SIRT2 suppressed osteogenesis via transcriptionally regulation of SLC31A1-meidated cuproptosis in a crotonylation manner

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher

Abstract

Abstract Osteoporosis (OP), a systemic disorder of bone metabolism characterized by impaired osteogenesis and excessive skeletal resorption, is increasingly linked to epigenetic regulation. Among these, histone crotonylation (Kcr) has emerged as a key determinant of gene expression and cellular differentiation, yet the role of histone H3 lysine 4 crotonylation (H3K4cr) in osteogenesis remains unclear. In this study, analysis of OP-related GEO datasets combined with validation in patient serum samples and an OP cell model identified Sirtuin (Sirt) 2, a histone deacetylase, as a central regulator of H3K4cr during bone formation. Functional assays, including Reverse Transcription Quantitative Real-Time Polymerase Chain Reaction (RT-qPCR), western blotting, Chromatin immunoprecipitation followed by quantitative PCR (ChIP-qPCR), luciferase reporter analyses, and in vivo studies using ovariectomized (OVX) rats, demonstrated that SIRT2 expression was elevated in OP and negatively correlated with osteogenic markers. Knockdown of SIRT2 increased H3K4cr levels, thereby enhancing osteogenic differentiation in vitro and promoting bone regeneration in OVX rats. Mechanistically, SIRT2-mediated H3K4 decrotonylation facilitated SLC31A1 transcription by alleviating the inhibitory effect of H3K4cr on E74-like factor 3 (ELF3) binding to the promoter. Elevated Copper transporter 1 (CTR1/SLC31A1) expression impaired osteogenesis by increasing intracellular copper accumulation and triggering cuproptosis, whereas copper chelation or SLC31A1 inhibition restored osteogenic potential both in vitro and in vivo. Collectively, these findings define a previously unrecognized SIRT2–H3K4cr–SLC31A1 axis that integrates epigenetic regulation with copper metabolism to modulate osteogenic differentiation, highlighting a promising therapeutic target for osteoporosis.
Full text 157,420 characters · extracted from preprint-html · click to expand
SIRT2 suppressed osteogenesis via transcriptionally regulation of SLC31A1-meidated cuproptosis in a crotonylation manner | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article SIRT2 suppressed osteogenesis via transcriptionally regulation of SLC31A1-meidated cuproptosis in a crotonylation manner Yong Wang, Hanjie Zhai, Chenghao Li, Yuxin Bao, Xin Zhang This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7734583/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Osteoporosis (OP), a systemic disorder of bone metabolism characterized by impaired osteogenesis and excessive skeletal resorption, is increasingly linked to epigenetic regulation. Among these, histone crotonylation (Kcr) has emerged as a key determinant of gene expression and cellular differentiation, yet the role of histone H3 lysine 4 crotonylation (H3K4cr) in osteogenesis remains unclear. In this study, analysis of OP-related GEO datasets combined with validation in patient serum samples and an OP cell model identified Sirtuin (Sirt) 2, a histone deacetylase, as a central regulator of H3K4cr during bone formation. Functional assays, including Reverse Transcription Quantitative Real-Time Polymerase Chain Reaction (RT-qPCR), western blotting, Chromatin immunoprecipitation followed by quantitative PCR (ChIP-qPCR), luciferase reporter analyses, and in vivo studies using ovariectomized (OVX) rats, demonstrated that SIRT2 expression was elevated in OP and negatively correlated with osteogenic markers. Knockdown of SIRT2 increased H3K4cr levels, thereby enhancing osteogenic differentiation in vitro and promoting bone regeneration in OVX rats. Mechanistically, SIRT2-mediated H3K4 decrotonylation facilitated SLC31A1 transcription by alleviating the inhibitory effect of H3K4cr on E74-like factor 3 (ELF3) binding to the promoter. Elevated Copper transporter 1 (CTR1/SLC31A1) expression impaired osteogenesis by increasing intracellular copper accumulation and triggering cuproptosis, whereas copper chelation or SLC31A1 inhibition restored osteogenic potential both in vitro and in vivo. Collectively, these findings define a previously unrecognized SIRT2–H3K4cr–SLC31A1 axis that integrates epigenetic regulation with copper metabolism to modulate osteogenic differentiation, highlighting a promising therapeutic target for osteoporosis. Health sciences/Diseases/Endocrine system and metabolic diseases/Metabolic bone disease/Osteopetrosis Biological sciences/Physiology/Bone Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction OP, a prevalent skeletal disorder, manifests as compromised bone mass and structural deterioration, culminating in heightened fragility and fracture susceptibility. This condition affects over 200 million individuals globally, predominantly postmenopausal women and the elderly 1 , 2 . Bone tissue comprises organic components - predominantly type I collagen, glycosaminoglycans, and noncollagenous proteins - and an inorganic mineral phase of hydroxyapatite crystals. Its cellular compartment, including osteoblasts, osteoclasts, and osteocytes, orchestrates matrix deposition, mineralization, and remodeling to maintain skeletal homeostasis 3 , 4 . While osteoclast-dominated resorption exceeding osteoblast-mediated formation drives osteoporosis pathogenesis, emerging evidence implicates osteoblast dysfunction and viability loss as critical determinants of disease progression 4 , 5 . There is growing evidence that the process of osteoblast dysfunction is not only regulated by genetic programs, but also by epigenetic regulation. Epigenetic modifications have emerged as crucial regulators of gene expression. Kcr is a distinct post-translational modification whereby a crotonyl group is added to the ε-amino group of lysine residues 6 . Unlike acetylation, crotonylation robustly associates with transcriptionally active chromatin, enhancing chromatin accessibility and recruiting transcriptional machinery 6 , 7 . In particular, H3K4cr facilitates transcription factor loading at gene promoters 8 . Sirtuins provide a mechanistic link between metabolism and chromatin remodeling. SIRT2 is a member of the family of silent information regulator 2 homologous proteins, which are all nicotinamide adenine dinucleotide (NAD⁺)-dependent deacetylases or deacylases 9 , 10 . As a key member of the Sirtuin family localized in the cytoplasm and nucleus, SIRT2 plays a vital role in regulating the cell cycle[20], oxidative stress[20], metabolic homeostasis 11 , and epigenetic modifications 8 , 9 . Recent studies have shown that SIRT2 possesses not only deacetylase activity 10 , but also decrotonylase activity, which is capable of specifically removing crotonyl group on histone lysine residues, especially H3K4cr, and thus regulating chromatin conformation and target gene expression 8 . SIRT2 thus serves as a bridge between cellular metabolic states and epigenetic regulation, playing key roles in various physiopathological processes. SIRT2-mediated decrotonylation provides a potential mechanism through which metabolic cues can directly regulate promoter activity in osteogenesis-related gene networks. Given that SIRT2 integrates metabolic signals with chromatin remodeling, it is plausible that SIRT2 may also intersect with copper metabolism and cuproptosis in osteoblasts. Cuproptosis represents another metabolism-linked pathway that intersects with osteoblast biology. Cuproptosis, a recently characterized form of regulated cell death mechanistically distinct from apoptosis, ferroptosis, and necroptosis, is triggered by intracellular copper overload. As an essential cofactor in energy metabolism and antioxidant defense 12 , copper homeostasis is stringently controlled. Pathological accumulation prompts copper binding to lipoylated TCA cycle enzymes, inducing Fe–S cluster protein destabilization, proteotoxic stress, and cell death 13 , 14 . Metabolically active osteoblasts, responsible for bone matrix synthesis, exhibit marked vulnerability to copper dysregulation, suggesting cuproptosis-mediated osteoblast demise may exacerbate bone loss 13 , 15 . SLC31A1, a high-affinity copper importer, critically maintains intracellular copper equilibrium 16 . Its expression is rigorously regulated to prevent copper overload and toxicity 17 . Dysregulated SLC31A1 has been implicated in diverse pathologies, highlighting the importance of its transcriptional regulation. In osteoblasts, SLC31A1 determines intracellular copper levels and thereby influences cellular function, survival, and susceptibility to cuproptosis 13 , 18 , 19 . Collectively, these observations suggest that dysregulated copper influx via SLC31A1 could act as a key trigger of cuproptosis, linking copper imbalance to impaired osteoblast viability and bone loss in osteoporosis. Recent studies have identified ELF3 as a key transcriptional activator of SLC31A1. ELF3 binds to the SLC31A1 promoter, enhancing its transcription and promoting copper uptake 20 . Nevertheless, the upstream molecular mechanisms regulating ELF3-driven SLC31A1 expression remain largely undefined. Notably, whether ELF3 participates in the regulation of cuproptosis in osteoblasts and during osteoporosis has not yet been reported. ELF3 has been implicated in epithelial differentiation 21 and stress responses 22 , but its role in osteoblast copper homeostasis remains unexplored. Elucidating these pathways is therefore critical for understanding disturbed copper balance in osteoblasts and its contribution to osteoporosis pathogenesis. SIRT2 upregulation in osteoblasts may enhance its decrotonylase activity, thereby depleting H3K4cr. This epigenetic shift may diminish recruitment of Kcr-dependent transcriptional regulators and favor ELF3 binding at the SLC31A1 promoter, thereby increasing SLC31A1 transcription and copper uptake. Excess intracellular copper would then trigger cuproptosis in osteoblasts, impairing their function and accelerating bone loss. By revealing this previously unrecognized link between epigenetic regulation, trace metal metabolism, and osteoblast viability, our findings have the potential to provide new mechanistic insights into the pathophysiology of osteoporosis. In addition, targeting key nodes within the SIRT2–H3K4cr–SLC31A1 regulatory axis may provide new therapeutic avenues for preventing or mitigating bone loss in osteoporosis patients. Results Clinical and experimental evidence reveal elevated SIRT2 expression in OP To investigate the functional role of Kcr in OP, we analyzed Kcr-related genes using two OP-related GEO datasets, GSE35958 and GSE56815, via the online tool GEO2R 23 . As illustrated in Fig. 1 a-b, our analysis revealed a consistent elevation of SIRT2, a recognized Kcr “eraser”, across both datasets. Furthermore, we assessed SIRT2 expression in 40 serum samples from individuals with OP and 40 paired serum samples from individuals without OP (non-OP) using RT-qPCR and western blot assays. The results demonstrated a pronounced elevation of SIRT2 expression in OP serum samples compared to that in non-OP samples (Fig. 1 c-d). Additionally, a further spearman correlation analysis revealed a robust positive correlation between SIRT2 expression and C-terminal telopeptide of type I collagen (CTX-1) 24 , a marker of bone resorption (Fig. 1 e). On the contrary, it was found that the expression level of SIRT2 was inversely associated with Bone Gla protein (BGP) 25 , a bone formation marker (Fig. 1 f). Even further, an OP-hBMSCs model was constructed as previously reported 26 . As shown in Fig. 1 g-h, the outcomes indicated that the expression of Runx2 and ALP was significantly downregulated in the constructed OP-hBMSCs model. Additionally, the expression of SIRT2 was further detected. As the findings indicated by an RT-qPCR assay and a western blot assay, SIRT2 was upregulated in OP-hBMSCs. Lastly, it was unveiled that high expression of SIRT2 was closely correlated with high risk of OP, and that SIRT2 might be an independent prognostic factor (Table 1 ). SIRT2 modulates H3K4cr levels during osteogenesis SIRT2, through its deacetylase activity, regulates the removal of various fatty acyl groups, including crotonyl groups, thereby influencing histone modifications such as H3K4cr 8 . While SIRT2 exhibits decrotonylase activity in vitro, its intracellular functions have not been fully substantiated. This finding motivated a deeper investigation into the role of SIRT2 in osteogenic differentiation and in the development of osteoporosis. To investigate the effect of SIRT2 on H3K4cr levels in hBMSCs, stable cell lines with either SIRT2 knockdown (shSIRT2) or overexpression (oeSIRT2) were generated via lentiviral transduction. RT-qPCR and Western blot analyses confirmed that SIRT2 expression was significantly reduced in shSIRT2 cells compared with the shNC group, while it was markedly increased in oeSIRT2 cells relative to the pcDNA group (Fig. 2 a). Immunoblotting with a specific anti-H3K4cr antibody revealed that SIRT2 knockdown (shSIRT2-1/2) significantly increased H3K4cr levels, indicating that SIRT2 regulates H3K4cr in hBMSCs (Fig. 2 b).To investigate the functional consequence of SIRT2-mediated H3K4cr during osteogenic differentiation, hBMSCs were cultured in osteogenic induction medium, and the expression levels of SIRT2, H3K4cr, and osteogenic markers ALP and Runx2 were evaluated at days 0, 7, and 14. As shown in Fig. 2 c-d, ALP and Runx2 levels were progressively increased over time, confirming successful osteogenic differentiation. Notably, gradually decreased SIRT2 expression as well as increased H3K4cr levels were found at day 7 and day 14. To further clarify the role of SIRT2 and exclude potential nonspecific effects, oeSIRT2-hBMSCs were subjected to the same osteogenic induction protocol, and ALP and Runx2 expression were assessed at corresponding time points. Compared with pcDNA, a significant and time-dependent reduction of ALP and Runx2 expression was exhibited in oeSIRT2-hBMSCs (Fig. 2 e-f). Consistently, SIRT2 overexpression reduced H3K4cr levels and further suppressed ALP and Runx2 expression (Fig. 2 g-h). To validate the regulatory role of H3K4cr, sodium crotonate (a crotonylation agonist, Na-Cro) was added to oeSIRT2-hBMSCs. Treatment partially restored H3K4cr levels and concomitantly increased ALP and Runx2 expression (Fig. 2 g-h). Phenotypically, SIRT2 overexpression markedly suppressed ALP activity and calcium nodule formation, as shown by diminished ALP staining at day 7 and reduced ARS staining at day 14. Importantly, Na-Cro supplementation reversed these effects, restoring ALP activity and enhancing mineralized matrix deposition. These findings demonstrate that SIRT2 inhibits both early and late osteogenic events by reducing H3K4cr, while increased crotonylation counteracts this suppression (Fig. 2 i). Subsequent in vivo validation employed an OVX rat model, a well-established system for bone loss and regeneration studies 27 . SIRT2 knockdown was achieved via adeno-associated virus (AAV) vector delivery and confirmed by RT-qPCR and serum Western blotting (Fig. 2 j). Immunohistochemistry (IHC) using an anti-H3K4cr antibody demonstrated predominant nuclear localization of this modification in osteoblasts. Significantly higher H3K4cr levels were observed in Sham versus OVX rats, while shSIRT2-OVX rats exhibited marked restoration of H3K4cr to Sham levels (Fig. 2 k). Micro-Computed Tomography imaging ( Micro-CT) analysis after four weeks showed that the shSIRT2-OVX rats exhibited significantly enhanced bone regeneration compared to Sham, as evidenced by increased bone mineral density (BMD), bone volume fraction (BV/TV), and trabecular number (Tb. N) (Fig. 2 l). In summary, these findings provide compelling evidence that SIRT2 downregulation promotes osteogenesis and bone regeneration in OVX-induced osteoporotic rats, potentially through upregulation of H3K4 crotonylation. SIRT2-mediated decrotonylation of H3K4cr promoted SLC31A1 transcription by competing with ELF3 for binding SLC31A1 is a crucial transmembrane transporter involved in cellular copper uptake and homeostasis 28 . Notably, we analyzed the OP-related GEO dataset GSE35956 using the online tool GEO2R and found that SLC31A1 expression was significantly upregulated in OP patients compared with non-OP patients (Fig. 3 a). To explore whether SIRT2 modulates H3K4cr at the SLC31A1 promoter, ChIP-qPCR was performed in shSIRT2-hBMSCs and shNC-hBMSCs. The results showed a marked enrichment of H3K4cr at the SLC31A1 promoter following SIRT2 knockdown (Fig. 3 b). Consistently, RT-qPCR and Western blot analyses demonstrated that loss of SIRT2 significantly suppressed SLC31A1 mRNA and protein expression (Fig. 3 c). These findings suggest, for the first time, that SIRT2 promotes SLC31A1 transcription via its decrotonylase activity, underscoring the inhibitory effect of histone crotonylation on gene expression. To further clarify the mechanism, we assessed ELF3 binding to the SLC31A1 promoter. ChIP-qPCR revealed that ELF3 occupancy was markedly reduced in shSIRT2-hBMSCs compared with shNC-hBMSCs (Fig. 3 d). To validate this regulatory axis, ELF3 was either silenced or overexpressed in shSIRT2-hBMSCs, and both RT-qPCR and Western blot confirmed the efficiency of modulation (Fig. 3 e). Importantly, ChIP-qPCR analysis showed that ELF3 overexpression significantly restored its recruitment to the SLC31A1 promoter in shSIRT2-hBMSCs (Fig. 3 f). Dual-luciferase reporter assays further validated the functional relevance of these interactions. Overexpression of H3K4cr in shSIRT2-hBMSCs significantly reduced SLC31A1 promoter activity. Co-expression of ELF3 partially rescued this suppression, while knockdown of ELF3 further enhanced the inhibitory effect, supporting a competitive interplay between H3K4cr and ELF3 at the promoter region (Fig. 3 g). Collectively, these data establish a regulatory model in which SIRT2 removes H3K4cr to relieve its competition with ELF3, thereby promoting ELF3 enrichment at the SLC31A1 promoter and enhancing its transcription. H3K4cr mediates SLC31A1 upregulation to inhibit osteogenesis To investigate the role of SLC31A1 in copper uptake and osteogenic differentiation, H3K4cr-mediated alterations in copper homeostasis and their functional implications for osteogenesis were first assessed. HBMSC models with stable knockdown and overexpression of SLC31A1 were established, and SLC31A1 expression levels were confirmed by RT-qPCR and Western blotting (Fig. 4 a). During osteogenic differentiation of oeSLC31A1-hBMSCs, intracellular copper levels were significantly elevated compared to pcDNA (Fig. 4 b), while the expression of osteogenic markers Runx2 and ALP was notably decreased (Fig. 4 d). These findings suggest a strong correlation between increased copper levels and impaired osteogenesis. Consistently, ALP and ARS staining revealed reduced ALP activity and mineralization capacity in oeSLC31A1-hBMSCs (Fig. 4 d). To further confirm the role of SLC31A1 in copper homeostasis, we treated oeSLC31A1-hBMSCs with sodium crotonate during osteogenic induction. This treatment significantly restored osteogenic differentiation, as evidenced by increased expression of Runx2 and ALP (Fig. 4 e-f), along with enhanced ALP activity and mineral deposition (Fig. 4 d). These results suggest that H3K4cr may regulate osteogenesis by modulating SLC31A1 transcription, thereby influencing copper homeostasis. Taken together, the data demonstrate that overexpression of SLC31A1 impairs the osteogenic potential of hBMSCs, likely through disruption of copper balance regulated by histone crotonylation. SLC31A1 suppressed osteogenesis by activating cuproptosis To further elucidate the mechanism of SLC31A1 in osteogenesis, we examined the expression of molecular markers associated with cuproptosis. The results showed that in oeSLC31A1-hBMSCs, key cuproptosis regulators, including Ferredoxin 1(FDX1) and Lipoyltransferase 1(LIPT1), were significantly upregulated, and levels of Dihydrolipoamide S-Acetyltransferase (DLAT) were also markedly increased (Fig. 5 a). These findings were further validated by treating hBMSCs with 150 ng/mL of elesclomol (CuET), a known inducer of cuproptosis, for 24 hours (Fig. 5 b). Together, these data indicate that overexpression of SLC31A1 promotes the onset of cuproptosis in hBMSCs. To determine whether the inhibitory effect of SLC31A1 on osteogenic differentiation is dependent on cuproptosis, we treated oeSLC31A1-hBMSCs with the copper chelator tetrathiomolybdate (TM, 10 µM) during osteogenic induction. RT-qPCR and Western blot analysis revealed a significant upregulation of Runx2 and ALP mRNA levels following TM treatment (Fig. 5 c-d); intracellular copper levels also decreased (Fig. 5 e). Furthermore, both ALP and ARS staining demonstrated that TM administration effectively restored the osteogenic capacity of oeSLC31A1-hBMSCs (Fig. 5 f-g). These findings provide additional evidence that SLC31A1 impairs osteogenic differentiation by activating cuproptosis. To further verify the role of SLC31A1 in vivo, we assessed SLC31A1 expression in OVX serum samples. Western blot and RT-qPCR analyses showed that SLC31A1 expression was significantly elevated in OVX rats compared to Sham (Fig. 5 h-i). To further elucidate the in vivo role of SLC31A1, we utilized AAV-mediated shRNA delivery approach to achieve targeted knockdown of SLC31A1 in OVX rats. The efficiency of knockdown was confirmed by both RT-qPCR and Western blot analyses (Fig. 5 j). Four weeks after injection, micro-CT analysis revealed that BMD, BV/TV and Tb. N were significantly increased in the shSLC31A1-OVX rats (Fig. 5 h). Histological evaluation demonstrated a marked increase in osteoblast numbers within the bone tissue of the shSLC31A1-OVX rats. Hematoxylin and Eosin (H&E) staining revealed well-organized trabeculae with osteoblasts lining the bone surface. In contrast, Masson's trichrome staining indicated enhanced collagen deposition and bone matrix formation, collectively suggesting elevated osteogenic activity following SLC31A1 silencing (Fig. 5 j). In summary, these results demonstrate that SLC31A1 impairs osteogenic differentiation both in vitro and in vivo by promoting cuproptosis, and that inhibition of cuproptosis can effectively rescue this impaired osteogenic potential. These findings highlight SLC31A1 as a critical regulator linking copper homeostasis, cuproptosis, and bone formation. Discussion This study elucidates a novel epigenetic mechanism by which SIRT2 regulates osteogenesis through the modulation of H3K4cr, with downstream effects on the copper transporter gene SLC31A1. Our findings reveal that SIRT2 is significantly upregulated in both human osteoporosis samples and an OP cell model, with its expression showing a positive correlation with bone resorption markers and an inverse correlation with bone formation markers. These observations align with prior research suggesting that SIRT2 is involved in bone metabolism. For instance, a 2019 study demonstrated that SIRT2 deficiency mitigates age-related bone loss in rats by inhibiting osteoclastogenesis 29 , liver-specific SIRT2 deficiency inhibits bone formation and mitigates bone loss in a mouse model of osteoporosis 29 , SIRT2 deacetylated C/EBPβ promotes AREG expression, thereby activating PI3K-AKT signaling pathway to promote osteoblast differentiation 30 , hinting at a dual role for SIRT2 in regulating both bone resorption and formation. Functionally, SIRT2 acts as a negative regulator of osteogenesis by removing H3K4cr. This decrotonylation represses the transcription of key osteogenic markers, such as Runx2 and ALP. Histone crotonylation is an emerging player in cellular differentiation, with studies demonstrating its role in other contexts, such as promoting endoderm differentiation in human embryonic stem cells by enhancing lineage-specific gene expression 31 . Our findings extend this paradigm to osteogenesis, suggesting that SIRT2-mediated removal of H3K4cr suppresses the osteogenic differentiation of mesenchymal stem cells, thereby contributing to the pathogenesis of osteoporosis. A pivotal discovery in our study is the SIRT2-H3K4cr-ELF3 axis, which mechanistically links histone modification to the regulation of metabolic genes in bone formation. We demonstrate that SIRT2, by suppressing H3K4cr, facilitates the recruitment of the transcription factor ELF3 to the SLC31A1 promoter, thereby enhancing SLC31A1 transcription. ELF3, known to regulate cellular processes such as epithelial differentiation 22 and inflammation 32 , 33 , emerges here as a critical mediator in osteogenesis. This axis not only underscores the interplay between epigenetic modifications and transcriptional control but also positions SIRT2 as a central regulator of metabolic pathways in bone biology. This mechanism may serve as a model for how histone modifications influence other metabolic genes in skeletal tissues, underscoring the need for further exploration. Our study further uncovers the role of SLC31A1 in osteogenesis, driven by its disruption of copper homeostasis and activation of cuproptosis—a recently identified form of copper-dependent cell death. Overexpression of SLC31A1, a copper transporter, elevates intracellular copper levels, triggering the activation of FDX1, LIPT1, and DLAT—hallmark components of the cuproptosis pathway. This cascade inhibits osteogenic differentiation, likely by inducing cellular stress and impairing the function of osteoblasts. While direct studies on SLC31A1 in osteoporosis are limited, copper’s role in bone health is well-documented. For example, a 2018 study linked serum copper levels to bone mineral density and fracture risk, and excessive copper has been shown to impair bone mineralization 34 . Our findings bridge these observations, demonstrating that SLC31A1-mediated copper overload shifts the cellular fate toward cuproptosis, thus suppressing bone formation. Notably, we demonstrate that pharmacological interventions can reverse these effects, underscoring their therapeutic potential. Sodium crotonate, which enhances histone crotonylation, restores H3K4cr levels and promotes osteogenic gene expression. Similarly, copper chelators such as tetrathiomolybdate reduce intracellular copper accumulation, mitigate cuproptosis, and rescue osteogenesis. These findings are particularly promising, given the precedent for copper chelators in treating copper-overload disorders, such as Wilson’s disease 35 , 36 . Repurposing such agents for osteoporosis could offer a novel strategy, especially in cases where copper dysregulation contributes to bone loss. Moreover, the use of histone-modifying agents aligns with studies showing that histone deacetylase inhibitors enhance osteogenesis [35, 36], thereby reinforcing the therapeutic relevance of targeting epigenetic regulators, such as SIRT2. Our in vitro findings were robustly validated in vivo using an ovariectomized rat model, a well-established model of postmenopausal osteoporosis 37 . Knockdown of SIRT2 restored H3K4cr levels, enhanced bone regeneration, and improved trabecular bone volume, as assessed by micro-CT analysis. Similarly, SLC31A1 knockdown reduced copper accumulation in bone tissue and improved bone microarchitecture, corroborating the deleterious role of copper overload. These results not only strengthen the translational relevance of our findings but also align with prior evidence that modulating epigenetic or metabolic pathways can improve bone health in preclinical models 38 . This study provides a comprehensive framework for understanding the epigenetic and metabolic regulation of osteogenesis, with SIRT2 and SLC31A1 emerging as potential therapeutic targets for osteoporosis. The identification of the SIRT2-H3K4cr-ELF3 axis and its downstream effects on copper homeostasis opens new avenues for research and treatment development. Future studies could explore: The role of this axis in other bone-related diseases, such as osteoarthritis or bone metastasis; Additional genes regulated by SIRT2-mediated crotonylation in skeletal tissues; and Clinical trials to evaluate sodium crotonate, copper chelators, or SIRT2 inhibitors as treatments for osteoporosis. Materials and methods Patients and Clinical Samples Forty patients diagnosed with osteoporosis (OP) and 40 age- and sex-matched non-OP controls were recruited from the Department of Spine Ⅱ, [Central Hospital Affiliated to Shenyang Medical College], between January and December 2024. OP was defined by dual-energy X-ray absorptiometry (DXA; T-score ≤–2.5 at the lumbar spine or femoral neck). Serum samples were collected after overnight fasting, aliquoted, and stored at − 80°C until analysis. All procedures were approved by the institutional review board of central hospital affiliated to Shenyang medical college (2023DEC12-8), and written informed consent was obtained from all participants. Bioinformatic Analysis of GEO Datasets Gene expression profiles from three publicly available op-related datasets (GSE35956, GSE35958, and GSE56815) were downloaded from the GEO datasets. Differentially expressed Kcr-related genes were identified using the GEO2R online tool with default settings. Only genes with |log2 fold change| >1 and adjusted p < 0.05 were considered significant. Cell Culture and Osteogenic Differentiation HBMSCs (Lonza, Cat. No. PT-2501) were cultured in α-MEM supplemented with 10% fetal bovine serum (FBS; Gibco), 100 U/mL penicillin, and 100 µg/mL streptomycin at 37°C in a humidified 5% CO₂ atmosphere. For osteogenic induction, confluent hBMSCs were switched to osteogenic medium (αMEM containing 10% FBS, 50 µg/mL ascorbic acid, 10 mM β-glycerophosphate, and 100 nM dexamethasone). The medium was changed every 3 days, and samples were harvested at days 0, 7, and 14. Construction of the OP-hBMSCs Model To simulate osteoporotic conditions, human bone marrow-derived mesenchymal stem cells were treated with dexamethasone to inhibit osteogenic differentiation. Cells at 70–80% confluence were cultured in α-Minimum Essential Medium (α-MEM; Gibco, Cat. No. 12561056) supplemented with 100 nM dexamethasone (Sigma-Aldrich, Cat. No. D4902), 10 mM β-glycerophosphate (Sigma-Aldrich, Cat. No. G9422), and 50 µg/mL ascorbic acid (Sigma-Aldrich, Cat. No. A4544) for 7 days, with the medium replaced every 2 days. Successful induction of an osteoporosis-like phenotype was confirmed by a greater than 30% reduction in alkaline phosphatase activity and downregulation of Runx2 and ALP expression at both mRNA and protein levels, as assessed by RT-qPCR and Western blotting, respectively, compared to untreated controls. Lentiviral Transduction and Generation of Stable Cell Lines Short hairpin RNAs targeting SIRT2 (shSIRT2) and nontargeting control (shRNA) were cloned into the pLKO.1 vector (Addgene, Cat. No. 10878). For overexpression, full-length human SIRT2 cDNA was subcloned the pLVX-Puro vector (Takara, Cat. No. 632183). Lentiviral particles were produced in HEK293T cells (ATCC, Cat. No. CRL-11268) by co-transfection with psPAX2 (Addgene, Cat. No. 12260) and pMD2.G (Addgene, Cat. No. 12259) using Lipofectamine 3000 (Thermo Fisher Scientific, Cat. No. L3000015). Human bone marrow-derived mesenchymal stem cells were transduced at a multiplicity of infection of 20 in the presence of 8 µg/mL polybrene (Sigma-Aldrich, Cat. No. H9268). After 48 h, cells were selected with 2 µg/mL puromycin for 7 days. Knockdown or overexpression efficiency was validated by RT-qPCR and Western blot. RT-qPCR and Western Blotting Total RNA was extracted from cells using TRIzol Reagent (Invitrogen, Cat. No. 15596026) and reverse transcribed into complementary DNA with the PrimeScript RT Reagent Kit (Takara, Cat. No. RR037A). Quantitative polymerase chain reaction (qPCR) was performed on a QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems, Cat. No. 4485696) using SYBR Green PCR Master Mix (Thermo Fisher Scientific, Cat. No. 4309155). Relative gene expression was calculated using the 2^–ΔCt method, with glyceraldehyde 3-phosphate dehydrogenase (GAPDH) serving as the internal control. For Western blot analysis, total proteins were extracted with radioimmunoprecipitation assay (RIPA) buffer supplemented with protease inhibitors (Thermo Fisher Scientific, Cat. No. 78430). Proteins were separated by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE; Bio-Rad, Cat. No. 4568094), transferred to polyvinylidene difluoride (PVDF) membranes (Millipore, Cat. No. IPVH00010), and incubated with primary antibodies against SIRT2 (Abcam, Cat. No. ab124974), H3K4cr (PTM Biolabs, Cat. No. PTM-1401), Runx2 (Cell Signaling Technology, Cat. No. 12556), ALP (Abcam, Cat. No. ab108337), SLC31A1 (Proteintech, Cat. No. 15955-1-AP), FDX1 (Abcam, Cat. No. ab174825), LIPT1 (Proteintech, Cat. No. 18157-1-AP), DLAT (Abcam, Cat. No. ab110332), and GAPDH as loading control. Membranes were incubated with horseradish peroxidase-conjugated secondary antibodies (Cell Signaling Technology, Cat. No. 7074) and visualized using enhanced chemiluminescence (ECL) detection reagents (GE Healthcare, Cat. No. RPN2232). Chromatin Immunoprecipitation (ChIP-qPCR) Chromatin immunoprecipitation (ChIP) was performed using the SimpleChIP Enzymatic Chromatin IP Kit (Cell Signaling Technology, Cat. No. 9003S) according to the manufacturer’s instructions. Briefly, 1 × 10⁷ hBMSCs were crosslinked with 1% formaldehyde (Sigma-Aldrich, Cat. No. F8775) for 10 min at room temperature and quenched with 125 mM glycine (Sigma-Aldrich, Cat. No. G8790) for 5 min. Chromatin was then fragmented enzymatically using micrococcal nuclease supplied in the kit. Immunoprecipitation was performed overnight at 4°C with anti-H3K4cr antibody or anti-ELF3 antibody (Abcam, Cat. No. ab211889). Protein-DNA complexes were captured using protein G magnetic beads provided in the kit, followed by washing and reverse crosslinking. DNA was purified using the kit’s spin columns and quantified by quantitative PCR with primers specific for the SLC31A1 promoter. Enrichment was calculated relative to input DNA and normalized to IgG control (SimpleChIP Normal Rabbit IgG, Cell Signaling Technology, Cat. No. 2729S). Dual-Luciferase Reporter Assay The human SLC31A1 promoter (~ 1 kilobase upstream of the transcription start site) was cloned into pGL4.10 [luc2] vector (Promega, Cat. No. E6651). Human bone marrow-derived mesenchymal stem cells were co-transfected with pGL4.10-SLC31A1, pRL-TK Renilla luciferase control plasmid (Promega, Cat. No. E2241), and expression vectors encoding ELF3 (Origene, Cat. No. RC217695) or an H3K4cr mimic (PTM Biolabs, Cat. No. PTM-1250) using Lipofectamine 3000 (Thermo Fisher Scientific, Cat. No. L3000015) according to the manufacturer’s instructions. After 48 hours, luciferase activity was measured using the Dual-Luciferase Reporter Assay System (Promega, Cat. No. E1910) on a GloMax 20/20 luminometer (Promega). Firefly luciferase activity was normalized to Renilla luciferase to control for transfection efficiency. Copper Quantification Intracellular copper levels were quantified using the Copper Assay Kit (Abcam, Cat. No. ab272528) following the manufacturer’s instructions. Briefly, cells were lysed in the provided lysis buffer, and the lysates were incubated with the Cu²⁺-specific probe at room temperature for the recommended time. The absorbance was measured at 359 nm using a microplate reader (Thermo Scientific, Multiskan FC). Copper concentrations were calculated based on a standard curve generated with known Cu²⁺ standards provided in the kit. ALP and ARS Staining For ALP staining, cells were fixed with 4% paraformaldehyde (Sigma-Aldrich, Cat. No. P6148) for 15 min at room temperature, followed by incubation with BCIP/NBT substrate (Sigma-Aldrich, Cat. No. B5655) for 30 min in the dark. ALP activity was quantified spectrophotometrically at 405 nm using a microplate reader. For mineralization assessment, cells were fixed with 4% paraformaldehyde and stained with 2% Alizarin Red S (Sigma-Aldrich, Cat. No. A5533; pH 4.2) for 20 min at room temperature. Excess stain was removed by washing with distilled water, and the bound dye was extracted with 10% cetylpyridinium chloride (Sigma-Aldrich, Cat. No. C9002). Mineralization was quantified by measuring the absorbance at 562 nm. In Vivo OVX Rat Model and AAV-Mediated Gene Knockdown Eight-week-old female Sprague–Dawley rats weighing 200–220 g were obtained from Liaoning Changsheng Biotechnology (Shenyang, China). Bilateral ovariectomy (OVX) or sham surgery was performed under isoflurane anesthesia (Sigma-Aldrich, Cat. No. Isoflurane) following standard aseptic procedures. Four weeks after OVX, rats were randomly assigned to receive tail vein injections of adeno-associated virus serotype 9 (AAV9) carrying shRNA targeting SIRT2 (AAV9-shSIRT2), shRNA targeting SLC31A1 (AAV9-shSLC31A1), or scrambled shRNA control (AAV9-shScramble) at a dose of 1×10¹² viral genomes per rat. All animal procedures were conducted in accordance with the Institutional Animal Care and Use Committee (IACUC) guidelines of Central Hospital Affiliated to Shenyang Medical College (2024DEC23-6), and efforts were made to minimize animal suffering. Micro-CT, Histology, and IHC Four weeks after adeno-associated virus (AAV) treatment, femurs were harvested and fixed in 4% paraformaldehyde (Sigma-Aldrich, Cat. No. P6148) at 4°C overnight. Samples were scanned using a high-resolution micro-computed tomography system (Skyscan 1176, Bruker) with a voxel size of 9 µm. Trabecular bone parameters, including BMD, BV/TV, and Tb. N, were quantified using the associated software. Decalcified bone sections were prepared using 10% ethylenediaminetetraacetic acid (EDTA; Sigma-Aldrich, Cat. No. E5134) and subsequently stained with Masson’s trichrome (Sigma-Aldrich, Cat. No. HT15) for osteoblast visualization. Immunohistochemistry was performed with an anti-H3K4cr antibody (Abcam, Cat. No. ab177919) following standard protocols. Copper deposition in bone tissue was evaluated using rubenamine acid staining (Sigma-Aldrich, Cat. No. R3016). Pharmacological Treatments CuET (Selleck Chemicals, Cat. No. S7293) was applied at a final concentration of 150 ng/mL for 24 hours to induce cuproptosis in cultured cells. To chelate intracellular copper during osteogenic induction, TM (Sigma-Aldrich, Cat. No. T1529) was added at 10 µM. Both treatments were performed under standard culture conditions, and control groups received vehicle alone. Statistical Analysis Data are presented as mean ± SD from at least three independent experiments. Unpaired two-tailed Student’s t test made statistical comparisons between two groups; multiple groups were compared using one-way ANOVA followed by Tukey’s post hoc test. Pearson’s correlation coefficient analyzed correlations. Cox proportional hazards model assessed the prognostic significance of SIRT2 expression. All analyses were performed with GraphPad Prism 10. p < 0.05 was considered statistically significant. Abbreviations Supplementary Table Ⅲ List of abbreviations used in this study Declarations Ethics approval and consent to participate All patients have been informed and agree to participate in this study and the study protocol was approved by the Ethics Committee of Central Hospital Affiliated with Shenyang Medical College (Approval Number: 2023DEC12-8). Consent for publication Not applicable. Availability of data and materials Please contact the corresponding author for data requests. Acknowledgments Not applicable. Funding NO Funding. Conflict of Interests The authors declare that they have no conflict of interests. Author contributions All authors contributed equally to this work. They jointly participated in study conception and design, data acquisition, analysis, and interpretation. All authors were involved in drafting and revising the manuscript critically for important intellectual content. All authors approved the final version of the manuscript and agree to be accountable for all aspects of the work. References Arceo-Mendoza, R. M. & Camacho, P. M. Postmenopausal Osteoporosis: Latest Guidelines. Endocrinol Metab Clin North Am 50, 167–178 (2021). https://doi.org:10.1016/j.ecl.2021.03.009 Compston, J. E., McClung, M. R. & Leslie, W. D. Osteoporosis. Lancet 393, 364–376 (2019). https://doi.org:10.1016/s0140-6736(18)32112-3 Boyle, W. J., Simonet, W. S. & Lacey, D. L. Osteoclast differentiation and activation. Nature 423, 337–342 (2003). https://doi.org:10.1038/nature01658 Zhivodernikov, I. V., Kirichenko, T. V., Markina, Y. V., Postnov, A. Y. & Markin, A. M. Molecular and Cellular Mechanisms of Osteoporosis. Int J Mol Sci 24 (2023). https://doi.org:10.3390/ijms242115772 Xu, J., Yu, L., Liu, F., Wan, L. & Deng, Z. The effect of cytokines on osteoblasts and osteoclasts in bone remodeling in osteoporosis: a review. Front Immunol 14, 1222129 (2023). https://doi.org:10.3389/fimmu.2023.1222129 Tan, M. et al. Identification of 67 histone marks and histone lysine crotonylation as a new type of histone modification. Cell 146, 1016–1028 (2011). https://doi.org:10.1016/j.cell.2011.08.008 Liu, N. et al. Histone H3 lysine 27 crotonylation mediates gene transcriptional repression in chromatin. Mol Cell 83, 2206–2221.e2211 (2023). https://doi.org:10.1016/j.molcel.2023.05.022 Bao, X. et al. Identification of 'erasers' for lysine crotonylated histone marks using a chemical proteomics approach. Elife 3 (2014). https://doi.org:10.7554/eLife.02999 Zhu, C. et al. Multiple Roles of SIRT2 in Regulating Physiological and Pathological Signal Transduction. Genet Res (Camb) 2022, 9282484 (2022). https://doi.org:10.1155/2022/9282484 Pande, S. & Raisuddin, S. Molecular and cellular regulatory roles of sirtuin protein. Crit Rev Food Sci Nutr 63, 9895–9913 (2023). https://doi.org:10.1080/10408398.2022.2070722 Ren, H. et al. Sirtuin 2 Prevents Liver Steatosis and Metabolic Disorders by Deacetylation of Hepatocyte Nuclear Factor 4α. Hepatology 74, 723–740 (2021). https://doi.org:10.1002/hep.31773 Chen, L., Min, J. & Wang, F. Copper homeostasis and cuproptosis in health and disease. Signal Transduct Target Ther 7, 378 (2022). https://doi.org:10.1038/s41392-022-01229-y Li, D., Gao, Z., Li, Q., Liu, X. & Liu, H. Cuproptosis-a potential target for the treatment of osteoporosis. Front Endocrinol (Lausanne) 14, 1135181 (2023). https://doi.org:10.3389/fendo.2023.1135181 Han, J., Luo, J., Wang, C., Kapilevich, L. & Zhang, X. A. Roles and mechanisms of copper homeostasis and cuproptosis in osteoarticular diseases. Biomed Pharmacother 174, 116570 (2024). https://doi.org:10.1016/j.biopha.2024.116570 Chen, J., Sun, Q., Wang, Y. & Yin, W. Revealing the key role of cuproptosis in osteoporosis via the bioinformatic analysis and experimental validation of cuproptosis-related genes. Mamm Genome 35, 414–431 (2024). https://doi.org:10.1007/s00335-024-10049-0 Qi, Y. et al. Cuproptosis-related gene SLC31A1: prognosis values and potential biological functions in cancer. Sci Rep 13, 17790 (2023). https://doi.org:10.1038/s41598-023-44681-8 Li, L., Li, L. & Sun, Q. High expression of cuproptosis-related SLC31A1 gene in relation to unfavorable outcome and deregulated immune cell infiltration in breast cancer: an analysis based on public databases. BMC Bioinformatics 23, 350 (2022). https://doi.org:10.1186/s12859-022-04894-6 Chen, X. et al. SP1/CTR1-mediated oxidative stress-induced cuproptosis in intervertebral disc degeneration. Biofactors 50, 1009–1023 (2024). https://doi.org:10.1002/biof.2052 Xu, F., Hu, X. R., Wang, Y. & Mei, X. F. Exploring the impact of cuproptosis-related genes on immune infiltration in rheumatoid arthritis. Naunyn Schmiedebergs Arch Pharmacol (2025). https://doi.org:10.1007/s00210-024-03731-2 Qiu, Z. et al. The copper transporter, SLC31A1, transcriptionally activated by ELF3, imbalances copper homeostasis to exacerbate cisplatin-induced acute kidney injury through mitochondrial dysfunction. Chem Biol Interact 393, 110943 (2024). https://doi.org:10.1016/j.cbi.2024.110943 Matsumoto, T. et al. FOXP4 inhibits squamous differentiation of atypical cells in cervical intraepithelial neoplasia via an ELF3-dependent pathway. Cancer Sci 113, 3376–3389 (2022). https://doi.org:10.1111/cas.15489 Luk, I. Y., Reehorst, C. M. & Mariadason, J. M. ELF3, ELF5, EHF and SPDEF Transcription Factors in Tissue Homeostasis and Cancer. Molecules 23 (2018). https://doi.org:10.3390/molecules23092191 Barrett, T. et al. NCBI GEO: archive for functional genomics data sets–update. Nucleic Acids Res 41, D991-995 (2013). https://doi.org:10.1093/nar/gks1193 Christgau, S. et al. Serum CrossLaps for monitoring the response in individuals undergoing antiresorptive therapy. Bone 26, 505–511 (2000). https://doi.org:10.1016/s8756-3282(00)00248-9 Price, P. A., Parthemore, J. G. & Deftos, L. J. New biochemical marker for bone metabolism. Measurement by radioimmunoassay of bone GLA protein in the plasma of normal subjects and patients with bone disease. J Clin Invest 66, 878–883 (1980). https://doi.org:10.1172/jci109954 Rodríguez, J. P., Garat, S., Gajardo, H., Pino, A. M. & Seitz, G. Abnormal osteogenesis in osteoporotic patients is reflected by altered mesenchymal stem cells dynamics. J Cell Biochem 75, 414–423 (1999). https://doi.org:10.1002/(sici)1097-4644(19991201)75:3%3C414::aid-jcb7%3E3.3.co;2-3 Johnston, B. D. & Ward, W. E. The ovariectomized rat as a model for studying alveolar bone loss in postmenopausal women. Biomed Res Int 2015, 635023 (2015). https://doi.org:10.1155/2015/635023 Lutsenko, S., Roy, S. & Tsvetkov, P. Mammalian copper homeostasis: physiological roles and molecular mechanisms. Physiol Rev 105, 441–491 (2025). https://doi.org:10.1152/physrev.00011.2024 Jing, Y. et al. SIRT2 deficiency prevents age-related bone loss in rats by inhibiting osteoclastogenesis. Cell Mol Biol (Noisy-le-grand) 65, 66–71 (2019). Ma, J. et al. Niacin regulates glucose metabolism and osteogenic differentiation via the SIRT2-C/EBPβ-AREG signaling axis. Biomed Pharmacother 180, 117447 (2024). https://doi.org:10.1016/j.biopha.2024.117447 Fang, Y. et al. Histone crotonylation promotes mesoendodermal commitment of human embryonic stem cells. Cell Stem Cell 28, 748–763.e747 (2021). https://doi.org:10.1016/j.stem.2020.12.009 Zhang, X., Zhang, R., Wang, Y., Li, L. & Zhong, Z. CDK5 Upregulated by ELF3 Transcription Promotes IL-1β-induced Inflammation and Extracellular Matrix Degradation in Human Chondrocytes. Cell Biochem Biophys 82, 3333–3344 (2024). https://doi.org:10.1007/s12013-024-01415-5 Zheng, T., Li, Y., Zhang, X., Xu, J. & Luo, M. Exosomes Derived From miR-212-5p Overexpressed Human Synovial Mesenchymal Stem Cells Suppress Chondrocyte Degeneration and Inflammation by Targeting ELF3. Front Bioeng Biotechnol 10, 816209 (2022). https://doi.org:10.3389/fbioe.2022.816209 Qu, X. et al. Serum copper levels are associated with bone mineral density and total fracture. J Orthop Translat 14, 34–44 (2018). https://doi.org:10.1016/j.jot.2018.05.001 Shribman, S. et al. Investigation and management of Wilson's disease: a practical guide from the British Association for the Study of the Liver. Lancet Gastroenterol Hepatol 7, 560–575 (2022). https://doi.org:10.1016/s2468-1253(22)00004-8 Kirk, F. T. et al. Effects of tetrathiomolybdate on copper metabolism in healthy volunteers and in patients with Wilson disease. J Hepatol 80, 586–595 (2024). https://doi.org:10.1016/j.jhep.2023.11.023 Yousefzadeh, N., Kashfi, K., Jeddi, S. & Ghasemi, A. Ovariectomized rat model of osteoporosis: a practical guide. Excli j 19, 89–107 (2020). https://doi.org:10.17179/excli2019-1990 Ren, L. J., Zhu, X. H., Tan, J. T., Lv, X. Y. & Liu, Y. MiR-210 improves postmenopausal osteoporosis in ovariectomized rats through activating VEGF/Notch signaling pathway. BMC Musculoskelet Disord 24, 393 (2023). https://doi.org:10.1186/s12891-023-06473-z Tables Table 1. M ultivariate logistic regression analysis Measurements 95% CI OR p- values Age 2.531 - 32.64 2.712 0.1055 Gender 0.8274 - 9.533 0.5127 0.2971 Smoke 0.1391 - 1.780 1.862 0.3028 fracture 0.5728 - 6.287 10.91 0.0073 calcium intake 2.196 - 77.04 0.1624 0.0056 SIRT2 2.531 - 32.64 8.312 0.0010 The p-values were obtained using multivariate logistic regression analysis, with statistical significance set at p < 0.05. Table 2. Oligonucleotides and other sequence‐based reagents Species F_Sequence R_Sequence DLAT CATGTATTTTGGCAATTGGTGCTT CACTGGGCTCCAACTGCT ELF3 ATCCCAGCTTTTGAGTCTGACA ACACTTTCAACAAATGCCAACTCC FDX1 GGCAAGCACCACAGATTACCAC AGACCATACTGTGTACCCCTT GAPDH CTCAAGATCATCAGCAATGCCT TGGTCATGAGTCCTTCCACGAT LIPT1 GCAGGCTACCAAAAGATTTGACC AAGAAGACAAGAACGTCCCAT RUNX2 AAATGGTTAATCTCCGCAGGT GCTGTTTGATGCCATAGTCCC SIRT2 CGGCACGAATACCCGCTA AAAAGACGATATCAGGCTTCACC SLC31A1 ACTACTGTTTTCCGGTTTGGT TCTCGGGCTATCTTGAGTCCT Human SIRT2 shRNA-1 5′‐CCGGTATGACAACCTAGAGAAGTACCTCGAGGTACTTCTCTAGGTTGTCATATTTTTG‐3′ Human SIRT2 shRNA-2 5′-CCGGCAGCGCGTTTCTTCTCCTGTACTCGAGTACAGGAGAAGAAACGCGCTGTTTTTG-3′ Human SLC31A1 shRNA-1 5'-GCTATGATGATGCCATTGATT-TTCAAGAGA-AATCAATGGCATCATCATAGC-3' Human SLC31A1 shRNA-2 5'-CCATGTTCTTCATCGTCATCT-TTCAAGAGA-AGATGACGATGAAGAACATGG-3' Human ELF3 shRNA-1 5'-CCAGATGATGATGCCATCTAT-TTCAAGAGA-ATAGATGGCATCATCATCTGG-3 Human ELF3 shRNA-2 5'-GCTGCTACTTCTCGTGGATTT-TTCAAGAGA-AAATCCACGAGAAGTAGCAGC-3 Additional Declarations There is no conflict of interest Supplementary Files SupplementaryTableXXXListofabbreviationsusedinthisstudy.docx Supplementary Table 3 GraphicalAbstract.png Figure 6 Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7734583","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":522650526,"identity":"f743452d-fdc9-4963-8ce4-1081475e71ab","order_by":0,"name":"Yong Wang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAApUlEQVRIiWNgGAWjYPACGx5+/gbStKTJSM44QJqWwzYGDQlEqjW4kcD86UbNeR4DhgOMHz7mEKeFTTrn2G0ec+YGZsmZ24jQYgbUwpzbcJvHsuEAGzMvkVqYP+c2nOMxOJBAvBYG6dyGAyRosT/zAOSXZB7JGQebifOLZDvQYTk1dvb8/M0HP3wkRguDQP4HKIuxgRj1QMB/gEiFo2AUjIJRMHIBAEtmNMx0ftzYAAAAAElFTkSuQmCC","orcid":"","institution":"Central Hospital Affiliated to Shenyang Medical College","correspondingAuthor":true,"prefix":"","firstName":"Yong","middleName":"","lastName":"Wang","suffix":""},{"id":522650527,"identity":"3981330f-9647-4f5c-9a7e-07666cebdcd4","order_by":1,"name":"Hanjie Zhai","email":"","orcid":"","institution":"Central Hospital Affiliated to Shenyang Medical College","correspondingAuthor":false,"prefix":"","firstName":"Hanjie","middleName":"","lastName":"Zhai","suffix":""},{"id":522650528,"identity":"a2db07cd-2c1f-4c9b-8084-fef6292e23b3","order_by":2,"name":"Chenghao Li","email":"","orcid":"","institution":"Central Hospital Affiliated to Shenyang Medical College","correspondingAuthor":false,"prefix":"","firstName":"Chenghao","middleName":"","lastName":"Li","suffix":""},{"id":522650529,"identity":"92a3a4b6-e820-49e3-b81f-ba0f962ea88e","order_by":3,"name":"Yuxin Bao","email":"","orcid":"","institution":"Central Hospital Affiliated to Shenyang Medical College","correspondingAuthor":false,"prefix":"","firstName":"Yuxin","middleName":"","lastName":"Bao","suffix":""},{"id":522650530,"identity":"b94125aa-e0ca-4685-bdd9-dfd8232a8cf9","order_by":4,"name":"Xin Zhang","email":"","orcid":"","institution":"Central Hospital Affiliated to Shenyang Medical College","correspondingAuthor":false,"prefix":"","firstName":"Xin","middleName":"","lastName":"Zhang","suffix":""}],"badges":[],"createdAt":"2025-09-28 13:15:19","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7734583/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7734583/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":92480530,"identity":"e66a2beb-e60a-4d21-84bc-431e3fdedea8","added_by":"auto","created_at":"2025-09-30 07:41:33","extension":"png","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":3568023,"visible":true,"origin":"","legend":"","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-7734583/v1/a489407446bd030c4bab1d05.png"},{"id":92480532,"identity":"2768a560-c89b-4cdf-b00c-fc11353a55be","added_by":"auto","created_at":"2025-09-30 07:41:33","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":119095,"visible":true,"origin":"","legend":"","description":"","filename":"manu1.docx","url":"https://assets-eu.researchsquare.com/files/rs-7734583/v1/4c2f98c9a80972fb08904f66.docx"},{"id":92480542,"identity":"3e0df947-1930-40ff-9002-da6e16ad948c","added_by":"auto","created_at":"2025-09-30 07:41:33","extension":"png","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":20971334,"visible":true,"origin":"","legend":"","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-7734583/v1/b2bda3dffb1c654bb4403487.png"},{"id":92481279,"identity":"1fe0f77c-5a0a-4986-ad92-57c8e76a6964","added_by":"auto","created_at":"2025-09-30 07:49:33","extension":"docx","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":17840,"visible":true,"origin":"","legend":"","description":"","filename":"Table1.Multivariatelogisticregressionanalysis.docx","url":"https://assets-eu.researchsquare.com/files/rs-7734583/v1/3c7d6968f732d727ece7beb4.docx"},{"id":92480534,"identity":"bdb5a416-d905-4bb7-8c60-83fb874d3d91","added_by":"auto","created_at":"2025-09-30 07:41:33","extension":"png","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2174708,"visible":true,"origin":"","legend":"","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-7734583/v1/cddb2442065dc8e46ee6e2e9.png"},{"id":92480538,"identity":"2e7eefc9-816a-41bd-bda5-049a2840bf87","added_by":"auto","created_at":"2025-09-30 07:41:33","extension":"docx","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":19470,"visible":true,"origin":"","legend":"","description":"","filename":"Table2OligonucleotidesandothersequenceXXXbasedreagents.docx","url":"https://assets-eu.researchsquare.com/files/rs-7734583/v1/21383596b4a1d850e4bc6c3c.docx"},{"id":92480548,"identity":"805bbd3a-0851-496a-b667-852fc61fa05e","added_by":"auto","created_at":"2025-09-30 07:41:33","extension":"png","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":24673996,"visible":true,"origin":"","legend":"","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-7734583/v1/b0a1d230e15595e7f7537d80.png"},{"id":92480551,"identity":"3db23709-7157-4a98-92ce-d348651cbc0d","added_by":"auto","created_at":"2025-09-30 07:41:34","extension":"png","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":22972382,"visible":true,"origin":"","legend":"","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-7734583/v1/686ca664a312e70acf0af22b.png"},{"id":92480547,"identity":"54ccbc05-e220-462c-8213-a69af38beeac","added_by":"auto","created_at":"2025-09-30 07:41:33","extension":"png","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1254274,"visible":true,"origin":"","legend":"","description":"","filename":"GraphicalAbstract.png","url":"https://assets-eu.researchsquare.com/files/rs-7734583/v1/0ba4eb4e1228eb35add4911f.png"},{"id":92480541,"identity":"1c545b2b-81ef-4462-ad88-f5ed19b7facf","added_by":"auto","created_at":"2025-09-30 07:41:33","extension":"json","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":7473,"visible":true,"origin":"","legend":"","description":"","filename":"BONERES05209.json","url":"https://assets-eu.researchsquare.com/files/rs-7734583/v1/01d6c3278ded2f1ec4aa3ace.json"},{"id":92482672,"identity":"3764ebe3-6fca-47df-8bf0-cfa6daa0ea17","added_by":"auto","created_at":"2025-09-30 07:57:34","extension":"docx","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":21625,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryTableXXXListofabbreviationsusedinthisstudy.docx","url":"https://assets-eu.researchsquare.com/files/rs-7734583/v1/15f6bd249bdc11bc5170fe33.docx"},{"id":92480539,"identity":"5425c9c1-7b77-4e87-a448-a5a1f7237e84","added_by":"auto","created_at":"2025-09-30 07:41:33","extension":"xml","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":128011,"visible":true,"origin":"","legend":"","description":"","filename":"BONERES052090enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7734583/v1/e4ee43be470913e748b429d4.xml"},{"id":92481282,"identity":"b54d9117-3f0d-4250-b798-3279ddec2daa","added_by":"auto","created_at":"2025-09-30 07:49:34","extension":"png","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":3568023,"visible":true,"origin":"","legend":"","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-7734583/v1/734ed17e9b09a30093430c94.png"},{"id":92480554,"identity":"b395042a-5c9b-4aeb-81f8-39f1c8115069","added_by":"auto","created_at":"2025-09-30 07:41:34","extension":"png","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":20971334,"visible":true,"origin":"","legend":"","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-7734583/v1/02bbd962e3e568bb0fc85724.png"},{"id":92480540,"identity":"2576e365-5d94-460f-8239-6224a59afa7e","added_by":"auto","created_at":"2025-09-30 07:41:33","extension":"png","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2174708,"visible":true,"origin":"","legend":"","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-7734583/v1/e9ddce24addedd6da7573cdb.png"},{"id":92480557,"identity":"988a0f11-9b3e-4e75-a18a-aa364ce2383b","added_by":"auto","created_at":"2025-09-30 07:41:34","extension":"png","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":24673996,"visible":true,"origin":"","legend":"","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-7734583/v1/8971f45e193b93c45e7353d8.png"},{"id":92480562,"identity":"46280ab9-b50a-47af-bdb9-ec6e8d22435b","added_by":"auto","created_at":"2025-09-30 07:41:34","extension":"png","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":22972382,"visible":true,"origin":"","legend":"","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-7734583/v1/62fe2de668ffa76e7e799984.png"},{"id":92480544,"identity":"763d5776-ccca-4163-8266-f4ee15cce505","added_by":"auto","created_at":"2025-09-30 07:41:33","extension":"png","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1254274,"visible":true,"origin":"","legend":"","description":"","filename":"GraphicalAbstract.png","url":"https://assets-eu.researchsquare.com/files/rs-7734583/v1/0b84d7969078030ecf3fcb0f.png"},{"id":92480545,"identity":"efc42ddf-4111-4fe1-92fa-6c753ae7866c","added_by":"auto","created_at":"2025-09-30 07:41:33","extension":"png","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":579146,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure1.png","url":"https://assets-eu.researchsquare.com/files/rs-7734583/v1/52df7c71791c7e5f9cb5bb20.png"},{"id":92480559,"identity":"87c793db-72dd-4a10-9708-ce2ad0e6c6d4","added_by":"auto","created_at":"2025-09-30 07:41:34","extension":"png","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":3934174,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure2.png","url":"https://assets-eu.researchsquare.com/files/rs-7734583/v1/c3fb8baa8897764984264263.png"},{"id":92482673,"identity":"187e82a7-db4a-4d42-9bfd-6778c5789e81","added_by":"auto","created_at":"2025-09-30 07:57:34","extension":"png","order_by":20,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":369303,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure3.png","url":"https://assets-eu.researchsquare.com/files/rs-7734583/v1/02003286a3425af68e159eb8.png"},{"id":92480560,"identity":"91bcd906-e9fb-45cb-b864-57fe7c7fc584","added_by":"auto","created_at":"2025-09-30 07:41:34","extension":"png","order_by":21,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":4949479,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure4.png","url":"https://assets-eu.researchsquare.com/files/rs-7734583/v1/00e50bae03ffdf365ba24d08.png"},{"id":92480561,"identity":"dd891d58-13c3-4de5-8776-f8f29698470f","added_by":"auto","created_at":"2025-09-30 07:41:34","extension":"png","order_by":22,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":4162630,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure5.png","url":"https://assets-eu.researchsquare.com/files/rs-7734583/v1/bf6bf8758bc66aa1b1c2cd4b.png"},{"id":92481284,"identity":"f4eff3e4-65cd-4d91-a957-2bdc8c9fba8b","added_by":"auto","created_at":"2025-09-30 07:49:34","extension":"png","order_by":23,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":401361,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineGraphicalAbstract.png","url":"https://assets-eu.researchsquare.com/files/rs-7734583/v1/f17557bfb10ca2d266a878fa.png"},{"id":92480549,"identity":"f37dec7c-bc24-454f-9558-e8f3c187fdc6","added_by":"auto","created_at":"2025-09-30 07:41:34","extension":"xml","order_by":24,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":126495,"visible":true,"origin":"","legend":"","description":"","filename":"BONERES052090structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7734583/v1/bfc350bcd08d7014df31b8fe.xml"},{"id":92481286,"identity":"3d1ce7ae-2a1a-4e7a-80bc-ff328c8e490b","added_by":"auto","created_at":"2025-09-30 07:49:34","extension":"html","order_by":25,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":137133,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7734583/v1/86574b9da914adda1154c5e6.html"},{"id":92481277,"identity":"688e0500-cd5f-42b5-a22d-84160f836033","added_by":"auto","created_at":"2025-09-30 07:49:33","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":3568023,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSIRT2 is upregulated in osteoporosis and correlates with impaired osteogenic activity.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(a–b) Differential expression analysis of Kcr-related genes in osteoporosis-related datasets (GSE35958 and GSE56815) using GEO2R identified SIRT2 as a consistently upregulated Kcr “eraser” gene.\u003c/p\u003e\n\u003cp\u003e(c–d) RT-qPCR and Western blot analysis revealed significantly increased expression of SIRT2 in serum samples from OP patients (n = 40) compared to non-OP controls (n = 40).\u003c/p\u003e\n\u003cp\u003e(e) SIRT2 expression was positively correlated with CTX-1, a marker of bone resorption.\u003c/p\u003e\n\u003cp\u003e(f) In contrast, a significant negative correlation was observed between SIRT2 and BGP, a marker of bone formation.\u003c/p\u003e\n\u003cp\u003e(g–h) An in vitro OP cell model established using hBMSCs exhibited a marked downregulation of osteogenic markers, including Runx2 and ALP, as determined by RT-qPCR and Western blotting.\u003c/p\u003e\n\u003cp\u003e(i) SIRT2 expression was significantly upregulated in OP-hBMSCs compared with control hBMSCs.\u003c/p\u003e\n\u003cp\u003e(j) Univariate and multivariate logistic regression analysis indicated that elevated SIRT2 expression is significantly associated with increased risk of osteoporosis and may serve as an independent prognostic factor.\u003c/p\u003e\n\u003cp\u003eData information: \u003csup\u003en.s\u003c/sup\u003eP \u0026gt; 0.05; *P \u0026lt; 0.05; **P \u0026lt; 0.01; ***P \u0026lt; 0.001; ****P \u0026lt; 0.0001;\u003csup\u003e#\u003c/sup\u003eP \u0026lt; 0.05; \u003csup\u003e##\u003c/sup\u003eP \u0026lt; 0.01; \u003csup\u003e###\u003c/sup\u003eP \u0026lt; 0.001; \u003csup\u003e####\u003c/sup\u003eP \u0026lt; 0.0001. Bars represent mean ± SD.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-7734583/v1/dfd60158d7a8b923f1fc69d6.png"},{"id":92480543,"identity":"7b85722e-0a5b-4bf3-88a4-02e3ff88de35","added_by":"auto","created_at":"2025-09-30 07:41:33","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":20971334,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSIRT2 suppresses osteogenesis through de-crotonylation of H3K4cr both in vitro and in vivo.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(a) RT-qPCR and Western blot analysis confirmed effective knockdown and overexpression of SIRT2 in hBMSCs transduced with shSIRT2 or oeSIRT2, respectively.\u003c/p\u003e\n\u003cp\u003e(b) Immunoblotting revealed that knockdown of SIRT2 resulted in a significant increase in H3K4cr levels.\u003c/p\u003e\n\u003cp\u003e(c–d) Dynamic expression profiles of SIRT2 and H3K4cr in hBMSCs cultured under osteogenic induction conditions for 0, 7, and 14days using RT-qPCR and Western blot analysis. SIRT2 levels progressively decreased, while H3K4cr and osteogenic markers Runx2 and ALP increased over time.\u003c/p\u003e\n\u003cp\u003e(e–f) oeSIRT2-hBMSCs significantly reduced the expression of Runx2 and ALP during osteogenic differentiation in a time-dependent manner.\u003c/p\u003e\n\u003cp\u003e(g–h) Overexpression of SIRT2 led to reduced H3K4cr levels, accompanied by decreased ALP and Runx2 expression, which could be partially rescued by supplementation with Na-Cro at day 7.\u003c/p\u003e\n\u003cp\u003e(i) ALP and ARS staining at day 14 further confirmed that SIRT2 overexpression impairs osteogenic potential, while Na-Cro administration partially restored ALP activity and matrix mineralization.\u003c/p\u003e\n\u003cp\u003e(j) SIRT2 knockdown in OVX rats was confirmed by RT-qPCR and western blot.\u003c/p\u003e\n\u003cp\u003e(k) IHC analysis of H3K4cr in osteoblast nuclei showed higher levels in sham and shSIRT2-OVX rats than OVX rats.\u003c/p\u003e\n\u003cp\u003e(l) Micro-CT analysis performed four weeks post-injection showed significantly improved bone regeneration in the shSIRT2-OVX group, as reflected by increased BMD, BV/TV and Tb.N, along with enhanced mineralized bone formation.\u003c/p\u003e\n\u003cp\u003eData information: \u003csup\u003en.s\u003c/sup\u003eP \u0026gt; 0.05; *P \u0026lt; 0.05; **P \u0026lt; 0.01; ***P \u0026lt; 0.001; ****P \u0026lt; 0.0001;\u003csup\u003e#\u003c/sup\u003eP \u0026lt; 0.05; \u003csup\u003e##\u003c/sup\u003eP \u0026lt; 0.01; \u003csup\u003e###\u003c/sup\u003eP \u0026lt; 0.001; \u003csup\u003e####\u003c/sup\u003eP \u0026lt; 0.0001. Bars represent mean ± SD.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-7734583/v1/5142ea1d98c376172c63c0f4.png"},{"id":92480537,"identity":"add3b6fd-01e2-4a8c-9524-a89fe8a71940","added_by":"auto","created_at":"2025-09-30 07:41:33","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":2174708,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSIRT2 promotes SLC31A1 transcription by removing H3K4cr and enhancing ELF3 binding.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(a) Expression analysis of SLC31A1 in the osteoporosis-related GEO dataset GSE35956 showed significant upregulation in OP samples compared with non-OP.\u003c/p\u003e\n\u003cp\u003e(b) ChIP-qPCR revealed increased H3K4cr enrichment at the SLC31A1 promoter in shSIRT2-hBMSCs versus shNC-hBMSCs.\u003c/p\u003e\n\u003cp\u003e(c) RT-qPCR and Western blotting demonstrated that SLC31A1 mRNA and protein levels were significantly downregulated upon SIRT2 knockdown.\u003c/p\u003e\n\u003cp\u003e(d) ChIP-qPCR showed decreased ELF3 occupancy at the SLC31A1 promoter in shSIRT2-hBMSCs.\u003c/p\u003e\n\u003cp\u003e(e) Validation of ELF3 knockdown and overexpression efficiency in shSIRT2-hBMSCs by RT-qPCR and Western blot analysis.\u003c/p\u003e\n\u003cp\u003e(f) ChIP-qPCR analysis revealed that overexpression of ELF3 partially restored ELF3 binding at the SLC31A1 promoter in the context of elevated H3K4cr.\u003c/p\u003e\n\u003cp\u003e(g) Dual-luciferase reporter assays confirmed that H3K4cr overexpression suppressed SLC31A1 promoter activity; this suppression was partially reversed by ELF3 overexpression and further enhanced by ELF3 knockdown.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-7734583/v1/a26fc2e740ce4b3302d058d7.png"},{"id":92481280,"identity":"a1b954db-ba07-458b-a05b-bf0be84b3bd6","added_by":"auto","created_at":"2025-09-30 07:49:33","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":24673996,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eOverexpression of SLC31A1 disrupts copper homeostasis and impairs osteogenic differentiation in hBMSCs\u003c/strong\u003e.\u003c/p\u003e\n\u003cp\u003e(a) Validation of stable SLC31A1 knockdown and overexpression in hBMSCs by qRT-PCR and Western blot analysis.\u003c/p\u003e\n\u003cp\u003e(b) Intracellular copper levels were significantly elevated in oeSLC31A1-hBMSCs during osteogenic induction.\u003c/p\u003e\n\u003cp\u003e(c) RT-qPCR and Western blot analysis showed a marked decrease in the expression of osteogenic markers Runx2 and ALP in oeSLC31A1-hBMSCs compared to pcDNA-hBMSCs.\u003c/p\u003e\n\u003cp\u003e(d) ALP and ARS staining revealed reduced ALP activity and mineralized nodule formation in oeSLC31A1-hBMSCs.\u003c/p\u003e\n\u003cp\u003e(e-f) Treatment with Na-Cro during osteogenic induction partially rescued the osteogenic defects in oeSLC31A1-hBMSCs, as evidenced by increased expression of Runx2 and ALP. Na-Cro treatment also enhanced ALP activity and calcium deposition, supporting a regulatory role of H3K4cr in SLC31A1-mediated copper homeostasis and osteogenesis.\u003c/p\u003e\n\u003cp\u003eData information: \u003csup\u003en.s\u003c/sup\u003eP \u0026gt; 0.05; *P \u0026lt; 0.05; **P \u0026lt; 0.01; ***P \u0026lt; 0.001; ****P \u0026lt; 0.0001;\u003csup\u003e#\u003c/sup\u003eP \u0026lt; 0.05; \u003csup\u003e##\u003c/sup\u003eP \u0026lt; 0.01; \u003csup\u003e###\u003c/sup\u003eP \u0026lt; 0.001; \u003csup\u003e####\u003c/sup\u003eP \u0026lt; 0.0001. Bars represent mean ± SD.\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-7734583/v1/59981d2dcb718221fe350709.png"},{"id":92481281,"identity":"d745be5d-ee25-433c-9d22-c35c0f685706","added_by":"auto","created_at":"2025-09-30 07:49:34","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":22972382,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSLC31A1 impairs osteogenesis through cuproptosis activation both in vitro and in vivo.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(a) Overexpression of SLC31A1 significantly upregulated key cuproptosis regulators FDX1 and LIPT1, as well as the copper-dependent lipoylated protein DLAT.\u003c/p\u003e\n\u003cp\u003e(b) Cuproptosis induction with CuET (150 ng/mL for 24 h) confirmed elevated expression of cuproptosis markers.\u003c/p\u003e\n\u003cp\u003e(c–d) Treatment of oeSLC31A1-hBMSCs with the TM (10 µM) restored Runx2 and ALP expression, as assessed by RT- qPCR and Western blot.\u003c/p\u003e\n\u003cp\u003e(e) Intracellular copper levels were significantly reduced by TM treatment in oeSLC31A1-hBMSCs.\u003c/p\u003e\n\u003cp\u003e(f) ALP and ARS staining showed that TM restored osteogenic differentiation capacity in oeSLC31A1-hBMSCs.\u003c/p\u003e\n\u003cp\u003e(g) RT-qPCR and Western blot analysis of serum samples from OVX rats revealed elevated SLC31A1 expression compared to sham.\u003c/p\u003e\n\u003cp\u003e(h) AAV-mediated SLC31A1 knockdown in OVX rats was confirmed by qRT-PCR and Western blotting.\u003c/p\u003e\n\u003cp\u003e(i) Micro-CT analysis demonstrated significant improvements in BMD, BV/TV, and Tb.N in the SLC31A1 knockdown group.\u003c/p\u003e\n\u003cp\u003e(j) H\u0026amp;E and Masson's trichrome staining showed increased osteoblast numbers, improved trabecular structure, and enhanced collagen deposition in the knockdown group, indicating elevated osteogenic activity.\u003c/p\u003e\n\u003cp\u003eData information: \u003csup\u003en.s\u003c/sup\u003eP \u0026gt; 0.05; *P \u0026lt; 0.05; **P \u0026lt; 0.01; ***P \u0026lt; 0.001; ****P \u0026lt; 0.0001;\u003csup\u003e#\u003c/sup\u003eP \u0026lt; 0.05; \u003csup\u003e##\u003c/sup\u003eP \u0026lt; 0.01; \u003csup\u003e###\u003c/sup\u003eP \u0026lt; 0.001; \u003csup\u003e####\u003c/sup\u003eP \u0026lt; 0.0001. Bars represent mean ± SD.\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-7734583/v1/420cb96388722b833163a2a4.png"},{"id":92838589,"identity":"91f81aab-0ceb-40fa-8f31-b7a0bd9237ae","added_by":"auto","created_at":"2025-10-06 08:25:18","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":83199818,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7734583/v1/bbdfe8ad-789b-41e3-a948-45712b27672d.pdf"},{"id":92480529,"identity":"fc11d649-568b-4572-85df-327ef63ac339","added_by":"auto","created_at":"2025-09-30 07:41:33","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":21625,"visible":true,"origin":"","legend":"Supplementary Table 3","description":"","filename":"SupplementaryTableXXXListofabbreviationsusedinthisstudy.docx","url":"https://assets-eu.researchsquare.com/files/rs-7734583/v1/300978059c33b6aee93b9910.docx"},{"id":92481278,"identity":"b9d1a504-09d0-473b-b45e-e0d15de5ffee","added_by":"auto","created_at":"2025-09-30 07:49:33","extension":"png","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":1254274,"visible":true,"origin":"","legend":"Figure 6","description":"","filename":"GraphicalAbstract.png","url":"https://assets-eu.researchsquare.com/files/rs-7734583/v1/3556e78cc47fc210d9f1aba3.png"}],"financialInterests":"There is no conflict of interest","formattedTitle":"SIRT2 suppressed osteogenesis via transcriptionally regulation of SLC31A1-meidated cuproptosis in a crotonylation manner","fulltext":[{"header":"Introduction","content":"\u003cp\u003eOP, a prevalent skeletal disorder, manifests as compromised bone mass and structural deterioration, culminating in heightened fragility and fracture susceptibility. This condition affects over 200\u0026nbsp;million individuals globally, predominantly postmenopausal women and the elderly\u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e,\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e. Bone tissue comprises organic components - predominantly type I collagen, glycosaminoglycans, and noncollagenous proteins - and an inorganic mineral phase of hydroxyapatite crystals. Its cellular compartment, including osteoblasts, osteoclasts, and osteocytes, orchestrates matrix deposition, mineralization, and remodeling to maintain skeletal homeostasis\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e,\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e. While osteoclast-dominated resorption exceeding osteoblast-mediated formation drives osteoporosis pathogenesis, emerging evidence implicates osteoblast dysfunction and viability loss as critical determinants of disease progression \u003csup\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e,\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e. There is growing evidence that the process of osteoblast dysfunction is not only regulated by genetic programs, but also by epigenetic regulation.\u003c/p\u003e\u003cp\u003eEpigenetic modifications have emerged as crucial regulators of gene expression. Kcr is a distinct post-translational modification whereby a crotonyl group is added to the ε-amino group of lysine residues\u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e. Unlike acetylation, crotonylation robustly associates with transcriptionally active chromatin, enhancing chromatin accessibility and recruiting transcriptional machinery\u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e,\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e. In particular, H3K4cr facilitates transcription factor loading at gene promoters\u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e. Sirtuins provide a mechanistic link between metabolism and chromatin remodeling. SIRT2 is a member of the family of silent information regulator 2 homologous proteins, which are all nicotinamide adenine dinucleotide (NAD⁺)-dependent deacetylases or deacylases\u003csup\u003e\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e,\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e. As a key member of the Sirtuin family localized in the cytoplasm and nucleus, SIRT2 plays a vital role in regulating the cell cycle[20], oxidative stress[20], metabolic homeostasis\u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e, and epigenetic modifications\u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e,\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003e. Recent studies have shown that SIRT2 possesses not only deacetylase activity\u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e, but also decrotonylase activity, which is capable of specifically removing crotonyl group on histone lysine residues, especially H3K4cr, and thus regulating chromatin conformation and target gene expression\u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e. SIRT2 thus serves as a bridge between cellular metabolic states and epigenetic regulation, playing key roles in various physiopathological processes. SIRT2-mediated decrotonylation provides a potential mechanism through which metabolic cues can directly regulate promoter activity in osteogenesis-related gene networks. Given that SIRT2 integrates metabolic signals with chromatin remodeling, it is plausible that SIRT2 may also intersect with copper metabolism and cuproptosis in osteoblasts.\u003c/p\u003e\u003cp\u003eCuproptosis represents another metabolism-linked pathway that intersects with osteoblast biology. Cuproptosis, a recently characterized form of regulated cell death mechanistically distinct from apoptosis, ferroptosis, and necroptosis, is triggered by intracellular copper overload. As an essential cofactor in energy metabolism and antioxidant defense\u003csup\u003e\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e, copper homeostasis is stringently controlled. Pathological accumulation prompts copper binding to lipoylated TCA cycle enzymes, inducing Fe\u0026ndash;S cluster protein destabilization, proteotoxic stress, and cell death\u003csup\u003e\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e,\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e. Metabolically active osteoblasts, responsible for bone matrix synthesis, exhibit marked vulnerability to copper dysregulation, suggesting cuproptosis-mediated osteoblast demise may exacerbate bone loss\u003csup\u003e\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e,\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u003c/sup\u003e. SLC31A1, a high-affinity copper importer, critically maintains intracellular copper equilibrium\u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e. Its expression is rigorously regulated to prevent copper overload and toxicity \u003csup\u003e\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u003c/sup\u003e. Dysregulated SLC31A1 has been implicated in diverse pathologies, highlighting the importance of its transcriptional regulation. In osteoblasts, SLC31A1 determines intracellular copper levels and thereby influences cellular function, survival, and susceptibility to cuproptosis\u003csup\u003e\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e,\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e,\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e. Collectively, these observations suggest that dysregulated copper influx via SLC31A1 could act as a key trigger of cuproptosis, linking copper imbalance to impaired osteoblast viability and bone loss in osteoporosis.\u003c/p\u003e\u003cp\u003eRecent studies have identified ELF3 as a key transcriptional activator of SLC31A1. ELF3 binds to the SLC31A1 promoter, enhancing its transcription and promoting copper uptake \u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e. Nevertheless, the upstream molecular mechanisms regulating ELF3-driven SLC31A1 expression remain largely undefined. Notably, whether ELF3 participates in the regulation of cuproptosis in osteoblasts and during osteoporosis has not yet been reported. ELF3 has been implicated in epithelial differentiation\u003csup\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e and stress responses\u003csup\u003e\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u003c/sup\u003e, but its role in osteoblast copper homeostasis remains unexplored. Elucidating these pathways is therefore critical for understanding disturbed copper balance in osteoblasts and its contribution to osteoporosis pathogenesis.\u003c/p\u003e\u003cp\u003eSIRT2 upregulation in osteoblasts may enhance its decrotonylase activity, thereby depleting H3K4cr. This epigenetic shift may diminish recruitment of Kcr-dependent transcriptional regulators and favor ELF3 binding at the SLC31A1 promoter, thereby increasing SLC31A1 transcription and copper uptake. Excess intracellular copper would then trigger cuproptosis in osteoblasts, impairing their function and accelerating bone loss. By revealing this previously unrecognized link between epigenetic regulation, trace metal metabolism, and osteoblast viability, our findings have the potential to provide new mechanistic insights into the pathophysiology of osteoporosis. In addition, targeting key nodes within the SIRT2\u0026ndash;H3K4cr\u0026ndash;SLC31A1 regulatory axis may provide new therapeutic avenues for preventing or mitigating bone loss in osteoporosis patients.\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\n \u003ch2\u003eClinical and experimental evidence reveal elevated SIRT2 expression in OP\u003c/h2\u003e\n \u003cp\u003eTo investigate the functional role of Kcr in OP, we analyzed Kcr-related genes using two OP-related GEO datasets, GSE35958 and GSE56815, via the online tool GEO2R\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e. As illustrated in Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003ea-b, our analysis revealed a consistent elevation of SIRT2, a recognized Kcr \u0026ldquo;eraser\u0026rdquo;, across both datasets. Furthermore, we assessed SIRT2 expression in 40 serum samples from individuals with OP and 40 paired serum samples from individuals without OP (non-OP) using RT-qPCR and western blot assays. The results demonstrated a pronounced elevation of SIRT2 expression in OP serum samples compared to that in non-OP samples (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003ec-d). Additionally, a further spearman correlation analysis revealed a robust positive correlation between SIRT2 expression and C-terminal telopeptide of type I collagen (CTX-1)\u003csup\u003e24\u003c/sup\u003e, a marker of bone resorption (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003ee). On the contrary, it was found that the expression level of SIRT2 was inversely associated with Bone Gla protein (BGP)\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e25\u003c/span\u003e\u003c/sup\u003e, a bone formation marker (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003ef). Even further, an OP-hBMSCs model was constructed as previously reported\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/sup\u003e. As shown in Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eg-h, the outcomes indicated that the expression of Runx2 and ALP was significantly downregulated in the constructed OP-hBMSCs model. Additionally, the expression of SIRT2 was further detected. As the findings indicated by an RT-qPCR assay and a western blot assay, SIRT2 was upregulated in OP-hBMSCs. Lastly, it was unveiled that high expression of SIRT2 was closely correlated with high risk of OP, and that SIRT2 might be an independent prognostic factor (Table \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e\n\u003c/div\u003e\n\u003ch3\u003eSIRT2 modulates H3K4cr levels during osteogenesis\u003c/h3\u003e\n\u003cp\u003eSIRT2, through its deacetylase activity, regulates the removal of various fatty acyl groups, including crotonyl groups, thereby influencing histone modifications such as H3K4cr\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e. While SIRT2 exhibits decrotonylase activity in vitro, its intracellular functions have not been fully substantiated. This finding motivated a deeper investigation into the role of SIRT2 in osteogenic differentiation and in the development of osteoporosis. To investigate the effect of SIRT2 on H3K4cr levels in hBMSCs, stable cell lines with either SIRT2 knockdown (shSIRT2) or overexpression (oeSIRT2) were generated via lentiviral transduction. RT-qPCR and Western blot analyses confirmed that SIRT2 expression was significantly reduced in shSIRT2 cells compared with the shNC group, while it was markedly increased in oeSIRT2 cells relative to the pcDNA group (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003ea). Immunoblotting with a specific anti-H3K4cr antibody revealed that SIRT2 knockdown (shSIRT2-1/2) significantly increased H3K4cr levels, indicating that SIRT2 regulates H3K4cr in hBMSCs (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eb).To investigate the functional consequence of SIRT2-mediated H3K4cr during osteogenic differentiation, hBMSCs were cultured in osteogenic induction medium, and the expression levels of SIRT2, H3K4cr, and osteogenic markers ALP and Runx2 were evaluated at days 0, 7, and 14. As shown in Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003ec-d, ALP and Runx2 levels were progressively increased over time, confirming successful osteogenic differentiation. Notably, gradually decreased SIRT2 expression as well as increased H3K4cr levels were found at day 7 and day 14. To further clarify the role of SIRT2 and exclude potential nonspecific effects, oeSIRT2-hBMSCs were subjected to the same osteogenic induction protocol, and ALP and Runx2 expression were assessed at corresponding time points. Compared with pcDNA, a significant and time-dependent reduction of ALP and Runx2 expression was exhibited in oeSIRT2-hBMSCs (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003ee-f). Consistently, SIRT2 overexpression reduced H3K4cr levels and further suppressed ALP and Runx2 expression (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eg-h). To validate the regulatory role of H3K4cr, sodium crotonate (a crotonylation agonist, Na-Cro) was added to oeSIRT2-hBMSCs. Treatment partially restored H3K4cr levels and concomitantly increased ALP and Runx2 expression (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eg-h). Phenotypically, SIRT2 overexpression markedly suppressed ALP activity and calcium nodule formation, as shown by diminished ALP staining at day 7 and reduced ARS staining at day 14. Importantly, Na-Cro supplementation reversed these effects, restoring ALP activity and enhancing mineralized matrix deposition. These findings demonstrate that SIRT2 inhibits both early and late osteogenic events by reducing H3K4cr, while increased crotonylation counteracts this suppression (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003ei).\u003c/p\u003e\n\u003cp\u003eSubsequent in vivo validation employed an OVX rat model, a well-established system for bone loss and regeneration studies\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e. SIRT2 knockdown was achieved via adeno-associated virus (AAV) vector delivery and confirmed by RT-qPCR and serum Western blotting (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003ej). Immunohistochemistry (IHC) using an anti-H3K4cr antibody demonstrated predominant nuclear localization of this modification in osteoblasts. Significantly higher H3K4cr levels were observed in Sham versus OVX rats, while shSIRT2-OVX rats exhibited marked restoration of H3K4cr to Sham levels (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003ek). Micro-Computed Tomography imaging \u003cstrong\u003e(\u003c/strong\u003eMicro-CT) analysis after four weeks showed that the shSIRT2-OVX rats exhibited significantly enhanced bone regeneration compared to Sham, as evidenced by increased bone mineral density (BMD), bone volume fraction (BV/TV), and trabecular number (Tb. N) (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003el). In summary, these findings provide compelling evidence that SIRT2 downregulation promotes osteogenesis and bone regeneration in OVX-induced osteoporotic rats, potentially through upregulation of H3K4 crotonylation.\u003c/p\u003e\n\u003ch3\u003eSIRT2-mediated decrotonylation of H3K4cr promoted SLC31A1 transcription by competing with ELF3 for binding\u003c/h3\u003e\n\u003cp\u003eSLC31A1 is a crucial transmembrane transporter involved in cellular copper uptake and homeostasis\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/sup\u003e. Notably, we analyzed the OP-related GEO dataset GSE35956 using the online tool GEO2R and found that SLC31A1 expression was significantly upregulated in OP patients compared with non-OP patients (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003ea). To explore whether SIRT2 modulates H3K4cr at the SLC31A1 promoter, ChIP-qPCR was performed in shSIRT2-hBMSCs and shNC-hBMSCs. The results showed a marked enrichment of H3K4cr at the SLC31A1 promoter following SIRT2 knockdown (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eb). Consistently, RT-qPCR and Western blot analyses demonstrated that loss of SIRT2 significantly suppressed SLC31A1 mRNA and protein expression (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003ec). These findings suggest, for the first time, that SIRT2 promotes SLC31A1 transcription via its decrotonylase activity, underscoring the inhibitory effect of histone crotonylation on gene expression. To further clarify the mechanism, we assessed ELF3 binding to the SLC31A1 promoter. ChIP-qPCR revealed that ELF3 occupancy was markedly reduced in shSIRT2-hBMSCs compared with shNC-hBMSCs (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003ed). To validate this regulatory axis, ELF3 was either silenced or overexpressed in shSIRT2-hBMSCs, and both RT-qPCR and Western blot confirmed the efficiency of modulation (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003ee). Importantly, ChIP-qPCR analysis showed that ELF3 overexpression significantly restored its recruitment to the SLC31A1 promoter in shSIRT2-hBMSCs (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003ef).\u003c/p\u003e\n\u003cp\u003eDual-luciferase reporter assays further validated the functional relevance of these interactions. Overexpression of H3K4cr in shSIRT2-hBMSCs significantly reduced SLC31A1 promoter activity. Co-expression of ELF3 partially rescued this suppression, while knockdown of ELF3 further enhanced the inhibitory effect, supporting a competitive interplay between H3K4cr and ELF3 at the promoter region (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eg). Collectively, these data establish a regulatory model in which SIRT2 removes H3K4cr to relieve its competition with ELF3, thereby promoting ELF3 enrichment at the SLC31A1 promoter and enhancing its transcription.\u003c/p\u003e\n\u003ch3\u003eH3K4cr mediates SLC31A1 upregulation to inhibit osteogenesis\u003c/h3\u003e\n\u003cp\u003eTo investigate the role of SLC31A1 in copper uptake and osteogenic differentiation, H3K4cr-mediated alterations in copper homeostasis and their functional implications for osteogenesis were first assessed. HBMSC models with stable knockdown and overexpression of SLC31A1 were established, and SLC31A1 expression levels were confirmed by RT-qPCR and Western blotting (Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003ea). During osteogenic differentiation of oeSLC31A1-hBMSCs, intracellular copper levels were significantly elevated compared to pcDNA (Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eb), while the expression of osteogenic markers Runx2 and ALP was notably decreased (Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003ed). These findings suggest a strong correlation between increased copper levels and impaired osteogenesis. Consistently, ALP and ARS staining revealed reduced ALP activity and mineralization capacity in oeSLC31A1-hBMSCs (Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003ed).\u003c/p\u003e\n\u003cp\u003eTo further confirm the role of SLC31A1 in copper homeostasis, we treated oeSLC31A1-hBMSCs with sodium crotonate during osteogenic induction. This treatment significantly restored osteogenic differentiation, as evidenced by increased expression of Runx2 and ALP (Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003ee-f), along with enhanced ALP activity and mineral deposition (Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003ed). These results suggest that H3K4cr may regulate osteogenesis by modulating SLC31A1 transcription, thereby influencing copper homeostasis. Taken together, the data demonstrate that overexpression of SLC31A1 impairs the osteogenic potential of hBMSCs, likely through disruption of copper balance regulated by histone crotonylation.\u003c/p\u003e\n\u003ch3\u003eSLC31A1 suppressed osteogenesis by activating cuproptosis\u003c/h3\u003e\n\u003cp\u003eTo further elucidate the mechanism of SLC31A1 in osteogenesis, we examined the expression of molecular markers associated with cuproptosis. The results showed that in oeSLC31A1-hBMSCs, key cuproptosis regulators, including Ferredoxin 1(FDX1) and Lipoyltransferase 1(LIPT1), were significantly upregulated, and levels of Dihydrolipoamide S-Acetyltransferase (DLAT) were also markedly increased (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003ea). These findings were further validated by treating hBMSCs with 150 ng/mL of elesclomol (CuET), a known inducer of cuproptosis, for 24 hours (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eb). Together, these data indicate that overexpression of SLC31A1 promotes the onset of cuproptosis in hBMSCs. To determine whether the inhibitory effect of SLC31A1 on osteogenic differentiation is dependent on cuproptosis, we treated oeSLC31A1-hBMSCs with the copper chelator tetrathiomolybdate (TM, 10 \u0026micro;M) during osteogenic induction. RT-qPCR and Western blot analysis revealed a significant upregulation of Runx2 and ALP mRNA levels following TM treatment (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003ec-d); intracellular copper levels also decreased (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003ee). Furthermore, both ALP and ARS staining demonstrated that TM administration effectively restored the osteogenic capacity of oeSLC31A1-hBMSCs (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003ef-g). These findings provide additional evidence that SLC31A1 impairs osteogenic differentiation by activating cuproptosis.\u003c/p\u003e\n\u003cp\u003eTo further verify the role of SLC31A1 in vivo, we assessed SLC31A1 expression in OVX serum samples. Western blot and RT-qPCR analyses showed that SLC31A1 expression was significantly elevated in OVX rats compared to Sham (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eh-i). To further elucidate the in vivo role of SLC31A1, we utilized AAV-mediated shRNA delivery approach to achieve targeted knockdown of SLC31A1 in OVX rats. The efficiency of knockdown was confirmed by both RT-qPCR and Western blot analyses (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003ej). Four weeks after injection, micro-CT analysis revealed that BMD, BV/TV and Tb. N were significantly increased in the shSLC31A1-OVX rats (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eh). Histological evaluation demonstrated a marked increase in osteoblast numbers within the bone tissue of the shSLC31A1-OVX rats. Hematoxylin and Eosin (H\u0026amp;E) staining revealed well-organized trabeculae with osteoblasts lining the bone surface. In contrast, Masson\u0026apos;s trichrome staining indicated enhanced collagen deposition and bone matrix formation, collectively suggesting elevated osteogenic activity following SLC31A1 silencing (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003ej). In summary, these results demonstrate that SLC31A1 impairs osteogenic differentiation both in vitro and in vivo by promoting cuproptosis, and that inhibition of cuproptosis can effectively rescue this impaired osteogenic potential. These findings highlight SLC31A1 as a critical regulator linking copper homeostasis, cuproptosis, and bone formation.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eThis study elucidates a novel epigenetic mechanism by which SIRT2 regulates osteogenesis through the modulation of H3K4cr, with downstream effects on the copper transporter gene SLC31A1. Our findings reveal that SIRT2 is significantly upregulated in both human osteoporosis samples and an OP cell model, with its expression showing a positive correlation with bone resorption markers and an inverse correlation with bone formation markers. These observations align with prior research suggesting that SIRT2 is involved in bone metabolism. For instance, a 2019 study demonstrated that SIRT2 deficiency mitigates age-related bone loss in rats by inhibiting osteoclastogenesis \u003csup\u003e\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u003c/sup\u003e, liver-specific SIRT2 deficiency inhibits bone formation and mitigates bone loss in a mouse model of osteoporosis\u003csup\u003e\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u003c/sup\u003e, SIRT2 deacetylated C/EBPβ promotes AREG expression, thereby activating PI3K-AKT signaling pathway to promote osteoblast differentiation\u003csup\u003e\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u003c/sup\u003e, hinting at a dual role for SIRT2 in regulating both bone resorption and formation.\u003c/p\u003e\u003cp\u003eFunctionally, SIRT2 acts as a negative regulator of osteogenesis by removing H3K4cr. This decrotonylation represses the transcription of key osteogenic markers, such as Runx2 and ALP. Histone crotonylation is an emerging player in cellular differentiation, with studies demonstrating its role in other contexts, such as promoting endoderm differentiation in human embryonic stem cells by enhancing lineage-specific gene expression \u003csup\u003e\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e. Our findings extend this paradigm to osteogenesis, suggesting that SIRT2-mediated removal of H3K4cr suppresses the osteogenic differentiation of mesenchymal stem cells, thereby contributing to the pathogenesis of osteoporosis.\u003c/p\u003e\u003cp\u003eA pivotal discovery in our study is the SIRT2-H3K4cr-ELF3 axis, which mechanistically links histone modification to the regulation of metabolic genes in bone formation. We demonstrate that SIRT2, by suppressing H3K4cr, facilitates the recruitment of the transcription factor ELF3 to the SLC31A1 promoter, thereby enhancing SLC31A1 transcription. ELF3, known to regulate cellular processes such as epithelial differentiation\u003csup\u003e\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u003c/sup\u003e and inflammation \u003csup\u003e\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e,\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u003c/sup\u003e, emerges here as a critical mediator in osteogenesis. This axis not only underscores the interplay between epigenetic modifications and transcriptional control but also positions SIRT2 as a central regulator of metabolic pathways in bone biology. This mechanism may serve as a model for how histone modifications influence other metabolic genes in skeletal tissues, underscoring the need for further exploration.\u003c/p\u003e\u003cp\u003eOur study further uncovers the role of SLC31A1 in osteogenesis, driven by its disruption of copper homeostasis and activation of cuproptosis\u0026mdash;a recently identified form of copper-dependent cell death. Overexpression of SLC31A1, a copper transporter, elevates intracellular copper levels, triggering the activation of FDX1, LIPT1, and DLAT\u0026mdash;hallmark components of the cuproptosis pathway. This cascade inhibits osteogenic differentiation, likely by inducing cellular stress and impairing the function of osteoblasts. While direct studies on SLC31A1 in osteoporosis are limited, copper\u0026rsquo;s role in bone health is well-documented. For example, a 2018 study linked serum copper levels to bone mineral density and fracture risk, and excessive copper has been shown to impair bone mineralization \u003csup\u003e\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u003c/sup\u003e. Our findings bridge these observations, demonstrating that SLC31A1-mediated copper overload shifts the cellular fate toward cuproptosis, thus suppressing bone formation.\u003c/p\u003e\u003cp\u003eNotably, we demonstrate that pharmacological interventions can reverse these effects, underscoring their therapeutic potential. Sodium crotonate, which enhances histone crotonylation, restores H3K4cr levels and promotes osteogenic gene expression. Similarly, copper chelators such as tetrathiomolybdate reduce intracellular copper accumulation, mitigate cuproptosis, and rescue osteogenesis. These findings are particularly promising, given the precedent for copper chelators in treating copper-overload disorders, such as Wilson\u0026rsquo;s disease \u003csup\u003e\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e,\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u003c/sup\u003e. Repurposing such agents for osteoporosis could offer a novel strategy, especially in cases where copper dysregulation contributes to bone loss. Moreover, the use of histone-modifying agents aligns with studies showing that histone deacetylase inhibitors enhance osteogenesis [35, 36], thereby reinforcing the therapeutic relevance of targeting epigenetic regulators, such as SIRT2.\u003c/p\u003e\u003cp\u003eOur in vitro findings were robustly validated in vivo using an ovariectomized rat model, a well-established model of postmenopausal osteoporosis\u003csup\u003e\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u003c/sup\u003e. Knockdown of SIRT2 restored H3K4cr levels, enhanced bone regeneration, and improved trabecular bone volume, as assessed by micro-CT analysis. Similarly, SLC31A1 knockdown reduced copper accumulation in bone tissue and improved bone microarchitecture, corroborating the deleterious role of copper overload. These results not only strengthen the translational relevance of our findings but also align with prior evidence that modulating epigenetic or metabolic pathways can improve bone health in preclinical models\u003csup\u003e\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003eThis study provides a comprehensive framework for understanding the epigenetic and metabolic regulation of osteogenesis, with SIRT2 and SLC31A1 emerging as potential therapeutic targets for osteoporosis. The identification of the SIRT2-H3K4cr-ELF3 axis and its downstream effects on copper homeostasis opens new avenues for research and treatment development. Future studies could explore: The role of this axis in other bone-related diseases, such as osteoarthritis or bone metastasis; Additional genes regulated by SIRT2-mediated crotonylation in skeletal tissues; and Clinical trials to evaluate sodium crotonate, copper chelators, or SIRT2 inhibitors as treatments for osteoporosis.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cp\u003ePatients and Clinical Samples\u003c/p\u003e\u003cp\u003eForty patients diagnosed with osteoporosis (OP) and 40 age- and sex-matched non-OP controls were recruited from the Department of Spine Ⅱ, [Central Hospital Affiliated to Shenyang Medical College], between January and December 2024. OP was defined by dual-energy X-ray absorptiometry (DXA; T-score \u0026le;\u0026ndash;2.5 at the lumbar spine or femoral neck). Serum samples were collected after overnight fasting, aliquoted, and stored at \u0026minus;\u0026thinsp;80\u0026deg;C until analysis. All procedures were approved by the institutional review board of central hospital affiliated to Shenyang medical college (2023DEC12-8), and written informed consent was obtained from all participants.\u003c/p\u003e\u003cp\u003eBioinformatic Analysis of GEO Datasets\u003c/p\u003e\u003cp\u003eGene expression profiles from three publicly available op-related datasets (GSE35956, GSE35958, and GSE56815) were downloaded from the GEO datasets. Differentially expressed Kcr-related genes were identified using the GEO2R online tool with default settings. Only genes with |log2 fold change| \u0026gt;1 and adjusted p\u0026thinsp;\u0026lt;\u0026thinsp;0.05 were considered significant.\u003c/p\u003e\u003cp\u003eCell Culture and Osteogenic Differentiation\u003c/p\u003e\u003cp\u003eHBMSCs (Lonza, Cat. No. PT-2501) were cultured in α-MEM supplemented with 10% fetal bovine serum (FBS; Gibco), 100 U/mL penicillin, and 100 \u0026micro;g/mL streptomycin at 37\u0026deg;C in a humidified 5% CO₂ atmosphere. For osteogenic induction, confluent hBMSCs were switched to osteogenic medium (αMEM containing 10% FBS, 50 \u0026micro;g/mL ascorbic acid, 10 mM β-glycerophosphate, and 100 nM dexamethasone). The medium was changed every 3 days, and samples were harvested at days 0, 7, and 14.\u003c/p\u003e\u003cp\u003eConstruction of the OP-hBMSCs Model\u003c/p\u003e\u003cp\u003eTo simulate osteoporotic conditions, human bone marrow-derived mesenchymal stem cells were treated with dexamethasone to inhibit osteogenic differentiation. Cells at 70\u0026ndash;80% confluence were cultured in α-Minimum Essential Medium (α-MEM; Gibco, Cat. No. 12561056) supplemented with 100 nM dexamethasone (Sigma-Aldrich, Cat. No. D4902), 10 mM β-glycerophosphate (Sigma-Aldrich, Cat. No. G9422), and 50 \u0026micro;g/mL ascorbic acid (Sigma-Aldrich, Cat. No. A4544) for 7 days, with the medium replaced every 2 days. Successful induction of an osteoporosis-like phenotype was confirmed by a greater than 30% reduction in alkaline phosphatase activity and downregulation of Runx2 and ALP expression at both mRNA and protein levels, as assessed by RT-qPCR and Western blotting, respectively, compared to untreated controls.\u003c/p\u003e\u003cp\u003eLentiviral Transduction and Generation of Stable Cell Lines\u003c/p\u003e\u003cp\u003eShort hairpin RNAs targeting SIRT2 (shSIRT2) and nontargeting control (shRNA) were cloned into the pLKO.1 vector (Addgene, Cat. No. 10878). For overexpression, full-length human SIRT2 cDNA was subcloned the pLVX-Puro vector (Takara, Cat. No. 632183). Lentiviral particles were produced in HEK293T cells (ATCC, Cat. No. CRL-11268) by co-transfection with psPAX2 (Addgene, Cat. No. 12260) and pMD2.G (Addgene, Cat. No. 12259) using Lipofectamine 3000 (Thermo Fisher Scientific, Cat. No. L3000015). Human bone marrow-derived mesenchymal stem cells were transduced at a multiplicity of infection of 20 in the presence of 8 \u0026micro;g/mL polybrene (Sigma-Aldrich, Cat. No. H9268). After 48 h, cells were selected with 2 \u0026micro;g/mL puromycin for 7 days. Knockdown or overexpression efficiency was validated by RT-qPCR and Western blot.\u003c/p\u003e\u003cp\u003eRT-qPCR and Western Blotting\u003c/p\u003e\u003cp\u003eTotal RNA was extracted from cells using TRIzol Reagent (Invitrogen, Cat. No. 15596026) and reverse transcribed into complementary DNA with the PrimeScript RT Reagent Kit (Takara, Cat. No. RR037A). Quantitative polymerase chain reaction (qPCR) was performed on a QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems, Cat. No. 4485696) using SYBR Green PCR Master Mix (Thermo Fisher Scientific, Cat. No. 4309155). Relative gene expression was calculated using the 2^\u0026ndash;ΔCt method, with glyceraldehyde 3-phosphate dehydrogenase (GAPDH) serving as the internal control. For Western blot analysis, total proteins were extracted with radioimmunoprecipitation assay (RIPA) buffer supplemented with protease inhibitors (Thermo Fisher Scientific, Cat. No. 78430). Proteins were separated by sodium dodecyl sulfate\u0026ndash;polyacrylamide gel electrophoresis (SDS-PAGE; Bio-Rad, Cat. No. 4568094), transferred to polyvinylidene difluoride (PVDF) membranes (Millipore, Cat. No. IPVH00010), and incubated with primary antibodies against SIRT2 (Abcam, Cat. No. ab124974), H3K4cr (PTM Biolabs, Cat. No. PTM-1401), Runx2 (Cell Signaling Technology, Cat. No. 12556), ALP (Abcam, Cat. No. ab108337), SLC31A1 (Proteintech, Cat. No. 15955-1-AP), FDX1 (Abcam, Cat. No. ab174825), LIPT1 (Proteintech, Cat. No. 18157-1-AP), DLAT (Abcam, Cat. No. ab110332), and GAPDH as loading control. Membranes were incubated with horseradish peroxidase-conjugated secondary antibodies (Cell Signaling Technology, Cat. No. 7074) and visualized using enhanced chemiluminescence (ECL) detection reagents (GE Healthcare, Cat. No. RPN2232).\u003c/p\u003e\u003cp\u003eChromatin Immunoprecipitation (ChIP-qPCR)\u003c/p\u003e\u003cp\u003eChromatin immunoprecipitation (ChIP) was performed using the SimpleChIP Enzymatic Chromatin IP Kit (Cell Signaling Technology, Cat. No. 9003S) according to the manufacturer\u0026rsquo;s instructions. Briefly, 1 \u0026times; 10⁷ hBMSCs were crosslinked with 1% formaldehyde (Sigma-Aldrich, Cat. No. F8775) for 10 min at room temperature and quenched with 125 mM glycine (Sigma-Aldrich, Cat. No. G8790) for 5 min. Chromatin was then fragmented enzymatically using micrococcal nuclease supplied in the kit. Immunoprecipitation was performed overnight at 4\u0026deg;C with anti-H3K4cr antibody or anti-ELF3 antibody (Abcam, Cat. No. ab211889). Protein-DNA complexes were captured using protein G magnetic beads provided in the kit, followed by washing and reverse crosslinking. DNA was purified using the kit\u0026rsquo;s spin columns and quantified by quantitative PCR with primers specific for the SLC31A1 promoter. Enrichment was calculated relative to input DNA and normalized to IgG control (SimpleChIP Normal Rabbit IgG, Cell Signaling Technology, Cat. No. 2729S).\u003c/p\u003e\u003cp\u003eDual-Luciferase Reporter Assay\u003c/p\u003e\u003cp\u003eThe human SLC31A1 promoter (~\u0026thinsp;1 kilobase upstream of the transcription start site) was cloned into pGL4.10 [luc2] vector (Promega, Cat. No. E6651). Human bone marrow-derived mesenchymal stem cells were co-transfected with pGL4.10-SLC31A1, pRL-TK Renilla luciferase control plasmid (Promega, Cat. No. E2241), and expression vectors encoding ELF3 (Origene, Cat. No. RC217695) or an H3K4cr mimic (PTM Biolabs, Cat. No. PTM-1250) using Lipofectamine 3000 (Thermo Fisher Scientific, Cat. No. L3000015) according to the manufacturer\u0026rsquo;s instructions. After 48 hours, luciferase activity was measured using the Dual-Luciferase Reporter Assay System (Promega, Cat. No. E1910) on a GloMax 20/20 luminometer (Promega). Firefly luciferase activity was normalized to Renilla luciferase to control for transfection efficiency.\u003c/p\u003e\u003cp\u003eCopper Quantification\u003c/p\u003e\u003cp\u003eIntracellular copper levels were quantified using the Copper Assay Kit (Abcam, Cat. No. ab272528) following the manufacturer\u0026rsquo;s instructions. Briefly, cells were lysed in the provided lysis buffer, and the lysates were incubated with the Cu\u0026sup2;⁺-specific probe at room temperature for the recommended time. The absorbance was measured at 359 nm using a microplate reader (Thermo Scientific, Multiskan FC). Copper concentrations were calculated based on a standard curve generated with known Cu\u0026sup2;⁺ standards provided in the kit.\u003c/p\u003e\u003cp\u003eALP and ARS Staining\u003c/p\u003e\u003cp\u003eFor ALP staining, cells were fixed with 4% paraformaldehyde (Sigma-Aldrich, Cat. No. P6148) for 15 min at room temperature, followed by incubation with BCIP/NBT substrate (Sigma-Aldrich, Cat. No. B5655) for 30 min in the dark. ALP activity was quantified spectrophotometrically at 405 nm using a microplate reader. For mineralization assessment, cells were fixed with 4% paraformaldehyde and stained with 2% Alizarin Red S (Sigma-Aldrich, Cat. No. A5533; pH 4.2) for 20 min at room temperature. Excess stain was removed by washing with distilled water, and the bound dye was extracted with 10% cetylpyridinium chloride (Sigma-Aldrich, Cat. No. C9002). Mineralization was quantified by measuring the absorbance at 562 nm.\u003c/p\u003e\u003cp\u003eIn Vivo OVX Rat Model and AAV-Mediated Gene Knockdown\u003c/p\u003e\u003cp\u003eEight-week-old female Sprague\u0026ndash;Dawley rats weighing 200\u0026ndash;220 g were obtained from Liaoning Changsheng Biotechnology (Shenyang, China). Bilateral ovariectomy (OVX) or sham surgery was performed under isoflurane anesthesia (Sigma-Aldrich, Cat. No. Isoflurane) following standard aseptic procedures. Four weeks after OVX, rats were randomly assigned to receive tail vein injections of adeno-associated virus serotype 9 (AAV9) carrying shRNA targeting SIRT2 (AAV9-shSIRT2), shRNA targeting SLC31A1 (AAV9-shSLC31A1), or scrambled shRNA control (AAV9-shScramble) at a dose of 1\u0026times;10\u0026sup1;\u0026sup2; viral genomes per rat. All animal procedures were conducted in accordance with the Institutional Animal Care and Use Committee (IACUC) guidelines of Central Hospital Affiliated to Shenyang Medical College (2024DEC23-6), and efforts were made to minimize animal suffering.\u003c/p\u003e\u003cp\u003eMicro-CT, Histology, and IHC\u003c/p\u003e\u003cp\u003eFour weeks after adeno-associated virus (AAV) treatment, femurs were harvested and fixed in 4% paraformaldehyde (Sigma-Aldrich, Cat. No. P6148) at 4\u0026deg;C overnight. Samples were scanned using a high-resolution micro-computed tomography system (Skyscan 1176, Bruker) with a voxel size of 9 \u0026micro;m. Trabecular bone parameters, including BMD, BV/TV, and Tb. N, were quantified using the associated software. Decalcified bone sections were prepared using 10% ethylenediaminetetraacetic acid (EDTA; Sigma-Aldrich, Cat. No. E5134) and subsequently stained with Masson\u0026rsquo;s trichrome (Sigma-Aldrich, Cat. No. HT15) for osteoblast visualization. Immunohistochemistry was performed with an anti-H3K4cr antibody (Abcam, Cat. No. ab177919) following standard protocols. Copper deposition in bone tissue was evaluated using rubenamine acid staining (Sigma-Aldrich, Cat. No. R3016).\u003c/p\u003e\u003cp\u003ePharmacological Treatments\u003c/p\u003e\u003cp\u003eCuET (Selleck Chemicals, Cat. No. S7293) was applied at a final concentration of 150 ng/mL for 24 hours to induce cuproptosis in cultured cells. To chelate intracellular copper during osteogenic induction, TM (Sigma-Aldrich, Cat. No. T1529) was added at 10 \u0026micro;M. Both treatments were performed under standard culture conditions, and control groups received vehicle alone.\u003c/p\u003e\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e\u003ch2\u003eStatistical Analysis\u003c/h2\u003e\u003cp\u003eData are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD from at least three independent experiments. Unpaired two-tailed Student\u0026rsquo;s t test made statistical comparisons between two groups; multiple groups were compared using one-way ANOVA followed by Tukey\u0026rsquo;s post hoc test. Pearson\u0026rsquo;s correlation coefficient analyzed correlations. Cox proportional hazards model assessed the prognostic significance of SIRT2 expression. All analyses were performed with GraphPad Prism 10. p\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered statistically significant.\u003c/p\u003e\u003c/div\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eSupplementary Table Ⅲ List of abbreviations used in this study\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll patients have been informed and agree to participate in this study and the study protocol was approved by the Ethics Committee of Central Hospital Affiliated with Shenyang Medical College (Approval Number: 2023DEC12-8).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePlease contact the corresponding author for data requests.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNO Funding.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of Interests\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no conflict of interests.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors contributed equally to this work. They jointly participated in study conception and design, data acquisition, analysis, and interpretation. All authors were involved in drafting and revising the manuscript critically for important intellectual content. All authors approved the final version of the manuscript and agree to be accountable for all aspects of the work.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eArceo-Mendoza, R. M. \u0026amp; Camacho, P. M. Postmenopausal Osteoporosis: Latest Guidelines. \u003cem\u003eEndocrinol Metab Clin North Am\u003c/em\u003e 50, 167\u0026ndash;178 (2021). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1016/j.ecl.2021.03.009\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1016/j.ecl.2021.03.009\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCompston, J. E., McClung, M. R. \u0026amp; Leslie, W. D. Osteoporosis. \u003cem\u003eLancet\u003c/em\u003e 393, 364\u0026ndash;376 (2019). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1016/s0140-6736(18)32112-3\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1016/s0140-6736(18)32112-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBoyle, W. J., Simonet, W. S. \u0026amp; Lacey, D. L. Osteoclast differentiation and activation. \u003cem\u003eNature\u003c/em\u003e 423, 337\u0026ndash;342 (2003). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1038/nature01658\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1038/nature01658\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhivodernikov, I. V., Kirichenko, T. V., Markina, Y. V., Postnov, A. Y. \u0026amp; Markin, A. M. Molecular and Cellular Mechanisms of Osteoporosis. \u003cem\u003eInt J Mol Sci\u003c/em\u003e 24 (2023). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.3390/ijms242115772\u003c/span\u003e\u003cspan address=\"https://doi.org:10.3390/ijms242115772\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eXu, J., Yu, L., Liu, F., Wan, L. \u0026amp; Deng, Z. The effect of cytokines on osteoblasts and osteoclasts in bone remodeling in osteoporosis: a review. \u003cem\u003eFront Immunol\u003c/em\u003e 14, 1222129 (2023). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.3389/fimmu.2023.1222129\u003c/span\u003e\u003cspan address=\"https://doi.org:10.3389/fimmu.2023.1222129\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTan, M. \u003cem\u003eet al.\u003c/em\u003e Identification of 67 histone marks and histone lysine crotonylation as a new type of histone modification. \u003cem\u003eCell\u003c/em\u003e 146, 1016\u0026ndash;1028 (2011). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1016/j.cell.2011.08.008\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1016/j.cell.2011.08.008\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiu, N. \u003cem\u003eet al.\u003c/em\u003e Histone H3 lysine 27 crotonylation mediates gene transcriptional repression in chromatin. \u003cem\u003eMol Cell\u003c/em\u003e 83, 2206\u0026ndash;2221.e2211 (2023). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1016/j.molcel.2023.05.022\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1016/j.molcel.2023.05.022\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBao, X. \u003cem\u003eet al.\u003c/em\u003e Identification of 'erasers' for lysine crotonylated histone marks using a chemical proteomics approach. \u003cem\u003eElife\u003c/em\u003e 3 (2014). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.7554/eLife.02999\u003c/span\u003e\u003cspan address=\"https://doi.org:10.7554/eLife.02999\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhu, C. \u003cem\u003eet al.\u003c/em\u003e Multiple Roles of SIRT2 in Regulating Physiological and Pathological Signal Transduction. \u003cem\u003eGenet Res (Camb)\u003c/em\u003e 2022, 9282484 (2022). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1155/2022/9282484\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1155/2022/9282484\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePande, S. \u0026amp; Raisuddin, S. Molecular and cellular regulatory roles of sirtuin protein. \u003cem\u003eCrit Rev Food Sci Nutr\u003c/em\u003e 63, 9895\u0026ndash;9913 (2023). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1080/10408398.2022.2070722\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1080/10408398.2022.2070722\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRen, H. \u003cem\u003eet al.\u003c/em\u003e Sirtuin 2 Prevents Liver Steatosis and Metabolic Disorders by Deacetylation of Hepatocyte Nuclear Factor 4α. \u003cem\u003eHepatology\u003c/em\u003e 74, 723\u0026ndash;740 (2021). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1002/hep.31773\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1002/hep.31773\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChen, L., Min, J. \u0026amp; Wang, F. Copper homeostasis and cuproptosis in health and disease. \u003cem\u003eSignal Transduct Target Ther\u003c/em\u003e 7, 378 (2022). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1038/s41392-022-01229-y\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1038/s41392-022-01229-y\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLi, D., Gao, Z., Li, Q., Liu, X. \u0026amp; Liu, H. Cuproptosis-a potential target for the treatment of osteoporosis. \u003cem\u003eFront Endocrinol (Lausanne)\u003c/em\u003e 14, 1135181 (2023). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.3389/fendo.2023.1135181\u003c/span\u003e\u003cspan address=\"https://doi.org:10.3389/fendo.2023.1135181\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHan, J., Luo, J., Wang, C., Kapilevich, L. \u0026amp; Zhang, X. A. Roles and mechanisms of copper homeostasis and cuproptosis in osteoarticular diseases. \u003cem\u003eBiomed Pharmacother\u003c/em\u003e 174, 116570 (2024). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1016/j.biopha.2024.116570\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1016/j.biopha.2024.116570\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChen, J., Sun, Q., Wang, Y. \u0026amp; Yin, W. Revealing the key role of cuproptosis in osteoporosis via the bioinformatic analysis and experimental validation of cuproptosis-related genes. \u003cem\u003eMamm Genome\u003c/em\u003e 35, 414\u0026ndash;431 (2024). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1007/s00335-024-10049-0\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1007/s00335-024-10049-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eQi, Y. \u003cem\u003eet al.\u003c/em\u003e Cuproptosis-related gene SLC31A1: prognosis values and potential biological functions in cancer. \u003cem\u003eSci Rep\u003c/em\u003e 13, 17790 (2023). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1038/s41598-023-44681-8\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1038/s41598-023-44681-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLi, L., Li, L. \u0026amp; Sun, Q. High expression of cuproptosis-related SLC31A1 gene in relation to unfavorable outcome and deregulated immune cell infiltration in breast cancer: an analysis based on public databases. \u003cem\u003eBMC Bioinformatics\u003c/em\u003e 23, 350 (2022). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1186/s12859-022-04894-6\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1186/s12859-022-04894-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChen, X. \u003cem\u003eet al.\u003c/em\u003e SP1/CTR1-mediated oxidative stress-induced cuproptosis in intervertebral disc degeneration. \u003cem\u003eBiofactors\u003c/em\u003e 50, 1009\u0026ndash;1023 (2024). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1002/biof.2052\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1002/biof.2052\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eXu, F., Hu, X. R., Wang, Y. \u0026amp; Mei, X. F. Exploring the impact of cuproptosis-related genes on immune infiltration in rheumatoid arthritis. \u003cem\u003eNaunyn Schmiedebergs Arch Pharmacol\u003c/em\u003e (2025). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1007/s00210-024-03731-2\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1007/s00210-024-03731-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eQiu, Z. \u003cem\u003eet al.\u003c/em\u003e The copper transporter, SLC31A1, transcriptionally activated by ELF3, imbalances copper homeostasis to exacerbate cisplatin-induced acute kidney injury through mitochondrial dysfunction. \u003cem\u003eChem Biol Interact\u003c/em\u003e 393, 110943 (2024). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1016/j.cbi.2024.110943\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1016/j.cbi.2024.110943\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMatsumoto, T. \u003cem\u003eet al.\u003c/em\u003e FOXP4 inhibits squamous differentiation of atypical cells in cervical intraepithelial neoplasia via an ELF3-dependent pathway. \u003cem\u003eCancer Sci\u003c/em\u003e 113, 3376\u0026ndash;3389 (2022). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1111/cas.15489\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1111/cas.15489\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLuk, I. Y., Reehorst, C. M. \u0026amp; Mariadason, J. M. ELF3, ELF5, EHF and SPDEF Transcription Factors in Tissue Homeostasis and Cancer. \u003cem\u003eMolecules\u003c/em\u003e 23 (2018). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.3390/molecules23092191\u003c/span\u003e\u003cspan address=\"https://doi.org:10.3390/molecules23092191\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBarrett, T. \u003cem\u003eet al.\u003c/em\u003e NCBI GEO: archive for functional genomics data sets\u0026ndash;update. \u003cem\u003eNucleic Acids Res\u003c/em\u003e 41, D991-995 (2013). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1093/nar/gks1193\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1093/nar/gks1193\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChristgau, S. \u003cem\u003eet al.\u003c/em\u003e Serum CrossLaps for monitoring the response in individuals undergoing antiresorptive therapy. \u003cem\u003eBone\u003c/em\u003e 26, 505\u0026ndash;511 (2000). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1016/s8756-3282(00)00248-9\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1016/s8756-3282(00)00248-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePrice, P. A., Parthemore, J. G. \u0026amp; Deftos, L. J. New biochemical marker for bone metabolism. Measurement by radioimmunoassay of bone GLA protein in the plasma of normal subjects and patients with bone disease. \u003cem\u003eJ Clin Invest\u003c/em\u003e 66, 878\u0026ndash;883 (1980). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1172/jci109954\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1172/jci109954\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRodr\u0026iacute;guez, J. P., Garat, S., Gajardo, H., Pino, A. M. \u0026amp; Seitz, G. Abnormal osteogenesis in osteoporotic patients is reflected by altered mesenchymal stem cells dynamics. \u003cem\u003eJ Cell Biochem\u003c/em\u003e 75, 414\u0026ndash;423 (1999). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1002/(sici)1097-4644(19991201)75:3%3C414::aid-jcb7%3E3.3.co;2-3\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1002/(sici)1097-4644(19991201)75:3%3C414::aid-jcb7%3E3.3.co;2-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJohnston, B. D. \u0026amp; Ward, W. E. The ovariectomized rat as a model for studying alveolar bone loss in postmenopausal women. \u003cem\u003eBiomed Res Int\u003c/em\u003e 2015, 635023 (2015). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1155/2015/635023\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1155/2015/635023\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLutsenko, S., Roy, S. \u0026amp; Tsvetkov, P. Mammalian copper homeostasis: physiological roles and molecular mechanisms. \u003cem\u003ePhysiol Rev\u003c/em\u003e 105, 441\u0026ndash;491 (2025). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1152/physrev.00011.2024\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1152/physrev.00011.2024\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJing, Y. \u003cem\u003eet al.\u003c/em\u003e SIRT2 deficiency prevents age-related bone loss in rats by inhibiting osteoclastogenesis. \u003cem\u003eCell Mol Biol (Noisy-le-grand)\u003c/em\u003e 65, 66\u0026ndash;71 (2019).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMa, J. \u003cem\u003eet al.\u003c/em\u003e Niacin regulates glucose metabolism and osteogenic differentiation via the SIRT2-C/EBPβ-AREG signaling axis. \u003cem\u003eBiomed Pharmacother\u003c/em\u003e 180, 117447 (2024). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1016/j.biopha.2024.117447\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1016/j.biopha.2024.117447\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFang, Y. \u003cem\u003eet al.\u003c/em\u003e Histone crotonylation promotes mesoendodermal commitment of human embryonic stem cells. \u003cem\u003eCell Stem Cell\u003c/em\u003e 28, 748\u0026ndash;763.e747 (2021). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1016/j.stem.2020.12.009\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1016/j.stem.2020.12.009\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhang, X., Zhang, R., Wang, Y., Li, L. \u0026amp; Zhong, Z. CDK5 Upregulated by ELF3 Transcription Promotes IL-1β-induced Inflammation and Extracellular Matrix Degradation in Human Chondrocytes. \u003cem\u003eCell Biochem Biophys\u003c/em\u003e 82, 3333\u0026ndash;3344 (2024). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1007/s12013-024-01415-5\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1007/s12013-024-01415-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZheng, T., Li, Y., Zhang, X., Xu, J. \u0026amp; Luo, M. Exosomes Derived From miR-212-5p Overexpressed Human Synovial Mesenchymal Stem Cells Suppress Chondrocyte Degeneration and Inflammation by Targeting ELF3. \u003cem\u003eFront Bioeng Biotechnol\u003c/em\u003e 10, 816209 (2022). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.3389/fbioe.2022.816209\u003c/span\u003e\u003cspan address=\"https://doi.org:10.3389/fbioe.2022.816209\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eQu, X. \u003cem\u003eet al.\u003c/em\u003e Serum copper levels are associated with bone mineral density and total fracture. \u003cem\u003eJ Orthop Translat\u003c/em\u003e 14, 34\u0026ndash;44 (2018). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1016/j.jot.2018.05.001\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1016/j.jot.2018.05.001\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eShribman, S. \u003cem\u003eet al.\u003c/em\u003e Investigation and management of Wilson's disease: a practical guide from the British Association for the Study of the Liver. \u003cem\u003eLancet Gastroenterol Hepatol\u003c/em\u003e 7, 560\u0026ndash;575 (2022). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1016/s2468-1253(22)00004-8\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1016/s2468-1253(22)00004-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKirk, F. T. \u003cem\u003eet al.\u003c/em\u003e Effects of tetrathiomolybdate on copper metabolism in healthy volunteers and in patients with Wilson disease. \u003cem\u003eJ Hepatol\u003c/em\u003e 80, 586\u0026ndash;595 (2024). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1016/j.jhep.2023.11.023\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1016/j.jhep.2023.11.023\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYousefzadeh, N., Kashfi, K., Jeddi, S. \u0026amp; Ghasemi, A. Ovariectomized rat model of osteoporosis: a practical guide. \u003cem\u003eExcli j\u003c/em\u003e 19, 89\u0026ndash;107 (2020). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.17179/excli2019-1990\u003c/span\u003e\u003cspan address=\"https://doi.org:10.17179/excli2019-1990\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRen, L. J., Zhu, X. H., Tan, J. T., Lv, X. Y. \u0026amp; Liu, Y. MiR-210 improves postmenopausal osteoporosis in ovariectomized rats through activating VEGF/Notch signaling pathway. \u003cem\u003eBMC Musculoskelet Disord\u003c/em\u003e 24, 393 (2023). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1186/s12891-023-06473-z\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1186/s12891-023-06473-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003e\u003cstrong\u003eTable 1. M\u003c/strong\u003e\u003cstrong\u003eultivariate logistic regression analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cdiv\u003e\n \u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 25%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eMeasurements\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 25%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e95% CI\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 25%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eOR\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 25%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003ep-\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003evalues\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 25%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eAge\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 25%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e2.531 - 32.64\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 25%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e2.712\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 25%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e0.1055\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 25%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eGender\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 25%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e0.8274 - 9.533\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 25%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e0.5127\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 25%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e0.2971\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 25%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eSmoke\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 25%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e0.1391 - 1.780\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 25%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e1.862\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 25%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e0.3028\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 25%;\"\u003e\n \u003cp\u003e\u003cstrong\u003efracture\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 25%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e0.5728 - 6.287\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 25%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e10.91\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 25%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e0.0073\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 25%;\"\u003e\n \u003cp\u003e\u003cstrong\u003ecalcium intake\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 25%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e2.196 - 77.04\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 25%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e0.1624\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 25%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e0.0056\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 25%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eSIRT2\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 25%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e2.531 - 32.64\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 25%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e8.312\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 25%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e0.0010\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003eThe p-values were obtained using multivariate logistic regression analysis, with statistical significance set at \u003cem\u003ep\u0026nbsp;\u003c/em\u003e\u0026lt; 0.05.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 2. Oligonucleotides and other sequence‐based reagents\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"744\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 30.0671%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eSpecies\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 31.9463%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eF_Sequence\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 37.9866%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eR_Sequence\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 30.0671%;\"\u003e\n \u003cp\u003eDLAT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 31.9463%;\"\u003e\n \u003cp\u003eCATGTATTTTGGCAATTGGTGCTT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 37.9866%;\"\u003e\n \u003cp\u003eCACTGGGCTCCAACTGCT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 30.0671%;\"\u003e\n \u003cp\u003eELF3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 31.9463%;\"\u003e\n \u003cp\u003eATCCCAGCTTTTGAGTCTGACA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 37.9866%;\"\u003e\n \u003cp\u003eACACTTTCAACAAATGCCAACTCC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 30.0671%;\"\u003e\n \u003cp\u003eFDX1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 31.9463%;\"\u003e\n \u003cp\u003eGGCAAGCACCACAGATTACCAC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 37.9866%;\"\u003e\n \u003cp\u003eAGACCATACTGTGTACCCCTT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 30.0671%;\"\u003e\n \u003cp\u003eGAPDH\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 31.9463%;\"\u003e\n \u003cp\u003eCTCAAGATCATCAGCAATGCCT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 37.9866%;\"\u003e\n \u003cp\u003eTGGTCATGAGTCCTTCCACGAT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 30.0671%;\"\u003e\n \u003cp\u003eLIPT1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 31.9463%;\"\u003e\n \u003cp\u003eGCAGGCTACCAAAAGATTTGACC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 37.9866%;\"\u003e\n \u003cp\u003eAAGAAGACAAGAACGTCCCAT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 30.0671%;\"\u003e\n \u003cp\u003eRUNX2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 31.9463%;\"\u003e\n \u003cp\u003eAAATGGTTAATCTCCGCAGGT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 37.9866%;\"\u003e\n \u003cp\u003eGCTGTTTGATGCCATAGTCCC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 30.0671%;\"\u003e\n \u003cp\u003eSIRT2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 31.9463%;\"\u003e\n \u003cp\u003eCGGCACGAATACCCGCTA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 37.9866%;\"\u003e\n \u003cp\u003eAAAAGACGATATCAGGCTTCACC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 30.0671%;\"\u003e\n \u003cp\u003eSLC31A1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 31.9463%;\"\u003e\n \u003cp\u003eACTACTGTTTTCCGGTTTGGT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 37.9866%;\"\u003e\n \u003cp\u003eTCTCGGGCTATCTTGAGTCCT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 30.0671%;\"\u003e\n \u003cp\u003eHuman SIRT2 shRNA-1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 69.9329%;\"\u003e\n \u003cp\u003e5\u0026prime;‐CCGGTATGACAACCTAGAGAAGTACCTCGAGGTACTTCTCTAGGTTGTCATATTTTTG‐3\u0026prime;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 30.0671%;\"\u003e\n \u003cp\u003eHuman SIRT2 shRNA-2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 69.9329%;\"\u003e\n \u003cp\u003e5\u0026prime;-CCGGCAGCGCGTTTCTTCTCCTGTACTCGAGTACAGGAGAAGAAACGCGCTGTTTTTG-3\u0026prime;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 30.0671%;\"\u003e\n \u003cp\u003eHuman SLC31A1 shRNA-1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 69.9329%;\"\u003e\n \u003cp\u003e5\u0026apos;-GCTATGATGATGCCATTGATT-TTCAAGAGA-AATCAATGGCATCATCATAGC-3\u0026apos;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 30.0671%;\"\u003e\n \u003cp\u003eHuman SLC31A1 shRNA-2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 69.9329%;\"\u003e\n \u003cp\u003e5\u0026apos;-CCATGTTCTTCATCGTCATCT-TTCAAGAGA-AGATGACGATGAAGAACATGG-3\u0026apos;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 30.0671%;\"\u003e\n \u003cp\u003eHuman ELF3 shRNA-1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 69.9329%;\"\u003e\n \u003cp\u003e5\u0026apos;-CCAGATGATGATGCCATCTAT-TTCAAGAGA-ATAGATGGCATCATCATCTGG-3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 30.0671%;\"\u003e\n \u003cp\u003eHuman ELF3 shRNA-2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 69.9329%;\"\u003e\n \u003cp\u003e5\u0026apos;-GCTGCTACTTCTCGTGGATTT-TTCAAGAGA-AAATCCACGAGAAGTAGCAGC-3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-7734583/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7734583/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eOsteoporosis (OP), a systemic disorder of bone metabolism characterized by impaired osteogenesis and excessive skeletal resorption, is increasingly linked to epigenetic regulation. Among these, histone crotonylation (Kcr) has emerged as a key determinant of gene expression and cellular differentiation, yet the role of histone H3 lysine 4 crotonylation (H3K4cr) in osteogenesis remains unclear. In this study, analysis of OP-related GEO datasets combined with validation in patient serum samples and an OP cell model identified Sirtuin (Sirt) 2, a histone deacetylase, as a central regulator of H3K4cr during bone formation. Functional assays, including Reverse Transcription Quantitative Real-Time Polymerase Chain Reaction (RT-qPCR), western blotting, Chromatin immunoprecipitation followed by quantitative PCR (ChIP-qPCR), luciferase reporter analyses, and in vivo studies using ovariectomized (OVX) rats, demonstrated that SIRT2 expression was elevated in OP and negatively correlated with osteogenic markers. Knockdown of SIRT2 increased H3K4cr levels, thereby enhancing osteogenic differentiation in vitro and promoting bone regeneration in OVX rats. Mechanistically, SIRT2-mediated H3K4 decrotonylation facilitated SLC31A1 transcription by alleviating the inhibitory effect of H3K4cr on E74-like factor 3 (ELF3) binding to the promoter. Elevated Copper transporter 1 (CTR1/SLC31A1) expression impaired osteogenesis by increasing intracellular copper accumulation and triggering cuproptosis, whereas copper chelation or SLC31A1 inhibition restored osteogenic potential both in vitro and in vivo. Collectively, these findings define a previously unrecognized SIRT2\u0026ndash;H3K4cr\u0026ndash;SLC31A1 axis that integrates epigenetic regulation with copper metabolism to modulate osteogenic differentiation, highlighting a promising therapeutic target for osteoporosis.\u003c/p\u003e","manuscriptTitle":"SIRT2 suppressed osteogenesis via transcriptionally regulation of SLC31A1-meidated cuproptosis in a crotonylation manner","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-09-30 07:41:28","doi":"10.21203/rs.3.rs-7734583/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"230e9f82-37e4-455b-9c09-8f384d9d25ea","owner":[],"postedDate":"September 30th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":55551260,"name":"Health sciences/Diseases/Endocrine system and metabolic diseases/Metabolic bone disease/Osteopetrosis"},{"id":55551261,"name":"Biological sciences/Physiology/Bone"}],"tags":[],"updatedAt":"2025-10-06T08:16:19+00:00","versionOfRecord":[],"versionCreatedAt":"2025-09-30 07:41:28","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7734583","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7734583","identity":"rs-7734583","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00
unpaywall
last seen: 2026-05-26T02:00:01.498150+00:00
License: CC-BY-4.0