Supervillin-mediated ZO-1 downregulation facilitates migration of cisplatin-resistant HCT116 colorectal cancer cells | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Supervillin-mediated ZO-1 downregulation facilitates migration of cisplatin-resistant HCT116 colorectal cancer cells Yali Hong, Xu Li, Rongchen Mao, Feier Zhou, Lai Jin, Chao Zhu, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3887260/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Supervillin (SVIL), the biggest member of the villin/gelsolin superfamily, has recently been reported to promote the metastasis of hepatocellular carcinoma by stimulating epithelial-mesenchymal transition (EMT). However, data about the role of SVIL in the migration of colorectal cancer cells are scarce. We investigated the effects of SVIL on the migration of cisplatin-resistant colorectal cancer cells. The model of cisplatin-resistant HCT116 cells (HCT116/DDP) was established. SVIL-knockdown HCT116/DDP cells with virus infection were also used. Migration was assessed by transwell assay and wound healing assay, tumor metastasis was assessed using a mouse model with tail vein injection of colorectal cancer cells. The results showed that the expression of SVIL was upregulated in HCT116/DDP cells compared to their parental cells. Also, the HCT116/DDP cells showed increased cell migration, stemness and lung metastasis. Furthermore, we revealed that the up-regulated SVIL was associated with the induction of migration of HCT116/DDP cells. Reduced SVIL expression reversed the enhanced migration and lung metastasis in cisplatin-resistant colorectal cancer cells. Further work showed that SVIL silencing reduced cell migration by targeting zona occludens (ZO)-1 mediated tight-junction remodeling. The expression of ZO-1, but not occludin and cludin5, was down-regulated after SVIL knock-down. Fluorescence detection indicated that the linear ZO-1 expression was interrupted in HCT116/DDP cells while the SVIL silencing reversed the interruption. This study firstly displayed the relationship between SVIL and ZO-1 in cisplatin-resistant colon cancer cells, providing a new insight into the mechanism of colorectal cancer migration. Supervillin ZO-1 Cell migration Cisplatin resistant HCT116 cells (HCT116/DDP) Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 1. Introduction Colorectal cancer (CRC) is one of the leading causes of cancer death worldwide, and evidence suggests that distant metastasis and drug resistance are two major causes of failures in cancer chemotherapy [ 1 , 2 ]. Chemo-resistant cancer cells own higher malignance, stemness and greater migratory and invasive capacity than their parental cells [ 3 – 5 ]. Suppressed cell migration and invasion could inhibit CRC development [ 6 ]. However, the metastatic mechanism in cisplatin-resistant cancer cells is still unclear. Therefore, it is necessary to explore the detailed molecules participating in the metastasis of the cisplatin-resistant CRC cells. Epithelial-to-mesenchymal transition (EMT) is a key step in tumor invasion and metastasis [ 7 ]. The EMT process is characterized by the disruption of tight intercellular junctions between cells, increased cell motility, and greater invasion capacity [ 8 ]. Cell-to-cell junction formations, such as adherens junctions (AJs) and tight junctions (TJs), play an important role in regulating the migratory and invasive ability of cells [ 9 ]. TJs are the most apical complex of intercellular junctions and composed of several proteins including zona occludens (ZO)-1, occludin, claudins and others [ 10 ], which play a key role not only in intercellular barrier function, but also in maintaining cell stability and blocking cell motility [ 11 , 12 ]. E-cadherin, a major component of AJs, is lost during tumorigenesis and its levels are associated with advanced tumor stages and poor prognosis in patients with cancer [ 13 ]. Supervillin (SVIL), an actin-binding protein, has been shown to be an important modulator of the cell motility, invasive and migratory activity [ 14 , 15 ]. It is reported that five isoforms of SVIL have been identified and are widely distributed in tissues and various subcellular compartments [ 14 , 16 ]. Higher expression of SVIL was found in patients with hepatocellular carcinoma, which was significantly correlated with the occurrence of distant metastasis [ 17 ]. Meanwhile, SVIL mRNA was found to be abundant in the HeLa S3 cervical carcinoma, A549 lung carcinoma and SW480 colon adenocarcinoma cell lines [ 15 ]. As well known, cell motility contributes to tumor metastasis. SVIL has been reported to participate in multiple biological functions, particularly cell adhesion and motility processes, and to play a critical role in tumor cell migration and metastasis [ 18 – 20 ]. SVIL was also observed to promote a process leading to disassembly of cell-substrate adhesion structure and loss of focal adhesions (FAs) by binding to TRIP6 [ 21 ]. The mechanisms through which SVIL could promote cell motility and invasive activity were not fully illustrated, especially in cisplatin resistant colorectal cancer cells. In this study, we investigated the effects of SVIL on the migration of CRC cells after chemoresistance and the relevant mechanisms. To obtain a characteristic chemo-resistant phenotype, we generated cisplatin-resistant colorectal cancer cells by treating HCT116 cells with cisplatin. Interestingly, we found that SVIL was upregulated in cisplatin-resistant HCT116 cells, which was related to the increased metastatic potential of cancer cells. Furthermore, SVIL was shown to mediate the expression of ZO-1 and accelerate the migration of cisplatin-resistant colon cancer cells. 2. Material and Methods 2.1. Cell culture Human colorectal cancer cell lines HCT116 and 293FT were purchased from the Institute of Biochemistry and Cell Biology (Shanghai, China), which were authenticated by STR profiling and tested for mycoplasma contamination. The HCT116 cells and their cisplatin-resistant counterparts HCT116/DDP cells were cultured in DMEM complete medium containing 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin. 293FT cells were cultured in RPMI-1640 complete medium. The generation of chemoresistant cells occurred through cisplatin treatment, which was obtained from Qilu Pharmaceutical Co. Ltd (Jinan, Shandong, China). All cells were maintained in a humidified 5% CO2 environment at 37°C. 2.2. Lentiviral Infection and Generation of SVIL knocked-down cell lines To generate SVIL knockdown stable cells (SVIL KD), shSVIL RNA and a scrambled shRNA (shNC) were designed and constructed by Gene Pharma (Shanghai, China). The sequences were shown in Table 1 . For packaging lentivirus, 293FT cells were co-transfected with shRNA and packaging plasmids using Lipofectamine 2000 (Yeasen Biotechnology, Shanghai, China). The viruses released from the 293FT cells were harvested and used to infect HCT116/DDP cells. Forty-eight hours later, the virus-containing culture medium was replaced with normal culture medium containing 2 µg/mL puromycin (Sigma, USA). Gene silencing was indicated by green fluorescence and confirmed by immunoblotting. Table 1 shRNA sequences Name Sequences shNC sense (5’→3’) GATCCGTTCTCCGAACGTGTCACGTTTCAAGAGAACGTGACACGTTCGGAGAACTTTTTTG Antisense (5’→3’) AATTCAAAAAAGTTCTCCGAACGTGTCACGTTCTCTTGAAACGTGACACGTTCGGAGAACG shSVIL-1882 sense (5’→3’) GATCCGCAAGTGCCACTGACTATATTCAAGAGATATAGTCAGTGGCACTTGCTTTTTTG Antisense (5’→3’) AATTCAAAAAAGCAAGTGCCACTGACTATATCTCTTGAATATAGTCAGTGGCACTTGCG shSVIL-3970 sense (5’→3’) GATCCGGTAGTGAAGTTTACGTATTTCAAGAGAATACGTAAACTTCACTACCTTTTTTG Antisense (5’→3’) AATTCAAAAAAGGTAGTGAAGTTTACGTATTCTCTTGAAATACGTAAACTTCACTACCG 2.3. CCK8 assay Cell viability was analyzed by Cell Counting Kit-8 assay (Yeasen Biotechnology, Shanghai, China) according to the manufacturer’s instruction. HCT116 and HCT116/DDP cells were seeded on 96-well plates (5 × 10 3 cells per well) and treated with cisplatin, oxaliplatin (Oxa) or 5-fluorouracil (5-Fu) for 48 h, and then incubated with CCK8 for 2 h. The absorbance at 450 nm was measured by a microplate reader (BioTek, USA). Oxaliplatin was purchased from Jiangsu Hengrui Pharmaceutical Co. Ltd (Lianyungang, Jiangsu, China) and 5-Fu was obtained from Tianjin Jinyao Pharmaceutical Co. Ltd (Tianjin, China). Experiments were performed at least three times. 2.4. Immunofluorescent analysis SVIL-KD cells, HCT116/DDP cells and their parental control cells were cultured in 20 mm confocal dishes (Corning, USA). When the cells were 50% confluent, the dishes were fixed with 4% paraformaldehyde for 15 min. Then the cells were blocked with 5% bovine serum albumin (BSA) in PBS buffer for 1 h and incubated with ZO-1 antibody (1:200, Proteintech, China) overnight at 4°C. After being washed by PBS, the dishes were incubated with fluorescent secondary antibody, anti-rabbit IgG 488 or Anti-rabbit IgG 594 (1:200, Proteintech, China), for 1 h at room temperature. Finally, cell nuclei were labeled with DAPI (Keygen Biotech, China) and examined using a LSM700 confocal microscopy (Zeiss, Germany). 2.5. Transwell assay Tumor cells (1× 10 5 cells per well), including SVIL-KD cells, HCT116/DDP cells and their parental control cells, were seeded in the upper chambers of transwell inserts (Corning, NY, USA), and the bottom well was filled with 10% FBS-containing medium. The plates were incubated at 37°C for 24 h. The cells on upper surface of membranes were gently wiped off with a cotton swab. The migrated cells on the lower surface were fixed with 4% paraformaldehyde, stained with crystal violet (Beyotime, Shanghai, China), and counted under a microscope. 2.6. Wound healing assay Tumor cells (SVIL-KD cells, HCT116/DDP cells and their parental control cells were seeded in 6-well plates and subjected to the linear scratch wounds using a 10-µl pipet tip. Cells were washed three times with PBS and cultured in serum-free medium. The photomicrographs were taken using a microscope at 0, 24, and 48 h, and the line drawn on the bottom of well provided as a landmark. The scratched area was quantified using ImageJ software, and data were expressed as percent migration compared with 0-h. 2.7. Western blot analysis Cells were harvested and lysed in RIPA buffer containing 1% PMSF, 1% protease inhibitor and 1% phosphatase inhibitor. Proteins (25–30 µg) were quantified by a BCA kit (Beyotime, Shanghai, China) and separated on 10% SDS/PAGE gel and then transferred to polyvinylidene difluoride (PVDF) membranes (Millipore, CA, USA). After blocking with 5% milk, membranes were incubated with primary antibodies (1:500-1:1000), HRP-conjugated secondary antibodies (1:10000), and detected using ECL kit on a Bio-Rad ChemiDoc imaging system (Bio-Rad). Primary antibodies of E-cadherin and N-cadherin were purchased from Cell Signaling (USA), antibodies of ZO-1, Occludin, NANOG, SOX2, β-Tublin and GAPDH were obtained from Proteintech (China), antibodies of Cludin5, VE-cadherin, Snail were obtained from Abcam (USA) and antibodies of SVIL was purchased from Sigma (MO, USA). Secondary antibodies anti-rabbit HRP (Jackson ImmunoResearch, USA) and anti-mouse HRP (Proteintech, China) were used in this study. 2.8. RNA extraction and quantitative real-time PCR (qPCR) analysis RNA extraction was performed through TRIzol reagent (Invitrogen, CA, USA), and the Total RNA (0.5-1 µg) was subjected to reverse transcription by HiScript II Q-RT superMix (Vazyme, China). qRT-PCR was conducted using the specific primers (Generay biotechnology, China) and a Bio-Rad CFX96 system with SYBR green (Bio-Rad, CA, USA) to determine the mRNA expression levels. GAPDH was used as references. The primer sequences are as follows: SVIL-F 5’ TTTCCAGCCTGTCCAACTTCA 3’, SVIL-R 5’ CGTCACCTACTGCCATAACCC 3’; GAPDH-F 5’ GGAGCGAGATCCCTCCAAAAT 3’, GAPDH-R 5’ GGCTGTTGTCATACTTCTCATGG 3’. Relative RNA expression was calculated using the 2 − ΔΔCt method, and each sample was detected in triplicate. 2.9. In vivo metastatic assay BALB/C nude mice (male, 5 weeks old) were obtained and housed in Animal Core Facility of Nanjing Medical University. A total of 3×10 6 cells suspended in 200 µl PBS were injected into mice via tail vein. The mice were sacrificed four weeks later, and the lung tissues were removed for H&E (hematoxylin-eosin) staining. Metastatic lesions were observed. All animal experiments were approved by Animal Care and Use Committee of Nanjing Medical University (No. IACUC-1711028). 2.10. Statistical analysis Data were analyzed with GraphPad Prism 8.0 by a student’s t-test (comparison of two groups) or one-way ANOVA followed by Turkey tests (comparison of multiple groups). Data were presented as mean ± standard error of the mean (SEM), and P-values < 0.05 were considered to be statistically significant. In our study, each experiment was repeated more than three times respectively. 3. Results 3.1. Cisplatin-resistant colorectal cancer cells (HCT116/DDP) were established To clarify the mechanisms behind chemoresistance and tumor metastasis in colon cancer, we established cisplatin-resistant colorectal cancer cells by two classical methods: 1) The colorectal cancer cells HCT116 were continuously exposed to cisplatin from a low dose (0.5 µg/ml) to a high dose (5 µg/ml) in a stepwise manner (named HCT116/DDP #1) (Fig. 1 A) [ 22 ]. 2) Cells were exposed to cisplatin at a high-dose (5 µg/ml) directly for 24 h, after which the medium was replaced with complete medium. The operation was repeated several times (named HCT116/DDP #2) (Fig. 1 A) [ 23 , 24 ]. The CCK8 results showed that HCT116/DDP cells were successfully established using two methods (Fig. 1 B). Specifically, high-dose cisplatin (10 µg/ml) significantly inhibited the viability of parental HCT116 cells, but had little effect on the proliferation of HCT116/DDP cells. The 50% inhibitory concentration (IC 50 ) values were measured and the cisplatin resistant HCT116/DDP cells showed IC 50 values almost 37 times higher than the parental cells (Fig. 1 C). Furthermore, the HCT116/DDP cells exhibited a strong resistance to oxaliplatin, while presenting a weak resistance to 5-Fu. 3.2. HCT116/DDP cells showed higher metastatic potential The metastatic potential and stem cell property of HCT116/DDP cells and their parental cells were examined. We observed significantly increased metastatic potential and cancer stemness in HCT116/DDP cells compared to their parental cells. The migration capacity of HCT116/DDP cells was measured in vitro. Transwell results showed that HCT116/DDP cells had greater straightforward migration compared to their parental cells (Fig. 2 A). And wound healing assays suggested that the cell migration ability was stronger in HCT116/DDP cells than that in parental cells (Fig. 2 B). This finding was consistent with the expression of EMT-related proteins. Especially, the EMT-related protein, N-cadherin, was markedly increased in HCT116/DDP cells (Fig. 2 C). 3.3. SVIL is overexpressed in cisplatin-resistant colorectal cancer cells To determine the role of SVIL in cisplatin resistance and cell migration of cisplatin-resistant cancer cells, we first detected its expression in HCT116/DDP and their parental cells. The results showed that SVIL mRNA levels were much higher in HCT116/DDP cells compared to their parental cells, and Western Blot results validated that SVIL protein expression levels were also increased in HCT116/DDP cells compared to their parental cells (Fig. 3 A, 3 B). 3.4. Inhibition of SVIL expression resulted in a reduction in metastatic potential in HCT116/DDP cells To further confirm the role of SVIL in cell migration in cisplatin-resistant HCT116 cells, we generated the SVIL knockdown HCT116/DDP cells (shSVIL − 1882 and shSVIL − 3970) and control cells (shNC) by lentiviral interference. As shown in Fig. 4 , SVIL expression level was obviously blocked in the SVIL-KD HCT116/DDP cells compared to the control cells. The GFP fluorescence image indicated successful transfection in HCT116/DDP cells (Fig. 4 A), and the transfection efficiency of SVIL knockdown was verified by Western blot analysis (Fig. 4 B). However, the inhibition of SVIL had no effect on cisplatin resistance of HCT116/DDP cells (Fig. 4 C). Transwell assay results showed that downregulation of SVIL significantly reduced the number of migrating HCT116/DDP cells (Fig. 4 D). Consistently, the wound healing assay indicated that cell migration ability in HCT116/DDP cells was significantly weakened after knockdown of SVIL expression (Fig. 4 E). However, the EMT-related proteins N-cadherin and E-cadherin did not revert when SVIL expression was knocked down (Fig. 4 F). 3.5. SVIL stimulated the migration via down-regulating ZO-1 expression in HCT116/DDP cells. To investigate the migration mechanism of HCT116/DDP cells, changes in TJs protein were examined. Firstly, the ZO-1 protein level exhibited a significant reduction in HCT116/DDP cells in comparison to the parental cells (Fig. 5 A and B), whereas the expression of occludin and cludin5 remained unaltered. Moreover, ZO-1 expression was dramatically reversed after SVIL knockdown (Fig. 5 D and E). Consistently, the results of immunofluorescence staining indicated that ZO-1 expression was downregulated and less concentrated in the cell membrane in HCT116/DDP cells (Fig. 5 C). Notably, the expression and localization were restored when SVIL knockdown was performed (Fig. 5 F). 3.6. SVIL silencing reversed the lung metastasis of HCT116/DDP cells in vivo HCT116/DDP cells, the parental control cells and SVIL-KD HCT116/DDP cells were intravenously injected into nude mice, respectively, through the tail vein. Four weeks later, the mice were sacrificed and the lung tissues were collected for H&E staining. The process diagram and lung tissues were shown in Fig. 6 A. Nude mice injected with HCT116/DDP cells generated more lung metastatic lesions than the corresponding controls (Fig. 6 B and 6 C). Meanwhile, the number of lung metastatic foci in the nude mice injected with SVIL-KD HCT116/DDP cells was lower in comparison to the control group (Fig. 6 D and 6 E). These results showed that SVIL knockdown intercepted lung metastasis of HCT116/DDP cells. 4. Discussion Colorectal cancer (CRC) remains a major fatal disease worldwide, being the second most common cancer type in China [ 25 ]. Its morbidity continues to rise annually [ 26 ]. Many previous studies were conducted on either tumor metastasis or chemoresistance [ 27 , 28 ]. Actually, distant metastasis and chemoresistance are two primary reasons for the failure in CRC chemotherapy, and they may co-occur and reinforce each other [ 29 , 30 ]. We established the cisplatin-resistant HCT116 cells using two classical methods and observed their metastatic features. Recent studies have shown that SVIL is widely distributed in cells and implicated in actin filament-based motile processes, cell survival, and signal transduction [ 17 , 31 ]. However, the role of SVIL in colon cancer metastasis has received limited attention, and hence the underlying mechanism remains unclear. In our previous study, it was demonstrated that there was a marked increase in corticotrophin-releasing hormone receptors’ (CRHRs) expression in colon cancer [ 32 ]. We here also observed an increase of CRHR1 in cisplatin-resistant CRC cells (unpublished results). Furthermore, when cells were treated with CRH, a specific agonist to CRHR1, SVIL gene expression was significantly upregulated (RNA-seq results, unpublished), suggesting a strong relationship between SVIL and CRC. As previously described, SVIL regulates cell motility and promotes tumor metastasis [ 19 , 31 ]. Based on the above research, we hypothesized that SVIL may play a role in tumor metastasis in colorectal cancer. In this study, the expression of SVIL was found to be upregulated in cisplatin-resistant colorectal cancer cells compared to the parental cells (Fig. 3 ), which is consistent with the previous report in hepatocellular carcinoma [ 17 ]. The upregulated SVIL expression was observed to be associated with enhanced metastatic potential (Fig. 4 ). When the expression of SVIL was inhibited by lentiviral infection in HCT116/DDP cells, the migration was suppressed. All of this evidence indicates that SVIL plays an important role in the migration of cisplatin-resistant CRC cells. Tumor metastasis and invasion are triggered and sustained by signaling pathways that regulate the dynamics of cytoskeleton in tumor cells, as well as the turnover of cell-matrix and cell-cell junctions, followed by cell migration into the adjacent tissue [ 33 ]. Our results appear to be similar to previous findings that chemoresistant cancer cells underwent morphological changes with increased cell migration ability, as well as increased expression of N-cadherin, a mesenchymal indicator (Fig. 2 )[ 34 ]. On the other hand, the cell–cell adhesion protein E-cadherin typically experiences a decrease during the EMT process [ 35 ]. Our study has identified a slight elevation in E-cadherin expression in HCT116/DDP cells. This result was consistent with a previous study showing that SVIL staining was specifically colocalized with E-cadherin [ 14 ]. However, silencing of SVIL did not reverse the expression of N-cadherin and E-cadherin in HCT116/DDP cells (Fig. 4 ). The explanation may lie in the fact that SVIL-regulated cell migration in HCT116/DDP cells is not dependent on either N-cadherin or E-cadherin. Additionally, it should be noted that not all cell types exhibit the same EMT markers. SVIL was identified as a tightly bound peripheral protein and has an intimate association with the plasma membrane [ 14 , 36 ]. Meanwhile, ZO-1 is a classic protein that regulates tight junctions and is associated with the cell membrane. It plays a vital role in maintaining the integrity of cell-cell junctions [ 37 , 38 ]. Defective tight junctions, regulated by ZO-1, can lead to intestinal epithelial dysfunction, which in turn accelerates the tumorigenesis and metastasis of colon cancer [ 39 – 41 ]. In our study we have identified a new relationship between ZO-1 and SVIL in cell migration. When compared to the parental cells, the ZO-1 expression level was significantly reduced in cisplatin-resistant HCT116 cells, which was reversed by SVIL-silence (Fig. 5 ). These results were consistent with the fluorescent staining of ZO-1. As shown Fig. 4 , the increased migration by the enhanced-SVIL induced ZO-1 decrease did not completely reversed by the SVIL silence. Therefore, besides the SVIL-regulated ZO-1 dysfunction, there must exist other underlying molecular mechanisms that regulate the migration of cisplatin-resistant colorectal cells, and more experiments are needed to verify them in the future. In addition, however, SVIL silencing had no effect on cisplatin resistance in HCT116/DDP cells (Fig. 4 C). It was reported that SVIL antisense RNA 1 (SVIL-AS 1) showed positive effects in cancer therapy since SVIL-AS1 overexpression suppressed cell proliferation and tumor chemoresistance [ 42 – 44 ]. Long non-coding RNA (lncRNA) promotes the expression of target genes by blocking miRNA and mitigating its inhibitory effect on the target genes. SVIL‐AS 1, a long non-coding RNA, inhibited chemoresistance by acting as a sponge for miR‐103a and upregulating ICE1 expression in lung adenocarcinoma chemotherapy resistance [ 44 ]. In our study, long non-coding RNA has not been investigated, despite its potential role in chemoresistance. In conclusion, this study revealed that SVIL expression was aberrantly upregulated in cisplatin-resistant cancer cells, and the elevated SVIL expression was associated with the increased cell migration ability. Meanwhile, our data and previous research indicated that SVIL served as a novel pro-metastatic factor and played a role in cell motility, leading to tumor metastasis. Moreover, SVIL promoted the migration of cisplatin-resistant colorectal cancer cells through the deduction of ZO-1. Our data helps gain an insight into a novel idea about the migration of cisplatin-resistant colorectal cancer cells. Declarations Acknowledgments This work was supported by the National Natural Science Foundation of China (No. 81773724) and Medical Science and Technology Development Foundation of Nanjing Municipality Health Bureau (No. YKK 23203). Declaration of Competing Interest The authors declare that they have no competing interests. Author Contribution YH designed the experiments and wrote the main manuscript text. XL, RM and FZ performed the experiments. LJ and CZ provided technical support. SL provided the overall direction and edited the manuscript. All authors reviewed the manuscript. References Siegel RL et al (2021) Cancer Statistics , CA Cancer J Clin, 2021. 71(1): p. 7–33 Bray F et al (2018) Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin 68(6):394–424 Wang Q et al (2022) Therapeutic targeting of glutamate dehydrogenase 1 that links metabolic reprogramming and Snail-mediated epithelial-mesenchymal transition in drug-resistant lung cancer. Pharmacol Res 185:106490 Jeon JH et al (2016) Migration and invasion of drug-resistant lung adenocarcinoma cells are dependent on mitochondrial activity. Exp Mol Med 48(12):e277 Xu X et al (2018) TGF-beta plays a vital role in triple-negative breast cancer (TNBC) drug-resistance through regulating stemness, EMT and apoptosis. Biochem Biophys Res Commun 502(1):160–165 Malki A et al (2020) Molecular Mechanisms of Colon Cancer Progression and Metastasis: Recent Insights and Advancements . Int J Mol Sci, 22(1) Erin N et al (2020) Tumor microenvironment and epithelial mesenchymal transition as targets to overcome tumor multidrug resistance. Drug Resist Updat 53:100715 Hashimoto I, Oshima T (2022) Claudins and Gastric Cancer: An Overview . Cancers (Basel), 14(2) Garcia MA, Nelson WJ, Chavez N (2018) Cell-Cell Junctions Organize Structural and Signaling Networks, vol 10. Cold Spring Harb Perspect Biol, 4 Otani T, Furuse M (2020) Tight Junction Structure and Function Revisited. Trends Cell Biol 30(10):805–817 Kim SY et al (2021) Yes-Associated Protein Is Required for ZO-1-Mediated Tight-Junction Integrity and Cell Migration in E-Cadherin-Restored AGS Gastric Cancer Cells . Biomedicines, 9(9) Yu S, He J, Xie K (2023) Zonula Occludens Proteins Signaling in Inflammation and Tumorigenesis. Int J Biol Sci 19(12):3804–3815 Berx G, van Roy F (2009) Involvement of members of the cadherin superfamily in cancer. Cold Spring Harb Perspect Biol 1(6):a003129 Pestonjamasp KN et al (1997) Supervillin (p205): A novel membrane-associated, F-actin-binding protein in the villin/gelsolin superfamily. J Cell Biol 139(5):1255–1269 Pope RK et al (1998) Cloning, characterization, and chromosomal localization of human superillin (SVIL). Genomics 52(3):342–351 Velichkovskii BT et al [Chemoluminescence analysis of the functional state of blood phagocytes in silicosis and chronic dust-induced bronchitis] . Sov Med, 1990(4): p. 14–16 Chen X et al (2018) Supervillin promotes epithelial-mesenchymal transition and metastasis of hepatocellular carcinoma in hypoxia via activation of the RhoA/ROCK-ERK/p38 pathway. J Exp Clin Cancer Res 37(1):128 Gangopadhyay SS et al (2004) Smooth muscle archvillin: a novel regulator of signaling and contractility in vascular smooth muscle. J Cell Sci 117(Pt 21):5043–5057 Fang Z, Luna EJ (2013) Supervillin-mediated suppression of p53 protein enhances cell survival. J Biol Chem 288(11):7918–7929 Chen Y et al (2003) F-actin and myosin II binding domains in supervillin. J Biol Chem 278(46):46094–46106 Takizawa N et al (2006) Supervillin modulation of focal adhesions involving TRIP6/ZRP-1. J Cell Biol 174(3):447–458 Liu Y et al (2019) Overexpressed methyltransferase-like 1 (METTL1) increased chemosensitivity of colon cancer cells to cisplatin by regulating miR-149-3p i>/S100A4/p53 axis. Aging (Albany NY), 11(24): p. 12328–12344. Yuan W et al (2018) [A novel chemo-resistant gene MSX2 discovered by establishment of two pancreatic cancer drug resistant cell lines JF305/CDDP and PANC-1/GEM]. Zhonghua Zhong Liu Za Zhi 40(5):330–334 Zhou Y et al (2010) Establishment of a human hepatoma multidrug resistant cell line in vitro. World J Gastroenterol 16(18):2291–2297 Li N et al (2021) Incidence, mortality, survival, risk factor and screening of colorectal cancer: A comparison among China, Europe, and northern America. Cancer Lett 522:255–268 Cao W et al (2021) Changing profiles of cancer burden worldwide and in China: a secondary analysis of the global cancer statistics 2020. Chin Med J (Engl) 134(7):783–791 Chen P et al (2021) Targeting YTHDF1 effectively re-sensitizes cisplatin-resistant colon cancer cells by modulating GLS-mediated glutamine metabolism. Mol Ther Oncolytics 20:228–239 Shin AE, Giancotti FG, Rustgi AK (2023) Metastatic colorectal cancer: mechanisms and emerging therapeutics. Trends Pharmacol Sci 44(4):222–236 Lin F et al (2022) Stanniocalcin 1 promotes metastasis, lipid metabolism and cisplatin chemoresistance via the FOXC2/ITGB6 signaling axis in ovarian cancer. J Exp Clin Cancer Res 41(1):129 Tian W et al (2022) Extracellular vesicles in ovarian cancer chemoresistance, metastasis, and immune evasion. Cell Death Dis 13(1):64 Chen X et al (2017) A novel splice variant of supervillin, SV5, promotes carcinoma cell proliferation and cell migration. Biochem Biophys Res Commun 482(1):43–49 Fang X et al (2017) CRH promotes human colon cancer cell proliferation via IL-6/JAK2/STAT3 signaling pathway and VEGF-induced tumor angiogenesis. Mol Carcinog 56(11):2434–2445 Friedl P, Alexander S (2011) Cancer invasion and the microenvironment: plasticity and reciprocity. Cell 147(5):992–1009 Han ML et al (2016) Cathepsin L upregulation-induced EMT phenotype is associated with the acquisition of cisplatin or paclitaxel resistance in A549 cells. Acta Pharmacol Sin 37(12):1606–1622 Kaszak I et al (2020) Role of Cadherins in Cancer-A Review . Int J Mol Sci, 21(20) Trivedi S, Bhattacharya M, Starz-Gaiano M (2022) Mind bomb 2 promotes cell migration and epithelial structure by regulating adhesion complexes and the actin cytoskeleton. Dev Biol 491:94–104 Bruckner BR, Janshoff A (2018) Importance of integrity of cell-cell junctions for the mechanics of confluent MDCK II cells. Sci Rep 8(1):14117 Tornavaca O et al (2015) ZO-1 controls endothelial adherens junctions, cell-cell tension, angiogenesis, and barrier formation. J Cell Biol 208(6):821–838 Jiang Y et al (2021) Piezo1 regulates intestinal epithelial function by affecting the tight junction protein claudin-1 via the ROCK pathway. Life Sci 275:119254 Zeng Z et al (2018) Cancer-derived exosomal miR-25-3p promotes pre-metastatic niche formation by inducing vascular permeability and angiogenesis. Nat Commun 9(1):5395 Ke J et al (2018) MicroRNA–103 regulates tumorigenesis in colorectal cancer by targeting ZO–1. Mol Med Rep 17(1):783–788 Hu Z et al (2022) N6-methyladenosine-induced SVIL antisense RNA 1 restrains lung adenocarcinoma cell proliferation by destabilizing E2F1. Bioengineered 13(2):3093–3107 Acha-Sagredo A et al (2020) Long non-coding RNA dysregulation is a frequent event in non-small cell lung carcinoma pathogenesis. Br J Cancer 122(7):1050–1058 Guo L, Ding L, Tang J (2021) Identification of a competing endogenous RNA axis SVIL-AS1/miR-103a/ICE1 associated with chemoresistance in lung adenocarcinoma by comprehensive bioinformatics analysis. Cancer Med 10(17):6022–6034 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3887260","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":268690607,"identity":"ef4bf769-b0d0-4a8b-9a0e-01d9e7f83af2","order_by":0,"name":"Yali Hong","email":"","orcid":"","institution":"Nanjing Medical University","correspondingAuthor":false,"prefix":"","firstName":"Yali","middleName":"","lastName":"Hong","suffix":""},{"id":268690608,"identity":"3329d398-b478-408f-ba94-63d75e16cd78","order_by":1,"name":"Xu Li","email":"","orcid":"","institution":"Nanjing Medical University","correspondingAuthor":false,"prefix":"","firstName":"Xu","middleName":"","lastName":"Li","suffix":""},{"id":268690609,"identity":"59282afa-f660-471b-a8be-6b8fd6ec7b98","order_by":2,"name":"Rongchen Mao","email":"","orcid":"","institution":"Nanjing Medical University","correspondingAuthor":false,"prefix":"","firstName":"Rongchen","middleName":"","lastName":"Mao","suffix":""},{"id":268690610,"identity":"07a6e73c-65ce-4c4e-b936-c9c1578b0238","order_by":3,"name":"Feier Zhou","email":"","orcid":"","institution":"Nanjing Medical University","correspondingAuthor":false,"prefix":"","firstName":"Feier","middleName":"","lastName":"Zhou","suffix":""},{"id":268690611,"identity":"dd6d5af6-c656-4011-8725-0548a8bfcbc1","order_by":4,"name":"Lai Jin","email":"","orcid":"","institution":"Nanjing Medical University","correspondingAuthor":false,"prefix":"","firstName":"Lai","middleName":"","lastName":"Jin","suffix":""},{"id":268690612,"identity":"cdd27394-1429-4c82-9a5f-673eca7014fe","order_by":5,"name":"Chao Zhu","email":"","orcid":"","institution":"Nanjing Medical University","correspondingAuthor":false,"prefix":"","firstName":"Chao","middleName":"","lastName":"Zhu","suffix":""},{"id":268690613,"identity":"41d46082-584f-4385-84f1-0a75316f2c2e","order_by":6,"name":"Shengnan Li","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAtElEQVRIiWNgGAWjYFAC5oYDHxjYwEwJIrUwNhycQbIWZh4okzgt8rMbGw/b7uCLNjjAfPA2D4NdHkEtBncONhzOPcOWu+EAW7I1D0NyMWEtEolALW0gLTxm0jwMBxIbCDpsBlCLJVgL/zfitDDcAGphhNjCRpwWA6CWg71ALTMPsxlbzjFIJsZhyYc//Gw7ltt3vPnhjTcVdkQ4DAKOAVMB2FIi1QNBDfFKR8EoGAWjYOQBAAZzPjTlaUw1AAAAAElFTkSuQmCC","orcid":"","institution":"Nanjing Medical University","correspondingAuthor":true,"prefix":"","firstName":"Shengnan","middleName":"","lastName":"Li","suffix":""}],"badges":[],"createdAt":"2024-01-22 07:44:19","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3887260/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3887260/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":50181837,"identity":"a82e8241-e28a-4624-a473-973e96a3392a","added_by":"auto","created_at":"2024-01-25 18:48:08","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":151144,"visible":true,"origin":"","legend":"\u003cp\u003eInduction of cisplatin resistant colorectal cancer cells.\u003c/p\u003e\n\u003cp\u003eA: The procedures of the induction of HCT116/DDP cells.\u003c/p\u003e\n\u003cp\u003eB: CCK-8 assay was conducted to detect the resistance of HCT116/DDP cells and their parental cells to cisplatin at the concentration of 10 μg/ml at 0, 24, 48 and 72 h.\u003c/p\u003e\n\u003cp\u003eC: the IC\u003csub\u003e50\u003c/sub\u003e values of HCT116/DDP cells and parental cells to cisplatin, oxaliplatin and 5-Fu were measured by CCK8 assay. ***p \u0026lt; 0.001, compared to parental cells.\u003c/p\u003e","description":"","filename":"Fig1.png","url":"https://assets-eu.researchsquare.com/files/rs-3887260/v1/0f93e13f479a486100de860e.png"},{"id":50181619,"identity":"213eadd6-402e-4a86-972a-d3db1cad782b","added_by":"auto","created_at":"2024-01-25 18:40:08","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1981137,"visible":true,"origin":"","legend":"\u003cp\u003eIncreased migration potential in HCT116/DDP cells.\u003c/p\u003e\n\u003cp\u003eA: Transwell assay was performed to evaluate the cell migratory potential. HCT116/DDP and parental cells (1\u0026nbsp;×\u0026nbsp;10\u003csup\u003e4\u003c/sup\u003e) were placed in upper chamber of transwell plates (8 μm) and invaded cells were counted at 24 h. Quantitation of the numbers of invade cells was shown in right panel.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eB: Wound-healing assay were performed to evaluate the cell migratory potential. Cells were seeded on 6-well plates and wounds were made by scratch with 10 μl tips. Photos were taken at 0 and 48 h after scratching. Quantitation analysis was shown on right panel.\u003c/p\u003e\n\u003cp\u003eC: Western Blot was used to determine the expression levels of N-cadherin and E-cadherin in HCT116/DDP cells and the parental cells. ***P\u0026lt;0.001,**P\u0026lt;0.01.\u003c/p\u003e","description":"","filename":"Fig2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3887260/v1/d778f62cf8f41015c3ae4533.jpg"},{"id":50181615,"identity":"f3756ff2-8321-4b90-b1b6-93474ad549d2","added_by":"auto","created_at":"2024-01-25 18:40:08","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":811400,"visible":true,"origin":"","legend":"\u003cp\u003eHigh expression levels of SVIL in HCT116/DDP cells.\u003c/p\u003e\n\u003cp\u003eA: Real-Time qPCR was performed to determine the mRNA levels of SVIL in HCT116/DDP cells compared to the parental cells.\u003c/p\u003e\n\u003cp\u003eB: Western Blot was used to determine the expression levels of SVIL in HCT116/DDP cells and the parental cells. ***P\u0026lt;0.001,**P\u0026lt;0.01.\u003c/p\u003e","description":"","filename":"Fig3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3887260/v1/fdeea7942026537071f862ad.jpg"},{"id":50181621,"identity":"03c54c00-8bb9-40bf-a765-0abceca1d0e7","added_by":"auto","created_at":"2024-01-25 18:40:08","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":2515288,"visible":true,"origin":"","legend":"\u003cp\u003eSVIL regulated HCT116/DDP cell migration.\u003c/p\u003e\n\u003cp\u003eA: Representative pictures of green fluorescent (GFP) expression in HCT116/DDP cells infected with shNC or shSVIL viruses for 72h.\u003c/p\u003e\n\u003cp\u003eB: Western blot analyses were performed to detect SVIL expression in SVIL KD cells and control cells.\u003c/p\u003e\n\u003cp\u003eC: CCK-8 assay was conducted to detect the resistance of SVIL knockdown cells and control cells to cisplatin at the concentration of 10 μg/ml at 0 h and 48 h.\u003c/p\u003e\n\u003cp\u003eD and E: Effect of SVIL inhibition on cell Migration. Transwell and Wound-healing assays were performed to evaluate the metastatic potential in HCT116/DDP cells after knock down SVIL.\u003c/p\u003e\n\u003cp\u003eF: Western Blot was used to determine the expression levels of N-cadherin and E-cadherin in SVIL KD cells and control cells.\u003c/p\u003e\n\u003cp\u003e***P\u0026lt;0.001,**P\u0026lt;0.01; “ns” means no statistical significance.\u003c/p\u003e","description":"","filename":"Fig4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3887260/v1/ee5a9321875831e5dc600c75.jpg"},{"id":50181617,"identity":"f4ece46a-88dc-4bd3-93b4-bb8f931d49dc","added_by":"auto","created_at":"2024-01-25 18:40:08","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":2835429,"visible":true,"origin":"","legend":"\u003cp\u003eThe involvement of ZO-1 in SVIL regulated cell migration.\u003c/p\u003e\n\u003cp\u003eA and B: Western Blot was conducted to detect the expression levels of TJs, including ZO-1, occludin, cludin5 in HCT116/DDP cells and their parental cells.\u003c/p\u003e\n\u003cp\u003eC: Representative immunofluorescence staining of ZO-1 (green) and nucleus (blue) in HCT116/DDP cells.\u003c/p\u003e\n\u003cp\u003eD and E: Western Blot was conducted to detect the expression levels of TJs, including ZO-1, occludin, cludin5 in SVIL knockdown HCT116/DDP cells and the control cells.\u003c/p\u003e\n\u003cp\u003eF: Representative immunofluorescence staining of ZO-1 (red), GFP fluorescence (green) and nucleus (blue) in SVIL knockdown cells and control cells.\u003c/p\u003e\n\u003cp\u003eAll the experiments repeated at least 3 times. ***P\u0026lt;0.001,**P\u0026lt;0.01; Scale bar: 5 μm.\u003c/p\u003e","description":"","filename":"Fig5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3887260/v1/531ed3f54f9b7a80ef0511e8.jpg"},{"id":50181838,"identity":"e6478cfe-864f-433e-9b98-4aec1a300e18","added_by":"auto","created_at":"2024-01-25 18:48:08","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":2711491,"visible":true,"origin":"","legend":"\u003cp\u003eSVIL regulated metastasis of HCT116/DDP cells in vivo.\u003c/p\u003e\n\u003cp\u003eA: The process diagram and lung tissues\u003c/p\u003e\n\u003cp\u003eB and C: HCT116 cells and HCT116/DDP cells were injected into nude mice via the tail vein, animals were sacrificed four weeks after injection. Representative HE staining of lung tissues is shown (n=7). Statistical results are shown.\u003c/p\u003e\n\u003cp\u003eD and E: SVIL knockdown HCT116/DDP cells and HCT116/DDP cells were injected into nude mice via the tail vein, animals were sacrificed four weeks after injection. Representative HE staining of lung tissues is shown (n=4). Statistical results are shown. *P\u0026lt;0.05; Scale bar: 200 μm and 50 μm.\u003c/p\u003e","description":"","filename":"Fig6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3887260/v1/e3084bb86ae0e13316cc01e8.jpg"},{"id":51281233,"identity":"d19c8cf0-cbb9-41f9-b3d1-aaa6d80e40e9","added_by":"auto","created_at":"2024-02-18 07:50:49","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1266529,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3887260/v1/f1114735-5341-447a-886c-101ea21e680c.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Supervillin-mediated ZO-1 downregulation facilitates migration of cisplatin-resistant HCT116 colorectal cancer cells","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eColorectal cancer (CRC) is one of the leading causes of cancer death worldwide, and evidence suggests that distant metastasis and drug resistance are two major causes of failures in cancer chemotherapy [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Chemo-resistant cancer cells own higher malignance, stemness and greater migratory and invasive capacity than their parental cells [\u003cspan additionalcitationids=\"CR4\" citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Suppressed cell migration and invasion could inhibit CRC development [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. However, the metastatic mechanism in cisplatin-resistant cancer cells is still unclear. Therefore, it is necessary to explore the detailed molecules participating in the metastasis of the cisplatin-resistant CRC cells.\u003c/p\u003e \u003cp\u003eEpithelial-to-mesenchymal transition (EMT) is a key step in tumor invasion and metastasis [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. The EMT process is characterized by the disruption of tight intercellular junctions between cells, increased cell motility, and greater invasion capacity [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Cell-to-cell junction formations, such as adherens junctions (AJs) and tight junctions (TJs), play an important role in regulating the migratory and invasive ability of cells [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. TJs are the most apical complex of intercellular junctions and composed of several proteins including zona occludens (ZO)-1, occludin, claudins and others [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e], which play a key role not only in intercellular barrier function, but also in maintaining cell stability and blocking cell motility [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. E-cadherin, a major component of AJs, is lost during tumorigenesis and its levels are associated with advanced tumor stages and poor prognosis in patients with cancer [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eSupervillin (SVIL), an actin-binding protein, has been shown to be an important modulator of the cell motility, invasive and migratory activity [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. It is reported that five isoforms of SVIL have been identified and are widely distributed in tissues and various subcellular compartments [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Higher expression of SVIL was found in patients with hepatocellular carcinoma, which was significantly correlated with the occurrence of distant metastasis [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Meanwhile, SVIL mRNA was found to be abundant in the HeLa S3 cervical carcinoma, A549 lung carcinoma and SW480 colon adenocarcinoma cell lines [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. As well known, cell motility contributes to tumor metastasis. SVIL has been reported to participate in multiple biological functions, particularly cell adhesion and motility processes, and to play a critical role in tumor cell migration and metastasis [\u003cspan additionalcitationids=\"CR19\" citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. SVIL was also observed to promote a process leading to disassembly of cell-substrate adhesion structure and loss of focal adhesions (FAs) by binding to TRIP6 [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. The mechanisms through which SVIL could promote cell motility and invasive activity were not fully illustrated, especially in cisplatin resistant colorectal cancer cells.\u003c/p\u003e \u003cp\u003eIn this study, we investigated the effects of SVIL on the migration of CRC cells after chemoresistance and the relevant mechanisms. To obtain a characteristic chemo-resistant phenotype, we generated cisplatin-resistant colorectal cancer cells by treating HCT116 cells with cisplatin. Interestingly, we found that SVIL was upregulated in cisplatin-resistant HCT116 cells, which was related to the increased metastatic potential of cancer cells. Furthermore, SVIL was shown to mediate the expression of ZO-1 and accelerate the migration of cisplatin-resistant colon cancer cells.\u003c/p\u003e"},{"header":"2. Material and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1. Cell culture\u003c/h2\u003e \u003cp\u003eHuman colorectal cancer cell lines HCT116 and 293FT were purchased from the Institute of Biochemistry and Cell Biology (Shanghai, China), which were authenticated by STR profiling and tested for mycoplasma contamination. The HCT116 cells and their cisplatin-resistant counterparts HCT116/DDP cells were cultured in DMEM complete medium containing 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin. 293FT cells were cultured in RPMI-1640 complete medium. The generation of chemoresistant cells occurred through cisplatin treatment, which was obtained from Qilu Pharmaceutical Co. Ltd (Jinan, Shandong, China). All cells were maintained in a humidified 5% CO2 environment at 37\u0026deg;C.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2. Lentiviral Infection and Generation of SVIL knocked-down cell lines\u003c/h2\u003e \u003cp\u003eTo generate SVIL knockdown stable cells (SVIL KD), shSVIL RNA and a scrambled shRNA (shNC) were designed and constructed by Gene Pharma (Shanghai, China). The sequences were shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. For packaging lentivirus, 293FT cells were co-transfected with shRNA and packaging plasmids using Lipofectamine 2000 (Yeasen Biotechnology, Shanghai, China). The viruses released from the 293FT cells were harvested and used to infect HCT116/DDP cells. Forty-eight hours later, the virus-containing culture medium was replaced with normal culture medium containing 2 \u0026micro;g/mL puromycin (Sigma, USA). Gene silencing was indicated by green fluorescence and confirmed by immunoblotting.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eshRNA sequences\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eName\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequences\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eshNC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003esense (5\u0026rsquo;\u0026rarr;3\u0026rsquo;)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGATCCGTTCTCCGAACGTGTCACGTTTCAAGAGAACGTGACACGTTCGGAGAACTTTTTTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAntisense (5\u0026rsquo;\u0026rarr;3\u0026rsquo;)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAATTCAAAAAAGTTCTCCGAACGTGTCACGTTCTCTTGAAACGTGACACGTTCGGAGAACG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eshSVIL-1882\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003esense (5\u0026rsquo;\u0026rarr;3\u0026rsquo;)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGATCCGCAAGTGCCACTGACTATATTCAAGAGATATAGTCAGTGGCACTTGCTTTTTTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAntisense (5\u0026rsquo;\u0026rarr;3\u0026rsquo;)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAATTCAAAAAAGCAAGTGCCACTGACTATATCTCTTGAATATAGTCAGTGGCACTTGCG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eshSVIL-3970\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003esense (5\u0026rsquo;\u0026rarr;3\u0026rsquo;)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGATCCGGTAGTGAAGTTTACGTATTTCAAGAGAATACGTAAACTTCACTACCTTTTTTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAntisense (5\u0026rsquo;\u0026rarr;3\u0026rsquo;)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAATTCAAAAAAGGTAGTGAAGTTTACGTATTCTCTTGAAATACGTAAACTTCACTACCG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3. CCK8 assay\u003c/h2\u003e \u003cp\u003eCell viability was analyzed by Cell Counting Kit-8 assay (Yeasen Biotechnology, Shanghai, China) according to the manufacturer\u0026rsquo;s instruction. HCT116 and HCT116/DDP cells were seeded on 96-well plates (5 \u0026times; 10\u003csup\u003e3\u003c/sup\u003e cells per well) and treated with cisplatin, oxaliplatin (Oxa) or 5-fluorouracil (5-Fu) for 48 h, and then incubated with CCK8 for 2 h. The absorbance at 450 nm was measured by a microplate reader (BioTek, USA). Oxaliplatin was purchased from Jiangsu Hengrui Pharmaceutical Co. Ltd (Lianyungang, Jiangsu, China) and 5-Fu was obtained from Tianjin Jinyao Pharmaceutical Co. Ltd (Tianjin, China). Experiments were performed at least three times.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4. Immunofluorescent analysis\u003c/h2\u003e \u003cp\u003eSVIL-KD cells, HCT116/DDP cells and their parental control cells were cultured in 20 mm confocal dishes (Corning, USA). When the cells were 50% confluent, the dishes were fixed with 4% paraformaldehyde for 15 min. Then the cells were blocked with 5% bovine serum albumin (BSA) in PBS buffer for 1 h and incubated with ZO-1 antibody (1:200, Proteintech, China) overnight at 4\u0026deg;C. After being washed by PBS, the dishes were incubated with fluorescent secondary antibody, anti-rabbit IgG 488 or Anti-rabbit IgG 594 (1:200, Proteintech, China), for 1 h at room temperature. Finally, cell nuclei were labeled with DAPI (Keygen Biotech, China) and examined using a LSM700 confocal microscopy (Zeiss, Germany).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5. Transwell assay\u003c/h2\u003e \u003cp\u003eTumor cells (1\u0026times; 10\u003csup\u003e5\u003c/sup\u003e cells per well), including SVIL-KD cells, HCT116/DDP cells and their parental control cells, were seeded in the upper chambers of transwell inserts (Corning, NY, USA), and the bottom well was filled with 10% FBS-containing medium. The plates were incubated at 37\u0026deg;C for 24 h. The cells on upper surface of membranes were gently wiped off with a cotton swab. The migrated cells on the lower surface were fixed with 4% paraformaldehyde, stained with crystal violet (Beyotime, Shanghai, China), and counted under a microscope.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6. Wound healing assay\u003c/h2\u003e \u003cp\u003eTumor cells (SVIL-KD cells, HCT116/DDP cells and their parental control cells were seeded in 6-well plates and subjected to the linear scratch wounds using a 10-\u0026micro;l pipet tip. Cells were washed three times with PBS and cultured in serum-free medium. The photomicrographs were taken using a microscope at 0, 24, and 48 h, and the line drawn on the bottom of well provided as a landmark. The scratched area was quantified using ImageJ software, and data were expressed as percent migration compared with 0-h.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.7. Western blot analysis\u003c/h2\u003e \u003cp\u003eCells were harvested and lysed in RIPA buffer containing 1% PMSF, 1% protease inhibitor and 1% phosphatase inhibitor. Proteins (25\u0026ndash;30 \u0026micro;g) were quantified by a BCA kit (Beyotime, Shanghai, China) and separated on 10% SDS/PAGE gel and then transferred to polyvinylidene difluoride (PVDF) membranes (Millipore, CA, USA). After blocking with 5% milk, membranes were incubated with primary antibodies (1:500-1:1000), HRP-conjugated secondary antibodies (1:10000), and detected using ECL kit on a Bio-Rad ChemiDoc imaging system (Bio-Rad). Primary antibodies of E-cadherin and N-cadherin were purchased from Cell Signaling (USA), antibodies of ZO-1, Occludin, NANOG, SOX2, β-Tublin and GAPDH were obtained from Proteintech (China), antibodies of Cludin5, VE-cadherin, Snail were obtained from Abcam (USA) and antibodies of SVIL was purchased from Sigma (MO, USA). Secondary antibodies anti-rabbit HRP (Jackson ImmunoResearch, USA) and anti-mouse HRP (Proteintech, China) were used in this study.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.8. RNA extraction and quantitative real-time PCR (qPCR) analysis\u003c/h2\u003e \u003cp\u003eRNA extraction was performed through TRIzol reagent (Invitrogen, CA, USA), and the Total RNA (0.5-1 \u0026micro;g) was subjected to reverse transcription by HiScript II Q-RT superMix (Vazyme, China). qRT-PCR was conducted using the specific primers (Generay biotechnology, China) and a Bio-Rad CFX96 system with SYBR green (Bio-Rad, CA, USA) to determine the mRNA expression levels. GAPDH was used as references. The primer sequences are as follows: SVIL-F 5\u0026rsquo; TTTCCAGCCTGTCCAACTTCA 3\u0026rsquo;, SVIL-R 5\u0026rsquo; CGTCACCTACTGCCATAACCC 3\u0026rsquo;; GAPDH-F 5\u0026rsquo; GGAGCGAGATCCCTCCAAAAT 3\u0026rsquo;, GAPDH-R 5\u0026rsquo; GGCTGTTGTCATACTTCTCATGG 3\u0026rsquo;. Relative RNA expression was calculated using the 2 \u003csup\u003e\u0026minus; ΔΔCt\u003c/sup\u003e method, and each sample was detected in triplicate.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e2.9. In vivo metastatic assay\u003c/h2\u003e \u003cp\u003eBALB/C nude mice (male, 5 weeks old) were obtained and housed in Animal Core Facility of Nanjing Medical University. A total of 3\u0026times;10\u003csup\u003e6\u003c/sup\u003e cells suspended in 200 \u0026micro;l PBS were injected into mice via tail vein. The mice were sacrificed four weeks later, and the lung tissues were removed for H\u0026amp;E (hematoxylin-eosin) staining. Metastatic lesions were observed. All animal experiments were approved by Animal Care and Use Committee of Nanjing Medical University (No. IACUC-1711028).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e2.10. Statistical analysis\u003c/h2\u003e \u003cp\u003eData were analyzed with GraphPad Prism 8.0 by a student\u0026rsquo;s t-test (comparison of two groups) or one-way ANOVA followed by Turkey tests (comparison of multiple groups). Data were presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard error of the mean (SEM), and P-values\u0026thinsp;\u0026lt;\u0026thinsp;0.05 were considered to be statistically significant. In our study, each experiment was repeated more than three times respectively.\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e3.1. Cisplatin-resistant colorectal cancer cells (HCT116/DDP) were established\u003c/h2\u003e \u003cp\u003eTo clarify the mechanisms behind chemoresistance and tumor metastasis in colon cancer, we established cisplatin-resistant colorectal cancer cells by two classical methods: 1) The colorectal cancer cells HCT116 were continuously exposed to cisplatin from a low dose (0.5 \u0026micro;g/ml) to a high dose (5 \u0026micro;g/ml) in a stepwise manner (named HCT116/DDP #1) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA) [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. 2) Cells were exposed to cisplatin at a high-dose (5 \u0026micro;g/ml) directly for 24 h, after which the medium was replaced with complete medium. The operation was repeated several times (named HCT116/DDP #2) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA) [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e].\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe CCK8 results showed that HCT116/DDP cells were successfully established using two methods (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). Specifically, high-dose cisplatin (10 \u0026micro;g/ml) significantly inhibited the viability of parental HCT116 cells, but had little effect on the proliferation of HCT116/DDP cells. The 50% inhibitory concentration (IC\u003csub\u003e50\u003c/sub\u003e) values were measured and the cisplatin resistant HCT116/DDP cells showed IC\u003csub\u003e50\u003c/sub\u003e values almost 37 times higher than the parental cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). Furthermore, the HCT116/DDP cells exhibited a strong resistance to oxaliplatin, while presenting a weak resistance to 5-Fu.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e3.2. HCT116/DDP cells showed higher metastatic potential\u003c/h2\u003e \u003cp\u003eThe metastatic potential and stem cell property of HCT116/DDP cells and their parental cells were examined. We observed significantly increased metastatic potential and cancer stemness in HCT116/DDP cells compared to their parental cells.\u003c/p\u003e \u003cp\u003eThe migration capacity of HCT116/DDP cells was measured in vitro. Transwell results showed that HCT116/DDP cells had greater straightforward migration compared to their parental cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). And wound healing assays suggested that the cell migration ability was stronger in HCT116/DDP cells than that in parental cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). This finding was consistent with the expression of EMT-related proteins. Especially, the EMT-related protein, N-cadherin, was markedly increased in HCT116/DDP cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e3.3. SVIL is overexpressed in cisplatin-resistant colorectal cancer cells\u003c/h2\u003e \u003cp\u003eTo determine the role of SVIL in cisplatin resistance and cell migration of cisplatin-resistant cancer cells, we first detected its expression in HCT116/DDP and their parental cells.\u003c/p\u003e \u003cp\u003eThe results showed that SVIL mRNA levels were much higher in HCT116/DDP cells compared to their parental cells, and Western Blot results validated that SVIL protein expression levels were also increased in HCT116/DDP cells compared to their parental cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA, \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003e3.4. Inhibition of SVIL expression resulted in a reduction in metastatic potential in HCT116/DDP cells\u003c/h2\u003e \u003cp\u003eTo further confirm the role of SVIL in cell migration in cisplatin-resistant HCT116 cells, we generated the SVIL knockdown HCT116/DDP cells (shSVIL \u0026minus;\u0026thinsp;1882 and shSVIL \u0026minus;\u0026thinsp;3970) and control cells (shNC) by lentiviral interference. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e, SVIL expression level was obviously blocked in the SVIL-KD HCT116/DDP cells compared to the control cells. The GFP fluorescence image indicated successful transfection in HCT116/DDP cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA), and the transfection efficiency of SVIL knockdown was verified by Western blot analysis (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). However, the inhibition of SVIL had no effect on cisplatin resistance of HCT116/DDP cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTranswell assay results showed that downregulation of SVIL significantly reduced the number of migrating HCT116/DDP cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). Consistently, the wound healing assay indicated that cell migration ability in HCT116/DDP cells was significantly weakened after knockdown of SVIL expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE). However, the EMT-related proteins N-cadherin and E-cadherin did not revert when SVIL expression was knocked down (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003e3.5. SVIL stimulated the migration via down-regulating ZO-1 expression in HCT116/DDP cells.\u003c/h2\u003e \u003cp\u003eTo investigate the migration mechanism of HCT116/DDP cells, changes in TJs protein were examined. Firstly, the ZO-1 protein level exhibited a significant reduction in HCT116/DDP cells in comparison to the parental cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA and B), whereas the expression of occludin and cludin5 remained unaltered. Moreover, ZO-1 expression was dramatically reversed after SVIL knockdown (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD and E).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eConsistently, the results of immunofluorescence staining indicated that ZO-1 expression was downregulated and less concentrated in the cell membrane in HCT116/DDP cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). Notably, the expression and localization were restored when SVIL knockdown was performed (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eF).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003e3.6. SVIL silencing reversed the lung metastasis of HCT116/DDP cells in vivo\u003c/h2\u003e \u003cp\u003eHCT116/DDP cells, the parental control cells and SVIL-KD HCT116/DDP cells were intravenously injected into nude mice, respectively, through the tail vein. Four weeks later, the mice were sacrificed and the lung tissues were collected for H\u0026amp;E staining. The process diagram and lung tissues were shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA. Nude mice injected with HCT116/DDP cells generated more lung metastatic lesions than the corresponding controls (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB and \u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC). Meanwhile, the number of lung metastatic foci in the nude mice injected with SVIL-KD HCT116/DDP cells was lower in comparison to the control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eD and \u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eE). These results showed that SVIL knockdown intercepted lung metastasis of HCT116/DDP cells.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eColorectal cancer (CRC) remains a major fatal disease worldwide, being the second most common cancer type in China [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. Its morbidity continues to rise annually [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Many previous studies were conducted on either tumor metastasis or chemoresistance [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Actually, distant metastasis and chemoresistance are two primary reasons for the failure in CRC chemotherapy, and they may co-occur and reinforce each other [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. We established the cisplatin-resistant HCT116 cells using two classical methods and observed their metastatic features.\u003c/p\u003e \u003cp\u003eRecent studies have shown that SVIL is widely distributed in cells and implicated in actin filament-based motile processes, cell survival, and signal transduction [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. However, the role of SVIL in colon cancer metastasis has received limited attention, and hence the underlying mechanism remains unclear. In our previous study, it was demonstrated that there was a marked increase in corticotrophin-releasing hormone receptors\u0026rsquo; (CRHRs) expression in colon cancer [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. We here also observed an increase of CRHR1 in cisplatin-resistant CRC cells (unpublished results). Furthermore, when cells were treated with CRH, a specific agonist to CRHR1, SVIL gene expression was significantly upregulated (RNA-seq results, unpublished), suggesting a strong relationship between SVIL and CRC. As previously described, SVIL regulates cell motility and promotes tumor metastasis [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. Based on the above research, we hypothesized that SVIL may play a role in tumor metastasis in colorectal cancer. In this study, the expression of SVIL was found to be upregulated in cisplatin-resistant colorectal cancer cells compared to the parental cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e), which is consistent with the previous report in hepatocellular carcinoma [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. The upregulated SVIL expression was observed to be associated with enhanced metastatic potential (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). When the expression of SVIL was inhibited by lentiviral infection in HCT116/DDP cells, the migration was suppressed. All of this evidence indicates that SVIL plays an important role in the migration of cisplatin-resistant CRC cells.\u003c/p\u003e \u003cp\u003eTumor metastasis and invasion are triggered and sustained by signaling pathways that regulate the dynamics of cytoskeleton in tumor cells, as well as the turnover of cell-matrix and cell-cell junctions, followed by cell migration into the adjacent tissue [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. Our results appear to be similar to previous findings that chemoresistant cancer cells underwent morphological changes with increased cell migration ability, as well as increased expression of N-cadherin, a mesenchymal indicator (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e)[\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. On the other hand, the cell\u0026ndash;cell adhesion protein E-cadherin typically experiences a decrease during the EMT process [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. Our study has identified a slight elevation in E-cadherin expression in HCT116/DDP cells. This result was consistent with a previous study showing that SVIL staining was specifically colocalized with E-cadherin [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. However, silencing of SVIL did not reverse the expression of N-cadherin and E-cadherin in HCT116/DDP cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). The explanation may lie in the fact that SVIL-regulated cell migration in HCT116/DDP cells is not dependent on either N-cadherin or E-cadherin. Additionally, it should be noted that not all cell types exhibit the same EMT markers. SVIL was identified as a tightly bound peripheral protein and has an intimate association with the plasma membrane [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. Meanwhile, ZO-1 is a classic protein that regulates tight junctions and is associated with the cell membrane. It plays a vital role in maintaining the integrity of cell-cell junctions [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e, \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. Defective tight junctions, regulated by ZO-1, can lead to intestinal epithelial dysfunction, which in turn accelerates the tumorigenesis and metastasis of colon cancer [\u003cspan additionalcitationids=\"CR40\" citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. In our study we have identified a new relationship between ZO-1 and SVIL in cell migration. When compared to the parental cells, the ZO-1 expression level was significantly reduced in cisplatin-resistant HCT116 cells, which was reversed by SVIL-silence (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). These results were consistent with the fluorescent staining of ZO-1. As shown Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e, the increased migration by the enhanced-SVIL induced ZO-1 decrease did not completely reversed by the SVIL silence. Therefore, besides the SVIL-regulated ZO-1 dysfunction, there must exist other underlying molecular mechanisms that regulate the migration of cisplatin-resistant colorectal cells, and more experiments are needed to verify them in the future.\u003c/p\u003e \u003cp\u003eIn addition, however, SVIL silencing had no effect on cisplatin resistance in HCT116/DDP cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). It was reported that SVIL antisense RNA 1 (SVIL-AS 1) showed positive effects in cancer therapy since SVIL-AS1 overexpression suppressed cell proliferation and tumor chemoresistance [\u003cspan additionalcitationids=\"CR43\" citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. Long non-coding RNA (lncRNA) promotes the expression of target genes by blocking miRNA and mitigating its inhibitory effect on the target genes. SVIL‐AS 1, a long non-coding RNA, inhibited chemoresistance by acting as a sponge for miR‐103a and upregulating ICE1 expression in lung adenocarcinoma chemotherapy resistance [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. In our study, long non-coding RNA has not been investigated, despite its potential role in chemoresistance.\u003c/p\u003e \u003cp\u003eIn conclusion, this study revealed that SVIL expression was aberrantly upregulated in cisplatin-resistant cancer cells, and the elevated SVIL expression was associated with the increased cell migration ability. Meanwhile, our data and previous research indicated that SVIL served as a novel pro-metastatic factor and played a role in cell motility, leading to tumor metastasis. Moreover, SVIL promoted the migration of cisplatin-resistant colorectal cancer cells through the deduction of ZO-1. Our data helps gain an insight into a novel idea about the migration of cisplatin-resistant colorectal cancer cells.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the National Natural Science Foundation of China (No. 81773724) and Medical Science and Technology Development Foundation of Nanjing Municipality Health Bureau (No. YKK 23203).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDeclaration of Competing Interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\n\u003cp\u003eYH designed the experiments and wrote the main manuscript text. XL, RM and FZ performed the experiments. LJ and CZ provided technical support. SL provided the overall direction and edited the manuscript. All authors reviewed the manuscript.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eSiegel RL et al (2021) \u003cem\u003eCancer Statistics\u003c/em\u003e, CA Cancer J Clin, 2021. 71(1): p. 7\u0026ndash;33\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBray F et al (2018) Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin 68(6):394\u0026ndash;424\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang Q et al (2022) Therapeutic targeting of glutamate dehydrogenase 1 that links metabolic reprogramming and Snail-mediated epithelial-mesenchymal transition in drug-resistant lung cancer. Pharmacol Res 185:106490\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJeon JH et al (2016) Migration and invasion of drug-resistant lung adenocarcinoma cells are dependent on mitochondrial activity. Exp Mol Med 48(12):e277\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXu X et al (2018) TGF-beta plays a vital role in triple-negative breast cancer (TNBC) drug-resistance through regulating stemness, EMT and apoptosis. Biochem Biophys Res Commun 502(1):160\u0026ndash;165\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMalki A et al (2020) \u003cem\u003eMolecular Mechanisms of Colon Cancer Progression and Metastasis: Recent Insights and Advancements\u003c/em\u003e. Int J Mol Sci, 22(1)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eErin N et al (2020) Tumor microenvironment and epithelial mesenchymal transition as targets to overcome tumor multidrug resistance. Drug Resist Updat 53:100715\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHashimoto I, Oshima T (2022) \u003cem\u003eClaudins and Gastric Cancer: An Overview\u003c/em\u003e. Cancers (Basel), 14(2)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGarcia MA, Nelson WJ, Chavez N (2018) Cell-Cell Junctions Organize Structural and Signaling Networks, vol 10. Cold Spring Harb Perspect Biol, 4\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOtani T, Furuse M (2020) Tight Junction Structure and Function Revisited. Trends Cell Biol 30(10):805\u0026ndash;817\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim SY et al (2021) \u003cem\u003eYes-Associated Protein Is Required for ZO-1-Mediated Tight-Junction Integrity and Cell Migration in E-Cadherin-Restored AGS Gastric Cancer Cells\u003c/em\u003e. Biomedicines, 9(9)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYu S, He J, Xie K (2023) Zonula Occludens Proteins Signaling in Inflammation and Tumorigenesis. Int J Biol Sci 19(12):3804\u0026ndash;3815\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBerx G, van Roy F (2009) Involvement of members of the cadherin superfamily in cancer. Cold Spring Harb Perspect Biol 1(6):a003129\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePestonjamasp KN et al (1997) Supervillin (p205): A novel membrane-associated, F-actin-binding protein in the villin/gelsolin superfamily. J Cell Biol 139(5):1255\u0026ndash;1269\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePope RK et al (1998) Cloning, characterization, and chromosomal localization of human superillin (SVIL). Genomics 52(3):342\u0026ndash;351\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVelichkovskii BT et al \u003cem\u003e[Chemoluminescence analysis of the functional state of blood phagocytes in silicosis and chronic dust-induced bronchitis]\u003c/em\u003e. Sov Med, 1990(4): p. 14\u0026ndash;16\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen X et al (2018) Supervillin promotes epithelial-mesenchymal transition and metastasis of hepatocellular carcinoma in hypoxia via activation of the RhoA/ROCK-ERK/p38 pathway. J Exp Clin Cancer Res 37(1):128\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGangopadhyay SS et al (2004) Smooth muscle archvillin: a novel regulator of signaling and contractility in vascular smooth muscle. J Cell Sci 117(Pt 21):5043\u0026ndash;5057\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFang Z, Luna EJ (2013) Supervillin-mediated suppression of p53 protein enhances cell survival. J Biol Chem 288(11):7918\u0026ndash;7929\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen Y et al (2003) F-actin and myosin II binding domains in supervillin. J Biol Chem 278(46):46094\u0026ndash;46106\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTakizawa N et al (2006) Supervillin modulation of focal adhesions involving TRIP6/ZRP-1. J Cell Biol 174(3):447\u0026ndash;458\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu Y et al (2019) \u003cem\u003eOverexpressed methyltransferase-like 1 (METTL1) increased chemosensitivity of colon cancer cells to cisplatin by regulating miR-149-3p\u003c/em\u003e\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ei\u0026gt;/S100A4/p53 axis. Aging (Albany NY), 11(24): p. 12328\u0026ndash;12344.\u003c/span\u003e\u003cspan address=\"http://i%3E/S100A4/p53 axis. Aging (Albany NY), 11(24): p. 12328\u0026ndash;12344.\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYuan W et al (2018) [A novel chemo-resistant gene MSX2 discovered by establishment of two pancreatic cancer drug resistant cell lines JF305/CDDP and PANC-1/GEM]. Zhonghua Zhong Liu Za Zhi 40(5):330\u0026ndash;334\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou Y et al (2010) Establishment of a human hepatoma multidrug resistant cell line in vitro. World J Gastroenterol 16(18):2291\u0026ndash;2297\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi N et al (2021) Incidence, mortality, survival, risk factor and screening of colorectal cancer: A comparison among China, Europe, and northern America. Cancer Lett 522:255\u0026ndash;268\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCao W et al (2021) Changing profiles of cancer burden worldwide and in China: a secondary analysis of the global cancer statistics 2020. Chin Med J (Engl) 134(7):783\u0026ndash;791\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen P et al (2021) Targeting YTHDF1 effectively re-sensitizes cisplatin-resistant colon cancer cells by modulating GLS-mediated glutamine metabolism. Mol Ther Oncolytics 20:228\u0026ndash;239\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShin AE, Giancotti FG, Rustgi AK (2023) Metastatic colorectal cancer: mechanisms and emerging therapeutics. Trends Pharmacol Sci 44(4):222\u0026ndash;236\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLin F et al (2022) Stanniocalcin 1 promotes metastasis, lipid metabolism and cisplatin chemoresistance via the FOXC2/ITGB6 signaling axis in ovarian cancer. J Exp Clin Cancer Res 41(1):129\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTian W et al (2022) Extracellular vesicles in ovarian cancer chemoresistance, metastasis, and immune evasion. Cell Death Dis 13(1):64\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen X et al (2017) A novel splice variant of supervillin, SV5, promotes carcinoma cell proliferation and cell migration. Biochem Biophys Res Commun 482(1):43\u0026ndash;49\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFang X et al (2017) CRH promotes human colon cancer cell proliferation via IL-6/JAK2/STAT3 signaling pathway and VEGF-induced tumor angiogenesis. Mol Carcinog 56(11):2434\u0026ndash;2445\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFriedl P, Alexander S (2011) Cancer invasion and the microenvironment: plasticity and reciprocity. Cell 147(5):992\u0026ndash;1009\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHan ML et al (2016) Cathepsin L upregulation-induced EMT phenotype is associated with the acquisition of cisplatin or paclitaxel resistance in A549 cells. Acta Pharmacol Sin 37(12):1606\u0026ndash;1622\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKaszak I et al (2020) \u003cem\u003eRole of Cadherins in Cancer-A Review\u003c/em\u003e. Int J Mol Sci, 21(20)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTrivedi S, Bhattacharya M, Starz-Gaiano M (2022) Mind bomb 2 promotes cell migration and epithelial structure by regulating adhesion complexes and the actin cytoskeleton. Dev Biol 491:94\u0026ndash;104\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBruckner BR, Janshoff A (2018) Importance of integrity of cell-cell junctions for the mechanics of confluent MDCK II cells. Sci Rep 8(1):14117\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTornavaca O et al (2015) ZO-1 controls endothelial adherens junctions, cell-cell tension, angiogenesis, and barrier formation. J Cell Biol 208(6):821\u0026ndash;838\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJiang Y et al (2021) Piezo1 regulates intestinal epithelial function by affecting the tight junction protein claudin-1 via the ROCK pathway. Life Sci 275:119254\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZeng Z et al (2018) Cancer-derived exosomal miR-25-3p promotes pre-metastatic niche formation by inducing vascular permeability and angiogenesis. Nat Commun 9(1):5395\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKe J et al (2018) MicroRNA\u0026ndash;103 regulates tumorigenesis in colorectal cancer by targeting ZO\u0026ndash;1. Mol Med Rep 17(1):783\u0026ndash;788\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHu Z et al (2022) N6-methyladenosine-induced SVIL antisense RNA 1 restrains lung adenocarcinoma cell proliferation by destabilizing E2F1. Bioengineered 13(2):3093\u0026ndash;3107\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAcha-Sagredo A et al (2020) Long non-coding RNA dysregulation is a frequent event in non-small cell lung carcinoma pathogenesis. Br J Cancer 122(7):1050\u0026ndash;1058\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuo L, Ding L, Tang J (2021) Identification of a competing endogenous RNA axis SVIL-AS1/miR-103a/ICE1 associated with chemoresistance in lung adenocarcinoma by comprehensive bioinformatics analysis. Cancer Med 10(17):6022\u0026ndash;6034\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Supervillin, ZO-1, Cell migration, Cisplatin resistant HCT116 cells (HCT116/DDP)","lastPublishedDoi":"10.21203/rs.3.rs-3887260/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3887260/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eSupervillin (SVIL), the biggest member of the villin/gelsolin superfamily, has recently been reported to promote the metastasis of hepatocellular carcinoma by stimulating epithelial-mesenchymal transition (EMT). However, data about the role of SVIL in the migration of colorectal cancer cells are scarce. We investigated the effects of SVIL on the migration of cisplatin-resistant colorectal cancer cells. The model of cisplatin-resistant HCT116 cells (HCT116/DDP) was established. SVIL-knockdown HCT116/DDP cells with virus infection were also used. Migration was assessed by transwell assay and wound healing assay, tumor metastasis was assessed using a mouse model with tail vein injection of colorectal cancer cells. The results showed that the expression of SVIL was upregulated in HCT116/DDP cells compared to their parental cells. Also, the HCT116/DDP cells showed increased cell migration, stemness and lung metastasis. Furthermore, we revealed that the up-regulated SVIL was associated with the induction of migration of HCT116/DDP cells. Reduced SVIL expression reversed the enhanced migration and lung metastasis in cisplatin-resistant colorectal cancer cells. Further work showed that SVIL silencing reduced cell migration by targeting zona occludens (ZO)-1 mediated tight-junction remodeling. The expression of ZO-1, but not occludin and cludin5, was down-regulated after SVIL knock-down. Fluorescence detection indicated that the linear ZO-1 expression was interrupted in HCT116/DDP cells while the SVIL silencing reversed the interruption. This study firstly displayed the relationship between SVIL and ZO-1 in cisplatin-resistant colon cancer cells, providing a new insight into the mechanism of colorectal cancer migration.\u003c/p\u003e","manuscriptTitle":"Supervillin-mediated ZO-1 downregulation facilitates migration of cisplatin-resistant HCT116 colorectal cancer cells","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-01-25 18:40:03","doi":"10.21203/rs.3.rs-3887260/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"6e43d48f-9e95-4c9f-81f1-a9d8161dceb3","owner":[],"postedDate":"January 25th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-02-18T07:50:35+00:00","versionOfRecord":[],"versionCreatedAt":"2024-01-25 18:40:03","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3887260","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3887260","identity":"rs-3887260","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.