Preparation and evaluation of peptide-PLGA nanoparticles on porcine epidemic diarrhea virus infection | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Case Report Preparation and evaluation of peptide-PLGA nanoparticles on porcine epidemic diarrhea virus infection Qian Xu, Fangyu Wang, Hua Feng, Qiang Wei, Xuefeng Sun, Guangxu Xing, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4183177/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Porcine epidemic diarrhea virus (PEDV) can cause diarrhea, dehydration and death in suckling piglets, which seriously affects the economic benefits of the production line. Therefore, it is urgent to find an economical and effective treatment to prevent and control PEDV. Methods peptide (P6), which could specifically target the S1 C-terminal domain (CTD) protein of porcine epidemic diarrhea virus (PEDV), was subsequently conjugated to poly (lactic-co-glycolic acid) (PLGA) by dehydration synthesis generating P6-PLGA nanoparticles and used cell counting kit-8 (CCK-8), real-time fluorescence quantitative PCR (qRT-PCR), Western blot and indirect immunofluorescence to further study the inhibitory effect of different concentrations of P6-PLGA nanoparticles on PEDV. Results The results showed that cell viability was > 95% when treated with P6-PLGA nanoparticles at concentrations not exceeding 1000 µg/ml. Results of the absolute quantitative PCR revealed that the concentration of P6-PLGA nanoparticles at 400 µg/ml could significantly reduce the viral load of PEDV compared with the virus group (p < 0.05 or p < 0.001). Similarly, results of Western blot and indirect immunofluorescence also suggested that the antiviral effect of P6-PLGA nanoparticles at 400 µg/ml is still significant. Based on the above research, high affinity peptide (P6) was covalently coupled with PLGA particles to obtain P6-PLGA nanoparticles. Conclusions PLGA as a drug delivery carrier combined with peptide (P6) can overcome the problems of poor stability, easy degradation or low bioavailability of peptide after entering the body, and provide a new strategy for the development of PEDV antiviral drugs. porcine epidemic diarrhea virus S1 C-terminal domain (CTD) protein PLGA nanoparticles antiviral peptides Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 1 Introduction Porcine epidemic diarrhea virus (PEDV) is a member of the coronavirus family, which can cause porcine epidemic diarrhea disease (PED). The clinical symptoms are vomiting, watery diarrhea, and severe dehydration death[ 1 ]. Before 2010, PEDV was an endemic infectious disease and had not received enough attention in China. However, after 2010, the continuous emergence of porcine epidemic diarrhea variant strains has caused serious losses in China 's pig industry[ 2 , 3 ], especially in the late autumn and early winter when the temperature is low. The virus mainly encodes four structural proteins: spike protein (S), nucleocapsid protein (N), membrane protein (M) and envelope protein (E)[ 4 ]. Among them, S protein is processed into S1 and S2 subunits by trypsin-like host cell protease, the former (S1) plays an important mediating role in virus attachment to host cells[ 5 ]. The S1-CTD region is also one of the key targets for the development of antiviral drugs for PEDV, however, due to the differences in antigen, genetics (differences in amino acid mutations between S1-NTD proteins) and phylogeny (G1 vs G2) between existing vaccines and current epidemic strains[ 6 ], PEDV vaccines can only provide low to medium immune efficacy[ 7 , 8 ], so other methods are needed to assist vaccines in preventing and controlling the occurrence of PEDV. Small molecular peptides are the focus of research in recent years, and targeting the two stages of virus adsorption and nucleic acid replication to design antiviral peptides is an effective means to reduce PEDV infection. Peptides not only have the advantages of simple structure, small molecular weight, easy synthesis and modification, but also have high cell membrane penetration, no cytotoxicity and low immunogenicity[ 9 ]. At present, the commonly used methods for screening peptides include phage display[ 10 ], mRNA display[ 11 ], ribosome display[ 12 , 13 ], combinatorial chemistry[ 14 ] and computer virtual screening. Compared with other screening methods, computer virtual screening technology predicts the binding strength and affinity between peptides and proteins by simulating the interaction between peptides and proteins. This method does not require the synthesis of peptides, which not only reduces the screening intensity, but also shortens the development cycle and saves manpower and energy[ 15 – 18 ]. Molecular docking technology is one of the most commonly used strategies in computer virtual screening methods. Obtaining bioactive peptides through this technology has been widely used in various fields, such as drug delivery, protein purification, etc[ 19 ]. Polylactic acid-co-glycolic acid (PLGA) is a multifunctional copolymer composed of synthetic lactic acid and glycolic acid monomers. It has good biocompatibility, biodegradability, sustained release, easy surface modification, and non-toxic side effects and protects the entrapped vaccine from proteases mediated degradation at mucosal surfaces[ 20 – 22 ]. It can be used to make drug sustained-release carriers, which is mainly the delivery of antigens, such as proteins, deoxyribonucleic acid (DNA) and peptides[ 23 ]. As an injection drug system approved by the US Food and Drug Administration (FDA) and the European Medicines Agency (EMA), the safety and efficacy of PLGA have been widely confirmed and have a wide range of uses in scientific research. In addition, PLGA can prevent the encapsulated drug from being biodegraded and interacting with other conjugated parts[ 24 ].Therefore, the encapsulation of drugs in PLGA nanoparticles will not affect the therapeutic effect and biological properties of the conjugates. In this study, the peptide(P6) targeting S1-CTD region of porcine epidemic diarrhea virus (PEDV), which have obtained by using computer virtual screening technology (SYBYL-X 2.0 program) in previous research articles, and conjugated it to PLGA nanoparticles by dehydration synthesis, and assembled the P6-PLGA nanoparticles. Furthermore, we identified the P6-PLGA nanoparticles on PEDV infection. 2 Materials and Methods 2.1 Materials The peptide P6 was synthesized and purified to at least 90% by GL Biochem (Shanghai, China). PLGA nanoparticles (particle size: 120 nm, carboxyl end modification) were purchased from Sunna Biotechnology, Ltd. (Shanghai, China). The 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC) and N-hydroxysuccinimide (NHS) were purchased from Thermo Scientific (TMO, USA). BCA Protein Assay Kit was purchased from Solarbio (Beijing, China). Meilun cell-counting kit-8 (CCK-8) was purchased from Bergolin (dalian, China). PerfectStart® Uni RT&qPCR Kit was purchased from TransGen Biotech (Beijing China). Figure 1 presents a schematic diagram of the preparation process of the P6-PLGA nanoparticles and its evaluation of antiviral effect evaluation. All other experimental materials used, like qRT-PCR, Western blot, IFA and so on, were mentioned in detail in the previous article[ 25 ]. 2.2 Preparation of P6-PLGA Nanoparticle An amount of 5 mg of PLGA nanoparticles (about 4 ml) was dialyzed overnight in a NaH2PO4 (pH 6.0) solution at 4°C and then transferred to a 10 mL centrifuge tube. 10 µL of NHS solution (50 mg/mL) and 10 µL of EDC solution (50 mg/mL) were added to it and mixed upside down at room temperature for 20 min. After centrifugation, the supernatant was removed as well as peptides solution (400 µg peptides/mg particles) was added to the particles and mixed upside down at room temperature for 4 h (thorough mixing between peptide P6 and PLGA nanoparticles). The mixture was dialyzed overnight in PBS to remove the uncoupled peptides and NHS or EDC, generating the PLGA-P6 nanoparticles after centrifugation[ 19 ]. 2.3 Coupling efficiency of P6 with nanoparticles The peptide P6 was diluted with PBS to 100 µg/ml, 200 µg/ml, 400 µg/ml, 800 µg/ml, 1000 µg/ml, 1600 µg/ml, 2000 µg/ml, 3200 µg/ml, 5000 µg/ml, 6400 µg/ml, respectively, and coupled with the same volume of PLGA. The supernatant of the solution after the reaction of peptide P6 with the PLGA nanoparticles was retained. Coupling efficiency was calculated by BCA Protein Assay Kit ((Solarbio, Beijing, China) and calculation formula was as follows: Coupling efficiency \(=\frac{\text{C}0-\text{C}1}{\text{C}0}\) ×100% In the formula, C0 and C1 were the concentration of peptide P6 solution before and after coupling with PLGA nanoparticles, respectively. 2.4 Cytotoxicity Assay The cytotoxic effects of P6-PLGA nanoparticles on vero cells was assessed using the Meilun Cell Counting Kit-8 (Dalian, China). Vero cells were cultured in 96-well plates at a density of 1.0 × 10 4 cells/well until they grew into a single layer. Subsequently, the culture medium was removed, washed with PBS three times, and added serial dilutions (100 µg/ml, 200 µg/ml, 400 µg/ml, 800 µg/ml, 1000 µg/ml) of the P6-PLGA nanoparticles in each corresponding well. 10 µL CCK-8 solution was added to each well and the cells were incubated for a further 1 h at 37°C. The samples were analyzed by reading the optical density at 450 nm using fully automated multifunctional microplate reader (Offenburg, Germany). The cell viability was analyzed by GraphPad Prism 8.0.2 (GraphPad Software). 2. 5 Absolute Quantification Real-Time PCR Assay To assess the inhibitory effects of P6-PLGA nanoparticles at attachment stage of PEDV infection, three different methods of treatment were tested with 400 µg/ml P6-PLGA nanoparticles on Vero cell. (ⅰ) For virus pretreatment, the virus was first incubated with P6-PLGA nanoparticles for 1 h at 37°C and then inoculated onto the cells for 1 h at 37°C again. The medium was removed at 1 h later and washed with phosphate-buffered saline (PBS) three times. Subsequently, the cells were cultured with 2% FBS DMEM to 12 h. (ⅱ) For cell pretreatment, the cells were incubated with P6-PLGA nanoparticles for 1 h at 37°C and then washed thoroughly with phosphate-buffered saline (PBS) three times. The cells then were infected with 0.01MOI PEDV for 1 h at 37°C and washed with phosphate-buffered saline (PBS) three times after 1 h. Subsequently, the cells were cultured with 2% FBS DMEM to 12 h. (ⅲ) For coincubation, the cells were incubated with P6-PLGA nanoparticles in the presence of 0.01MOI PEDV for 1 h at 4°C, and 1 h later, the medium was removed and washed with phosphate-buffered saline (PBS) three times, then the cells were collected. Total RNAs were extracted from the cells in a 24-well plate by using TransZol Up according to the manufacturer’s instructions. PerfectStart® Uni RT&qPCR Kit was used to synthesize cDNA. The virus N gene in cell(copies) was assessed in triplicate by PerfectStart® ⅡProbe qPCR SuperMix UDG using ABI 7500 Fast Real-time Fluorescent Quantitative PCR System. Primer and probe sequences are shown in Table 1 . Table 1 Primers and probes used for the duplex TaqMan probe-based real-time RT-PCR. Primer Name Sequence (5′-3′) N-F CGCAAAGACTGAACCCACTAAC N-R TTGCCTCTGTTGTTACTTGGAGAT Probe Name Sequence (5′-3′) PEDV N TGTTGCCATTACCACGACTCCTGC 5'fam- 3'BHQ3 2.6 Western Blot Assay The total cellular proteins were extracted using RIPA lysis buffer (Beyotime). Proteins were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis and then transferred to polyvinylidene difluoride membranes. The membranes were blocked with 5% nonfat milk for 2 h at room temperature, washed with PBST (PBS containing 0.5‰Tween 20), and then incubated with a primary antibody ( anti-PEDV-N or β-actin) overnight at 4 ℃. After repeated washes with PBST, the membranes were further incubated for 1 h with a secondary antibody (HRP-anti-mouse IgG). The target protein bands were then analyzed using Vilber Fusion FX chemiluminescence gel imager. The level of target protein expression was analyzed using ImageJ software (National Institutes of Health, Bethesda, MD, USA). 2.7 Immunofluorescence Assay Cells were fixed with 4% paraformaldehyde at 4 ℃ for 30 min, incubated with 0.2% TritonX-100 at a room temperature for 15 min, washed with PBST three times, blocked with 5% nonfat dry milk in PBST for 2 h at 37°C, and incubated with anti-PEDV-N antibody for 1 h at 37°C. The cells were then washed with PBST three times, incubated with fluorescence-conjugated goat anti-mouse IgG secondary antibody for 1 h at 37°C, and then incubated with 2-(4-Amidinophenyl)-6-indolecarbamidine dihydrochloride (DAPI, Beyotime) for 15 min at RT after washing with PBST three times. The stained cells were examined using a fluorescence microscope(Leica, Germany. 2.8 Statistics All experiments were evaluated and analysed by GraphPad Prism 8.0.2 software (GraphPad Software). Statistical analyses were performed using one-way ANOVA or student’s t-test. All experiments results were used as means and standard deviations (SD) as well as performed with three independent replicates. The statistical significances were defined as p < 0.05 (*), and the higher significance was denoted by p < 0.01 (**), p < 0.001 (***), p < 0.0001 (****). 3 Results 3.1 Design of the PEDV S Peptides The crystal structure of PEDV S protein (PDB ID: 6U7K) is shown in Figure 2A [26]. Since the amino acid sequence of the C-terminal 505-642 of the PEDV S1 protein is relatively conserved among different PEDV variant strains, which is selected as the docking pocket (the red region in Figure 2B-D was the selected docking pocket). After molecular docking using Surflex-Dock program in SYBYL-X 2.1.1 software, the affinity of PEDV S docking pocket and peptide was evaluated by consensus scoring function and displayed by Total _ Score value. Total _Score is the total score of Surflex-Dock, expressed as − log (Kd), indicating the affinity of the ligand to the protein. The interaction between polypeptides and PEDV S protein was analyzed by PyMOL software and MOLCAD program of SYBYL-X 2.1.1. The results showed that the key to the optimal peptide binding of peptide P6 to PEDV protein was the multipolar bond between them ( Figure 2E ). 3.2 Protein Binding Capacity As shown in Figure 3A-B, with the increase of peptide concentration (200-6400 μg/100ul), the coupling efficiency with PLGA nanoparticles also increased, up to 86 %, and the number of peptides coupled to PLGA nanoparticles also increased accordingly, up to 6.373ug. On the contrary, the lower the peptide concentration was, the worse the coupling efficiency was, and the lowest was 19 %. The number of peptides coupled to PLGA nanoparticles also decreased, and the lowest was 0.148 ug. Therefore, in order to ensure the coupling amount of peptide P6, as many peptide ligands as possible should be coupled to PLGA nanoparticles. 3.3 Cytotoxicity Test Cell Counting Kit-8(CCK-8) is widely used to access the cell proliferation and cytotoxicity. The cell viability of P6-PLGA was evaluated using vero cell lines. The untreated cells (contains 10% CCK-8 solution) were used as a negative control as well as cell-free (contains 10% CCK-8 solution) was blank control. The vero cells were incubated with different concentration of P6-PLGA for 24 h. It was observed that the cell viability was largely maintained after incubating the vero cells with the formulations as shown in the in Fig. 4 . However, the vero cell viability slightly decreased with the increase in concentration of P6-PLGA. Compared with other groups, the vero cell viability was maintained above 85% when exposed at the concentration of 2000 µg/mL and 1600 µg/mL. The slight cytotoxicity of its might be due to the concentration of coupling P6 peptide is too high. However, when the concentrations at 100 µg/mL, 200 µg/mL, 400 µg/mL,800 µg/mL,1000 µg/mL, the cell viability of P6-PLGA was more than 90%. Thus, the concentration below 1000 µg/mL was used for subsequent experiments. 3.4 Attachment of PEDV affected by P6-PLGA Due to the effective safe concentration range of P6-PLGA nanoparticles was determined, we further explored whether P6-PLGA nanoparticles had a direct viricidal effect on the stage of PEDV attachment through qRT-PCR, Western blotting and IFA experiments. The results suggested that treatment with P6-PLGA nanoparticles led to a significant reduction in viral load in a dose-dependent manner. Among them, as shown in Fig. 5 A-E, in the case of virus pretreatment, the copy number of viral N protein gene decreased by about 2.43 times after the cells were treated with 400 µg/mL P6-PLGA for 12 h (P < 0.01). When the cells were pretreated, the copy number of viral N protein gene was reduced by about 1.89 times (P 0.05) under circumstances of co-treatment. In addition, Western blotting results showed that compared with the control group, the levels of N protein in PEDV-infected Vero E6 cells in a dose-dependent manner, and the N protein of PEDV expression levels significantly decreased with 400 µg/mL P6-PLGA (Fig. 6 ) Similarly, IFA results also showed the inhibitory effect of P6-PLGA on PEDV (Fig. 7 ). Therefore, these results indicate that P6-PLGA reduces PEDV infection by blocking PEDV adsorption. Total RNA was then extracted from the cells, viral N gene was quantified by qRT-PCR, using the primer sets described in Table 1 . 4 Discussion In recent years, the prevalence of viral infectious diseases such as novel coronavirus[ 27 , 28 ], influenza virus, and African swine fever virus[ 29 , 30 ] has caused serious negative impacts on human and animal health worldwide. PEDV is a member of the coronavirus, coronavirus infection is mediated by its outer membrane protein S, which is further cleaved into S1 and S2 subunits by endogenous and / or exogenous proteases[ 31 ]. The S1 subunit recognizes and binds to the corresponding host receptor, while the S2 subunit mediates membrane fusion between the virus and the host cell[ 32 ], S1 contains two independent regions, the N-terminal region (S1-NTD) and the C-terminal region (S1-CTD)[ 33 ]. The S1-NTD and S1-CTD of coronavirus play an important role in recognition and binding to cell receptors, and the latter is one of the important targets for the development of antiviral drugs for PEDV. However, since 2010, different types of PEDV variants have emerged in many countries, which has seriously hindered the development of the global pig industry[ 34 – 38 ]. In view of the fact that the PEDV vaccine currently on the market does not provide sufficient immune protection for pigs, there is an urgent need for effective prevention and treatment drugs to assist the vaccine in blocking PEDV infection. As affinity ligands, peptides have the characteristics of small molecular weight, easy synthesis, no immunogenicity and no cytotoxicity. Therefore, the selection of the key domains of the target protein that can specifically bind to the peptide ligand is the primary task in the design and screening of peptide ligands. In order to quickly obtain the best peptide ligands with good specificity and high affinity, the most commonly used high-throughput screening methods mainly include phage display technology, mRNA display technology, DNA display technology, combinatorial chemistry technology and computer virtual screening technology[ 39 ]. In comparison, computer virtual screening technology has many incomparable advantages, such as simple and rapid operation, reducing the workload of peptide screening, shortening the development cycle, and improving the success rate of screening[ 15 ]. It is regarded as an improvement and development of traditional high-throughput screening technology, and has also been applied in many fields. Molecular docking technology is one of the commonly used methods of computer virtual screening. Therefore, this study is the first attempt to use molecular docking technology for virtual screening to design affinity peptides with strong antiviral activity against PEDV infection. Nanoparticles not only have adjuvant properties, but also can improve the efficiency of drug or vaccine delivery[ 40 ]. Poly (lactic-co-glycolic acid) PLGA is a biodegradable functional polymer organic compound composed of synthetic lactic acid and glycolic acid monomers. At present, carboxyl-modified PLGA nanoparticles are the most commonly used microsphere carriers for coupling proteins[ 41 ], peptides[ 42 , 43 ], vitamins[ 44 ] and other organic substances. However, due to its special chemical properties, peptides have poor stability, unstable biological activity and poor biocompatibility in vivo. The PLGA microsphere carrier can effectively improve these problems and also prolong the half-life of the drug. Related studies have also proved that it can effectively induce protective immune response [ 45 , 46 ]and protect the encapsulated vaccine from protease degradation through mucosal and systemic pathways. Therefore, the use of PLGA microspheres as a carrier to package peptide drugs is a promising research direction. In our study, a high-affinity peptide P6 targeting the PEDV S1-CTD region was obtained by molecular docking technology, and it was covalently coupled with PLGA nanoparticles containing carboxyl groups to obtain P6-PLGA nanoparticles. However, considering that the purpose of our experiment is to block the adsorption of virus, we finally used virus pretreatment, cell pretreatment and co-treatment to evaluate the ability of P6-PLGA nanoparticles to prevent PEDV infection in vitro. The results showed that the higher the concentration of peptide P6, the higher the coupling efficiency with PLGA. However, the CCK-8 cell survival rate test results showed that when the concentration of P6-PLGA nanoparticles exceeded 1000 µg/mL, the cell survival rate was only 85%. In addition, qRT-PCR, western blotting and IFA results showed that P6-PLGA nanoparticles could significantly block PEDV adsorption in vitro. The main reason is that PLGA nanoparticles with a size of about 120 nm have a large steric hindrance, which can effectively block the binding of PEDV to protein peptide receptor aminopeptidase N (APN), etc., thereby preventing the infection of porcine epidemic diarrhea virus. On the other hand, in our previous study, peptide P6 and 110766 designed to target the PEDV S1-CTD region could significantly inhibit PEDV infection. More importantly, PLGA nanoparticles can not only improve the bioavailability of peptide drugs and prolong their half-life, but also avoid the degradation of peptides by some enzymes after entering the animal body. At the same time, it can also achieve targeted drug delivery and reduce the non-targeted local effects of drugs. Therefore, our study revealed a screening strategy for designing antiviral peptides targeting the PEDV S1-CTD region, and determined that P6-PLGA nanoparticles can be used as a promising antiviral candidate drug, laying a solid foundation for subsequent animal experiments. 5 Conclusions Targeted PEDV S1-CTD region designing and screening of antiviral peptides can provide auxiliary comprehensive prevention and control measures for the current epidemic of PEDV, that is, reducing the risk of PEDV infection through synergy (vaccine + antiviral peptide). Therefore, we designed and synthesized 53 high-affinity peptides by molecular docking technology, among which peptide P6 had significant antiviral effect in vitro (in the pre-experiment). In order to realize the clinical application value of peptide drugs, it was covalently coupled with PLGA nanoparticles containing carboxyl groups on the surface. The final in vitro test results showed that 400 µg/mL P6-PLGA nanoparticles could significantly block the adsorption of PEDV. Therefore, this study provides a strong reference for the development of subsequent animal experiments, and further promotes the clinical application of antiviral peptides. Declarations Competing interests All authors declare that No conflict of interest exists. Funding This research was supported by Fund for Distinguished Young Scholars from Henan Academy of Agricultural Sciences (No. 2024JQ03). Author Contribution QX, FYW and GPZwang designed this study.QX, FYW, HF and QW performed the experiments.QX and FYW wrote the manuscript and prepared all figures.XFS and GXX contributed to analysis of the data and discussion of the results, QX revised the manuscript.All authors reviewed the manuscript. Availability of data and materials The manuscript was finished by contributions of all authors. In this study, all data obtained or analyzed are available from the corresponding author on reasonable request. References Wang T, Zheng G, Chen Z, Wang Y, Zhao C, Li Y, et al. Drug repurposing screens identify Tubercidin as a potent antiviral agent against porcine nidovirus infections. Virus Res. 2024;339:199275. Li W, Li H, Liu Y, Pan Y, Deng F, Song Y, et al. New variants of porcine epidemic diarrhea virus, China, 2011. Emerg Infect Dis. 2012;18:1350–3. Weiss S, Witkowski PT, Auste B, Nowak K, Weber N, Fahr J, et al. Hantavirus in bat, Sierra Leone. Emerg Infect Dis. 2012;18:159–61. Park SJ, Kim HK, Song DS, An DJ, Park BK. Complete genome sequences of a Korean virulent porcine epidemic diarrhea virus and its attenuated counterpart. J Virol. 2012;86:5964. Song D, Park B. Porcine epidemic diarrhoea virus: a comprehensive review of molecular epidemiology, diagnosis, and vaccines. Virus Genes. 2012;44:167–75. Zhang Y, Chen Y, Zhou J, Wang X, Ma L, Li J et al. Porcine Epidemic Diarrhea Virus: An Updated Overview of Virus Epidemiology, Virulence Variation Patterns and Virus-Host Interactions. Viruses. 2022;14. Gerdts V, Zakhartchouk A. Vaccines for porcine epidemic diarrhea virus and other swine coronaviruses. Vet Microbiol. 2017;206:45–51. Wang Q, Vlasova AN, Kenney SP, Saif LJ. Emerging and re-emerging coronaviruses in pigs. Curr Opin Virol. 2019;34:39–49. Lowe CR, Burton SJ, Burton NP, Alderton WK, Pitts JM, Thomas JA. Designer dyes: 'biomimetic' ligands for the purification of pharmaceutical proteins by affinity chromatography. Trends Biotechnol. 1992;10:442–8. Smith GP. Filamentous fusion phage: novel expression vectors that display cloned antigens on the virion surface. Science. 1985;228:1315–7. Roberts RW, Szostak JW. RNA-peptide fusions for the in vitro selection of peptides and proteins. Proc Natl Acad Sci U S A. 1997;94:12297–302. Hanes J, Plückthun A. In vitro selection and evolution of functional proteins by using ribosome display. Proc Natl Acad Sci U S A. 1997;94:4937–42. He M, Taussig MJ. Antibody-ribosome-mRNA (ARM) complexes as efficient selection particles for in vitro display and evolution of antibody combining sites. Nucleic Acids Res. 1997;25:5132–4. Liu R, Li X, Lam KS. Combinatorial chemistry in drug discovery. Curr Opin Chem Biol. 2017;38:117–26. Lyne PD. Structure-based virtual screening: an overview. Drug Discov Today. 2002;7:1047–55. Sammond DW, Bosch DE, Butterfoss GL, Purbeck C, Machius M, Siderovski DP, et al. Computational design of the sequence and structure of a protein-binding peptide. J Am Chem Soc. 2011;133:4190–2. Tinberg CE, Khare SD, Dou J, Doyle L, Nelson JW, Schena A, et al. Computational design of ligand-binding proteins with high affinity and selectivity. Nature. 2013;501:212–6. Vanhee P, van der Sloot AM, Verschueren E, Serrano L, Rousseau F, Schymkowitz J. Computational design of peptide ligands. Trends Biotechnol. 2011;29:231–9. Wang F, Hu M, Li N, Sun X, Xing G, Zheng G, et al. Precise Assembly of Multiple Antigens on Nanoparticles with Specially Designed Affinity Peptides. ACS Appl Mater Interfaces. 2022;14:39843–57. Danhier F, Ansorena E, Silva JM, Coco R, Le Breton A, Preat V. PLGA-based nanoparticles: an overview of biomedical applications. J Control Release. 2012;161:505–22. Lu JM, Wang X, Marin-Muller C, Wang H, Lin PH, Yao Q, et al. Current advances in research and clinical applications of PLGA-based nanotechnology. Expert Rev Mol Diagn. 2009;9:325–41. Thomasin C, Corradin G, Men Y, Merkle HP, Gander B. Tetanus toxoid and synthetic malaria antigen containing poly(lactide)/poly(lactide-co-glycolide) microspheres: importance of polymer degradation and antigen release for immune response. J Controlled Release. 1996;41:131–45. Varshochian R, Jeddi-Tehrani M, Mahmoudi AR, Khoshayand MR, Atyabi F, Sabzevari A, et al. The protective effect of albumin on bevacizumab activity and stability in PLGA nanoparticles intended for retinal and choroidal neovascularization treatments. Eur J Pharm Sci. 2013;50:341–52. Dhoke DM, Basaiyye SS, Khedekar PB. Development and characterization of L-HSA conjugated PLGA nanoparticle for hepatocyte targeted delivery of antiviral drug. J Drug Deliv Sci Technol. 2018;47:77–94. Xu Q, Wang F, Jiao W, Zhang M, Xing G, Feng H et al. Virtual Screening-Based Peptides Targeting Spike Protein to Inhibit Porcine Epidemic Diarrhea Virus (PEDV) Infection. Viruses. 2023;15. Wrapp D, McLellan JS. The 3.1-Angstrom Cryo-electron Microscopy Structure of the Porcine Epidemic Diarrhea Virus Spike Protein in the Prefusion Conformation. J Virol. 2019;93. Wu F, Zhao S, Yu B, Chen YM, Wang W, Song ZG, et al. Author Correction: A new coronavirus associated with human respiratory disease in China. Nature. 2020;580:E7. Zhou P, Yang XL, Wang XG, Hu B, Zhang L, Zhang W, et al. A pneumonia outbreak associated with a new coronavirus of probable bat origin. Nature. 2020;579:270–3. Dixon LK, Stahl K, Jori F, Vial L, Pfeiffer DU. African Swine Fever Epidemiology and Control. Annu Rev Anim Biosci. 2020;8:221–46. Zhou X, Li N, Luo Y, Liu Y, Miao F, Chen T, et al. Emergence of African Swine Fever in China, 2018. Transbound Emerg Dis. 2018;65:1482–4. Millet JK, Whittaker GR. Host cell proteases: Critical determinants of coronavirus tropism and pathogenesis. Virus Res. 2015;202:120–34. Brian DA, Baric RS. Coronavirus genome structure and replication. Curr Top Microbiol Immunol. 2005;287:1–30. Li F. Evidence for a common evolutionary origin of coronavirus spike protein receptor-binding subunits. J Virol. 2012;86:2856–8. Huang YW, Dickerman AW, Piñeyro P, Li L, Fang L, Kiehne R, et al. Origin, evolution, and genotyping of emergent porcine epidemic diarrhea virus strains in the United States. mBio. 2013;4:e00737–13. Jung K, Saif LJ, Wang Q. Porcine epidemic diarrhea virus (PEDV): An update on etiology, transmission, pathogenesis, and prevention and control. Virus Res. 2020;286:198045. Lin CM, Saif LJ, Marthaler D, Wang Q. Evolution, antigenicity and pathogenicity of global porcine epidemic diarrhea virus strains. Virus Res. 2016;226:20–39. Sun RQ, Cai RJ, Chen YQ, Liang PS, Chen DK, Song CX. Outbreak of porcine epidemic diarrhea in suckling piglets, China. Emerg Infect Dis. 2012;18:161–3. Wang D, Fang L, Xiao S. Porcine epidemic diarrhea in China. Virus Res. 2016;226:7–13. Merrifield RB. Solid-phase peptide synthesis. Adv Enzymol Relat Areas Mol Biol. 1969;32:221–96. Gupta RK, Chang AC, Siber GR. Biodegradable polymer microspheres as vaccine adjuvants and delivery systems. Dev Biol Stand. 1998;92:63–78. He Y, Yang L, Yuan JJ, Zhu HH, Shao LY. [Effect of ultrasound contrast agent targeting gelatin on uptake of mouse ascites hepatocellular carcinoma cell lines with high lymphatic metastasis]. Zhonghua Zhong Liu Za Zhi. 2020;42:319–24. Hong JKY, Schwendeman SP. Characterization of Octreotide-PLGA Binding by Isothermal Titration Calorimetry. Biomacromolecules. 2020;21:4087–93. Sophocleous AM, Desai KG, Mazzara JM, Tong L, Cheng JX, Olsen KF, et al. The nature of peptide interactions with acid end-group PLGAs and facile aqueous-based microencapsulation of therapeutic peptides. J Control Release. 2013;172:662–70. Li G, Wang Y, Tan G. The construction of EpCAM/vimentin-PLGA/lipid immunomagnetic microspheres and the isolation of circulating tumor cells from lung cancer. Int J Clin Exp Pathol. 2018;11:5561–70. Eldridge JH, Gilley RM, Staas JK, Moldoveanu Z, Meulbroek JA, Tice TR. Biodegradable microspheres: vaccine delivery system for oral immunization. Curr Top Microbiol Immunol. 1989;146:59–66. Spiers ID, Eyles JE, Baillie LW, Williamson ED, Alpar HO. Biodegradable microparticles with different release profiles: effect on the immune response after a single administration via intranasal and intramuscular routes. J Pharm Pharmacol. 2000;52:1195–201. Additional Declarations No competing interests reported. Supplementary Files supplementaryfileWBoriginaldrawing.zip Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4183177","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Case Report","associatedPublications":[],"authors":[{"id":287725502,"identity":"faeef3d1-54a4-4865-93b8-fa2217872a9f","order_by":0,"name":"Qian Xu","email":"","orcid":"","institution":"Northwest A\u0026 F University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Qian","middleName":"","lastName":"Xu","suffix":""},{"id":287725503,"identity":"95bc1171-6db4-4f82-ba16-86debaf15347","order_by":1,"name":"Fangyu Wang","email":"","orcid":"","institution":"Henan Academy of Agricultural Sciences","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Fangyu","middleName":"","lastName":"Wang","suffix":""},{"id":287725504,"identity":"3a8c49ea-6226-421a-9812-6106e9751854","order_by":2,"name":"Hua Feng","email":"","orcid":"","institution":"Henan Academy of Agricultural Sciences","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Hua","middleName":"","lastName":"Feng","suffix":""},{"id":287725505,"identity":"a5699d92-bbd2-4cce-b301-0428228ded57","order_by":3,"name":"Qiang Wei","email":"","orcid":"","institution":"Henan Academy of Agricultural Sciences","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Qiang","middleName":"","lastName":"Wei","suffix":""},{"id":287725506,"identity":"edda363f-f67c-4b8a-9145-9614a693a238","order_by":4,"name":"Xuefeng Sun","email":"","orcid":"","institution":"Henan Academy of Agricultural Sciences","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Xuefeng","middleName":"","lastName":"Sun","suffix":""},{"id":287725507,"identity":"343b7f6d-c17b-41bb-8145-2c1d02cbd35c","order_by":5,"name":"Guangxu Xing","email":"","orcid":"","institution":"Henan Academy of Agricultural Sciences","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Guangxu","middleName":"","lastName":"Xing","suffix":""},{"id":287725508,"identity":"e65a948c-98e1-45a7-9122-16a0551a8832","order_by":6,"name":"Gaiping Zhang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA1UlEQVRIiWNgGAWjYDACCQjFw8De2PjgA2laeA43G84gRQuQkd4mzUGMDvnZzc8efvllJ2Mu+bBBmoHBTk63gYAWxjnHzI1l+5J5LGcnNhgXMCQbmx0goIVZIsFMWrKHmcfgdmJD8gyGA4nbCGlhk0j/BtRSz2Nw82DDYR5itPBI5JhJfvhxmMfgBmNjM1FaJCRyyqQZG47zWPYkNjPOMCDCL/Iz0rdJ/vhTbW/Ofvz5jw8VdnIEtYAAM28bA4MBmGlAhHIQYPzxh3jFo2AUjIJRMAIBAL93QPYjEfErAAAAAElFTkSuQmCC","orcid":"","institution":"Henan Academy of Agricultural Sciences","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Gaiping","middleName":"","lastName":"Zhang","suffix":""}],"badges":[],"createdAt":"2024-03-28 15:14:24","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4183177/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4183177/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":54370965,"identity":"d9b2c91a-3abb-4804-abc7-a30f9e029976","added_by":"auto","created_at":"2024-04-09 13:12:58","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":540016,"visible":true,"origin":"","legend":"\u003cp\u003eSchematic diagram of the preparation process of P6-PLGA nanoparticles, its antiviral effect was evaluated by coupling P6 to the surface of PLGA.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-4183177/v1/21d067e4895854dc5c15d649.png"},{"id":54369582,"identity":"067561e0-71b6-4a69-8592-fd73ad55c6ae","added_by":"auto","created_at":"2024-04-09 13:04:58","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":516373,"visible":true,"origin":"","legend":"\u003cp\u003eDocking pocket display and peptide ligand (P6)-PEDV S protein interaction pattern diagram: (A)The diagram of 3D structure of PEDV S protein; (B)The diagram of docking active pocket; (C) Docking active pocket on PEDV S protein was colored red; (D) Schematic diagram of interaction between peptide P6 and PEDV S1-CTD protein; (E) The H-bond interactions between the ligands and target residues of protein were indicated by dotted yellow lines.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-4183177/v1/ea04c032b40d6373648cd2c6.png"},{"id":54370964,"identity":"012babc2-565e-4cb7-9b13-9b4e1c8b9a13","added_by":"auto","created_at":"2024-04-09 13:12:58","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":39873,"visible":true,"origin":"","legend":"\u003cp\u003eIdentification of conjugation efficiency between affinity peptides and nanoparticles. (A) Coupling efficiency of different concentrations of peptide P6 with PLGA nanoparticles. (B) peptide P6 load adsorption lines on nanoparticles.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-4183177/v1/0737dfaf58d8c9a5a2d681bd.png"},{"id":54372449,"identity":"73ef7d33-7214-438a-9b2e-48a130d3a1a2","added_by":"auto","created_at":"2024-04-09 13:20:58","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":7698,"visible":true,"origin":"","legend":"\u003cp\u003eThe cytotoxicity of P6-PLGA nanoparticles on vero cells. Vero cell viability was measured by CCK-8. All the CCK-8 values were normalized based on the control (with no P6-PLGA nanoparticles which represents 100% cell viability).\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-4183177/v1/f1b74973cd34f2e11904e149.png"},{"id":54372450,"identity":"1f6bcb8b-fead-414d-9ea9-0febace46bb5","added_by":"auto","created_at":"2024-04-09 13:20:58","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":276375,"visible":true,"origin":"","legend":"\u003cp\u003eInhibitory effect of P6-PLGA nanoparticles against PEDV (CH/hubei/2016strain) at the nucleic acid level.\u003c/p\u003e\n\u003cp\u003e(A)\u0026nbsp; A Schematic diagram of P6-PLGA antiviral experiments.\u003c/p\u003e\n\u003cp\u003ea: \u003cstrong\u003eVirus pretreatment: \u003c/strong\u003ePEDV of 0.01MOI and P6-PLGA were equivalent volume pre-incubated at 37 ℃ for 1 h, after 1 h of action on the cells, the medium was discarded,adding cell maintenance fluid and culturing to 12 h; b:\u003cstrong\u003e Cell pretreatment:\u003c/strong\u003e The cells were treated with P6-PLGA at 37 °C for 1 h, then PEDV of 0.01MOI was incubated for 1 h and cultured to 12 h; c:\u003cstrong\u003e Co-treatment: \u003c/strong\u003ePEDV of 0.01MOI was incubated with P6-PLGA at 4 °C for 1 h and then the samples were collected.\u003c/p\u003e\n\u003cp\u003e(B) Recombinant PEDV variant strain plasmid DNA standard curve for variant PEDV strain, slope=−3.428, R\u003csup\u003e2\u003c/sup\u003e=0.993. 1: 1.2 × 10\u003csup\u003e1\u003c/sup\u003e; 2: 1.2 × 10\u003csup\u003e2\u003c/sup\u003e; 3: 1.2 × 10\u003csup\u003e3\u003c/sup\u003e; 4: 1.2 × 10\u003csup\u003e4\u003c/sup\u003e; 5: 1.2 × 10\u003csup\u003e5\u003c/sup\u003e; 6: 1.2 × 10\u003csup\u003e6\u003c/sup\u003e; 7: 1.2 × 10\u003csup\u003e7\u003c/sup\u003e; 8: 1.2 × 10\u003csup\u003e8\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003e(C) Vero cells were infected with a mixture of virus and increasing concentrations of P6-PLGA at 400 μg/mL, they were pre-incubated at 37 °C for 1 h, and then inoculated onto the cells for 1 h, washed 3 times/well with PBS and replaced with maintenance medium containing 2 % FBS to 12h.\u003c/p\u003e\n\u003cp\u003e(D) Vero cells were infected with a mixture of virus and increasing concentrations of P6-PLGA at 400 μg/mL, they were pre-incubated at 37 °C for 1 h, and then inoculated onto the cells for 1 h, washed 3 times/well with PBS and replaced with maintenance medium containing 2 % FBS to 12h.\u003c/p\u003e\n\u003cp\u003e(E) Vero cells were infected with a mixture of virus and increasing concentrations of P6-PLGA at 400 μg/mL, they were pre-incubated at 37 °C for 1 h, and then inoculated onto the cells for 1 h, washed 3 times/well with PBS and replaced with maintenance medium containing 2 % FBS to 12h.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-4183177/v1/c24818893298288fe4cf04cb.png"},{"id":54369586,"identity":"37ca2803-6166-40a0-b154-36c2e6c77fec","added_by":"auto","created_at":"2024-04-09 13:04:58","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":96144,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of P6-PLGA nanoparticles on the absorption of PEDV. The N-protein levels of PEDV in P6-PLGA nanoparticles-treated cells were determined by western blotting. Proteins were separated by SDS-PAGE and then were probed with an antibody against either PEDV N or β-actin. M: Maker, 1-2: virus pretreatment group, 3-4: cell pretreatment group, 5-6: Virus treatment group.\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-4183177/v1/7f1517d26efae59ea3b52eb7.png"},{"id":54369587,"identity":"8d3cca30-2c0c-497b-bf52-eead30e26186","added_by":"auto","created_at":"2024-04-09 13:04:58","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":722974,"visible":true,"origin":"","legend":"\u003cp\u003eP6-PLGA nanoparticles have viricidal effect on PEDV. Absorption of PEDV (MOI = 0.01) in vero cells was determined by IFA at 12 h. Cells were fixed with 4% paraformaldehyde and stained with anti-PEDV-N antibody and FITC-conjugated secondary antibody (green); nuclei were stained blue with DAPI.(a) cells infected with PEDV of MOI 0.01;(b) mock-infected cells; (c) PEDV were incubated with P6-PLGA nanoparticles at the concentration of 400 μg/mL ( virus pretreatment); (d) the cells were incubated with P6-PLGA nanoparticles for 1 h at 37 °C and then the cells were infected with PEDV ( cell pretreatment),Scale bar,100 µm.\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-4183177/v1/4613fac4d566c71bb5ed32fc.png"},{"id":56960461,"identity":"26ed481a-5b04-4436-8552-fbaad1c7d2cc","added_by":"auto","created_at":"2024-05-22 17:35:19","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2714653,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4183177/v1/28020b51-aea9-47c8-9e7b-b1fafbc52493.pdf"},{"id":54369588,"identity":"3450991e-5429-47f1-adc8-aa614768a137","added_by":"auto","created_at":"2024-04-09 13:04:58","extension":"zip","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":6933150,"visible":true,"origin":"","legend":"","description":"","filename":"supplementaryfileWBoriginaldrawing.zip","url":"https://assets-eu.researchsquare.com/files/rs-4183177/v1/12d65562a92516c38e12609e.zip"}],"financialInterests":"No competing interests reported.","formattedTitle":"Preparation and evaluation of peptide-PLGA nanoparticles on porcine epidemic diarrhea virus infection","fulltext":[{"header":"1 Introduction","content":"\u003cp\u003ePorcine epidemic diarrhea virus (PEDV) is a member of the coronavirus family, which can cause porcine epidemic diarrhea disease (PED). The clinical symptoms are vomiting, watery diarrhea, and severe dehydration death[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Before 2010, PEDV was an endemic infectious disease and had not received enough attention in China. However, after 2010, the continuous emergence of porcine epidemic diarrhea variant strains has caused serious losses in China 's pig industry[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e], especially in the late autumn and early winter when the temperature is low. The virus mainly encodes four structural proteins: spike protein (S), nucleocapsid protein (N), membrane protein (M) and envelope protein (E)[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Among them, S protein is processed into S1 and S2 subunits by trypsin-like host cell protease, the former (S1) plays an important mediating role in virus attachment to host cells[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. The S1-CTD region is also one of the key targets for the development of antiviral drugs for PEDV, however, due to the differences in antigen, genetics (differences in amino acid mutations between S1-NTD proteins) and phylogeny (G1 vs G2) between existing vaccines and current epidemic strains[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e], PEDV vaccines can only provide low to medium immune efficacy[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e], so other methods are needed to assist vaccines in preventing and controlling the occurrence of PEDV.\u003c/p\u003e \u003cp\u003eSmall molecular peptides are the focus of research in recent years, and targeting the two stages of virus adsorption and nucleic acid replication to design antiviral peptides is an effective means to reduce PEDV infection. Peptides not only have the advantages of simple structure, small molecular weight, easy synthesis and modification, but also have high cell membrane penetration, no cytotoxicity and low immunogenicity[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. At present, the commonly used methods for screening peptides include phage display[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e], mRNA display[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e], ribosome display[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e], combinatorial chemistry[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e] and computer virtual screening. Compared with other screening methods, computer virtual screening technology predicts the binding strength and affinity between peptides and proteins by simulating the interaction between peptides and proteins. This method does not require the synthesis of peptides, which not only reduces the screening intensity, but also shortens the development cycle and saves manpower and energy[\u003cspan additionalcitationids=\"CR16 CR17\" citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Molecular docking technology is one of the most commonly used strategies in computer virtual screening methods. Obtaining bioactive peptides through this technology has been widely used in various fields, such as drug delivery, protein purification, etc[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e].\u003c/p\u003e \u003cp\u003ePolylactic acid-co-glycolic acid (PLGA) is a multifunctional copolymer composed of synthetic lactic acid and glycolic acid monomers. It has good biocompatibility, biodegradability, sustained release, easy surface modification, and non-toxic side effects and protects the entrapped vaccine from proteases mediated degradation at mucosal surfaces[\u003cspan additionalcitationids=\"CR21\" citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. It can be used to make drug sustained-release carriers, which is mainly the delivery of antigens, such as proteins, deoxyribonucleic acid (DNA) and peptides[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. As an injection drug system approved by the US Food and Drug Administration (FDA) and the European Medicines Agency (EMA), the safety and efficacy of PLGA have been widely confirmed and have a wide range of uses in scientific research. In addition, PLGA can prevent the encapsulated drug from being biodegraded and interacting with other conjugated parts[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e].Therefore, the encapsulation of drugs in PLGA nanoparticles will not affect the therapeutic effect and biological properties of the conjugates.\u003c/p\u003e \u003cp\u003eIn this study, the peptide(P6) targeting S1-CTD region of porcine epidemic diarrhea virus (PEDV), which have obtained by using computer virtual screening technology (SYBYL-X 2.0 program) in previous research articles, and conjugated it to PLGA nanoparticles by dehydration synthesis, and assembled the P6-PLGA nanoparticles. Furthermore, we identified the P6-PLGA nanoparticles on PEDV infection.\u003c/p\u003e"},{"header":"2 Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e\u003cb\u003e2.1 Materials\u003c/b\u003e\u003c/h2\u003e \u003cp\u003eThe peptide P6 was synthesized and purified to at least 90% by GL Biochem (Shanghai, China). PLGA nanoparticles (particle size: 120 nm, carboxyl end modification) were purchased from Sunna Biotechnology, Ltd. (Shanghai, China). The 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC) and N-hydroxysuccinimide (NHS) were purchased from Thermo Scientific (TMO, USA). BCA Protein Assay Kit was purchased from Solarbio (Beijing, China). Meilun cell-counting kit-8 (CCK-8) was purchased from Bergolin (dalian, China). PerfectStart\u0026reg; Uni RT\u0026amp;qPCR Kit was purchased from TransGen Biotech (Beijing China). Figure\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e presents a schematic diagram of the preparation process of the P6-PLGA nanoparticles and its evaluation of antiviral effect evaluation. All other experimental materials used, like qRT-PCR, Western blot, IFA and so on, were mentioned in detail in the previous article[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e].\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2 Preparation of P6-PLGA Nanoparticle\u003c/h2\u003e \u003cp\u003eAn amount of 5 mg of PLGA nanoparticles (about 4 ml) was dialyzed overnight in a NaH2PO4 (pH 6.0) solution at 4\u0026deg;C and then transferred to a 10 mL centrifuge tube. 10 \u0026micro;L of NHS solution (50 mg/mL) and 10 \u0026micro;L of EDC solution (50 mg/mL) were added to it and mixed upside down at room temperature for 20 min. After centrifugation, the supernatant was removed as well as peptides solution (400 \u0026micro;g peptides/mg particles) was added to the particles and mixed upside down at room temperature for 4 h (thorough mixing between peptide P6 and PLGA nanoparticles). The mixture was dialyzed overnight in PBS to remove the uncoupled peptides and NHS or EDC, generating the PLGA-P6 nanoparticles after centrifugation[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3 Coupling efficiency of P6 with nanoparticles\u003c/h2\u003e \u003cp\u003eThe peptide P6 was diluted with PBS to 100 \u0026micro;g/ml, 200 \u0026micro;g/ml, 400 \u0026micro;g/ml, 800 \u0026micro;g/ml, 1000 \u0026micro;g/ml, 1600 \u0026micro;g/ml, 2000 \u0026micro;g/ml, 3200 \u0026micro;g/ml, 5000 \u0026micro;g/ml, 6400 \u0026micro;g/ml, respectively, and coupled with the same volume of PLGA. The supernatant of the solution after the reaction of peptide P6 with the PLGA nanoparticles was retained. Coupling efficiency was calculated by BCA Protein Assay Kit ((Solarbio, Beijing, China) and calculation formula was as follows:\u003c/p\u003e \u003cp\u003eCoupling efficiency\u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(=\\frac{\\text{C}0-\\text{C}1}{\\text{C}0}\\)\u003c/span\u003e\u003c/span\u003e\u0026times;100%\u003c/p\u003e \u003cp\u003eIn the formula, C0 and C1 were the concentration of peptide P6 solution before and after coupling with PLGA nanoparticles, respectively.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4 Cytotoxicity Assay\u003c/h2\u003e \u003cp\u003eThe cytotoxic effects of P6-PLGA nanoparticles on vero cells was assessed using the Meilun Cell Counting Kit-8 (Dalian, China). Vero cells were cultured in 96-well plates at a density of 1.0 \u0026times; 10\u003csup\u003e4\u003c/sup\u003e cells/well until they grew into a single layer. Subsequently, the culture medium was removed, washed with PBS three times, and added serial dilutions (100 \u0026micro;g/ml, 200 \u0026micro;g/ml, 400 \u0026micro;g/ml, 800 \u0026micro;g/ml, 1000 \u0026micro;g/ml) of the P6-PLGA nanoparticles in each corresponding well. 10 \u0026micro;L CCK-8 solution was added to each well and the cells were incubated for a further 1 h at 37\u0026deg;C. The samples were analyzed by reading the optical density at 450 nm using fully automated multifunctional microplate reader (Offenburg, Germany). The cell viability was analyzed by GraphPad Prism 8.0.2 (GraphPad Software).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e\u003cb\u003e2.\u003c/b\u003e5 \u003cb\u003eAbsolute Quantification Real-Time PCR Assay\u003c/b\u003e\u003c/h2\u003e \u003cp\u003eTo assess the inhibitory effects of P6-PLGA nanoparticles at attachment stage of PEDV infection, three different methods of treatment were tested with 400 \u0026micro;g/ml P6-PLGA nanoparticles on Vero cell.\u003c/p\u003e \u003cp\u003e(ⅰ) For virus pretreatment, the virus was first incubated with P6-PLGA nanoparticles for 1 h at 37\u0026deg;C and then inoculated onto the cells for 1 h at 37\u0026deg;C again. The medium was removed at 1 h later and washed with phosphate-buffered saline (PBS) three times. Subsequently, the cells were cultured with 2% FBS DMEM to 12 h. (ⅱ) For cell pretreatment, the cells were incubated with P6-PLGA nanoparticles for 1 h at 37\u0026deg;C and then washed thoroughly with phosphate-buffered saline (PBS) three times. The cells then were infected with 0.01MOI PEDV for 1 h at 37\u0026deg;C and washed with phosphate-buffered saline (PBS) three times after 1 h. Subsequently, the cells were cultured with 2% FBS DMEM to 12 h. (ⅲ) For coincubation, the cells were incubated with P6-PLGA nanoparticles in the presence of 0.01MOI PEDV for 1 h at 4\u0026deg;C, and 1 h later, the medium was removed and washed with phosphate-buffered saline (PBS) three times, then the cells were collected.\u003c/p\u003e \u003cp\u003eTotal RNAs were extracted from the cells in a 24-well plate by using TransZol Up according to the manufacturer\u0026rsquo;s instructions. PerfectStart\u0026reg; Uni RT\u0026amp;qPCR Kit was used to synthesize cDNA. The virus N gene in cell(copies) was assessed in triplicate by PerfectStart\u0026reg; ⅡProbe qPCR SuperMix UDG using ABI 7500 Fast Real-time Fluorescent Quantitative PCR System. Primer and probe sequences are shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimers and probes used for the duplex TaqMan probe-based real-time RT-PCR.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimer Name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequence (5\u0026prime;-3\u0026prime;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eN-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCGCAAAGACTGAACCCACTAAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eN-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTGCCTCTGTTGTTACTTGGAGAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eProbe Name\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequence (5\u0026prime;-3\u0026prime;)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePEDV N\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGTTGCCATTACCACGACTCCTGC 5'fam- 3'BHQ3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6 Western Blot Assay\u003c/h2\u003e \u003cp\u003eThe total cellular proteins were extracted using RIPA lysis buffer (Beyotime). Proteins were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis and then transferred to polyvinylidene difluoride membranes. The membranes were blocked with 5% nonfat milk for 2 h at room temperature, washed with PBST (PBS containing 0.5\u0026permil;Tween 20), and then incubated with a primary antibody ( anti-PEDV-N or β-actin) overnight at 4 ℃. After repeated washes with PBST, the membranes were further incubated for 1 h with a secondary antibody (HRP-anti-mouse IgG). The target protein bands were then analyzed using Vilber Fusion FX chemiluminescence gel imager. The level of target protein expression was analyzed using ImageJ software (National Institutes of Health, Bethesda, MD, USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.7 Immunofluorescence Assay\u003c/h2\u003e \u003cp\u003eCells were fixed with 4% paraformaldehyde at 4 ℃ for 30 min, incubated with 0.2% TritonX-100 at a room temperature for 15 min, washed with PBST three times, blocked with 5% nonfat dry milk in PBST for 2 h at 37\u0026deg;C, and incubated with anti-PEDV-N antibody for 1 h at 37\u0026deg;C. The cells were then washed with PBST three times, incubated with fluorescence-conjugated goat anti-mouse IgG secondary antibody for 1 h at 37\u0026deg;C, and then incubated with 2-(4-Amidinophenyl)-6-indolecarbamidine dihydrochloride (DAPI, Beyotime) for 15 min at RT after washing with PBST three times. The stained cells were examined using a fluorescence microscope(Leica, Germany.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.8 Statistics\u003c/h2\u003e \u003cp\u003eAll experiments were evaluated and analysed by GraphPad Prism 8.0.2 software (GraphPad Software). Statistical analyses were performed using one-way ANOVA or student\u0026rsquo;s t-test. All experiments results were used as means and standard deviations (SD) as well as performed with three independent replicates. The statistical significances were defined as p\u0026thinsp;\u0026lt;\u0026thinsp;0.05 (*), and the higher significance was denoted by p\u0026thinsp;\u0026lt;\u0026thinsp;0.01 (**), p\u0026thinsp;\u0026lt;\u0026thinsp;0.001 (***), p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001 (****).\u003c/p\u003e \u003c/div\u003e"},{"header":"3 Results","content":"\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\n\u003ch2\u003e\u003cstrong\u003e3.1 Design of the PEDV S Peptides\u003c/strong\u003e\u003c/h2\u003e\n\u003cp\u003eThe crystal structure of PEDV S protein (PDB ID: 6U7K) is shown in \u003cstrong\u003eFigure 2A\u003c/strong\u003e[26]. Since the amino acid sequence of the C-terminal 505-642 of the PEDV S1 protein is relatively conserved among different PEDV variant strains, which is selected as the docking pocket (the red region in \u003cstrong\u003eFigure 2B-D\u003c/strong\u003e was the selected docking pocket). After molecular docking using Surflex-Dock program in SYBYL-X 2.1.1 software, the affinity of PEDV S docking pocket and peptide was evaluated by consensus scoring function and displayed by Total _ Score value. Total _Score is the total score of Surflex-Dock, expressed as \u0026minus; log (Kd), indicating the affinity of the ligand to the protein. The interaction between polypeptides and PEDV S protein was analyzed by PyMOL software and MOLCAD program of SYBYL-X 2.1.1. The results showed that the key to the optimal peptide binding of peptide P6 to PEDV protein was the multipolar bond between them (\u003cstrong\u003eFigure 2E\u003c/strong\u003e).\u0026nbsp;\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\n\u003ch2\u003e3.2 Protein Binding Capacity\u003c/h2\u003e\n\u003cp\u003eAs shown in \u003cstrong\u003eFigure 3A-B,\u003c/strong\u003e with the increase of peptide concentration (200-6400 \u0026mu;g/100ul), the coupling efficiency with PLGA nanoparticles also increased, up to 86 %, and the number of peptides coupled to PLGA nanoparticles also increased accordingly, up to 6.373ug. On the contrary, the lower the peptide concentration was, the worse the coupling efficiency was, and the lowest was 19 %. The number of peptides coupled to PLGA nanoparticles also decreased, and the lowest was 0.148 ug. Therefore, in order to ensure the coupling amount of peptide P6, as many peptide ligands as possible should be coupled to PLGA nanoparticles.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\n\u003ch2\u003e3.3 Cytotoxicity Test\u003c/h2\u003e\n\u003cp\u003eCell Counting Kit-8(CCK-8) is widely used to access the cell proliferation and cytotoxicity. The cell viability of P6-PLGA was evaluated using vero cell lines. The untreated cells (contains 10% CCK-8 solution) were used as a negative control as well as cell-free (contains 10% CCK-8 solution) was blank control. The vero cells were incubated with different concentration of P6-PLGA for 24 h. It was observed that the cell viability was largely maintained after incubating the vero cells with the formulations as shown in the in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003e. However, the vero cell viability slightly decreased with the increase in concentration of P6-PLGA. Compared with other groups, the vero cell viability was maintained above 85% when exposed at the concentration of 2000 \u0026micro;g/mL and 1600 \u0026micro;g/mL. The slight cytotoxicity of its might be due to the concentration of coupling P6 peptide is too high. However, when the concentrations at 100 \u0026micro;g/mL, 200 \u0026micro;g/mL, 400 \u0026micro;g/mL,800 \u0026micro;g/mL,1000 \u0026micro;g/mL, the cell viability of P6-PLGA was more than 90%. Thus, the concentration below 1000 \u0026micro;g/mL was used for subsequent experiments.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\n\u003ch2\u003e3.4 Attachment of PEDV affected by P6-PLGA\u003c/h2\u003e\n\u003cp\u003eDue to the effective safe concentration range of P6-PLGA nanoparticles was determined, we further explored whether P6-PLGA nanoparticles had a direct viricidal effect on the stage of PEDV attachment through qRT-PCR, Western blotting and IFA experiments. The results suggested that treatment with P6-PLGA nanoparticles led to a significant reduction in viral load in a dose-dependent manner. Among them, as shown \u003cstrong\u003ein\u003c/strong\u003e Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eA-E, in the case of virus pretreatment, the copy number of viral N protein gene decreased by about 2.43 times after the cells were treated with 400 \u0026micro;g/mL P6-PLGA for 12 h (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01). When the cells were pretreated, the copy number of viral N protein gene was reduced by about 1.89 times (P\u0026thinsp;\u0026lt;\u0026thinsp;0.001) after the cells were treated with 400 \u0026micro;g/mL P6-PLGA for 12 h compared with the control group. The copy number of viral N protein gene decreased by about 1.07 times (P\u0026thinsp;\u0026gt;\u0026thinsp;0.05) under circumstances of co-treatment. In addition, Western blotting results showed that compared with the control group, the levels of N protein in PEDV-infected Vero E6 cells in a dose-dependent manner, and the N protein of PEDV expression levels significantly decreased with 400 \u0026micro;g/mL P6-PLGA (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003e) Similarly, IFA results also showed the inhibitory effect of P6-PLGA on PEDV (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003e). Therefore, these results indicate that P6-PLGA reduces PEDV infection by blocking PEDV adsorption.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTotal RNA was then extracted from the cells, viral N gene was quantified by qRT-PCR, using the primer sets described in Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"4 Discussion","content":"\u003cp\u003eIn recent years, the prevalence of viral infectious diseases such as novel coronavirus[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e], influenza virus, and African swine fever virus[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e] has caused serious negative impacts on human and animal health worldwide. PEDV is a member of the coronavirus, coronavirus infection is mediated by its outer membrane protein S, which is further cleaved into S1 and S2 subunits by endogenous and / or exogenous proteases[\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. The S1 subunit recognizes and binds to the corresponding host receptor, while the S2 subunit mediates membrane fusion between the virus and the host cell[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e], S1 contains two independent regions, the N-terminal region (S1-NTD) and the C-terminal region (S1-CTD)[\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. The S1-NTD and S1-CTD of coronavirus play an important role in recognition and binding to cell receptors, and the latter is one of the important targets for the development of antiviral drugs for PEDV. However, since 2010, different types of PEDV variants have emerged in many countries, which has seriously hindered the development of the global pig industry[\u003cspan additionalcitationids=\"CR35 CR36 CR37\" citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. In view of the fact that the PEDV vaccine currently on the market does not provide sufficient immune protection for pigs, there is an urgent need for effective prevention and treatment drugs to assist the vaccine in blocking PEDV infection.\u003c/p\u003e \u003cp\u003eAs affinity ligands, peptides have the characteristics of small molecular weight, easy synthesis, no immunogenicity and no cytotoxicity. Therefore, the selection of the key domains of the target protein that can specifically bind to the peptide ligand is the primary task in the design and screening of peptide ligands. In order to quickly obtain the best peptide ligands with good specificity and high affinity, the most commonly used high-throughput screening methods mainly include phage display technology, mRNA display technology, DNA display technology, combinatorial chemistry technology and computer virtual screening technology[\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. In comparison, computer virtual screening technology has many incomparable advantages, such as simple and rapid operation, reducing the workload of peptide screening, shortening the development cycle, and improving the success rate of screening[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. It is regarded as an improvement and development of traditional high-throughput screening technology, and has also been applied in many fields. Molecular docking technology is one of the commonly used methods of computer virtual screening. Therefore, this study is the first attempt to use molecular docking technology for virtual screening to design affinity peptides with strong antiviral activity against PEDV infection.\u003c/p\u003e \u003cp\u003eNanoparticles not only have adjuvant properties, but also can improve the efficiency of drug or vaccine delivery[\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. Poly (lactic-co-glycolic acid) PLGA is a biodegradable functional polymer organic compound composed of synthetic lactic acid and glycolic acid monomers. At present, carboxyl-modified PLGA nanoparticles are the most commonly used microsphere carriers for coupling proteins[\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e], peptides[\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e, \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e], vitamins[\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e] and other organic substances. However, due to its special chemical properties, peptides have poor stability, unstable biological activity and poor biocompatibility in vivo. The PLGA microsphere carrier can effectively improve these problems and also prolong the half-life of the drug. Related studies have also proved that it can effectively induce protective immune response [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e, \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]and protect the encapsulated vaccine from protease degradation through mucosal and systemic pathways. Therefore, the use of PLGA microspheres as a carrier to package peptide drugs is a promising research direction.\u003c/p\u003e \u003cp\u003eIn our study, a high-affinity peptide P6 targeting the PEDV S1-CTD region was obtained by molecular docking technology, and it was covalently coupled with PLGA nanoparticles containing carboxyl groups to obtain P6-PLGA nanoparticles. However, considering that the purpose of our experiment is to block the adsorption of virus, we finally used virus pretreatment, cell pretreatment and co-treatment to evaluate the ability of P6-PLGA nanoparticles to prevent PEDV infection in vitro. The results showed that the higher the concentration of peptide P6, the higher the coupling efficiency with PLGA. However, the CCK-8 cell survival rate test results showed that when the concentration of P6-PLGA nanoparticles exceeded 1000 \u0026micro;g/mL, the cell survival rate was only 85%. In addition, qRT-PCR, western blotting and IFA results showed that P6-PLGA nanoparticles could significantly block PEDV adsorption in vitro. The main reason is that PLGA nanoparticles with a size of about 120 nm have a large steric hindrance, which can effectively block the binding of PEDV to protein peptide receptor aminopeptidase N (APN), etc., thereby preventing the infection of porcine epidemic diarrhea virus. On the other hand, in our previous study, peptide P6 and 110766 designed to target the PEDV S1-CTD region could significantly inhibit PEDV infection. More importantly, PLGA nanoparticles can not only improve the bioavailability of peptide drugs and prolong their half-life, but also avoid the degradation of peptides by some enzymes after entering the animal body. At the same time, it can also achieve targeted drug delivery and reduce the non-targeted local effects of drugs. Therefore, our study revealed a screening strategy for designing antiviral peptides targeting the PEDV S1-CTD region, and determined that P6-PLGA nanoparticles can be used as a promising antiviral candidate drug, laying a solid foundation for subsequent animal experiments.\u003c/p\u003e"},{"header":"5 Conclusions","content":"\u003cp\u003eTargeted PEDV S1-CTD region designing and screening of antiviral peptides can provide auxiliary comprehensive prevention and control measures for the current epidemic of PEDV, that is, reducing the risk of PEDV infection through synergy (vaccine\u0026thinsp;+\u0026thinsp;antiviral peptide). Therefore, we designed and synthesized 53 high-affinity peptides by molecular docking technology, among which peptide P6 had significant antiviral effect in vitro (in the pre-experiment). In order to realize the clinical application value of peptide drugs, it was covalently coupled with PLGA nanoparticles containing carboxyl groups on the surface. The final in vitro test results showed that 400 \u0026micro;g/mL P6-PLGA nanoparticles could significantly block the adsorption of PEDV. Therefore, this study provides a strong reference for the development of subsequent animal experiments, and further promotes the clinical application of antiviral peptides.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003ch2\u003eCompeting interests\u003c/h2\u003e \u003cp\u003eAll authors declare that No conflict of interest exists.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e \u003cp\u003eThis research was supported by Fund for Distinguished Young Scholars from Henan Academy of Agricultural Sciences (No. 2024JQ03).\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eQX, FYW and GPZwang designed this study.QX, FYW, HF and QW performed the experiments.QX and FYW wrote the manuscript and prepared all figures.XFS and GXX contributed to analysis of the data and discussion of the results, QX revised the manuscript.All authors reviewed the manuscript.\u003c/p\u003e\u003ch2\u003eAvailability of data and materials\u003c/h2\u003e \u003cp\u003eThe manuscript was finished by contributions of all authors. In this study, all data obtained or analyzed are available from the corresponding author on reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eWang T, Zheng G, Chen Z, Wang Y, Zhao C, Li Y, et al. Drug repurposing screens identify Tubercidin as a potent antiviral agent against porcine nidovirus infections. Virus Res. 2024;339:199275.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi W, Li H, Liu Y, Pan Y, Deng F, Song Y, et al. New variants of porcine epidemic diarrhea virus, China, 2011. Emerg Infect Dis. 2012;18:1350\u0026ndash;3.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWeiss S, Witkowski PT, Auste B, Nowak K, Weber N, Fahr J, et al. Hantavirus in bat, Sierra Leone. Emerg Infect Dis. 2012;18:159\u0026ndash;61.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePark SJ, Kim HK, Song DS, An DJ, Park BK. Complete genome sequences of a Korean virulent porcine epidemic diarrhea virus and its attenuated counterpart. J Virol. 2012;86:5964.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSong D, Park B. Porcine epidemic diarrhoea virus: a comprehensive review of molecular epidemiology, diagnosis, and vaccines. Virus Genes. 2012;44:167\u0026ndash;75.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang Y, Chen Y, Zhou J, Wang X, Ma L, Li J et al. Porcine Epidemic Diarrhea Virus: An Updated Overview of Virus Epidemiology, Virulence Variation Patterns and Virus-Host Interactions. Viruses. 2022;14.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGerdts V, Zakhartchouk A. Vaccines for porcine epidemic diarrhea virus and other swine coronaviruses. Vet Microbiol. 2017;206:45\u0026ndash;51.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang Q, Vlasova AN, Kenney SP, Saif LJ. Emerging and re-emerging coronaviruses in pigs. Curr Opin Virol. 2019;34:39\u0026ndash;49.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLowe CR, Burton SJ, Burton NP, Alderton WK, Pitts JM, Thomas JA. Designer dyes: 'biomimetic' ligands for the purification of pharmaceutical proteins by affinity chromatography. Trends Biotechnol. 1992;10:442\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSmith GP. Filamentous fusion phage: novel expression vectors that display cloned antigens on the virion surface. Science. 1985;228:1315\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRoberts RW, Szostak JW. RNA-peptide fusions for the in vitro selection of peptides and proteins. Proc Natl Acad Sci U S A. 1997;94:12297\u0026ndash;302.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHanes J, Pl\u0026uuml;ckthun A. In vitro selection and evolution of functional proteins by using ribosome display. Proc Natl Acad Sci U S A. 1997;94:4937\u0026ndash;42.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHe M, Taussig MJ. Antibody-ribosome-mRNA (ARM) complexes as efficient selection particles for in vitro display and evolution of antibody combining sites. Nucleic Acids Res. 1997;25:5132\u0026ndash;4.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu R, Li X, Lam KS. Combinatorial chemistry in drug discovery. Curr Opin Chem Biol. 2017;38:117\u0026ndash;26.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLyne PD. Structure-based virtual screening: an overview. Drug Discov Today. 2002;7:1047\u0026ndash;55.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSammond DW, Bosch DE, Butterfoss GL, Purbeck C, Machius M, Siderovski DP, et al. Computational design of the sequence and structure of a protein-binding peptide. J Am Chem Soc. 2011;133:4190\u0026ndash;2.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTinberg CE, Khare SD, Dou J, Doyle L, Nelson JW, Schena A, et al. Computational design of ligand-binding proteins with high affinity and selectivity. Nature. 2013;501:212\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVanhee P, van der Sloot AM, Verschueren E, Serrano L, Rousseau F, Schymkowitz J. Computational design of peptide ligands. Trends Biotechnol. 2011;29:231\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang F, Hu M, Li N, Sun X, Xing G, Zheng G, et al. Precise Assembly of Multiple Antigens on Nanoparticles with Specially Designed Affinity Peptides. ACS Appl Mater Interfaces. 2022;14:39843\u0026ndash;57.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDanhier F, Ansorena E, Silva JM, Coco R, Le Breton A, Preat V. PLGA-based nanoparticles: an overview of biomedical applications. J Control Release. 2012;161:505\u0026ndash;22.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLu JM, Wang X, Marin-Muller C, Wang H, Lin PH, Yao Q, et al. Current advances in research and clinical applications of PLGA-based nanotechnology. Expert Rev Mol Diagn. 2009;9:325\u0026ndash;41.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eThomasin C, Corradin G, Men Y, Merkle HP, Gander B. Tetanus toxoid and synthetic malaria antigen containing poly(lactide)/poly(lactide-co-glycolide) microspheres: importance of polymer degradation and antigen release for immune response. J Controlled Release. 1996;41:131\u0026ndash;45.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVarshochian R, Jeddi-Tehrani M, Mahmoudi AR, Khoshayand MR, Atyabi F, Sabzevari A, et al. The protective effect of albumin on bevacizumab activity and stability in PLGA nanoparticles intended for retinal and choroidal neovascularization treatments. Eur J Pharm Sci. 2013;50:341\u0026ndash;52.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDhoke DM, Basaiyye SS, Khedekar PB. Development and characterization of L-HSA conjugated PLGA nanoparticle for hepatocyte targeted delivery of antiviral drug. J Drug Deliv Sci Technol. 2018;47:77\u0026ndash;94.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXu Q, Wang F, Jiao W, Zhang M, Xing G, Feng H et al. Virtual Screening-Based Peptides Targeting Spike Protein to Inhibit Porcine Epidemic Diarrhea Virus (PEDV) Infection. Viruses. 2023;15.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWrapp D, McLellan JS. The 3.1-Angstrom Cryo-electron Microscopy Structure of the Porcine Epidemic Diarrhea Virus Spike Protein in the Prefusion Conformation. J Virol. 2019;93.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu F, Zhao S, Yu B, Chen YM, Wang W, Song ZG, et al. Author Correction: A new coronavirus associated with human respiratory disease in China. Nature. 2020;580:E7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou P, Yang XL, Wang XG, Hu B, Zhang L, Zhang W, et al. A pneumonia outbreak associated with a new coronavirus of probable bat origin. Nature. 2020;579:270\u0026ndash;3.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDixon LK, Stahl K, Jori F, Vial L, Pfeiffer DU. African Swine Fever Epidemiology and Control. Annu Rev Anim Biosci. 2020;8:221\u0026ndash;46.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou X, Li N, Luo Y, Liu Y, Miao F, Chen T, et al. Emergence of African Swine Fever in China, 2018. Transbound Emerg Dis. 2018;65:1482\u0026ndash;4.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMillet JK, Whittaker GR. Host cell proteases: Critical determinants of coronavirus tropism and pathogenesis. Virus Res. 2015;202:120\u0026ndash;34.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBrian DA, Baric RS. Coronavirus genome structure and replication. Curr Top Microbiol Immunol. 2005;287:1\u0026ndash;30.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi F. Evidence for a common evolutionary origin of coronavirus spike protein receptor-binding subunits. J Virol. 2012;86:2856\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang YW, Dickerman AW, Pi\u0026ntilde;eyro P, Li L, Fang L, Kiehne R, et al. Origin, evolution, and genotyping of emergent porcine epidemic diarrhea virus strains in the United States. mBio. 2013;4:e00737\u0026ndash;13.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJung K, Saif LJ, Wang Q. Porcine epidemic diarrhea virus (PEDV): An update on etiology, transmission, pathogenesis, and prevention and control. Virus Res. 2020;286:198045.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLin CM, Saif LJ, Marthaler D, Wang Q. Evolution, antigenicity and pathogenicity of global porcine epidemic diarrhea virus strains. Virus Res. 2016;226:20\u0026ndash;39.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSun RQ, Cai RJ, Chen YQ, Liang PS, Chen DK, Song CX. Outbreak of porcine epidemic diarrhea in suckling piglets, China. Emerg Infect Dis. 2012;18:161\u0026ndash;3.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang D, Fang L, Xiao S. Porcine epidemic diarrhea in China. Virus Res. 2016;226:7\u0026ndash;13.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMerrifield RB. Solid-phase peptide synthesis. Adv Enzymol Relat Areas Mol Biol. 1969;32:221\u0026ndash;96.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGupta RK, Chang AC, Siber GR. Biodegradable polymer microspheres as vaccine adjuvants and delivery systems. Dev Biol Stand. 1998;92:63\u0026ndash;78.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHe Y, Yang L, Yuan JJ, Zhu HH, Shao LY. [Effect of ultrasound contrast agent targeting gelatin on uptake of mouse ascites hepatocellular carcinoma cell lines with high lymphatic metastasis]. Zhonghua Zhong Liu Za Zhi. 2020;42:319\u0026ndash;24.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHong JKY, Schwendeman SP. Characterization of Octreotide-PLGA Binding by Isothermal Titration Calorimetry. Biomacromolecules. 2020;21:4087\u0026ndash;93.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSophocleous AM, Desai KG, Mazzara JM, Tong L, Cheng JX, Olsen KF, et al. The nature of peptide interactions with acid end-group PLGAs and facile aqueous-based microencapsulation of therapeutic peptides. J Control Release. 2013;172:662\u0026ndash;70.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi G, Wang Y, Tan G. The construction of EpCAM/vimentin-PLGA/lipid immunomagnetic microspheres and the isolation of circulating tumor cells from lung cancer. Int J Clin Exp Pathol. 2018;11:5561\u0026ndash;70.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEldridge JH, Gilley RM, Staas JK, Moldoveanu Z, Meulbroek JA, Tice TR. Biodegradable microspheres: vaccine delivery system for oral immunization. Curr Top Microbiol Immunol. 1989;146:59\u0026ndash;66.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSpiers ID, Eyles JE, Baillie LW, Williamson ED, Alpar HO. Biodegradable microparticles with different release profiles: effect on the immune response after a single administration via intranasal and intramuscular routes. J Pharm Pharmacol. 2000;52:1195\u0026ndash;201.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"porcine epidemic diarrhea virus, S1 C-terminal domain (CTD) protein, PLGA nanoparticles, antiviral peptides","lastPublishedDoi":"10.21203/rs.3.rs-4183177/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4183177/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003ePorcine epidemic diarrhea virus (PEDV) can cause diarrhea, dehydration and death in suckling piglets, which seriously affects the economic benefits of the production line. Therefore, it is urgent to find an economical and effective treatment to prevent and control PEDV.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003epeptide (P6), which could specifically target the S1 C-terminal domain (CTD) protein of porcine epidemic diarrhea virus (PEDV), was subsequently conjugated to poly (lactic-co-glycolic acid) (PLGA) by dehydration synthesis generating P6-PLGA nanoparticles and used cell counting kit-8 (CCK-8), real-time fluorescence quantitative PCR (qRT-PCR), Western blot and indirect immunofluorescence to further study the inhibitory effect of different concentrations of P6-PLGA nanoparticles on PEDV.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eThe results showed that cell viability was \u0026gt;\u0026thinsp;95% when treated with P6-PLGA nanoparticles at concentrations not exceeding 1000 \u0026micro;g/ml. Results of the absolute quantitative PCR revealed that the concentration of P6-PLGA nanoparticles at 400 \u0026micro;g/ml could significantly reduce the viral load of PEDV compared with the virus group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05 or p\u0026thinsp;\u0026lt;\u0026thinsp;0.001). Similarly, results of Western blot and indirect immunofluorescence also suggested that the antiviral effect of P6-PLGA nanoparticles at 400 \u0026micro;g/ml is still significant. Based on the above research, high affinity peptide (P6) was covalently coupled with PLGA particles to obtain P6-PLGA nanoparticles.\u003c/p\u003e\u003ch2\u003eConclusions\u003c/h2\u003e \u003cp\u003ePLGA as a drug delivery carrier combined with peptide (P6) can overcome the problems of poor stability, easy degradation or low bioavailability of peptide after entering the body, and provide a new strategy for the development of PEDV antiviral drugs.\u003c/p\u003e","manuscriptTitle":"Preparation and evaluation of peptide-PLGA nanoparticles on porcine epidemic diarrhea virus infection","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-04-09 13:04:53","doi":"10.21203/rs.3.rs-4183177/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"6511785a-8b2f-4218-bcf6-42c2b94c7c54","owner":[],"postedDate":"April 9th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-05-22T17:27:11+00:00","versionOfRecord":[],"versionCreatedAt":"2024-04-09 13:04:53","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4183177","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4183177","identity":"rs-4183177","version":["v1"]},"buildId":"-HB7Z8yhvgn0wM9Nzuekk","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.