times for 5 min each in PBS. Sections were then incubated with secondary antibodies (goat anti-rabbit IgG (H+L) Alexa Fluor 564 at 1:400; goat anti-mouse IgG (H+L) Alexa Fluor 488 at 1:1000) for 1 h. After secondary antibody incubation, samples were washed three times in PBS and incubated in DAPI solution for 5 min. Finally, samples were mounted using Prolong Gold Antifade (P10144, Vector Laboratories) and coverslipped. Imaging was conducted at high magnification using a Zeiss LSM980 confocal microscope, with whole sections imaged utilizing an Axio Scan Z1 slide scanner. Statistical analysis To compare Taf1 expression across the four different brain regions, an ordinary one-way ANOVA was conducted. For DTU and DTE analyses, Swish (with fishpond) performed nonparametric testing using the Wilcoxon rank-sum test for pairwise comparisons between conditions. Statistical significance was defined as p < 0.05 (*p-value < 0.05; **p-value < 0.01; ***p-value < 0.005). Western blot quantification and statistical analyses were performed using GraphPad Prism 10, accessed in August 2024. Data and Code Availability RNA sequencing data are available through the ArrayExpress under accession E-MTAB-15282. The codes used in this study are deposited in https://github.com/PeihangLi/Taf1-longreads . No new resources were generated in this study. Authors’ contributions PL, KC, JB and A-LB undertook data curation and formal analysis. All authors contributed to the conceptualisation and investigation. A-LB and EMCF undertook funding acquisition. All authors contributed to all stages of writing and have read and approved the final manuscript. Competing Interests The authors have no relevant financial or non-financial interests to disclose. Acknowledgments EMCF, PL and KC were supported by the Collaborative Center for X-linked Dystonia–Parkinsonism (no. 239295 to EMCF). JB was supported by the Medical Research Council (MC_UU_00037/7) and the National Institute of Neurological Disorders and Stroke (1R21NS101588-01A1). A-LB was supported by a Fellowship from the Guarantors of Brain. We thank Marc Timmers for useful discussions, and for the TAF1 [177-4] antibody, produced by the Timmers’ laboratory with support from the Collaborative Center for X-linked Dystonia-Parkinsonism (CCXDP). Funder Information Declared X-linked Dystonia–Parkinsonism , no. 239295 Medical Research Council , MC_UU_00037/7 National Institute of Neurological Disorders and Stroke , 1R21NS101588-01A1 Guarantors of Brain Footnotes https://github.com/PeihangLi/Taf1-longreads References 1. ↵ Crombie EM , Cleverley K , Timmers HTM , Fisher EMC . The roles of TAF1 in neuroscience and beyond . R Soc Open Sci . 2024 ; 11 ( 9 ): 240790 – 25 . doi: 10.1098/rsos.240790 OpenUrl CrossRef PubMed 2. ↵ Singh M V. , Bland CE , Weil PA . Molecular and Genetic Characterization of a Taf1p Domain Essential for Yeast TFIID Assembly . Mol Cell Biol . 2004 ; 24 ( 11 ): 4929 – 4942 . doi: 10.1128/MCB.24.11.4929-4942.2004 OpenUrl Abstract / FREE Full Text 3. ↵ Bernardini A , Mukherjee P , Scheer E , et al. Hierarchical TAF1-dependent co-translational assembly of the basal transcription factor TFIID . Nat Struct Mol Biol . 2023 ; 30 ( 8 ): 1141 – 1152 . doi: 10.1038/s41594-023-01026-3 OpenUrl CrossRef PubMed 4. ↵ Chen X , Qi Y , Wu Z , et al. Structural insights into preinitiation complex assembly on core promoters . Science (American Association for the Advancement of Science ) . 2021 ; 372 ( 6541 ). doi: 10.1126/science.aba8490 OpenUrl Abstract / FREE Full Text 5. ↵ Bernardini A , Tora L . Co-translational Assembly Pathways of Nuclear Multiprotein Complexes Involved in the Regulation of Gene Transcription . J Mol Biol . 2024 ; 436 ( 4 ). doi: 10.1016/j.jmb.2023.168382 OpenUrl CrossRef PubMed 6. ↵ Kamenova I , Mukherjee P , Conic S , et al. Co-translational assembly of mammalian nuclear multisubunit complexes . Nat Commun . 2019 ; 10 ( 1 ): 1740 – 1740 . doi: 10.1038/s41467-019-09749-y OpenUrl CrossRef PubMed 7. ↵ Patel AB , Louder RK , Greber BJ , et al. Structure of human TFIID and mechanism of TBP loading onto promoter DNA . Science (American Association for the Advancement of Science ) . 2018 ; 362 ( 6421 ): 1376 . doi: 10.1126/science.aau8872 OpenUrl Abstract / FREE Full Text 8. ↵ Chen X , Xu Y . Structural insights into assembly of transcription preinitiation complex . Curr Opin Struct Biol . 2022 ; 75 : 102404 – 102404 . doi: 10.1016/j.sbi.2022.102404 OpenUrl CrossRef PubMed 9. ↵ Burley SK , Roeder RG . TATA Box Mimicry by TFIID: Autoinhibition of Pol II Transcription . Cell . 1998 ; 94 ( 5 ): 551 – 553 . doi: 10.1016/S0092-8674(00)81596-2 OpenUrl CrossRef PubMed Web of Science 10. Kokubo T , Yamashita S , Horikoshi M , Roeder RG , Nakatani Y . Interaction between the N-terminal domain of the 230-kDa subunit and the TATA box-binding subunit of TFIID negatively regulates TATA-box binding . Proceedings of the National Academy of Sciences -PNAS . 1994 ; 91 ( 9 ): 3520 – 3524 . doi: 10.1073/pnas.91.9.3520 OpenUrl Abstract / FREE Full Text 11. ↵ Liu D , Ishima R , Tong KI , et al. Solution structure of a TBP-TAF(II)230 complex: Protein mimicry of the minor groove surface of the TATA box unwound by TBP . Cell . 1998 ; 94 ( 5 ): 573 – 583 . doi: 10.1016/S0092-8674(00)81599-8 OpenUrl CrossRef PubMed Web of Science 12. ↵ Wang H , Curran EC , Hinds TR , Wang EH , Zheng N . Crystal structure of a TAF1-TAF7 complex in human transcription factor IID reveals a promoter binding module . Cell Res . 2014 ; 24 ( 12 ): 1433 – 1444 . doi: 10.1038/cr.2014.148 OpenUrl CrossRef PubMed 13. ↵ Curran EC , Wang H , Hinds TR , Zheng N , Wang EH . Zinc knuckle of TAF1 is a DNA binding module critical for TFIID promoter occupancy . Sci Rep . 2018 ; 8 ( 1 ): 4630 – 13 . doi: 10.1038/s41598-018-22879-5 OpenUrl CrossRef PubMed 14. ↵ Bhuiyan T , Timmers HThM . Promoter Recognition: Putting TFIID on the Spot . Trends Cell Biol . 2019 ; 29 ( 9 ): 752 – 763 . doi: 10.1016/j.tcb.2019.06.004 OpenUrl CrossRef PubMed 15. Flynn EM , Huang OW , Poy F , et al. A Subset of Human Bromodomains Recognizes Butyryllysine and Crotonyllysine Histone Peptide Modifications . Structure . 2015 ; 23 ( 10 ): 1801 – 1814 . doi: 10.1016/j.str.2015.08.004 OpenUrl CrossRef PubMed 16. ↵ Jacobson RH , Ladurner AG , King DS , Tjian R . Structure and Function of a Human TAFII250 Double Bromodomain Module . Science (American Association for the Advancement of Science ) . 2000 ; 288 ( 5470 ): 1422 – 1425 . doi: 10.1126/science.288.5470.1422 OpenUrl Abstract / FREE Full Text 17. ↵ Gudmundsson S , Wilbe M , Filipek-Górniok B , et al. TAF1, associated with intellectual disability in humans, is essential for embryogenesis and regulates neurodevelopmental processes in zebrafish . Sci Rep . 2019 ; 9 ( 1 ): 10730 – 11 . doi: 10.1038/s41598-019-46632-8 OpenUrl CrossRef PubMed 18. ↵ O’Rawe JA , Wu Y , Dörfel MJ , et al. TAF1 Variants Are Associated with Dysmorphic Features, Intellectual Disability, and Neurological Manifestations . Am J Hum Genet . 2015 ; 97 ( 6 ): 922 – 932 . doi: 10.1016/j.ajhg.2015.11.005 OpenUrl CrossRef PubMed 19. ↵ Walker AK , Shi Y , Blackwell TK . An Extensive Requirement for Transcription Factor IID-specific TAF-1 in Caenorhabditis elegans Embryonic Transcription . J Biol Chem . 2004 ; 279 ( 15 ): 15339 – 15347 . doi: 10.1074/jbc.M310731200 OpenUrl Abstract / FREE Full Text 20. ↵ Crombie EM , Korecki AJ , Cleverley K , et al. Taf1 knockout is lethal in embryonic male mice and heterozygous females show weight and movement disorders . Dis Model Mech . 2024 ; 17 ( 7 ). doi: 10.1242/dmm.050741 OpenUrl CrossRef 21. ↵ Dhanalakshmi C , Janakiraman U , Moutal A , Fukunaga K , Khanna R , Nelson MA . Evaluation of the effects of the T-type calcium channel enhancer SAK3 in a rat model of TAF1 deficiency . Neurobiol Dis . 2021 ; 149 : 105224 – 105224 . doi: 10.1016/j.nbd.2020.105224 OpenUrl CrossRef PubMed 22. Janakiraman U , Dhanalakshmi C , Yu J , et al. The investigation of the T-type calcium channel enhancer SAK3 in an animal model of TAF1 intellectual disability syndrome . Neurobiol Dis . 2020 ; 143 : 105006 – 105006 . doi: 10.1016/j.nbd.2020.105006 OpenUrl CrossRef PubMed 23. ↵ Janakiraman U , Yu J , Moutal A , et al. TAF1-gene editing alters the morphology and function of the cerebellum and cerebral cortex . Neurobiol Dis . 2019 ; 132 : 104539 . doi: 10.1016/j.nbd.2019.104539 OpenUrl CrossRef PubMed 24. ↵ Cheng H , Capponi S , Wakeling E , et al. Missense variants in TAF1 and developmental phenotypes: Challenges of determining pathogenicity . Hum Mutat . 2020 ; 41 ( 2 ): 449 – 464 . doi: 10.1002/humu.23936 OpenUrl CrossRef 25. Morton SU , Agarwal R , Madden JA , et al. Congenital Heart Defects Due to TAF1 Missense Variants . Circ Genom Precis Med . 2020 ; 13 ( 3 ): E002843 – e002843 . doi: 10.1161/CIRCGEN.119.002843 OpenUrl CrossRef 26. Okamoto N , Arai H , Onishi T , Mizuguchi T , Matsumoto N . Intellectual disability and dysmorphic features in male siblings arising from a novel TAF1 mutation . Congenit Anom (Kyoto ) . 2020 ; 60 ( 1 ): 40 – 41 . doi: 10.1111/cga.12330 OpenUrl CrossRef PubMed 27. ↵ Vianna EQ , Piergiorge RM , Gonçalves AP , et al. Understanding the Landscape of X-linked Variants Causing Intellectual Disability in Females Through Extreme X Chromosome Inactivation Skewing . Mol Neurobiol . 2020 ; 57 ( 9 ): 3671 – 3684 . doi: 10.1007/s12035-020-01981-8 OpenUrl CrossRef PubMed 28. ↵ Aneichyk T , Hendriks WT , Yadav R , et al. Dissecting the Causal Mechanism of X-Linked Dystonia-Parkinsonism by Integrating Genome and Transcriptome Assembly . Cell . 2018 ; 172 ( 5 ): 897 – 909 .e21. doi: 10.1016/j.cell.2018.02.011 OpenUrl CrossRef PubMed 29. ↵ Bragg DC , Sharma N , Ozelius LJ . X-Linked Dystonia-Parkinsonism: recent advances . Curr Opin Neurol . 2019 ; 32 ( 4 ): 604 – 609 . doi: 10.1097/WCO.0000000000000708 OpenUrl CrossRef PubMed 30. ↵ Lee L V. , Rivera C , Teleg RA , et al. The Unique Phenomenology of Sex-Linked Dystonia Parkinsonism (XDP, DYT3, “Lubag”) . International journal of neuroscience. 2011 ; 121 ( S1 ): 3 – 11 . doi: 10.3109/00207454.2010.526728 OpenUrl CrossRef 31. ↵ Rakovic A , Domingo A , Grütz K , et al. Genome editing in induced pluripotent stem cells rescues TAF1 levels in X-linked dystonia-parkinsonism . Movement disorders . 2018 ; 33 ( 7 ): 1108 – 1118 . doi: 10.1002/mds.27441 OpenUrl CrossRef PubMed 32. ↵ Al Ali J , Vaine CA , Shah S , et al. TAF1 Transcripts and Neurofilament Light Chain as Biomarkers for X-linked Dystonia-Parkinsonism . Movement disorders . 2021 ; 36 ( 1 ): 206 – 215 . doi: 10.1002/mds.28305 OpenUrl CrossRef PubMed 33. ↵ Capponi S , Stöffler N , Irimia M , et al. Neuronal-specific microexon splicing of TAF1 mRNA is directly regulated by SRRM4/nSR100 . RNA Biol . 2020 ; 17 ( 1 ): 62 – 74 . doi: 10.1080/15476286.2019.1667214 OpenUrl CrossRef PubMed 34. ↵ Adamopoulos PG , Tsiakanikas P , Adam EE , Scorilas A . Unraveling novel survivin mRNA transcripts in cancer cells using an in-house developed targeted high-throughput sequencing approach . Genomics . 2021 ; 113 ( 1 ): 573 – 581 . doi: 10.1016/j.ygeno.2020.09.053 OpenUrl CrossRef PubMed 35. ↵ Belchikov N , Hsu J , Li XJ , et al. Understanding isoform expression by pairing long-read sequencing with single-cell and spatial transcriptomics . Genome Res.Cold Spring Harbor Laboratory Press . 2024 ; 34 ( 11 ): 1735 – 1746 . doi: 10.1101/gr.279640.124 OpenUrl Abstract / FREE Full Text 36. ↵ Pitolli C , Marini A , Sette C , Pagliarini V . Non-Canonical Splicing and Its Implications in Brain Physiology and Cancer . Int J Mol Sci.MDPI . 2022 ; 23 ( 5 ). doi: 10.3390/ijms23052811 OpenUrl CrossRef 37. ↵ Abdullah Alieh LH , De Toledo BC , Hadarovich A , Toth-Petroczy A , Calegari F . Characterization of alternative splicing during mammalian brain development reveals the extent of isoform diversity and potential effects on protein structural changes . Biol Open . 2024 ; 13 ( 10 ). doi: 10.1242/bio.061721 OpenUrl CrossRef 38. ↵ Aguzzoli Heberle B , Brandon JA , Page ML , et al. Mapping medically relevant RNA isoform diversity in the aged human frontal cortex with deep long-read RNA-seq . Nat Biotechnol . 2025 ; 43 ( 4 ): 635 – 646 . doi: 10.1038/s41587-024-02245-9 OpenUrl CrossRef 39. ↵ Lee Y , Rio DC . Mechanisms and Regulation of Alternative Pre-mRNA Splicing. Kornberg R, ed . Annu Rev Biochem . 2015 ; 84 ( 1 ): 291 – 323 . doi: 10.1146/annurev-biochem-060614-034316 OpenUrl CrossRef PubMed 40. ↵ Warren CFA , Wong-Brown MW , Bowden NA . BCL-2 family isoforms in apoptosis and cancer . Cell Death Dis . 2019 ; 10 ( 3 ): 177 . doi: 10.1038/s41419-019-1407-6 OpenUrl CrossRef PubMed 41. ↵ Monzó C , Liu T , Conesa A . Transcriptomics in the era of long-read sequencing . Nat Rev Genet. Published online 2025 . doi: 10.1038/s41576-025-00828-z OpenUrl CrossRef 42. ↵ Kozak M . Point mutations define a sequence flanking the AUG initiator codon that modulates translation by eukaryotic ribosomes . Cell . 1986 ; 44 ( 2 ): 283 – 292 . doi: 10.1016/0092-8674(86)90762-2 OpenUrl CrossRef PubMed Web of Science 43. ↵ Zur H , Tuller T . New Universal Rules of Eukaryotic Translation Initiation Fidelity . PLoS Comput Biol . 2013 ; 9 ( 7 ): e1003136 – e1003136 . doi: 10.1371/journal.pcbi.1003136 OpenUrl CrossRef PubMed 44. ↵ Jones EF , Haldar A , Oza VH , Lasseigne BN . Quantifying transcriptome diversity: a review . Brief Funct Genomics . 2024 ; 23 ( 2 ): 83 – 94 . doi: 10.1093/bfgp/elad019 OpenUrl CrossRef 45. ↵ Capponi S , Stöffler N , Irimia M , et al. Neuronal-specific microexon splicing of TAF1 mRNA is directly regulated by SRRM4/nSR100 . RNA Biol . 2020 ; 17 ( 1 ): 62 – 74 . doi: 10.1080/15476286.2019.1667214 OpenUrl CrossRef PubMed 46. ↵ Liu Z , Zhu C , Steinmetz LM , Wei W . Identification and quantification of small exon-containing isoforms in long-read RNA sequencing data . Nucleic Acids Res . 2023 ; 51 ( 20 ): e104 – e104 . doi: 10.1093/nar/gkad810 OpenUrl CrossRef PubMed 47. ↵ Sharon D , Tilgner H , Grubert F , Snyder M . A single-molecule long-read survey of the human transcriptome . Nat Biotechnol . 2013 ; 31 ( 11 ): 1009 – 1014 . doi: 10.1038/nbt.2705 OpenUrl CrossRef PubMed 48. Tilgner H , Jahanbani F , Blauwkamp T , et al. Comprehensive transcriptome analysis using synthetic long-read sequencing reveals molecular co-association of distant splicing events . Nat Biotechnol . 2015 ; 33 ( 7 ): 736 – 742 . doi: 10.1038/nbt.3242 OpenUrl CrossRef PubMed 49. ↵ Gupta I , Collier PG , Haase B , et al. Single-cell isoform RNA sequencing characterizes isoforms in thousands of cerebellar cells . Nat Biotechnol . 2018 ; 36 ( 12 ): 1197 – 1202 . doi: 10.1038/nbt.4259 OpenUrl CrossRef 50. ↵ Boti MA , Adamopoulos PG , Tsiakanikas P , Scorilas A . Nanopore Sequencing Unveils Diverse Transcript Variants of the Epithelial Cell-Specific Transcription Factor Elf-3 in Human Malignancies . Genes (Basel ) . 2021 ; 12 ( 6 ): 839 . doi: 10.3390/genes12060839 OpenUrl CrossRef PubMed 51. ↵ Goto S , Lee L V. , Munoz EL , et al. Functional anatomy of the basal ganglia in X-linked recessive dystonia-parkinsonism . Ann Neurol . 2005 ; 58 ( 1 ): 7 – 17 . doi: 10.1002/ana.20513 OpenUrl CrossRef PubMed Web of Science 52. Lee L V. , Maranon E , Demaisip C , et al. The natural history of sex-linked recessive dystonia parkinsonism of Panay, Philippines (XDP) . Parkinsonism Relat Disord . 2002 ; 9 ( 1 ): 29 – 38 . doi: 10.1016/S1353-8020(02)00042-1 OpenUrl CrossRef PubMed Web of Science 53. ↵ Brüggemann N , Heldmann M , Klein C , et al. Neuroanatomical changes extend beyond striatal atrophy in X-linked dystonia parkinsonism . Parkinsonism Relat Disord . 2016 ; 31 : 91 – 97 . doi: 10.1016/j.parkreldis.2016.07.012 OpenUrl CrossRef PubMed 54. ↵ Joglekar A , Hu W , Zhang B , et al. Single-cell long-read sequencing-based mapping reveals specialized splicing patterns in developing and adult mouse and human brain . Nat Neurosci . 2024 ; 27 ( 6 ): 1051 – 1063 . doi: 10.1038/s41593-024-01616-4 OpenUrl CrossRef PubMed 55. ↵ Cho WK , Spille JH , Hecht M , et al. Mediator and RNA polymerase II clusters associate in transcription-dependent condensates . Science (American Association for the Advancement of Science) . 2018 ; 361 ( 6400 ): 412 – 415 . doi: 10.1126/science.aar4199 OpenUrl Abstract / FREE Full Text 56. ↵ Lu H , Yu D , Hansen AS , et al. Phase-separation mechanism for C-terminal hyperphosphorylation of RNA polymerase II . Nature (London ) . 2018 ; 558 ( 7709 ): 318 – 323 . doi: 10.1038/s41586-018-0174-3 OpenUrl CrossRef PubMed 57. ↵ Basu S , Mackowiak SD , Niskanen H , et al. Unblending of Transcriptional Condensates in Human Repeat Expansion Disease . Cell . 2020 ; 181 ( 5 ): 1062 – 1079.e30 . doi: 10.1016/j.cell.2020.04.018 OpenUrl CrossRef PubMed 58. ↵ Brodsky S , Jana T , Barkai N . Order through disorder: The role of intrinsically disordered regions in transcription factor binding specificity . Curr Opin Struct Biol . 2021 ; 71 : 110 – 115 . doi: 10.1016/j.sbi.2021.06.011 OpenUrl CrossRef PubMed 59. ↵ Kelemen O , Convertini P , Zhang Z , et al. Function of alternative splicing . Gene . 2013 ; 514 ( 1 ): 1 – 30 . doi: 10.1016/j.gene.2012.07.083 OpenUrl CrossRef PubMed Web of Science 60. ↵ Marasco LE , Kornblihtt AR . The physiology of alternative splicing . Nat Rev Mol Cell Biol . 2023 ; 24 ( 4 ): 242 – 254 . doi: 10.1038/s41580-022-00545-z OpenUrl CrossRef 61. ↵ Abramson J , Adler J , Dunger J , et al. Accurate structure prediction of biomolecular interactions with AlphaFold 3 . Nature (London ) . 2024 ; 630 ( 8016 ): 493 – 500 . doi: 10.1038/s41586-024-07487-w OpenUrl CrossRef PubMed View the discussion thread. Back to top Previous Next Posted September 12, 2025. Download PDF Data/Code Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following Taf1 expression in mouse: novel transcripts and protein distribution Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share Taf1 expression in mouse: novel transcripts and protein distribution Peihang Li , Karen Cleverley , Elisa M. Crombie , Jan Bieschke , Elizabeth M.C. Fisher , Anna-Leigh Brown bioRxiv 2025.09.08.674157; doi: https://doi.org/10.1101/2025.09.08.674157 Share This Article: Copy Citation Tools Taf1 expression in mouse: novel transcripts and protein distribution Peihang Li , Karen Cleverley , Elisa M. Crombie , Jan Bieschke , Elizabeth M.C. Fisher , Anna-Leigh Brown bioRxiv 2025.09.08.674157; doi: https://doi.org/10.1101/2025.09.08.674157 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Bioinformatics Subject Areas All Articles Animal Behavior and Cognition (7624) Biochemistry (17650) Bioengineering (13871) Bioinformatics (41882) Biophysics (21424) Cancer Biology (18566) Cell Biology (25461) Clinical Trials (138) Developmental Biology (13365) Ecology (19867) Epidemiology (2067) Evolutionary Biology (24290) Genetics (15590) Genomics (22476) Immunology (17713) Microbiology (40331) Molecular Biology (17148) Neuroscience (88477) Paleontology (666) Pathology (2828) Pharmacology and Toxicology (4816) Physiology (7635) Plant Biology (15114) Scientific Communication and Education (2044) Synthetic Biology (4286) Systems Biology (9815) Zoology (2268)