Morning vs. Evening: The Temporal Differences of Ginger's Efficacy in Lung | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Morning vs. Evening: The Temporal Differences of Ginger's Efficacy in Lung Yu Wu, Yaxin Li, Wenqing Lv, Qian Shen, Yanjun Zhang, Pengwei Zhuang, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8913616/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 6 You are reading this latest preprint version Abstract Ginger, a substance utilized in both culinary and medicinal contexts, demonstrates significant protective effects on pulmonary health and mitigates lung injury. Although numerous studies propose that the timing of ginger consumption may result in varied therapeutic outcomes, these propositions have yet to be empirically validated. This study represents the first systematic exploration of the temporal effects and underlying mechanisms associated with morning versus evening ginger administration in both healthy and lung-injured murine models. In comparison to the control group, evening consumption of ginger markedly affected lung function, inflammatory cytokine levels, and clock gene expression in healthy mice, whereas morning consumption did not produce significant effects. Conversely, morning administration of ginger ameliorated the symptoms of bleomycin-induced lung injury and altered clock gene expression, while evening administration aggravated lung damage. In Per2-knockout (Per2-KO) mice, the distinct effects of morning versus evening ginger intake were nullified. Proteomic analysis identified Sytl2 and Cluap1 as potential key proteins mediating the differential responses to ginger based on the time of administration. The study's findings underscore the importance of considering intake timing in both clinical applications and daily use of ginger to optimize its safety and therapeutic efficacy. Health sciences/Diseases Biological sciences/Drug discovery Health sciences/Medical research Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Circadian rhythms represent a fundamental biological mechanism that facilitates organisms' adaptation to daily light-dark cycles, thereby regulating diurnal fluctuations in essential physiological processes, including sleep-wake cycles [ 16 ] , thermoregulation [ 9 ] , metabolic pathways [ 2 ] , and hormonal balance [ 26 ] . Various tissues and organs, such as the liver and lungs, possess autonomous endogenous circadian clock mechanisms that can detect and synchronize with environmental circadian cycles [ 25 ] . Furthermore, circadian rhythms exert a significant impact on drug absorption, metabolism, bioavailability, and related in vivo processes [ 23 ][ 24 ] . For example, administering triamcinolone, a glucocorticoid, at 3:00 PM not only avoids exacerbating systemic adverse effects but also effectively controls nocturnal asthma symptoms [ 20 ] . Similarly, the nocturnal administration of anticholinergic agents, such as tiotropium bromide, can substantially enhance bronchodilatory effects by inhibiting the circadian peak of vagal nerve activity [ 5 ] . These chronopharmacological strategies show promise as crucial components of future personalized medicine, facilitating more precise and optimized therapeutic interventions. The pulmonary system demonstrates a significant circadian rhythmic organization, characterized by cell-autonomous oscillators that drive rhythmic variations in functional parameters and the expression of core clock genes [ 18 ] .The timing of drug administration influences the therapeutic outcomes in lung diseases: evening administration of tobramycin in a pediatric pulmonary fibrosis trial was associated with a higher risk of nephrotoxicity compared to morning administration [ 20 ] , while morning administration of ciclesonide preferentially improved peak expiratory flow (PEF) [ 14 ] . Ginger ( Zingiber officinale Roscoe ), recognized for its dual role as both a medicinal and food herb, has attracted attention due to its diverse bioactivities. Contemporary pharmacological studies have confirmed its immunomodulatory [ 13 ] , anti-inflammatory [ 36 ] , antioxidant [ 35 ] ,non-alcoholic fatty liver disease preventive [ 15 ] , and cholesterol-lowering effects [ 30 ] . In Traditional Chinese Medicine, ginger is believed to possess pungent and warm properties, making it more suitable for consumption during the daytime, a notion reflected in the folk saying "avoid ginger after noon." Our preliminary research [ 32 ] identified variations in thermogenesis induced by ginger in healthy mice, depending on the time of day, thereby indicating potential chronotherapeutic properties that merit systematic exploration. In this study, both normal and bleomycin-induced mice were utilized to evaluate lung-related indices under both physiological and pathological conditions, with the aim of further investigating the temporal differences in the effects of ginger between morning and evening. Concurrently, we sought to identify key proteins responsible for these temporal variations. The findings are expected to provide scientific evidence for optimizing the timing of ginger dietary interventions and for developing precision nutritional strategies. Materials and methods Reagents Ginger was acquired from Sichuan, identified as Zingiber officinale Rosc by Professor at Tianjin University of Traditional Chinese Medicine. Bleomycin was purchased from Beijing Solaibao Technology Co., LTD. Antibodies were purchased from Biolegend (USA). Antibody Details were shown in Table 1 . Table 1 Name, source, and cat. number of antibodies used in the experiments. Antibodies Source Cat. number APC anti-mouse CD3 Biolegend 100235 PE anti-mouse CD4 Biolegend 100407 PE anti-mouse CD8a Biolegend 100707 FITC anti-mouse CD8a Biolegend 100706 APC anti-mouse CD19 Biolegend 115511 PE anti-mouse CD19 Biolegend 115508 FITC anti-mouse CD45 Biolegend 157214 β-actin Proteintech 66009-1-Ig Cluap1 Proteintech 17470-1-AP Sytl2 Proteintech 12359-1-AP Goat anti-rabbit IgG Beyotime A0208 Goat anti-mouse IgG Beyotime A0258 Preparation of water extract of ginger For the preparation, 39 g of sliced ginger were combined with 400 ml of pure water and decocted for 30 minutes. The mixture was then filtered to collect the filtrate, and an additional 300 ml of pure water was added to the residue. This was decocted for another 20 minutes, after which the filtrates were combined and concentrated to a volume of 300 ml, resulting in a concentration of 0.325 g/ml of ginger. Animals and treatment Eight-week-old male C57BL/6 mice (18–22 g) were procured from Beijing Huafukang Biotechnology Co., Ltd., under the laboratory animal production license number SCXK (Jing) 2019-0008. The experimental protocols received approval from the Animal Ethics Committee of Tianjin University of Traditional Chinese Medicine (approval number: TCM-LAEC2023124). In a normal mouse experiment, 40 mice were randomly assigned to four groups, each consisting of 10 mice: the morning control (MC) group, the morning ginger (MG) group, the evening control (EC) group, and the evening ginger (EG) group. The MG and EG groups received a ginger water extract (0.1 ml/10 g) via gavage once daily at either 7:00 AM or 7:00 PM for a period of 14 days. The control groups were administered an equivalent volume of pure water via gavage. In the bleomycin-induced mice, a total of 60 mice were randomly allocated into six distinct groups: the morning control (MC) group, the morning model (MM) group, the morning ginger (MG) group, the evening control (EC) group, the evening model (EM) group, and the evening ginger (EG) group. To establish an acute lung injury model, bleomycin (2.5 mg/kg, dissolved in PBS) was administered via tracheal instillation to the mice in the MM, MG, EM, and EG groups, whereas an equivalent volume of PBS was administered to the MC and EC groups. The MG group received ginger extract via gavage once daily at 7:00 AM, while the MM and MC groups were given pure water. Similarly, the EG group was administered ginger extract via gavage once daily at 7:00 PM, with the EM and EC groups receiving pure water. This treatment regimen was maintained for 14 consecutive days. Per2 knockout mice were sourced from the Cambridge-SU Genomic Resource Center (CAM-SU GRC) and were bred and maintained in the IVC feeding system at the Animal Center of Tianjin University of Chinese Medicine. The animal grouping and treatment protocols are the same as those used for the mice with lung injury. Noninvasive lung function Respiratory parameters, including minute ventilation volume (MV), tidal volume (TV), respiratory rate (F), inspiratory duration (TI), expiratory duration (TE), and the bronchoconstriction parameter (Pech), were assessed using the EMKA Pulmonary System (EMKA, France) during periods of wakefulness and free movement. The average value measured over a 10-minute period was used as the statistic. Micro-CT Prior to sampling the mice, lung scans were conducted utilizing a high-resolution micro-CT scanner (Quantum GX2, PerkinElmer, USA). Following the administration of anesthesia with isoflurane, the mice were positioned in a prone orientation on the scanning bed. Each scan was executed over a duration of 2 minutes with a 360° rotation. Subsequently, lung injury scoring was conducted based on the micro-CT images. A score of 0 denotes no damage, a score of 1 indicates damage confined to 1/4 of the lung area, a score of 2 signifies damage confined to 1/2 of the lung area, a score of 3 represents damage confined to 3/4 of the lung area, and a score of 4 indicates damage encompassing the entire lung area. Histopathology The lung tissue was then fixed in 4% paraformaldehyde and embedded in paraffin wax following standard protocols. Thereafter, 3 µm thick sections were obtained using a microtome. These sections were stained with hematoxylin and eosin (H&E) and subsequently imaged under a microscope to examine the pathological changes. Flow cytometry Fresh lung tissue was sectioned and subjected to enzymatic treatment with collagenase I and deoxyribonuclease I, followed by incubation at 37 ℃ for one hour. Subsequently, the samples underwent centrifugation at 4000 rpm for eight minutes, after which 1 ml of red cell lysate was added for re-suspension and incubated on ice for four minutes. The samples were again centrifuged at 4000 rpm for eight minutes, and 1 ml of Cell Staining Buffer containing 25 µl of deoxyribonuclease I was added, followed by incubation on ice for ten minutes. The stained samples were centrifuged at 4000 rpm for eight minutes, and the Cell Staining Buffer was removed. The resulting pellet was resuspended in 1.5 ml of a centrifuge tube and subsequently counted. Following cell counting, 100 µl of a sealing solution (comprising 0.5 µl of CD16/32) was added for sealing, with incubation for ten minutes. An antibody was then introduced and incubated for 30 minutes in the absence of light. The staining process involved centrifugation at 4000 rpm for eight minutes, and cell staining was repeated using a 400-mesh screen prior to analysis by flow cytometry. In the ginger administration experiment conducted on normal mice, CD45-FITC, CD3-APC, and CD4-PE were employed to identify CD4 + T cells, whereas CD45-FITC, CD3-APC, and CD8-PE were utilized for CD8 + T cells. B cells were labeled using CD45-FITC and CD19-APC. In the experiment involving ginger administration within a murine lung injury model, CD4 + and CD8 + T cells were analyzed using CD3-APC, CD4-PE, and CD8-FITC labeling, while B cells were identified with CD45-FITC and CD19-PE markers. The study quantified the percentages of CD4 + and CD8 + T cells within the CD3 + T cell population and assessed the proportion of B cells among the total immune cell population. Real-time RT-PCR Real-time RT-PCR Total RNA was reverse transcribed utilizing Promega™ Reverse Transcriptase, followed by quantitative real-time PCR using SYBR qPCR premix (Tiangen). mRNA expression levels were normalized to GAPDH expression for each gene. The primers were designed and synthesized by Shanghai Sangon Biotechnology Co., Ltd., with sequences provided in the Table 2 . Table 2 Names and sequences of the primers used in the PCR experiments Gene Gene sequence (5 '→3') Tnf-α TGCACCAACTGCTTAGC GGCATGGACTGTGGTCATGAG IL-6 CTTCTTGGGACTGATGCTGGTGAC AGGTCTGTTGGGAGTGGTATCCTC Bmal1 GGACTTCGCCTCTACCTGTTCAAAG TCGTTGTCTGGCTCATTGTCTTCG Clock TGGTGACTGCCTATCCTACCTTCG TGCTGCTGCTGCTGCTGTTG Per1 CCTGGGCTCTGGGTCTGGTTC TTGCTTGTATGGCTGCTCTGACTG Per2 GCTGCGGATGCTCGTGGAATC GGTTGTGCTCTGCCTCTGTCATC Per3 AAAGATCCTGACCTCGCCCTACG GTGCTTCTGCCTCTCGCTTCC Cry1 GCCAGCAGACACCATCACATCAG CCAGGGAAGGAACGCCATATTTCTC Cry2 TGGACAAGCACTTGGAACGGAAG GTAGAAGAGGCGGCAGGAGAGG Rev-erbα CGTCATCCTCTTCATCCTCCTCCTC CTTGGTAATGTTGCTTGTGCCCTTG Rev-erbβ TGACCAGAGCCCACAAGGATACC TTCCTGGGAATCCGTTCTCCTCTC Gapdh GTGGCAAAGTGGAGATTGTTG CGTTGAATTTGCCGTGAGTG Western blot Following lung tissue homogenization, protein concentration was determined using a BCA Protein Assay Kit. Proteins were separated via SDS-PAGE and transferred to polyvinylidene fluoride (PVDF) membranes. The membranes were subsequently blocked and incubated overnight at 4°C with primary antibodies targeting β-actin, Cluap1, and Sytl2. The membranes were then incubated with a goat anti-rabbit IgG secondary antibody for 1.5 hours at room temperature. Protein band signals were detected using an ultra-sensitive multifunctional imager (Amersham Imager 600, USA). The relative intensity of each protein band was normalized to β-actin levels. Statistical analysis Data analysis was performed using SPSS 22.0 software. The results are expressed as mean ± SEM. Statistical analysis included one-way analysis of variance, the Bonferroni multiple comparison test, and Student's t-test. A significance level of P < 0.05 was considered statistically significant. Results Effects of morning or evening ginger intake on lung tissues of healthy mice This study initially investigated the differences in lung tissues of healthy mice following gavage administration of ginger in the morning versus the evening. As illustrated in Fig. 1 , no significant differences were detected in pulmonary function indices, pulmonary immune cell counts, or inflammatory cytokine expression between the morning gavage (MG) and morning control (MC) groups. In contrast, when compared to the evening control (EC) group, the evening gavage (EG) group demonstrated significantly reduced minute ventilation (MV), tidal volume (TV), and flow rate (F), along with significantly increased inspiratory time (TI), expiratory time (TE), and enhanced pause (Penh). Furthermore, the EG group showed a reduction in the proportions of CD8 + T cells and B cells in lung tissues, as well as increased expression of the inflammatory cytokines IL-6 and TNF-α. These findings collectively suggest that ginger consumption in the evening may have specific effects on lung tissues. However, ginger intake, regardless of whether it occurs in the morning or evening, did not result in morphological changes in lung tissues. As depicted in Fig. 1 E, imaging analyses indicated that the lung fields of mice in all groups were fully visualized, with well-expanded lung tissues and distinct architectural textures. HE staining further demonstrated intact lung tissue architecture and normal alveolar morphology, with no observable signs of inflammatory cell infiltration or interstitial congestion. Clock gene expression in healthy mice Considering the circadian rhythm fluctuations observed in lung tissues, this study investigates whether the differential effects of ginger on lung tissues between morning and evening correlate with the expression of clock genes. Real-time RT-PCR was utilized to quantify the expression levels of nine key clock genes in lung tissues. As depicted in Fig. 2 , the administration of ginger in the morning did not significantly affect the expression of these clock genes. In contrast, evening administration of ginger resulted in a significant reduction in the expression of clock genes Per1/2/3 , Cry1/2 , and Rev-Erbα/β . Effects of morning or evening ginger intake on lung tissues of bleomycin-induced mice Since different administration timings exert distinct effects on normal lung tissue, does such a difference also exist in injured lung tissue? To address this question, the present study further established a bleomycin-induced lung injury mouse model. The results are shown in Fig. 3 , after intratracheal instillation of bleomycin in mice, obvious lung injury manifestations were observed regardless of morning or evening administration, specifically including blurred lung tissue margins, thickened alveolar walls, and inflammatory cell infiltration. Meanwhile, significant changes were detected in lung function parameters, immune cell proportions, and inflammatory factor expression levels. Administration of ginger in the morning reversed bleomycin-induced lung injury via multiple pathways, including ameliorating lung tissue morphological and pathological changes, restoring lung function, and suppressing inflammatory factor expression. In sharp contrast, ginger administered in the evening not only failed to exert a protective effect on the lungs but also exacerbated lung injury to a certain extent, which resulted in severe impairment of lung morphological and structural integrity, marked deterioration of histopathological features, and a significant reduction in pulmonary ventilation function. Clock gene expression in bleomycin-induced mice We employed real-time RT-PCR technology to quantify the mRNA expression levels of clock genes in mouse lung tissues. The results are shown in Fig. 4 , after bleomycin induction, the mRNA expression of the vast majority of clock genes was significantly downregulated, whereas the expression of Bmal1 and Clock genes in the nighttime group was significantly upregulated. Compared with the MM group, morning administration of ginger significantly reversed the mRNA expression levels of Per2 , Per3 , Cry2 and Rev-Erbα genes in the MG group, resulting in an upward trend. In contrast, evening administration of ginger did not exert any significant effect on the expression levels of any clock genes. Circadian rhythm disruption abolishes the morning-evening differences in ginger's effects on lung injury Considering the observed discrepancy in the ameliorative effects of ginger on lung injury between morning and evening, as well as its impact on clock gene expression, this study further explored whether this variation is modulated by the circadian rhythm. To investigate this hypothesis, the study utilized clock gene knockout mice ( Per2 knockout mice), to assess the effects of ginger on lung function, lung histopathology, and inflammatory cytokine levels following bleomycin-induced lung injury. The findings revealed that (Fig. 5 ), in Per2 knockout mice, disruption of the circadian rhythm did not modify the effects of bleomycin-induced lung injury; however, it completely nullified the therapeutic benefits of ginger. Additionally, the morning-evening discrepancy in ginger intervention was eliminated. These results suggest that maintaining circadian homeostasis is essential for ginger to exert its protective effects against lung injury. Sytl2 and Cluap1 are key proteins responsible for the differences in efficacy of ginger between morning and evening The disruption of the circadian rhythm eliminated the lung-protective effects of ginger, yet this elimination did not exhibit a difference between morning and evening. Moreover, administering ginger in the morning modulated the expression of certain clock genes, whereas evening administration did not significantly affect these genes, suggesting that clock genes are not the primary targets responsible for the differential efficacy of ginger between morning and evening. To further investigate the mechanisms underlying this temporal efficacy variation, we employed label-free quantitative proteomics to systematically analyze the protein expression profiles in the lung tissues of mice with lung injury following morning or evening administration of ginger. As illustrated in Fig. 6 A, a hierarchical clustering heatmap revealed distinct protein expression patterns between the morning and evening ginger-treated groups and their respective control groups (MC vs. MM and EC vs. EM). To screen the key proteins, we initially identified differentially expressed proteins (DEPs, P < 0.05) in the MM-MC group (evening model vs. evening control) and the MG-MM group (morning treatment vs. evening model), resulting in 384 intersecting proteins identified through Venn diagram analysis. Given the pronounced therapeutic effect observed with morning administration of ginger, we focused on 223 proteins that were negatively regulated among these DEPs. Subsequently, we examined DEPs ( P < 0.05) in the EM-EC group (evening model vs. evening control) and the EG-EM group (evening treatment vs. evening model), identifying 322 intersecting DEPs. Considering that evening administration of ginger was associated with exacerbated lung injury, we selected 32 proteins that were positively regulated from these DEPs. A cross-analysis of the proteins negatively regulated in the morning and positively regulated in the evening highlighted CLUAP1 and SYTL2 as potential key proteins underlying the differential efficacy of ginger based on the time of administration. Mouse lung tissues were collected, and Western blot analysis was performed to determine the differential expression of CLUAP1 and SYTL2 proteins. As illustrated in Fig. 6 D, lung injury induced by bleomycin resulted in an upregulation of CLUAP1 expression and a downregulation of SYTL2 expression within the lung tissues of mice. Administration of ginger in the morning led to a decrease in CLUAP1 expression and an increase in SYTL2 expression, whereas evening administration further promoted the upregulation of CLUAP1 and exacerbated the downregulation of SYTL2. These findings are consistent with the proteomic analysis and corroborate the observed differences in the efficacy of ginger based on the time of administration. Discussion Ginger serves as both a prevalent culinary seasoning and a traditional medicinal herb within Chinese medicine, renowned for its extensive therapeutic applications. Traditional Chinese medicine underscores the importance of aligning medicinal consumption with temporal rhythms to harmonize with natural cycles and maintain the body's balance of yin and yang [ 37 ] . The folk dietary belief that ginger should not be consumed after noon is consistent with this principle. In our preliminary experiments with mice, we observed that the timing of ginger administration—morning versus evening—produces significant differences in its effects on the thermogenic capacity of normal mice. Specifically, administering ginger at night significantly enhances thermogenic capacity, whereas morning administration does not yield a similar effect [ 33 ] . Consequently, further investigation into the temporal effects of ginger administration and the optimization of its usage protocols is crucial for elucidating its clinical efficacy and ensuring medication safety. Recent pharmacological research has substantiated that ginger and preparations containing ginger demonstrates significant efficacy in mitigating acute asthma attacks, ameliorating dyspnea and chronic cough symptoms in patients with chronic obstructive pulmonary disease, and enhancing lung function-related parameters [ 10 ][ 21 ][ 22 ] . As a critical organ, the lung's physiological and pathological processes are influenced by circadian rhythms. Previous studies have indicated that the protective effect of ceramide-1-phosphate against High-altitude pulmonary edema by stabilizing circadian rhythms and maintaining mitochondrial dynamics [ 31 ] . In light of this, the current study concentrates on lung tissue to examine the differential effects of ginger administration in the morning versus the evening on both normal and lung-injured mice. The objective is to elucidate the temporal specificity of ginger's clinical application and establish guidelines for its administration in relation to circadian timing. Initially, we examined the differential impacts of morning vs. evening ginger consumption on lung tissue function and clock gene expression in normal mice. The findings indicated that, relative to the control group, morning ginger intake did not result in significant alterations in pulmonary respiratory function, the proportion of pulmonary immune cells, or levels of inflammatory markers. In contrast, evening ginger intake disrupted normal lung function and its intrinsic rhythmicity. Importantly, within the dosage parameters established in this study, no pathological changes in lung tissue were observed, irrespective of whether ginger was consumed in the morning or evening. The physiological functions of lung tissue demonstrate pronounced circadian rhythmicity [ 7 ] , primarily regulated by the periodic expression of clock genes [ 27 ] . Upon injury to lung tissue, this rhythmicity is notably disrupted, thereby initiating a detrimental cycle of "damage - rhythm disorder - secondary damage" [ 17 ] . In light of this, we explored whether temporal variations in ginger intake, specifically in the morning versus the evening, yield differential effects in the context of lung injury. Our findings indicate that morning administration of ginger significantly mitigated bleomycin-induced lung injury, enhanced the expression of clock genes, and restored the circadian rhythmicity of lung tissue. Conversely, evening ginger intake not only failed to ameliorate lung injury symptoms but also exacerbated tissue damage, without further disruption of clock gene expression. These results tentatively affirm the critical role of administration timing in the therapeutic efficacy of ginger. Nonetheless, the precise temporal patterns of ginger's effects and the optimal timing for administration warrant further investigation in future studies. Given the close association between the differential effects of ginger in the morning and evening and the expression of clock genes, we employed a circadian rhythm disorder model using Per2 knockout mice to investigate its time-dependent pharmacodynamic variations. In the context of a combined bleomycin-induced lung injury model, we observed an unexpected outcome: disruption of the biological clock led to the complete elimination of the temporal differences in ginger's effects. Specifically, irrespective of whether ginger was administered in the morning or evening, there were no significant differences in pulmonary respiratory function, degree of pathological damage, or inflammatory response when compared to the model group at the corresponding time. This observation aligns with Dallmann's findings [ 4 ] , which suggest that in models with clock gene deficiencies, such as knockouts, the circadian rhythmicity of drug responses is typically diminished or abolished, rendering the timing of administration non-essential. These results further suggest that the protective or deleterious effects of ginger on lung tissue are contingent upon an intact circadian rhythm regulatory system. In light of the observation that the differential effects of ginger in the morning and evening are absent in the circadian rhythm disorder model, it is implied that these temporal effects are likely mediated by other critical downstream targets. To elucidate potential targets, we conducted a proteomic analysis. The findings indicate that the variation in ginger's effects between morning and evening may be attributed to the regulation of CLUAP1 and SYTL2 protein expression. SYTL2 (synaptotagmin-like protein 2) is a member of the C2 domain-containing protein family [ 6 ] . It plays a pivotal role in vesicle transport, secretion, dynamic alterations of cell membranes, and inflammatory responses through its interaction with small GTPases such as Rab27A/B [ 12 ][ 28 ][ 34 ] . Although no direct associations with circadian rhythms and clock genes have been reported thus far, it is noteworthy that Chen et al [ 3 ] . observed differential expression of SYTL2 in a sleep deprivation-related myocardial infarction model, suggesting its potential involvement in pathology associated with circadian rhythm disruption.SYTL2 is instrumental in cell signaling and membrane fusion by coordinating vesicle-mediated secretion of active substances and regulating the exocytosis of inflammatory mediators [ 33 ] . CLUAP1 (clusterin-associated protein 1) serves as a crucial regulator of cilia assembly and function. As an integral component of intraflagellar transport complex B (IFT-B) [ 1 ] , it is indispensable for cilia formation and maintenance [ 11 ] . Evidence indicates that CLUAP1 may indirectly influence circadian rhythms by preserving ciliary structure and modulating the Hedgehog signaling pathway [ 19 ] . This study is the first to identify the involvement of CLUAP1 and SYTL2 proteins in the temporal variations of drug effects, although their precise mechanisms warrant further investigation. Previous research on the use of ginger in the treatment of lung injury has been extensive [ 8 ][ 29 ] ; however, the temporal variations in its efficacy remain underexplored. This study's primary innovation is its examination of the differential effects of ginger intake timing (morning versus night) on both healthy and injured lung tissue. This investigation provides a foundational understanding of the temporal mechanisms associated with ginger consumption and offers valuable insights for its clinical application and daily use. Nonetheless, the study has certain limitations: it exclusively examines the relationship between circadian rhythms and ginger's therapeutic effects on lung injury using mouse models, with no current validation in human subjects. Additionally, the study is limited to the lungs and does not consider rhythmic changes in other tissues. Future research should extend to other organs to investigate the diurnal effects of ginger consumption and advance clinical studies to elucidate its impact on both healthy and injured lung tissue, as well as its precise mechanisms of action. Data availability The data that support the findings of this study are available from the corresponding authors upon reasonable request. Declarations Data availability The data that support the findings of this study are available from the corresponding authors upon reasonable request. Funding statement This research did not receive funding from organizations. Competing interests The authors declare no competing interests. Author Information Contributions Yu Wu : Methodology, Design and accomplish the experiment, Data curation. Yaxin Li : Accomplish the experiment, Writing - original draft. Wenqing Lv : Analyze data, Visualization. Qian Shen : Accomplish the experiment. Yanjun Zhang : Provide technical guidance. Pengwei Zhuang : Provide guidance, Writing-review and editing. Hong Guo : Provide financial support, Provide guidance. Corresponding author Correspondence to Pengwei Zhuang and Hong Guo. References Beyer, T. et al. CRISPR/Cas9-mediated Genomic Editing of Cluap1/IFT38 Reveals a New Role in Actin Arrangement. Molecular & cellular proteomics: MCP, 17(7), 1285–1294. https://doi.org/10.1074/mcp.RA117.000487 (2018). Bishehsari, F., Voigt, R. M., & Keshavarzian, A. Circadian rhythms and the gut microbiota: from the metabolic syndrome to cancer. Nature reviews. Endocrinology, 16(12), 731–739. https://doi.org/10.1038/s41574-020-00427-4 (2020). Chen, X., Li, Q., Zhang, Z., Yang, M., & Wang, E. Identification of Potential Diagnostic Biomarkers From Circulating Cells During the Course of Sleep Deprivation-Related Myocardial Infarction Based on Bioinformatics Analyses. Frontiers in cardiovascular medicine, 9, 843426. https://doi.org/10.3389/fcvm.2022.843426 (2022). Dallmann, R., Okyar, A., & Lévi, F. Dosing-Time Makes the Poison: Circadian Regulation and Pharmacotherapy. Trends in molecular medicine, 22(5), 430–445. https://doi.org/10.1016/j.molmed.2016.03.004 (2016). D'Alonzo, G. E., Crocetti, J. G., & Smolensky, M. H. Circadian rhythms in the pharmacokinetics and clinical effects of beta-agonist, theophylline, and anticholinergic medications in the treatment of nocturnal asthma. Chronobiology international, 16(5), 663–682. https://doi.org/10.3109/07420529908998734 (1999). Fukuda, M., & Mikoshiba, K. Synaptotagmin-like protein 1–3: a novel family of C-terminal-type tandem C2 proteins. Biochemical and biophysical research communications, 281(5), 1226–1233. https://doi.org/10.1006/bbrc.2001.4512 (2001). Grabe, S., Ananthasubramaniam, B., & Herzel, H. Quantification of circadian rhythms in mammalian lung tissue snapshot data. Scientific reports, 14(1), 16238. https://doi.org/10.1038/s41598-024-66694-7 (2024). Han, R. et al. Folic acid-modified ginger-derived extracellular vesicles for targeted treatment of rheumatoid arthritis by remodeling immune microenvironment via the PI3K-AKT pathway. Journal of nanobiotechnology, 23(1), 41. https://doi.org/10.1186/s12951-025-03096-5 (2025). Harris-Gauthier, N., Srikanta, S. B., & Cermakian, N. Deubiquitinases: key regulators of the circadian clock. American journal of physiology. Cell physiology, 323(5), C1539–C1547. https://doi.org/10.1152/ajpcell.00289.2022 (2022). Jedli, O. et al. Attenuation of ovalbumin-induced inflammation and lung oxidative injury in asthmatic rats by Zingiber officinale extract: combined in silico and in vivo study on antioxidant potential, STAT6 and TNF-α pathways. 3 Biotech, 12(9), 191. https://doi.org/10.1007/s13205-022-03249-5 (2022). Katoh, Y. et al. Overall Architecture of the Intraflagellar Transport (IFT)-B Complex Containing Cluap1/IFT38 as an Essential Component of the IFT-B Peripheral Subcomplex. The Journal of biological chemistry, 291(21), 10962–10975. https://doi.org/10.1074/jbc.M116.713883 (2016). Kesari, A. et al. Dysferlin deficiency shows compensatory induction of Rab27A/Slp2a that may contribute to inflammatory onset. The American journal of pathology, 173(5), 1476–1487. https://doi.org/10.2353/ajpath.2008.080098 (2008). Kim, J., Lee, H., & You, S. Dried Ginger Extract Restores the T Helper Type 1/T Helper Type 2 Balance and Antibody Production in Cyclophosphamide-Induced Immunocompromised Mice after Flu Vaccination. Nutrients, 14(9), 1984. https://doi.org/10.3390/nu14091984 (2022). Krakowiak, K., & Durrington, H. J. The Role of the Body Clock in Asthma and COPD: Implication for Treatment. Pulmonary therapy, 4(1), 29–43. https://doi.org/10.1007/s41030-018-0058-6 (2018). Lai, Y. S. et al. Ginger Essential Oil Ameliorates Hepatic Injury and Lipid Accumulation in High Fat Diet-Induced Nonalcoholic Fatty Liver Disease. Journal of agricultural and food chemistry, 64(10), 2062–2071. https://doi.org/10.1021/acs.jafc.5b06159 (2016). Meyer, N., Harvey, A. G., Lockley, S. W., & Dijk, D. J. Circadian rhythms and disorders of the timing of sleep. Lancet (London, England), 400(10357), 1061–1078. https://doi.org/10.1016/S0140-6736(22)00877-7 (2022). Naik, A. et al. Circadian regulation of lung repair and regeneration. JCI insight, 8(16), e164720. https://doi.org/10.1172/jci.insight.164720 (2023). Nosal, C., Ehlers, A., & Haspel, J. A. Why Lungs Keep Time: Circadian Rhythms and Lung Immunity. Annual review of physiology, 82, 391–412. https://doi.org/10.1146/annurev-physiol-021119-034602 (2020). Pasek, R. C., Berbari, N. F., Lewis, W. R., Kesterson, R. A., & Yoder, B. K. Mammalian Clusterin associated protein 1 is an evolutionarily conserved protein required for ciliogenesis. Cilia, 1(1), 20. https://doi.org/10.1186/2046-2530-1-20 (2012). Paudel, K. R. et al. Recent Advances in Chronotherapy Targeting Respiratory Diseases. Pharmaceutics, 13(12), 2008. https://doi.org/10.3390/pharmaceutics13122008 (2021). Pecoraro, L., Peterle, E., Dalla Benetta, E., Piazza, M., Chatziparasidis, G., & Kantar, A. Well-Established and Traditional Use of Vegetal Extracts as an Approach to the "Deep Roots" of Cough. Children (Basel, Switzerland), 11(5), 584. https://doi.org/10.3390/children11050584 (2024). Rho, J. et al. Yijin-Tang Attenuates Cigarette Smoke and Lipopolysaccharide-Induced Chronic Obstructive Pulmonary Disease in Mice. Evidence-based complementary and alternative medicine: eCAM, 2022, 7902920. https://doi.org/10.1155/2022/7902920 (2022). Robles, A. L., Bautista-Sánchez, U., Olvera-Hernández, E. G., et al. Chronopharmacokinetics: A Brief Analysis of the Influence of Circadian Rhythm on the Absorption, Distribution, Metabolism, and Elimination of Drugs. Biomedical & Pharmacology Journal, 17(3), 2011–2017. https://doi.org/10.13005/bpj/3003 (2024). Sato, T., & Greco, C. M. Expanding the link between circadian rhythms and redox metabolism of epigenetic control. Free radical biology & medicine, 170, 50–58. https://doi.org/10.1016/j.freeradbiomed.2021.01.009 (2021). Schibler U. The daily rhythms of genes, cells and organs. Biological clocks and circadian timing in cells. EMBO reports, 6 Spec No(Suppl 1), S9–S13. https://doi.org/10.1038/sj.embor.7400424 (2005). Serin, Y., & Acar Tek, N. Effect of Circadian Rhythm on Metabolic Processes and the Regulation of Energy Balance. Annals of nutrition & metabolism, 74(4), 322–330. https://doi.org/10.1159/000500071 (2019). Sundar, I. K., Yao, H., Sellix, M. T., & Rahman, I. Circadian molecular clock in lung pathophysiology. American journal of physiology. Lung cellular and molecular physiology, 309(10), L1056–L1075. https://doi.org/10.1152/ajplung.00152.2015 (2015). Tanaka, M., & Nakamura, T. Role of the RAB27/SYTL Axis in Tumor Microenvironment Construction. Cancer science, 116(7), 1815–1822. https://doi.org/10.1111/cas.70096 (2025). Teng, Y. et al. Plant-derived exosomal microRNAs inhibit lung inflammation induced by exosomes SARS-CoV-2 Nsp12. Molecular therapy: the journal of the American Society of Gene Therapy, 29(8), 2424–2440. https://doi.org/10.1016/j.ymthe.2021.05.005 (2021). Thomson, M., Al-Qattan, K. K., Al-Sawan, S. M., Alnaqeeb, M. A., Khan, I., & Ali, M. The use of ginger (Zingiber officinale Rosc.) as a potential anti-inflammatory and antithrombotic agent. Prostaglandins, leukotrienes, and essential fatty acids, 67(6), 475–478. https://doi.org/10.1054/plef.2002.0441 (2002). Tian, L. et al. Ceramide-1-phosphate alleviates high-altitude pulmonary edema by stabilizing circadian ARNTL-mediated mitochondrial dynamics. Journal of advanced research, 60, 75–92. https://doi.org/10.1016/j.jare.2023.07.008 (2024). Wu, Y. et al. Effects of different administration timing of ginger on heat production capacity in normal mice. Drug Evaluation Research, 47(2), 309–315 (2024). Xie, X. et al. Effects of COL1A1 and SYTL2 on inflammatory cell infiltration and poor extracellular matrix remodeling of the vascular wall in thoracic aortic aneurysm. Chinese medical journal, 137(9), 1105–1114. https://doi.org/10.1097/CM9.0000000000002808 (2024). Yasuda, T., & Fukuda, M. Slp2-a controls renal epithelial cell size through regulation of Rap-ezrin signaling independently of Rab27. Journal of cell science, 127(Pt 3), 557–570. https://doi.org/10.1242/jcs.134056 (2014). Yocum, G. T. et al. Ginger and its bioactive component 6-shogaol mitigate lung inflammation in a murine asthma model. American journal of physiology. Lung cellular and molecular physiology, 318(2), L296–L303. https://doi.org/10.1152/ajplung.00249.2019 (2020). Zhang, M., Zhao, R., Wang, D., Wang, L., Zhang, Q., Wei, S., Lu, F., Peng, W., & Wu, C. Ginger (Zingiber officinale Rosc.) and its bioactive components are potential resources for health beneficial agents. Phytotherapy research: PTR, 35(2), 711–742. https://doi.org/10.1002/ptr.6858 (2021). Zhang, T., Yan, L., Ma, S., & He, J. Human biological rhythm in traditional Chinese medicine. Journal of Traditional Chinese Medical Sciences, 3(4), 206–211. https://doi.org/10.1016/j.jtcms.2016.12.004 (2016). Additional Declarations No competing interests reported. Supplementary Files GA.png Cite Share Download PDF Status: Under Review Version 1 posted Reviews received at journal 14 May, 2026 Reviewers agreed at journal 03 May, 2026 Reviewers invited by journal 03 May, 2026 Editor assigned by journal 22 Feb, 2026 Submission checks completed at journal 22 Feb, 2026 First submitted to journal 18 Feb, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8913616","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":637322184,"identity":"a64c17a6-e9b8-469c-b1ff-d3e4af66aa32","order_by":0,"name":"Yu Wu","email":"","orcid":"","institution":"State Key Laboratory of Component-based Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Yu","middleName":"","lastName":"Wu","suffix":""},{"id":637322186,"identity":"ceba68b2-1c2c-4016-b79e-0e5947faa942","order_by":1,"name":"Yaxin Li","email":"","orcid":"","institution":"Tianjin University of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Yaxin","middleName":"","lastName":"Li","suffix":""},{"id":637322189,"identity":"b06f691d-eb10-4ee5-b343-7911ae452761","order_by":2,"name":"Wenqing Lv","email":"","orcid":"","institution":"Tianjin University of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Wenqing","middleName":"","lastName":"Lv","suffix":""},{"id":637322193,"identity":"bf811c1c-64c6-4f5b-814b-672cc9413073","order_by":3,"name":"Qian Shen","email":"","orcid":"","institution":"State Key Laboratory of Component-based Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Qian","middleName":"","lastName":"Shen","suffix":""},{"id":637322196,"identity":"d9812bd2-4192-4aa6-b651-a0c6dc68d4f9","order_by":4,"name":"Yanjun Zhang","email":"","orcid":"","institution":"First Teaching Hospital of Tianjin University of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Yanjun","middleName":"","lastName":"Zhang","suffix":""},{"id":637322199,"identity":"8f43b4e0-1254-4bf3-941e-270d99aa8b37","order_by":5,"name":"Pengwei Zhuang","email":"","orcid":"","institution":"First Teaching Hospital of Tianjin University of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Pengwei","middleName":"","lastName":"Zhuang","suffix":""},{"id":637322201,"identity":"ecd01643-05c1-44ba-b85b-f477a271ee6d","order_by":6,"name":"Hong Guo","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAxUlEQVRIiWNgGAWjYLCCBAMbOXn2xsaHH4jUwNiQUJBmbNhzuNlYgmgtDB8OJzbcSG8T4CFGPX/74ecPHhgcNmac+bCNQYLBTk63gYAWiTNphg0JBuly7NKJbQ8KGJKNzQ4Q0GLAkAP0i4G1MePsxHYDCYYDidsIauF/A9LCnNhw82CbBA9RWiTAtjgDvc9IpBaJG88MZyQYgAI5ERjIBkT4hb8/+cHHH39AUXn84cMPFXZyBLWgu5M05aNgFIyCUTAKcAAAtHdD9AVU/DEAAAAASUVORK5CYII=","orcid":"","institution":"State Key Laboratory of Component-based Chinese Medicine","correspondingAuthor":true,"prefix":"","firstName":"Hong","middleName":"","lastName":"Guo","suffix":""}],"badges":[],"createdAt":"2026-02-19 03:53:40","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8913616/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8913616/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":109067927,"identity":"83627f13-2d8e-4a56-9c7c-75f936f80f3d","added_by":"auto","created_at":"2026-05-12 10:02:34","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":274135,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffects of morning or evening ginger administration on lung tissue in normal mice.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Schematic illustration of the experimental design. (B) Pulmonary function parameters. (C) Flow cytometry plots and the relative proportions of lung immune cell populations. (D) Expression levels of inflammatory cytokines in lung tissue. (E) Lung CT images and HE staining (scale bar: 500 μm). Data are presented as mean ± SEM. *\u003cem\u003eP\u003c/em\u003e\u0026lt; 0.05, ***\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001 \u003cem\u003evs.\u003c/em\u003e EC group. n = 5-10 per group.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-8913616/v1/d007cbdf95cc2175e61a528d.png"},{"id":109021671,"identity":"09c21c9f-2b22-4d3d-9a92-b7e3b1b81ef3","added_by":"auto","created_at":"2026-05-11 19:20:55","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":140440,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffects of morning or evening ginger intake on the expression of clock genes in the lungs of normal mice.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Schematic of clock gene interactions \u003cem\u003ein vivo\u003c/em\u003e. (B) Effects of morning or evening ginger intake on the expression of clock genes in the lungs of normal mice. Data are presented as mean ± SEM. **\u003cem\u003eP\u003c/em\u003e\u0026lt; 0.01, ***\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001 \u003cem\u003evs.\u003c/em\u003e EC group. n = 5 per group.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-8913616/v1/c29d99c1910df7e61ba18ae5.png"},{"id":109067936,"identity":"3924257f-545e-49c4-9685-396a1c4c3360","added_by":"auto","created_at":"2026-05-12 10:02:38","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":311837,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffects of morning or evening ginger administration on lung tissue of mice with acute lung injury.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Schematic diagram of the experimental protocol. (B) Pulmonary function parameters. (C) Flow cytometry plots and the relative proportions of lung immune cell popul ations. (D) Lung CT images. (E) Representative HE staining of lung sections (scale bar: 500 μm). (F) Expression levels of inflammatory cytokines in lung tissue. Data are presented as mean ± SEM. *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, **\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01, ***\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001 \u003cem\u003evs.\u003c/em\u003e MM group. \u003csup\u003e#\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, \u003csup\u003e##\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01\u003cem\u003e vs.\u003c/em\u003e EM group. n = 3-10 per group.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-8913616/v1/1ab75301fd574f52a8917381.png"},{"id":109067635,"identity":"a2d56aa5-6d13-4782-a43d-449d11c5edda","added_by":"auto","created_at":"2026-05-12 09:58:28","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":150273,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffects of morning or evening ginger intake on the expression of clock genes in the lungs of mice with acute lung injury.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eEffects of morning or evening ginger intake on the expression of clock genes in the lungs of lung-injured mice. Data are presented as mean ± SEM. *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, **\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01, ***\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001 \u003cem\u003evs.\u003c/em\u003e MM group. \u003csup\u003e###\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001\u003cem\u003e vs.\u003c/em\u003e EM group. n = 5 per group.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-8913616/v1/0720ccd421f97cb2425a4b97.png"},{"id":109021672,"identity":"2202df92-f7a0-410f-8c8e-9316d4f0843b","added_by":"auto","created_at":"2026-05-11 19:20:55","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":334921,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffects of morning or evening ginger intake on lung tissue of Per2-KO mice with lung injury.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Schematic illustration of the experimental design. (B) Pulmonary function parameters. (C) Expression of inflammatory cytokines in lung tissue. (D) Lung CT images and HE staining (scale bar: 500 μm). Data are presented as mean ± SEM. *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, ***\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001 \u003cem\u003evs.\u003c/em\u003e MM group. \u003csup\u003e#\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, \u003csup\u003e##\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01, \u003csup\u003e###\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001\u003cem\u003e vs.\u003c/em\u003e EM group. n = 3-6 per group.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-8913616/v1/22e3fb3de457fce51606a6f4.png"},{"id":109068023,"identity":"8197c560-a60f-4373-98f6-f16d6a3d3b3a","added_by":"auto","created_at":"2026-05-12 10:02:58","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":282240,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDifferential impacts of morning or evening ginger intake on the lung proteome of mice with lung injury.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Heatmap visualization of the lung proteome profiles in mice receiving morning orevening ginger administration. (B) Venn diagram illustrating the overlap and uniqueness of differentially expressed proteins between the morning (red) and evening (blue) administration groups. (C) Line chart depicting the expression trends of significantly differentially expressed proteins identified in both morning and evening groups. (D) Validation of intersecting differentially expressed proteins by Western blotting. Data are presented as mean ± SEM. *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, ***\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001 \u003cem\u003evs.\u003c/em\u003e MM group. \u003csup\u003e##\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01\u003cem\u003e vs.\u003c/em\u003e EM group. n = 3 per group.\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-8913616/v1/eda3084425d88ba7fe80e657.png"},{"id":109081435,"identity":"7578a8c7-3338-4036-913e-5a867f7f2cc9","added_by":"auto","created_at":"2026-05-12 12:18:10","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1673175,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8913616/v1/ee5b277d-2ca9-49ec-907e-d214429b1ca0.pdf"},{"id":109021669,"identity":"7e535e44-c74f-494d-b55e-9162508ef395","added_by":"auto","created_at":"2026-05-11 19:20:55","extension":"png","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":219487,"visible":true,"origin":"","legend":"","description":"","filename":"GA.png","url":"https://assets-eu.researchsquare.com/files/rs-8913616/v1/a143607ea0fd080fb1ffed8e.png"}],"financialInterests":"No competing interests reported.","formattedTitle":"Morning vs. Evening: The Temporal Differences of Ginger's Efficacy in Lung","fulltext":[{"header":"Introduction","content":"\u003cp\u003eCircadian rhythms represent a fundamental biological mechanism that facilitates organisms' adaptation to daily light-dark cycles, thereby regulating diurnal fluctuations in essential physiological processes, including sleep-wake cycles\u003csup\u003e[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]\u003c/sup\u003e, thermoregulation\u003csup\u003e[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]\u003c/sup\u003e, metabolic pathways\u003csup\u003e[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]\u003c/sup\u003e, and hormonal balance\u003csup\u003e[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]\u003c/sup\u003e. Various tissues and organs, such as the liver and lungs, possess autonomous endogenous circadian clock mechanisms that can detect and synchronize with environmental circadian cycles\u003csup\u003e[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]\u003c/sup\u003e. Furthermore, circadian rhythms exert a significant impact on drug absorption, metabolism, bioavailability, and related in vivo processes\u003csup\u003e[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e][\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]\u003c/sup\u003e. For example, administering triamcinolone, a glucocorticoid, at 3:00 PM not only avoids exacerbating systemic adverse effects but also effectively controls nocturnal asthma symptoms\u003csup\u003e[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]\u003c/sup\u003e. Similarly, the nocturnal administration of anticholinergic agents, such as tiotropium bromide, can substantially enhance bronchodilatory effects by inhibiting the circadian peak of vagal nerve activity\u003csup\u003e[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]\u003c/sup\u003e. These chronopharmacological strategies show promise as crucial components of future personalized medicine, facilitating more precise and optimized therapeutic interventions.\u003c/p\u003e \u003cp\u003eThe pulmonary system demonstrates a significant circadian rhythmic organization, characterized by cell-autonomous oscillators that drive rhythmic variations in functional parameters and the expression of core clock genes\u003csup\u003e[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]\u003c/sup\u003e.The timing of drug administration influences the therapeutic outcomes in lung diseases: evening administration of tobramycin in a pediatric pulmonary fibrosis trial was associated with a higher risk of nephrotoxicity compared to morning administration\u003csup\u003e[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]\u003c/sup\u003e, while morning administration of ciclesonide preferentially improved peak expiratory flow (PEF)\u003csup\u003e[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eGinger (\u003cem\u003eZingiber officinale Roscoe\u003c/em\u003e), recognized for its dual role as both a medicinal and food herb, has attracted attention due to its diverse bioactivities. Contemporary pharmacological studies have confirmed its immunomodulatory\u003csup\u003e[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]\u003c/sup\u003e, anti-inflammatory\u003csup\u003e[\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]\u003c/sup\u003e, antioxidant\u003csup\u003e[\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]\u003c/sup\u003e,non-alcoholic fatty liver disease preventive\u003csup\u003e[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]\u003c/sup\u003e, and cholesterol-lowering effects\u003csup\u003e[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]\u003c/sup\u003e. In Traditional Chinese Medicine, ginger is believed to possess pungent and warm properties, making it more suitable for consumption during the daytime, a notion reflected in the folk saying \"avoid ginger after noon.\" Our preliminary research\u003csup\u003e[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]\u003c/sup\u003eidentified variations in thermogenesis induced by ginger in healthy mice, depending on the time of day, thereby indicating potential chronotherapeutic properties that merit systematic exploration.\u003c/p\u003e \u003cp\u003eIn this study, both normal and bleomycin-induced mice were utilized to evaluate lung-related indices under both physiological and pathological conditions, with the aim of further investigating the temporal differences in the effects of ginger between morning and evening. Concurrently, we sought to identify key proteins responsible for these temporal variations. The findings are expected to provide scientific evidence for optimizing the timing of ginger dietary interventions and for developing precision nutritional strategies.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eReagents\u003c/h2\u003e \u003cp\u003eGinger was acquired from Sichuan, identified as \u003cem\u003eZingiber officinale Rosc\u003c/em\u003e by Professor at Tianjin University of Traditional Chinese Medicine. Bleomycin was purchased from Beijing Solaibao Technology Co., LTD. Antibodies were purchased from Biolegend (USA). Antibody Details were shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eName, source, and cat. number of antibodies used in the experiments.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAntibodies\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSource\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCat. number\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAPC anti-mouse CD3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eBiolegend\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e100235\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePE anti-mouse CD4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eBiolegend\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e100407\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePE anti-mouse CD8a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eBiolegend\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e100707\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFITC anti-mouse CD8a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eBiolegend\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e100706\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAPC anti-mouse CD19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eBiolegend\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e115511\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePE anti-mouse CD19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eBiolegend\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e115508\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFITC anti-mouse CD45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eBiolegend\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e157214\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eβ-actin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eProteintech\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e66009-1-Ig\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCluap1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eProteintech\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e17470-1-AP\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSytl2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eProteintech\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e12359-1-AP\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGoat anti-rabbit IgG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eBeyotime\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eA0208\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGoat anti-mouse IgG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eBeyotime\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eA0258\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003ePreparation of water extract of ginger\u003c/h3\u003e\n\u003cp\u003eFor the preparation, 39 g of sliced ginger were combined with 400 ml of pure water and decocted for 30 minutes. The mixture was then filtered to collect the filtrate, and an additional 300 ml of pure water was added to the residue. This was decocted for another 20 minutes, after which the filtrates were combined and concentrated to a volume of 300 ml, resulting in a concentration of 0.325 g/ml of ginger.\u003c/p\u003e\n\u003ch3\u003eAnimals and treatment\u003c/h3\u003e\n\u003cp\u003eEight-week-old male C57BL/6 mice (18\u0026ndash;22 g) were procured from Beijing Huafukang Biotechnology Co., Ltd., under the laboratory animal production license number SCXK (Jing) 2019-0008. The experimental protocols received approval from the Animal Ethics Committee of Tianjin University of Traditional Chinese Medicine (approval number: TCM-LAEC2023124).\u003c/p\u003e \u003cp\u003eIn a normal mouse experiment, 40 mice were randomly assigned to four groups, each consisting of 10 mice: the morning control (MC) group, the morning ginger (MG) group, the evening control (EC) group, and the evening ginger (EG) group. The MG and EG groups received a ginger water extract (0.1 ml/10 g) via gavage once daily at either 7:00 AM or 7:00 PM for a period of 14 days. The control groups were administered an equivalent volume of pure water via gavage.\u003c/p\u003e \u003cp\u003eIn the bleomycin-induced mice, a total of 60 mice were randomly allocated into six distinct groups: the morning control (MC) group, the morning model (MM) group, the morning ginger (MG) group, the evening control (EC) group, the evening model (EM) group, and the evening ginger (EG) group. To establish an acute lung injury model, bleomycin (2.5 mg/kg, dissolved in PBS) was administered via tracheal instillation to the mice in the MM, MG, EM, and EG groups, whereas an equivalent volume of PBS was administered to the MC and EC groups. The MG group received ginger extract via gavage once daily at 7:00 AM, while the MM and MC groups were given pure water. Similarly, the EG group was administered ginger extract via gavage once daily at 7:00 PM, with the EM and EC groups receiving pure water. This treatment regimen was maintained for 14 consecutive days.\u003c/p\u003e \u003cp\u003ePer2 knockout mice were sourced from the Cambridge-SU Genomic Resource Center (CAM-SU GRC) and were bred and maintained in the IVC feeding system at the Animal Center of Tianjin University of Chinese Medicine. The animal grouping and treatment protocols are the same as those used for the mice with lung injury.\u003c/p\u003e\n\u003ch3\u003eNoninvasive lung function\u003c/h3\u003e\n\u003cp\u003eRespiratory parameters, including minute ventilation volume (MV), tidal volume (TV), respiratory rate (F), inspiratory duration (TI), expiratory duration (TE), and the bronchoconstriction parameter (Pech), were assessed using the EMKA Pulmonary System (EMKA, France) during periods of wakefulness and free movement. The average value measured over a 10-minute period was used as the statistic.\u003c/p\u003e\n\u003ch3\u003eMicro-CT\u003c/h3\u003e\n\u003cp\u003ePrior to sampling the mice, lung scans were conducted utilizing a high-resolution micro-CT scanner (Quantum GX2, PerkinElmer, USA). Following the administration of anesthesia with isoflurane, the mice were positioned in a prone orientation on the scanning bed. Each scan was executed over a duration of 2 minutes with a 360\u0026deg; rotation. Subsequently, lung injury scoring was conducted based on the micro-CT images. A score of 0 denotes no damage, a score of 1 indicates damage confined to 1/4 of the lung area, a score of 2 signifies damage confined to 1/2 of the lung area, a score of 3 represents damage confined to 3/4 of the lung area, and a score of 4 indicates damage encompassing the entire lung area.\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eHistopathology\u003c/h2\u003e \u003cp\u003eThe lung tissue was then fixed in 4% paraformaldehyde and embedded in paraffin wax following standard protocols. Thereafter, 3 \u0026micro;m thick sections were obtained using a microtome. These sections were stained with hematoxylin and eosin (H\u0026amp;E) and subsequently imaged under a microscope to examine the pathological changes.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eFlow cytometry\u003c/h3\u003e\n\u003cp\u003eFresh lung tissue was sectioned and subjected to enzymatic treatment with collagenase I and deoxyribonuclease I, followed by incubation at 37 ℃ for one hour. Subsequently, the samples underwent centrifugation at 4000 rpm for eight minutes, after which 1 ml of red cell lysate was added for re-suspension and incubated on ice for four minutes. The samples were again centrifuged at 4000 rpm for eight minutes, and 1 ml of Cell Staining Buffer containing 25 \u0026micro;l of deoxyribonuclease I was added, followed by incubation on ice for ten minutes. The stained samples were centrifuged at 4000 rpm for eight minutes, and the Cell Staining Buffer was removed. The resulting pellet was resuspended in 1.5 ml of a centrifuge tube and subsequently counted. Following cell counting, 100 \u0026micro;l of a sealing solution (comprising 0.5 \u0026micro;l of CD16/32) was added for sealing, with incubation for ten minutes. An antibody was then introduced and incubated for 30 minutes in the absence of light. The staining process involved centrifugation at 4000 rpm for eight minutes, and cell staining was repeated using a 400-mesh screen prior to analysis by flow cytometry.\u003c/p\u003e \u003cp\u003eIn the ginger administration experiment conducted on normal mice, CD45-FITC, CD3-APC, and CD4-PE were employed to identify CD4\u003csup\u003e+\u003c/sup\u003e T cells, whereas CD45-FITC, CD3-APC, and CD8-PE were utilized for CD8\u003csup\u003e+\u003c/sup\u003e T cells. B cells were labeled using CD45-FITC and CD19-APC. In the experiment involving ginger administration within a murine lung injury model, CD4\u003csup\u003e+\u003c/sup\u003e and CD8\u003csup\u003e+\u003c/sup\u003e T cells were analyzed using CD3-APC, CD4-PE, and CD8-FITC labeling, while B cells were identified with CD45-FITC and CD19-PE markers. The study quantified the percentages of CD4\u003csup\u003e+\u003c/sup\u003e and CD8\u003csup\u003e+\u003c/sup\u003e T cells within the CD3\u003csup\u003e+\u003c/sup\u003e T cell population and assessed the proportion of B cells among the total immune cell population.\u003c/p\u003e\n\u003ch3\u003eReal-time RT-PCR\u003c/h3\u003e\n\u003cdiv class=\"Heading\"\u003eReal-time RT-PCR\u003c/div\u003e \u003cp\u003eTotal RNA was reverse transcribed utilizing Promega\u0026trade; Reverse Transcriptase, followed by quantitative real-time PCR using SYBR qPCR premix (Tiangen). mRNA expression levels were normalized to GAPDH expression for each gene. The primers were designed and synthesized by Shanghai Sangon Biotechnology Co., Ltd., with sequences provided in the Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eNames and sequences of the primers used in the PCR experiments\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGene sequence (5 '\u0026rarr;3')\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eTnf-α\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGCACCAACTGCTTAGC\u003c/p\u003e \u003cp\u003eGGCATGGACTGTGGTCATGAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eIL-6\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTTCTTGGGACTGATGCTGGTGAC\u003c/p\u003e \u003cp\u003eAGGTCTGTTGGGAGTGGTATCCTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eBmal1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGACTTCGCCTCTACCTGTTCAAAG\u003c/p\u003e \u003cp\u003eTCGTTGTCTGGCTCATTGTCTTCG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eClock\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGGTGACTGCCTATCCTACCTTCG\u003c/p\u003e \u003cp\u003eTGCTGCTGCTGCTGCTGTTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003ePer1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCTGGGCTCTGGGTCTGGTTC\u003c/p\u003e \u003cp\u003eTTGCTTGTATGGCTGCTCTGACTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003ePer2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCTGCGGATGCTCGTGGAATC\u003c/p\u003e \u003cp\u003eGGTTGTGCTCTGCCTCTGTCATC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003ePer3\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAAAGATCCTGACCTCGCCCTACG\u003c/p\u003e \u003cp\u003eGTGCTTCTGCCTCTCGCTTCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eCry1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCCAGCAGACACCATCACATCAG\u003c/p\u003e \u003cp\u003eCCAGGGAAGGAACGCCATATTTCTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eCry2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGGACAAGCACTTGGAACGGAAG\u003c/p\u003e \u003cp\u003eGTAGAAGAGGCGGCAGGAGAGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eRev-erbα\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCGTCATCCTCTTCATCCTCCTCCTC\u003c/p\u003e \u003cp\u003eCTTGGTAATGTTGCTTGTGCCCTTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eRev-erbβ\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGACCAGAGCCCACAAGGATACC\u003c/p\u003e \u003cp\u003eTTCCTGGGAATCCGTTCTCCTCTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eGapdh\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGTGGCAAAGTGGAGATTGTTG\u003c/p\u003e \u003cp\u003eCGTTGAATTTGCCGTGAGTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eWestern blot\u003c/h2\u003e \u003cp\u003eFollowing lung tissue homogenization, protein concentration was determined using a BCA Protein Assay Kit. Proteins were separated via SDS-PAGE and transferred to polyvinylidene fluoride (PVDF) membranes. The membranes were subsequently blocked and incubated overnight at 4\u0026deg;C with primary antibodies targeting β-actin, Cluap1, and Sytl2. The membranes were then incubated with a goat anti-rabbit IgG secondary antibody for 1.5 hours at room temperature. Protein band signals were detected using an ultra-sensitive multifunctional imager (Amersham Imager 600, USA). The relative intensity of each protein band was normalized to β-actin levels.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eData analysis was performed using SPSS 22.0 software. The results are expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM. Statistical analysis included one-way analysis of variance, the Bonferroni multiple comparison test, and Student's t-test. A significance level of \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eEffects of morning or evening ginger intake on lung tissues of healthy mice\u003c/h2\u003e \u003cp\u003eThis study initially investigated the differences in lung tissues of healthy mice following gavage administration of ginger in the morning versus the evening. As illustrated in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e, no significant differences were detected in pulmonary function indices, pulmonary immune cell counts, or inflammatory cytokine expression between the morning gavage (MG) and morning control (MC) groups. In contrast, when compared to the evening control (EC) group, the evening gavage (EG) group demonstrated significantly reduced minute ventilation (MV), tidal volume (TV), and flow rate (F), along with significantly increased inspiratory time (TI), expiratory time (TE), and enhanced pause (Penh). Furthermore, the EG group showed a reduction in the proportions of CD8\u003csup\u003e+\u003c/sup\u003e T cells and B cells in lung tissues, as well as increased expression of the inflammatory cytokines IL-6 and TNF-α. These findings collectively suggest that ginger consumption in the evening may have specific effects on lung tissues.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eHowever, ginger intake, regardless of whether it occurs in the morning or evening, did not result in morphological changes in lung tissues. As depicted in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE, imaging analyses indicated that the lung fields of mice in all groups were fully visualized, with well-expanded lung tissues and distinct architectural textures. HE staining further demonstrated intact lung tissue architecture and normal alveolar morphology, with no observable signs of inflammatory cell infiltration or interstitial congestion.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eClock gene expression in healthy mice\u003c/h2\u003e \u003cp\u003eConsidering the circadian rhythm fluctuations observed in lung tissues, this study investigates whether the differential effects of ginger on lung tissues between morning and evening correlate with the expression of clock genes. Real-time RT-PCR was utilized to quantify the expression levels of nine key clock genes in lung tissues. As depicted in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, the administration of ginger in the morning did not significantly affect the expression of these clock genes. In contrast, evening administration of ginger resulted in a significant reduction in the expression of clock genes \u003cem\u003ePer1/2/3\u003c/em\u003e, \u003cem\u003eCry1/2\u003c/em\u003e, and \u003cem\u003eRev-Erbα/β\u003c/em\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eEffects of morning or evening ginger intake on lung tissues of bleomycin-induced mice\u003c/h2\u003e \u003cp\u003eSince different administration timings exert distinct effects on normal lung tissue, does such a difference also exist in injured lung tissue? To address this question, the present study further established a bleomycin-induced lung injury mouse model. The results are shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e, after intratracheal instillation of bleomycin in mice, obvious lung injury manifestations were observed regardless of morning or evening administration, specifically including blurred lung tissue margins, thickened alveolar walls, and inflammatory cell infiltration. Meanwhile, significant changes were detected in lung function parameters, immune cell proportions, and inflammatory factor expression levels.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eAdministration of ginger in the morning reversed bleomycin-induced lung injury via multiple pathways, including ameliorating lung tissue morphological and pathological changes, restoring lung function, and suppressing inflammatory factor expression. In sharp contrast, ginger administered in the evening not only failed to exert a protective effect on the lungs but also exacerbated lung injury to a certain extent, which resulted in severe impairment of lung morphological and structural integrity, marked deterioration of histopathological features, and a significant reduction in pulmonary ventilation function.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eClock gene expression in bleomycin-induced mice\u003c/h2\u003e \u003cp\u003eWe employed real-time RT-PCR technology to quantify the mRNA expression levels of clock genes in mouse lung tissues. The results are shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e, after bleomycin induction, the mRNA expression of the vast majority of clock genes was significantly downregulated, whereas the expression of Bmal1 and Clock genes in the nighttime group was significantly upregulated. Compared with the MM group, morning administration of ginger significantly reversed the mRNA expression levels of \u003cem\u003ePer2\u003c/em\u003e, \u003cem\u003ePer3\u003c/em\u003e, \u003cem\u003eCry2\u003c/em\u003e and \u003cem\u003eRev-Erbα\u003c/em\u003e genes in the MG group, resulting in an upward trend. In contrast, evening administration of ginger did not exert any significant effect on the expression levels of any clock genes.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eCircadian rhythm disruption abolishes the morning-evening differences in ginger's effects on lung injury\u003c/h2\u003e \u003cp\u003eConsidering the observed discrepancy in the ameliorative effects of ginger on lung injury between morning and evening, as well as its impact on clock gene expression, this study further explored whether this variation is modulated by the circadian rhythm. To investigate this hypothesis, the study utilized clock gene knockout mice (\u003cem\u003ePer2\u003c/em\u003e knockout mice), to assess the effects of ginger on lung function, lung histopathology, and inflammatory cytokine levels following bleomycin-induced lung injury. The findings revealed that (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e), in \u003cem\u003ePer2\u003c/em\u003e knockout mice, disruption of the circadian rhythm did not modify the effects of bleomycin-induced lung injury; however, it completely nullified the therapeutic benefits of ginger. Additionally, the morning-evening discrepancy in ginger intervention was eliminated. These results suggest that maintaining circadian homeostasis is essential for ginger to exert its protective effects against lung injury.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eSytl2 and Cluap1 are key proteins responsible for the differences in efficacy of ginger between morning and evening\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThe disruption of the circadian rhythm eliminated the lung-protective effects of ginger, yet this elimination did not exhibit a difference between morning and evening. Moreover, administering ginger in the morning modulated the expression of certain clock genes, whereas evening administration did not significantly affect these genes, suggesting that clock genes are not the primary targets responsible for the differential efficacy of ginger between morning and evening.\u003c/p\u003e \u003cp\u003eTo further investigate the mechanisms underlying this temporal efficacy variation, we employed label-free quantitative proteomics to systematically analyze the protein expression profiles in the lung tissues of mice with lung injury following morning or evening administration of ginger. As illustrated in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA, a hierarchical clustering heatmap revealed distinct protein expression patterns between the morning and evening ginger-treated groups and their respective control groups (MC \u003cem\u003evs.\u003c/em\u003e MM and EC \u003cem\u003evs.\u003c/em\u003e EM).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo screen the key proteins, we initially identified differentially expressed proteins (DEPs, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) in the MM-MC group (evening model vs. evening control) and the MG-MM group (morning treatment vs. evening model), resulting in 384 intersecting proteins identified through Venn diagram analysis. Given the pronounced therapeutic effect observed with morning administration of ginger, we focused on 223 proteins that were negatively regulated among these DEPs. Subsequently, we examined DEPs (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) in the EM-EC group (evening model vs. evening control) and the EG-EM group (evening treatment vs. evening model), identifying 322 intersecting DEPs. Considering that evening administration of ginger was associated with exacerbated lung injury, we selected 32 proteins that were positively regulated from these DEPs. A cross-analysis of the proteins negatively regulated in the morning and positively regulated in the evening highlighted CLUAP1 and SYTL2 as potential key proteins underlying the differential efficacy of ginger based on the time of administration.\u003c/p\u003e \u003cp\u003eMouse lung tissues were collected, and Western blot analysis was performed to determine the differential expression of CLUAP1 and SYTL2 proteins. As illustrated in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eD, lung injury induced by bleomycin resulted in an upregulation of CLUAP1 expression and a downregulation of SYTL2 expression within the lung tissues of mice. Administration of ginger in the morning led to a decrease in CLUAP1 expression and an increase in SYTL2 expression, whereas evening administration further promoted the upregulation of CLUAP1 and exacerbated the downregulation of SYTL2. These findings are consistent with the proteomic analysis and corroborate the observed differences in the efficacy of ginger based on the time of administration.\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eGinger serves as both a prevalent culinary seasoning and a traditional medicinal herb within Chinese medicine, renowned for its extensive therapeutic applications. Traditional Chinese medicine underscores the importance of aligning medicinal consumption with temporal rhythms to harmonize with natural cycles and maintain the body's balance of yin and yang\u003csup\u003e[\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]\u003c/sup\u003e. The folk dietary belief that ginger should not be consumed after noon is consistent with this principle. In our preliminary experiments with mice, we observed that the timing of ginger administration\u0026mdash;morning versus evening\u0026mdash;produces significant differences in its effects on the thermogenic capacity of normal mice. Specifically, administering ginger at night significantly enhances thermogenic capacity, whereas morning administration does not yield a similar effect\u003csup\u003e[\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]\u003c/sup\u003e. Consequently, further investigation into the temporal effects of ginger administration and the optimization of its usage protocols is crucial for elucidating its clinical efficacy and ensuring medication safety.\u003c/p\u003e \u003cp\u003eRecent pharmacological research has substantiated that ginger and preparations containing ginger demonstrates significant efficacy in mitigating acute asthma attacks, ameliorating dyspnea and chronic cough symptoms in patients with chronic obstructive pulmonary disease, and enhancing lung function-related parameters\u003csup\u003e[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e][\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e][\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]\u003c/sup\u003e. As a critical organ, the lung's physiological and pathological processes are influenced by circadian rhythms. Previous studies have indicated that the protective effect of ceramide-1-phosphate against High-altitude pulmonary edema by stabilizing circadian rhythms and maintaining mitochondrial dynamics\u003csup\u003e[\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]\u003c/sup\u003e. In light of this, the current study concentrates on lung tissue to examine the differential effects of ginger administration in the morning versus the evening on both normal and lung-injured mice. The objective is to elucidate the temporal specificity of ginger's clinical application and establish guidelines for its administration in relation to circadian timing.\u003c/p\u003e \u003cp\u003eInitially, we examined the differential impacts of morning vs. evening ginger consumption on lung tissue function and clock gene expression in normal mice. The findings indicated that, relative to the control group, morning ginger intake did not result in significant alterations in pulmonary respiratory function, the proportion of pulmonary immune cells, or levels of inflammatory markers. In contrast, evening ginger intake disrupted normal lung function and its intrinsic rhythmicity. Importantly, within the dosage parameters established in this study, no pathological changes in lung tissue were observed, irrespective of whether ginger was consumed in the morning or evening.\u003c/p\u003e \u003cp\u003eThe physiological functions of lung tissue demonstrate pronounced circadian rhythmicity\u003csup\u003e[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]\u003c/sup\u003e, primarily regulated by the periodic expression of clock genes\u003csup\u003e[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]\u003c/sup\u003e. Upon injury to lung tissue, this rhythmicity is notably disrupted, thereby initiating a detrimental cycle of \"damage - rhythm disorder - secondary damage\"\u003csup\u003e[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]\u003c/sup\u003e. In light of this, we explored whether temporal variations in ginger intake, specifically in the morning versus the evening, yield differential effects in the context of lung injury. Our findings indicate that morning administration of ginger significantly mitigated bleomycin-induced lung injury, enhanced the expression of clock genes, and restored the circadian rhythmicity of lung tissue. Conversely, evening ginger intake not only failed to ameliorate lung injury symptoms but also exacerbated tissue damage, without further disruption of clock gene expression. These results tentatively affirm the critical role of administration timing in the therapeutic efficacy of ginger. Nonetheless, the precise temporal patterns of ginger's effects and the optimal timing for administration warrant further investigation in future studies.\u003c/p\u003e \u003cp\u003eGiven the close association between the differential effects of ginger in the morning and evening and the expression of clock genes, we employed a circadian rhythm disorder model using \u003cem\u003ePer2\u003c/em\u003e knockout mice to investigate its time-dependent pharmacodynamic variations. In the context of a combined bleomycin-induced lung injury model, we observed an unexpected outcome: disruption of the biological clock led to the complete elimination of the temporal differences in ginger's effects. Specifically, irrespective of whether ginger was administered in the morning or evening, there were no significant differences in pulmonary respiratory function, degree of pathological damage, or inflammatory response when compared to the model group at the corresponding time. This observation aligns with Dallmann's findings\u003csup\u003e[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]\u003c/sup\u003e, which suggest that in models with clock gene deficiencies, such as knockouts, the circadian rhythmicity of drug responses is typically diminished or abolished, rendering the timing of administration non-essential. These results further suggest that the protective or deleterious effects of ginger on lung tissue are contingent upon an intact circadian rhythm regulatory system.\u003c/p\u003e \u003cp\u003eIn light of the observation that the differential effects of ginger in the morning and evening are absent in the circadian rhythm disorder model, it is implied that these temporal effects are likely mediated by other critical downstream targets. To elucidate potential targets, we conducted a proteomic analysis. The findings indicate that the variation in ginger's effects between morning and evening may be attributed to the regulation of CLUAP1 and SYTL2 protein expression.\u003c/p\u003e \u003cp\u003eSYTL2 (synaptotagmin-like protein 2) is a member of the C2 domain-containing protein family\u003csup\u003e[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]\u003c/sup\u003e. It plays a pivotal role in vesicle transport, secretion, dynamic alterations of cell membranes, and inflammatory responses through its interaction with small GTPases such as Rab27A/B\u003csup\u003e[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e][\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e][\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]\u003c/sup\u003e. Although no direct associations with circadian rhythms and clock genes have been reported thus far, it is noteworthy that Chen et al\u003csup\u003e[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]\u003c/sup\u003e. observed differential expression of SYTL2 in a sleep deprivation-related myocardial infarction model, suggesting its potential involvement in pathology associated with circadian rhythm disruption.SYTL2 is instrumental in cell signaling and membrane fusion by coordinating vesicle-mediated secretion of active substances and regulating the exocytosis of inflammatory mediators\u003csup\u003e[\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]\u003c/sup\u003e. CLUAP1 (clusterin-associated protein 1) serves as a crucial regulator of cilia assembly and function. As an integral component of intraflagellar transport complex B (IFT-B)\u003csup\u003e[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]\u003c/sup\u003e, it is indispensable for cilia formation and maintenance\u003csup\u003e[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]\u003c/sup\u003e. Evidence indicates that CLUAP1 may indirectly influence circadian rhythms by preserving ciliary structure and modulating the Hedgehog signaling pathway\u003csup\u003e[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]\u003c/sup\u003e. This study is the first to identify the involvement of CLUAP1 and SYTL2 proteins in the temporal variations of drug effects, although their precise mechanisms warrant further investigation.\u003c/p\u003e \u003cp\u003ePrevious research on the use of ginger in the treatment of lung injury has been extensive\u003csup\u003e[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e][\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]\u003c/sup\u003e; however, the temporal variations in its efficacy remain underexplored. This study's primary innovation is its examination of the differential effects of ginger intake timing (morning versus night) on both healthy and injured lung tissue. This investigation provides a foundational understanding of the temporal mechanisms associated with ginger consumption and offers valuable insights for its clinical application and daily use. Nonetheless, the study has certain limitations: it exclusively examines the relationship between circadian rhythms and ginger's therapeutic effects on lung injury using mouse models, with no current validation in human subjects. Additionally, the study is limited to the lungs and does not consider rhythmic changes in other tissues. Future research should extend to other organs to investigate the diurnal effects of ginger consumption and advance clinical studies to elucidate its impact on both healthy and injured lung tissue, as well as its precise mechanisms of action.\u003c/p\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eData availability\u003c/h2\u003e \u003cp\u003eThe data that support the findings of this study are available from the corresponding authors upon reasonable request.\u003c/p\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data that support the findings of this study are available from the corresponding authors upon reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research did not receive funding from organizations.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Information\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eContributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eYu Wu\u003c/strong\u003e: Methodology, Design and accomplish the experiment, Data curation. \u003cstrong\u003eYaxin Li\u003c/strong\u003e: Accomplish the experiment, Writing - original draft. \u003cstrong\u003eWenqing Lv\u003c/strong\u003e: Analyze data, Visualization. \u003cstrong\u003eQian Shen\u003c/strong\u003e: Accomplish the experiment. \u003cstrong\u003eYanjun Zhang\u003c/strong\u003e: Provide technical guidance. \u003cstrong\u003ePengwei Zhuang\u003c/strong\u003e: Provide guidance, Writing-review and editing. \u003cstrong\u003eHong Guo\u003c/strong\u003e: Provide financial support, Provide guidance.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCorresponding author\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCorrespondence to Pengwei Zhuang and Hong Guo.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eBeyer, T. et al. CRISPR/Cas9-mediated Genomic Editing of Cluap1/IFT38 Reveals a New Role in Actin Arrangement. Molecular \u0026amp; cellular proteomics: MCP, 17(7), 1285\u0026ndash;1294. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1074/mcp.RA117.000487\u003c/span\u003e\u003cspan address=\"10.1074/mcp.RA117.000487\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBishehsari, F., Voigt, R. M., \u0026amp; Keshavarzian, A. Circadian rhythms and the gut microbiota: from the metabolic syndrome to cancer. Nature reviews. Endocrinology, 16(12), 731\u0026ndash;739. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41574-020-00427-4\u003c/span\u003e\u003cspan address=\"10.1038/s41574-020-00427-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen, X., Li, Q., Zhang, Z., Yang, M., \u0026amp; Wang, E. Identification of Potential Diagnostic Biomarkers From Circulating Cells During the Course of Sleep Deprivation-Related Myocardial Infarction Based on Bioinformatics Analyses. Frontiers in cardiovascular medicine, 9, 843426. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fcvm.2022.843426\u003c/span\u003e\u003cspan address=\"10.3389/fcvm.2022.843426\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDallmann, R., Okyar, A., \u0026amp; L\u0026eacute;vi, F. Dosing-Time Makes the Poison: Circadian Regulation and Pharmacotherapy. Trends in molecular medicine, 22(5), 430\u0026ndash;445. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.molmed.2016.03.004\u003c/span\u003e\u003cspan address=\"10.1016/j.molmed.2016.03.004\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eD'Alonzo, G. E., Crocetti, J. G., \u0026amp; Smolensky, M. H. Circadian rhythms in the pharmacokinetics and clinical effects of beta-agonist, theophylline, and anticholinergic medications in the treatment of nocturnal asthma. Chronobiology international, 16(5), 663\u0026ndash;682. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3109/07420529908998734\u003c/span\u003e\u003cspan address=\"10.3109/07420529908998734\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (1999).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFukuda, M., \u0026amp; Mikoshiba, K. Synaptotagmin-like protein 1\u0026ndash;3: a novel family of C-terminal-type tandem C2 proteins. Biochemical and biophysical research communications, 281(5), 1226\u0026ndash;1233. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1006/bbrc.2001.4512\u003c/span\u003e\u003cspan address=\"10.1006/bbrc.2001.4512\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2001).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGrabe, S., Ananthasubramaniam, B., \u0026amp; Herzel, H. Quantification of circadian rhythms in mammalian lung tissue snapshot data. Scientific reports, 14(1), 16238. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41598-024-66694-7\u003c/span\u003e\u003cspan address=\"10.1038/s41598-024-66694-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHan, R. et al. Folic acid-modified ginger-derived extracellular vesicles for targeted treatment of rheumatoid arthritis by remodeling immune microenvironment via the PI3K-AKT pathway. Journal of nanobiotechnology, 23(1), 41. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s12951-025-03096-5\u003c/span\u003e\u003cspan address=\"10.1186/s12951-025-03096-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2025).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHarris-Gauthier, N., Srikanta, S. B., \u0026amp; Cermakian, N. Deubiquitinases: key regulators of the circadian clock. American journal of physiology. Cell physiology, 323(5), C1539\u0026ndash;C1547. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1152/ajpcell.00289.2022\u003c/span\u003e\u003cspan address=\"10.1152/ajpcell.00289.2022\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJedli, O. et al. Attenuation of ovalbumin-induced inflammation and lung oxidative injury in asthmatic rats by Zingiber officinale extract: combined in silico and in vivo study on antioxidant potential, STAT6 and TNF-α pathways. 3 Biotech, 12(9), 191. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s13205-022-03249-5\u003c/span\u003e\u003cspan address=\"10.1007/s13205-022-03249-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKatoh, Y. et al. Overall Architecture of the Intraflagellar Transport (IFT)-B Complex Containing Cluap1/IFT38 as an Essential Component of the IFT-B Peripheral Subcomplex. The Journal of biological chemistry, 291(21), 10962\u0026ndash;10975. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1074/jbc.M116.713883\u003c/span\u003e\u003cspan address=\"10.1074/jbc.M116.713883\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKesari, A. et al. Dysferlin deficiency shows compensatory induction of Rab27A/Slp2a that may contribute to inflammatory onset. The American journal of pathology, 173(5), 1476\u0026ndash;1487. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.2353/ajpath.2008.080098\u003c/span\u003e\u003cspan address=\"10.2353/ajpath.2008.080098\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2008).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim, J., Lee, H., \u0026amp; You, S. Dried Ginger Extract Restores the T Helper Type 1/T Helper Type 2 Balance and Antibody Production in Cyclophosphamide-Induced Immunocompromised Mice after Flu Vaccination. Nutrients, 14(9), 1984. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/nu14091984\u003c/span\u003e\u003cspan address=\"10.3390/nu14091984\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKrakowiak, K., \u0026amp; Durrington, H. J. The Role of the Body Clock in Asthma and COPD: Implication for Treatment. Pulmonary therapy, 4(1), 29\u0026ndash;43. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s41030-018-0058-6\u003c/span\u003e\u003cspan address=\"10.1007/s41030-018-0058-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLai, Y. S. et al. Ginger Essential Oil Ameliorates Hepatic Injury and Lipid Accumulation in High Fat Diet-Induced Nonalcoholic Fatty Liver Disease. Journal of agricultural and food chemistry, 64(10), 2062\u0026ndash;2071. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1021/acs.jafc.5b06159\u003c/span\u003e\u003cspan address=\"10.1021/acs.jafc.5b06159\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMeyer, N., Harvey, A. G., Lockley, S. W., \u0026amp; Dijk, D. J. Circadian rhythms and disorders of the timing of sleep. Lancet (London, England), 400(10357), 1061\u0026ndash;1078. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/S0140-6736(22)00877-7\u003c/span\u003e\u003cspan address=\"10.1016/S0140-6736(22)00877-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNaik, A. et al. Circadian regulation of lung repair and regeneration. JCI insight, 8(16), e164720. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1172/jci.insight.164720\u003c/span\u003e\u003cspan address=\"10.1172/jci.insight.164720\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNosal, C., Ehlers, A., \u0026amp; Haspel, J. A. Why Lungs Keep Time: Circadian Rhythms and Lung Immunity. Annual review of physiology, 82, 391\u0026ndash;412. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1146/annurev-physiol-021119-034602\u003c/span\u003e\u003cspan address=\"10.1146/annurev-physiol-021119-034602\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePasek, R. C., Berbari, N. F., Lewis, W. R., Kesterson, R. A., \u0026amp; Yoder, B. K. Mammalian Clusterin associated protein 1 is an evolutionarily conserved protein required for ciliogenesis. Cilia, 1(1), 20. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/2046-2530-1-20\u003c/span\u003e\u003cspan address=\"10.1186/2046-2530-1-20\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2012).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePaudel, K. R. et al. Recent Advances in Chronotherapy Targeting Respiratory Diseases. Pharmaceutics, 13(12), 2008. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/pharmaceutics13122008\u003c/span\u003e\u003cspan address=\"10.3390/pharmaceutics13122008\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePecoraro, L., Peterle, E., Dalla Benetta, E., Piazza, M., Chatziparasidis, G., \u0026amp; Kantar, A. Well-Established and Traditional Use of Vegetal Extracts as an Approach to the \"Deep Roots\" of Cough. Children (Basel, Switzerland), 11(5), 584. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/children11050584\u003c/span\u003e\u003cspan address=\"10.3390/children11050584\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRho, J. et al. Yijin-Tang Attenuates Cigarette Smoke and Lipopolysaccharide-Induced Chronic Obstructive Pulmonary Disease in Mice. Evidence-based complementary and alternative medicine: eCAM, 2022, 7902920. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1155/2022/7902920\u003c/span\u003e\u003cspan address=\"10.1155/2022/7902920\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRobles, A. L., Bautista-S\u0026aacute;nchez, U., Olvera-Hern\u0026aacute;ndez, E. G., et al. Chronopharmacokinetics: A Brief Analysis of the Influence of Circadian Rhythm on the Absorption, Distribution, Metabolism, and Elimination of Drugs. Biomedical \u0026amp; Pharmacology Journal, 17(3), 2011\u0026ndash;2017. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.13005/bpj/3003\u003c/span\u003e\u003cspan address=\"10.13005/bpj/3003\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSato, T., \u0026amp; Greco, C. M. Expanding the link between circadian rhythms and redox metabolism of epigenetic control. Free radical biology \u0026amp; medicine, 170, 50\u0026ndash;58. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.freeradbiomed.2021.01.009\u003c/span\u003e\u003cspan address=\"10.1016/j.freeradbiomed.2021.01.009\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchibler U. The daily rhythms of genes, cells and organs. Biological clocks and circadian timing in cells. EMBO reports, 6 Spec No(Suppl 1), S9\u0026ndash;S13. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/sj.embor.7400424\u003c/span\u003e\u003cspan address=\"10.1038/sj.embor.7400424\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2005).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSerin, Y., \u0026amp; Acar Tek, N. Effect of Circadian Rhythm on Metabolic Processes and the Regulation of Energy Balance. Annals of nutrition \u0026amp; metabolism, 74(4), 322\u0026ndash;330. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1159/000500071\u003c/span\u003e\u003cspan address=\"10.1159/000500071\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSundar, I. K., Yao, H., Sellix, M. T., \u0026amp; Rahman, I. Circadian molecular clock in lung pathophysiology. American journal of physiology. Lung cellular and molecular physiology, 309(10), L1056\u0026ndash;L1075. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1152/ajplung.00152.2015\u003c/span\u003e\u003cspan address=\"10.1152/ajplung.00152.2015\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2015).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTanaka, M., \u0026amp; Nakamura, T. Role of the RAB27/SYTL Axis in Tumor Microenvironment Construction. Cancer science, 116(7), 1815\u0026ndash;1822. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/cas.70096\u003c/span\u003e\u003cspan address=\"10.1111/cas.70096\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2025).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTeng, Y. et al. Plant-derived exosomal microRNAs inhibit lung inflammation induced by exosomes SARS-CoV-2 Nsp12. Molecular therapy: the journal of the American Society of Gene Therapy, 29(8), 2424\u0026ndash;2440. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.ymthe.2021.05.005\u003c/span\u003e\u003cspan address=\"10.1016/j.ymthe.2021.05.005\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eThomson, M., Al-Qattan, K. K., Al-Sawan, S. M., Alnaqeeb, M. A., Khan, I., \u0026amp; Ali, M. The use of ginger (Zingiber officinale Rosc.) as a potential anti-inflammatory and antithrombotic agent. Prostaglandins, leukotrienes, and essential fatty acids, 67(6), 475\u0026ndash;478. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1054/plef.2002.0441\u003c/span\u003e\u003cspan address=\"10.1054/plef.2002.0441\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2002).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTian, L. et al. Ceramide-1-phosphate alleviates high-altitude pulmonary edema by stabilizing circadian ARNTL-mediated mitochondrial dynamics. Journal of advanced research, 60, 75\u0026ndash;92. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jare.2023.07.008\u003c/span\u003e\u003cspan address=\"10.1016/j.jare.2023.07.008\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu, Y. et al. Effects of different administration timing of ginger on heat production capacity in normal mice. Drug Evaluation Research, 47(2), 309\u0026ndash;315 (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXie, X. et al. Effects of COL1A1 and SYTL2 on inflammatory cell infiltration and poor extracellular matrix remodeling of the vascular wall in thoracic aortic aneurysm. Chinese medical journal, 137(9), 1105\u0026ndash;1114. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1097/CM9.0000000000002808\u003c/span\u003e\u003cspan address=\"10.1097/CM9.0000000000002808\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYasuda, T., \u0026amp; Fukuda, M. Slp2-a controls renal epithelial cell size through regulation of Rap-ezrin signaling independently of Rab27. Journal of cell science, 127(Pt 3), 557\u0026ndash;570. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1242/jcs.134056\u003c/span\u003e\u003cspan address=\"10.1242/jcs.134056\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2014).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYocum, G. T. et al. Ginger and its bioactive component 6-shogaol mitigate lung inflammation in a murine asthma model. American journal of physiology. Lung cellular and molecular physiology, 318(2), L296\u0026ndash;L303. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1152/ajplung.00249.2019\u003c/span\u003e\u003cspan address=\"10.1152/ajplung.00249.2019\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang, M., Zhao, R., Wang, D., Wang, L., Zhang, Q., Wei, S., Lu, F., Peng, W., \u0026amp; Wu, C. Ginger (Zingiber officinale Rosc.) and its bioactive components are potential resources for health beneficial agents. Phytotherapy research: PTR, 35(2), 711\u0026ndash;742. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/ptr.6858\u003c/span\u003e\u003cspan address=\"10.1002/ptr.6858\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang, T., Yan, L., Ma, S., \u0026amp; He, J. Human biological rhythm in traditional Chinese medicine. Journal of Traditional Chinese Medical Sciences, 3(4), 206\u0026ndash;211. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jtcms.2016.12.004\u003c/span\u003e\u003cspan address=\"10.1016/j.jtcms.2016.12.004\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2016).\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"npj-science-of-food","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"npjscifood","sideBox":"Learn more about [npj Science of Food](http://www.nature.com/npjscifood/)","snPcode":"41538","submissionUrl":"https://submission.springernature.com/new-submission/41538/3","title":"npj Science of Food","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"NPJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-8913616/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8913616/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eGinger, a substance utilized in both culinary and medicinal contexts, demonstrates significant protective effects on pulmonary health and mitigates lung injury. Although numerous studies propose that the timing of ginger consumption may result in varied therapeutic outcomes, these propositions have yet to be empirically validated. This study represents the first systematic exploration of the temporal effects and underlying mechanisms associated with morning versus evening ginger administration in both healthy and lung-injured murine models. In comparison to the control group, evening consumption of ginger markedly affected lung function, inflammatory cytokine levels, and clock gene expression in healthy mice, whereas morning consumption did not produce significant effects. Conversely, morning administration of ginger ameliorated the symptoms of bleomycin-induced lung injury and altered clock gene expression, while evening administration aggravated lung damage. In Per2-knockout (Per2-KO) mice, the distinct effects of morning versus evening ginger intake were nullified. Proteomic analysis identified Sytl2 and Cluap1 as potential key proteins mediating the differential responses to ginger based on the time of administration. The study's findings underscore the importance of considering intake timing in both clinical applications and daily use of ginger to optimize its safety and therapeutic efficacy.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e","manuscriptTitle":"Morning vs. Evening: The Temporal Differences of Ginger's Efficacy in Lung","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-05-11 19:20:50","doi":"10.21203/rs.3.rs-8913616/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"editorInvitedReview","content":"","date":"2026-05-14T17:34:54+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"48924782931312795174493705134312862339","date":"2026-05-04T01:37:28+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2026-05-04T00:20:27+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-02-22T13:42:45+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-02-22T13:41:10+00:00","index":"","fulltext":""},{"type":"submitted","content":"npj Science of Food","date":"2026-02-19T03:46:59+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"npj-science-of-food","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"npjscifood","sideBox":"Learn more about [npj Science of Food](http://www.nature.com/npjscifood/)","snPcode":"41538","submissionUrl":"https://submission.springernature.com/new-submission/41538/3","title":"npj Science of Food","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"NPJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"24c79ced-3fce-4a29-893d-e825f7f30e07","owner":[],"postedDate":"May 11th, 2026","published":true,"recentEditorialEvents":[{"type":"editorInvitedReview","content":"","date":"2026-05-14T17:34:54+00:00","index":21,"fulltext":""},{"type":"reviewerAgreed","content":"48924782931312795174493705134312862339","date":"2026-05-04T01:37:28+00:00","index":18,"fulltext":""},{"type":"reviewersInvited","content":"8","date":"2026-05-04T00:20:27+00:00","index":"","fulltext":""}],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[{"id":67835597,"name":"Health sciences/Diseases"},{"id":67835599,"name":"Biological sciences/Drug discovery"},{"id":67835601,"name":"Health sciences/Medical research"}],"tags":[],"updatedAt":"2026-05-11T19:20:51+00:00","versionOfRecord":[],"versionCreatedAt":"2026-05-11 19:20:50","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8913616","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8913616","identity":"rs-8913616","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.