The isoforms of c-MPL plays an instrumental role in regulating the severity of leukemic conditions

The isoforms of c-MPL plays an instrumental role in regulating the severity of leukemic conditions | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article The isoforms of c-MPL plays an instrumental role in regulating the severity of leukemic conditions Mohammad Amjad Hussain, Mithila Kulkarni, Suparna Laha This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7204532/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background: Acute myeloid leukemia (AML) is a hematopoietic defect and various clinical studies confirms that the development of this condition has a correlation with the hematopoietic receptor c-MPL. The function of MPL is mostly regulated by the crosstalk and stoichiometry of the different isoforms of c-MPL. Though expression of c-MPL in AML cases are studied, the regulation of the isoforms, their balance and mechanism of action in conditions like AML needs to be revealed, to develop c-MPL as a therapeutic target for AML cases. Through this work we have reconfirmed that c-MPL expression increases in AML, but the severity of the condition is independent of the total MPL expression. Methods: Molecular techniques like qRT-PCR, western blotting, immunophenotyping, and immunofluorescence were used to investigate the expression of c-MPL isoforms and their correlation with AML severity. The significance of the work depends on the statistical analysis of the experimental and technical triplicates. Conclusion: We have confirmed that the severity of the AML condition directly depends on the expression of MPL-FL isoform, more precisely, on the increase in the ration of MPL-FL/MPL-TR. Furthermore, we have observed that with increase in MPL-FL isoforms, inactive STAT5 converts to active pSTAT5 to promote the transition of HSC G0 state to HSC proliferative state to bring in the severity. Interpretation: Our study provides compelling evidence to establish the regulatory role of c-MPL isoforms, particularly MPL-FL in bringing in severity in AML conditions. This finding is a significant step towards developing c-MPL as a therapeutic target for AML cases. c-MPL AML STAT5 c-MPL isoforms Severity HSC Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 1. Introduction Acute Myeloid Leukaemia (AML) is a malignant neoplasm of immature bone marrow (BM)-derived myeloid cells exhibiting variable differentiation. It is a heterogeneous disorder characterised by the uncontrolled clonal proliferation of stem cell precursors of the myeloid lineage, i.e., red blood cells (RBCs), platelets, and white blood cells (WBCs), in addition to B and T lymphocytes in the marrow and the arrest of their maturation ( 1 ). It is one of the most common acute leukaemia in adults, accounting for almost 80% of cases ( 2 ). The thrombopoietin receptor, c-Myeloproliferative Leukaemia (c-MPL), is well known for its function in regulating hematopoiesis. It has well established role in maintaining hematopoietic stem cells (HSCs) and it is also the key cytokine regulating the production of platelets from megakaryocytes. c-MPL is the only known receptor for TPO. c-MPL activates various downstream signalling pathways, promoting cellular survival and proliferation ( 3 ). c-MPL is a member of the hematopoietic growth factor receptor superfamily which encodes the 635 amino acid protein c-MPL, containing a signal peptide domain, two extracellular cytokine receptor domains, a transmembrane domain and two intracellular cytokine receptor box motifs ( 4 ). Oncogenic activating mutations in the receptor c-MPL have been identified in myelofibrosis (MF) and essential thrombocythemia (ET) ( 5 , 6 ). Furthermore, functional abnormalities of c-MPL are associated with several hematological disorders, such as Thrombocytopenia Purpura (ITP), Myelodysplastic Syndrome (MDS), Myeloproliferative Neoplasm(MPN), Chronic Myeloid Leukaemia (CML), and AML ( 7 , 8 ). c-MPL mutations have been discovered in several MPNs, including Primary Myelofibrosis (PMF), Polycythaemia Vera (PV), and Essential thrombocythemia (ET) ( 9 ). In a study done by Wang et al., 2011, it was observed that in a cohort of 1509 AML patients, 19 tested positive, with c-MPL mutation accounting for 1.26% of overall mutations, primarily in intracellular and transmembrane areas ( 10 ). A more prevalent mutation, W515L/K, contributes to increased cell proliferation in AML. This mutation has been reported to be present in around 25% of AMKL cases, a subtype of AML ( 11 ). In addition, even in the absence of mutations, many AML patients express c-MPL, and the proliferation and survival of HSCs are enhanced in response to c-MPL. c-MPL and its receptor are essential for megakaryocyte development and maintaining hematopoietic stem cell function ( 12 ). The c-MPL/TPO pathway is a critical survival pathway for leukaemia patients. Additionally, patients with AML and different types of leukaemia (megakaryocytic and erythropoietic leukaemia) have increased c-MPL expression, which correlates with CD34 expression ( 13 , 14 ). In primary human AML samples, it was found that the c-MPL expression, especially in CD34 + patients, was significantly greater than that in normal donors (p < 0.05). Studies also confirm that, c-MPL over-expression is correlated with shorter and complete remission in patients with AML ( 15 ). These finding suggests the presence of a permanent and chemo-resistant population of leukaemia cells in relapse. These leukaemia stem cells (LSCs) are capable of propagating and self-renewing leukaemia cells. c-MPL is a candidate surface marker for LSCs. They are involved in maintaining the properties of LSCs. Furthermore, patients with c-MPL + LSCs have a worse prognosis and are resistant to conventional chemotherapies ( 14 ). The over-expression of MPL is also observed in patients with normal or unfavorable cytogenetics ( 15 ). Another study revealed that in the process of active Rac1-mediated leukaemia initiation and maintenance, the overexpression of c-MPL plays a vital role in the interaction of leukaemia cells with the bone marrow (BM) niche and contributes to quiescence and chemotherapy resistance in leukaemia cells ( 16 ). Therefore, there is a need to understand the mechanism underlying the severity developed by c-MPL isoforms in patients with AML. In this study we have observed that, it is actual the c-MPL -FL which is associated with the increased severity of the AML disease in invitro system. 2. Materials and Methods 2.1. Materials The cell lines used in the study were primarily taken from NCCS Pune, except the MRC-5 cell line, which was purchased from ATCC. The antibodies used in the study were sourced from various sources: MPL and Ki67 from Invitrogen, STAT, pSTAT and Caspase from Cell Signalling Technology (CST), and CD44 + from Abcam. The antibodies and their concentration used in the study have been mentioned in Table 1 . The cDNA synthesis kit and Syber Green were purchased from Takara. The DAPI used in Immunofluorescence, Propidium Iodide (PI) and RNase A, used in cell cycle analysis, were all purchased from Himedia. Table 1 List of Antibodies and their concentration mentioned in the paper. S. No Antibody Purpose Concentration Company Secondary Antibody concentration 1 c-MPL Western Blotting 1:1000 Invitrogen 1:2000 2 STAT Western Blotting 1:1000 CST 1:2000 3 p-STAT Western Blotting 1:1000 CST 1:2000 4 c-MPL Immunofluorescence 1:200 Invitrogen 1:250 5 c-MPL Immunophenotyping 1:200 Invitrogen 1:250 6 Caspase Immunophenotyping 1:200 CST 1:250 7 STAT Immunophenotyping 1:200 CST 1:250 8 p-STAT Immunophenotyping 1:200 CST 1:250 9 CD44 Immunophenotyping 1:100 Abcam Conjugated 10 Ki67 Immunophenotyping 1:200 Invitrogen 1:250 2.2. Cell culture The human AML cell lines at different FAB (French American and British classification system) stages like KG1 (M1), K562 (M6), HL60 (M2), and Jurkat (a T-lymphoma cell line) were cultured in RPMI-1680 supplemented with 10% FBS, 1 mM sodium pyruvate, and 50 IU/ml antibiotics/antimycotic and maintained at 37°C with 5% CO2. Normal lung fibroblast (MRC-5) cells were cultured in DMEM supplemented with 10% FBS, while the remaining components were the same and used as a negative control. All the experiments were performed after the cells reached 70–75% confluency. 2.3. Preparation of cell lysates and western blot analysis. The cells were treated under the appropriate conditions, quickly placed on ice, and washed with ice-cold PBS. After that, the cells were treated with RIPA lysis buffer (20 mM Tris HCl (pH 7.4), 150 mM NaCl, 5 mM EDTA, 1% Nonidet P-40, 1 mM Na 3 VO 4 ) supplemented with proteinase inhibitor ( 17 ). Sonication was performed for 3 min with 30 amps and a pulse of 10 sec on/off. Protein estimation was performed with Bradford’s reagent. 50 µg of protein was loaded for each cell line for β-actin, c-MPL, STAT, and pSTAT, and the results were analysed by a chemo gel doc system software. 2.4. RNA extraction and RT‒PCR RNA extraction was performed using the TRIzol chloroform method, which was then quantified by a micro-volume spectrometer ( 18 ). Reverse transcription for cDNA synthesis from 1 ug of total RNA was allowed to proceed at 37°C for 15 min and 85°C for 5 sec in a final volume of 20 µl. RT‒PCR of the cDNA (100 µg) was performed in a final volume of 10 µl containing 2X SYBR Green and 5 µM of forward and reverse primers for the c-MPL isoforms. For GAPDH, 10 µM primers were used. The primer sequences are provided in Table 2 . Table 2 List of Primers and their sequence mentioned in the paper. c-MPL -P (NM_005373) has been designed from exon 9 (forward) and 10 (reverse). The c-MPL-S has been designed from the exon 8–11 junction for forward and the exon 11 for reverse. GAPDH (NM_001256799) has been designed from exon 2 (forward) and exon 4 (reverse). Primers Position Sequence c-MPL-FL (MPL-P) Forward Primer 5' GCGATCTCGCTACCGTTTAC 3' Reverse Primer 5' AGGAAACTGCCACCTCAGC 3' c-MPL -TR (MPL-S) Forward Primer 5' AGGACTGGAAGGAGAC 3' Reverse Primer 5' TCAGGCTGCAGTGTCCTAAG 3' c-MPL -Total Forward Primer 5' GAGAAGCTTCAGCTCTGAC 3' Reverse Primer 5' CAAGTGCCACTGCATCTCCA 3' GAPDH Forward Primer 5’AGGGCTGCTTTTAACTCTGGT3’ Reverse Primer 5’TCCCTCCAAAATCAAGTGGGG3’ 2.5. Cell cycle analysis The cells were seeded overnight in a 60 mm dish. Then, 0.5 M cells/ml were collected in an Eppendorf tube and washed with PBS. The cells were then fixed in ethanol at -20°C for 1 hr. After washing with PBS, the cells were incubated in a DNA staining solution containing 0.5 mg/ml PI, 0.1% sodium citrate, 2% Triton X-100 and 2 mg/ml RNAase A, for 20 min in the dark ( 19 ). Cell cycle analysis was then performed using Guava flow cytometry (Merck, Millipore, FCS version 7.0). 2.6. Immunofluorescence. The expression of the cell surface marker c-MPL was analysed by an immunofluorescence assay with the following protocol: 0.5 M/ml cells were washed with PBS, then fixed with 4% PFA and incubated at RT in the dark for 20 min at 37°C. The supernatant was discarded after centrifugation, and the cells were then treated with a permeabilisation agent (0.1% Triton X-100 in 1X PBS) and incubated at RT for 15 min, followed by washing with PBS. Blocking was performed with 2% BSA in PBS for 1 hr. 1 o Ab incubation was performed in 0.1% BSA in 1X PBS overnight at 4°C. After washing, the cells were incubated with a fluorescent-tagged 2 o Ab in 1X PBS for 1 hr. The cells were then stained with DAPI after PBS wash and incubated at room temperature for 20 min. followed by mounting on a slide and visualisation via fluorescence microscopy. 2.7. Immunophenotyping. A total of 0.5 M cells were collected, washed with PBS followed by 15 min of incubation in FACS staining buffer. The supernatant was discarded after centrifugation, and the cells were then treated with a permeabilization agent (0.1% Triton X-100 in 1X PBS) and incubated at RT for 15 min, followed by washing with PBS. Blocking was performed with 2% BSA in PBS for 1 hr. The cells were then incubated in FACS buffer stain followed by incubation in 1 o Ab at 4°C overnight. Then, the cells were incubated with Alexa Flour 488, a fluorescent-tagged 2 o Ab for 1 hr at RT. The cells were then washed, and fresh FACS buffer was added to them. The data were acquired through Guava flow cytometry (Merck, Millipore, FCS version 7.0). 2.8. In-silico analysis of the correlation between c-MPL and AML with TCGA datasets. To analyse the c-MPL expression profile across different cancers and their normal counterparts, we curated a dataset which comprised 31 tumour types and normal tissues. This dataset contains data from 9496 tumour patients and 5540 normal samples; all downloaded from the Gene Expression Profiling Interactive Analysis (GEPIA) database ( 20 ). The expression levels of c-MPL are represented as the median of TPM (Transcripts Per Million), ensuring normalisation among the samples. Graphs were generated using GraphPad Prism Software. To specifically check the expression of c-MPL in different types of leukaemia, additional analysis was conducted by the Gene Expression across Normal and Tumour tissues 2 database (GENT2), which provides transcriptomics data comparing wide range of cancers, including leukaemia such as Acute Lymphoblastic Leukemia (ALL), Acute Myeloid Leukemia (AML) Chronic Lymphoblastic Leukemia (CLL), Chronic Myeloid leukemia (CML) ( 21 ). The normalised c-MPL expression data were extracted and then curated using GraphPad Prism Since there is a clinical importance of FAB classification in categorising AML based on morphology, and it is also used as a quick method for AML type identification, we incorporated FAB staging in our study ( 22 ). We used the TCGA-LAML cohort (n = 200) for analysis and retrieved the data from UCSC Xena-browser ( 23 ). This allowed us to examine the c-MPL expression across different FAB stages from M0-M7. The downloaded data was further curated using GraphPad Prism. To understand the cell proportion of different immune markers, and relative c-MPL expression on those immune cells in AML disease and normal blood, the data were retrieved from the GEPIA 2021 database which integrates RNA-seq data from TCGA and Genotype-Tissue Expression (GTEx) sets ( 24 ). This enables us to relate the immune cell proportion profile, such as T cells, B cells, NK cells, Macrophages, Dendritic cells, Mast cells, Eosinophils, with c-MPL expression in those particular immune cells in AML and normal blood. The retrieved data were then processed and curated using GraphPad Prism software. To check the impact of immune cell expression on survival probability in AML, we analysed both immune cells directly as well as with their specific markers. The Kaplan-Meier curve graph was downloaded using the GEPIA 2021 database to show the association of immune cell expression with survivability ( 24 ). In addition to this, we also selected specific surface markers of the immune cells to check survival probability in AML due to their expression; for instance, CD27 was used for B cell Memory, CD80 for M1 Macrophages, and CD69 for Eosinophils. We selected these markers based on the established studies, which have been validated as cell-specific markers for specific immune cells ( 25 , 26 ). For this, the expression data was retrieved from UCSC Xena Browser, specifically from the TCGA-LAML cohort ( 23 ). The data were analysed using GraphPad Prism to generate a Kaplan-Meier survival curve, allowing us to determine whether high or low expression is associated with overall survival in AML patients. 3. Results and discussion 3.1. c-MPL expression is significantly high in AML patient samples. c-MPL, a thrombopoietin receptor belongs to thecytokine receptor with versatile functions. It has an important role in hematopoiesis and megakaryocyte maturation.To understand the role of c-MPL in conditions like cancer, we first analysed c-MPL expression in normal and malignant tissues using the TCGA datasets from the GEPIA database. Our study included a total cohort of Tumor = 9496 and Normal = 5540 samples, comprising 31 different cancers and their normal types, for the c-MPL expression analysis. We found that the overall c-MPL expression was lower in most of the malignant tissue than in normal tissues (Fig. 1 A).However, in AML cases, it was comparatively higher in the case of the tumour compared to its normal counterpart (Fig. 1 B). This significant increase was exclusive to AML; as it did not appear in any other examined tumour types. Furthermore, our analysis demonstrated a substantial increase in c-MPL expression in AML compared to any other blood disorders like ALL, CLL or CML, highlighting its unique significance in the development of this malignancy (Fig. 1 C). Additionally, we also tried to investigated the expression levels of c-MPL in different AML stages and found that in the case of the M2 FAB stage, exhibited higher levels of c-MPL than in the other stages. This finding indicates that the M2 stage may be more severe and aggressive than the other stages, potentially driven by increased c-MPL expression(Fig. 1 D). These all results summarizes the pathogenic role of c-MPL in AML, particularly in M2 stage of FAB classification. 3.2. The immune cells overexpressed in severe AML conditions correlate with c-MPL. The population of immune cells is commonly altered in hematopoietic malignancies ( 27 ). To explore the immunological landscape associated with c-MPL expression in AML, wee the comprehensively investigated the immunological environment. In AML, the immunological micro-environment is characterised by complex interaction among various immune cells, including eosinophils, mast cells, macrophages, NK cells, T cells, plasma cells, monocytes and B cells. Our analysis revealed that some of the immune cells like M2 macrophage, plasma cells, eosinophil and monocytes were found to be significantly increased in AML micro-environment compared to the normal blood (Fig. 2 A). However, some immune molecules like mast cells, B cells, CD4 memory T-cells are present in significant high numbers in their resting, naive or inactive stage during AML condition (Fig. 2 A). Active immune cells like T-cells, active Mast cells, B cells and M2 macrophages, neutrophil and NK cells are found to be significantly low in population in AML condition compared to the normal blood micro-environment (Fig. 2 A). This data indicates that the immune micro-environment in AML is mostly inactive. A decreased number of active memory T-cells (Fig. 2 A) may not be able to recognise the tumour cells and eliminate them, resulting to growth of the tumor condition. Similarly, Dendritic cells are one of the most efficient APCs of the immune system, inducing and dispersing the primary response by the activity of naïve T cells ( 28 ). A lower population of active Dendritic cells along with reduced CD4 naive cells, may likely impair the immune activity against tumor, thereby increasing the severity of the AML condition (Fig. 2 A). Among the immune cells M2 macrophages were found to be more expressed and these cells are known to produce factors that support leukaemia cells' growth, survival, and resistance to chemotherapy ( 29 ). A significant increase in the M2 population along with decreased dendrtic cells T cells may further increase AML progression (Fig. 2 A). So, overall the compromised complex interaction of the immune molecules contributes towards the worsening of the disease progression. Few immune molecules have no significant differences in their population between the normal and AML micro-environment (supplementary Fig. 1). We further investigated the role of c-MPL in regulating these immune cells.. c-MPL is found to regulate expression and activation of T-cells ( 30 , 31 ) and activated c-MPL enhances anti-tumour activity and preserves a central memory phenotype ( 30 ). Morever, c-MPL is found to be present on the dendritic cells and is involved in the maturation and development of mast cells ( 32 , 33 ). c-MPL-TPO interaction plays a role in the growth regulation of B-precursor leukaemia cells ( 31 ). To explore these finding we further conducted an in-silico analysis of the c-MPL expression on the different immune cells in the AML microenvironment and compared it with normal blood cell data. We extracted relevant data from the GEPIA 2021 database through cybersort and analysed it to check for any correlation between c-MPL expression on immune cells and AML severity. Our findings revealed a strong correlation between the c-MPL expression and the immune cell population in AML condition, suggesting that c-MPL over expression may contribute to AML severity (Fig. 2 B). These all findings establish the role of c-MPL in regulating immune cell microenvironment regulation and leukemia progression, highlighting its potential as therapeutic target in AML. 3.3. The expression of immune cells correlates with the survival probability of AML patients. In the previous section, we confirmed the expression of immune cells in the AML microenvironment and their correlation with c-MPL (either positive or negative). To further investigate the prognostic implication, we assessed the patient’s overall survival with c-MPL-regulated immune cells to determine the correlation of c-MPL with disease severity (Fig. 3 ). The analysis of immune cell population with survival by the Kaplan-Meier curve reveals that certain cell types, like Eosinophils, their high population coupled with c-MPL overexpression led to the development of AML condition and a significant increase in severity as well suggesting that c-MPL overexpression might support leukemic microenvironment (Fig. 3 A). On the contrary, there are immune cell types like B-cell memory and M1 macrophage presents a different scenario; while they are highly populated with overexpression of MPL, leading to the development of the AML condition, but they bring severity when they are less in number with less c-MPL expression (Fig. 3 A). These findings implicated the complex role of c-MPL in modulating immune cell function and its further effect on AML severity and prognosis. The markers to the same immune cell types (Eosinophils, B-cell memory and M1 macrophage) also show a similar profile of their correlation to survivability and c-MPL expression (Supplementary Fig. 2). So, the in-silico analysis reveals a contradiction in the correlation between severity and MPL expression. Though c-MPL expression regulates the development of the leukemic (AML) condition, we observed conflicting data on c-MPL expression and survivability with AML (Fig. 3 B). The analysis concludes that c-MPL expression regulates AML but doesn’t play a role in regulating survivability or prognosis. But since c-MPL plays a role in the development of the disease, we hypothesise that this difference maybe due to the isoforms of c-MPL, which might play a role in bringing in severity instead of the combination of all the MPL isoforms, i.e., total MPL. It is well known that the FL-MPL promotes cell proliferation and tumorgenicity through JAK-STAT signalling and the truncated c-MPL act as negative regulator by inhibiting this pathway. The ratio of the two isoforms balances the effect. So, if there is an increase in FL MPL, the tumorogenic condition may increase, leading to severity. To confirm this hypothesis, we checked the expression of MPL (which is the total of the two isoforms) as well as the isoforms and their correlation with tumorigenicity, if any, in the following sections. 3.4 Over-expression of total c-MPL in different leukaemic cell lines compared to the control line To explore the relative expression of c-MPL in various leukemia cell lines, we performed in vitro analysis with different leukemic cell lines representing different FAB stages. KG1 (M1), K562 (M6), HL60 (M2), and Jurkat (a T-lymphoma cell line) were used to check the c-MPL expression. K562, which was initially considered as the M6 stage of FAB classification relying on its highly undifferentiated state, is now considered as M1 type, even though it is an erythroleukemic cell line. HL60 is considered an M2 type according to FAB classification ( 34 , 35 ). Although the Jurkat cell line is lymphoid cell line, it was also used, as it is also a leukemic cell line but T-cell leukaemia, as both myeloid and lymphoid originate from common progenitor cells, i.e, HSC, and it has been observed that c-MPL maintains the proliferative and quiescent state of HSCs ( 36 ), so we tried to check whether there is expression of c-MPL in lymphoma cell lines as well. Also, as to get normal cells, we had to collect it from primary cultures (blood samples from healthy individual, since non-cancerous secondary cell lines for HSCs are not available), which will be in a different background from the secondary cell lines used, so we selected the normal lung fibroblast line, MRC-5 cell line as the control cell line. We selected normal lung fibroblasts because lung cancer cells also have a high expression of c-MPL (unpublished data). Our findings revealed that all leukemia cell lines, including Jurkat cells, which are T-cell leukemia cell lines, expressed significantly greater levels of c-MPL than MRC-5 cells. Among these, the HL60 cell line, which reflects the M2 stage in the FAB categorisation of AML ( 22 ), had the greatest amount of c-MPL expression. This finding reveals a possible link between c-MPL expression and AML, particularly the M2 FAB stage of AML, which was also supported by our in-silico studies (Fig. 1 D). To validate our finding we used numerous validation approaches to ensure that our findings were reliable. Immunofluorescence assays revealed c-MPL proteins on the cell membrane, with stronger fluorescence signals in leukemia cell lines than in MRC-5 cells (Fig. 4 A & B). Through qRT-PCR analysis, we further found that compared to the normal cell line, all the leukemia cell lines expressed more c-MPL, further confirming the overexpression of c-MPL in HL60 cells having higher c-MPL expression than the other leukemia lines (Fig. 4 C). Similar results were obtained by analysing the c-MPL expression through immunophenotyping in different cell lines (Fig. 4 D & E). Collectively, these combined results validated the enhanced expression of c-MPL in leukemia cell lines, particularly in the HL60 cell line representing the M2 FAB stage, underlining its possible significance in leukemic pathophysiology 3.5 Different leukemia cell lines exhibit different levels of severity even with over-expression of c-MPL As we confirmed the over-expression of c-MPL in different leukemia lines, we next tried to understand the relationship between severity and enhanced c-MPL expression. We checked the cell cycle pattern in leukemic and normal cell lines (Fig. 5 A & B). We found that leukemic cells move faster in the cell cycle and spend less time in the G0 / G1 phase than normal cell lines (MRC-5). Additionally, the percentage of the cells were higher in in the S phase than in the normal cell line. This cell cycle pattern in leukemia cell lines indicates its proliferative nature compared to the normal cell line. We also confirmed the proliferative nature of these cell lines by studying the expression of the Ki67 marker. All the leukemia cell lines were exhibiting more Ki67 expression suggesting significantly more proliferative than the normal cell line (MRC-5), with the HL60 cell line exhibiting the greatest Ki67 expression compared to others leukemia cell lines, indicating its more proliferative and aggressive phenotype nature (Fig. 5 C & D). To further evaluate the differential severity of the leukemia cell lines, we evaluated the expression of Caspase-3, an apoptotic marker whose expression goes down in severe AML cases ( 37 ). We observed that the HL60 cell line exhibited lower expression than the other leukemia cell lines, suggesting resistance to apoptosis in HL60 cells and accumulation of tumor cells compared to other cell lines, increasing the severity (Fig. 5 E & F). Finally, we confirmed the severity of the disease by assessing the expression of the tumorogenic/stem cell marker CD44 + in different cell lines. Interestingly, we found that the HL60 cell line exhibited significantly greater expression than the other leukemia cell lines, confirming the more agressive nature of the HL60 cell line, even though all the leukemia lines highly expressed c-MPL. However, the MRC-5 cell line showed even greater expression of CD44 + than the leukemia cell lines due to its mesenchymal stem cell properties ( 38 ) (Fig. 5 G & H). Taken all these findings together these results prove that although c-MPL is over-expressed in all leukemia cell lines, though there is a difference in severity between them-reflected by proliferation, apoptotic resistance and stemness markers. Compared with the other leukemia cell lines, the HL60 cell line exhibited the highest expression of severity markers (with high Ki67 and CD44 + expression). This all indicates that, even with high c-MPL expression, the severity of leukemia cell lines varies, which justifies the presence of other factors that play a role in severity. 3.6 Overexpression of c-MPL-FL exacerbates leukemic conditions through activation of the STAT pathway. After establishing the association between c-MPL and leukemia and between the severity of leukemia and c-MPL expression, we focused on the c-MPL isoforms, i.e. , c-MPL-FL (full-length) and c-MPL-TR (truncated), to address the differences in severity. We identified four isoforms of c-MPL through western blot analysis and found that c-MPL-FL expression was notably greater in leukemia cell lines than in noncancerous MRC5 cells (Fig. 6 A). Furthermore, c-MPL-FL was greater than c-MPL-TR in all the leukemia lines, which was not observed in the case of MRC5. Specifically, c-MPL-FL levels were significantly elevated in the HL60 cell line compared to the c-MPL-TR cell line and in the other leukemia cell lines (Fig. 6 . A, B). These data also confirmed that the ratio of c-MPL-FL to c-MPL-TR is greater in the HL60 cell line than in the other leukemia lines or in the noncancerous line. This suggests that c-MPL-FL plays a more prominent role in leukemia pathology. To further confirm these findings, we performed RT-PCR analysis of c-MPL isoforms with isoform-specific primers. The results showed that the expression of c-MPL, particularly c-MPL-FL transcripts, was greater in leukemia cell lines than in normal cell lines. These results again showed that aamong all the leukemia cell lines, HL60 exhibited the highest levels of c-MPL-FL, confirming the western blot results (Fig. 6 C). Conversely, the expression of the truncated isoform c-MPL-TR was significantly lower. This increase in the imbalance between the expression of c-MPL isoforms contributes to the aggressiveness of leukemia. We further wanted to determine the relation between c-MPL-FL and disease severity by studying STAT-5, a critical downstream molecule activated by the dimer of c-MPL-FL, which, when phosphorylated to pSTAT-5, acts as a transcription factor promoting cell proliferation ( 39 ). We examined its expression through western blotting experiments and immunophenotyping. In both experiments, we found that compared to the normal MRC-5 cell line, the levels of STAT-5 of PSTAT-5 in the leukemia cell lines were greater, (Fig. 6 D, E, F, G, H, I). While inactive STAT levels were relatively low in HL60 cells, the levels of pSTAT5 were significantly higher in this cell line than in the other cell lines. This indicates a strong correlation between c-MPL-FL and STAT5 activation and cell proliferation in terms of leukemia severity. In contrast, both inactive and phosphorylated STAT levels were low in normal MRC-5 cells, suggesting that the activation of STAT-5 is linked to the proliferation of cancerous cells. 4. Discussion and Conclusion The present study was performed to corelate the role of c-MPL isoforms in modulating the severity of Acute Myeloid Leukemia (AML). C-MPL is key factor to regulate hematopoietic stem cell maintenance and megakaryopoiesis. Dysregulation of c-MPL has been found in various malignant haematological disorders. Through this study, we established a correlation between the hematopoietic receptor c-MPL and AML through in vitro and in silico studies. Furthermore, our findings suggest that the pathogenesis of AML can be predicted by high c-MPL expression (Fig. 1 ). Our findings also demonstrate that overexpression of c-MPL in AML may contribute to severity by changing the immune microenvironment, promoting cell such as M2 macrophages associated with enhancing leukemogenesis and chemotherapy resistance while reducing active cell such as T cells and dendritic cells involved in the active immunity by recognising tumor cells for destruction (Fig. 2 ). Our analysis also revealed that while c-MPL levels corelates with severity in eosinophils, the association is contradictory for memory B cells and M1 macrophages. This difference points towards a possible role of c-MPL isoform balance, in increasing the disease severity and prognosis (Fig. 3 ). Our study also demonstrated that there is high expression of c-MPL in leukemic cell lines with the highest in HL60 cell line corresponding to M2 FAB stage which suggests that c-MPL might play an important role in disease progression (Fig. 4 ) .We have also observed that, even though there is high expression of c-MPL in certain AML cases (Fig. 3 ), but the severity of AML condition increases with increasing c-MPL-FL isoform levels (Fig. 6 ). Previous studies have suggested that regulating the two isomers of c-MPL plays an important role in megakaryocyte development and hematopoiesis ( 40 ). A knockout model of the spliceosome-associated Ott1 gene demonstrated that Ott1 binds to c-MPL pre-mRNA and regulates splicing between c-MPL-TR and c-MPL-FL in HSCs by regulating epigenetic marks. The activation of STAT5, a critical downstream effector of the TPO/MPL axis, is dramatically reduced in MPL-stimulated Ott1-/- HSCs. HSCs expressing a greater ratio of c-MPL-TR:c-MPL-FL have dramatically reduced engraftment when transplanted ( 41 ). Through this work, we have proved that the tumorogenic markers (Ki67, CD44) increase in those leukemic conditions that contain high expression of c-MPL-FL isoform (Figs. 5 & 6 ). An increase in the c-MPL-FL isoform disturbs the stoichiometric balance of c-MPL-FL and c-MPL-TR on HSCs, leading to a more proliferative state ( 42 ). A high level of c-MPL-FL results in the generation of more c-MPL dimers, which internalize more TPO to activate the JAK-STAT pathway and proliferate HSCs randomly, resulting in more severe conditions ( 43 ). On the contrary, the truncated c-MPL can lead to deregulation of proliferative hematopoietic stem cells, and as a result, it can maintain the reservoir for hematopoietic stem cells in the G0 phase, which can play a major role in preventing megakaryocyte malignancies ( 41 ). We have also observed that high levels of pSTAT5 in leukemia cells with high c-MPL-FL, even in the absence of TPO, which the ligand typically require for c-MPL activation (Fig. 6 ). This suggests that the STAT pathway is constitutively activated in leukemia cells in which there is abundant c-MPL-FL, likely due to the formation of ample c-MPL dimers in the absence of TPO, which results in continuous signalling through the c-MPL/JAK/STAT pathway. c-MPL-TR and c-MPL-FL are conserved among different species, which confirms the importance of their presence and role in hematopoiesis ( 44 ). Our observations also confirmed the role of the ratio of c-MPL-TR to c-MPL-FL in maintaining the G0 and proliferative states of HSCs. In the case of malignancies due to defects in hematopoiesis, the balance between the two isoforms is affected. This loss of the stoichiometric balance of c-MPL-FL and c-MPL-TR may drive the uncontrolled cell proliferation characteristic of leukemia, making c-MPL-FL a critical target for understanding the disease mechanisms and potentially developing targeted therapies. Declarations Acknowledgments: We would like to acknowledge Yenepoya Deemed to be a University for providing the Seed grant project and the facility to carry out the research and partially providing the fellowship to Mr. Amjad Hussain to carry out the research activities. We would also like to acknowledge the Indian Council of Medical Research (ICMR) for providing the fellowship to AH. We would like to acknowledge Ms. Sushma Atri for helping with the setting up of some experiments. We also acknowledge UCSC Xena browser for providing needful information and visualization of FAB classification of AML. Additionally, we acknowledge GEPIA nad GEPIA2021 databases which enabled us to analyse gene expression among normal and cancer cases. We also acknowledge GENT2 database for providing insights to compare the gene expression among different cancer subtypes. Author Contributions: MAH: Writing original draft, Data Curation, Conducting experiments, Analyzing, Referencing, and figures designing. MK: Reviewing, Experiments conducting and editing of the figures. SL: Conceptualization, Structuring, Funding acquisition, Supervision, Resources, Writing original draft, reviewing, Editing, Project Administration. Data available on request: The data supporting this study's findings will be available upon reasonable request. Conflict of Interest Statement: The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Source of Funding: Funding: The funding from ICMR (Indian Council of Medical Research) to SL (Project No.-5/13/31/2018/NCD-III) was received for executing the study and performing the related research activities. We would also like to mention the Seed grant project to SL (YU/Seed grant/132-2022) by the Yenepoya (Deemed to be) University for providing the initial laboratory setup. References Saultz JN, Garzon R (2016) Acute myeloid leukemia: a concise review. Journal of clinical medicine, 5(3), p.33 De Kouchkovsky I, Abdul-Hay M (2016) Acute myeloid leukemia: a comprehensive review and 2016 update. Blood cancer J 6(7):e441–e441 Drachman JG (2000) Role of thrombopoietin in hematopoietic stem cell and progenitor regulation. Curr Opin Hematol 7(3):183–190 Hitchcock IS, Hafer M, Sangkhae V, Tucker JA (2021) The thrombopoietin receptor: revisiting the master regulator of platelet production. Platelets 32(6):770–778 Pikman Y, Lee BH, Mercher T, McDowell E, Ebert BL, Gozo M, Cuker A, Wernig G, Moore S, Galinsky I, DeAngelo DJ (2006) MPLW515L is a novel somatic activating mutation in myelofibrosis with myeloid metaplasia. PLoS Med 3(7):e270 Ding J, Komatsu H, Wakita A, Kato-Uranishi M, Ito M, Satoh A, Tsuboi K, Nitta M, Miyazaki H, Iida S, Ueda R (2004) Familial essential thrombocythemia associated with a dominant-positive activating mutation of the c-MPL gene, which encodes for the receptor for thrombopoietin. Blood 103(11):4198–4200 Wang T, Wang Z, Yang R (2011) Thrombopoietic growth factors in the treatment of immune thrombocytopenic purpura. Crit Rev Oncol/Hematol 77(3):172–183 Duensing S, Duensing A, Meran JG, Kreft A, Büsche G, Ganser A, Georgii A (1999) Molecular detection of c-mpl thrombopoietin receptor gene expression in chronic myeloproliferative disorders. Molecular Pathology, 52(3), p.146 Bridgford JL, Lee SM, Lee CM, Guglielmelli P, Rumi E, Pietra D, Wilcox S, Chhabra Y, Rubin AF, Cazzola M, Vannucchi AM (2020) Novel drivers and modifiers of MPL-dependent oncogenic transformation identified by deep mutational scanning. Blood J Am Soc Hematol 135(4):287–292 Chen Y, Xie J, Shen Z, Shi J, Chen S, Wang G (2022) Clinical and molecular characteristics of acute myeloid leukemia with MPL mutation. Hematology 27(1):530–534 He X, Chen Z, Jiang Y, Qiu X, Zhao X (2013) Different mutations of the human c-mpl gene indicate distinct haematopoietic diseases. J Hematol Oncol 6:1–8 Ng AP, Kauppi M, Metcalf D, Hyland CD, Josefsson EC, Lebois M, Zhang JG, Baldwin TM, Di Rago L, Hilton DJ, Alexander WS (2014) Mpl expression on megakaryocytes and platelets is dispensable for thrombopoiesis but essential to prevent myeloproliferation. Proceedings of the National Academy of Sciences, 111(16), pp.5884–5889 Yu P, Qiu SW, Rao Q, Lin D, Xing HY, Tang KJ, Tian Z, Wang M, Wang JX (2012) Expression of c-MPL in leukemic stem cells from acute myeloid leukemia patients. Zhongguo shi yan xue ye xue za zhi. 20(5):1052–1055 Li H, Zhao N, Li Y, Xing H, Chen S, Xu Y, Tang K, Tian Z, Wang M, Rao Q, Wang J (2018) c-MPL is a candidate surface marker and confers self-renewal, quiescence, chemotherapy resistance, and leukemia initiation potential in leukemia stem cells. Stem Cells 36(11):1685–1696 Albitar M, Manshouri T, Kantarjian H, Keating M, Estrov Z, Faber J, Freireich EJ, Pierce S, Estey E (1999) Correlation between lower c-mpl protein expression and favorable cytogenetic groups in acute myeloid leukemia. Leuk Res 23(1):63–69 Wang JY, Yu P, Chen S, Xing H, Chen Y, Wang M, Tang K, Tian Z, Rao Q, Wang J (2013) Activation of Rac1 GTPase promotes leukemia cell chemotherapy resistance, quiescence and niche interaction. Mol Oncol 7(5):907–916 Katheeja MN, Das SP, Das R, Laha S (2023) BRCA1 interactors, RAD50 and BRIP1, as prognostic markers for triple-negative breast cancer severity. Frontiers in Genetics, 14, p.1035052 Adel A, Djida AA, Hamid N, Lila BH, Souhil T, Abderrezak G, Idir B TRIzol-Based RNA extraction for detection protocol for SARS-CoV-2 of the coronavirus Disease 2019. New Microbes and New Infections Hajdúch M, Drábek J (eds) (2021) Laboratory Techniques in Cellular and Molecular Medicine. Palacky University Olomouc Tang Z, Li C, Kang B, Gao G, Li C, Zhang Z (2017) GEPIA: a web server for cancer and normal gene expression profiling and interactive analyses. Nucleic Acids Res 45(W1):W98–W102 Park SJ, Yoon BH, Kim SK, Kim SY (2019) GENT2: an updated gene expression database for normal and tumor tissues. BMC Med Genom 12(Suppl 5):101 Skopek R, Palusińska M, Kaczor-Keller K, Pingwara R, Papierniak-Wyglądała A, Schenk T, Lewicki S, Zelent A, Szymański Ł (2023) Choosing the right cell line for acute myeloid leukemia (AML) research. International journal of molecular sciences, 24(6), p.5377 Goldman MJ, Craft B, Hastie M, Repečka K, McDade F, Kamath A, Banerjee A, Luo Y, Rogers D, Brooks AN, Zhu J (2020) Visualizing and interpreting cancer genomics data via the Xena platform. Nat Biotechnol 38(6):675–678 Li C, Tang Z, Zhang W, Ye Z, Liu F (2021) GEPIA2021: integrating multiple deconvolution-based analysis into GEPIA. Nucleic Acids Res 49(W1):W242–W246 De Koning W, Latifi D, Li Y, Van Eijck CH, Stubbs AP, Mustafa DA (2021) Identification, validation, and utilization of immune cells in pancreatic ductal adenocarcinoma based on marker genes. Frontiers in immunology, 12 , p.649061 Horna P, Nowakowski G, Endell J, Boxhammer R (2019) Comparative assessment of surface CD19 and CD20 expression on B-cell lymphomas from clinical biopsies: implications for targeted therapies. Blood, 134, p.5345 Camacho V, Kuznetsova V, Welner RS (2021) Inflammatory cytokines shape an altered immune response during myeloid malignancies. Front Immunol 12:772408 Zanna MY, Yasmin AR, Omar AR, Arshad SS, Mariatulqabtiah AR, Nur-Fazila SH, Mahiza MIN (2021) Review of dendritic cells, their role in clinical immunology, and distribution in various animal species. Int J Mol Sci 22(15):8044 Perzolli A, Koedijk JB, Zwaan CM, Heidenreich O (2024) Targeting the innate immune system in pediatric and adult AML. Leukemia 38(6):1191–1201 Nishimura CD, Brenner DA, Mukherjee M, Hirsch RA, Ott L, Wu MF, Liu H, Dakhova O, Orange JS, Brenner MK, Lin CY (2017) c-MPL provides tumor-targeted T-cell receptor-transgenic T cells with costimulation and cytokine signals. Blood. J Am Soc Hematol 130(25):2739–2749 Iijima K, Sugita K, Inukai T, Goi K, Tezuka T, Uno K, Sato H, Kagami K, Nakazawa S (2000) Expression of thrombopoietin receptor and its functional role in human B-precursor leukemia cells with 11q23 translocation or Philadelphia chromosome. Leukemia 14(9):1598–1605 Kumamoto T, Azuma E, Tanaka M, Qi J, Hirayama M, Zhang SL, Kobayashi M, Iwamoto S, Komada Y, Yamamoto H, Nakashima K (1999) Human dendritic cells express the thrombopoietin receptor, c-Mpl. Br J Haematol 105(4):1025–1033 Ghinassi B, Zingariello M, Martelli F, Lorenzini R, Vannucchi AM, Rana RA, Nishikawa M, Migliaccio G, Mascarenhas J, Migliaccio AR (2009) Increased differentiation of dermal mast cells in mice lacking the Mpl gene. Stem Cells Dev 18(7):1081–1092 Maktoof SA, Al-Ammar NS, Al-Kashwan TA, Jumaa AK, Bader P, Kreyenberg H (2024) The expressions of myeloid differentiation and non-lineage specific differentiation antigens among FAB subtypes of acute myeloid leukemia in Iraqi patients. Romanian Med J, 71 (4) Jensen HA, Yourish HB, Bunaciu RP, Varner JD, Yen A (2015) Induced myelomonocytic differentiation in leukemia cells is accompanied by noncanonical transcription factor expression. FEBS open bio 5:789–800 Yoshihara H, Arai F, Hosokawa K, Hagiwara T, Takubo K, Nakamura Y, Gomei Y, Iwasaki H, Matsuoka S, Miyamoto K, Miyazaki H (2007) Thrombopoietin/MPL signaling regulates hematopoietic stem cell quiescence and interaction with the osteoblastic niche. Cell Stem Cell 1(6):685–697 Wu Y, Zhao B, Chen X, Geng X, Zhang Z (2022) Circ_0009910 sponges miR-491‐5p to promote acute myeloid leukemia progression through modulating B4GALT5 expression and PI3K/AKT signaling pathway. Int J Lab Hematol 44(2):320–332 Zhang K, Na T, Wang L, Gao Q, Yin W, Wang J, Yuan BZ (2014) Human diploid MRC-5 cells exhibit several critical properties of human umbilical cord-derived mesenchymal stem cells. Vaccine 32(50):6820–6827 Wang Z, Bunting KD (2013) STAT5 in hematopoietic stem cell biology and transplantation. Jak-stat 2(4):e27159 Kaushansky K (2005) The molecular mechanisms that control thrombopoiesis. The J Clin Invest 115(12):3339–3347 Xiao N, Laha S, Das SP, Morlock K, Jesneck JL, Raffel GD (2015) Ott1 (Rbm15) regulates thrombopoietin response in hematopoietic stem cells through alternative splicing of c-Mpl. Blood J Am Soc Hematol 125(6):941–948 Li F, Xiong Y, Yang M, Chen P, Zhang J, Wang Q, Xu M, Wang Y, He Z, Zhao X, Huang J (2022) c-Mpl-del, a c-Mpl alternative splicing isoform, promotes AMKL progression and chemoresistance. Cell Death & Disease, 13(10), p.869 Spivak JL, Moliterno AR (2021) The thrombopoietin receptor, MPL, is a therapeutic target of opportunity in the MPN. Front Oncol 11:641613 Skoda RC, Seldin DC, Chiang MK, Peichel CL, Vogt TF, Leder P (1993) Murine c-mpl: a member of the hematopoietic growth factor receptor superfamily that transduces a proliferative signal. EMBO J 12(7):2645–2653 Supplementary Figure Supplementary figure 1 is not available with this version. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7204532","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":493205415,"identity":"1b0cc6e9-fc26-4a2d-bbea-ca77e2364849","order_by":0,"name":"Mohammad Amjad Hussain","email":"","orcid":"","institution":"Yenepoya University","correspondingAuthor":false,"prefix":"","firstName":"Mohammad","middleName":"Amjad","lastName":"Hussain","suffix":""},{"id":493205416,"identity":"29be9f95-1edd-437c-a1fc-30de589a7a31","order_by":1,"name":"Mithila Kulkarni","email":"","orcid":"","institution":"Yenepoya University","correspondingAuthor":false,"prefix":"","firstName":"Mithila","middleName":"","lastName":"Kulkarni","suffix":""},{"id":493205417,"identity":"90752a3f-dbb1-42f2-b5e4-e1229023ea6b","order_by":2,"name":"Suparna Laha","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABJUlEQVRIiWNgGAWjYBADGQYJBsYHSALMYIQP8AC1MBuQrIVNAlULDiA/I/fg58oddjz8s5ufVfNU3JEzZ+8x/MBQYZ3YwM57AJsWgxt5yZJnzyTzSNw5Znab58wzY8ueM8YSDGfSExuY+RKwapHIMZBsbGPmYbiRYHabt+1w4oYbOQYSjEBGAzOPATYt8jNyjH82ttXzyN9I/1bM++9wPVCL8Q/Gf7i1MNzIMQPacpjHAMhg5m04nABiSDA24NZicOZdmmVj23Eewxs5xZJzjh023NlzrMwi4Vi6cRsuh7XnHr7Z2FYtJ3cjfeOHNzWH5c3Zmzff+FBjLdvPfwa7w4AxAgdMILYBA4cBAyio2LCrR9XC+AOshf0BTsWjYBSMglEwIgEAU4xgX3gIDIMAAAAASUVORK5CYII=","orcid":"","institution":"Yenepoya University","correspondingAuthor":true,"prefix":"","firstName":"Suparna","middleName":"","lastName":"Laha","suffix":""}],"badges":[],"createdAt":"2025-07-24 10:23:29","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7204532/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7204532/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":88419629,"identity":"9d2f8c3b-22f8-4ae7-9f7f-4b45946fd10b","added_by":"auto","created_at":"2025-08-06 09:21:16","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":757154,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ec-MPL expression is significantly high in AML patient samples.\u003c/strong\u003e (A)The dot plot represents the c-MPL expression in normal samples (n=31) compared to their tumor counterparts (n=31) from various malignancies. The red dot indicates the tumor samples, whereas the blue dot represents the normal samples. The cancers analysed in the figure are ACC (Adrenocortical carcinoma, Tumor=77, Normal=128), BLCA (Bladder Urothelial Carcinoma, Tumor=404, Normal=28), BRCA (Breast invasive Carcinoma, Tumor=1085, Normal=291), CESC (Cervical Squamous cell Carcinoma, Tumor=306, Normal=13), CHOL (Cholangiocarcinoma, Tumor=36, Normal=9), COAD (Colon adenocarcinoma, Tumor=275, Normal= 349), DLBC (Diffuse large B-cell lymphoma, Tumor=47, Normal=337)\u003cstrong\u003e \u003c/strong\u003eESCA (Esophageal Carcinoma, Tumor=182, Normal=286), GBM (Glioblastoma multiforme, Tumor=163, Normal=207), HNSC (Head and neck squamous cell carcinoma, Tumor=519, Normal=44), KICH (Kidney Chromophobe, Tumor=66, Normal=53) , KIRC (Kidney renal clear cell carcinoma, Tumor=523, Normal=100), KIRP (Kidney renal papillary cell carcinoma, Tumor=286, Normal=60), LAML (Acute Myeloid Leukemia, Tumor=171, Normal=70), LGG (Low Grade Glioma, Tumor=518, Normal =207), LIHC (Liver hepatocellular carcinoma, Tumor=369, Normal=160 LUAD (Lung Adenocarcinoma, Tumor=483, Normal=347), LUSC (Lung Squamous Cell Carcinoma, Tumor=486, Tumor=338), OV(Ovarian serous cystadenocarcinoma, Tumor=426, Normal=88), PAAD (Pancreatic adenocarcinoma, Tumor=179, Normal=171), PCPG (Pheochromocytoma and Paraganglioma, Tumor=182, Normal=3), PRAD(Prostate adenocarcinoma, Tumor=492, Normal=152), READ (Rectum adenocarcinoma Tumor=92, Normal=318, SARC (Sarcoma Tumor=262, Normal=2), SKCM (Skin Cutaneous Melanoma, Tumor=461, Normal=558), STAD (Stomach adenocarcinoma, Tumor=408, Normal=211), TGCT (Testicular Germ Cell Tumors Tumor=137, Normal=165), THCA (Thyroid Carcinoma, Tumor=512, Normal=337), THYM (Thymoma, Tumor=118, Normal=339), UCEC (Uterus Corpus Endometrium Carcinoma Tumor=174, Normal=91), UCS (Uterine carcinosarcoma, Tumor=57, Normal=78). (B) The same data was taken to check the expression of c-MPL in each individual cancer and its normal counterpart. The bar graph represents the c-MPL expression across different diseases compared to their normal samples. The diseases and their normal counterpart are given in the figures . (C)This figure represents the c-MPL expression in different haematological disorders. The plot shows the average c-MPL expression in ALL (n=788), AML (n=1103 ), CLL (n=517) and CML (n=85) cases, respectively. (D) The graph was curated according to the c-MPL expression in different stages of AML as per the FAB classification, M0: Undifferentiated AML(n=16), M1: without maturation(n=42), M2: with maturation (n=39), M3: promyelocytic leukaemia (n=16), M4=myelomonocytic leukaemia (n=35), M5:monoblastic and monocytic leukaemia (n=17), M6: erythroid leukaemia (n=2), M7: megakaryoblastic leukaemia (n=3). The significance value (p) has been represented by (**p˂0.01, ****p˂0.0001)\u003c/p\u003e","description":"","filename":"image1.png","url":"https://assets-eu.researchsquare.com/files/rs-7204532/v1/337ce09f6d85b7931253771f.png"},{"id":88419631,"identity":"f9e4ad4e-0eae-4bf9-a01c-6660e4889826","added_by":"auto","created_at":"2025-08-06 09:21:17","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1377626,"visible":true,"origin":"","legend":"\u003cp\u003eCell proportion of immune cells and the expression of c-MPL on the same immune cells in AML cases\u003cstrong\u003e.\u003c/strong\u003e(A) This figure represents the proportion of immune cells in AML and normal blood with the cohort size of: B cells naive (T=8, N=32), B-cells memory (T=14, N=70), Eosinophils (T=4, N=31), Mast cell activated (T=38, N=62), Mast cell resting (T=12, N=45), Dendritic cell activated (n=21, N=71), Dendritic cell resting (T=3, N=2), M2 macrophages (T=6, N=46), M1 macrophages (T=16, N=5), M0 macrophages (T=1, N=24), NK cell activated (T=25, N=35), NK cell resting (T=16, N=42), T cells gamma delta (T=11, N=41), T cells follicular helper (T=24, N=22), T cells CD4 memory activated (T=23, N=36), T cells CD4 memory resting (T=14, N=25), T cells CD4 naive (T=27, N=24), Plasma Cells (T=4, N=65). (B) It represents the c-MPL expression on different immune cells in the AML tumour and normal blood. The cohort size for this study is: B cells naive (T=7, N=32), B-cells memory (T=15, N=64), Eosinophils (T=4, N=70), Mast cell activated (T=37, N=76), Mast cell resting (T=9, N=54), Dendritic cell activated (n=23, N=78), M2 macrophages (T=4, N=44), M1 macrophages (T=18, N=6), NK cell activated (T=25, N=35), NK cell resting (T=36, N=47), T cells gamma delta (T=11, N=47), T cells follicular helper (T=33, N=32), T cells CD4 memory activated (T=38, N=47), T cells CD4 memory resting (T=10, N=40), T cells CD4 naive (T=29, N=24), T cells regulatory (T=35, N=37), where T= AML Tumor and N=Normal Blood.\u003c/p\u003e","description":"","filename":"image2.png","url":"https://assets-eu.researchsquare.com/files/rs-7204532/v1/7edf543a17e38573fd1a5284.png"},{"id":88419630,"identity":"f5d92047-221b-4f28-8509-fe5b61a48878","added_by":"auto","created_at":"2025-08-06 09:21:17","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":116842,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eExpression of immune cells correlates with the survival probability of AML patients:\u003c/strong\u003e (A) The various Kaplan-Meier graphs represent the survival probability due to the overexpression of different immune molecules found in the AML immune landscape. The figure shows red and blue lines representing high expression and low expression of immune molecules in AML, respectively. (B) It represents the survival probability of AML patients in relation to the expression of c-MPL. The red and blue line in the graph shows the high and low expression of c-MPL in AML disease. The cutoff for high and low expression for c-MPL is provided in the figure.\u003c/p\u003e","description":"","filename":"image3.png","url":"https://assets-eu.researchsquare.com/files/rs-7204532/v1/a0459268038f21b0457a8ead.png"},{"id":88421424,"identity":"9d223c93-5731-4f32-a570-e10e4707dfeb","added_by":"auto","created_at":"2025-08-06 09:29:17","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":215131,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTotal c-MPL is expressed more indifferent leukemic cell lines compared to the control line.\u003c/strong\u003e (A) Immunofluorescence assays revealed the c-MPL protein expression in different cell lines. Blue panels demonstrate the DAPI, whereas the green panel depicts the c-MPL expression. The third panel is the merged images of DAPI and c-MPL. (B) This figure represents the quantification of the immunofluorescence between different cell lines. (C) The bar graph in the figure represents the mRNA expression of total c-MPL through RT-PCR. The different FAB stages are shown on the X-axis, whereas the Y-axis depicts relative mRNA expression. (D\u0026amp;E)The figures arethe histogram and bar graph representation of the c-MPL expression through immunophenotyping and its analysis,which shows the c-MPL expression in unstained and stained samples. The different cell lines are mentioned in the X-axis, whereas the Y-axis represents the expression in percentage. The stars present in the graph represent the relative statistical significance(p) (**p˂0.01, *** p˂0.001, ****p˂0.0001).\u003c/p\u003e","description":"","filename":"image4.png","url":"https://assets-eu.researchsquare.com/files/rs-7204532/v1/b60c65117eebf4b849313a08.png"},{"id":88419636,"identity":"7d7a991b-c286-4209-9d24-92225311b0ba","added_by":"auto","created_at":"2025-08-06 09:21:17","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":1907545,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDifferent leukemia cell lines exhibit different levels of severity even with overexpression of c-MPL\u003c/strong\u003e. (A) Representative histogram plot for the cell cycle analysis of different cell lines. (B) It represents the analysis of cell cycle analysis, with the X-axis representing the different phases of the cell cycle, whereas the Y-axis represents the percentage of cells in each phase. (C) The histogram plots from the flow cytometer depict the Ki67 expression, a proliferative marker, in various cell lines. The left panel represents the unstained, whereas the right panel represents stained cell lines. (D) The bar graph represents the flow cytometer data analysis of Ki67, with the X-axis representing different cell lines and the Y-axis showing the expression of\u0026nbsp; Ki67. (E\u0026amp;F) The histogram plots from the flow cytometer represent the expression of Caspase-3, an important apoptotic marker, among various cell lines. The unstained and stained are shown in the left histogram panel, whereas the right panels represent the analysis of the caspase-3 expression. (G\u0026amp;H) The histogram plots depict the expression of tumorogenic and stem cell marker CD44\u003csup\u003e+\u003c/sup\u003e. The stars present in the graph represent relative statistical significance (p) (*p˂0.05, **p˂0.001, ****p˂0.0001).\u003c/p\u003e","description":"","filename":"image5.png","url":"https://assets-eu.researchsquare.com/files/rs-7204532/v1/8c7a5cd075662bf201bac635.png"},{"id":88419639,"identity":"14948cc1-207f-4d46-a114-c34cb7bf820c","added_by":"auto","created_at":"2025-08-06 09:21:17","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":1983271,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eOverexpression of c-MPL-FL exacerbates leukemia conditions through activation of the STAT pathway.\u003c/strong\u003e (A) The figure depicts the expression of four different isoforms of c-MPL through western blotting, which is mainly present in humans. The molecular weight for different isoforms ranges from 70 KDa to 60 KDa. Figure (B) The intensities of the bands of western blotting were analysed using ChemiDoc software, taking c-MPL-FL and c-MPL-TR into consideration and normalising with beta-actin. (C) The figure represents the c-MPL isoform expression through RT-PCR. The X-axis represents two different isoforms, whereas the Y-axis represents the relative mRNA expression of c-MPL isoforms in different cell lines. (D\u0026amp;E) The figure represents the inactivate STAT-5 and its analysis, which is a downstream signalling molecule for c-MPL expression through western blotting.(F\u0026amp;G) This figure describes the expression of activated STAT-5 (pSTAT-5) through western blotting. The X-axis represents the different cell lines under study, whereas the Y-axis represents the relative protein expression of pSTAT. (H) This figure represents the histogram plot for the expression of STAT-5 and pSTAT-5 through immunophenotyping with unstained and stained cells. (I) This bar graph represents the analysis of the immunophenotyping. The stars present in the graph represent relative statistical significance (p) (*p˂0.01, **p˂0.001, ***p˂0.0002, **** p˂0.0001, \u003csup\u003e##\u003c/sup\u003ep˂0.001).\u003c/p\u003e","description":"","filename":"image6.png","url":"https://assets-eu.researchsquare.com/files/rs-7204532/v1/be4e30d61782980626503b47.png"},{"id":88972047,"identity":"755ef345-0020-4ac6-9467-15196f688e9e","added_by":"auto","created_at":"2025-08-13 09:47:57","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":6961596,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7204532/v1/936b2b57-c348-47af-8858-7a7ecc0b6887.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"The isoforms of c-MPL plays an instrumental role in regulating the severity of leukemic conditions","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003e\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003eAcute Myeloid Leukaemia (AML) is a malignant neoplasm of immature bone marrow (BM)-derived myeloid cells exhibiting variable differentiation. It is a heterogeneous disorder characterised by the uncontrolled clonal proliferation of stem cell precursors of the myeloid lineage, i.e., red blood cells (RBCs), platelets, and white blood cells (WBCs), in addition to B and T lymphocytes in the marrow and the arrest of their maturation (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e). It is one of the most common acute leukaemia in adults, accounting for almost 80% of cases (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eThe thrombopoietin receptor, c-Myeloproliferative Leukaemia (c-MPL), is well known for its function in regulating hematopoiesis. It has well established role in maintaining hematopoietic stem cells (HSCs) and it is also the key cytokine regulating the production of platelets from megakaryocytes. c-MPL is the only known receptor for TPO. c-MPL activates various downstream signalling pathways, promoting cellular survival and proliferation (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e). c-MPL is a member of the hematopoietic growth factor receptor superfamily which encodes the 635 amino acid protein c-MPL, containing a signal peptide domain, two extracellular cytokine receptor domains, a transmembrane domain and two intracellular cytokine receptor box motifs (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eOncogenic activating mutations in the receptor c-MPL have been identified in myelofibrosis (MF) and essential thrombocythemia (ET) (\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e). Furthermore, functional abnormalities of c-MPL are associated with several hematological disorders, such as Thrombocytopenia Purpura (ITP), Myelodysplastic Syndrome (MDS), Myeloproliferative Neoplasm(MPN), Chronic Myeloid Leukaemia (CML), and AML (\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e). c-MPL mutations have been discovered in several MPNs, including Primary Myelofibrosis (PMF), Polycythaemia Vera (PV), and Essential thrombocythemia (ET) (\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e). In a study done by Wang et al., 2011, it was observed that in a cohort of 1509 AML patients, 19 tested positive, with c-MPL mutation accounting for 1.26% of overall mutations, primarily in intracellular and transmembrane areas (\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e). A more prevalent mutation, W515L/K, contributes to increased cell proliferation in AML. This mutation has been reported to be present in around 25% of AMKL cases, a subtype of AML (\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e). In addition, even in the absence of mutations, many AML patients express c-MPL, and the proliferation and survival of HSCs are enhanced in response to c-MPL. c-MPL and its receptor are essential for megakaryocyte development and maintaining hematopoietic stem cell function (\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e). The c-MPL/TPO pathway is a critical survival pathway for leukaemia patients. Additionally, patients with AML and different types of leukaemia (megakaryocytic and erythropoietic leukaemia) have increased c-MPL expression, which correlates with CD34 expression (\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e). In primary human AML samples, it was found that the c-MPL expression, especially in CD34\u003csup\u003e+\u003c/sup\u003e patients, was significantly greater than that in normal donors (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Studies also confirm that, c-MPL over-expression is correlated with shorter and complete remission in patients with AML (\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e). These finding suggests the presence of a permanent and chemo-resistant population of leukaemia cells in relapse. These leukaemia stem cells (LSCs) are capable of propagating and self-renewing leukaemia cells. c-MPL is a candidate surface marker for LSCs. They are involved in maintaining the properties of LSCs. Furthermore, patients with c-MPL\u003csup\u003e+\u003c/sup\u003e LSCs have a worse prognosis and are resistant to conventional chemotherapies (\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e). The over-expression of MPL is also observed in patients with normal or unfavorable cytogenetics (\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e). Another study revealed that in the process of active Rac1-mediated leukaemia initiation and maintenance, the overexpression of c-MPL plays a vital role in the interaction of leukaemia cells with the bone marrow (BM) niche and contributes to quiescence and chemotherapy resistance in leukaemia cells (\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e). Therefore, there is a need to understand the mechanism underlying the severity developed by c-MPL isoforms in patients with AML. In this study we have observed that, it is actual the c-MPL -FL which is associated with the increased severity of the AML disease in invitro system.\u003c/p\u003e\u003c/div\u003e\u003c/p\u003e"},{"header":"2. Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003e2.1. Materials\u003c/h2\u003e\u003cp\u003eThe cell lines used in the study were primarily taken from NCCS Pune, except the MRC-5 cell line, which was purchased from ATCC. The antibodies used in the study were sourced from various sources: MPL and Ki67 from Invitrogen, STAT, pSTAT and Caspase from Cell Signalling Technology (CST), and CD44\u003csup\u003e+\u003c/sup\u003e from Abcam. The antibodies and their concentration used in the study have been mentioned in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. The cDNA synthesis kit and Syber Green were purchased from Takara. The DAPI used in Immunofluorescence, Propidium Iodide (PI) and RNase A, used in cell cycle analysis, were all purchased from Himedia.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eList of Antibodies and their concentration mentioned in the paper.\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"6\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eS. No\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAntibody\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003ePurpose\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eConcentration\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003eCompany\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c6\"\u003e\u003cp\u003eSecondary Antibody concentration\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ec-MPL\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eWestern Blotting\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e1:1000\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eInvitrogen\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e1:2000\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSTAT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eWestern Blotting\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e1:1000\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eCST\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e1:2000\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ep-STAT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eWestern Blotting\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e1:1000\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eCST\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e1:2000\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e4\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ec-MPL\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eImmunofluorescence\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e1:200\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eInvitrogen\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e1:250\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e5\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ec-MPL\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eImmunophenotyping\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e1:200\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eInvitrogen\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e1:250\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e6\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCaspase\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eImmunophenotyping\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e1:200\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eCST\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e1:250\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e7\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSTAT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eImmunophenotyping\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e1:200\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eCST\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e1:250\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e8\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ep-STAT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eImmunophenotyping\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e1:200\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eCST\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e1:250\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e9\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCD44\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eImmunophenotyping\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e1:100\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eAbcam\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003eConjugated\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e10\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eKi67\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eImmunophenotyping\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e1:200\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eInvitrogen\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e1:250\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\u003ch2\u003e2.2. Cell culture\u003c/h2\u003e\u003cp\u003eThe human AML cell lines at different FAB (French American and British classification system) stages like KG1 (M1), K562 (M6), HL60 (M2), and Jurkat (a T-lymphoma cell line) were cultured in RPMI-1680 supplemented with 10% FBS, 1 mM sodium pyruvate, and 50 IU/ml antibiotics/antimycotic and maintained at 37\u0026deg;C with 5% CO2. Normal lung fibroblast (MRC-5) cells were cultured in DMEM supplemented with 10% FBS, while the remaining components were the same and used as a negative control. All the experiments were performed after the cells reached 70\u0026ndash;75% confluency.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\u003ch2\u003e2.3. Preparation of cell lysates and western blot analysis.\u003c/h2\u003e\u003cp\u003eThe cells were treated under the appropriate conditions, quickly placed on ice, and washed with ice-cold PBS. After that, the cells were treated with RIPA lysis buffer (20 mM Tris HCl (pH 7.4), 150 mM NaCl, 5 mM EDTA, 1% Nonidet P-40, 1 mM Na\u003csub\u003e3\u003c/sub\u003eVO\u003csub\u003e4\u003c/sub\u003e) supplemented with proteinase inhibitor (\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e). Sonication was performed for 3 min with 30 amps and a pulse of 10 sec on/off. Protein estimation was performed with Bradford\u0026rsquo;s reagent. 50 \u0026micro;g of protein was loaded for each cell line for β-actin, c-MPL, STAT, and pSTAT, and the results were analysed by a chemo gel doc system software.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e\u003ch2\u003e2.4. RNA extraction and RT‒PCR\u003c/h2\u003e\u003cp\u003eRNA extraction was performed using the TRIzol chloroform method, which was then quantified by a micro-volume spectrometer (\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e). Reverse transcription for cDNA synthesis from 1 ug of total RNA was allowed to proceed at 37\u0026deg;C for 15 min and 85\u0026deg;C for 5 sec in a final volume of 20 \u0026micro;l. RT‒PCR of the cDNA (100 \u0026micro;g) was performed in a final volume of 10 \u0026micro;l containing 2X SYBR Green and 5 \u0026micro;M of forward and reverse primers for the c-MPL isoforms. For GAPDH, 10 \u0026micro;M primers were used. The primer sequences are provided in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eList of Primers and their sequence mentioned in the paper. c-MPL -P (NM_005373) has been designed from exon 9 (forward) and 10 (reverse). The c-MPL-S has been designed from the exon 8\u0026ndash;11 junction for forward and the exon 11 for reverse. GAPDH (NM_001256799) has been designed from exon 2 (forward) and exon 4 (reverse).\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"3\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePrimers\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePosition\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eSequence\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003ec-MPL-FL (MPL-P)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward Primer\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e5' GCGATCTCGCTACCGTTTAC 3'\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eReverse Primer\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e5' AGGAAACTGCCACCTCAGC 3'\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003ec-MPL -TR (MPL-S)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward Primer\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e5' AGGACTGGAAGGAGAC 3'\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eReverse Primer\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e5' TCAGGCTGCAGTGTCCTAAG 3'\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003ec-MPL -Total\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward Primer\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e5' GAGAAGCTTCAGCTCTGAC 3'\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eReverse Primer\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e5' CAAGTGCCACTGCATCTCCA 3'\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eGAPDH\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward Primer\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e5\u0026rsquo;AGGGCTGCTTTTAACTCTGGT3\u0026rsquo;\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eReverse Primer\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e5\u0026rsquo;TCCCTCCAAAATCAAGTGGGG3\u0026rsquo;\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e\u003ch2\u003e2.5. Cell cycle analysis\u003c/h2\u003e\u003cp\u003eThe cells were seeded overnight in a 60 mm dish. Then, 0.5 M cells/ml were collected in an Eppendorf tube and washed with PBS. The cells were then fixed in ethanol at -20\u0026deg;C for 1 hr. After washing with PBS, the cells were incubated in a DNA staining solution containing 0.5 mg/ml PI, 0.1% sodium citrate, 2% Triton X-100 and 2 mg/ml RNAase A, for 20 min in the dark (\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e). Cell cycle analysis was then performed using Guava flow cytometry (Merck, Millipore, FCS version 7.0).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003e2.6. Immunofluorescence.\u003c/h2\u003e\u003cp\u003eThe expression of the cell surface marker c-MPL was analysed by an immunofluorescence assay with the following protocol: 0.5 M/ml cells were washed with PBS, then fixed with 4% PFA and incubated at RT in the dark for 20 min at 37\u0026deg;C. The supernatant was discarded after centrifugation, and the cells were then treated with a permeabilisation agent (0.1% Triton X-100 in 1X PBS) and incubated at RT for 15 min, followed by washing with PBS. Blocking was performed with 2% BSA in PBS for 1 hr. 1\u003csup\u003eo\u003c/sup\u003e Ab incubation was performed in 0.1% BSA in 1X PBS overnight at 4\u0026deg;C. After washing, the cells were incubated with a fluorescent-tagged 2\u003csup\u003eo\u003c/sup\u003e Ab in 1X PBS for 1 hr. The cells were then stained with DAPI after PBS wash and incubated at room temperature for 20 min. followed by mounting on a slide and visualisation via fluorescence microscopy.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e\u003ch2\u003e2.7. Immunophenotyping.\u003c/h2\u003e\u003cp\u003eA total of 0.5 M cells were collected, washed with PBS followed by 15 min of incubation in FACS staining buffer. The supernatant was discarded after centrifugation, and the cells were then treated with a permeabilization agent (0.1% Triton X-100 in 1X PBS) and incubated at RT for 15 min, followed by washing with PBS. Blocking was performed with 2% BSA in PBS for 1 hr. The cells were then incubated in FACS buffer stain followed by incubation in 1\u003csup\u003eo\u003c/sup\u003e Ab at 4\u0026deg;C overnight. Then, the cells were incubated with Alexa Flour 488, a fluorescent-tagged 2\u003csup\u003eo\u003c/sup\u003e Ab for 1 hr at RT. The cells were then washed, and fresh FACS buffer was added to them. The data were acquired through Guava flow cytometry (Merck, Millipore, FCS version 7.0).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e\u003ch2\u003e2.8. In-silico analysis of the correlation between c-MPL and AML with TCGA datasets.\u003c/h2\u003e\u003cp\u003eTo analyse the c-MPL expression profile across different cancers and their normal counterparts, we curated a dataset which comprised 31 tumour types and normal tissues. This dataset contains data from 9496 tumour patients and 5540 normal samples; all downloaded from the Gene Expression Profiling Interactive Analysis (GEPIA) database (\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e). The expression levels of c-MPL are represented as the median of TPM (Transcripts Per Million), ensuring normalisation among the samples. Graphs were generated using GraphPad Prism Software. To specifically check the expression of c-MPL in different types of leukaemia, additional analysis was conducted by the Gene Expression across Normal and Tumour tissues 2 database (GENT2), which provides transcriptomics data comparing wide range of cancers, including leukaemia such as Acute Lymphoblastic Leukemia (ALL), Acute Myeloid Leukemia (AML) Chronic Lymphoblastic Leukemia (CLL), Chronic Myeloid leukemia (CML) (\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e). The normalised c-MPL expression data were extracted and then curated using GraphPad Prism\u003c/p\u003e\u003cp\u003eSince there is a clinical importance of FAB classification in categorising AML based on morphology, and it is also used as a quick method for AML type identification, we incorporated FAB staging in our study (\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e). We used the TCGA-LAML cohort (n\u0026thinsp;=\u0026thinsp;200) for analysis and retrieved the data from UCSC Xena-browser (\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e). This allowed us to examine the c-MPL expression across different FAB stages from M0-M7. The downloaded data was further curated using GraphPad Prism.\u003c/p\u003e\u003cp\u003eTo understand the cell proportion of different immune markers, and relative c-MPL expression on those immune cells in AML disease and normal blood, the data were retrieved from the GEPIA 2021 database which integrates RNA-seq data from TCGA and Genotype-Tissue Expression (GTEx) sets (\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e). This enables us to relate the immune cell proportion profile, such as T cells, B cells, NK cells, Macrophages, Dendritic cells, Mast cells, Eosinophils, with c-MPL expression in those particular immune cells in AML and normal blood. The retrieved data were then processed and curated using GraphPad Prism software.\u003c/p\u003e\u003cp\u003eTo check the impact of immune cell expression on survival probability in AML, we analysed both immune cells directly as well as with their specific markers. The Kaplan-Meier curve graph was downloaded using the GEPIA 2021 database to show the association of immune cell expression with survivability (\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e). In addition to this, we also selected specific surface markers of the immune cells to check survival probability in AML due to their expression; for instance, CD27 was used for B cell Memory, CD80 for M1 Macrophages, and CD69 for Eosinophils. We selected these markers based on the established studies, which have been validated as cell-specific markers for specific immune cells (\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e). For this, the expression data was retrieved from UCSC Xena Browser, specifically from the TCGA-LAML cohort (\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e). The data were analysed using GraphPad Prism to generate a Kaplan-Meier survival curve, allowing us to determine whether high or low expression is associated with overall survival in AML patients.\u003c/p\u003e\u003c/div\u003e"},{"header":"3. Results and discussion","content":"\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003e3.1. c-MPL expression is significantly high in AML patient samples.\u003c/h2\u003e\u003cp\u003ec-MPL, a thrombopoietin receptor belongs to thecytokine receptor with versatile functions. It has an important role in hematopoiesis and megakaryocyte maturation.To understand the role of c-MPL in conditions like cancer, we first analysed c-MPL expression in normal and malignant tissues using the TCGA datasets from the GEPIA database. Our study included a total cohort of Tumor\u0026thinsp;=\u0026thinsp;9496 and Normal\u0026thinsp;=\u0026thinsp;5540 samples, comprising 31 different cancers and their normal types, for the c-MPL expression analysis. We found that the overall c-MPL expression was lower in most of the malignant tissue than in normal tissues (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA).However, in AML cases, it was comparatively higher in the case of the tumour compared to its normal counterpart (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). This significant increase was exclusive to AML; as it did not appear in any other examined tumour types. Furthermore, our analysis demonstrated a substantial increase in c-MPL expression in AML compared to any other blood disorders like ALL, CLL or CML, highlighting its unique significance in the development of this malignancy (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). Additionally, we also tried to investigated the expression levels of c-MPL in different AML stages and found that in the case of the M2 FAB stage, exhibited higher levels of c-MPL than in the other stages. This finding indicates that the M2 stage may be more severe and aggressive than the other stages, potentially driven by increased c-MPL expression(Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). These all results summarizes the pathogenic role of c-MPL in AML, particularly in M2 stage of FAB classification.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003e3.2. The immune cells overexpressed in severe AML conditions correlate with c-MPL.\u003c/h2\u003e\u003cp\u003eThe population of immune cells is commonly altered in hematopoietic malignancies (\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e). To explore the immunological landscape associated with c-MPL expression in AML, wee the comprehensively investigated the immunological environment. In AML, the immunological micro-environment is characterised by complex interaction among various immune cells, including eosinophils, mast cells, macrophages, NK cells, T cells, plasma cells, monocytes and B cells. Our analysis revealed that some of the immune cells like M2 macrophage, plasma cells, eosinophil and monocytes were found to be significantly increased in AML micro-environment compared to the normal blood (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). However, some immune molecules like mast cells, B cells, CD4 memory T-cells are present in significant high numbers in their resting, naive or inactive stage during AML condition (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). Active immune cells like T-cells, active Mast cells, B cells and M2 macrophages, neutrophil and NK cells are found to be significantly low in population in AML condition compared to the normal blood micro-environment (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). This data indicates that the immune micro-environment in AML is mostly inactive. A decreased number of active memory T-cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eA) may not be able to recognise the tumour cells and eliminate them, resulting to growth of the tumor condition. Similarly, Dendritic cells are one of the most efficient APCs of the immune system, inducing and dispersing the primary response by the activity of na\u0026iuml;ve T cells (\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e). A lower population of active Dendritic cells along with reduced CD4 naive cells, may likely impair the immune activity against tumor, thereby increasing the severity of the AML condition (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). Among the immune cells M2 macrophages were found to be more expressed and these cells are known to produce factors that support leukaemia cells' growth, survival, and resistance to chemotherapy (\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e). A significant increase in the M2 population along with decreased dendrtic cells T cells may further increase AML progression (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). So, overall the compromised complex interaction of the immune molecules contributes towards the worsening of the disease progression. Few immune molecules have no significant differences in their population between the normal and AML micro-environment (supplementary Fig.\u0026nbsp;1).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eWe further investigated the role of c-MPL in regulating these immune cells.. c-MPL is found to regulate expression and activation of T-cells (\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e) and activated c-MPL enhances anti-tumour activity and preserves a central memory phenotype (\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e). Morever, c-MPL is found to be present on the dendritic cells and is involved in the maturation and development of mast cells (\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e). c-MPL-TPO interaction plays a role in the growth regulation of B-precursor leukaemia cells (\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e). To explore these finding we further conducted an in-silico analysis of the c-MPL expression on the different immune cells in the AML microenvironment and compared it with normal blood cell data. We extracted relevant data from the GEPIA 2021 database through cybersort and analysed it to check for any correlation between c-MPL expression on immune cells and AML severity. Our findings revealed a strong correlation between the c-MPL expression and the immune cell population in AML condition, suggesting that c-MPL over expression may contribute to AML severity (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). These all findings establish the role of c-MPL in regulating immune cell microenvironment regulation and leukemia progression, highlighting its potential as therapeutic target in AML.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003e\u003cb\u003e3.3. The expression of immune cells correlates with the survival probability of AML patients.\u003c/b\u003e\u003c/h2\u003e\u003cp\u003eIn the previous section, we confirmed the expression of immune cells in the AML microenvironment and their correlation with c-MPL (either positive or negative). To further investigate the prognostic implication, we assessed the patient\u0026rsquo;s overall survival with c-MPL-regulated immune cells to determine the correlation of c-MPL with disease severity (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e3\u003c/span\u003e). The analysis of immune cell population with survival by the Kaplan-Meier curve reveals that certain cell types, like Eosinophils, their high population coupled with c-MPL overexpression led to the development of AML condition and a significant increase in severity as well suggesting that c-MPL overexpression might support leukemic microenvironment (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). On the contrary, there are immune cell types like B-cell memory and M1 macrophage presents a different scenario; while they are highly populated with overexpression of MPL, leading to the development of the AML condition, but they bring severity when they are less in number with less c-MPL expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). These findings implicated the complex role of c-MPL in modulating immune cell function and its further effect on AML severity and prognosis.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eThe markers to the same immune cell types (Eosinophils, B-cell memory and M1 macrophage) also show a similar profile of their correlation to survivability and c-MPL expression (Supplementary Fig.\u0026nbsp;2). So, the in-silico analysis reveals a contradiction in the correlation between severity and MPL expression. Though c-MPL expression regulates the development of the leukemic (AML) condition, we observed conflicting data on c-MPL expression and survivability with AML (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). The analysis concludes that c-MPL expression regulates AML but doesn\u0026rsquo;t play a role in regulating survivability or prognosis. But since c-MPL plays a role in the development of the disease, we hypothesise that this difference maybe due to the isoforms of c-MPL, which might play a role in bringing in severity instead of the combination of all the MPL isoforms, i.e., total MPL. It is well known that the FL-MPL promotes cell proliferation and tumorgenicity through JAK-STAT signalling and the truncated c-MPL act as negative regulator by inhibiting this pathway. The ratio of the two isoforms balances the effect. So, if there is an increase in FL MPL, the tumorogenic condition may increase, leading to severity. To confirm this hypothesis, we checked the expression of MPL (which is the total of the two isoforms) as well as the isoforms and their correlation with tumorigenicity, if any, in the following sections.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\u003ch2\u003e3.4 Over-expression of total c-MPL in different leukaemic cell lines compared to the control line\u003c/h2\u003e\u003cp\u003eTo explore the relative expression of c-MPL in various leukemia cell lines, we performed \u003cem\u003ein vitro\u003c/em\u003e analysis with different leukemic cell lines representing different FAB stages. KG1 (M1), K562 (M6), HL60 (M2), and Jurkat (a T-lymphoma cell line) were used to check the c-MPL expression. K562, which was initially considered as the M6 stage of FAB classification relying on its highly undifferentiated state, is now considered as M1 type, even though it is an erythroleukemic cell line. HL60 is considered an M2 type according to FAB classification (\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e). Although the Jurkat cell line is lymphoid cell line, it was also used, as it is also a leukemic cell line but T-cell leukaemia, as both myeloid and lymphoid originate from common progenitor cells, i.e, HSC, and it has been observed that c-MPL maintains the proliferative and quiescent state of HSCs (\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e), so we tried to check whether there is expression of c-MPL in lymphoma cell lines as well. Also, as to get normal cells, we had to collect it from primary cultures (blood samples from healthy individual, since non-cancerous secondary cell lines for HSCs are not available), which will be in a different background from the secondary cell lines used, so we selected the normal lung fibroblast line, MRC-5 cell line as the control cell line. We selected normal lung fibroblasts because lung cancer cells also have a high expression of c-MPL (unpublished data). Our findings revealed that all leukemia cell lines, including Jurkat cells, which are T-cell leukemia cell lines, expressed significantly greater levels of c-MPL than MRC-5 cells. Among these, the HL60 cell line, which reflects the M2 stage in the FAB categorisation of AML (\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e), had the greatest amount of c-MPL expression. This finding reveals a possible link between c-MPL expression and AML, particularly the M2 FAB stage of AML, which was also supported by our in-silico studies (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). To validate our finding we used numerous validation approaches to ensure that our findings were reliable. Immunofluorescence assays revealed c-MPL proteins on the cell membrane, with stronger fluorescence signals in leukemia cell lines than in MRC-5 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e4\u003c/span\u003eA \u0026amp; B). Through qRT-PCR analysis, we further found that compared to the normal cell line, all the leukemia cell lines expressed more c-MPL, further confirming the overexpression of c-MPL in HL60 cells having higher c-MPL expression than the other leukemia lines (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). Similar results were obtained by analysing the c-MPL expression through immunophenotyping in different cell lines (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e4\u003c/span\u003eD \u0026amp; E). Collectively, these combined results validated the enhanced expression of c-MPL in leukemia cell lines, particularly in the HL60 cell line representing the M2 FAB stage, underlining its possible significance in leukemic pathophysiology\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\u003ch2\u003e3.5 Different leukemia cell lines exhibit different levels of severity even with over-expression of c-MPL\u003c/h2\u003e\u003cp\u003eAs we confirmed the over-expression of c-MPL in different leukemia lines, we next tried to understand the relationship between severity and enhanced c-MPL expression. We checked the cell cycle pattern in leukemic and normal cell lines (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e5\u003c/span\u003eA \u0026amp; B). We found that leukemic cells move faster in the cell cycle and spend less time in the G0 / G1 phase than normal cell lines (MRC-5). Additionally, the percentage of the cells were higher in in the S phase than in the normal cell line. This cell cycle pattern in leukemia cell lines indicates its proliferative nature compared to the normal cell line. We also confirmed the proliferative nature of these cell lines by studying the expression of the Ki67 marker. All the leukemia cell lines were exhibiting more Ki67 expression suggesting significantly more proliferative than the normal cell line (MRC-5), with the HL60 cell line exhibiting the greatest Ki67 expression compared to others leukemia cell lines, indicating its more proliferative and aggressive phenotype nature (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e5\u003c/span\u003eC \u0026amp; D). To further evaluate the differential severity of the leukemia cell lines, we evaluated the expression of Caspase-3, an apoptotic marker whose expression goes down in severe AML cases (\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e). We observed that the HL60 cell line exhibited lower expression than the other leukemia cell lines, suggesting resistance to apoptosis in HL60 cells and accumulation of tumor cells compared to other cell lines, increasing the severity (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e5\u003c/span\u003eE \u0026amp; F). Finally, we confirmed the severity of the disease by assessing the expression of the tumorogenic/stem cell marker CD44\u003csup\u003e+\u003c/sup\u003e in different cell lines. Interestingly, we found that the HL60 cell line exhibited significantly greater expression than the other leukemia cell lines, confirming the more agressive nature of the HL60 cell line, even though all the leukemia lines highly expressed c-MPL. However, the MRC-5 cell line showed even greater expression of CD44\u003csup\u003e+\u003c/sup\u003e than the leukemia cell lines due to its mesenchymal stem cell properties (\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e) (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e5\u003c/span\u003eG \u0026amp; H). Taken all these findings together these results prove that although c-MPL is over-expressed in all leukemia cell lines, though there is a difference in severity between them-reflected by proliferation, apoptotic resistance and stemness markers. Compared with the other leukemia cell lines, the HL60 cell line exhibited the highest expression of severity markers (with high Ki67 and CD44\u003csup\u003e+\u003c/sup\u003e expression). This all indicates that, even with high c-MPL expression, the severity of leukemia cell lines varies, which justifies the presence of other factors that play a role in severity.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\u003ch2\u003e3.6 Overexpression of c-MPL-FL exacerbates leukemic conditions through activation of the STAT pathway.\u003c/h2\u003e\u003cp\u003eAfter establishing the association between c-MPL and leukemia and between the severity of leukemia and c-MPL expression, we focused on the c-MPL isoforms, \u003cem\u003ei.e.\u003c/em\u003e, c-MPL-FL (full-length) and c-MPL-TR (truncated), to address the differences in severity. We identified four isoforms of c-MPL through western blot analysis and found that c-MPL-FL expression was notably greater in leukemia cell lines than in noncancerous MRC5 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e6\u003c/span\u003eA). Furthermore, c-MPL-FL was greater than c-MPL-TR in all the leukemia lines, which was not observed in the case of MRC5. Specifically, c-MPL-FL levels were significantly elevated in the HL60 cell line compared to the c-MPL-TR cell line and in the other leukemia cell lines (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e6\u003c/span\u003e. A, B). These data also confirmed that the ratio of c-MPL-FL to c-MPL-TR is greater in the HL60 cell line than in the other leukemia lines or in the noncancerous line. This suggests that c-MPL-FL plays a more prominent role in leukemia pathology. To further confirm these findings, we performed RT-PCR analysis of c-MPL isoforms with isoform-specific primers. The results showed that the expression of c-MPL, particularly c-MPL-FL transcripts, was greater in leukemia cell lines than in normal cell lines. These results again showed that aamong all the leukemia cell lines, HL60 exhibited the highest levels of c-MPL-FL, confirming the western blot results (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e6\u003c/span\u003eC). Conversely, the expression of the truncated isoform c-MPL-TR was significantly lower. This increase in the imbalance between the expression of c-MPL isoforms contributes to the aggressiveness of leukemia. We further wanted to determine the relation between c-MPL-FL and disease severity by studying STAT-5, a critical downstream molecule activated by the dimer of c-MPL-FL, which, when phosphorylated to pSTAT-5, acts as a transcription factor promoting cell proliferation (\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e). We examined its expression through western blotting experiments and immunophenotyping. In both experiments, we found that compared to the normal MRC-5 cell line, the levels of STAT-5 of PSTAT-5 in the leukemia cell lines were greater, (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e6\u003c/span\u003eD, E, F, G, H, I). While inactive STAT levels were relatively low in HL60 cells, the levels of pSTAT5 were significantly higher in this cell line than in the other cell lines. This indicates a strong correlation between c-MPL-FL and STAT5 activation and cell proliferation in terms of leukemia severity. In contrast, both inactive and phosphorylated STAT levels were low in normal MRC-5 cells, suggesting that the activation of STAT-5 is linked to the proliferation of cancerous cells.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e"},{"header":"4. Discussion and Conclusion","content":"\u003cp\u003eThe present study was performed to corelate the role of c-MPL isoforms in modulating the severity of Acute Myeloid Leukemia (AML). C-MPL is key factor to regulate hematopoietic stem cell maintenance and megakaryopoiesis. Dysregulation of c-MPL has been found in various malignant haematological disorders. Through this study, we established a correlation between the hematopoietic receptor c-MPL and AML through in vitro and in silico studies. Furthermore, our findings suggest that the pathogenesis of AML can be predicted by high c-MPL expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Our findings also demonstrate that overexpression of c-MPL in AML may contribute to severity by changing the immune microenvironment, promoting cell such as M2 macrophages associated with enhancing leukemogenesis and chemotherapy resistance while reducing active cell such as T cells and dendritic cells involved in the active immunity by recognising tumor cells for destruction (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Our analysis also revealed that while c-MPL levels corelates with severity in eosinophils, the association is contradictory for memory B cells and M1 macrophages. This difference points towards a possible role of c-MPL isoform balance, in increasing the disease severity and prognosis (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Our study also demonstrated that there is high expression of c-MPL in leukemic cell lines with the highest in HL60 cell line corresponding to M2 FAB stage which suggests that c-MPL might play an important role in disease progression (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e4\u003c/span\u003e) .We have also observed that, even though there is high expression of c-MPL in certain AML cases (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e3\u003c/span\u003e), but the severity of AML condition increases with increasing c-MPL-FL isoform levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e6\u003c/span\u003e). Previous studies have suggested that regulating the two isomers of c-MPL plays an important role in megakaryocyte development and hematopoiesis (\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e). A knockout model of the spliceosome-associated Ott1 gene demonstrated that Ott1 binds to c-MPL pre-mRNA and regulates splicing between c-MPL-TR and c-MPL-FL in HSCs by regulating epigenetic marks. The activation of STAT5, a critical downstream effector of the TPO/MPL axis, is dramatically reduced in MPL-stimulated Ott1-/- HSCs. HSCs expressing a greater ratio of c-MPL-TR:c-MPL-FL have dramatically reduced engraftment when transplanted (\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e). Through this work, we have proved that the tumorogenic markers (Ki67, CD44) increase in those leukemic conditions that contain high expression of c-MPL-FL isoform (Figs.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e5\u003c/span\u003e \u0026amp; \u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e6\u003c/span\u003e). An increase in the c-MPL-FL isoform disturbs the stoichiometric balance of c-MPL-FL and c-MPL-TR on HSCs, leading to a more proliferative state (\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e). A high level of c-MPL-FL results in the generation of more c-MPL dimers, which internalize more TPO to activate the JAK-STAT pathway and proliferate HSCs randomly, resulting in more severe conditions (\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e). On the contrary, the truncated c-MPL can lead to deregulation of proliferative hematopoietic stem cells, and as a result, it can maintain the reservoir for hematopoietic stem cells in the G0 phase, which can play a major role in preventing megakaryocyte malignancies (\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e). We have also observed that high levels of pSTAT5 in leukemia cells with high c-MPL-FL, even in the absence of TPO, which the ligand typically require for c-MPL activation (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e6\u003c/span\u003e). This suggests that the STAT pathway is constitutively activated in leukemia cells in which there is abundant c-MPL-FL, likely due to the formation of ample c-MPL dimers in the absence of TPO, which results in continuous signalling through the c-MPL/JAK/STAT pathway. c-MPL-TR and c-MPL-FL are conserved among different species, which confirms the importance of their presence and role in hematopoiesis (\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e). Our observations also confirmed the role of the ratio of c-MPL-TR to c-MPL-FL in maintaining the G0 and proliferative states of HSCs. In the case of malignancies due to defects in hematopoiesis, the balance between the two isoforms is affected. This loss of the stoichiometric balance of c-MPL-FL and c-MPL-TR may drive the uncontrolled cell proliferation characteristic of leukemia, making c-MPL-FL a critical target for understanding the disease mechanisms and potentially developing targeted therapies.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments:\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;We would like to acknowledge Yenepoya Deemed to be a University for providing the Seed grant project and the facility to carry out the research and partially providing the fellowship to Mr. Amjad Hussain to carry out the research activities. We would also like to acknowledge the Indian Council of Medical Research (ICMR) for providing the fellowship to AH. We would like to acknowledge Ms. Sushma Atri for helping with the setting up of some experiments. We also acknowledge UCSC Xena browser for providing needful information and visualization of FAB classification of AML. Additionally, we acknowledge GEPIA \u0026nbsp;nad GEPIA2021 databases which enabled us to analyse gene expression among normal and cancer cases. \u0026nbsp;We also acknowledge GENT2 database for providing insights to compare the gene expression among different cancer subtypes.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMAH: Writing original draft, Data Curation, Conducting experiments, Analyzing, Referencing, and figures designing.\u003c/p\u003e\n\u003cp\u003eMK: Reviewing, Experiments conducting and editing of the figures.\u003c/p\u003e\n\u003cp\u003eSL: Conceptualization, Structuring, Funding acquisition, Supervision, Resources, Writing original draft, reviewing, Editing, Project Administration.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData available on request:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data supporting this study's findings will be available upon reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of Interest Statement:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSource of Funding: Funding:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe funding from ICMR (Indian Council of Medical Research) to SL (Project No.-5/13/31/2018/NCD-III) was received for executing the study and performing the related research activities. We would also like to mention the Seed grant project to SL (YU/Seed grant/132-2022) by the Yenepoya (Deemed to be) University for providing the initial laboratory setup.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eSaultz JN, Garzon R (2016) Acute myeloid leukemia: a concise review. Journal of clinical medicine, 5(3), p.33\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDe Kouchkovsky I, Abdul-Hay M (2016) Acute myeloid leukemia: a comprehensive review and 2016 update. Blood cancer J 6(7):e441\u0026ndash;e441\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDrachman JG (2000) Role of thrombopoietin in hematopoietic stem cell and progenitor regulation. Curr Opin Hematol 7(3):183\u0026ndash;190\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHitchcock IS, Hafer M, Sangkhae V, Tucker JA (2021) The thrombopoietin receptor: revisiting the master regulator of platelet production. Platelets 32(6):770\u0026ndash;778\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePikman Y, Lee BH, Mercher T, McDowell E, Ebert BL, Gozo M, Cuker A, Wernig G, Moore S, Galinsky I, DeAngelo DJ (2006) MPLW515L is a novel somatic activating mutation in myelofibrosis with myeloid metaplasia. PLoS Med 3(7):e270\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDing J, Komatsu H, Wakita A, Kato-Uranishi M, Ito M, Satoh A, Tsuboi K, Nitta M, Miyazaki H, Iida S, Ueda R (2004) Familial essential thrombocythemia associated with a dominant-positive activating mutation of the c-MPL gene, which encodes for the receptor for thrombopoietin. Blood 103(11):4198\u0026ndash;4200\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang T, Wang Z, Yang R (2011) Thrombopoietic growth factors in the treatment of immune thrombocytopenic purpura. Crit Rev Oncol/Hematol 77(3):172\u0026ndash;183\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDuensing S, Duensing A, Meran JG, Kreft A, B\u0026uuml;sche G, Ganser A, Georgii A (1999) Molecular detection of c-mpl thrombopoietin receptor gene expression in chronic myeloproliferative disorders. Molecular Pathology, 52(3), p.146\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBridgford JL, Lee SM, Lee CM, Guglielmelli P, Rumi E, Pietra D, Wilcox S, Chhabra Y, Rubin AF, Cazzola M, Vannucchi AM (2020) Novel drivers and modifiers of MPL-dependent oncogenic transformation identified by deep mutational scanning. Blood J Am Soc Hematol 135(4):287\u0026ndash;292\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChen Y, Xie J, Shen Z, Shi J, Chen S, Wang G (2022) Clinical and molecular characteristics of acute myeloid leukemia with MPL mutation. Hematology 27(1):530\u0026ndash;534\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHe X, Chen Z, Jiang Y, Qiu X, Zhao X (2013) Different mutations of the human c-mpl gene indicate distinct haematopoietic diseases. J Hematol Oncol 6:1\u0026ndash;8\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNg AP, Kauppi M, Metcalf D, Hyland CD, Josefsson EC, Lebois M, Zhang JG, Baldwin TM, Di Rago L, Hilton DJ, Alexander WS (2014) Mpl expression on megakaryocytes and platelets is dispensable for thrombopoiesis but essential to prevent myeloproliferation. Proceedings of the National Academy of Sciences, 111(16), pp.5884\u0026ndash;5889\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYu P, Qiu SW, Rao Q, Lin D, Xing HY, Tang KJ, Tian Z, Wang M, Wang JX (2012) Expression of c-MPL in leukemic stem cells from acute myeloid leukemia patients. Zhongguo shi yan xue ye xue za zhi. 20(5):1052\u0026ndash;1055\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLi H, Zhao N, Li Y, Xing H, Chen S, Xu Y, Tang K, Tian Z, Wang M, Rao Q, Wang J (2018) c-MPL is a candidate surface marker and confers self-renewal, quiescence, chemotherapy resistance, and leukemia initiation potential in leukemia stem cells. Stem Cells 36(11):1685\u0026ndash;1696\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAlbitar M, Manshouri T, Kantarjian H, Keating M, Estrov Z, Faber J, Freireich EJ, Pierce S, Estey E (1999) Correlation between lower c-mpl protein expression and favorable cytogenetic groups in acute myeloid leukemia. Leuk Res 23(1):63\u0026ndash;69\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang JY, Yu P, Chen S, Xing H, Chen Y, Wang M, Tang K, Tian Z, Rao Q, Wang J (2013) Activation of Rac1 GTPase promotes leukemia cell chemotherapy resistance, quiescence and niche interaction. Mol Oncol 7(5):907\u0026ndash;916\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKatheeja MN, Das SP, Das R, Laha S (2023) BRCA1 interactors, RAD50 and BRIP1, as prognostic markers for triple-negative breast cancer severity. Frontiers in Genetics, 14, p.1035052\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAdel A, Djida AA, Hamid N, Lila BH, Souhil T, Abderrezak G, Idir B TRIzol-Based RNA extraction for detection protocol for SARS-CoV-2 of the coronavirus Disease 2019. New Microbes and New Infections\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHajd\u0026uacute;ch M, Dr\u0026aacute;bek J (eds) (2021) Laboratory Techniques in Cellular and Molecular Medicine. Palacky University Olomouc\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTang Z, Li C, Kang B, Gao G, Li C, Zhang Z (2017) GEPIA: a web server for cancer and normal gene expression profiling and interactive analyses. Nucleic Acids Res 45(W1):W98\u0026ndash;W102\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePark SJ, Yoon BH, Kim SK, Kim SY (2019) GENT2: an updated gene expression database for normal and tumor tissues. BMC Med Genom 12(Suppl 5):101\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSkopek R, Palusińska M, Kaczor-Keller K, Pingwara R, Papierniak-Wyglądała A, Schenk T, Lewicki S, Zelent A, Szymański Ł (2023) Choosing the right cell line for acute myeloid leukemia (AML) research. International journal of molecular sciences, 24(6), p.5377\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGoldman MJ, Craft B, Hastie M, Repečka K, McDade F, Kamath A, Banerjee A, Luo Y, Rogers D, Brooks AN, Zhu J (2020) Visualizing and interpreting cancer genomics data via the Xena platform. Nat Biotechnol 38(6):675\u0026ndash;678\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLi C, Tang Z, Zhang W, Ye Z, Liu F (2021) GEPIA2021: integrating multiple deconvolution-based analysis into GEPIA. Nucleic Acids Res 49(W1):W242\u0026ndash;W246\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDe Koning W, Latifi D, Li Y, Van Eijck CH, Stubbs AP, Mustafa DA (2021) Identification, validation, and utilization of immune cells in pancreatic ductal adenocarcinoma based on marker genes. Frontiers in immunology, \u003cem\u003e12\u003c/em\u003e, p.649061\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHorna P, Nowakowski G, Endell J, Boxhammer R (2019) Comparative assessment of surface CD19 and CD20 expression on B-cell lymphomas from clinical biopsies: implications for targeted therapies. Blood, 134, p.5345\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCamacho V, Kuznetsova V, Welner RS (2021) Inflammatory cytokines shape an altered immune response during myeloid malignancies. Front Immunol 12:772408\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZanna MY, Yasmin AR, Omar AR, Arshad SS, Mariatulqabtiah AR, Nur-Fazila SH, Mahiza MIN (2021) Review of dendritic cells, their role in clinical immunology, and distribution in various animal species. Int J Mol Sci 22(15):8044\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePerzolli A, Koedijk JB, Zwaan CM, Heidenreich O (2024) Targeting the innate immune system in pediatric and adult AML. Leukemia 38(6):1191\u0026ndash;1201\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNishimura CD, Brenner DA, Mukherjee M, Hirsch RA, Ott L, Wu MF, Liu H, Dakhova O, Orange JS, Brenner MK, Lin CY (2017) c-MPL provides tumor-targeted T-cell receptor-transgenic T cells with costimulation and cytokine signals. Blood. J Am Soc Hematol 130(25):2739\u0026ndash;2749\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eIijima K, Sugita K, Inukai T, Goi K, Tezuka T, Uno K, Sato H, Kagami K, Nakazawa S (2000) Expression of thrombopoietin receptor and its functional role in human B-precursor leukemia cells with 11q23 translocation or Philadelphia chromosome. Leukemia 14(9):1598\u0026ndash;1605\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKumamoto T, Azuma E, Tanaka M, Qi J, Hirayama M, Zhang SL, Kobayashi M, Iwamoto S, Komada Y, Yamamoto H, Nakashima K (1999) Human dendritic cells express the thrombopoietin receptor, c-Mpl. Br J Haematol 105(4):1025\u0026ndash;1033\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGhinassi B, Zingariello M, Martelli F, Lorenzini R, Vannucchi AM, Rana RA, Nishikawa M, Migliaccio G, Mascarenhas J, Migliaccio AR (2009) Increased differentiation of dermal mast cells in mice lacking the Mpl gene. Stem Cells Dev 18(7):1081\u0026ndash;1092\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMaktoof SA, Al-Ammar NS, Al-Kashwan TA, Jumaa AK, Bader P, Kreyenberg H (2024) The expressions of myeloid differentiation and non-lineage specific differentiation antigens among FAB subtypes of acute myeloid leukemia in Iraqi patients. Romanian Med J, \u003cem\u003e71\u003c/em\u003e(4)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJensen HA, Yourish HB, Bunaciu RP, Varner JD, Yen A (2015) Induced myelomonocytic differentiation in leukemia cells is accompanied by noncanonical transcription factor expression. FEBS open bio 5:789\u0026ndash;800\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYoshihara H, Arai F, Hosokawa K, Hagiwara T, Takubo K, Nakamura Y, Gomei Y, Iwasaki H, Matsuoka S, Miyamoto K, Miyazaki H (2007) Thrombopoietin/MPL signaling regulates hematopoietic stem cell quiescence and interaction with the osteoblastic niche. Cell Stem Cell 1(6):685\u0026ndash;697\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWu Y, Zhao B, Chen X, Geng X, Zhang Z (2022) Circ_0009910 sponges miR-491‐5p to promote acute myeloid leukemia progression through modulating B4GALT5 expression and PI3K/AKT signaling pathway. Int J Lab Hematol 44(2):320\u0026ndash;332\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhang K, Na T, Wang L, Gao Q, Yin W, Wang J, Yuan BZ (2014) Human diploid MRC-5 cells exhibit several critical properties of human umbilical cord-derived mesenchymal stem cells. Vaccine 32(50):6820\u0026ndash;6827\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang Z, Bunting KD (2013) STAT5 in hematopoietic stem cell biology and transplantation. Jak-stat 2(4):e27159\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKaushansky K (2005) The molecular mechanisms that control thrombopoiesis. The J Clin Invest 115(12):3339\u0026ndash;3347\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eXiao N, Laha S, Das SP, Morlock K, Jesneck JL, Raffel GD (2015) Ott1 (Rbm15) regulates thrombopoietin response in hematopoietic stem cells through alternative splicing of c-Mpl. Blood J Am Soc Hematol 125(6):941\u0026ndash;948\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLi F, Xiong Y, Yang M, Chen P, Zhang J, Wang Q, Xu M, Wang Y, He Z, Zhao X, Huang J (2022) c-Mpl-del, a c-Mpl alternative splicing isoform, promotes AMKL progression and chemoresistance. Cell Death \u0026amp; Disease, 13(10), p.869\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSpivak JL, Moliterno AR (2021) The thrombopoietin receptor, MPL, is a therapeutic target of opportunity in the MPN. Front Oncol 11:641613\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSkoda RC, Seldin DC, Chiang MK, Peichel CL, Vogt TF, Leder P (1993) Murine c-mpl: a member of the hematopoietic growth factor receptor superfamily that transduces a proliferative signal. EMBO J 12(7):2645\u0026ndash;2653\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"},{"header":"Supplementary Figure","content":"\u003cp\u003eSupplementary figure 1 is not available with this version.\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"c-MPL, AML, STAT5, c-MPL isoforms, Severity, HSC","lastPublishedDoi":"10.21203/rs.3.rs-7204532/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7204532/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground: \u003c/strong\u003eAcute myeloid leukemia (AML) is a hematopoietic defect and various clinical studies confirms that the development of this condition has a correlation with the hematopoietic receptor c-MPL. The function of MPL is mostly regulated by the crosstalk and stoichiometry of the different isoforms of c-MPL. Though expression of c-MPL in AML cases are studied, the regulation of the isoforms, their balance and mechanism of action in conditions like AML needs to be revealed, to develop c-MPL as a therapeutic target for AML cases. Through this work we have reconfirmed that c-MPL expression increases in AML, but the severity of the condition is independent of the total MPL expression.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethods:\u003c/strong\u003e Molecular techniques like qRT-PCR, western blotting, immunophenotyping, and immunofluorescence were used to investigate the expression of c-MPL isoforms and their correlation with AML severity. The significance of the work depends on the statistical analysis of the experimental and technical triplicates.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusion: \u003c/strong\u003e\u0026nbsp;We have confirmed that the severity of the AML condition directly depends on the expression of MPL-FL isoform, more precisely, on the increase in the ration of MPL-FL/MPL-TR. Furthermore, we have observed that with increase in MPL-FL isoforms, inactive STAT5 converts to active pSTAT5 to promote the transition of HSC G0 state to HSC proliferative state to bring in the severity.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eInterpretation:\u003c/strong\u003eOur study provides compelling evidence to establish the regulatory role of c-MPL isoforms, particularly MPL-FL in bringing in severity in AML conditions. This finding is a significant step towards developing c-MPL as a therapeutic target for AML cases.\u003c/p\u003e","manuscriptTitle":"The isoforms of c-MPL plays an instrumental role in regulating the severity of leukemic conditions","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-08-06 09:21:12","doi":"10.21203/rs.3.rs-7204532/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"4a1a30e3-5f46-4183-9e26-fe8984a49fcd","owner":[],"postedDate":"August 6th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-08-13T09:39:37+00:00","versionOfRecord":[],"versionCreatedAt":"2025-08-06 09:21:12","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7204532","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7204532","identity":"rs-7204532","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}