G protein-coupled receptor 91 activations suppressed mineralization in Porphyromonas gingivalis–infected osteoblasts

G protein-coupled receptor 91 activations suppressed mineralization in Porphyromonas gingivalis–infected osteoblasts | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article G protein-coupled receptor 91 activations suppressed mineralization in Porphyromonas gingivalis–infected osteoblasts Wenqi Su, Dandan Zhang, Yujia Wang, Lang Lei, Houxuan Li This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4983726/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 11 Nov, 2024 Read the published version in Scientific Reports → Version 1 posted 10 You are reading this latest preprint version Abstract Succinate receptor GPR91 is one of the G protein-coupled receptors (GPCRs), which interact with a variety of proteins and signals to regulate different cellular functions such as cell morphology, apoptosis, and differentiation. This study aimed to investigate whether the GPR91-mediated signaling pathway affects mineralization in Porphyromonas gingivalis ( P. gingivalis )-treated osteoblasts and to investigate its potential role in osteoclast differentiation. Utilizing primary mouse osteoblasts from wild-type (WT) and GPR91 knockout (GPR91 −/− ) mice infected with P. gingivalis , we demonstrated that inhibition by 4C, a specific inhibitor, and knockout of GPR91 promoted migration and mineralization ability in P. gingivalis -infected osteoblasts. Additionally, ranged with P. gingivalis -infected WT osteoblasts, GPR91 −/− osteoblasts had reduced RANKL production, and CM from bacteria-infected GPR91 −/− osteoblasts had reduced formation of osteoclast precursors. Moreover, P. gingivalis mediates GPR91 involvement in osteoblast mineralization by activating the NF-κB pathway. These findings suggest that GPR91 activation reduces mineralization of P. gingivalis -infected osteoblasts and promoted osteoclastogenesis from macrophages. Targeting GPR91 may help reduce the loss of alveolar bone during bacterial infection. Biological sciences/Cell biology Biological sciences/Microbiology Health sciences/Medical research GPR91 P. gingivalis osteoblasts NF-κB mineralization Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Chronic periodontal disease is an inflamed disease tied to destroying tooth-support tissue. The critical factor of this disease pathogen is an imbalance between the parasitic flora and the host's defence system 1 . Anaerobic bacteria affect healthy tissues, resulting in increased inflammatory cells, the degradation of collagen fibers, and the alveolar bone deteriorates 2 . The alveolar bone continuously changes, balancing bone homeostasis between wound healing and bone loss 3 . The immune system in the area that has been attacked by periodontal disease disrupts the ratio between bone formation and resorption, ultimately causing bone loss 4 . Porphyromonas gingivalis ( P. gingivalis ) is a Gram-negative anaerobic pigmented coccobacillus and grows well in an anaerobe state, establishing colonies in the periodontal pockets. It also penetrates deeply into tissues and bone tissue 5 . P. gingivalis can produce many virulent factors, such as lipopolysaccharide (LPS), hemagglutinin, and gingipain 6 . LPS acts upon the immune system and intensifies the creation of pro-inflammatory molecules, for instance, the tumour necrosis factor (TNF)-α, and interleukin (IL)-6. It can also interfere with the formation of osteoblasts, perhaps leading to depreciation in the mass of periodontal disease tissues 7 . Osteoblasts are mostly specialized bone-forming cells that play an essential function in the metabolism of alveolar bone. The most probable reason for the deplorable degradation of alveolar bone, a hallmark characteristic of periodontitis, is the excessive activity of osteoclast precursors and an increasing population of mature osteoclasts 8 . Alveolar bone destruction due to bone resorption can further involve abnormalities in the development of bones 9 . Differentiation of osteoblast lineages may be inhibited in an inflammatory environment. The inflammatory environment most likely leads to inhibition of differentiation the osteoblast lineage. In such a context, LPS from P. gingivalis caused a shift in the metabolism of osteoblasts from an oxidative phosphorylation mode into a glycolytic mode, with the consequence of RANKL secretion 10 . Proportions of P. gingivalis within periodontal ligament cells led to an entirely different type of inflammation and increased overproduction of a TCA metabolic intermediate-succinate 11 . Guo et al. have presented evidence that when high glucose conditions were combined with succinate, the expression of the succinate receptor 1 (SUCNR1) was activated, which promoted osteoclast formation and permitted osteoclastogenesis 12 . SUCNR1 is the value of the G protein-coupled receptors (GPCRs) superfamily and is also termed GPR91. Ligand binding initiates signalling molecules that act through several signalling pathways involving a conformational change in the receptor with their subsequent interaction with G protein partners, leading to biological responses like migration, proliferation, and cell division 13 . Several authors have reported that ligands would activate GPR91 through a mechanism that kicks off a coordination compound signal transduction cascade, leading to a high regulation within inflammatory markers. New research proved that diabetic rats with decreased GPR91 have lower expression of PTGS2 and prostaglandin E2 (PGE2) level 14 . Research showed an interrelation between GPR91 and hypoxic retinal vascular disease 15 . The disease of arthritis in GPR91 knockout mice is reduced in the animal model of rheumatoid arthritis of bone 16 . In various types of inflammatory disease, dysregulation of GPR91 occurs. Previous studies have demonstrated that GPR91 antagonizing agents, when applied directly to the affected region, lower the process of inflammatory signalling and osteoclast formation within living organisms 17 . However, the result of GPR91 within the mineralization of osteoblasts in an inflammatory environment has rarely been studied. Therefore, this work aimed at the role of GPR91 in the process of P. gingivalis stimulation of osteoblast calcification. Results P. gingivalis infection promoted GPR91 expression with inhibited mineralization in osteoblasts. To know the effect of P. gingivalis on osteoblasts, cells were treated with different concentrations of P. gingivalis at the multiplicity of infection (MOI) levels of 10, 50, and 250 for 24 h. The pro-inflammatory cytokine IL-6 levels increased progressively at a high MOI. In contrast, the gene transcription of osteogenic-related genes Osterix (OSX), runt-associated transcription factor (RUNX) 2, and osteopontin (OPN) reduced (Fig. 1 A). The protein expression of osteogenesis-related components consistently showed a decrease, as assessed by Western blot analysis at the two-day time point (Fig. 1 B and Supplemental Information S1). Considering the outcomes presented above, P. gingivalis with a MOI of 50 was chosen for further investigations. Similarly, the ALP staining performed at seven days (Fig. 1 C) and the ARS staining performed at 14 days (Fig. 1 D) provided evidence of the diminished mineralization capacity of osteoblasts that P.gingivalis induced. The link between minerality-related markers and GPR91 was found to be inverted. Consequently, cells were once again stimulated for different durations. The results demonstrated a positive correlation between the duration of induction and upregulation for OSX, RUNX2, and OPN, as indicated by the data presented in Fig. 1 E&F and Supplemental Information S1. However, GPR91 was once again found to be downregulated (Fig. 1 E). Blocking GPR91 alleviated the inhibitory effect of P. gingivalis on mineralization of osteoblasts To ascertain the function of GPR91 in osteoblast mineralization, in vitro tests were conducted using 4C, a selective inhibitor of GPR91, in conjunction with osteoblasts obtained from GPR91 -/- mice. Following pre-treatment with different dosages of 4C in a controlled laboratory setting, we assessed cellular activity using the Cell Counting Kit 8 (CCK8) after administering 4C to minimize any disruption caused by the chemical medication. The ideal concentration of 5 µM was chosen based on the drug's impact on cell activity and its ability to inhibit GPR91 (Fig. 2 A). Before P. gingivalis stimulation, we subjected osteoblasts obtained from WT mice to a 2 h pre-treatment with 4C. This resulted in a noticeable elevation in OSX, RUNX2, and OPN after 24 h (Fig. 2 B). Additionally, protein expression of osteogenic genes was evaluated 2 days later using Western blotting. Under inflammatory conditions, the mineralization ability of osteoblasts was greatly boosted by inhibiting GPR91 (Fig. 2 C and Supplemental Information S1). The identical outcome was observed through alkaline phosphatase (ALP) staining after seven days (Fig. 2 D) and alizarin red S (ARS) staining after 14 days (Fig. 2 E). To give additional proof of inhibitory control for GPR91 activity, qPCR and western blot analyses were performed on a ton of mineralization-related markers in osteoblasts induced by P. gingivalis . These analyses were undertaken on WT mice and animals lacking the GPR91 gene (Fig. 3 A&B and Supplemental Information S1). Osteoblasts derived from GPR91 ,-/- mice, exhibit enhanced mineralization capacity. The results were additionally validated using ALP staining after seven days (Fig. 3 C) and ARS staining after 14 days (Fig. 3 D). GPR91 promotes osteoclast differentiation under inflammatory conditions To determine whether GPR91 affects osteogenic mineralization and osteoclast formation, we exposed cells from WT and GPR91 −/− mice to P. gingivalis , collected conditioned media from these osteoblasts, and then treated osteoclast precursors with the conditional media (CM) obtained from the WT and GPR91 −/− osteoblasts. After 24 h of culture, RANKL expression in the P. gingivalis -treated GPR91 −/− osteoblasts was lower (Fig. 4 A&B and Supplemental Information S1). Significantly, the mRNA appearance stages of osteoclast marker genes were markedly reduced on treatment with P. gingivalis -treated GPR91 −/− mice osteoblastic CM, such as tartrate-resistant proton donor phosphatase ( TRAP ), Nfatc1, CTSK, c-Fos , and Car2 , in osteoclast precursors isolated from mice (Fig. 4 C). Furthermore, the number of osteoclasts formed by CM from P. gingivalis -treated GPR91 −/− osteoblasts was the lowest among those induced by CM from P. gingivalis (Fig. 4 D). A higher level of TRAP protein expression was additionally shown in the osteoclast precursors in the conditioned medium originating from infected GPR91 −/− osteoblasts, as shown in Fig. 4 E and Supplemental Information S1. GPR91 partially enhances osteoblast migration Osteoblast surface receptors facilitate cell attachment and polarization, leading to the activation of osteoblast migration 18 . G protein-mediated signalling is essential for transmitting information across membranes. It enables the recognition of external signals and their coupling with internal cellular information 19 . WT and GPR91 −/− osteoblasts were exposed to P. gingivalis for 24 h and then placed in 6-well plates, or coupled with a 24-well transwell culture chamber in the upper compartment. The measurement revealed a noticeable difference in the healed/damaged area ratio between osteoblasts from GPR91 −/− mice and osteoblasts from WT mice, with the value being lower in the former (Fig. 5 A). Once again, the Transwell studies demonstrate that osteoblasts derived from WT mice exhibit a higher level of migration after 24 h, as depicted in Fig. 5 B. Upon further analysis, a significant depreciation in matrix metalloproteinases (MMP)2, MMP9, and chemokine ligand (CCL)2 transcription levels in osteoblasts from GPR91 −/− mice was observed compared to those from WT mice (Fig. 5 C). This finding was corroborated by the protein detection results obtained through western blotting (Fig. 5 D and Supplemental Information S1). It was indicated that GPR91 may be necessary for cell migration. P. gingivalis mediates GPR91 involvement in osteoblast mineralization through activation of NF-κB pathway We examined four signaling pathways to elucidate the potential mechanism underlying GPR91-facilitated osteoblast mineralization. Western blotting indicated that p-ERK1/2/total-ERK1/2 and p-P65/total-P65 was upregulated due to treatment with P. gingivalis , along with p-p38/total-p38 and p-JNK/ total-JNK, which is not obvious (Fig. 6 A and Supplemental Information S1). We further pretreated these osteoblasts with specific inhibitors of the ERK1/2 pathway, SCH772984, and P65 pathway inhibitor, SC75741. Data showed that inhibition of the ERK pathway increased the expression of OPN. However, it failed to reverse the expression levels of OSX and RUNX2, and it was not that effective in inhibiting the expression of GPR91 (Fig. 6 B and Supplemental Information S1). Apart from this, inhibition of the P65 pathway not only prevented the overexpression of GPR91 but also enhanced the process of mineralization by P. gingivalis . This enhancement was confirmed by a decreased OSX, RUNX2, and OPN expression (Fig. 6 C and Supplemental Information S1). GPR91 regulates the process of mineralization by osteoblasts through the P65 signaling pathway. Discussion The accumulation of bacteria such as P. gingivalis , Tannobacteria forsythiae , and Treponemas around the teeth degenerates the alveolar bone 20 . P. gingivalis is a main bacteria that plays an important role in the aetiology of periodontal diseases. There is ample evidence that many P. gingivalis strains inhibit osteoblasts and thus delay alveolar bone growth. Studies have shown that LPS, lipids, metabolites, and ultrasound extracts from P. gingivalis slow down osteoblast differentiation and osteogenesis 21 – 24 . Consequently, it was of great significance that the animal model of periodontitis induced by inoculation with live P. gingivalis is similar to the human patient model 25 . This confirms that P. gingivalis can enter infected cells (gingival epithelial cells, fibroblasts, osteoblasts, osteoblasts) at the infected site in a mouse model of periodontitis 26 . This effect destroys osteoblasts and osteoclasts, inhibiting the osteoblast pool and causing bone loss. Taken together, the total bacteria treatment could fully reveal its functional advantages and simulate pathological processes in vivo. In this study, researchers used P. gingivalis as a direct stimulant of osteoblasts rather than using its ingredients (such as LPS). Sex hormones exert pleiotropic effects on several tissues and organs, serving as the foundation for bone formation, homeostasis, and immunological function 27 . The osteoblasts in our study were extracted from 3-day newborn male mice, and the effects of sex hormones might be minimal. Since large epidemiological studies have shown that after controlling for all major covariates, periodontal disease susceptibility and progression/severity are higher in men than in women 28 , both male and female animals should be used to explore whether there is a sex difference in the effect of succinate-GPR91 axis, especially in further animal studies. The precise function of GPR91 in regulating periodontitis following succinate pre-treatment remains unknown despite its known ability to stimulate osteoclast production 12 , 29 . The impact of GPR91 on mineralization in inflammatory osteoblasts has not been studied. Experiments were conducted to investigate how GPR91 regulates mineralization in inflammatory osteoblasts generated by P. gingivalis . IL-6, a cytokine with many effects, is widely recognized for its work in contributing to the production of osteoclasts and inhibiting the production of ALP and collagenase in osteoblasts 30 . Thus, we utilized IL-6 expression to analyze the creation of an inflammatory environment in vitro, which exhibited a positive correlation with the concentration of P. gingivalis stimulation (Fig. 1 ). A multitude of protein-protein interactions culminate in the activation of signalling molecules, forming a complex signalling network that regulates the crucial process of osteoblast development, which is essential for bone production. RUNX2 is expressed in preosteoblasts, immature osteoblasts, and precocious osteoblasts, and is crucial for controlling osteoblast variation and bone formation 31 . RUNX2 differentiates several genes related to bone matrix proteins, including OPN and osteocalcin 32 . OPN is an extracellular matrix glycoprotein involved in bone remodelling and expressed preferentially in the intermediate phase of bone formation 33 . OSX is a zinc-finger-containing transcription factor and an essential player in osteoblastogenesis, and is a downstream target of RUNX2 34 . Consequently, our results indicated that with the progressive worsening of the inflammation induced by P. gingivalis , the GPR91 expression upregulation was accompanied by a gradual downregulation of the expressions of OSX, RUNX2, and OPN simultaneously (Fig. 1 ). We, therefore, went on to complete experiments assessing the effects of GPR91-mediated signalling on osteoblast mineralization in an inflammatory environment by measuring the expression of OSX, RUNX2, and OPN using GPR91 −/− osteoblasts treated with P. gingivalis and WT osteoblasts following pre-treatment with 4C. On interruption of GPR91 signalling, the osteoblasts restored following exposure to P. gingivalis had a moderate level of restored mineralization, which can be observed in Figs. 2 and 3 . The development of chronic periodontitis involves the continuous breakdown and formation of alveolar bone, which is influenced by the ratio of RANKL to OPG. A high RANKL/OPG ratio leads to the active breakdown of alveolar bone 35 . Prior research has shown that live P. gingivalis is a powerful trigger for the osteoblasts to produce RANKL 36 . RANKL is a cytokine that promotes the formation of osteoclasts, which are cells accountable for reducing tissue of the bone 37 . Osteoblasts regulate the production of osteoclasts in normal bone tissue by producing two opposing factors, RANKL and OPG. The equilibrium between RANKL and OPG is crucial in determining the bone density in the alveolar bone. The results of our investigation demonstrated that the increase in RANKL expression in osteoblasts produced by P. gingivalis is reduced when GPR91 is absent, as shown in Fig. 4 A&B. In addition, the liquid portion of the osteoblast culture was used to treat osteoclast precursor cells. It was found that the culture medium from osteoblasts infected with bacteria and lacking the GPR91 gene supported a lower formation of osteoclasts from their precursors compared to the culture medium from normal osteoblasts infected with bacteria (see Fig. 4 D&E). The migration and adhesion characteristics are strongly connected to the bone formation and regeneration process, which is mediated by osteoblasts 38 . Our previous research indicated that GPR91 might augment the migratory capacity of periodontal ligament fibroblasts under low oxygen conditions 39 . Observations of GPR91-deficient mice models revealed a notable suppression of dendritic cell secretion and migration 29 . MMP facilitate cellular migration in various tissues during developmental processes, such as wound healing and bone remodeling 40 . Suppressing MMP13 activity increased cell mineralization while decreasing cell migration 41 . MMP9 and MPP2 are well-established proteins linked to cell migration, and their decreased expression can significantly reduce the migration of cells 42 . CCL2 is a known chemoattractant that mediates migration, proliferation, and cancer cell invasion. CCL2 signalling has also been shown to stimulate Osteoclastogenesis. Moreover, the silencing of CCL2 also increased bone mineral density 42 . Interestingly, our results show that although GPR91 knockout can partially restore the mineralization ability of osteoblasts inhibited by P. gingivalis , it inhibits the migration ability of osteoblasts and the expression of MMP2, MMP9, and CCL2 (Fig. 5 ). Ko SH et al. found that Succinate activated Gαq, Gαi and Gα12, and Gαq and Gα12 specifically participated in human marrow mesenchymal stem cells (hMSC) migration 43 . We hypothesized that when P. gingivalis stimulate osteoblasts, it will cause intracellular succinate accumulation and Gαq and Gα12 are activated by succinic acid to participate in osteoblast migration. The osteogenic differentiation process has long been associated with the mitogen-activated (MAP) kinases pathway, which comprises the crucial ERK1/2, JNK, and p38 44–46 . The ERK pathway is a member of the MAPK signalling pathways. Studies have shown that important signalling molecules that control osteoblast activity work by activating the ERK pathway 47 . The function of ERK in enhancing cell proliferation, augmenting RUNX2 transcriptional activity, and facilitating osteogenic diversity has been broadly acknowledged 46 . Activation of JNK is necessary for the development of human periosteal osteoblasts in an in vitro system 44 . High expression of SUCNR1 has been found to activate MAP kinases, specifically ERK 1/2, in several cellular models, such as HEK293 cells and immature dendritic cell models under in vitro conditions 48 . Upon stimulating with P. gingivalis , we conducted a more in-depth analysis of the activation of MAPK and P65 pathways. Our findings indicate that the ERK and P65 pathways were activated compared to the control group (Fig. 6 A). Our research focused on examining the functions of the ERK and P65 pathways using inhibitors that specifically target ERK and P65, respectively. Inhibition of the P65 pathway increased the mineralization capacity of osteoblasts in an inflammatory environment and, and reduced the expression of GPR91(Fig. 6 C). Succinate works by stimulating SUCNR1 to upregulate nuclear expressions of P65 and p50 in osteoclast cells 12 . The effect promotes the release of RANKL and eventually leads to the formation of osteoclasts. We hypothesized that activation of the NF-κB pathway initiated by P. gingivalis leads to the involvement of GPR91 in osteoblast mineralization and osteoclast development. Conclusion Activation of GPR91 results in decreased mineralization and increased macrophage osteoclastogenesis in P. gingivalis -infected osteoblasts. The outcomes suggest that GPR91 plays a central part in influencing osteoblast function, partly through the NF-κB signalling pathway. On the other hand, inhibiting osteoblast GPR91 would reduce the inhibitory effect of P. gingivalis and provide a new way to repair and regenerate bone damaged by P. gingivalis . Materials and methods We confirmed that all experiments in this study were performed in accordance with the relevant guidelines and regulations. All the procedure of the study is followed by the ARRIVE guidelines. The Ethical Review Committee on Experimental Animal Welfare of Nanjing University (IACUC-D2202111) has accepted the protocol for the procedures. Osteoblast isolation and culture Osteoblasts were separated from neonatal male GPR91 −/ − and C57BL6/J WT mice (GemPharmatech Co. Ltd., Nanjing, China). The calvaria bones of neonatal mice were cut off and cultured by trypsin and collagenase digestion method as we described previously 10 . Cells obtained from digestion were cultured at 37℃ in 5% CO2 in α-MEM with 10% fetal bovine serum (FBS), 100 mg/ml streptomycin, and 100 U/ml penicillin. Observe and follow up after approximately 3–5 generations of culture once the cell density reaches 80%. Visible osteoblasts were observed one week after staining with the BCIP/NBT ALP color development kit (Beyotime, China). After 14 days of culture, calcium accumulation was assessed using alizarin red staining (Sigma-Aldrich, USA). To test whether osteoblasts could produce a mineralized matrix, cells were in a medium containing 10 mM β-glycerophosphate, 50 µM ascorbic acid, and 0.1 µM dexamethasone with α-MEM supplemented with 10% FBS. The osteogenic medium was changed daily. Bacteria Culture and Drug Treatment P. gingivalis (ATCC33277) developed in a Brain Heart Infusion (BHI) medium, adding 0.1% yeast extract, 1 µg/ml vitamin K1, and hemin of 5 µg/ml. The visual density for the bacterial spread out was estimated with a spectrophotometer around 600 nm. An OD of 1 corresponds to a concentration of 10 9 P. gingivalis /ml. Osteoblasts were infected with live P. gingivalis at the MOI of 10, 50, and 250. The concentration of the inhibitor was 5 µM. The inhibitor used is 4C, which is a selective inhibitor for GPR91. The ERK inhibitor SCH772984 and the P65 inhibitor SC75741 are introduced at 500 nM and 5 µM, respectively. Additionally, osteoblasts were pretreated with the drug for 2 h before stimulation by P. gingivalis . Isolation of RNA and quantitative PCR Osteoblasts to be lysed were treated with RNA extraction reagent ((Accurate Biology, China). A Nanodrop (Thermo Fisher Scientific, USA) calculated the total molarity of RNA. The PrimerScriptTM RT kit from Vazyme was used for reverse engineering. Real-time PCR of the reverse-engineered samples was done by employing SYBR Green Master MIX (Vazyme, China). The qPCR primers were then synthesized using PrimerBank's design code ( https://pga.mgh.harvard.edu/primerbank/ ). The pattern of primers used is shown in Table 1 . Relative quantification was achieved using the comparative 2 −△△ Ct method. Table 1 The primer sequences used for real-time qPCR Genes Sequence(5'-3') Sequence(3'-5') GPR91 (mouse) CTTGTGAGAATTGGTTGGCAA CATCTCCATAGGTCCCCTTATCA OSX (mouse) CTTCCCAATCCTATTTGCCGTTT CGGCCAGGTTACTAACACCAATCT RUNX2 (mouse) CATTTGCACTGGGTCACACGTA GAATCTGGCCATGTTTGTGCTC OPN (mouse) GATGATGATGACGATGGAGACC CGACTGTAGGGACGATTGGAG IL-6(mouse) AGTTGCCTTCTTGGGACTGA TCCACGATTTCCCAGAGAAC RANKL (mouse) AGCCGAGACTACGGCAAGTA AAAGTACAGGAACAGAGCGATG OPG(mouse) ACCCAGAAACTGGTCATCAGC CTGCAATACACACACTCATCACT TRAP(mouse) TGTGAGGGAGGAGGCGTCTGC CGTTCCCAAGAAAGCTCTACC NFATc1(mouse) CCGTCACATTCTGGTCCATAC CCAATGAACAGCTGTAGCGTG Ctsk(mouse) GTGTCCATCGATGCAAGCTTGGCA GCTCTCTCCCCAGCTGTTTTTAAT c-Fos(mouse) CGGGTTTCAACGCCGACTA TTGGCACTAGAGACGGACAGA Car2(mouse) TCCCACCACTGGGGATACAG CTCTTGGACGCAGCTTTATCATA MMP2 (mouse) CGATGTCGCCCCTAAAACAG GCATGGTCTCGATGGTGTTC MMP9 (mouse) GGAGACGCCACGCATTTCA CTTACGGCCTGAGGGTCTTG CCl2 (mouse) AACTGCATCTGCCCTAAGGT GGCATCACAGTCCGAGTCA β-actin (mouse) AGGTCGGTGTGAACGGATTTG TGTAGACCATGTAGTTGAGGTCA Alkaline phosphatase (ALP) activity and staining The ALP staining procedure was done with a BCIP/NBT Staining Kit (Beyotime, China). The cells were stimulated to undergo osteogenic differentiation and treated with 4% paraformaldehyde for 30 min on the 7 days. Subsequently, they were placed in a BCIP/NBT staining solution for a suitable duration under dark conditions. The ALP activity testing was conducted using the ALP activity assay kit (Beyotime, China) following the methods provided by the producer. Alizarin red S (ARS) staining The cells were incubated within osteogenic medium for 14 days, then treated with 4 percentage paraformaldehyde for 30 min to fix them. Subsequently, the cells were stained with ARS for a further 30 min. The development of mineralized nodules by the osteoblasts was evaluated using ARS staining. The calculation of absorbance at a wavelength around 405 nm was recorded, and the ARS standard curve was applied to determine the ARS amount. Osteoclast genesis by the conditioned medium from osteoblasts Similarly, osteoblasts obtained from the tibia of GPR91 −/− and WT mice were cultured for 24 h in the availability or negativity of P. gingivalis . Then, the medium of osteoblasts as a CM was collected to generate osteoclasts. Bone marrow cells from 6-week-old mice (GemPharmatech Co. Ltd., Nanjing, China) was cultured for 3–5 days in RPMI 1640 medium supplemented with 30% L929 cell supernatant to promote the growth of macrophages adherent to the culture surface. Mix fresh 1640 complete medium with CM of GPR91 −/− or WT osteoblasts at a ratio of 1:1. Additionally, 20 ng/mL M-CSF (RP01216, ABclonal, China) and 50 ng/mL RANKL (RP00745, ABclonal, China) were added. They were then stained using a TRAP kit as instructed by the producer. The identification process involves counting the presence of three or more nuclei in a cell. Osteoclasts were counted as TRAP + multinucleated osteoclast precursors, and images were recorded using an inverted microscope (Nikon, Japan). Trans well migration assay Trans well migration assay was done following the procedure described by Yang et al 49 . Osteoblasts from GPR91 −/− or WT mice were separated in a serum-free medium, and cell numbers were adjusted to 2 x 10 5 . The down chamber was occupied by 600 µl of complete medium containing 20% fetal calf serum. After a day of incubation at around 37°C, nonmigrating cells were taken from the filter surface using cotton gauze. The drifted cells were fixed with 4% paraformaldehyde solution and then tarnished with 0.2% crystal violet solution (Service bio, G1014, China) for 10 min. The cells are then counted under the microscope. Wound healing migration assay 4×10 6 Osteoblasts from GPR91 −/− or WT mice were plated into six-plates and cultured overnight. Linear scratches were prepared within the cell layer with the tip of a 200 µl pipetting tip when growth had reached 80% confluence; the cells were incubated with serum-free DMEM after being cleaned three times with PBS. The wound healing of cells in each group was photographed at 4× magnification after 0, 24, and 48 h of culture. Furthermore, the images were analyzed using Image J software, and the wound healing was compared at the exact location at different time points. Western blot analysis The western blot method described earlier was used 11 . Cell lysis was performed by applying ice-cold RIPA buffer (Beyotime Biotechnology, China). Following cell lysis, the protein amount was quantified by a nanodrop from Thermo Fisher Scientific, USA. Proteins splited by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) using the China Smart-Lifesciences system were drawn onto a polyvinylidene difluoride membrane from Millipore in the United States and then blocked with QuickBlock™ blocking buffer feeding through sealed China Beyotime Liquid. The membrane was blocked with 5% bovine albumin and then incubated with primary antibodies: OSX (1:1000; A18699, ABclonal, China), RUNX2 (1:1000; D1L7F, CST, Germany), OPN (1:1000; A21084, ABclonal, China), GPR91 (1:1000, orb157370, Biorbyt, China), RANKL (1:1000, 23408-1-AP, PTG, China), OPG (1:1000, DF6824, Affinity, China), TRAP (1:1000; A0962, ABclonal, China), MMP9 (1:1000; A11147, ABclonal, China), CCL2 (1:1000; A23288, ABclonal, China), P38 (1:1000; 8690, CST, Germany), p-P38 (1:1000; 4511, CST, Germany), JNK (1:1000; 9252, CST, Germany), p-JNK (1:1000; 4668, CST, Germany), p-P65 (1:1000, 93H1, CST, Germany), ERK (1:1000, GB11560, Servicebio, China), p-ERK (1:1000, AF1015, Affinity, China), β-actin (1:1000; 66009-l-lg, Proteintech, China ). Followed by secondary antibodies (Thermo Fisher Scientific, USA). Protein bands were detected with ImageQuant LAS 4000. Statistical analysis The Shapiro-Wilk test was used to show the normality and the homogeneity of variants using the F test. Analysis of variance (ANOVA) and Dunnett's multiple comparisons for post hoc analysis analyzed experimental data. Two data sets were analyzed in different groups using a student's t-test, where a probability < 0.05 was considered significant. Results are expressed as mean ± SEM and analyzed using GraphPad Prism software (9.00). Declarations Disclosure of interest Each author has read and passed the final version and reached an agreement to ensure all features of the work are accurate. Date available statement The datasets used and/or analyzed during the current study are available from the corresponding author upon reasonable request. Author Contribution Wenqi Su: Methodology; data curation; formal analysis; investigation; writing – original draft. Dandan Zhang: Methodology; validation. Yujia Wang: Methodology; software. Lang Lei: Writing – review and editing; supervision. Houxuan Li: Conceptualization; writing – review and editing; funding acquisition; methodology; supervision. Acknowledgements This research was partly supported by the National Natural Science Foundation of China (No. 82371007) and the Postgraduate Research & Practice Innovation Program of Jiangsu Province (KYCX23_0196). Data Availability The datasets used and/or analyzed during the current study are available from the corresponding author upon reasonable request. References Bhuyan R, Bhuyan SK, Mohanty JN, Das S, Juliana N, Juliana IF. Periodontitis and Its Inflammatory Changes Linked to Various Systemic Diseases: A Review of Its Underlying Mechanisms. Biomedicines. 2022. 10(10): 2659. Zhou M, Graves DT. Impact of the host response and osteoblast lineage cells on periodontal disease. Front Immunol. 2022. 13: 998244. Omi M, Mishina Y. Roles of osteoclasts in alveolar bone remodeling. Genesis. 2022. 60(8-9): e23490. Hienz SA, Paliwal S, Ivanovski S. Mechanisms of Bone Resorption in Periodontitis. J Immunol Res. 2015. 2015: 615486. Bostanci N, Belibasakis GN. Porphyromonas gingivalis: an invasive and evasive opportunistic oral pathogen. FEMS Microbiol Lett. 2012. 333(1): 1-9. Lunar Silva I, Cascales E. Molecular Strategies Underlying Porphyromonas gingivalis Virulence. J Mol Biol. 2021. 433(7): 166836. Cong S, Peng Q, Cao L, et al. Diosgenin prevents periodontitis by inhibiting inflammation and promoting osteogenic differentiation. Oral Dis. 2023 . Zhang JR, Pang DD, Tong Q, Liu X, Su DF, Dai SM. Different Modulatory Effects of IL-17, IL-22, and IL-23 on Osteoblast Differentiation. Mediators Inflamm. 2017. 2017: 5950395. Guo C, Yuan L, Wang JG, et al. Lipopolysaccharide (LPS) induces the apoptosis and inhibits osteoblast differentiation through JNK pathway in MC3T3-E1 cells. Inflammation. 2014. 37(2): 621-31. Yu Y, Jiang L, Li J, Lei L, Li H. Hexokinase 2-mediated glycolysis promotes receptor activator of NF-κB ligand expression in Porphyromonas gingivalis lipopolysaccharide-treated osteoblasts. J Periodontol. 2022. 93(7): 1036-1047. Su W, Shi J, Zhao Y, Yan F, Lei L, Li H. Porphyromonas gingivalis triggers inflammatory responses in periodontal ligament cells by succinate-succinate dehydrogenase-HIF-1α axis. Biochem Biophys Res Commun. 2020. 522(1): 184-190. Guo Y, Xie C, Li X, et al. Succinate and its G-protein-coupled receptor stimulates osteoclastogenesis. Nat Commun. 2017. 8: 15621. Wettschureck N, Offermanns S. Mammalian G proteins and their cell type specific functions. Physiol Rev. 2005. 85(4): 1159-204. Li T, Hu J, Du S, Chen Y, Wang S, Wu Q. ERK1/2/COX-2/PGE2 signaling pathway mediates GPR91-dependent VEGF release in streptozotocin-induced diabetes. Mol Vis. 2014. 20: 1109-21. Hu J, Li T, Du X, Wu Q, Le YZ. G protein-coupled receptor 91 signaling in diabetic retinopathy and hypoxic retinal diseases. Vision Res. 2017. 139: 59-64. Rubić-Schneider T, Carballido-Perrig N, Regairaz C, et al. GPR91 deficiency exacerbates allergic contact dermatitis while reducing arthritic disease in mice. Allergy. 2017. 72(3): 444-452. Guo Y, Xu F, Thomas SC, et al. Targeting the succinate receptor effectively inhibits periodontitis. Cell Rep. 2022. 40(12): 111389. Thiel A, Reumann MK, Boskey A, Wischmann J, von Eisenhart-Rothe R, Mayer-Kuckuk P. Osteoblast migration in vertebrate bone. Biol Rev Camb Philos Soc. 2018. 93(1): 350-363. Krzak G, Willis CM, Smith JA, Pluchino S, Peruzzotti-Jametti L. Succinate Receptor 1: An Emerging Regulator of Myeloid Cell Function in Inflammation. Trends Immunol. 2021. 42(1): 45-58. Byrne SJ, Dashper SG, Darby IB, Adams GG, Hoffmann B, Reynolds EC. Progression of chronic periodontitis can be predicted by the levels of Porphyromonas gingivalis and Treponema denticola in subgingival plaque. Oral Microbiol Immunol. 2009. 24(6): 469-77. Loomer PM, Sigusch B, Sukhu B, Ellen RP, Tenenbaum HC. Direct effects of metabolic products and sonicated extracts of Porphyromonas gingivalis 2561 on osteogenesis in vitro. Infect Immun. 1994. 62(4): 1289-97. Kim CS, Choi SH, Choi BK, et al. The effect of recombinant human bone morphogenetic protein-4 on the osteoblastic differentiation of mouse calvarial cells affected by Porphyromonas gingivalis. J Periodontol. 2002. 73(10): 1126-32. Azuma H, Kido J, Ikedo D, Kataoka M, Nagata T. Substance P enhances the inhibition of osteoblastic cell differentiation induced by lipopolysaccharide from Porphyromonas gingivalis. J Periodontol. 2004. 75(7): 974-81. Kato T, Tsuda T, Inaba H, et al. Porphyromonas gingivalis gingipains cause G(1) arrest in osteoblastic/stromal cells. Oral Microbiol Immunol. 2008. 23(2): 158-64. Kang MS, Moon JH, Park SC, Jang YP, Choung SY. Spirulina maxima reduces inflammation and alveolar bone loss in Porphyromonas gingivalis-induced periodontitis. Phytomedicine. 2021. 81: 153420. Zhang W, Ju J, Rigney T, Tribble G. Porphyromonas gingivalis infection increases osteoclastic bone resorption and osteoblastic bone formation in a periodontitis mouse model. BMC Oral Health. 2014. 14: 89. Shiau HJ, Aichelmann-Reidy ME, Reynolds MA. Influence of sex steroids on inflammation and bone metabolism. Periodontol 2000. 2014. 64(1): 81-94. Shiau HJ, Reynolds MA. Sex differences in destructive periodontal disease: a systematic review. J Periodontol. 2010. 81(10): 1379-89. Rubic T, Lametschwandtner G, Jost S, et al. Triggering the succinate receptor GPR91 on dendritic cells enhances immunity. Nat Immunol. 2008. 9(11): 1261-9. Peruzzi B, Cappariello A, Del Fattore A, Rucci N, De Benedetti F, Teti A. c-Src and IL-6 inhibit osteoblast differentiation and integrate IGFBP5 signalling. Nat Commun. 2012. 3: 630. Komori T. Regulation of bone development and extracellular matrix protein genes by RUNX2. Cell Tissue Res. 2010. 339(1): 189-95. Lee M, Arikawa K, Nagahama F. Micromolar Levels of Sodium Fluoride Promote Osteoblast Differentiation Through Runx2 Signaling. Biol Trace Elem Res. 2017. 178(2): 283-291. Kusuyama J, Amir MS, Albertson BG, et al. JNK inactivation suppresses osteogenic differentiation, but robustly induces osteopontin expression in osteoblasts through the induction of inhibitor of DNA binding 4 (Id4). FASEB J. 2019. 33(6): 7331-7347. Fakhry M, Hamade E, Badran B, Buchet R, Magne D. Molecular mechanisms of mesenchymal stem cell differentiation towards osteoblasts. World J Stem Cells. 2013. 5(4): 136-48. AlQranei MS, Senbanjo LT, Aljohani H, Hamza T, Chellaiah MA. Lipopolysaccharide- TLR-4 Axis regulates Osteoclastogenesis independent of RANKL/RANK signaling. BMC Immunol. 2021. 22(1): 23. Okahashi N, Inaba H, Nakagawa I, et al. Porphyromonas gingivalis induces receptor activator of NF-kappaB ligand expression in osteoblasts through the activator protein 1 pathway. Infect Immun. 2004. 72(3): 1706-14. Kong YY, Yoshida H, Sarosi I, et al. OPGL is a key regulator of osteoclastogenesis, lymphocyte development and lymph-node organogenesis. Nature. 1999. 397(6717): 315-23. Yun HM, Kim B, Park JE, Park KR. Trifloroside Induces Bioactive Effects on Differentiation, Adhesion, Migration, and Mineralization in Pre-Osteoblast MC3T3E-1 Cells. Cells. 2022. 11(23): 3887. Mao H, Yang A, Zhao Y, Lei L, Li H. Succinate Supplement Elicited "Pseudohypoxia" Condition to Promote Proliferation, Migration, and Osteogenesis of Periodontal Ligament Cells. Stem Cells Int. 2020. 2020: 2016809. Bartlett JD, Smith CE. Modulation of cell-cell junctional complexes by matrix metalloproteinases. J Dent Res. 2013. 92(1): 10-7. Duncan HF, Smith AJ, Fleming GJ, et al. The Histone-Deacetylase-Inhibitor Suberoylanilide Hydroxamic Acid Promotes Dental Pulp Repair Mechanisms Through Modulation of Matrix Metalloproteinase-13 Activity. J Cell Physiol. 2016. 231(4): 798-816. Deng G, Zhou F, Wu Z, et al. Inhibition of cancer cell migration with CuS@ mSiO(2)-PEG nanoparticles by repressing MMP-2/MMP-9 expression. Int J Nanomedicine. 2018. 13: 103-116. Ko SH, Choi GE, Oh JY, et al. Succinate promotes stem cell migration through the GPR91-dependent regulation of DRP1-mediated mitochondrial fission. Sci Rep. 2017. 7(1): 12582. Hah YS, Kang HG, Cho HY, et al. JNK signaling plays an important role in the effects of TNF-α and IL-1β on in vitro osteoblastic differentiation of cultured human periosteal-derived cells. Mol Biol Rep. 2013. 40(8): 4869-81. Rodríguez-Carballo E, Gámez B, Ventura F. p38 MAPK Signaling in Osteoblast Differentiation. Front Cell Dev Biol. 2016. 4: 40. Kim JM, Yang YS, Park KH, Oh H, Greenblatt MB, Shim JH. The ERK MAPK Pathway Is Essential for Skeletal Development and Homeostasis. Int J Mol Sci. 2019. 20(8): 1803. Greenblatt MB, Shim JH, Glimcher LH. Mitogen-activated protein kinase pathways in osteoblasts. Annu Rev Cell Dev Biol. 2013. 29: 63-79. Atallah R, Olschewski A, Heinemann A. Succinate at the Crossroad of Metabolism and Angiogenesis: Roles of SDH, HIF1α and SUCNR1. Biomedicines. 2022. 10(12). Yang Y, Huang Y, Liu H, Zheng Y, Jia L, Li W. Compressive force regulates cementoblast migration via downregulation of autophagy. J Periodontol. 2021. 92(11): 128-138. Additional Declarations No competing interests reported. Supplementary Files SupplementalInformationS1.pdf Cite Share Download PDF Status: Published Journal Publication published 11 Nov, 2024 Read the published version in Scientific Reports → Version 1 posted Editorial decision: Revision requested 23 Sep, 2024 Reviews received at journal 18 Sep, 2024 Reviews received at journal 18 Sep, 2024 Reviewers agreed at journal 08 Sep, 2024 Reviewers agreed at journal 08 Sep, 2024 Reviewers invited by journal 08 Sep, 2024 Editor assigned by journal 06 Sep, 2024 Editor invited by journal 03 Sep, 2024 Submission checks completed at journal 30 Aug, 2024 First submitted to journal 27 Aug, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4983726","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":358134394,"identity":"c939c839-d257-4c9a-832f-e80b062b6b0f","order_by":0,"name":"Wenqi Su","email":"","orcid":"","institution":"Nanjing Stomatological Hospital, Nanjing University","correspondingAuthor":false,"prefix":"","firstName":"Wenqi","middleName":"","lastName":"Su","suffix":""},{"id":358134395,"identity":"677f32fe-fb27-42b0-84a7-4825216e2b13","order_by":1,"name":"Dandan Zhang","email":"","orcid":"","institution":"Nanjing Stomatological Hospital, Nanjing University","correspondingAuthor":false,"prefix":"","firstName":"Dandan","middleName":"","lastName":"Zhang","suffix":""},{"id":358134396,"identity":"5747c113-c286-4871-af70-c2d9d292ab18","order_by":2,"name":"Yujia Wang","email":"","orcid":"","institution":"Nanjing Stomatological Hospital, Nanjing University","correspondingAuthor":false,"prefix":"","firstName":"Yujia","middleName":"","lastName":"Wang","suffix":""},{"id":358134397,"identity":"401467ae-fac8-405f-94ed-39951ca32322","order_by":3,"name":"Lang Lei","email":"","orcid":"","institution":"Nanjing Stomatological Hospital, Nanjing University","correspondingAuthor":false,"prefix":"","firstName":"Lang","middleName":"","lastName":"Lei","suffix":""},{"id":358134398,"identity":"0f134b23-05ae-46bf-b7c6-46c311bdf469","order_by":4,"name":"Houxuan Li","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA+UlEQVRIie3QMUvEMBTA8VcOekuuXQMV+xUaAjrciX6UVwrtJN7Y8URIFz/ADYefIZNw2ytZA66CS6HgJtzYSTzxFBwudnTIf0mG94O8APh8/7Bowg63eFX0A/DTcNqQk4Q/hNOrBFjIiFl0E/gmkHcJQJk/8KvMTaaztp8pk56DQbkEUykOCEP96HhYVEhmjdjeKezXYK5VckvBvX1x7XKWsNoEmixm7JOcEE4C9RfJzKWmmx3fkyrkmI0gtck1ISYMShxDpNjYqtDPVIo1LITaf3Lr2iWOreje1PxCP62Kbgc8TZum7Yb6OPld8P510sh5n8/n8x3pAy14UryeGT1EAAAAAElFTkSuQmCC","orcid":"","institution":"Nanjing Stomatological Hospital, Nanjing University","correspondingAuthor":true,"prefix":"","firstName":"Houxuan","middleName":"","lastName":"Li","suffix":""}],"badges":[],"createdAt":"2024-08-27 10:30:12","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4983726/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4983726/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41598-024-78944-9","type":"published","date":"2024-11-11T15:57:19+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":65595268,"identity":"658dcabd-3364-47b4-a009-42f3dfac44aa","added_by":"auto","created_at":"2024-09-30 10:52:50","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":12541454,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eP. gingivalis\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e infection promoted GPR91 expression with inhibited mineralization in osteoblasts.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eOsteoblasts were cultured with different multiplicity of infections (MOIs) of \u003cem\u003eP. gingivalis\u003c/em\u003e, and the expressions of OSX, RUNX2, OPN and IL-6 were detected by real-time PCR for 24 h (A) and western blotting after 48 h stimulation (B). ALP staining (C) was performed at 7 days, and ARS (D) was performed at 14 days after being stimulated with \u003cem\u003eP. gingivalis\u003c/em\u003e at a MOI of 50. Expressions of mineralization-related markers and GPR91 in osteoblasts cementogenic-differentiated at 0, 4, and 7 days were examined by qPCR (E) and western blotting (F). In all cases, bars in graphs represent mean ± SEM. β-actin was adopted as an internal reference. *, \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05; **,\u003cem\u003e p\u003c/em\u003e\u0026lt; 0.01 compared with the control.\u003c/p\u003e","description":"","filename":"figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-4983726/v1/694e8886dbdb18e0b897cfb6.png"},{"id":65596031,"identity":"3452dbb7-447d-41b0-b6df-b470446dc136","added_by":"auto","created_at":"2024-09-30 11:00:50","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":21691971,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eBlocking GPR91 mitigated the bone mineralization inhibited by \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eP.gingivalis.\u003c/strong\u003e\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eCCK8 examined the activity of osteoblasts treated with 4C at different concentrations (A). Osteoblasts were pretreated with 4C (5 μM) for 2 h and then treated with P. gingivalis at a MOI of 50. Gene transcript levels of OSX, RUNX2 and OPN were analyzed by real-time PCR at 24 h (B) and protein levels were detected by western blotting after 48 h stimulation (C). ALP staining and ALP activity assay at 7 days (D) and ARS at 14 days (E) of osteoblasts treated with \u003cem\u003eP. gingivalis\u003c/em\u003e at a MOI of 50.In all cases, bars in graphs represent mean ± SEM. β-actin was adopted as an internal reference. *, p \u0026lt; 0.05; **, p \u0026lt; 0.01 compared with the control; #, p \u0026lt; 0.05; ##, p \u0026lt; 0.01 compared with the P. gingivalis-treated group.\u003c/p\u003e","description":"","filename":"figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-4983726/v1/99168275c35127c71dff08bf.png"},{"id":65596030,"identity":"2f2ed2fd-a6cf-4ff8-a9d0-ea868bcd6158","added_by":"auto","created_at":"2024-09-30 11:00:50","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":20224758,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGPR91 knockdown mitigated the bone mineralization inhibited by \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eP.gingivalis\u003c/strong\u003e\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eOsteoblasts from WT\u003csup\u003e \u003c/sup\u003eand GPR91\u003csup\u003e-/-\u003c/sup\u003e mice were stimulated with P. gingivalis (MOI =50). Gene transcript levels of OSX, RUNX2 and OPN were analyzed by real-time PCR for 24 h (A), and protein levels were detected by western blotting after 48 h stimulation (B). ALP staining and ALP activity assay at 7 days (C) and ARS at 14 days (D) of osteoblasts treated with \u003cem\u003eP. gingivalis\u003c/em\u003e at a MOI of 50. In all cases, bars in graphs represent mean ± SEM. β-actin was adopted as an internal reference. *, p \u0026lt; 0.05; **, p \u0026lt; 0.01 compared with the WT group; #, p \u0026lt; 0.05; ##, p \u0026lt; 0.01 compared with the WT+P. g-treated group.\u0026nbsp;\u003c/p\u003e","description":"","filename":"figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-4983726/v1/9ba6c8bc88c964b249fe5d18.png"},{"id":65595266,"identity":"ee54d590-f54b-4453-83aa-9532b89e9012","added_by":"auto","created_at":"2024-09-30 10:52:50","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":29190336,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eConditioned medium from GPR91-knockdown osteoblasts inhibited Osteoclastogenesis.\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eOsteoblasts from WT\u003csup\u003e \u003c/sup\u003eand GPR91\u003csup\u003e-/-\u003c/sup\u003e mice were stimulated with P. gingivalis (MOI =50) for 24 h or 48 h. Gene transcript levels of RANKL and OPG were analyzed by real-time PCR (A), and protein levels were detected using western blotting (B). The mice BMMs were treated with the CM of osteoblasts from WT and GPR91\u003csup\u003e-/- \u003c/sup\u003emice stimulated by P. gingivalis (MOI =50) for 24 h. (C) After 3 days of culture, the relative mRNA expression of osteoclast markers in osteoclasts was detected by real-time PCR. (D) After 5 days of culture, the formation of osteoclasts was analyzed by Trap staining, and the number of osteoclasts was counted as Trap positive multinucleated cells. (E) Trap protein levels in differentiated BMMs were detected after culture for 3 days. In all cases, bars in graphs represent mean ± SEM. β-actin was adopted as an internal reference. *, p \u0026lt; 0.05; **, p \u0026lt; 0.01 compared with the WT group; #, p \u0026lt; 0.05; ##, p \u0026lt; 0.01 compared with the WT+P. g-treated group.\u003c/p\u003e","description":"","filename":"figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-4983726/v1/ce7b89ec69670119251c1ea8.png"},{"id":65596621,"identity":"7703707f-faf8-43b3-bf49-b4dce8a59d25","added_by":"auto","created_at":"2024-09-30 11:08:50","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":1771911,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eInvolvements of GPR91 in \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eP. gingivalis\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e-induced osteoblasts migration.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eOsteoblasts from WT\u003csup\u003e \u003c/sup\u003eand GPR91\u003csup\u003e-/-\u003c/sup\u003e mice were stimulated with P. gingivalis (MOI =50) for 24 h and inoculated in 6-well culture plates and the upper compartment of a 24-well trans-well culture chamber. (A) Wound healing migration test. The wound surface was recorded with a microscope immediately after scratching (0 h) and migrated for 24 and 48 h. (B)Transwell migration test. After 24 h, the cell migration was observed with a microscope. Scale = 100 μm. Osteoblasts from WT\u003csup\u003e \u003c/sup\u003eand GPR91\u003csup\u003e-/-\u003c/sup\u003e mice were stimulated with P. gingivalis (MOI =50) for 4 h or 24 h. Gene transcript levels of MMP2, MMP9 and CCL2 were analyzed by real-time PCR (C) and protein levels were detected by western blotting (D). In all cases, bars in graphs represent mean ± SEM.*, p \u0026lt; 0.05; **, p \u0026lt; 0.01 compared with the WT+P—g-treated group.\u003c/p\u003e","description":"","filename":"figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-4983726/v1/61f6ec255967fa86f00be83b.png"},{"id":65595263,"identity":"9f24724a-a6d6-4c15-a787-3f683bd71fe5","added_by":"auto","created_at":"2024-09-30 10:52:50","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":9178523,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGPR91-NFκB signalling pathway was involved in the mineralization of osteoblasts under inflammation.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e(A)\u003cstrong\u003e \u003c/strong\u003eOsteoblasts from WT\u003csup\u003e \u003c/sup\u003emice were treated with P. gingivalis (MOI =50) for 1 h and harvested for western blotting to reveal the phosphorylation of NF-κB and MAPK pathways. Osteoblasts were pretreated with SCH772984 (ERK inhibitor, 500 nM) and SC75741 (P65 inhibitor, 5 μM) and then treated with P. gingivalis (MOI =50) for 48 h. Protein levels of OSX, RUNX2, OPN and GPR91 were detected by western blotting (B\u0026amp;C). In all cases, bars in graphs represent mean ± SEM. *, p \u0026lt; 0.05; **, p \u0026lt; 0.01 compared with the WT group; #, p \u0026lt; 0.05; ##, p \u0026lt; 0.01 compared with the WT+P. g-treated group.\u003c/p\u003e","description":"","filename":"figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-4983726/v1/a8892b130ba8ddea8edaaebc.png"},{"id":65595267,"identity":"3f317926-54be-414e-ac87-c33e00f3d4bb","added_by":"auto","created_at":"2024-09-30 10:52:50","extension":"pdf","order_by":9,"title":"","display":"","copyAsset":false,"role":"supplement","size":2782571,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementalInformationS1.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4983726/v1/968e64cf14b9e7a0feff8694.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"G protein-coupled receptor 91 activations suppressed mineralization in Porphyromonas gingivalis–infected osteoblasts","fulltext":[{"header":"Introduction","content":"\u003cp\u003eChronic periodontal disease is an inflamed disease tied to destroying tooth-support tissue. The critical factor of this disease pathogen is an imbalance between the parasitic flora and the host's defence system\u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e. Anaerobic bacteria affect healthy tissues, resulting in increased inflammatory cells, the degradation of collagen fibers, and the alveolar bone deteriorates\u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e. The alveolar bone continuously changes, balancing bone homeostasis between wound healing and bone loss\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e. The immune system in the area that has been attacked by periodontal disease disrupts the ratio between bone formation and resorption, ultimately causing bone loss\u003csup\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003e \u003cem\u003ePorphyromonas gingivalis\u003c/em\u003e (\u003cem\u003eP. gingivalis\u003c/em\u003e) is a Gram-negative anaerobic pigmented coccobacillus and grows well in an anaerobe state, establishing colonies in the periodontal pockets. It also penetrates deeply into tissues and bone tissue\u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e. \u003cem\u003eP. gingivalis\u003c/em\u003e can produce many virulent factors, such as lipopolysaccharide (LPS), hemagglutinin, and gingipain\u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e. LPS acts upon the immune system and intensifies the creation of pro-inflammatory molecules, for instance, the tumour necrosis factor (TNF)-α, and interleukin (IL)-6. It can also interfere with the formation of osteoblasts, perhaps leading to depreciation in the mass of periodontal disease tissues\u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e. Osteoblasts are mostly specialized bone-forming cells that play an essential function in the metabolism of alveolar bone. The most probable reason for the deplorable degradation of alveolar bone, a hallmark characteristic of periodontitis, is the excessive activity of osteoclast precursors and an increasing population of mature osteoclasts\u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e. Alveolar bone destruction due to bone resorption can further involve abnormalities in the development of bones\u003csup\u003e\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003e. Differentiation of osteoblast lineages may be inhibited in an inflammatory environment.\u003c/p\u003e \u003cp\u003eThe inflammatory environment most likely leads to inhibition of differentiation the osteoblast lineage. In such a context, LPS from \u003cem\u003eP. gingivalis\u003c/em\u003e caused a shift in the metabolism of osteoblasts from an oxidative phosphorylation mode into a glycolytic mode, with the consequence of RANKL secretion\u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e. Proportions of \u003cem\u003eP. gingivalis\u003c/em\u003e within periodontal ligament cells led to an entirely different type of inflammation and increased overproduction of a TCA metabolic intermediate-succinate\u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e. Guo et al. have presented evidence that when high glucose conditions were combined with succinate, the expression of the succinate receptor 1 (SUCNR1) was activated, which promoted osteoclast formation and permitted osteoclastogenesis\u003csup\u003e\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e. SUCNR1 is the value of the G protein-coupled receptors (GPCRs) superfamily and is also termed GPR91. Ligand binding initiates signalling molecules that act through several signalling pathways involving a conformational change in the receptor with their subsequent interaction with G protein partners, leading to biological responses like migration, proliferation, and cell division\u003csup\u003e\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eSeveral authors have reported that ligands would activate GPR91 through a mechanism that kicks off a coordination compound signal transduction cascade, leading to a high regulation within inflammatory markers. New research proved that diabetic rats with decreased GPR91 have lower expression of PTGS2 and prostaglandin E2 (PGE2) level\u003csup\u003e\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e. Research showed an interrelation between GPR91 and hypoxic retinal vascular disease\u003csup\u003e\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u003c/sup\u003e. The disease of arthritis in GPR91 knockout mice is reduced in the animal model of rheumatoid arthritis of bone\u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e. In various types of inflammatory disease, dysregulation of GPR91 occurs. Previous studies have demonstrated that GPR91 antagonizing agents, when applied directly to the affected region, lower the process of inflammatory signalling and osteoclast formation within living organisms\u003csup\u003e\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u003c/sup\u003e. However, the result of GPR91 within the mineralization of osteoblasts in an inflammatory environment has rarely been studied. Therefore, this work aimed at the role of GPR91 in the process of \u003cem\u003eP. gingivalis\u003c/em\u003e stimulation of osteoblast calcification.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eP. gingivalis\u003c/b\u003e \u003cb\u003einfection promoted GPR91 expression with inhibited mineralization in osteoblasts.\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTo know the effect of \u003cem\u003eP. gingivalis\u003c/em\u003e on osteoblasts, cells were treated with different concentrations of \u003cem\u003eP. gingivalis\u003c/em\u003e at the multiplicity of infection (MOI) levels of 10, 50, and 250 for 24 h. The pro-inflammatory cytokine IL-6 levels increased progressively at a high MOI. In contrast, the gene transcription of osteogenic-related genes Osterix (OSX), runt-associated transcription factor (RUNX) 2, and osteopontin (OPN) reduced (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). The protein expression of osteogenesis-related components consistently showed a decrease, as assessed by Western blot analysis at the two-day time point (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB and Supplemental Information S1). Considering the outcomes presented above, \u003cem\u003eP. gingivalis\u003c/em\u003e with a MOI of 50 was chosen for further investigations. Similarly, the ALP staining performed at seven days (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC) and the ARS staining performed at 14 days (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD) provided evidence of the diminished mineralization capacity of osteoblasts that \u003cem\u003eP.gingivalis\u003c/em\u003e induced.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe link between minerality-related markers and GPR91 was found to be inverted. Consequently, cells were once again stimulated for different durations. The results demonstrated a positive correlation between the duration of induction and upregulation for OSX, RUNX2, and OPN, as indicated by the data presented in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE\u0026amp;F and Supplemental Information S1. However, GPR91 was once again found to be downregulated (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE).\u003c/p\u003e \u003cp\u003e \u003cb\u003eBlocking GPR91 alleviated the inhibitory effect of\u003c/b\u003e \u003cb\u003eP. gingivalis\u003c/b\u003e \u003cb\u003eon mineralization of osteoblasts\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTo ascertain the function of GPR91 in osteoblast mineralization, in vitro tests were conducted using 4C, a selective inhibitor of GPR91, in conjunction with osteoblasts obtained from GPR91\u003csup\u003e-/-\u003c/sup\u003e mice. Following pre-treatment with different dosages of 4C in a controlled laboratory setting, we assessed cellular activity using the Cell Counting Kit 8 (CCK8) after administering 4C to minimize any disruption caused by the chemical medication. The ideal concentration of 5 \u0026micro;M was chosen based on the drug's impact on cell activity and its ability to inhibit GPR91 (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). Before \u003cem\u003eP. gingivalis\u003c/em\u003e stimulation, we subjected osteoblasts obtained from WT mice to a 2 h pre-treatment with 4C. This resulted in a noticeable elevation in OSX, RUNX2, and OPN after 24 h (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). Additionally, protein expression of osteogenic genes was evaluated 2 days later using Western blotting. Under inflammatory conditions, the mineralization ability of osteoblasts was greatly boosted by inhibiting GPR91 (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC and Supplemental Information S1). The identical outcome was observed through alkaline phosphatase (ALP) staining after seven days (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD) and alizarin red S (ARS) staining after 14 days (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo give additional proof of inhibitory control for GPR91 activity, qPCR and western blot analyses were performed on a ton of mineralization-related markers in osteoblasts induced by \u003cem\u003eP. gingivalis\u003c/em\u003e. These analyses were undertaken on WT mice and animals lacking the GPR91 gene (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA\u0026amp;B and Supplemental Information S1). Osteoblasts derived from GPR91\u003csup\u003e,-/-\u003c/sup\u003e mice, exhibit enhanced mineralization capacity. The results were additionally validated using ALP staining after seven days (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC) and ARS staining after 14 days (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e\n\u003ch3\u003eGPR91 promotes osteoclast differentiation under inflammatory conditions\u003c/h3\u003e\n\u003cp\u003eTo determine whether GPR91 affects osteogenic mineralization and osteoclast formation, we exposed cells from WT and GPR91\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice to \u003cem\u003eP. gingivalis\u003c/em\u003e, collected conditioned media from these osteoblasts, and then treated osteoclast precursors with the conditional media (CM) obtained from the WT and GPR91\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e osteoblasts. After 24 h of culture, RANKL expression in the \u003cem\u003eP. gingivalis\u003c/em\u003e-treated GPR91\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e osteoblasts was lower (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA\u0026amp;B and Supplemental Information S1). Significantly, the mRNA appearance stages of osteoclast marker genes were markedly reduced on treatment with \u003cem\u003eP. gingivalis\u003c/em\u003e-treated GPR91\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice osteoblastic CM, such as tartrate-resistant proton donor phosphatase (\u003cem\u003eTRAP\u003c/em\u003e), \u003cem\u003eNfatc1, CTSK, c-Fos\u003c/em\u003e, and \u003cem\u003eCar2\u003c/em\u003e, in osteoclast precursors isolated from mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). Furthermore, the number of osteoclasts formed by CM from \u003cem\u003eP. gingivalis\u003c/em\u003e-treated GPR91\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003eosteoblasts was the lowest among those induced by CM from \u003cem\u003eP. gingivalis\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). A higher level of TRAP protein expression was additionally shown in the osteoclast precursors in the conditioned medium originating from infected GPR91\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e osteoblasts, as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE and Supplemental Information S1.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eGPR91 partially enhances osteoblast migration\u003c/h2\u003e \u003cp\u003eOsteoblast surface receptors facilitate cell attachment and polarization, leading to the activation of osteoblast migration\u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e. G protein-mediated signalling is essential for transmitting information across membranes. It enables the recognition of external signals and their coupling with internal cellular information\u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e. WT and GPR91\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e osteoblasts were exposed to \u003cem\u003eP. gingivalis\u003c/em\u003e for 24 h and then placed in 6-well plates, or coupled with a 24-well transwell culture chamber in the upper compartment. The measurement revealed a noticeable difference in the healed/damaged area ratio between osteoblasts from GPR91\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice and osteoblasts from WT mice, with the value being lower in the former (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). Once again, the Transwell studies demonstrate that osteoblasts derived from WT mice exhibit a higher level of migration after 24 h, as depicted in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB. Upon further analysis, a significant depreciation in matrix metalloproteinases (MMP)2, MMP9, and chemokine ligand (CCL)2 transcription levels in osteoblasts from GPR91\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice was observed compared to those from WT mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). This finding was corroborated by the protein detection results obtained through western blotting (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD and Supplemental Information S1). It was indicated that GPR91 may be necessary for cell migration.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eP. gingivalis\u003c/b\u003e \u003cb\u003emediates GPR91 involvement in osteoblast mineralization through activation of NF-κB pathway\u003c/b\u003e\u003c/p\u003e \u003cp\u003eWe examined four signaling pathways to elucidate the potential mechanism underlying GPR91-facilitated osteoblast mineralization. Western blotting indicated that p-ERK1/2/total-ERK1/2 and p-P65/total-P65 was upregulated due to treatment with \u003cem\u003eP. gingivalis\u003c/em\u003e, along with p-p38/total-p38 and p-JNK/ total-JNK, which is not obvious (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA and Supplemental Information S1).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eWe further pretreated these osteoblasts with specific inhibitors of the ERK1/2 pathway, SCH772984, and P65 pathway inhibitor, SC75741. Data showed that inhibition of the ERK pathway increased the expression of OPN. However, it failed to reverse the expression levels of OSX and RUNX2, and it was not that effective in inhibiting the expression of GPR91 (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB and Supplemental Information S1). Apart from this, inhibition of the P65 pathway not only prevented the overexpression of GPR91 but also enhanced the process of mineralization by \u003cem\u003eP. gingivalis\u003c/em\u003e. This enhancement was confirmed by a decreased OSX, RUNX2, and OPN expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC and Supplemental Information S1). GPR91 regulates the process of mineralization by osteoblasts through the P65 signaling pathway.\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe accumulation of bacteria such as \u003cem\u003eP. gingivalis\u003c/em\u003e, \u003cem\u003eTannobacteria forsythiae\u003c/em\u003e, and \u003cem\u003eTreponemas\u003c/em\u003e around the teeth degenerates the alveolar bone\u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e. \u003cem\u003eP. gingivalis\u003c/em\u003e is a main bacteria that plays an important role in the aetiology of periodontal diseases. There is ample evidence that many \u003cem\u003eP. gingivalis\u003c/em\u003e strains inhibit osteoblasts and thus delay alveolar bone growth. Studies have shown that LPS, lipids, metabolites, and ultrasound extracts from \u003cem\u003eP. gingivalis\u003c/em\u003e slow down osteoblast differentiation and osteogenesis\u003csup\u003e\u003cspan additionalcitationids=\"CR22 CR23\" citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e. Consequently, it was of great significance that the animal model of periodontitis induced by inoculation with live \u003cem\u003eP. gingivalis\u003c/em\u003e is similar to the human patient model\u003csup\u003e\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u003c/sup\u003e. This confirms that \u003cem\u003eP. gingivalis\u003c/em\u003e can enter infected cells (gingival epithelial cells, fibroblasts, osteoblasts, osteoblasts) at the infected site in a mouse model of periodontitis\u003csup\u003e\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/sup\u003e. This effect destroys osteoblasts and osteoclasts, inhibiting the osteoblast pool and causing bone loss. Taken together, the total bacteria treatment could fully reveal its functional advantages and simulate pathological processes in vivo. In this study, researchers used \u003cem\u003eP. gingivalis\u003c/em\u003e as a direct stimulant of osteoblasts rather than using its ingredients (such as LPS).\u003c/p\u003e \u003cp\u003eSex hormones exert pleiotropic effects on several tissues and organs, serving as the foundation for bone formation, homeostasis, and immunological function\u003csup\u003e\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e. The osteoblasts in our study were extracted from 3-day newborn male mice, and the effects of sex hormones might be minimal. Since large epidemiological studies have shown that after controlling for all major covariates, periodontal disease susceptibility and progression/severity are higher in men than in women\u003csup\u003e\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/sup\u003e, both male and female animals should be used to explore whether there is a sex difference in the effect of succinate-GPR91 axis, especially in further animal studies.\u003c/p\u003e \u003cp\u003eThe precise function of GPR91 in regulating periodontitis following succinate pre-treatment remains unknown despite its known ability to stimulate osteoclast production\u003csup\u003e\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e,\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u003c/sup\u003e. The impact of GPR91 on mineralization in inflammatory osteoblasts has not been studied. Experiments were conducted to investigate how GPR91 regulates mineralization in inflammatory osteoblasts generated by \u003cem\u003eP. gingivalis\u003c/em\u003e. IL-6, a cytokine with many effects, is widely recognized for its work in contributing to the production of osteoclasts and inhibiting the production of ALP and collagenase in osteoblasts\u003csup\u003e\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u003c/sup\u003e. Thus, we utilized IL-6 expression to analyze the creation of an inflammatory environment in vitro, which exhibited a positive correlation with the concentration of \u003cem\u003eP. gingivalis\u003c/em\u003e stimulation (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eA multitude of protein-protein interactions culminate in the activation of signalling molecules, forming a complex signalling network that regulates the crucial process of osteoblast development, which is essential for bone production. RUNX2 is expressed in preosteoblasts, immature osteoblasts, and precocious osteoblasts, and is crucial for controlling osteoblast variation and bone formation\u003csup\u003e\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e. RUNX2 differentiates several genes related to bone matrix proteins, including OPN and osteocalcin\u003csup\u003e\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u003c/sup\u003e. OPN is an extracellular matrix glycoprotein involved in bone remodelling and expressed preferentially in the intermediate phase of bone formation\u003csup\u003e\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u003c/sup\u003e. OSX is a zinc-finger-containing transcription factor and an essential player in osteoblastogenesis, and is a downstream target of RUNX2\u003csup\u003e34\u003c/sup\u003e. Consequently, our results indicated that with the progressive worsening of the inflammation induced by \u003cem\u003eP. gingivalis\u003c/em\u003e, the GPR91 expression upregulation was accompanied by a gradual downregulation of the expressions of OSX, RUNX2, and OPN simultaneously (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eWe, therefore, went on to complete experiments assessing the effects of GPR91-mediated signalling on osteoblast mineralization in an inflammatory environment by measuring the expression of OSX, RUNX2, and OPN using GPR91\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e osteoblasts treated with \u003cem\u003eP. gingivalis\u003c/em\u003e and WT osteoblasts following pre-treatment with 4C. On interruption of GPR91 signalling, the osteoblasts restored following exposure to \u003cem\u003eP. gingivalis\u003c/em\u003e had a moderate level of restored mineralization, which can be observed in Figs.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e and \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e. The development of chronic periodontitis involves the continuous breakdown and formation of alveolar bone, which is influenced by the ratio of RANKL to OPG. A high RANKL/OPG ratio leads to the active breakdown of alveolar bone\u003csup\u003e\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u003c/sup\u003e. Prior research has shown that live \u003cem\u003eP. gingivalis\u003c/em\u003e is a powerful trigger for the osteoblasts to produce RANKL\u003csup\u003e\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u003c/sup\u003e. RANKL is a cytokine that promotes the formation of osteoclasts, which are cells accountable for reducing tissue of the bone\u003csup\u003e\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u003c/sup\u003e. Osteoblasts regulate the production of osteoclasts in normal bone tissue by producing two opposing factors, RANKL and OPG. The equilibrium between RANKL and OPG is crucial in determining the bone density in the alveolar bone. The results of our investigation demonstrated that the increase in RANKL expression in osteoblasts produced by \u003cem\u003eP. gingivalis\u003c/em\u003e is reduced when GPR91 is absent, as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA\u0026amp;B. In addition, the liquid portion of the osteoblast culture was used to treat osteoclast precursor cells. It was found that the culture medium from osteoblasts infected with bacteria and lacking the GPR91 gene supported a lower formation of osteoclasts from their precursors compared to the culture medium from normal osteoblasts infected with bacteria (see Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD\u0026amp;E).\u003c/p\u003e \u003cp\u003eThe migration and adhesion characteristics are strongly connected to the bone formation and regeneration process, which is mediated by osteoblasts\u003csup\u003e\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u003c/sup\u003e. Our previous research indicated that GPR91 might augment the migratory capacity of periodontal ligament fibroblasts under low oxygen conditions\u003csup\u003e\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e\u003c/sup\u003e. Observations of GPR91-deficient mice models revealed a notable suppression of dendritic cell secretion and migration\u003csup\u003e\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u003c/sup\u003e. MMP facilitate cellular migration in various tissues during developmental processes, such as wound healing and bone remodeling\u003csup\u003e\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e\u003c/sup\u003e. Suppressing MMP13 activity increased cell mineralization while decreasing cell migration\u003csup\u003e\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e\u003c/sup\u003e. MMP9 and MPP2 are well-established proteins linked to cell migration, and their decreased expression can significantly reduce the migration of cells\u003csup\u003e\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eCCL2 is a known chemoattractant that mediates migration, proliferation, and cancer cell invasion. CCL2 signalling has also been shown to stimulate Osteoclastogenesis. Moreover, the silencing of CCL2 also increased bone mineral density\u003csup\u003e\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e\u003c/sup\u003e. Interestingly, our results show that although GPR91 knockout can partially restore the mineralization ability of osteoblasts inhibited by \u003cem\u003eP. gingivalis\u003c/em\u003e, it inhibits the migration ability of osteoblasts and the expression of MMP2, MMP9, and CCL2 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). Ko SH et al. found that Succinate activated Gαq, Gαi and Gα12, and Gαq and Gα12 specifically participated in human marrow mesenchymal stem cells (hMSC) migration\u003csup\u003e\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e\u003c/sup\u003e. We hypothesized that when \u003cem\u003eP. gingivalis\u003c/em\u003e stimulate osteoblasts, it will cause intracellular succinate accumulation and Gαq and Gα12 are activated by succinic acid to participate in osteoblast migration.\u003c/p\u003e \u003cp\u003eThe osteogenic differentiation process has long been associated with the mitogen-activated (MAP) kinases pathway, which comprises the crucial ERK1/2, JNK, and p38\u003csup\u003e44\u0026ndash;46\u003c/sup\u003e. The ERK pathway is a member of the MAPK signalling pathways. Studies have shown that important signalling molecules that control osteoblast activity work by activating the ERK pathway\u003csup\u003e\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e\u003c/sup\u003e. The function of ERK in enhancing cell proliferation, augmenting RUNX2 transcriptional activity, and facilitating osteogenic diversity has been broadly acknowledged\u003csup\u003e\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e\u003c/sup\u003e. Activation of JNK is necessary for the development of human periosteal osteoblasts in an in vitro system\u003csup\u003e\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e\u003c/sup\u003e. High expression of SUCNR1 has been found to activate MAP kinases, specifically ERK 1/2, in several cellular models, such as HEK293 cells and immature dendritic cell models under in vitro conditions\u003csup\u003e\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eUpon stimulating with \u003cem\u003eP. gingivalis\u003c/em\u003e, we conducted a more in-depth analysis of the activation of MAPK and P65 pathways. Our findings indicate that the ERK and P65 pathways were activated compared to the control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA). Our research focused on examining the functions of the ERK and P65 pathways using inhibitors that specifically target ERK and P65, respectively. Inhibition of the P65 pathway increased the mineralization capacity of osteoblasts in an inflammatory environment and, and reduced the expression of GPR91(Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC). Succinate works by stimulating SUCNR1 to upregulate nuclear expressions of P65 and p50 in osteoclast cells\u003csup\u003e\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e. The effect promotes the release of RANKL and eventually leads to the formation of osteoclasts. We hypothesized that activation of the NF-κB pathway initiated by \u003cem\u003eP. gingivalis\u003c/em\u003e leads to the involvement of GPR91 in osteoblast mineralization and osteoclast development.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eActivation of GPR91 results in decreased mineralization and increased macrophage osteoclastogenesis in \u003cem\u003eP. gingivalis\u003c/em\u003e-infected osteoblasts. The outcomes suggest that GPR91 plays a central part in influencing osteoblast function, partly through the NF-κB signalling pathway. On the other hand, inhibiting osteoblast GPR91 would reduce the inhibitory effect of \u003cem\u003eP. gingivalis\u003c/em\u003e and provide a new way to repair and regenerate bone damaged by \u003cem\u003eP. gingivalis\u003c/em\u003e.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cp\u003eWe confirmed that all experiments in this study were performed in accordance with the relevant guidelines and regulations. All the procedure of the study is followed by the ARRIVE guidelines. The Ethical Review Committee on Experimental Animal Welfare of Nanjing University (IACUC-D2202111) has accepted the protocol for the procedures.\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eOsteoblast isolation and culture\u003c/h2\u003e \u003cp\u003eOsteoblasts were separated from neonatal male GPR91\u003csup\u003e\u003cem\u003e\u0026minus;/\u003c/em\u003e\u0026minus;\u003c/sup\u003e and C57BL6/J WT mice (GemPharmatech Co. Ltd., Nanjing, China). The calvaria bones of neonatal mice were cut off and cultured by trypsin and collagenase digestion method as we described previously\u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e. Cells obtained from digestion were cultured at 37℃ in 5% CO2 in α-MEM with 10% fetal bovine serum (FBS), 100 mg/ml streptomycin, and 100 U/ml penicillin. Observe and follow up after approximately 3\u0026ndash;5 generations of culture once the cell density reaches 80%. Visible osteoblasts were observed one week after staining with the BCIP/NBT ALP color development kit (Beyotime, China). After 14 days of culture, calcium accumulation was assessed using alizarin red staining (Sigma-Aldrich, USA). To test whether osteoblasts could produce a mineralized matrix, cells were in a medium containing 10 mM β-glycerophosphate, 50 \u0026micro;M ascorbic acid, and 0.1 \u0026micro;M dexamethasone with α-MEM supplemented with 10% FBS. The osteogenic medium was changed daily.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eBacteria Culture and Drug Treatment\u003c/h3\u003e\n\u003cp\u003e \u003cem\u003eP. gingivalis\u003c/em\u003e (ATCC33277) developed in a Brain Heart Infusion (BHI) medium, adding 0.1% yeast extract, 1 \u0026micro;g/ml vitamin K1, and hemin of 5 \u0026micro;g/ml. The visual density for the bacterial spread out was estimated with a spectrophotometer around 600 nm. An OD of 1 corresponds to a concentration of 10\u003csup\u003e9\u003c/sup\u003e \u003cem\u003eP. gingivalis\u003c/em\u003e/ml.\u003c/p\u003e \u003cp\u003eOsteoblasts were infected with live \u003cem\u003eP. gingivalis\u003c/em\u003e at the MOI of 10, 50, and 250. The concentration of the inhibitor was 5 \u0026micro;M. The inhibitor used is 4C, which is a selective inhibitor for GPR91. The ERK inhibitor SCH772984 and the P65 inhibitor SC75741 are introduced at 500 nM and 5 \u0026micro;M, respectively. Additionally, osteoblasts were pretreated with the drug for 2 h before stimulation by \u003cem\u003eP. gingivalis\u003c/em\u003e.\u003c/p\u003e\n\u003ch3\u003eIsolation of RNA and quantitative PCR\u003c/h3\u003e\n\u003cp\u003eOsteoblasts to be lysed were treated with RNA extraction reagent ((Accurate Biology, China). A Nanodrop (Thermo Fisher Scientific, USA) calculated the total molarity of RNA. The PrimerScriptTM RT kit from Vazyme was used for reverse engineering. Real-time PCR of the reverse-engineered samples was done by employing SYBR Green Master MIX (Vazyme, China). The qPCR primers were then synthesized using PrimerBank's design code (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://pga.mgh.harvard.edu/primerbank/\u003c/span\u003e\u003cspan address=\"https://pga.mgh.harvard.edu/primerbank/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). The pattern of primers used is shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. Relative quantification was achieved using the comparative 2\u003csup\u003e\u0026minus;△△\u003c/sup\u003eCt method.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe primer sequences used for real-time qPCR\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGenes\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequence(5'-3')\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSequence(3'-5')\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGPR91 (mouse)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTTGTGAGAATTGGTTGGCAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCATCTCCATAGGTCCCCTTATCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOSX (mouse)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTTCCCAATCCTATTTGCCGTTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCGGCCAGGTTACTAACACCAATCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRUNX2 (mouse)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCATTTGCACTGGGTCACACGTA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGAATCTGGCCATGTTTGTGCTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOPN (mouse)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGATGATGATGACGATGGAGACC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCGACTGTAGGGACGATTGGAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-6(mouse)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGTTGCCTTCTTGGGACTGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCCACGATTTCCCAGAGAAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRANKL (mouse)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGCCGAGACTACGGCAAGTA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAAAGTACAGGAACAGAGCGATG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOPG(mouse)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACCCAGAAACTGGTCATCAGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTGCAATACACACACTCATCACT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTRAP(mouse)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGTGAGGGAGGAGGCGTCTGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCGTTCCCAAGAAAGCTCTACC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNFATc1(mouse)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCGTCACATTCTGGTCCATAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCAATGAACAGCTGTAGCGTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCtsk(mouse)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGTGTCCATCGATGCAAGCTTGGCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCTCTCTCCCCAGCTGTTTTTAAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ec-Fos(mouse)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCGGGTTTCAACGCCGACTA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTGGCACTAGAGACGGACAGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCar2(mouse)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCCCACCACTGGGGATACAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTCTTGGACGCAGCTTTATCATA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMMP2 (mouse)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCGATGTCGCCCCTAAAACAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCATGGTCTCGATGGTGTTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMMP9 (mouse)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGAGACGCCACGCATTTCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTTACGGCCTGAGGGTCTTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCCl2 (mouse)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAACTGCATCTGCCCTAAGGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGCATCACAGTCCGAGTCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eβ-actin (mouse)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGGTCGGTGTGAACGGATTTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGTAGACCATGTAGTTGAGGTCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eAlkaline phosphatase (ALP) activity and staining\u003c/h2\u003e \u003cp\u003eThe ALP staining procedure was done with a BCIP/NBT Staining Kit (Beyotime, China). The cells were stimulated to undergo osteogenic differentiation and treated with 4% paraformaldehyde for 30 min on the 7 days. Subsequently, they were placed in a BCIP/NBT staining solution for a suitable duration under dark conditions. The ALP activity testing was conducted using the ALP activity assay kit (Beyotime, China) following the methods provided by the producer.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eAlizarin red S (ARS) staining\u003c/h2\u003e \u003cp\u003eThe cells were incubated within osteogenic medium for 14 days, then treated with 4 percentage paraformaldehyde for 30 min to fix them. Subsequently, the cells were stained with ARS for a further 30 min. The development of mineralized nodules by the osteoblasts was evaluated using ARS staining. The calculation of absorbance at a wavelength around 405 nm was recorded, and the ARS standard curve was applied to determine the ARS amount.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eOsteoclast genesis by the conditioned medium from osteoblasts\u003c/h2\u003e \u003cp\u003eSimilarly, osteoblasts obtained from the tibia of GPR91\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e and WT mice were cultured for 24 h in the availability or negativity of \u003cem\u003eP. gingivalis\u003c/em\u003e. Then, the medium of osteoblasts as a CM was collected to generate osteoclasts. Bone marrow cells from 6-week-old mice (GemPharmatech Co. Ltd., Nanjing, China) was cultured for 3\u0026ndash;5 days in RPMI 1640 medium supplemented with 30% L929 cell supernatant to promote the growth of macrophages adherent to the culture surface. Mix fresh 1640 complete medium with CM of GPR91\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e or WT osteoblasts at a ratio of 1:1. Additionally, 20 ng/mL M-CSF (RP01216, ABclonal, China) and 50 ng/mL RANKL (RP00745, ABclonal, China) were added. They were then stained using a TRAP kit as instructed by the producer. The identification process involves counting the presence of three or more nuclei in a cell. Osteoclasts were counted as TRAP\u003csup\u003e+\u003c/sup\u003e multinucleated osteoclast precursors, and images were recorded using an inverted microscope (Nikon, Japan).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eTrans well migration assay\u003c/h2\u003e \u003cp\u003eTrans well migration assay was done following the procedure described by Yang et al\u003csup\u003e\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e\u003c/sup\u003e. Osteoblasts from GPR91\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e or WT mice were separated in a serum-free medium, and cell numbers were adjusted to 2 x 10\u003csup\u003e5\u003c/sup\u003e. The down chamber was occupied by 600 \u0026micro;l of complete medium containing 20% fetal calf serum. After a day of incubation at around 37\u0026deg;C, nonmigrating cells were taken from the filter surface using cotton gauze. The drifted cells were fixed with 4% paraformaldehyde solution and then tarnished with 0.2% crystal violet solution (Service bio, G1014, China) for 10 min. The cells are then counted under the microscope.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eWound healing migration assay\u003c/h2\u003e \u003cp\u003e4\u0026times;10\u003csup\u003e6\u003c/sup\u003e Osteoblasts from GPR91\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003eor WT mice were plated into six-plates and cultured overnight. Linear scratches were prepared within the cell layer with the tip of a 200 \u0026micro;l pipetting tip when growth had reached 80% confluence; the cells were incubated with serum-free DMEM after being cleaned three times with PBS. The wound healing of cells in each group was photographed at 4\u0026times; magnification after 0, 24, and 48 h of culture. Furthermore, the images were analyzed using Image J software, and the wound healing was compared at the exact location at different time points.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eWestern blot analysis\u003c/h2\u003e \u003cp\u003eThe western blot method described earlier was used\u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e. Cell lysis was performed by applying ice-cold RIPA buffer (Beyotime Biotechnology, China). Following cell lysis, the protein amount was quantified by a nanodrop from Thermo Fisher Scientific, USA. Proteins splited by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) using the China Smart-Lifesciences system were drawn onto a polyvinylidene difluoride membrane from Millipore in the United States and then blocked with QuickBlock\u0026trade; blocking buffer feeding through sealed China Beyotime Liquid. The membrane was blocked with 5% bovine albumin and then incubated with primary antibodies: OSX (1:1000; A18699, ABclonal, China), RUNX2 (1:1000; D1L7F, CST, Germany), OPN (1:1000; A21084, ABclonal, China), GPR91 (1:1000, orb157370, Biorbyt, China), RANKL (1:1000, 23408-1-AP, PTG, China), OPG (1:1000, DF6824, Affinity, China), TRAP (1:1000; A0962, ABclonal, China), MMP9 (1:1000; A11147, ABclonal, China), CCL2 (1:1000; A23288, ABclonal, China), P38 (1:1000; 8690, CST, Germany), p-P38 (1:1000; 4511, CST, Germany), JNK (1:1000; 9252, CST, Germany), p-JNK (1:1000; 4668, CST, Germany), p-P65 (1:1000, 93H1, CST, Germany), ERK (1:1000, GB11560, Servicebio, China), p-ERK (1:1000, AF1015, Affinity, China), β-actin (1:1000; 66009-l-lg, Proteintech, China ). Followed by secondary antibodies (Thermo Fisher Scientific, USA). Protein bands were detected with ImageQuant LAS 4000.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eThe Shapiro-Wilk test was used to show the normality and the homogeneity of variants using the F test. Analysis of variance (ANOVA) and Dunnett's multiple comparisons for post hoc analysis analyzed experimental data. Two data sets were analyzed in different groups using a student's t-test, where a probability\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered significant. Results are expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM and analyzed using GraphPad Prism software (9.00).\u003c/p\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003ch2\u003eDisclosure of interest\u003c/h2\u003e \u003cp\u003eEach author has read and passed the final version and reached an agreement to ensure all features of the work are accurate.\u003c/p\u003e \u003c/p\u003e\u003cp\u003e \u003ch2\u003eDate available statement\u003c/h2\u003e \u003cp\u003eThe datasets used and/or analyzed during the current study are available from the corresponding author upon reasonable request.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eWenqi Su: Methodology; data curation; formal analysis; investigation; writing \u0026ndash; original draft. Dandan Zhang: Methodology; validation. Yujia Wang: Methodology; software. Lang Lei: Writing \u0026ndash; review and editing; supervision. Houxuan Li: Conceptualization; writing \u0026ndash; review and editing; funding acquisition; methodology; supervision.\u003c/p\u003e\u003ch2\u003eAcknowledgements\u003c/h2\u003e \u003cp\u003eThis research was partly supported by the National Natural Science Foundation of China (No. 82371007) and the Postgraduate Research \u0026amp; Practice Innovation Program of Jiangsu Province (KYCX23_0196).\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eThe datasets used and/or analyzed during the current study are available from the corresponding author upon reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eBhuyan R, Bhuyan SK, Mohanty JN, Das S, Juliana N, Juliana IF. Periodontitis and Its Inflammatory Changes Linked to Various Systemic Diseases: A Review of Its Underlying Mechanisms. Biomedicines. 2022. 10(10): 2659.\u003c/li\u003e\n\u003cli\u003eZhou M, Graves DT. Impact of the host response and osteoblast lineage cells on periodontal disease. Front Immunol. 2022. 13: 998244.\u003c/li\u003e\n\u003cli\u003eOmi M, Mishina Y. Roles of osteoclasts in alveolar bone remodeling. Genesis. 2022. 60(8-9): e23490.\u003c/li\u003e\n\u003cli\u003eHienz SA, Paliwal S, Ivanovski S. Mechanisms of Bone Resorption in Periodontitis. J Immunol Res. 2015. 2015: 615486.\u003c/li\u003e\n\u003cli\u003eBostanci N, Belibasakis GN. Porphyromonas gingivalis: an invasive and evasive opportunistic oral pathogen. FEMS Microbiol Lett. 2012. 333(1): 1-9.\u003c/li\u003e\n\u003cli\u003eLunar Silva I, Cascales E. Molecular Strategies Underlying Porphyromonas gingivalis Virulence. J Mol Biol. 2021. 433(7): 166836.\u003c/li\u003e\n\u003cli\u003eCong S, Peng Q, Cao L, et al. Diosgenin prevents periodontitis by inhibiting inflammation and promoting osteogenic differentiation. Oral Dis. 2023 .\u003c/li\u003e\n\u003cli\u003eZhang JR, Pang DD, Tong Q, Liu X, Su DF, Dai SM. Different Modulatory Effects of IL-17, IL-22, and IL-23 on Osteoblast Differentiation. Mediators Inflamm. 2017. 2017: 5950395.\u003c/li\u003e\n\u003cli\u003eGuo C, Yuan L, Wang JG, et al. Lipopolysaccharide (LPS) induces the apoptosis and inhibits osteoblast differentiation through JNK pathway in MC3T3-E1 cells. Inflammation. 2014. 37(2): 621-31.\u003c/li\u003e\n\u003cli\u003eYu Y, Jiang L, Li J, Lei L, Li H. Hexokinase 2-mediated glycolysis promotes receptor activator of NF-\u0026kappa;B ligand expression in Porphyromonas gingivalis lipopolysaccharide-treated osteoblasts. J Periodontol. 2022. 93(7): 1036-1047.\u003c/li\u003e\n\u003cli\u003eSu W, Shi J, Zhao Y, Yan F, Lei L, Li H. Porphyromonas gingivalis triggers inflammatory responses in periodontal ligament cells by succinate-succinate dehydrogenase-HIF-1\u0026alpha; axis. Biochem Biophys Res Commun. 2020. 522(1): 184-190.\u003c/li\u003e\n\u003cli\u003eGuo Y, Xie C, Li X, et al. Succinate and its G-protein-coupled receptor stimulates osteoclastogenesis. Nat Commun. 2017. 8: 15621.\u003c/li\u003e\n\u003cli\u003eWettschureck N, Offermanns S. Mammalian G proteins and their cell type specific functions. Physiol Rev. 2005. 85(4): 1159-204.\u003c/li\u003e\n\u003cli\u003eLi T, Hu J, Du S, Chen Y, Wang S, Wu Q. ERK1/2/COX-2/PGE2 signaling pathway mediates GPR91-dependent VEGF release in streptozotocin-induced diabetes. Mol Vis. 2014. 20: 1109-21.\u003c/li\u003e\n\u003cli\u003eHu J, Li T, Du X, Wu Q, Le YZ. G protein-coupled receptor 91 signaling in diabetic retinopathy and hypoxic retinal diseases. Vision Res. 2017. 139: 59-64.\u003c/li\u003e\n\u003cli\u003eRubić-Schneider T, Carballido-Perrig N, Regairaz C, et al. GPR91 deficiency exacerbates allergic contact dermatitis while reducing arthritic disease in mice. Allergy. 2017. 72(3): 444-452.\u003c/li\u003e\n\u003cli\u003eGuo Y, Xu F, Thomas SC, et al. Targeting the succinate receptor effectively inhibits periodontitis. Cell Rep. 2022. 40(12): 111389.\u003c/li\u003e\n\u003cli\u003eThiel A, Reumann MK, Boskey A, Wischmann J, von Eisenhart-Rothe R, Mayer-Kuckuk P. Osteoblast migration in vertebrate bone. Biol Rev Camb Philos Soc. 2018. 93(1): 350-363.\u003c/li\u003e\n\u003cli\u003eKrzak G, Willis CM, Smith JA, Pluchino S, Peruzzotti-Jametti L. Succinate Receptor 1: An Emerging Regulator of Myeloid Cell Function in Inflammation. Trends Immunol. 2021. 42(1): 45-58.\u003c/li\u003e\n\u003cli\u003eByrne SJ, Dashper SG, Darby IB, Adams GG, Hoffmann B, Reynolds EC. Progression of chronic periodontitis can be predicted by the levels of Porphyromonas gingivalis and Treponema denticola in subgingival plaque. Oral Microbiol Immunol. 2009. 24(6): 469-77.\u003c/li\u003e\n\u003cli\u003eLoomer PM, Sigusch B, Sukhu B, Ellen RP, Tenenbaum HC. Direct effects of metabolic products and sonicated extracts of Porphyromonas gingivalis 2561 on osteogenesis in vitro. Infect Immun. 1994. 62(4): 1289-97.\u003c/li\u003e\n\u003cli\u003eKim CS, Choi SH, Choi BK, et al. The effect of recombinant human bone morphogenetic protein-4 on the osteoblastic differentiation of mouse calvarial cells affected by Porphyromonas gingivalis. J Periodontol. 2002. 73(10): 1126-32.\u003c/li\u003e\n\u003cli\u003eAzuma H, Kido J, Ikedo D, Kataoka M, Nagata T. Substance P enhances the inhibition of osteoblastic cell differentiation induced by lipopolysaccharide from Porphyromonas gingivalis. J Periodontol. 2004. 75(7): 974-81.\u003c/li\u003e\n\u003cli\u003eKato T, Tsuda T, Inaba H, et al. Porphyromonas gingivalis gingipains cause G(1) arrest in osteoblastic/stromal cells. Oral Microbiol Immunol. 2008. 23(2): 158-64.\u003c/li\u003e\n\u003cli\u003eKang MS, Moon JH, Park SC, Jang YP, Choung SY. Spirulina maxima reduces inflammation and alveolar bone loss in Porphyromonas gingivalis-induced periodontitis. Phytomedicine. 2021. 81: 153420.\u003c/li\u003e\n\u003cli\u003eZhang W, Ju J, Rigney T, Tribble G. Porphyromonas gingivalis infection increases osteoclastic bone resorption and osteoblastic bone formation in a periodontitis mouse model. BMC Oral Health. 2014. 14: 89.\u003c/li\u003e\n\u003cli\u003eShiau HJ, Aichelmann-Reidy ME, Reynolds MA. Influence of sex steroids on inflammation and bone metabolism. Periodontol 2000. 2014. 64(1): 81-94.\u003c/li\u003e\n\u003cli\u003eShiau HJ, Reynolds MA. Sex differences in destructive periodontal disease: a systematic review. J Periodontol. 2010. 81(10): 1379-89.\u003c/li\u003e\n\u003cli\u003eRubic T, Lametschwandtner G, Jost S, et al. Triggering the succinate receptor GPR91 on dendritic cells enhances immunity. Nat Immunol. 2008. 9(11): 1261-9.\u003c/li\u003e\n\u003cli\u003ePeruzzi B, Cappariello A, Del Fattore A, Rucci N, De Benedetti F, Teti A. c-Src and IL-6 inhibit osteoblast differentiation and integrate IGFBP5 signalling. Nat Commun. 2012. 3: 630.\u003c/li\u003e\n\u003cli\u003eKomori T. Regulation of bone development and extracellular matrix protein genes by RUNX2. Cell Tissue Res. 2010. 339(1): 189-95.\u003c/li\u003e\n\u003cli\u003eLee M, Arikawa K, Nagahama F. Micromolar Levels of Sodium Fluoride Promote Osteoblast Differentiation Through Runx2 Signaling. Biol Trace Elem Res. 2017. 178(2): 283-291.\u003c/li\u003e\n\u003cli\u003eKusuyama J, Amir MS, Albertson BG, et al. JNK inactivation suppresses osteogenic differentiation, but robustly induces osteopontin expression in osteoblasts through the induction of inhibitor of DNA binding 4 (Id4). FASEB J. 2019. 33(6): 7331-7347.\u003c/li\u003e\n\u003cli\u003eFakhry M, Hamade E, Badran B, Buchet R, Magne D. Molecular mechanisms of mesenchymal stem cell differentiation towards osteoblasts. World J Stem Cells. 2013. 5(4): 136-48.\u003c/li\u003e\n\u003cli\u003eAlQranei MS, Senbanjo LT, Aljohani H, Hamza T, Chellaiah MA. Lipopolysaccharide- TLR-4 Axis regulates Osteoclastogenesis independent of RANKL/RANK signaling. BMC Immunol. 2021. 22(1): 23.\u003c/li\u003e\n\u003cli\u003eOkahashi N, Inaba H, Nakagawa I, et al. Porphyromonas gingivalis induces receptor activator of NF-kappaB ligand expression in osteoblasts through the activator protein 1 pathway. Infect Immun. 2004. 72(3): 1706-14.\u003c/li\u003e\n\u003cli\u003eKong YY, Yoshida H, Sarosi I, et al. OPGL is a key regulator of osteoclastogenesis, lymphocyte development and lymph-node organogenesis. Nature. 1999. 397(6717): 315-23.\u003c/li\u003e\n\u003cli\u003eYun HM, Kim B, Park JE, Park KR. Trifloroside Induces Bioactive Effects on Differentiation, Adhesion, Migration, and Mineralization in Pre-Osteoblast MC3T3E-1 Cells. Cells. 2022. 11(23): 3887.\u003c/li\u003e\n\u003cli\u003eMao H, Yang A, Zhao Y, Lei L, Li H. Succinate Supplement Elicited \u0026quot;Pseudohypoxia\u0026quot; Condition to Promote Proliferation, Migration, and Osteogenesis of Periodontal Ligament Cells. Stem Cells Int. 2020. 2020: 2016809.\u003c/li\u003e\n\u003cli\u003eBartlett JD, Smith CE. Modulation of cell-cell junctional complexes by matrix metalloproteinases. J Dent Res. 2013. 92(1): 10-7.\u003c/li\u003e\n\u003cli\u003eDuncan HF, Smith AJ, Fleming GJ, et al. The Histone-Deacetylase-Inhibitor Suberoylanilide Hydroxamic Acid Promotes Dental Pulp Repair Mechanisms Through Modulation of Matrix Metalloproteinase-13 Activity. J Cell Physiol. 2016. 231(4): 798-816.\u003c/li\u003e\n\u003cli\u003eDeng G, Zhou F, Wu Z, et al. Inhibition of cancer cell migration with CuS@ mSiO(2)-PEG nanoparticles by repressing MMP-2/MMP-9 expression. Int J Nanomedicine. 2018. 13: 103-116.\u003c/li\u003e\n\u003cli\u003eKo SH, Choi GE, Oh JY, et al. Succinate promotes stem cell migration through the GPR91-dependent regulation of DRP1-mediated mitochondrial fission. Sci Rep. 2017. 7(1): 12582.\u003c/li\u003e\n\u003cli\u003eHah YS, Kang HG, Cho HY, et al. JNK signaling plays an important role in the effects of TNF-\u0026alpha; and IL-1\u0026beta; on in vitro osteoblastic differentiation of cultured human periosteal-derived cells. Mol Biol Rep. 2013. 40(8): 4869-81.\u003c/li\u003e\n\u003cli\u003eRodr\u0026iacute;guez-Carballo E, G\u0026aacute;mez B, Ventura F. p38 MAPK Signaling in Osteoblast Differentiation. Front Cell Dev Biol. 2016. 4: 40.\u003c/li\u003e\n\u003cli\u003eKim JM, Yang YS, Park KH, Oh H, Greenblatt MB, Shim JH. The ERK MAPK Pathway Is Essential for Skeletal Development and Homeostasis. Int J Mol Sci. 2019. 20(8): 1803.\u003c/li\u003e\n\u003cli\u003eGreenblatt MB, Shim JH, Glimcher LH. Mitogen-activated protein kinase pathways in osteoblasts. Annu Rev Cell Dev Biol. 2013. 29: 63-79.\u003c/li\u003e\n\u003cli\u003eAtallah R, Olschewski A, Heinemann A. Succinate at the Crossroad of Metabolism and Angiogenesis: Roles of SDH, HIF1\u0026alpha; and SUCNR1. Biomedicines. 2022. 10(12).\u003c/li\u003e\n\u003cli\u003eYang Y, Huang Y, Liu H, Zheng Y, Jia L, Li W. Compressive force regulates cementoblast migration via downregulation of autophagy. J Periodontol. 2021. 92(11): 128-138.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"GPR91, P. gingivalis, osteoblasts, NF-κB, mineralization","lastPublishedDoi":"10.21203/rs.3.rs-4983726/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4983726/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eSuccinate receptor GPR91 is one of the G protein-coupled receptors (GPCRs), which interact with a variety of proteins and signals to regulate different cellular functions such as cell morphology, apoptosis, and differentiation. This study aimed to investigate whether the GPR91-mediated signaling pathway affects mineralization in \u003cem\u003ePorphyromonas gingivalis\u003c/em\u003e (\u003cem\u003eP. gingivalis\u003c/em\u003e)-treated osteoblasts and to investigate its potential role in osteoclast differentiation. Utilizing primary mouse osteoblasts from wild-type (WT) and GPR91 knockout (GPR91\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e) mice infected with \u003cem\u003eP. gingivalis\u003c/em\u003e, we demonstrated that inhibition by 4C, a specific inhibitor, and knockout of GPR91 promoted migration and mineralization ability in \u003cem\u003eP. gingivalis\u003c/em\u003e-infected osteoblasts. Additionally, ranged with \u003cem\u003eP. gingivalis\u003c/em\u003e-infected WT osteoblasts, GPR91\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e osteoblasts had reduced RANKL production, and CM from bacteria-infected GPR91\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e osteoblasts had reduced formation of osteoclast precursors. Moreover, \u003cem\u003eP. gingivalis\u003c/em\u003e mediates GPR91 involvement in osteoblast mineralization by activating the NF-κB pathway. These findings suggest that GPR91 activation reduces mineralization of \u003cem\u003eP. gingivalis\u003c/em\u003e-infected osteoblasts and promoted osteoclastogenesis from macrophages. Targeting GPR91 may help reduce the loss of alveolar bone during bacterial infection.\u003c/p\u003e","manuscriptTitle":"G protein-coupled receptor 91 activations suppressed mineralization in Porphyromonas gingivalis–infected osteoblasts","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-09-30 10:52:44","doi":"10.21203/rs.3.rs-4983726/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-09-23T20:03:11+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-09-19T03:42:19+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-09-18T16:51:40+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"306192604352107118107141426089106819415","date":"2024-09-08T14:15:00+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"55903886159856054927579479833766228571","date":"2024-09-08T11:42:11+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-09-08T09:20:41+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-09-07T02:12:13+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2024-09-03T06:39:01+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-08-30T08:46:48+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2024-08-27T10:28:50+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"f9af0b5a-0226-486c-9c4c-2007985884a2","owner":[],"postedDate":"September 30th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":38102170,"name":"Biological sciences/Cell biology"},{"id":38102171,"name":"Biological sciences/Microbiology"},{"id":38102172,"name":"Health sciences/Medical research"}],"tags":[],"updatedAt":"2024-11-18T16:00:57+00:00","versionOfRecord":{"articleIdentity":"rs-4983726","link":"https://doi.org/10.1038/s41598-024-78944-9","journal":{"identity":"scientific-reports","isVorOnly":false,"title":"Scientific Reports"},"publishedOn":"2024-11-11 15:57:19","publishedOnDateReadable":"November 11th, 2024"},"versionCreatedAt":"2024-09-30 10:52:44","video":"","vorDoi":"10.1038/s41598-024-78944-9","vorDoiUrl":"https://doi.org/10.1038/s41598-024-78944-9","workflowStages":[]},"version":"v1","identity":"rs-4983726","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4983726","identity":"rs-4983726","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}