Interleukin-18-primed human umbilical cord-mesenchymal stem cells achieve superior therapeutic efficacy for severe viral pneumonia via enhancing T-cell immunosuppression

Interleukin-18-primed human umbilical cord-mesenchymal stem cells achieve superior therapeutic efficacy for severe viral pneumonia via enhancing T-cell immunosuppression | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Interleukin-18-primed human umbilical cord-mesenchymal stem cells achieve superior therapeutic efficacy for severe viral pneumonia via enhancing T-cell immunosuppression Cheguo Cai, Yan Liao, Zeqin Fu, Yinfu Huang, Shiduo Wu, Zhen Wang, and 11 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-2012946/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 28 Jan, 2023 Read the published version in Cell Death & Disease → Version 1 posted 9 You are reading this latest preprint version Abstract Coronavirus disease 2019 (COVID-19) treatments are still urgently needed for critically and severely ill patients. Human umbilical cord-mesenchymal stem cells (hUC-MSCs) infusion has therapeutic benefits in COVID-19 patients; however, uncertain therapeutic efficacy has been reported in severe patients. In this study, we selected an appropriate cytokine, IL-18, based on the special cytokine expression profile in severe pneumonia of mice induced by H1N1virus to prime hUC-MSCs in vitro and improve the therapeutic effect of hUC-MSCs in vivo . In vitro , we demonstrated that IL-18-primed hUC-MSCs (IL18-hUCMSC) have higher proliferative ability than non-primed hUC-MSCs (hUCMSCcon), and there was no significant difference in their migration capacity. In addition, VCAM-1, MMP-1, TGF-β1, and some chemokines (CCL2 and CXCL12, for example) are more highly expressed in IL18-hUCMSCs. We found that IL18-hUCMSC significantly enhanced the immunosuppressive effect on CD3 + T-cells. In vivo , we demonstrated that IL18-hUCMSC infusion could reduce the body weight loss caused by a viral infection and significantly improve the survival rate. Of note, IL18-hUCMSC can also significantly attenuate certain clinical symptoms, including reduced activity, ruffled fur, hunched backs, and lung injuries. Pathologically, IL18-hUCMSC transplantation significantly enhanced the inhibition of inflammation, viral load, fibrosis, and cell apoptosis in acute lung injuries. Notably, IL18-hUCMSC treatment has a superior inhibitory effect on T-cell exudation and proinflammatory cytokine secretion in bronchoalveolar lavage fluid (BALF). Altogether, IL-18 is a promising cytokine that can prime hUC-MSCs to improve the efficacy of precision therapy against viral-induced pneumonia, such as COVID-19. COVID-19 severe pneumonia IL-18 hUC-MSCs immunosuppression precision therapy Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction The coronavirus disease 2019 (COVID-19), a pneumonia-like disease caused by the virus severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), became a pandemic in China in early 2020 [ 1 ]. The SARS-CoV-2 infection causes substantial lung damage, ranging from mild respiratory illness to severe acute respiratory syndrome and even death [ 2 ]. Current coronavirus vaccines have protected most people from infection, and pulmonary symptoms in patients with mild and moderate COVID-19 can be mitigated with regular supportive therapy and effective antiviral therapy [ 3 ]. However, no specific drugs or vaccines are currently available to treat severe COVID-19 patients. The typical characteristics of these patients are an excessive immune response, cytokine storm, upregulation of proinflammatory cytokines and chemokines, acute respiratory distress syndrome (ARDS), respiratory and cardiovascular failure, end-organ damage, and even death [ 4 ]. Therefore, there is an urgent need for safe and effective therapeutic methods for mitigating lung injuries in severe COVID-19 patients. Mesenchymal stem cells (MSCs) are nonhematopoietic cells with immunomodulatory, regenerative, and tri-differentiation properties. There have been reports that MSC infusion reduces pathological changes in the lungs and inhibits the inflammatory response induced by the influenza virus in animal models [ 5 – 8 ] and by the influenza virus or coronavirus in clinical trials [ 9 , 10 ]. Moreover, in a phase 1 trial, safe and well-tolerated human umbilical cord-derived mesenchymal stem cells (hUC-MSCs) therapy was reported in patients with COVID-19 [ 4 ]. In a randomized, double-blind, placebo-controlled phase 2 trial, hUC-MSCs treatment was viewed as a safe and potentially effective therapeutic approach for severe COVID-19 patients with lung damage [ 3 ]. However, there are also reports of MSC therapy failing in patients with severe viral pneumonia [ 11 , 12 ]. One reason is the diversity of inflammatory microenvironment in patients and the heterogeneity of hUC-MSCs from various human sources, which limits therapeutic efficacy. Some studies have found that the local microenvironment could affect immune-related behaviors and MSC therapeutic efficacy [ 13 , 14 ]. High inflammatory levels in the microenvironment induce the immunosuppression of MSCs, while low inflammatory levels induce the immune promotion of MSCs [ 15 ]. To fully harness MSC immunosuppressive activity, they must be activated or primed in vitro [ 16 – 18 ] or in vivo [ 19 ]. Multiple factors have been tested in an attempt to increase MSC immunosuppression and therapeutic efficacy, including the pro-inflammatory cytokines tumor necrosis factor-alpha (TNF-α) [ 20 , 21 ], interferon-gamma (IFN-γ) [ 22 , 23 ], interleukin-1 alpha/beta (IL-1α/β) [ 18 , 24 ], interleukin-17A (IL-17A) [ 16 , 25 ], interleukin-25 (IL-25) [ 13 ], either singly or as a combination of IL-1β + TNF-α and TNF-α + IFN-γ [ 26 – 28 ]. Moreover, transforming growth factor-β1 (TGF-β1) [ 29 ], lipopolysaccharide (LPS) [ 30 ], metformin [ 31 ], and Poly(I:C) [ 32 ] were also used for MSC priming. It has a special inflammatory factor expression profile in the microenvironment of different diseases or stages of the same disease. In this study, we must identify the crucial inflammatory factor, which is more highly expressed in severe pneumonia induced by the virus. Interleukin (IL)-18 is a proinflammatory cytokine belonging to the IL‐1 family, first identified for its interferon‐γ‐inducing properties [ 33 ]. IL‐18‐mediated inflammation has largely been studied in animal models of bacterial, viral, parasitic, and fungal infections [ 34 ]. Damage in the later phases of COVID‐19 appears to be driven by a cytokine storm, including interleukin IL‐1 family members and secondary cytokines like IL‐6. IL‐18 could participate in this hyperinflammation, as it was previously found to injure the lung tissue of infected animals by regulating both T helper (Th)1 and Th2 responses [ 35 ]. IL‐18 is involved in both innate and acquired immune responses since it is released by macrophages after infections and binds to the IL‐18 receptor (IL‐18Rα and IL‐18Rβ) in the cytomembrane of T and NK cells [ 36 ]. After binding to the IL‐18Rα subunit, a heterodimeric complex is formed to propagate the intracellular MyD88 signaling that culminates in proinflammatory gene transcription with the activation of NF‐κB [ 37 ]. IL‐18 plasma levels are commonly elevated in viral infections, exceeding 1,000 pg/ml during the acute phase of Epstein–Barr virus (EBV) and in human immunodeficiency virus (HIV) infection, particularly in patients with severe cases [ 38 , 39 ]. In SARS caused by SARS‐CoV‐1, circulating IL‐18 levels peaked 4–6 days after fever onset and normalized during the convalescent period [ 40 ]. Collectively, IL-18 is the important cytokine in the proinflammatory microenvironment of influenza virus-induced severe pneumonia and could influence MSC priming in vitro and in vivo . In this study, IL-18 first showed higher expression in a mouse model of severe pneumonia, and IL-18 was used for priming hUC-MSCs in vitro . Next, we will explore how IL-18 affects the characteristics of hUC-MSCs in vitro and assess the therapeutic efficacy of IL18-primed-hUC-MSCs on H1N1 virus-induced acute severe lung injury in vivo . Lastly, the mechanism of the therapeutic effects of IL18-primed hUC-MSCs will be further clarified. Materials And Methods Isolation and culture of hUC-MSCs hUC-MSCs were obtained and cultured according to previously described methods [41]. Briefly, the umbilical cord was obtained from a healthy pregnant woman after informed consent was obtained. The umbilical cord was rinsed twice with Dulbecco’s phosphate-buffered saline (D-PBS, Invitrogen), cut longitudinally, and the arteries and veins were removed. The soft gel tissues were dissected into small pieces and individually placed on 100-mm tissue culture dishes with low-glucose Dulbecco’s modified Eagle’s medium (L-DMEM, HyClone) supplemented with 5% (v/v) hPL (UltraGRO TM -Advanced, GMP Grade, AventaCell BioMedical), as well as 2 mM L-glutamine and 1% penicillin/streptomycin. After 12 days of culture, the umbilical cord tissue was carefully removed. The plates were washed three times with D-PBS; the plastic adherent cell colonies were trypsinized, and cells (Passage 0, P0) were re-seeded for propagating with the growth medium changing every 72 hours. Passage 4 (P4) hUC-MSCs were used in all experiments, and all cells were cultured at 37°C in a humidified atmosphere of 5% CO 2 . Preparation of IL-18-primed hUC-MSCs (IL18-hUCMSC) hUC-MSCs (P3) were grown in T175 flasks (Corning); when they reached >80% confluence, cells were trypsinized and replated at a density of 5,000 cells per cm 2 in T175. After overnight culture, the IL18-hUCMSC was generated by cells pre-stimulated with 100ng/ml recombinant human IL-18 (Sigma-Aldrich) for 24 hours in the complete medium; hUCMSCcon was the cell control without pre-stimulation. Regardless of IL-18 pretreatment, the IL18-hUCMSC and hUCMSCcon were obtained for the following in vitro and in vivo experiments. Flow Cytometric Analysis Flow cytometric analyses were performed using a BD™ Aria IIu flow cytometer, and data were analyzed with FlowJo7.5 software (Tree Star). The following anti-human antibodies were used: CD73-PE (TY/23), CD90-FITC (5E10), CD105-APC (266), CD34-PE (563), CD45-FITC (HI30), HLA-DR-PerCP (G46-6), and CD3-APC (UCHT1); and the anti-mouse antibodies were: CD3-FITC (17A2), CD4-PE (GK1.5), and CD8-APC (53-6.7). All these antibodies, along with the corresponding isotype control antibodies, were purchased from BD Pharmingen. 5,6-carboxyfluorescein diacetatesuccinimidyl ester (CFSE; Invitrogen) and 7-AAD (BD Pharmingen) were used to stain proliferative and dead cells. Characterization and in vitro differentiation of hUCMSCcon and IL18-hUCMSC To evaluate the expression changes of MSC surface markers between hUCMSCcon and IL18-hUCMSC, flow cytometry was performed using a BD™ Aria IIu flow cytometer. Antibodies used for cytometric analysis were CD73, CD90, CD105, CD34, CD45, and HLA-DR, as mentioned above. To evaluate the tri-lineage differentiation potential of hUCMSCcon and IL18-hUCMSC, the osteogenic, adipogenic, and chondrogenic differentiation abilities were analyzed in vitro . Briefly, hUCMSCcon and IL18-hUCMSC were cultured in the relevant differentiation media for 2-3 weeks and analyzed by staining with Alizarin Red, Oil Red O, and toluidine blue staining, as previously described [42]. hUC-MSCs proliferation assay hUCMSCcon and IL18-hUCMSC were resuspended in DMEM complete medium (supplemented with 5% (v/v) hPL, as well as 2 mM L-glutamine and 1% penicillin/streptomycin), and seeded to a 12-well plate at 10 4 cells per well. The cells were trypsinized at each indicated time point over seven days, and the cell numbers were directly counted. The population doubling times (DTs) of hUCMSCcon and IL18-hUCMSC were calculated using the following formula: DT = t × [log 2 / (log Nt-logN0)], where Nt is the number of harvested cells, N0 is the number of seeded cells, and t is the culture time. Scratch wound assay Five straight lines were prepared on the back of 30-mm Petri dishes at 1cm intervals. Then, a 2 ml cell suspension of hUCMSCcon or IL18-hUCMSC (2.5×10 5 cells/ml) was separately added to two Petri dishes and cultivated for 24 hours. Next, a scratch line was made with a 10 μl pipetting spear perpendicular to the five baselines, and detached cells were washed with D-PBS (Invitrogen. Then, 2 ml serum-free medium was added to the Petri dishes. Human peripheral blood lymphocyte proliferation assays. Human hUC-MSCs (1 × 10 5 cells) were plated to a 24-well plate (Corning) and cultured for 24 hours they were used for the lymphocyte proliferation assay. Human PBMCs were washed twice with D-PBS and stained with CFSE (5 μmol/l, Invitrogen), which was used to assess T-cell proliferation. The cells were then suspended in Roswell Park Memorial Institute (RPMI)1640 at 1 × 10 6 cells/ml and distributed to 24-well plates (1 ml/well) in the presence or absence of hUC-MSCs. To induce T-cell proliferation, anti-human CD3 and CD28 antibodies (BD Pharmingen; final concentration, 500 ng/ml) were added to the wells. After four days of coculture, the CD3 + T-cells were collected and analyzed by flow cytometry. Reverse transcription and real-time qPCR Total RNA was extracted from hUC-MSCs and mouse lung tissues using the TRIzol reagent (Invitrogen), and 1 μg of RNA was reverse transcribed using a RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific). The resulting cDNA was subjected to real-time PCR with the SYBR Green reagent (Roche) using the human and mouse primers listed in Table 1 and Table 2. The relative mRNA abundances were calculated using the ΔCt method, and the gene expression levels were normalized with respect to those of GAPDH. Viruses and animals The type of influenza virus we used in our study is the mouse-adapted Influenza A/Puerto Rico/8/34 (H1N1; abbreviated as PR8) and was propagated in 10-day-old SPF chicken embryos at 37℃ for 48 h. Aliquots of collected allantoic fluids were stored at -80℃ in the lab of College of Veterinary Medicine, South China Agricultural University. The allantoic fluid was collected and titrated to determine the 50% tissue culture infection dose (TCID 50 ) in A549 cells. All experiments involving the live virus (PR8) were performed in an approved biosafety level 2 (BSL-2) laboratory. Eight-week-old specific pathogen-free (SPF) grade female BALB/c mice (body weight: 18-20 g) were purchased from the Animal Center at the Medical Laboratory of Guangdong Province, China. All mice were maintained in a specific pathogen-free facility, and all animal procedures and protocols were reviewed and approved by the animal experimental ethics committee of the South China Agricultural University. Infection, monitoring, and sampling of mice Seventy BALB/c mice were intraperitoneally injected with 0.2 ml 3% (v/v) chloral hydrate. Several minutes later, the 50μl saline or PR8 (TCID 50 ) was administered through a nasal inhalation (0 day-post-infection, 0 dpi). BALB/c mice were randomly allocated to four experimental groups: Mock group (10 mice), Model + Saline group (20 mice), Model + hUCMSCcon group (20 mice), and Model + IL18-hUCMSC group (20 mice). After infection with the PR8 virus, the mice in different groups were observed daily, and changes in the clinical symptoms, body weight, and survival were recorded for up to 14 days. Mice that lost more than 20% of their body weight were considered to have reached the experimental endpoint and were euthanized. Model mice were injected intravenously with 100 μl saline without or with hUC-MSCs (hUCMSCcon or IL18-hUCMSC, 1.0 × 10 6 cells/per mice) at 3 dpi. At 7 dpi, five mice from each group were sacrificed, and their blood was obtained by excising eyeballs. Blood samples were then centrifuged at 1000g for 20 min at 4℃, and supernatants were collected as serum. Bronchoalveolar lavage fluid (BALF) from both lungs was obtained by three consecutive instillations and aspirations of 500 μl sterile D-PBS; aliquots were spun at 800 g 4℃ for 5 min; supernatant from the first lavage was removed and stored at -80℃ for further analysis. The lung tissues in each group were collected and homogenized in 1 ml of sterile D-PBS. At 7 or 14 dpi, newborn rats were sacrificed, and the whole lung tissue was harvested for histology (hematoxylin-eosin, H&E, and Masson’s trichrome staining), total lung mRNA analysis. Lung injury conditions and lung index The whole lung tissue of the mice was collected at 14 dpi, and the degree of lung injury visible to the naked eye was dark red due to edema. The area ratio of lung injury to the total lung tissue was estimated by at least three different individuals, from which the average was calculated. Finally, the lung injury area of five mice in each group was counted. The wet weight of the lung tissue was weighed. Lung index = lung wet weight/body mass. Histopathology At 7 and 14 dpi, lung tissues were fixed in 4% paraformaldehyde and then dehydrated, embedded in paraffin, and cut into 5 μm-thick sections. The sections were stained with hematoxylin and eosin (H&E) and Masson’s Trichrome using a Leica DM500B microscope (Leica, Germany). Quantification of cytokines Mouse BALF, serum, and lung tissue were harvested to count cytokines. The lung tissue was homogenized in 1 ml of D-PBS containing protease inhibitor cocktail (Roche). The homogenate was centrifuged at 16,000 g for 20 min at 4°C before the supernatant was harvested. The amounts of the following cytokines were analyzed: IFN-γ, TNF-α, IL-1β, and IL-6. All cytokines were analyzed using a commercial ELISA kit (R&D Systems). Results Acute severe lung injury caused by H1N1 virus infection leads to elevated IL-18 expression To evaluate the therapeutic effect of primed hUC-MSCs on severe lung injury, it is necessary to induce a severe mouse model with weight loss of more than 20% (reaching the endpoint of the experiment). Four viral infection doses (TCID50: 1×10 6 /ml, 1×10 7 /ml, 5×10 7 /ml, and 1×10 8 /ml) were used inH1N1 (PR8) virus-induced acute lung injuries in vivo . The results demonstrated that the body weight of mice gradually decreased after viral infections, while only the highest infection dose (TCID50: 1×10 8 /ml) could reduce the body weight to 80% lower than their original level 6 days post-infection (6 dpi) ( Figure 1A ), and the survival rate at 5 dpi and 6 dpi decreased to 66.67% and 33.33%, respectively ( Figure 1B ). As such, a severe disease mouse model was successfully established. Various diseases induce unique cytokine expression profiles. In this study, we investigated changes in several important cytokines in a mouse model of severe lung injuries. We found that five key genes (TNF-α, IFN-γ, IL-1β, IL-6, and IL-10) first increased and then decreased, peaking at 5 dpi ( Figure 1C ). This phenomenon is consistent with typical inflammatory responses to viral infections. Interestingly, we confirmed that the gene expression of proinflammatory factor IL-18 in the injured lung was higher than that of the other five cytokines, and its changes were similar to that of these genes ( Figure 1C ). Additionally, the IL-18 protein concentration in bronchoalveolar lavage fluid (BALF) was higher (approximately 2000-3500 pg/ml) than in the others, which were lower than 650 pg/ml ( Figure 1D ). Together, the expression of proinflammatory factor IL-18 is elevated in the severe H1N1 virus-induced acute lung injury model, suggesting that it could stimulate transplanted hUC-MSCs in vivo . IL-18-primed hUC-MSCs exhibit robust immunosuppressive ability We first investigated the expression of the IL-18 receptor (IL-18R) in hUC-MSCs to ensure activation of the downstream signaling pathway of IL-18-IL-18R. RT-qPCR analysis indicated that IL-18R expression is approximately 1/500th that of GAPDH ( Supplementary figure 1A ). To better understand IL-18R expression levels, we compared the expression of several common factor receptors, including IFN-γ receptors (IFNGR1 and IFNGR2), TNF receptors (TNFR1 and TNFR2), TGF-β receptors (TGFbR1 and TGFbR2), IL-1 receptors (IL1R1 and IL1R2), and the IL-17 receptor (IL17RA). We found that the mRNA expression of IL-18R was higher than that of IL1R2 and lower than that of the other eight receptors ( Supplementary figure 1B ). These results indicate that hUC-MSCs express IL-18R at relatively lower levels. We then investigated the characteristics and functions of IL-18-primed hUC-MSCs, as illustrated in the scheme ( Figure 2A ). In detail, hUC-MSCs were first cultured in a complete medium from passage 0 (P 0) to P 3, with passaging every 3-4 days. P 3 hUC-MSCs were re-seeded in a culture dish in a complete medium by the 5000 cells/cm 2 . Recombinant human IL-18 protein was added into a fresh medium after 48 hours of culture, and the P 4 IL-18-primed hUC-MSCs (IL18-hUCMSC) or control hUC-MSCs (hUCMSCcon) were obtained with or without 24 hours of priming. Then, the surface markers, tri-lineage differentiation potential, proliferation ability, migration ability, paracrine secretion, and immunosuppression ability were analyzed in the following experiments. First, we performed immunophenotyping of IL18-hUCMSC and hUCMSCcon. At P4, more than 95% of these two hUCMSCs were positive for typical mesenchymal cell surface markers (CD73, CD90, and CD105), while hematopoietic cell markers (CD34 and CD45) and HLA-DR were almost completely absent ( Supplementary figure 2A ). We also assessed the ability of IL18-hUCMSC and hUCMSCcon to differentiate into osteocytes, adipocytes, and chondrocytes on day 21 of culture in the conditioned medium. The results indicated that IL18-hUCMSC and hUCMSCcon had similar tri-differentiation abilities ( Supplementary figure 2B ). Second, the results of cell proliferation showed that IL18-hUCMSC expanded faster than hUCMSCcon during the seven-day culture, especially on days 2 and 3 ( Figure 2B ). The population doubling time (DT) was significantly lower for IL18-hUCMSC compared with hUCMSCcon (22.06 ± 0.63 h versus 29.65± 1.47 h, Figure 2C ). We found no significant difference in cell migration between IL18-hUCMSC and hUCMSCcon in a scratch wound assay, with a similar healing ratio from 4h to 24h ( Figure 2D and Supplementary figure 3A ). Third, the qPCR analysis demonstrated that IL-18 priming could increase the mRNA expression of vascular cell adhesion molecule-1 (VCAM-1) and matrix metalloproteinase-1 (MMP-1), but not intercellular cell adhesion molecule-1 (ICAM-1) and MMP-2 in the IL18-hUCMSC group, compared with that of the hUCMSCcon group ( Figure 2E , and Supplementary figure 3B ). Adhesion and matrix degradation are two prerequisites for MSCs to move into injured tissues. Compared to the hUCMSCcon group, many chemokines have increased expression in the IL18-hUCMSC group, including CCL2, CCL7, CXCL1, CXCL2, CXCL8, and CXCL12 (while CCL5 and CXCL5 have no obvious change) ( Figure 2E , and Supplementary figure 3 B ), suggesting that IL18-hUCMSC can recruit a variety of immune cells. Transforming growth factor-beta 1 (TGF-β1), an immunomodulatory factor [43], significantly increased after IL-18 priming in the IL18-hUCMSC group (Figure 2E) , but other IDO, PGE-2, TSG-6, and PD-L1 expressions did not obviously increase compared to hUCMSCcon ( Supplementary figure 3C ). Additionally, many growth factors were analyzed by qPCR. The expression of nerve growth factor (NGF) in IL18-hUCMSC exceeded that of hUCMSCcon, but many other IGF-1, EGF, FGF-2, and HGF did not increase after IL-18 priming ( Figure 2E, and Supplementary figure 3D ). According to qPCR data, the most important immunosuppressive capacity of hUC-MSCs was evaluated by an in vitro coculture experiment. The flow cytometric data in Figure 2F demonstrates that the proliferation percentage of T-cells not cocultured with hUC-MSCs was 76.10 ± 0.94%. After four days of coculture, hUCMSCcon could significantly suppress the proliferation of T-cells, from 76.10 ± 0.94% to 45.03 ± 2.63%. Importantly, compared with hUCMSCcon, IL18-hUCMSC significantly reduced the inhibition of T-cells (21.43 ± 1.46% versus 45.03 ± 2.63%) ( Figure 2G ). Together, the induction of hUC-MSCs by IL-18 in vitro promotes MSC proliferation, secreting some adhesion/matrix degradation/chemokine/growth paracrine factors and enhancing the immunosuppressive ability of T-cells. IL18-hUCMSC enhances therapeutic effects by attenuating acute lung injuries in PR8-infected mice The schematic of protocols used for establishing a severe lung injury model at day 0, included hUC-MSCs injection (i.v.) at 3 dpi, and analysis of weight loss, survival rate, serum, BALF, and lung tissue at 7 or 14 dpi (Figure 3A) . The body weight of model mice significantly reduced after PR8 infection from 0 to 8 dpi. hUCMSCcon transplantation could increase the body weight from 6 dpi compared with the saline treatment group, but there was no significant difference between these two groups. Importantly, body weight increased in the IL18-hUCMSC group from 5 dpi, and there are significant differences at 7 dpi, 8 dpi, and 9 dpi, compared with the saline treatment group (Figure 3 B) . The survival rates significantly decreased in the Model + Saline group compared with the Mock group and Model + IL18-hUCMSC group (25.0% versus 100.0%, and 60.0%, respectively; Figure 3C ). Importantly, model mice with IL18-hUCMSC treatment had higher survival rates than those with hUCMSCcon treatment (60.0% versus 37.5%; Figure 3C ). There was no change in the general appearance of the Mock group mice. In the Model + Saline group, flu-like symptoms began to appear at 4 dpi, such as reduced activity, ruffled fur, hunched back, and weight loss. The symptoms of the Model + hUCMSCcon group were slightly better than those of the Model + Saline group, while IL18-hUCMSC treatment could restore milder clinical symptoms than the Model + hUCMSCcon group (Figure 3D) ; the morphological scores in these four groups also had lower scores in the IL18-hUCMSC treatment group, similar with the Mock group (Figure 3E) . This demonstrated that IL18-hUCMSC had enhanced therapeutic effects after assessing clinical symptoms. The results of general lung tissue analysis showed that in PR8-infected mice, the lungs exhibited different degrees of damage, and the color of the injured parts changed from pink to dark red with the presence of edema. The extent of the lung injury in the Model + Saline group was significantly more severe than in the Model + hUCMSCcon group and the Model + IL18-hUCMSC group; the lung color was darker, and the lesion area was larger. Interesting, the degree of lung injury in the Model + IL18-hUCMSC group was significantly less severe than in the Model + hUCMSCcon group (Figure 3F) . The results of the lung index showed that the lung index of the Model + Saline group significantly increased compared with the Mock group, from 0.682 ± 0.059 % to 2.384 ± 0.297 %. hUCMSCcon and IL18-hUCMSC treatment reduced the lung index, from 2.384 ± 0.297 % to 1.885 ± 0.273 % or 1.413 ± 0.086 %, respectively (Figure 3G) . The area of lung injury in different groups displayed a similar change trend regarding the lung index; the area was 0.620 ± 0.117, 0.420 ± 0.075, and 0.220 ± 0.075 in the Model + Saline group, Model + hUCMSCcon group, and Model + IL18-hUCMSC group, respectively (Figure 3H) . Figure 3F-H demonstrates that IL-18 priming on hUC-MSCs could significantly decrease lung damage and promote lung repair. Altogether, IL18-hUCMSC showed enhanced therapeutic efficacy in PR8-infected mice. IL18-hUCMSC attenuated acute lung injuries by reducing inflammation, fibrosis, and cell apoptosis Histological examinations of lung tissues by HE staining showed the occurrence of alveolar edema, inflammation, bleeding, and interstitial tissue. PR8 infection induced severe alveolar edema, large infiltration of inflammatory cells, slight bleeding, hyperplasia of interstitial tissue in the Model + Saline group; and hUC-MSCs administration could suppress the occurrence of these symptoms at 7 dpi and 14 dpi. Compared with hUCMSCcon treatment in the Model + hUCMSCcon group, IL18-hUCMSC significantly attenuated these four aspects of acute lung injuries in the Model + IL18-hUCMSC group (Figure 4A) . The histopathological scores significantly decreased by IL18-hUCMSC treatment compared to hUCMSCcon treatment; the suppression rate ranged from 10.00 ± 1.79 to 6.20 ± 1.60 at 7 dpi and from 8.80 ± 1.94 to 5.20 ± 2.04 at 14 dpi, respectively (Figure 4B) . To assess whether hUC-MSCs regulate viral replication in damaged lungs, qPCR was used to detect changes in the viral matrix protein 1 (M1) expression in the lungs of PR8-infected mice, which could indirectly reflect the viral load. The viral load in the lungs of the Model + Saline group greatly increased after PR8 infection at 7 dpi, and hUC-MSCs treatment significantly reduced M1 expression. The M1 gene was barely expressed in the Model + IL18-hUCMSC group, which demonstrated that IL18-hUCMSCs have an antiviral function (Figure 4C) . In addition, we could not find M1 expression in any group at 14 dpi (Figure 4C) . Moreover, collagen deposition was analyzed in the lung tissue at 14 dpi using Masson’s Trichrome staining; we found that PR8 infection induced much lung fibrosis in the Model + Saline group, as indicated by the blue area in the pulmonary interstitium (Figure 4D) . hUC-MSCs injection significantly reduced fibrosis, in particular, IL18-hUCMSC showed enhanced performance. The percentages of collagen area were 15.34 ± 2.24 %, 5.64 ± 1.56 %, and 2.44 ± 0.80 % in the Model + Saline group, Model + hUCMSCcon group, and Model + IL18-hUCMSC group, respectively (Figure 4E) . Figure 3F shows lung necrosis after PR8 infection. We next analyzed the cell apoptosis in lung tissue at 7 dpi and 14 dpi using 7AAD staining. The flow cytometric analysis was used to identify the percentage of 7AAD positive cells in all groups (Figure 4F) and demonstrated that hUC-MSCs injection significantly decreased cell apoptosis at 7 dpi compared to the Saline treatment, but there was no obvious difference between hUCMSCcon and IL18-hUCMSC at 7 dpi and 14 dpi (Figure 4G) . Collectively, IL18-hUCMSC protected the lungs by reducing inflammation, fibrosis, and cell apoptosis at the cellular level. IL18-hUCMSC had better immunosuppression on T-cells in BALF Next, the change of T-cells and their subpopulations in BALF were analyzed by flow cytometry after PR8 infection and hUC-MSCs treatment. The percentages of CD3 + , CD4 + , and CD8 + T-cells in BALF at 7 dpi were shown (Figure 5A) . Compared with Saline treatment in the Model + Saline group, IL18-hUCMSC largely reduced the number of total cells in BALF (Figure 5B) ; further, we found that IL18-hUCMSC treatment could significantly decrease the infiltration of CD3 + , CD4 + , and CD8 + T-cells into BALF (Figure 5C-5E) . In contrast, hUCMSCcon therapy effectively reduced CD3 + and CD4 + T-cell in BALF at 7 dpi (Figure 5C, 5D) . Meanwhile, the protein levels of four proinflammatory cytokines were evaluated in BALF at 7 dpi. The results demonstrated that IL18-hUCMSC treatment largely suppressed IFN-γ, TNF-α, IL-1β, and IL-6 expression in the Model + IL18-hUCMSC group compared with the Model + Saline group; but there was no statistical difference in IL-1β and IL-6 expression between hUCMSCcon and IL18-hUCMSC (Figure 5F) . Altogether, IL18-hUCMSC was a more effective immunosuppressant in BALF. IL18-hUCMSC has no enhanced performance in suppressing proinflammatory cytokine expression in serum and lung tissue PR8 infections in the lung typically induce systemic inflammation, while proinflammatory cytokines are also overexpressed in serum. Our results showed that hUC-MSCs therapy could significantly reduce proinflammatory cytokine expression in serum at 7 dpi compared with Saline treatment, but no difference was observed between hUCMSCcon and IL18-hUCMSC (Figure 6A) . Then, we assessed proinflammatory cytokine expression in the lung tissue. Compared to Saline treatment in the Model + Saline group, IL18-hUCMSC could significantly reduce mRNA expression of proinflammatory cytokines, especially IFN-γ, TNF-α, and IL-1β; meanwhile, IL-10 (anti-inflammatory cytokine) was more highly expressed in the Model + IL18-hUCMSC group (Figure 6B) . However, there was no obvious statistical difference between hUCMSCcon and IL18-hUCMSC (Figure 6B) . We also observed similar trends in the protein levels of the above proinflammatory cytokines in lung tissue homogenate, and there was no change between the hUCMSCcon and IL18-hUCMSC group (Figure 6C) . While IL18-hUCMSC treatment did not enhance performance in serum and lung tissue compared with hUCMSCcon, IL18-hUCMSC still had a therapeutic effect on N1N1 virus-induced lung damage. Discussion COVID-19 patients have increased levels of IL-18, which is involved in the generation of cytokine storms after SARS-CoV-2 infection [ 44 ]. Rodrigues TS et al. studied moderate and severe COVID-19 patients and found that inflammasome-derived products such as caspase-1 and IL-18 in the sera are correlated with markers of COVID-19 severity, including IL-6 and lactate dehydrogenase (LDH). Moreover, a higher level of IL-18 is associated with disease severity and poor clinical outcomes [ 45 ]. In this study, the mouse-adapted H1N1 influenza virus (A/Puerto Rico/8/34) was used to mimic SARS-CoV-2-induced pneumonia and lung injuries in mice. We also found higher levels of IL-18 than other cytokines, such as IFN-γ, TNF-α, IL-1β, IL-6, and IL-10, in a mouse model ( Figs. 1 C and 1 D ) . In addition, the most severe form of acute lung injury is represented by acute respiratory distress syndrome (ARDS), which is commonly observed in severe COVID-19 patients [ 46 ]. Elevated IL-18 concentrations have been found in the serum and lungs of patients with ARDS (to the order of 600 pg/mL) and are correlated with severity score and death [ 47 ]. The protein levels of IL-18 in our mouse model almost exceeded 2,000 pg/mL from 1 to 14 days after H1N1 infection ( Fig. 1 D ) . Together, they demonstrated that IL-18 could be important in cases of H1N1-induced severe pneumonia. The IL-18 precursor (pro-IL-18) is constitutively expressed within the cytoplasm of monocytes, macrophages, and dendritic cells, as well as in endothelial cells, keratinocytes, and intestinal epithelial cells of the gastrointestinal tract [ 48 ]. It is synthesized as an inactive precursor, processed to its active form by caspase‐1, and finally released [ 49 ]. Like IFN-γ, IL-18 also promotes the pro-inflammation process after binding to its receptor (IL-18R) and mediates the formation of the inflammatory microenvironment. Therefore, IL-18 was initially described as an interferon (IFN)γ-inducing factor. The inflammatory microenvironment is a prerequisite for MSCs to play an immunomodulatory role in vivo [ 50 ]. For example, the resting MSCs do not express indoleamine 2,3-dioxygenase (IDO), but they overexpress IDO to exert an immunosuppressive effect after IFN-γ activation. The ability of MSCs to adopt a different phenotype in response to special inflammatory microenvironments is crucial for understanding their potential for precise therapeutic treatment in immune-mediated disorders. Bernardo ME et al. found that MSCs can sense inflammation and adopt a proinflammatory or anti-inflammatory phenotype by interfering with innate and adaptive immune responses both in vitro and in vivo [ 15 ]. Therefore, understanding the specific inflammatory microenvironment of severe COVID-19 disease helps prime the appropriate cytokines to enhance the immunomodulatory potential of MSCs. In this study, IL-18 could be the superior candidate to prime hUC-MSCs to enhance the therapeutic efficacy of severe H1N1-induced pneumonia in mice. Many studies have found that cytokines that emerge in inflammatory microenvironments are typically used to prime MSCs to enhance specific properties, including IFN-γ, TNF-α, IL-1β, IL-17A, and IL-25 [ 13 , 16 – 26 ]. Kim et al. reported that IFN-γ-primed MSCs are correlated with the induction of IDO expression in MSCs via the IFN-γ-JAK-STAT1 pathway, which suppresses T-cell proliferation during GvHD treatment [ 23 ]. Bai et al. found that IL-17A pretreatment enhances the efficacy of MSCs on mice with ischemia-reperfusion acute kidney injury (IRI-AKI) by increasing the Treg percentages through the COX-2/PGE2 pathway [ 25 ]. Importantly, our results found that IL-18-primed hUC-MSCs enhance immunosuppression ability on the proliferation of T-cells and their subpopulations in vitro and in vivo , partly via the TGF-β1-mediated regulatory pathway ( Fig. 2 E- 2 G ) . However, IDO, PGE2, and TSG-6 expressions did not change (Supplementary Fig. 3C) . Regarding trophic factors, we tested five growth factors, including NGF, IGF-1, EGF, FGF-2, and HGF. Only NGF expression increased after IL-18 priming, but IGF-1, EGF, and FGF-2 had no statistical changes (Supplementary Fig. 3D) , which means that IL-18 priming does not significantly influence most trophic factors. While Redondo-Castro et al. reported that IL-1α and IL-1β (which belongs to the IL-1 family, like IL-18) did not affect VEGF, NGF, BDNF, or IL-1Ra expression but induced strong G-CSF release from MSCs [ 18 ]. In addition, we first reported that IL-18 priming could enhance the proliferation of hUC-MSCs, but not migration in a scratch wound assay ( Fig. 2 B- 2 D ) . IL-18-primed hUC-MSCs in our study have special characteristics, including enhanced proliferation and immunosuppressive ability and increased expressions of TGF-β1, NGF, MMP-1, VCAM-1, and many chemokines. In this study, we reported that IL18-hUCMSCs could significantly ameliorate some symptoms of pneumonia, such as weight loss, death, lung injury, lung fibrosis, and apoptosis of lung cells. Considering the therapeutic mechanism of IL-18-primed hUC-MSCs, this is likely due to the suppression of the inflammatory response. We found that IL18-hUCMSCs have better immunosuppressive effects on T-cell infiltration (CD3 + , CD4 + , and CD8 + T-cells) and inflammatory cytokine secretion (IFN-γ and TNF-α) in BALF ( Fig. 5 ) . However, IL18-hUCMSCs did not show superior inhibition of inflammatory cytokine expression in serum and lung tissue compared to hUCMSCcon therapy; IL18-hUCMSCs still have better immunosuppressive performance than the Saline treatment group ( Fig. 6 ) . In conclusion, IL-18 is highly expressed in H1N1-induced severe lung injury in mice, and it is an appropriate cytokine to prime hUC-MSCs in vitro to improve precision therapy against viral-induced pneumonia, such as COVID-19. Declarations Acknowledgments Thanks for the personnel and equipment support provided by professor Shoujun Li and his lab in South China Agricultural University. Conflict of Interest The authors declare no competing interests. Author Contributors Y.L. and Z.F. conceived and designed this study. Y.H., S.W., Z.W., and S.Y. performed majority of the experiments and data analyses. W.Z., G.Z., D.L., Y.Y., K.P., J.Y., and Z.H. collected data and performed statistical analysis. X.L., and J.H. administrative support. Y.L. wrote the manuscript. J.H., M.L., and C.C. revised and supervised all the works. All authors read and approved the final version of the manuscript. Ethics Statement The animal study was reviewed and approved by the animal experimental ethics committee of the South China Agricultural University. Funding This work was supported by the Key Project of Science and Technology helps economy (2020) for drug development of novel coronavirus pneumonia treated with mesenchymal stem cells, which was led by Shenzhen Beike Biotechnology Co., Ltd; and Guangdong Basic and Applied Basic Research Foundation (Grant no. 2021A1515011108). Data Availability Statement All reagents used in this work are available upon request and a brief statement describing the purpose for their use. Data in this study is available upon request from the corresponding author. References Lanzoni G, Linetsky E, Correa D, Messinger Cayetano S, Alvarez RA, Kouroupis D, et al. Umbilical cord mesenchymal stem cells for COVID-19 acute respiratory distress syndrome: A double-blind, phase 1/2a, randomized controlled trial. Stem Cells Transl Med. 2021;10:660-73. Richardson S, Hirsch JS, Narasimhan M, Crawford JM, McGinn T, Davidson KW, et al. Presenting Characteristics, Comorbidities, and Outcomes Among 5700 Patients Hospitalized With COVID-19 in the New York City Area. JAMA. 2020;323:2052-59. Shi L, Huang H, Lu X, Yan X, Jiang X, Xu R, et al. Effect of human umbilical cord-derived mesenchymal stem cells on lung damage in severe COVID-19 patients: a randomized, double-blind, placebo-controlled phase 2 trial. Signal Transduct Target Ther. 2021;6:58. Meng F, Xu R, Wang S, Xu Z, Zhang C, Li Y, et al. Human umbilical cord-derived mesenchymal stem cell therapy in patients with COVID-19: a phase 1 clinical trial. Signal Transduct Target Ther. 2020;5:172. Chan MC, Kuok DI, Leung CY, Hui KP, Valkenburg SA, Lau EH, et al. Human mesenchymal stromal cells reduce influenza A H5N1-associated acute lung injury in vitro and in vivo. Proc Natl Acad Sci U S A. 2016;113:3621-6. Li Y, Xu J, Shi W, Chen C, Shao Y, Zhu L, et al. Mesenchymal stromal cell treatment prevents H9N2 avian influenza virus-induced acute lung injury in mice. Stem Cell Res Ther. 2016;7:159. Loy H, Kuok DIT, Hui KPY, Choi MHL, Yuen W, Nicholls JM, et al. Therapeutic Implications of Human Umbilical Cord Mesenchymal Stromal Cells in Attenuating Influenza A(H5N1) Virus-Associated Acute Lung Injury. J Infect Dis. 2019;219:186-96. Yudhawati R, Amin M, Rantam FA, Prasetya RR, Dewantari JR, Nastri AM, et al. Bone marrow-derived mesenchymal stem cells attenuate pulmonary inflammation and lung damage caused by highly pathogenic avian influenza A/H5N1 virus in BALB/c mice. BMC Infect Dis. 2020;20:823. Chen J, Hu C, Chen L, Tang L, Zhu Y, Xu X, et al. Clinical Study of Mesenchymal Stem Cell Treatment for Acute Respiratory Distress Syndrome Induced by Epidemic Influenza A (H7N9) Infection: A Hint for COVID-19 Treatment. Engineering (Beijing). 2020;6:1153-61. Xu X, Jiang W, Chen L, Xu Z, Zhang Q, Zhu M, et al. Evaluation of the safety and efficacy of using human menstrual blood-derived mesenchymal stromal cells in treating severe and critically ill COVID-19 patients: An exploratory clinical trial. Clin Transl Med. 2021;11:e297. Darwish I, Banner D, Mubareka S, Kim H, Besla R, Kelvin DJ, et al. Mesenchymal stromal (stem) cell therapy fails to improve outcomes in experimental severe influenza. PLoS One. 2013;8:e71761. Gotts JE, Abbott J, Matthay MA. Influenza causes prolonged disruption of the alveolar-capillary barrier in mice unresponsive to mesenchymal stem cell therapy. Am J Physiol Lung Cell Mol Physiol. 2014;307:L395-406. Cheng W, Su J, Hu Y, Huang Q, Shi H, Wang L, et al. Interleukin-25 primed mesenchymal stem cells achieve better therapeutic effects on dextran sulfate sodium-induced colitis via inhibiting Th17 immune response and inducing T regulatory cell phenotype. Am J Transl Res. 2017;9:4149-60. Islam D, Huang Y, Fanelli V, Delsedime L, Wu S, Khang J, et al. Identification and Modulation of Microenvironment Is Crucial for Effective Mesenchymal Stromal Cell Therapy in Acute Lung Injury. Am J Respir Crit Care Med. 2019;199:1214-24. Bernardo ME, Fibbe WE. Mesenchymal stromal cells: sensors and switchers of inflammation. Cell Stem Cell. 2013;13:392-402. Sivanathan KN, Rojas-Canales DM, Hope CM, Krishnan R, Carroll RP, Gronthos S, et al. Interleukin-17A-Induced Human Mesenchymal Stem Cells Are Superior Modulators of Immunological Function. Stem Cells. 2015;33:2850-63. Klinker MW, Marklein RA, Lo Surdo JL, Wei CH, Bauer SR. Morphological features of IFN-γ-stimulated mesenchymal stromal cells predict overall immunosuppressive capacity. Proc Natl Acad Sci U S A. 2017;114:E2598-E2607. Redondo-Castro E, Cunningham C, Miller J, Martuscelli L, Aoulad-Ali S, Rothwell NJ, et al. Interleukin-1 primes human mesenchymal stem cells towards an anti-inflammatory and pro-trophic phenotype in vitro. Stem Cell Res Ther. 2017;8:79. He X, Yang Y, Yao M, Yang L, Ao L, Hu X, et al. Combination of human umbilical cord mesenchymal stem (stromal) cell transplantation with IFN-γ treatment synergistically improves the clinical outcomes of patients with rheumatoid arthritis. Ann Rheum Dis. 2020;79:1298-304. Lu Z, Wang G, Dunstan CR, Chen Y, Lu WY, Davies B, et al. Activation and promotion of adipose stem cells by tumour necrosis factor-α preconditioning for bone regeneration. J Cell Physiol. 2013;228:1737-44. Lu Z, Chen Y, Dunstan C, Roohani-Esfahani S, Zreiqat H. Priming Adipose Stem Cells with Tumor Necrosis Factor-Alpha Preconditioning Potentiates Their Exosome Efficacy for Bone Regeneration. Tissue Eng Part A. 2017;23:1212-20. Duijvestein M, Wildenberg ME, Welling MM, Hennink S, Molendijk I, van Zuylen VL, et al. Pretreatment with interferon-γ enhances the therapeutic activity of mesenchymal stromal cells in animal models of colitis. Stem Cells. 2011;29:1549-58. Kim DS, Jang IK, Lee MW, Ko YJ, Lee DH, Lee JW, et al. Enhanced Immunosuppressive Properties of Human Mesenchymal Stem Cells Primed by Interferon-γ. EBioMedicine. 2018;28:261-73. Magne B, Dedier M, Nivet M, Coulomb B, Banzet S, Lataillade JJ, et al. J Invest Dermatol. IL-1β-Primed Mesenchymal Stromal Cells Improve Epidermal Substitute Engraftment and Wound Healing via Matrix Metalloproteinases and Transforming Growth Factor-β1. 2020;140:688-698.e21. Bai M, Zhang L, Fu B, Bai J, Zhang Y, Cai G, et al. IL-17A improves the efficacy of mesenchymal stem cells in ischemic-reperfusion renal injury by increasing Treg percentages by the COX-2/PGE2 pathway. Kidney Int. 2018;93:814-25. Murphy N, Treacy O, Lynch K, Morcos M, Lohan P, Howard L, et al. TNF-α/IL-1β-licensed mesenchymal stromal cells promote corneal allograft survival via myeloid cell-mediated induction of Foxp3+ regulatory T cells in the lung. FASEB J. 2019;33:9404-21. François M, Romieu-Mourez R, Li M, Galipeau J. Human MSC suppression correlates with cytokine induction of indoleamine 2,3-dioxygenase and bystander M2 macrophage differentiation. Mol Ther. 2012;20:187-95. López-García L, Castro-Manrreza ME. TNF-α and IFN-γ Participate in Improving the Immunoregulatory Capacity of Mesenchymal Stem/Stromal Cells: Importance of Cell-Cell Contact and Extracellular Vesicles. Int J Mol Sci. 2021;22:9531. Lynch K, Treacy O, Chen X, Murphy N, Lohan P, Islam MN, et al. TGF-β1-Licensed Murine MSCs Show Superior Therapeutic Efficacy in Modulating Corneal Allograft Immune Rejection In Vivo. Mol Ther. 2020;28:2023-43. Wang J, Li Z, Zhang Y, Liu X, Chen L, Chen Y. CX43 change in LPS preconditioning against apoptosis of mesenchymal stem cells induced by hypoxia and serum deprivation is associated with ERK signaling pathway. Mol Cell Biochem. 2013;380:267-75. Jang SG, Lee J, Hong SM, Kwok SK, Cho ML, Park SH. Metformin enhances the immunomodulatory potential of adipose-derived mesenchymal stem cells through STAT1 in an animal model of lupus. Rheumatology (Oxford). 2020;59:1426-38. Souza-Moreira L, Tan Y, Wang Y, Wang JP, Salkhordeh M, Virgo J, et al. Poly(I:C) enhances mesenchymal stem cell control of myeloid cells from COVID-19 patients. iScience. 2022;25:104188. Okamura H, Tsutsi H, Komatsu T, Yutsudo M, Hakura A, Tanimoto T, et al. Cloning of a new cytokine that induces IFN-gamma production by T cells. Nature. 1995;378:88-91. Vecchié A, Bonaventura A, Toldo S, Dagna L, Dinarello CA, Abbate A. IL-18 and infections: Is there a role for targeted therapies? J Cell Physiol. 2021;236:1638-57. Nakanishi K, Yoshimoto T, Tsutsui H, Okamura H. Interleukin-18 regulates both Th1 and Th2 responses. Annu Rev Immunol. 2001;19:423-74. Mühl H, Bachmann M. IL-18/IL-18BP and IL-22/IL-22BP: Two interrelated couples with therapeutic potential. Cell Signal. 2019;63:109388. Toldo S, Mauro AG, Cutter Z, Abbate A. Inflammasome, pyroptosis, and cytokines in myocardial ischemia-reperfusion injury. Am J Physiol Heart Circ Physiol. 2018;315:H1553-H1568. Stylianou E, Bjerkeli V, Yndestad A, Heggelund L, Waehre T, Damås JK, et al. Raised serum levels of interleukin-18 is associated with disease progression and may contribute to virological treatment failure in HIV-1-infected patients. Clin Exp Immunol. 2003;132:462-66. van de Veerdonk FL, Wever PC, Hermans MH, Fijnheer R, Joosten LA, van der Meer JW, et al. IL-18 serum concentration is markedly elevated in acute EBV infection and can serve as a marker for disease severity. J Infect Dis. 2012;206:197-201. Huang KJ, Su IJ, Theron M, Wu YC, Lai SK, Liu CC, et al. An interferon-gamma-related cytokine storm in SARS patients. J Med Virol. 2005;75:185-94. Liao G, Liao Y, Li D, Fu Z, Wu S, Cheng D, et al. Human Platelet Lysate Maintains Stemness of Umbilical Cord-Derived Mesenchymal Stromal Cells and Promote Lung Repair in Rat Bronchopulmonary Dysplasia. Front Cell Dev Biol. 2021;9:722953. Liao Y, Li G, Zhang X, Huang W, Xie D, Dai G, et al. Cardiac Nestin + Mesenchymal Stromal Cells Enhance Healing of Ischemic Heart through Periostin-Mediated M2 Macrophage Polarization. Mol Ther. 2020;28:855-73. Patel SA, Meyer JR, Greco SJ, Corcoran KE, Bryan M, Rameshwar P. Mesenchymal stem cells protect breast cancer cells through regulatory T cells: role of mesenchymal stem cell-derived TGF-beta. J Immunol. 2010;184:5885-94. Morris G, Bortolasci CC, Puri BK, Marx W, O'Neil A, Athan E, et al. The cytokine storms of COVID-19, H1N1 influenza, CRS and MAS compared. Can one sized treatment fit all? Cytokine. 2021;144:155593. Rodrigues TS, de Sá KSG, Ishimoto AY, Becerra A, Oliveira S, Almeida L, et al. Inflammasomes are activated in response to SARS-CoV-2 infection and are associated with COVID-19 severity in patients. J Exp Med. 2021;218:e20201707. Butt Y, Kurdowska A, Allen TC. Acute Lung Injury: A Clinical and Molecular Review. Arch Pathol Lab Med. 2016;140:345-50. Makabe H, Kojika M, Takahashi G, Matsumoto N, Shibata S, Suzuki Y, et al. Interleukin-18 levels reflect the long-term prognosis of acute lung injury and acute respiratory distress syndrome. J Anesth. 2012;26:658-63. Dinarello CA, Novick D, Kim S, Kaplanski G. Interleukin-18 and IL-18 binding protein. Front Immunol. 2013;4:289. Abbate A, Toldo S, Marchetti C, Kron J, Van Tassell BW, Dinarello CA. Interleukin-1 and the Inflammasome as Therapeutic Targets in Cardiovascular Disease. Circ Res. 2020;126:1260-80. Waterman RS, Tomchuck SL, Henkle SL, Betancourt AM. A new mesenchymal stem cell (MSC) paradigm: polarization into a pro-inflammatory MSC1 or an Immunosuppressive MSC2 phenotype. PLoS One. 2010;5:e10088. Tables Table 1. Primers used for the amplification of human transcripts by real-time quantitative PCR Genes Forward sequence (5’ to 3’) Reverse sequence (5’ to 3’) GAPDH GTCTCCTCTGACTTCAACAGCG ACCACCCTGTTGCTGTAGCCAA VCAM1 GATTCTGTGCCCACAGTAAGGC TGGTCACAGAGCCACCTTCTTG ICAM1 AGCGGCTGACGTGTGCAGTAAT TCTGAGACCTCTGGCTTCGTCA MMP1 ATGAAGCAGCCCAGATGTGGAG TGGTCCACATCTGCTCTTGGCA MMP2 AGCGAGTGGATGCCGCCTTTAA CATTCCAGGCATCTGCGATGAG CCL2 (MCP1) AGAATCACCAGCAGCAAGTGTCC TCCTGAACCCACTTCTGCTTGG CCL5 (RANTES) CCTGCTGCTTTGCCTACATTGC ACACACTTGGCGGTTCTTTCGG CCL7 (MCP3) ACAGAAGGACCACCAGTAGCCA GGTGCTTCATAAAGTCCTGGACC CXCL1 (GRO α) AGCTTGCCTCAATCCTGCATCC TCCTTCAGGAACAGCCACCAGT CXCL2 (GRO β) GGCAGAAAGCTTGTCTCAACCC CTCCTTCAGGAACAGCCACCAA CXCL5 CAGACCACGCAAGGAGTTCATC TTCCTTCCCGTTCTTCAGGGAG CXCL8 (IL8) GAGAGTGATTGAGAGTGGACCAC CACAACCCTCTGCACCCAGTTT CXCL12 (SDF1) CTCAACACTCCAAACTGTGCCC CTCCAGGTACTCCTGAATCCAC NGF ACCCGCAACATTACTGTGGACC GACCTCGAAGTCCAGATCCTGA TGF-β1 TACCTGAACCCGTGTTGCTCTC GTTGCTGAGGTATCGCCAGGAA IGF1 CTCTTCAGTTCGTGTGTGGAGAC CAGCCTCCTTAGATCACAGCTC EGF TGCGATGCCAAGCAGTCTGTGA GCATAGCCCAATCTGAGAACCAC FGF2 AGCGGCTGTACTGCAAAAACGG CCTTTGATAGACACAACTCCTCTC HGF GAGAGTTGGGTTCTTACTGCACG CTCATCTCCTCTTCCGTGGACA IDO1 GCCTGATCTCATAGAGTCTGGC TGCATCCCAGAACTAGACGTGC PGE2 TCAAGATGTACGTGGTGGCC CAGAAAGGAGTAGACGAAGCC TSG6 (TNFAIP6) TCACCTACGCAGAAGCTAAGGC TCCAACTCTGCCCTTAGCCATC PD-L1 (CD274) TGCCGACTACAAGCGAATTACTG CTGCTTGTCCAGATGACTTCGG Table 2. Primers used for the amplification of mouse transcripts by real-time quantitative PCR Genes Forward sequence (5’ to 3’) Reverse sequence (5’ to 3’) GAPDH CATCACTGCCACCCAGAAGACTG ATGCCAGTGAGCTTCCCGTTCAG IFN-γ CAGCAACAGCAAGGCGAAAAAGG TTTCCGCTTCCTGAGGCTGGAT TNF-α GGTGCCTATGTCTCAGCCTCTT GCCATAGAACTGATGAGAGGGAG IL-1β TGGACCTTCCAGGATGAGGACA GTTCATCTCGGAGCCTGTAGTG IL-6 TACCACTTCACAAGTCGGAGGC CTGCAAGTGCATCATCGTTGTTC IL-10 CGGGAAGACAATAACTGCACCC CGGTTAGCAGTATGTTGTCCAGC IL-18 GACAGCCTGTGTTCGAGGATATG TGTTCTTACAGGAGAGGGTAGAC Viral matrix protein 1 (M1) GACCRATCCTGTCACCTCTGAC GGGCATTYTGGACAAAKCGTCTACG Additional Declarations (Not answered) Supplementary Files SupplementalData.pdf Cite Share Download PDF Status: Published Journal Publication published 28 Jan, 2023 Read the published version in Cell Death & Disease → Version 1 posted Editorial decision: revise 03 Oct, 2022 Review # 1 received at journal 25 Sep, 2022 Review # 2 received at journal 21 Sep, 2022 Reviewer # 2 agreed at journal 13 Sep, 2022 Reviewer # 1 agreed at journal 12 Sep, 2022 Reviewers invited by journal 11 Sep, 2022 Submission checks completed at journal 30 Aug, 2022 First submitted to journal 30 Aug, 2022 Editor assigned by journal 30 Aug, 2022 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-2012946","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":135814079,"identity":"741dcb22-5b75-4dab-af81-ff360e3d9465","order_by":0,"name":"Cheguo Cai","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA30lEQVRIiWNgGAWjYDACCRiDmfkAM5hxgHgtbAmkamHgMSBOC//s5sOveSoY5Pnbeb5JF7YxyPHdSGD8XIDPkjvH0qx5zjAYzjjMu016ZhuDseSNBGbpGXi0GEjkmBnztjEkMAC13AYyEjfcSGBj5sGrJf8bWIv8YZ5nIC31RGjJYX4M0mJwmIftNphBSIvEjTQzxjlAv2w8zGb+m+echOHMMw+bpfFp4Z+R/PjDG2CIyZ0//NiYp8xGnu948sHP+LQAARswav7DbQVixgb8GoDR/oGQilEwCkbBKBjhAAA0DkQ8lg2RcQAAAABJRU5ErkJggg==","orcid":"https://orcid.org/0000-0002-3712-1696","institution":"Wuhan University","correspondingAuthor":true,"prefix":"","firstName":"Cheguo","middleName":"","lastName":"Cai","suffix":""},{"id":135814080,"identity":"50aca17a-03bc-4fe2-af47-818c70eba042","order_by":1,"name":"Yan Liao","email":"","orcid":"","institution":"Shenzhen Beike Biotechnology Co., Ltd.","correspondingAuthor":false,"prefix":"","firstName":"Yan","middleName":"","lastName":"Liao","suffix":""},{"id":135814081,"identity":"ea0dae58-1093-4b91-8383-a4c124e26631","order_by":2,"name":"Zeqin Fu","email":"","orcid":"","institution":"Shenzhen Beike Biotechnology Co., Ltd.","correspondingAuthor":false,"prefix":"","firstName":"Zeqin","middleName":"","lastName":"Fu","suffix":""},{"id":135814082,"identity":"7cd2ff2f-4c69-4dc1-8893-b2f8c785f7b7","order_by":3,"name":"Yinfu Huang","email":"","orcid":"","institution":"Shenzhen Beike Biotechnology Co., Ltd.","correspondingAuthor":false,"prefix":"","firstName":"Yinfu","middleName":"","lastName":"Huang","suffix":""},{"id":135814083,"identity":"75608ec6-a4ec-4ccb-bf0d-b66c53800e06","order_by":4,"name":"Shiduo Wu","email":"","orcid":"","institution":"Shenzhen Beike Biotechnology Co., Ltd.","correspondingAuthor":false,"prefix":"","firstName":"Shiduo","middleName":"","lastName":"Wu","suffix":""},{"id":135814084,"identity":"abfee65c-833a-4441-8b0d-6f91c25e5d18","order_by":5,"name":"Zhen Wang","email":"","orcid":"","institution":"South China Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Zhen","middleName":"","lastName":"Wang","suffix":""},{"id":135814085,"identity":"9dc9727c-d6dc-4420-ac3b-84ff7352b998","order_by":6,"name":"Shaotang Ye","email":"","orcid":"","institution":"South China Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Shaotang","middleName":"","lastName":"Ye","suffix":""},{"id":135814086,"identity":"488ddc60-d3d3-4295-b8ca-685b0ff45f9a","order_by":7,"name":"Weijie Zeng","email":"","orcid":"","institution":"Shenzhen Beike Biotechnology Co., Ltd.","correspondingAuthor":false,"prefix":"","firstName":"Weijie","middleName":"","lastName":"Zeng","suffix":""},{"id":135814087,"identity":"b16d4d4e-9362-4059-a6af-083bdbd22516","order_by":8,"name":"Guifang Zeng","email":"","orcid":"","institution":"Shenzhen Beike Biotechnology Co., Ltd.","correspondingAuthor":false,"prefix":"","firstName":"Guifang","middleName":"","lastName":"Zeng","suffix":""},{"id":135814088,"identity":"fa703e8a-3449-462b-b00b-dcefacbf0541","order_by":9,"name":"Duanduan Li","email":"","orcid":"","institution":"Shenzhen Beike Biotechnology Co., Ltd.","correspondingAuthor":false,"prefix":"","firstName":"Duanduan","middleName":"","lastName":"Li","suffix":""},{"id":135814089,"identity":"fbb5af71-0ead-4864-97b4-a62a30bc61c8","order_by":10,"name":"Yulin Yang","email":"","orcid":"","institution":"Shenzhen Beike Biotechnology Co., Ltd.","correspondingAuthor":false,"prefix":"","firstName":"Yulin","middleName":"","lastName":"Yang","suffix":""},{"id":135814090,"identity":"0118d2a1-3f35-4a55-acb1-e0a4f4989b74","order_by":11,"name":"Ke Pei","email":"","orcid":"","institution":"Shenzhen Beike Biotechnology Co., Ltd.","correspondingAuthor":false,"prefix":"","firstName":"Ke","middleName":"","lastName":"Pei","suffix":""},{"id":135814091,"identity":"30020fe6-d264-4baa-935f-90bc96c2c0b3","order_by":12,"name":"Jian Yang","email":"","orcid":"","institution":"Shenzhen Beike Biotechnology Co., Ltd.","correspondingAuthor":false,"prefix":"","firstName":"Jian","middleName":"","lastName":"Yang","suffix":""},{"id":135814092,"identity":"26be9449-f150-4e5e-a7b4-e63a10f29a0d","order_by":13,"name":"Zhiwei Hu","email":"","orcid":"","institution":"Shenzhen Beike Biotechnology Co., Ltd.","correspondingAuthor":false,"prefix":"","firstName":"Zhiwei","middleName":"","lastName":"Hu","suffix":""},{"id":135814093,"identity":"69fff419-b091-4a93-ae25-93298a3b6a0e","order_by":14,"name":"Xiao Liang","email":"","orcid":"","institution":"Shenzhen Beike Biotechnology Co., Ltd.","correspondingAuthor":false,"prefix":"","firstName":"Xiao","middleName":"","lastName":"Liang","suffix":""},{"id":135814094,"identity":"620c35b9-5900-46c0-8905-b1805b110a65","order_by":15,"name":"Junyuan Hu","email":"","orcid":"","institution":"Shenzhen Beike Biotechnology Co., Ltd.","correspondingAuthor":false,"prefix":"","firstName":"Junyuan","middleName":"","lastName":"Hu","suffix":""},{"id":135814095,"identity":"ea9d64a9-6905-4d7c-a1cb-c90f4ab772ef","order_by":16,"name":"Muyun Liu","email":"","orcid":"","institution":"National-Local Associated Engineering Laboratory for Personalized Cell Therapy","correspondingAuthor":false,"prefix":"","firstName":"Muyun","middleName":"","lastName":"Liu","suffix":""}],"badges":[],"createdAt":"2022-08-30 08:45:49","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-2012946/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-2012946/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41419-023-05597-3","type":"published","date":"2023-01-28T05:00:00+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":26421640,"identity":"738e87ee-cfbc-4e35-b3e8-d45a908e2980","added_by":"auto","created_at":"2022-09-13 21:14:07","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":193424,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eIL-18 is highly expressed in the H1N1 virus-induced mouse model of severe pneumonia. (A)\u003c/strong\u003eThe body weight change of Mouse pneumonia that induced by four different viral doses, the TCID50 was 1×106/ml, 1×107/ml, 5×107/ml and 1×108/ml, respectively. Only 1×108/ml viral doses could induce severe pneumonia, showing body weight loss of more than 20% at day 6 post infection; n = 5 per group in each time point. \u003cstrong\u003e(B)\u003c/strong\u003e The survival rate of different viral dose groups, and the mouse death only occurred in highest dose group; n = 5 per group in each time point. \u003cstrong\u003e(C)\u003c/strong\u003e The mRNA expression of IL-18 and five important cytokines (TNF-α, IFN-γ, IL-1β, IL-6 and IL-10) in lung tissues were analyzed by qPCR from day 1 to day 14 after H1N1 viral infection; n = 3 per group in each time point. \u003cstrong\u003e(D)\u003c/strong\u003e The protein concentration of different cytokines in BALF were analyzed by using ELISA kit; n = 3 per group in each time point. Data are shown as mean ± SEM; *p \u0026lt; 0.05, **p \u0026lt; 0.01, ***p \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-2012946/v1/efc4a22b67eceff6b1856abb.png"},{"id":26421157,"identity":"3e504010-6c6e-4d6d-825d-1a51e3fdfa7f","added_by":"auto","created_at":"2022-09-13 21:09:07","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":349886,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe different properties of IL-18-primed hUC-MSCs were evaluated, and IL18-hUCMSC showed enhanced immunosuppressive ability. (A)\u003c/strong\u003e Schematic of protocols used for representing culture and propagation of hUC-MSCs from P 0 to P 3, IL-18 priming time at P 3, and characteristic verification at P 4, including surface markers, tri-lineage differentiation potential, proliferation and migration ability, paracrine factors secretion, and immunosuppression. \u003cstrong\u003e(B)\u003c/strong\u003eGrowth curves of hUCMSCcon and IL18-hUC-MSC were assessed by direct counting for 7 days. Three replicates were performed at each time point. \u003cstrong\u003e(C)\u003c/strong\u003e The doubling time (DT) of hUCMSCcon and IL18-hUC-MSC were analyzed by a formula: DT = t × [log 2 / (log Nt – logN0)], where Nt is the number of harvested cells, N0 is the number of seeded cells and t is the culture time. \u003cstrong\u003e(D) \u003c/strong\u003eThe analysis of healing ratio (%) in scratch wound assay at 4h, 8h, 12h, 16h, 20h and 24h after scratching. \u003cstrong\u003e(E)\u003c/strong\u003e The mRNA expressions of paracrine-related genes (VCAM-1, MMP-1, CCL family, CXCL family, NGF, and TGF-β1) in hUCMSCcon and IL18-hUC-MSC were analyzed by qPCR. \u003cstrong\u003e(F and G)\u003c/strong\u003e The proliferation level of human CD3+ T-cells was analyzed by flow cytometry; the change of CFSE fluorescence intensity indicates the growth ratio (F); and the immunosuppression ratio was analyzed statistically (G). Data are shown as mean ± SEM. n = 3–9. *p \u0026lt; 0.05, **p \u0026lt; 0.01, ***p \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-2012946/v1/5b5c528711bc6dc80c261fc2.png"},{"id":26421155,"identity":"24480924-8041-4681-8d2c-fad1cc2e1484","added_by":"auto","created_at":"2022-09-13 21:09:07","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":815292,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDesign scheme of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ein vivo\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e experiment and IL18-hUCMSC enhanced therapeutic efficacy in the body weight, survival rate, clinical manifestations, and lung injury of BALB/c mice following PR8 infection. (A)\u003c/strong\u003e Schematic of protocols used for model establishment, MSC injection, and index analysis. Briefly, PR8 virus infection dose is 1×108 (EID50) and BALB/c mice (8 weeks) were intranasally infected PR8 at 0 dpi, hUC-MSCs injection dose is 1×106cells/mouse and were injected intravenously (i.v.) at 3 dpi; Weight change, clinical score, serum, BALF, and lung tissue were analyzed at 7 dpi; survival rate, weight change and Histopathological examination was analyzed at 14 dpi. \u003cstrong\u003e(B and C)\u003c/strong\u003e During 0 dpi to 14 dpi, the body weight (B) and survival rate (C) in each point were recorded among saline and hUC-MSCs (hUCMSCcon or IL18-hUCMSC) treatment group. n = 10-20.\u003cstrong\u003e (D and E)\u003c/strong\u003e Clinical symptoms of BALB/c mice after PR8 infection at 7 dpi in different groups were recorded (D), and morphological score was calculated by analyzing reduced activity (0-3 score), ruffled fur (0-3 score), hunched back (0-3 score) and weight loss (0-3 score), with a total 12 scores (E). (F-H) the mice lungs were examined for changes in morphology (F), lung index (G), and lung injury areas (H); Lung index = lung wet weight/body mass; The area ratio of lung injury to the total lung tissue was estimated, and the lung injury area of five mice in each group was counted. Data are shown as mean ± SEM. n = 5-10 in each group. *p \u0026lt; 0.05, **p \u0026lt; 0.01, ***p \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-2012946/v1/89884a5c62c230c95d366279.png"},{"id":26421154,"identity":"55ecb4f2-7885-4c01-bd7d-38dfde48e603","added_by":"auto","created_at":"2022-09-13 21:09:07","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1378593,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eIL18-hUCMSC significantly ameliorated lung injury, fibrosis, and cell apoptosis at the cellular level. (A and B) \u003c/strong\u003eMice lung tissue were harvested at 7 dpi and 14 dpi, and lung sections were stained with H\u0026amp;E (A). Scale bars, 100 μm. Quantification of lung injury in each group (lung injury score) was calculated by analyzing alveolar edema (0-4 score), inflammation (0-4 score), bleeding (0-4 score), and interstitial tissue (0-4 score) with a total 16 scores (B). \u003cstrong\u003e(C)\u003c/strong\u003eThe mice lungs were examined for changes in viral load by analyzing M1 expression of viral gene at 7 dpi and 14 dpi. \u003cstrong\u003e(D and E)\u003c/strong\u003e Collagen deposition of lung sections were assessed by staining for Masson’s trichrome at 14 dpi (D). Scale bars, 100 μm. Collagen deposition was used as surrogate of fibrosis and was reported as percent of septal area (E). \u003cstrong\u003e(F and G)\u003c/strong\u003e The cell apoptosis in lung tissues were analyzed by flow cytometry, and 7AAD+ cells were regarded as apoptotic cells (F); the percentages of 7AAD+ cells in different groups were calculated at 7 dpi and 14 dpi (G). Data are shown as mean ± SEM. n = 3-10 in each group. *p \u0026lt; 0.05, **p \u0026lt; 0.01, ***p \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-2012946/v1/4a7449ccaa99b42e2a44164a.png"},{"id":26421641,"identity":"118e17a0-cc3a-40de-aec1-cf7cc1b7e151","added_by":"auto","created_at":"2022-09-13 21:14:07","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":340484,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eIL18-hUCMSC has a superior immunosuppressive effect on T-cells and secretion of proinflammatory cytokines in BALF. (A) \u003c/strong\u003eThe CD3+ T-cell and its CD4+and CD8+ subpopulations in BALF at 7 dpi were analyzed by flow cytometry. \u003cstrong\u003e(B-E)\u003c/strong\u003e The number of total cells in BALF was counted (B), and the percentage of CD3+ T-cell (C), CD4+ T-cell (D) and CD8+ T-cell (E) in BALF were calculated according to flow cytometric analysis. \u003cstrong\u003e(F)\u003c/strong\u003e The protein level of pro-inflammatory cytokines (IFN-γ, TNF-α, IL-1β, and IL-6) in BALF at 7 dpi was analyzed by ELISA kit. Data are shown as mean ± SEM. n = 3-5 in each group. *p \u0026lt; 0.05, **p \u0026lt; 0.01, ***p \u0026lt; 0.001, ns = not significant.\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-2012946/v1/d71c5098ae94a90ad6fd9cf7.png"},{"id":26421160,"identity":"8464d852-7465-44c9-b0fe-f683088a1118","added_by":"auto","created_at":"2022-09-13 21:09:07","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":207150,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eIL18-hUCMSC did not have a better immunosuppressive effect on the expression of proinflammatory cytokines in serum and lung tissue. (A) \u003c/strong\u003eThe protein level of pro-inflammatory cytokines (IFN-γ, TNF-α, IL-1β, and IL-6) in serum in different groups at 7 dpi was analyzed by ELISA kit. \u003cstrong\u003e(B)\u003c/strong\u003e The mRNA expression of IFN-γ, TNF-α, IL-1β, IL-6 and IL-10 in lung tissue were analyzed by qPCR. \u003cstrong\u003e(C)\u003c/strong\u003e The protein level of IFN-γ, TNF-α, IL-1β, and IL-6 in lung tissues in different groups at 7 dpi was analyzed by ELISA kit. Data are shown as mean ± SEM. n = 3-5 in each group. *p \u0026lt; 0.05, **p \u0026lt; 0.01, ***p \u0026lt; 0.001, ns = not significant.\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-2012946/v1/11551e60cd41f9954f96bd65.png"},{"id":32150193,"identity":"04cc5e8d-b2b6-4961-b631-b45496292227","added_by":"auto","created_at":"2023-01-28 08:06:18","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3853575,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-2012946/v1/8e6e5abe-110b-4088-8bc4-6325626b5be7.pdf"},{"id":26422358,"identity":"0b474647-f007-410a-a53e-4d4a012b8b3f","added_by":"auto","created_at":"2022-09-13 21:19:07","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":545094,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"SupplementalData.pdf","url":"https://assets-eu.researchsquare.com/files/rs-2012946/v1/bd30bb3e53fac1418718c932.pdf"}],"financialInterests":"(Not answered)","formattedTitle":"Interleukin-18-primed human umbilical cord-mesenchymal stem cells achieve superior therapeutic efficacy for severe viral pneumonia via enhancing T-cell immunosuppression","fulltext":[{"header":"Introduction","content":"\u003cp\u003eThe coronavirus disease 2019 (COVID-19), a pneumonia-like disease caused by the virus severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), became a pandemic in China in early 2020 [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. The SARS-CoV-2 infection causes substantial lung damage, ranging from mild respiratory illness to severe acute respiratory syndrome and even death [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Current coronavirus vaccines have protected most people from infection, and pulmonary symptoms in patients with mild and moderate COVID-19 can be mitigated with regular supportive therapy and effective antiviral therapy [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. However, no specific drugs or vaccines are currently available to treat severe COVID-19 patients. The typical characteristics of these patients are an excessive immune response, cytokine storm, upregulation of proinflammatory cytokines and chemokines, acute respiratory distress syndrome (ARDS), respiratory and cardiovascular failure, end-organ damage, and even death [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Therefore, there is an urgent need for safe and effective therapeutic methods for mitigating lung injuries in severe COVID-19 patients.\u003c/p\u003e \u003cp\u003eMesenchymal stem cells (MSCs) are nonhematopoietic cells with immunomodulatory, regenerative, and tri-differentiation properties. There have been reports that MSC infusion reduces pathological changes in the lungs and inhibits the inflammatory response induced by the influenza virus in animal models [\u003cspan additionalcitationids=\"CR6 CR7\" citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e] and by the influenza virus or coronavirus in clinical trials [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Moreover, in a phase 1 trial, safe and well-tolerated human umbilical cord-derived mesenchymal stem cells (hUC-MSCs) therapy was reported in patients with COVID-19 [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. In a randomized, double-blind, placebo-controlled phase 2 trial, hUC-MSCs treatment was viewed as a safe and potentially effective therapeutic approach for severe COVID-19 patients with lung damage [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. However, there are also reports of MSC therapy failing in patients with severe viral pneumonia [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. One reason is the diversity of inflammatory microenvironment in patients and the heterogeneity of hUC-MSCs from various human sources, which limits therapeutic efficacy.\u003c/p\u003e \u003cp\u003eSome studies have found that the local microenvironment could affect immune-related behaviors and MSC therapeutic efficacy [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. High inflammatory levels in the microenvironment induce the immunosuppression of MSCs, while low inflammatory levels induce the immune promotion of MSCs [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. To fully harness MSC immunosuppressive activity, they must be activated or primed \u003cem\u003ein vitro\u003c/em\u003e [\u003cspan additionalcitationids=\"CR17\" citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e] or \u003cem\u003ein vivo\u003c/em\u003e [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Multiple factors have been tested in an attempt to increase MSC immunosuppression and therapeutic efficacy, including the pro-inflammatory cytokines tumor necrosis factor-alpha (TNF-α) [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e], interferon-gamma (IFN-γ) [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e], interleukin-1 alpha/beta (IL-1α/β) [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e], interleukin-17A (IL-17A) [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e], interleukin-25 (IL-25) [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e], either singly or as a combination of IL-1β\u0026thinsp;+\u0026thinsp;TNF-α and TNF-α\u0026thinsp;+\u0026thinsp;IFN-γ [\u003cspan additionalcitationids=\"CR27\" citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Moreover, transforming growth factor-β1 (TGF-β1) [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e], lipopolysaccharide (LPS) [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e], metformin [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e], and Poly(I:C) [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e] were also used for MSC priming. It has a special inflammatory factor expression profile in the microenvironment of different diseases or stages of the same disease. In this study, we must identify the crucial inflammatory factor, which is more highly expressed in severe pneumonia induced by the virus.\u003c/p\u003e \u003cp\u003eInterleukin (IL)-18 is a proinflammatory cytokine belonging to the IL‐1 family, first identified for its interferon‐γ‐inducing properties [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. IL‐18‐mediated inflammation has largely been studied in animal models of bacterial, viral, parasitic, and fungal infections [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. Damage in the later phases of COVID‐19 appears to be driven by a cytokine storm, including interleukin IL‐1 family members and secondary cytokines like IL‐6. IL‐18 could participate in this hyperinflammation, as it was previously found to injure the lung tissue of infected animals by regulating both T helper (Th)1 and Th2 responses [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. IL‐18 is involved in both innate and acquired immune responses since it is released by macrophages after infections and binds to the IL‐18 receptor (IL‐18Rα and IL‐18Rβ) in the cytomembrane of T and NK cells [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. After binding to the IL‐18Rα subunit, a heterodimeric complex is formed to propagate the intracellular MyD88 signaling that culminates in proinflammatory gene transcription with the activation of NF‐κB [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. IL‐18 plasma levels are commonly elevated in viral infections, exceeding 1,000 pg/ml during the acute phase of Epstein\u0026ndash;Barr virus (EBV) and in human immunodeficiency virus (HIV) infection, particularly in patients with severe cases [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e, \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. In SARS caused by SARS‐CoV‐1, circulating IL‐18 levels peaked 4\u0026ndash;6 days after fever onset and normalized during the convalescent period [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. Collectively, IL-18 is the important cytokine in the proinflammatory microenvironment of influenza virus-induced severe pneumonia and could influence MSC priming \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e.\u003c/p\u003e \u003cp\u003eIn this study, IL-18 first showed higher expression in a mouse model of severe pneumonia, and IL-18 was used for priming hUC-MSCs \u003cem\u003ein vitro\u003c/em\u003e. Next, we will explore how IL-18 affects the characteristics of hUC-MSCs \u003cem\u003ein vitro\u003c/em\u003e and assess the therapeutic efficacy of IL18-primed-hUC-MSCs on H1N1 virus-induced acute severe lung injury \u003cem\u003ein vivo\u003c/em\u003e. Lastly, the mechanism of the therapeutic effects of IL18-primed hUC-MSCs will be further clarified.\u003c/p\u003e"},{"header":"Materials And Methods","content":"\u003cp\u003e\u003cstrong\u003eIsolation and culture of hUC-MSCs\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ehUC-MSCs were obtained and cultured according to previously described methods [41]. Briefly, the umbilical cord was obtained from a healthy pregnant woman after informed consent was obtained. The umbilical cord was rinsed twice with Dulbecco\u0026rsquo;s phosphate-buffered saline (D-PBS, Invitrogen), cut longitudinally, and the arteries and veins were removed. The soft gel tissues were dissected into small pieces and individually placed on 100-mm tissue culture dishes with low-glucose Dulbecco\u0026rsquo;s modified Eagle\u0026rsquo;s medium (L-DMEM, HyClone) supplemented with 5% (v/v) hPL (UltraGRO\u003csup\u003eTM\u003c/sup\u003e-Advanced, GMP Grade, AventaCell BioMedical), as well as 2 mM L-glutamine and 1% penicillin/streptomycin. After 12 days of culture, the umbilical cord tissue was carefully removed. The plates were washed three times with D-PBS; the plastic adherent cell colonies were trypsinized, and cells (Passage 0, P0) were re-seeded for propagating with the growth medium changing every 72 hours. Passage 4 (P4) hUC-MSCs were used in all experiments, and all cells were cultured at 37\u0026deg;C in a humidified atmosphere of 5% CO\u003csub\u003e2\u003c/sub\u003e.\u003c/p\u003e\n\n\u003cp\u003e\u003cstrong\u003ePreparation of IL-18-primed hUC-MSCs (IL18-hUCMSC)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ehUC-MSCs (P3) were grown in T175 flasks (Corning); when they reached \u0026gt;80% confluence, cells were trypsinized and replated at a density of 5,000 cells per cm\u003csup\u003e2\u003c/sup\u003e in T175. After overnight culture, the IL18-hUCMSC was generated by cells pre-stimulated with 100ng/ml recombinant human IL-18 (Sigma-Aldrich) for 24 hours in the complete medium; hUCMSCcon was the cell control without pre-stimulation. Regardless of IL-18 pretreatment, the IL18-hUCMSC and hUCMSCcon were obtained for the following \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e experiments.\u003c/p\u003e\n\n\u003cp\u003e\u003cstrong\u003eFlow Cytometric Analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFlow cytometric analyses were performed using a BD\u0026trade; Aria IIu flow cytometer, and data were analyzed with FlowJo7.5 software (Tree Star). The following anti-human antibodies were used: CD73-PE (TY/23), CD90-FITC (5E10), CD105-APC (266), CD34-PE (563), CD45-FITC (HI30), HLA-DR-PerCP (G46-6), and CD3-APC (UCHT1); and the anti-mouse antibodies were: CD3-FITC (17A2), CD4-PE (GK1.5), and CD8-APC (53-6.7). All these antibodies, along with the corresponding isotype control antibodies, were purchased from BD Pharmingen. 5,6-carboxyfluorescein diacetatesuccinimidyl ester (CFSE; Invitrogen) and 7-AAD (BD Pharmingen) were used to stain proliferative and dead cells.\u003c/p\u003e\n\n\u003cp\u003e\u003cstrong\u003eCharacterization and \u003cem\u003ein vitro\u003c/em\u003e differentiation of hUCMSCcon and IL18-hUCMSC\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo evaluate the expression changes of MSC surface markers between hUCMSCcon and IL18-hUCMSC, flow cytometry was performed using a BD\u0026trade; Aria IIu flow cytometer. Antibodies used for cytometric analysis were CD73, CD90, CD105, CD34, CD45, and HLA-DR, as mentioned above. \u003c/p\u003e\n\u003cp\u003eTo evaluate the tri-lineage differentiation potential of hUCMSCcon and IL18-hUCMSC, the osteogenic, adipogenic, and chondrogenic differentiation abilities were analyzed \u003cem\u003ein vitro\u003c/em\u003e. Briefly, hUCMSCcon and IL18-hUCMSC were cultured in the relevant differentiation media for 2-3 weeks and analyzed by staining with Alizarin Red, Oil Red O, and toluidine blue staining, as previously described [42].\u003c/p\u003e\n\n\u003cp\u003e\u003cstrong\u003ehUC-MSCs proliferation assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ehUCMSCcon and IL18-hUCMSC were resuspended in DMEM complete medium (supplemented with 5% (v/v) hPL, as well as 2 mM L-glutamine and 1% penicillin/streptomycin), and seeded to a 12-well plate at 10\u003csup\u003e4\u003c/sup\u003e cells per well. The cells were trypsinized at each indicated time point over seven days, and the cell numbers were directly counted. The population doubling times (DTs) of hUCMSCcon and IL18-hUCMSC were calculated using the following formula: DT = t \u0026times; [log 2 / (log Nt-logN0)], where Nt is the number of harvested cells, N0 is the number of seeded cells, and t is the culture time.\u003c/p\u003e\n\n\u003cp\u003e\u003cstrong\u003eScratch wound assay \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFive straight lines were prepared on the back of 30-mm Petri dishes at 1cm intervals. Then, a 2 ml cell suspension of hUCMSCcon or IL18-hUCMSC (2.5\u0026times;10\u003csup\u003e5\u003c/sup\u003e cells/ml) was separately added to two Petri dishes and cultivated for 24 hours. Next, a scratch line was made with a 10 \u0026mu;l pipetting spear perpendicular to the five baselines, and detached cells were washed with D-PBS (Invitrogen. Then, 2 ml serum-free medium was added to the Petri dishes.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHuman peripheral blood lymphocyte proliferation assays. \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHuman hUC-MSCs (1 \u0026times; 10\u003csup\u003e5 \u003c/sup\u003ecells) were plated to a 24-well plate (Corning) and cultured for 24 hours they were used for the lymphocyte proliferation assay. Human PBMCs were washed twice with D-PBS and stained with CFSE (5 \u0026mu;mol/l, Invitrogen), which was used to assess T-cell proliferation. The cells were then suspended in Roswell Park Memorial Institute (RPMI)1640 at 1 \u0026times; 10\u003csup\u003e6\u003c/sup\u003e cells/ml and distributed to 24-well plates (1 ml/well) in the presence or absence of hUC-MSCs. To induce T-cell proliferation, anti-human CD3 and CD28 antibodies (BD Pharmingen; final concentration, 500 ng/ml) were added to the wells. After four days of coculture, the CD3\u003csup\u003e+\u003c/sup\u003e T-cells were collected and analyzed by flow cytometry.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eReverse transcription and real-time qPCR\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal RNA was extracted from hUC-MSCs and mouse lung tissues using the TRIzol reagent (Invitrogen), and 1 \u0026mu;g of RNA was reverse transcribed using a RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific). The resulting cDNA was subjected to real-time PCR with the SYBR Green reagent (Roche) using the human and mouse primers listed in Table 1 and Table 2. The relative mRNA abundances were calculated using the \u0026Delta;Ct method, and the gene expression levels were normalized with respect to those of GAPDH.\u003c/p\u003e\n\n\u003cp\u003e\u003cstrong\u003eViruses and animals\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe type of influenza virus we used in our study is the mouse-adapted Influenza A/Puerto Rico/8/34 (H1N1; abbreviated as PR8) and was propagated in 10-day-old SPF chicken embryos at 37℃ for 48 h. Aliquots of collected allantoic fluids were stored at -80℃ in the lab of College of Veterinary Medicine, South China Agricultural University. The allantoic fluid was collected and titrated to determine the 50% tissue culture infection dose (TCID\u003csub\u003e50\u003c/sub\u003e) in A549 cells. All experiments involving the live virus (PR8) were performed in an approved biosafety level 2 (BSL-2) laboratory.\u003c/p\u003e\n\u003cp\u003eEight-week-old specific pathogen-free (SPF) grade female BALB/c mice (body weight: 18-20 g) were purchased from the Animal Center at the Medical Laboratory of Guangdong Province, China. All mice were maintained in a specific pathogen-free facility, and all animal procedures and protocols were reviewed and approved by the animal experimental ethics committee of the South China Agricultural University.\u003c/p\u003e\n\n\u003cp\u003e\u003cstrong\u003eInfection, monitoring, and sampling of mice\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSeventy BALB/c mice were intraperitoneally injected with 0.2 ml 3% (v/v) chloral hydrate. Several minutes later, the 50\u0026mu;l saline or PR8 (TCID\u003csub\u003e50\u003c/sub\u003e) was administered through a nasal inhalation (0 day-post-infection, 0 dpi). BALB/c mice were randomly allocated to four experimental groups: Mock group (10 mice), Model + Saline group (20 mice), Model + hUCMSCcon group (20 mice), and Model + IL18-hUCMSC group (20 mice). After infection with the PR8 virus, the mice in different groups were observed daily, and changes in the clinical symptoms, body weight, and survival were recorded for up to 14 days. Mice that lost more than 20% of their body weight were considered to have reached the experimental endpoint and were euthanized. Model mice were injected intravenously with 100 \u0026mu;l saline without or with hUC-MSCs (hUCMSCcon or IL18-hUCMSC, 1.0 \u0026times; 10\u003csup\u003e6\u003c/sup\u003e cells/per mice) at 3 dpi. At 7 dpi, five mice from each group were sacrificed, and their blood was obtained by excising eyeballs. Blood samples were then centrifuged at 1000g for 20 min at 4℃, and supernatants were collected as serum. Bronchoalveolar lavage fluid (BALF) from both lungs was obtained by three consecutive instillations and aspirations of 500 \u0026mu;l sterile D-PBS; aliquots were spun at 800 g 4℃ for 5 min; supernatant from the first lavage was removed and stored at -80℃ for further analysis. The lung tissues in each group were collected and homogenized in 1 ml of sterile D-PBS. At 7 or 14 dpi, newborn rats were sacrificed, and the whole lung tissue was harvested for histology (hematoxylin-eosin, H\u0026amp;E, and Masson\u0026rsquo;s trichrome staining), total lung mRNA analysis.\u003c/p\u003e\n\n\u003cp\u003e\u003cstrong\u003eLung injury conditions and lung index\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe whole lung tissue of the mice was collected at 14 dpi, and the degree of lung injury visible to the naked eye was dark red due to edema. The area ratio of lung injury to the total lung tissue was estimated by at least three different individuals, from which the average was calculated. Finally, the lung injury area of five mice in each group was counted. The wet weight of the lung tissue was weighed. Lung index = lung wet weight/body mass.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHistopathology\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAt 7 and 14 dpi, lung tissues were fixed in 4% paraformaldehyde and then dehydrated, embedded in paraffin, and cut into 5 \u0026mu;m-thick sections. The sections were stained with hematoxylin and eosin (H\u0026amp;E) and Masson\u0026rsquo;s Trichrome using a Leica DM500B microscope (Leica, Germany). \u003c/p\u003e\n\n\u003cp\u003e\u003cstrong\u003eQuantification of cytokines\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMouse BALF, serum, and lung tissue were harvested to count cytokines. The lung tissue was homogenized in 1 ml of D-PBS containing protease inhibitor cocktail (Roche). The homogenate was centrifuged at 16,000 g for 20 min at 4\u0026deg;C before the supernatant was harvested. The amounts of the following cytokines were analyzed: IFN-\u0026gamma;, TNF-\u0026alpha;, IL-1\u0026beta;, and IL-6. All cytokines were analyzed using a commercial ELISA kit (R\u0026amp;D Systems).\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eAcute severe lung injury caused by H1N1 virus infection leads to elevated IL-18 expression\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo evaluate the therapeutic effect of primed hUC-MSCs on severe lung injury, it is necessary to induce a severe mouse model with weight loss of more than 20% (reaching the endpoint of the experiment). Four viral infection doses (TCID50: 1\u0026times;10\u003csup\u003e6\u003c/sup\u003e/ml, 1\u0026times;10\u003csup\u003e7\u003c/sup\u003e/ml, 5\u0026times;10\u003csup\u003e7\u003c/sup\u003e/ml, and 1\u0026times;10\u003csup\u003e8\u003c/sup\u003e/ml) were used inH1N1 (PR8) virus-induced acute lung injuries \u003cem\u003ein vivo\u003c/em\u003e. The results demonstrated that the body weight of mice gradually decreased after viral infections, while only the highest infection dose (TCID50: 1\u0026times;10\u003csup\u003e8\u003c/sup\u003e/ml) could reduce the body weight to 80% lower than their original level 6 days post-infection (6 dpi) (\u003cstrong\u003eFigure 1A\u003c/strong\u003e), and the survival rate at 5 dpi and 6 dpi decreased to 66.67% and 33.33%, respectively (\u003cstrong\u003eFigure 1B\u003c/strong\u003e). As such, a severe disease mouse model was successfully established. \u003c/p\u003e\n\u003cp\u003eVarious diseases induce unique cytokine expression profiles. In this study, we investigated changes in several important cytokines in a mouse model of severe lung injuries. We found that five key genes (TNF-\u0026alpha;, IFN-\u0026gamma;, IL-1\u0026beta;, IL-6, and IL-10) first increased and then decreased, peaking at 5 dpi (\u003cstrong\u003eFigure 1C\u003c/strong\u003e). This phenomenon is consistent with typical inflammatory responses to viral infections. \u003c/p\u003e\n\u003cp\u003eInterestingly, we confirmed that the gene expression of proinflammatory factor IL-18 in the injured lung was higher than that of the other five cytokines, and its changes were similar to that of these genes (\u003cstrong\u003eFigure 1C\u003c/strong\u003e). Additionally, the IL-18 protein concentration in bronchoalveolar lavage fluid (BALF) was higher (approximately 2000-3500 pg/ml) than in the others, which were lower than 650 pg/ml (\u003cstrong\u003eFigure 1D\u003c/strong\u003e). Together, the expression of proinflammatory factor IL-18 is elevated in the severe H1N1 virus-induced acute lung injury model, suggesting that it could stimulate transplanted hUC-MSCs \u003cem\u003ein vivo\u003c/em\u003e. \u003c/p\u003e\n\n\u003cp\u003e\u003cstrong\u003eIL-18-primed hUC-MSCs exhibit robust immunosuppressive ability\u003c/strong\u003e\u003cstrong\u003e \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe first investigated the expression of the IL-18 receptor (IL-18R) in hUC-MSCs to ensure activation of the downstream signaling pathway of IL-18-IL-18R. RT-qPCR analysis indicated that IL-18R expression is approximately 1/500th that of GAPDH (\u003cstrong\u003eSupplementary figure 1A\u003c/strong\u003e). To better understand IL-18R expression levels, we compared the expression of several common factor receptors, including IFN-\u0026gamma; receptors (IFNGR1 and IFNGR2), TNF receptors (TNFR1 and TNFR2), TGF-\u0026beta; receptors (TGFbR1 and TGFbR2), IL-1 receptors (IL1R1 and IL1R2), and the IL-17 receptor (IL17RA). We found that the mRNA expression of IL-18R was higher than that of IL1R2 and lower than that of the other eight receptors (\u003cstrong\u003eSupplementary figure 1B\u003c/strong\u003e). These results indicate that hUC-MSCs express IL-18R at relatively lower levels. We then investigated the characteristics and functions of IL-18-primed hUC-MSCs, as illustrated in the scheme (\u003cstrong\u003eFigure 2A\u003c/strong\u003e). In detail, hUC-MSCs were first cultured in a complete medium from passage 0 (P 0) to P 3, with passaging every 3-4 days. P 3 hUC-MSCs were re-seeded in a culture dish in a complete medium by the 5000 cells/cm\u003csup\u003e2\u003c/sup\u003e. Recombinant human IL-18 protein was added into a fresh medium after 48 hours of culture, and the P 4 IL-18-primed hUC-MSCs (IL18-hUCMSC) or control hUC-MSCs (hUCMSCcon) were obtained with or without 24 hours of priming. Then, the surface markers, tri-lineage differentiation potential, proliferation ability, migration ability, paracrine secretion, and immunosuppression ability were analyzed in the following experiments. First, we performed immunophenotyping of IL18-hUCMSC and hUCMSCcon. At P4, more than 95% of these two hUCMSCs were positive for typical mesenchymal cell surface markers (CD73, CD90, and CD105), while hematopoietic cell markers (CD34 and CD45) and HLA-DR were almost completely absent (\u003cstrong\u003eSupplementary figure 2A\u003c/strong\u003e). We also assessed the ability of IL18-hUCMSC and hUCMSCcon to differentiate into osteocytes, adipocytes, and chondrocytes on day 21 of culture in the conditioned medium. The results indicated that IL18-hUCMSC and hUCMSCcon had similar tri-differentiation abilities (\u003cstrong\u003eSupplementary figure 2B\u003c/strong\u003e). Second, the results of cell proliferation showed that IL18-hUCMSC expanded faster than hUCMSCcon during the seven-day culture, especially on days 2 and 3 (\u003cstrong\u003eFigure 2B\u003c/strong\u003e). The population doubling time (DT) was significantly lower for IL18-hUCMSC compared with hUCMSCcon (22.06 \u0026plusmn; 0.63 h versus 29.65\u0026plusmn; 1.47 h, \u003cstrong\u003eFigure 2C\u003c/strong\u003e). We found no significant difference in cell migration between IL18-hUCMSC and hUCMSCcon in a scratch wound assay, with a similar healing ratio from 4h to 24h (\u003cstrong\u003eFigure 2D\u003c/strong\u003e and \u003cstrong\u003eSupplementary figure 3A\u003c/strong\u003e). Third, the qPCR analysis demonstrated that IL-18 priming could increase the mRNA expression of vascular cell adhesion molecule-1 (VCAM-1) and matrix metalloproteinase-1 (MMP-1), but not intercellular cell adhesion molecule-1 (ICAM-1) and MMP-2 in the IL18-hUCMSC group, compared with that of the hUCMSCcon group (\u003cstrong\u003eFigure 2E\u003c/strong\u003e, and \u003cstrong\u003eSupplementary figure 3B\u003c/strong\u003e). Adhesion and matrix degradation are two prerequisites for MSCs to move into injured tissues. Compared to the hUCMSCcon group, many chemokines have increased expression in the IL18-hUCMSC group, including CCL2, CCL7, CXCL1, CXCL2, CXCL8, and CXCL12 (while CCL5 and CXCL5 have no obvious change) (\u003cstrong\u003eFigure 2E\u003c/strong\u003e, and \u003cstrong\u003eSupplementary figure 3\u003c/strong\u003e\u003cstrong\u003eB\u003c/strong\u003e), suggesting that IL18-hUCMSC can recruit a variety of immune cells. Transforming growth factor-beta 1 (TGF-\u0026beta;1), an immunomodulatory factor [43], significantly increased after IL-18 priming in the IL18-hUCMSC group \u003cstrong\u003e(Figure 2E)\u003c/strong\u003e, but other IDO, PGE-2, TSG-6, and PD-L1 expressions did not obviously increase compared to hUCMSCcon (\u003cstrong\u003eSupplementary figure 3C\u003c/strong\u003e). Additionally, many growth factors were analyzed by qPCR. The expression of nerve growth factor (NGF) in IL18-hUCMSC exceeded that of hUCMSCcon, but many other IGF-1, EGF, FGF-2, and HGF did not increase after IL-18 priming (\u003cstrong\u003eFigure 2E, \u003c/strong\u003eand\u003cstrong\u003e Supplementary figure 3D\u003c/strong\u003e). According to qPCR data, the most important immunosuppressive capacity of hUC-MSCs was evaluated by an \u003cem\u003ein vitro\u003c/em\u003e coculture experiment. \u003c/p\u003e\n\u003cp\u003eThe flow cytometric data in\u003cstrong\u003e Figure 2F\u003c/strong\u003e demonstrates that the proliferation percentage of T-cells not cocultured with hUC-MSCs was 76.10 \u0026plusmn; 0.94%. After four days of coculture, hUCMSCcon could significantly suppress the proliferation of T-cells, from 76.10 \u0026plusmn; 0.94% to 45.03 \u0026plusmn; 2.63%. Importantly, compared with hUCMSCcon, IL18-hUCMSC significantly reduced the inhibition of T-cells (21.43 \u0026plusmn; 1.46% versus 45.03 \u0026plusmn; 2.63%) (\u003cstrong\u003eFigure 2G\u003c/strong\u003e). Together, the induction of hUC-MSCs by IL-18 \u003cem\u003ein vitro\u003c/em\u003e promotes MSC proliferation, secreting some adhesion/matrix degradation/chemokine/growth paracrine factors and enhancing the immunosuppressive ability of T-cells.\u003c/p\u003e\n\n\u003cp\u003e\u003cstrong\u003eIL18-hUCMSC enhances therapeutic effects by attenuating acute lung injuries\u003c/strong\u003e\u003cstrong\u003e in PR8-infected mice\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe schematic of protocols used for establishing a severe lung injury model at day 0, included hUC-MSCs injection (i.v.) at 3 dpi, and analysis of weight loss, survival rate, serum, BALF, and lung tissue at 7 or 14 dpi \u003cstrong\u003e(Figure 3A)\u003c/strong\u003e. The body weight of model mice significantly reduced after PR8 infection from 0 to 8 dpi. hUCMSCcon transplantation could increase the body weight from 6 dpi compared with the saline treatment group, but there was no significant difference between these two groups. Importantly, body weight increased in the IL18-hUCMSC group from 5 dpi, and there are significant differences at 7 dpi, 8 dpi, and 9 dpi, compared with the saline treatment group \u003cstrong\u003e(Figure 3 B)\u003c/strong\u003e. The survival rates significantly decreased in the Model + Saline group compared with the Mock group and Model + IL18-hUCMSC group (25.0% versus 100.0%, and 60.0%, respectively; \u003cstrong\u003eFigure 3C\u003c/strong\u003e). Importantly, model mice with IL18-hUCMSC treatment had higher survival rates than those with hUCMSCcon treatment (60.0% versus 37.5%; \u003cstrong\u003eFigure 3C\u003c/strong\u003e). There was no change in the general appearance of the Mock group mice. In the Model + Saline group, flu-like symptoms began to appear at 4 dpi, such as reduced activity, ruffled fur, hunched back, and weight loss. The symptoms of the Model + hUCMSCcon group were slightly better than those of the Model + Saline group, while IL18-hUCMSC treatment could restore milder clinical symptoms than the Model + hUCMSCcon group \u003cstrong\u003e(Figure 3D)\u003c/strong\u003e; the morphological scores in these four groups also had lower scores in the IL18-hUCMSC treatment group, similar with the Mock group \u003cstrong\u003e(Figure 3E)\u003c/strong\u003e. This demonstrated that IL18-hUCMSC had enhanced therapeutic effects after assessing clinical symptoms. The results of general lung tissue analysis showed that in PR8-infected mice, the lungs exhibited different degrees of damage, and the color of the injured parts changed from pink to dark red with the presence of edema. The extent of the lung injury in the Model + Saline group was significantly more severe than in the Model + hUCMSCcon group and the Model + IL18-hUCMSC group; the lung color was darker, and the lesion area was larger. Interesting, the degree of lung injury in the Model + IL18-hUCMSC group was significantly less severe than in the Model + hUCMSCcon group \u003cstrong\u003e(Figure 3F)\u003c/strong\u003e. The results of the lung index showed that the lung index of the Model + Saline group significantly increased compared with the Mock group, from 0.682 \u0026plusmn; 0.059 % to 2.384 \u0026plusmn; 0.297 %. hUCMSCcon and IL18-hUCMSC treatment reduced the lung index, from 2.384 \u0026plusmn; 0.297 % to 1.885 \u0026plusmn; 0.273 % or 1.413 \u0026plusmn; 0.086 %, respectively \u003cstrong\u003e(Figure 3G)\u003c/strong\u003e. The area of lung injury in different groups displayed a similar change trend regarding the lung index; the area was 0.620 \u0026plusmn; 0.117, 0.420 \u0026plusmn; 0.075, and 0.220 \u0026plusmn; 0.075 in the Model + Saline group, Model + hUCMSCcon group, and Model + IL18-hUCMSC group, respectively \u003cstrong\u003e(Figure 3H)\u003c/strong\u003e. Figure 3F-H demonstrates that IL-18 priming on hUC-MSCs could significantly decrease lung damage and promote lung repair. Altogether, IL18-hUCMSC showed enhanced therapeutic efficacy in PR8-infected mice.\u003c/p\u003e\n\n\u003cp\u003e\u003cstrong\u003eIL18-hUCMSC attenuated acute lung injuries by reducing inflammation, fibrosis, and cell apoptosis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHistological examinations of lung tissues by HE staining showed the occurrence of alveolar edema, inflammation, bleeding, and interstitial tissue. PR8 infection induced severe alveolar edema, large infiltration of inflammatory cells, slight bleeding, hyperplasia of interstitial tissue in the Model + Saline group; and hUC-MSCs administration could suppress the occurrence of these symptoms at 7 dpi and 14 dpi. Compared with hUCMSCcon treatment in the Model + hUCMSCcon group, IL18-hUCMSC significantly attenuated these four aspects of acute lung injuries in the Model + IL18-hUCMSC group \u003cstrong\u003e(Figure 4A)\u003c/strong\u003e. The histopathological scores significantly decreased by IL18-hUCMSC treatment compared to hUCMSCcon treatment; the suppression rate ranged from 10.00 \u0026plusmn; 1.79 to 6.20 \u0026plusmn; 1.60 at 7 dpi and from 8.80 \u0026plusmn; 1.94 to 5.20 \u0026plusmn; 2.04 at 14 dpi, respectively \u003cstrong\u003e(Figure 4B)\u003c/strong\u003e. To assess whether hUC-MSCs regulate viral replication in damaged lungs, qPCR was used to detect changes in the viral matrix protein 1 (M1) expression in the lungs of PR8-infected mice, which could indirectly reflect the viral load. The viral load in the lungs of the Model + Saline group greatly increased after PR8 infection at 7 dpi, and hUC-MSCs treatment significantly reduced M1 expression. The M1 gene was barely expressed in the Model + IL18-hUCMSC group, which demonstrated that IL18-hUCMSCs have an antiviral function \u003cstrong\u003e(Figure 4C)\u003c/strong\u003e. In addition, we could not find M1 expression in any group at 14 dpi \u003cstrong\u003e(Figure 4C)\u003c/strong\u003e. Moreover, collagen deposition was analyzed in the lung tissue at 14 dpi using Masson\u0026rsquo;s Trichrome staining; we found that PR8 infection induced much lung fibrosis in the Model + Saline group, as indicated by the blue area in the pulmonary interstitium \u003cstrong\u003e(Figure 4D)\u003c/strong\u003e. hUC-MSCs injection significantly reduced fibrosis, in particular, IL18-hUCMSC showed enhanced performance. The percentages of collagen area were 15.34 \u0026plusmn; 2.24 %, 5.64 \u0026plusmn; 1.56 %, and 2.44 \u0026plusmn; 0.80 % in the Model + Saline group, Model + hUCMSCcon group, and Model + IL18-hUCMSC group, respectively \u003cstrong\u003e(Figure 4E)\u003c/strong\u003e. Figure 3F shows lung necrosis after PR8 infection. We next analyzed the cell apoptosis in lung tissue at 7 dpi and 14 dpi using 7AAD staining. The flow cytometric analysis was used to identify the percentage of 7AAD positive cells in all groups \u003cstrong\u003e(Figure 4F)\u003c/strong\u003e and demonstrated that hUC-MSCs injection significantly decreased cell apoptosis at 7 dpi compared to the Saline treatment, but there was no obvious difference between hUCMSCcon and IL18-hUCMSC at 7 dpi and 14 dpi \u003cstrong\u003e(Figure 4G)\u003c/strong\u003e. Collectively, IL18-hUCMSC protected the lungs by reducing inflammation, fibrosis, and cell apoptosis at the cellular level.\u003c/p\u003e\n\n\u003cp\u003e\u003cstrong\u003eIL18-hUCMSC had better immunosuppression on T-cells in BALF\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNext, the change of T-cells and their subpopulations in BALF were analyzed by flow cytometry after PR8 infection and hUC-MSCs treatment. The percentages of CD3\u003csup\u003e+\u003c/sup\u003e, CD4\u003csup\u003e+\u003c/sup\u003e, and CD8\u003csup\u003e+\u003c/sup\u003e T-cells in BALF at 7 dpi were shown \u003cstrong\u003e(Figure 5A)\u003c/strong\u003e. Compared with Saline treatment in the Model + Saline group, IL18-hUCMSC largely reduced the number of total cells in BALF \u003cstrong\u003e(Figure 5B)\u003c/strong\u003e; further, we found that IL18-hUCMSC treatment could significantly decrease the infiltration of CD3\u003csup\u003e+\u003c/sup\u003e, CD4\u003csup\u003e+\u003c/sup\u003e, and CD8\u003csup\u003e+\u003c/sup\u003e T-cells into BALF \u003cstrong\u003e(Figure 5C-5E)\u003c/strong\u003e. In contrast, hUCMSCcon therapy effectively reduced CD3\u003csup\u003e+\u003c/sup\u003e and CD4\u003csup\u003e+\u003c/sup\u003e T-cell in BALF at 7 dpi \u003cstrong\u003e(Figure 5C, 5D)\u003c/strong\u003e. Meanwhile, the protein levels of four proinflammatory cytokines were evaluated in BALF at 7 dpi. The results demonstrated that IL18-hUCMSC treatment largely suppressed IFN-\u0026gamma;, TNF-\u0026alpha;, IL-1\u0026beta;, and IL-6 expression in the Model + IL18-hUCMSC group compared with the Model + Saline group; but there was no statistical difference in IL-1\u0026beta; and IL-6 expression between hUCMSCcon and IL18-hUCMSC \u003cstrong\u003e(Figure 5F)\u003c/strong\u003e. Altogether, IL18-hUCMSC was a more effective immunosuppressant in BALF. \u003c/p\u003e\n\n\u003cp\u003e\u003cstrong\u003eIL18-hUCMSC has no enhanced performance in suppressing proinflammatory cytokine expression in serum and lung tissue\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePR8 infections in the lung typically induce systemic inflammation, while proinflammatory cytokines are also overexpressed in serum. Our results showed that hUC-MSCs therapy could significantly reduce proinflammatory cytokine expression in serum at 7 dpi compared with Saline treatment, but no difference was observed between hUCMSCcon and IL18-hUCMSC \u003cstrong\u003e(Figure 6A)\u003c/strong\u003e. Then, we assessed proinflammatory cytokine expression in the lung tissue. Compared to Saline treatment in the Model + Saline group, IL18-hUCMSC could significantly reduce mRNA expression of proinflammatory cytokines, especially IFN-\u0026gamma;, TNF-\u0026alpha;, and IL-1\u0026beta;; meanwhile, IL-10 (anti-inflammatory cytokine) was more highly expressed in the Model + IL18-hUCMSC group \u003cstrong\u003e(Figure 6B)\u003c/strong\u003e. However, there was no obvious statistical difference between hUCMSCcon and IL18-hUCMSC \u003cstrong\u003e(Figure 6B)\u003c/strong\u003e. We also observed similar trends in the protein levels of the above proinflammatory cytokines in lung tissue homogenate, and there was no change between the hUCMSCcon and IL18-hUCMSC group \u003cstrong\u003e(Figure 6C)\u003c/strong\u003e. While IL18-hUCMSC treatment did not enhance performance in serum and lung tissue compared with hUCMSCcon, IL18-hUCMSC still had a therapeutic effect on N1N1 virus-induced lung damage. \u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eCOVID-19 patients have increased levels of IL-18, which is involved in the generation of cytokine storms after SARS-CoV-2 infection [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. Rodrigues TS et al. studied moderate and severe COVID-19 patients and found that inflammasome-derived products such as caspase-1 and IL-18 in the sera are correlated with markers of COVID-19 severity, including IL-6 and lactate dehydrogenase (LDH). Moreover, a higher level of IL-18 is associated with disease severity and poor clinical outcomes [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. In this study, the mouse-adapted H1N1 influenza virus (A/Puerto Rico/8/34) was used to mimic SARS-CoV-2-induced pneumonia and lung injuries in mice. We also found higher levels of IL-18 than other cytokines, such as IFN-γ, TNF-α, IL-1β, IL-6, and IL-10, in a mouse model \u003cb\u003e(\u003c/b\u003eFigs.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC and \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD\u003cb\u003e)\u003c/b\u003e. In addition, the most severe form of acute lung injury is represented by acute respiratory distress syndrome (ARDS), which is commonly observed in severe COVID-19 patients [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. Elevated IL-18 concentrations have been found in the serum and lungs of patients with ARDS (to the order of 600 pg/mL) and are correlated with severity score and death [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]. The protein levels of IL-18 in our mouse model almost exceeded 2,000 pg/mL from 1 to 14 days after H1N1 infection \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD\u003cb\u003e)\u003c/b\u003e. Together, they demonstrated that IL-18 could be important in cases of H1N1-induced severe pneumonia.\u003c/p\u003e \u003cp\u003eThe IL-18 precursor (pro-IL-18) is constitutively expressed within the cytoplasm of monocytes, macrophages, and dendritic cells, as well as in endothelial cells, keratinocytes, and intestinal epithelial cells of the gastrointestinal tract [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]. It is synthesized as an inactive precursor, processed to its active form by caspase‐1, and finally released [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. Like IFN-γ, IL-18 also promotes the pro-inflammation process after binding to its receptor (IL-18R) and mediates the formation of the inflammatory microenvironment. Therefore, IL-18 was initially described as an interferon (IFN)γ-inducing factor. The inflammatory microenvironment is a prerequisite for MSCs to play an immunomodulatory role \u003cem\u003ein vivo\u003c/em\u003e [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]. For example, the resting MSCs do not express indoleamine 2,3-dioxygenase (IDO), but they overexpress IDO to exert an immunosuppressive effect after IFN-γ activation. The ability of MSCs to adopt a different phenotype in response to special inflammatory microenvironments is crucial for understanding their potential for precise therapeutic treatment in immune-mediated disorders. Bernardo ME et al. found that MSCs can sense inflammation and adopt a proinflammatory or anti-inflammatory phenotype by interfering with innate and adaptive immune responses both \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Therefore, understanding the specific inflammatory microenvironment of severe COVID-19 disease helps prime the appropriate cytokines to enhance the immunomodulatory potential of MSCs. In this study, IL-18 could be the superior candidate to prime hUC-MSCs to enhance the therapeutic efficacy of severe H1N1-induced pneumonia in mice.\u003c/p\u003e \u003cp\u003eMany studies have found that cytokines that emerge in inflammatory microenvironments are typically used to prime MSCs to enhance specific properties, including IFN-γ, TNF-α, IL-1β, IL-17A, and IL-25 [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan additionalcitationids=\"CR17 CR18 CR19 CR20 CR21 CR22 CR23 CR24 CR25\" citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Kim et al. reported that IFN-γ-primed MSCs are correlated with the induction of IDO expression in MSCs via the IFN-γ-JAK-STAT1 pathway, which suppresses T-cell proliferation during GvHD treatment [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Bai et al. found that IL-17A pretreatment enhances the efficacy of MSCs on mice with ischemia-reperfusion acute kidney injury (IRI-AKI) by increasing the Treg percentages through the COX-2/PGE2 pathway [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. Importantly, our results found that IL-18-primed hUC-MSCs enhance immunosuppression ability on the proliferation of T-cells and their subpopulations \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e, partly via the TGF-β1-mediated regulatory pathway \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE-\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eG\u003cb\u003e)\u003c/b\u003e. However, IDO, PGE2, and TSG-6 expressions did not change \u003cb\u003e(Supplementary Fig.\u0026nbsp;3C)\u003c/b\u003e. Regarding trophic factors, we tested five growth factors, including NGF, IGF-1, EGF, FGF-2, and HGF. Only NGF expression increased after IL-18 priming, but IGF-1, EGF, and FGF-2 had no statistical changes \u003cb\u003e(Supplementary Fig.\u0026nbsp;3D)\u003c/b\u003e, which means that IL-18 priming does not significantly influence most trophic factors. While Redondo-Castro et al. reported that IL-1α and IL-1β (which belongs to the IL-1 family, like IL-18) did not affect VEGF, NGF, BDNF, or IL-1Ra expression but induced strong G-CSF release from MSCs [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. In addition, we first reported that IL-18 priming could enhance the proliferation of hUC-MSCs, but not migration in a scratch wound assay \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB-\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD\u003cb\u003e)\u003c/b\u003e. IL-18-primed hUC-MSCs in our study have special characteristics, including enhanced proliferation and immunosuppressive ability and increased expressions of TGF-β1, NGF, MMP-1, VCAM-1, and many chemokines.\u003c/p\u003e \u003cp\u003eIn this study, we reported that IL18-hUCMSCs could significantly ameliorate some symptoms of pneumonia, such as weight loss, death, lung injury, lung fibrosis, and apoptosis of lung cells. Considering the therapeutic mechanism of IL-18-primed hUC-MSCs, this is likely due to the suppression of the inflammatory response. We found that IL18-hUCMSCs have better immunosuppressive effects on T-cell infiltration (CD3\u003csup\u003e+\u003c/sup\u003e, CD4\u003csup\u003e+\u003c/sup\u003e, and CD8\u003csup\u003e+\u003c/sup\u003e T-cells) and inflammatory cytokine secretion (IFN-γ and TNF-α) in BALF \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e. However, IL18-hUCMSCs did not show superior inhibition of inflammatory cytokine expression in serum and lung tissue compared to hUCMSCcon therapy; IL18-hUCMSCs still have better immunosuppressive performance than the Saline treatment group \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e.\u003c/p\u003e \u003cp\u003eIn conclusion, IL-18 is highly expressed in H1N1-induced severe lung injury in mice, and it is an appropriate cytokine to prime hUC-MSCs \u003cem\u003ein vitro\u003c/em\u003e to improve precision therapy against viral-induced pneumonia, such as COVID-19.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThanks for the personnel and equipment support provided by professor Shoujun Li and his lab in South China Agricultural University.\u003c/p\u003e\n\n\u003cp\u003e\u003cstrong\u003eConflict of Interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e\n\n\u003cp\u003e\u003cstrong\u003eAuthor Contributors\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eY.L. and Z.F. conceived and designed this study. Y.H., S.W., Z.W., and S.Y. performed majority of the experiments and data analyses. W.Z., G.Z., D.L., Y.Y., K.P., J.Y., and Z.H. collected data and performed statistical analysis. X.L., and J.H. administrative support. Y.L. wrote the manuscript. J.H., M.L., and C.C. revised and supervised all the works. All authors read and approved the final version of the manuscript.\u003c/p\u003e\n\n\u003cp\u003e\u003cstrong\u003eEthics Statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe animal study was reviewed and approved by the animal experimental ethics committee of the South China Agricultural University.\u003c/p\u003e\n\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the Key Project of Science and Technology helps economy (2020) for drug development of novel coronavirus pneumonia treated with mesenchymal stem cells, which was led by Shenzhen Beike Biotechnology Co., Ltd; and Guangdong Basic and Applied Basic Research Foundation (Grant no. 2021A1515011108).\u003c/p\u003e\n\n\u003cp\u003e\u003cstrong\u003eData Availability Statement \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll reagents used in this work are available upon request and a brief statement describing the purpose for their use. Data in this study is available upon request from the corresponding author.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eLanzoni G, Linetsky E, Correa D, Messinger Cayetano S, Alvarez RA, Kouroupis D, et al. Umbilical cord mesenchymal stem cells for COVID-19 acute respiratory distress syndrome: A double-blind, phase 1/2a, randomized controlled trial. Stem Cells Transl Med. 2021;10:660-73.\u003c/li\u003e\n\u003cli\u003eRichardson S, Hirsch JS, Narasimhan M, Crawford JM, McGinn T, Davidson KW, et al. Presenting Characteristics, Comorbidities, and Outcomes Among 5700 Patients Hospitalized With COVID-19 in the New York City Area. JAMA. 2020;323:2052-59.\u003c/li\u003e\n\u003cli\u003eShi L, Huang H, Lu X, Yan X, Jiang X, Xu R, et al. Effect of human umbilical cord-derived mesenchymal stem cells on lung damage in severe COVID-19 patients: a randomized, double-blind, placebo-controlled phase 2 trial. Signal Transduct Target Ther. 2021;6:58.\u003c/li\u003e\n\u003cli\u003eMeng F, Xu R, Wang S, Xu Z, Zhang C, Li Y, et al. Human umbilical cord-derived mesenchymal stem cell therapy in patients with COVID-19: a phase 1 clinical trial. Signal Transduct Target Ther. 2020;5:172.\u003c/li\u003e\n\u003cli\u003eChan MC, Kuok DI, Leung CY, Hui KP, Valkenburg SA, Lau EH, et al. Human mesenchymal stromal cells reduce influenza A H5N1-associated acute lung injury in vitro and in vivo. Proc Natl Acad Sci U S A. 2016;113:3621-6.\u003c/li\u003e\n\u003cli\u003eLi Y, Xu J, Shi W, Chen C, Shao Y, Zhu L, et al. Mesenchymal stromal cell treatment prevents H9N2 avian influenza virus-induced acute lung injury in mice. Stem Cell Res Ther. 2016;7:159.\u003c/li\u003e\n\u003cli\u003eLoy H, Kuok DIT, Hui KPY, Choi MHL, Yuen W, Nicholls JM, et al. Therapeutic Implications of Human Umbilical Cord Mesenchymal Stromal Cells in Attenuating Influenza A(H5N1) Virus-Associated Acute Lung Injury. J Infect Dis. 2019;219:186-96.\u003c/li\u003e\n\u003cli\u003eYudhawati R, Amin M, Rantam FA, Prasetya RR, Dewantari JR, Nastri AM, et al. Bone marrow-derived mesenchymal stem cells attenuate pulmonary inflammation and lung damage caused by highly pathogenic avian influenza A/H5N1 virus in BALB/c mice. BMC Infect Dis. 2020;20:823.\u003c/li\u003e\n\u003cli\u003eChen J, Hu C, Chen L, Tang L, Zhu Y, Xu X, et al. Clinical Study of Mesenchymal Stem Cell Treatment for Acute Respiratory Distress Syndrome Induced by Epidemic Influenza A (H7N9) Infection: A Hint for COVID-19 Treatment. Engineering (Beijing). 2020;6:1153-61.\u003c/li\u003e\n\u003cli\u003eXu X, Jiang W, Chen L, Xu Z, Zhang Q, Zhu M, et al. Evaluation of the safety and efficacy of using human menstrual blood-derived mesenchymal stromal cells in treating severe and critically ill COVID-19 patients: An exploratory clinical trial. Clin Transl Med. 2021;11:e297.\u003c/li\u003e\n\u003cli\u003eDarwish I, Banner D, Mubareka S, Kim H, Besla R, Kelvin DJ, et al. Mesenchymal stromal (stem) cell therapy fails to improve outcomes in experimental severe influenza. PLoS One. 2013;8:e71761.\u003c/li\u003e\n\u003cli\u003eGotts JE, Abbott J, Matthay MA. Influenza causes prolonged disruption of the alveolar-capillary barrier in mice unresponsive to mesenchymal stem cell therapy. Am J Physiol Lung Cell Mol Physiol. 2014;307:L395-406.\u003c/li\u003e\n\u003cli\u003eCheng W, Su J, Hu Y, Huang Q, Shi H, Wang L, et al. Interleukin-25 primed mesenchymal stem cells achieve better therapeutic effects on dextran sulfate sodium-induced colitis via inhibiting Th17 immune response and inducing T regulatory cell phenotype. Am J Transl Res. 2017;9:4149-60.\u003c/li\u003e\n\u003cli\u003eIslam D, Huang Y, Fanelli V, Delsedime L, Wu S, Khang J, et al. Identification and Modulation of Microenvironment Is Crucial for Effective Mesenchymal Stromal Cell Therapy in Acute Lung Injury. Am J Respir Crit Care Med. 2019;199:1214-24.\u003c/li\u003e\n\u003cli\u003eBernardo ME, Fibbe WE. Mesenchymal stromal cells: sensors and switchers of inflammation. Cell Stem Cell. 2013;13:392-402.\u003c/li\u003e\n\u003cli\u003eSivanathan KN, Rojas-Canales DM, Hope CM, Krishnan R, Carroll RP, Gronthos S, et al. Interleukin-17A-Induced Human Mesenchymal Stem Cells Are Superior Modulators of Immunological Function. Stem Cells. 2015;33:2850-63.\u003c/li\u003e\n\u003cli\u003eKlinker MW, Marklein RA, Lo Surdo JL, Wei CH, Bauer SR. Morphological features of IFN-\u0026gamma;-stimulated mesenchymal stromal cells predict overall immunosuppressive capacity. Proc Natl Acad Sci U S A. 2017;114:E2598-E2607.\u003c/li\u003e\n\u003cli\u003eRedondo-Castro E, Cunningham C, Miller J, Martuscelli L, Aoulad-Ali S, Rothwell NJ, et al. Interleukin-1 primes human mesenchymal stem cells towards an anti-inflammatory and pro-trophic phenotype in vitro. Stem Cell Res Ther. 2017;8:79.\u003c/li\u003e\n\u003cli\u003eHe X, Yang Y, Yao M, Yang L, Ao L, Hu X, et al. Combination of human umbilical cord mesenchymal stem (stromal) cell transplantation with IFN-\u0026gamma; treatment synergistically improves the clinical outcomes of patients with rheumatoid arthritis. Ann Rheum Dis. 2020;79:1298-304.\u003c/li\u003e\n\u003cli\u003eLu Z, Wang G, Dunstan CR, Chen Y, Lu WY, Davies B, et al. Activation and promotion of adipose stem cells by tumour necrosis factor-\u0026alpha; preconditioning for bone regeneration. J Cell Physiol. 2013;228:1737-44.\u003c/li\u003e\n\u003cli\u003eLu Z, Chen Y, Dunstan C, Roohani-Esfahani S, Zreiqat H. Priming Adipose Stem Cells with Tumor Necrosis Factor-Alpha Preconditioning Potentiates Their Exosome Efficacy for Bone Regeneration. Tissue Eng Part A. 2017;23:1212-20.\u003c/li\u003e\n\u003cli\u003eDuijvestein M, Wildenberg ME, Welling MM, Hennink S, Molendijk I, van Zuylen VL, et al. Pretreatment with interferon-\u0026gamma; enhances the therapeutic activity of mesenchymal stromal cells in animal models of colitis. Stem Cells. 2011;29:1549-58.\u003c/li\u003e\n\u003cli\u003eKim DS, Jang IK, Lee MW, Ko YJ, Lee DH, Lee JW, et al. Enhanced Immunosuppressive Properties of Human Mesenchymal Stem Cells Primed by Interferon-\u0026gamma;. EBioMedicine. 2018;28:261-73.\u003c/li\u003e\n\u003cli\u003eMagne B, Dedier M, Nivet M, Coulomb B, Banzet S, Lataillade JJ, et al. J Invest Dermatol. IL-1\u0026beta;-Primed Mesenchymal Stromal Cells Improve Epidermal Substitute Engraftment and Wound Healing via Matrix Metalloproteinases and Transforming Growth Factor-\u0026beta;1. 2020;140:688-698.e21.\u003c/li\u003e\n\u003cli\u003eBai M, Zhang L, Fu B, Bai J, Zhang Y, Cai G, et al. IL-17A improves the efficacy of mesenchymal stem cells in ischemic-reperfusion renal injury by increasing Treg percentages by the COX-2/PGE2 pathway. Kidney Int. 2018;93:814-25.\u003c/li\u003e\n\u003cli\u003eMurphy N, Treacy O, Lynch K, Morcos M, Lohan P, Howard L, et al. TNF-\u0026alpha;/IL-1\u0026beta;-licensed mesenchymal stromal cells promote corneal allograft survival via myeloid cell-mediated induction of Foxp3+ regulatory T cells in the lung. FASEB J. 2019;33:9404-21.\u003c/li\u003e\n\u003cli\u003eFran\u0026ccedil;ois M, Romieu-Mourez R, Li M, Galipeau J. Human MSC suppression correlates with cytokine induction of indoleamine 2,3-dioxygenase and bystander M2 macrophage differentiation. Mol Ther. 2012;20:187-95.\u003c/li\u003e\n\u003cli\u003eL\u0026oacute;pez-Garc\u0026iacute;a L, Castro-Manrreza ME. TNF-\u0026alpha; and IFN-\u0026gamma; Participate in Improving the Immunoregulatory Capacity of Mesenchymal Stem/Stromal Cells: Importance of Cell-Cell Contact and Extracellular Vesicles. Int J Mol Sci. 2021;22:9531.\u003c/li\u003e\n\u003cli\u003eLynch K, Treacy O, Chen X, Murphy N, Lohan P, Islam MN, et al. TGF-\u0026beta;1-Licensed Murine MSCs Show Superior Therapeutic Efficacy in Modulating Corneal Allograft Immune Rejection In Vivo. Mol Ther. 2020;28:2023-43.\u003c/li\u003e\n\u003cli\u003eWang J, Li Z, Zhang Y, Liu X, Chen L, Chen Y. CX43 change in LPS preconditioning against apoptosis of mesenchymal stem cells induced by hypoxia and serum deprivation is associated with ERK signaling pathway. Mol Cell Biochem. 2013;380:267-75.\u003c/li\u003e\n\u003cli\u003eJang SG, Lee J, Hong SM, Kwok SK, Cho ML, Park SH. Metformin enhances the immunomodulatory potential of adipose-derived mesenchymal stem cells through STAT1 in an animal model of lupus. Rheumatology (Oxford). 2020;59:1426-38.\u003c/li\u003e\n\u003cli\u003eSouza-Moreira L, Tan Y, Wang Y, Wang JP, Salkhordeh M, Virgo J, et al. Poly(I:C) enhances mesenchymal stem cell control of myeloid cells from COVID-19 patients. iScience. 2022;25:104188.\u003c/li\u003e\n\u003cli\u003eOkamura H, Tsutsi H, Komatsu T, Yutsudo M, Hakura A, Tanimoto T, et al. Cloning of a new cytokine that induces IFN-gamma production by T cells. Nature. 1995;378:88-91.\u003c/li\u003e\n\u003cli\u003eVecchi\u0026eacute; A, Bonaventura A, Toldo S, Dagna L, Dinarello CA, Abbate A. IL-18 and infections: Is there a role for targeted therapies? J Cell Physiol. 2021;236:1638-57.\u003c/li\u003e\n\u003cli\u003eNakanishi K, Yoshimoto T, Tsutsui H, Okamura H. Interleukin-18 regulates both Th1 and Th2 responses. Annu Rev Immunol. 2001;19:423-74.\u003c/li\u003e\n\u003cli\u003eM\u0026uuml;hl H, Bachmann M. IL-18/IL-18BP and IL-22/IL-22BP: Two interrelated couples with therapeutic potential. Cell Signal. 2019;63:109388.\u003c/li\u003e\n\u003cli\u003eToldo S, Mauro AG, Cutter Z, Abbate A. Inflammasome, pyroptosis, and cytokines in myocardial ischemia-reperfusion injury. Am J Physiol Heart Circ Physiol. 2018;315:H1553-H1568.\u003c/li\u003e\n\u003cli\u003eStylianou E, Bjerkeli V, Yndestad A, Heggelund L, Waehre T, Dam\u0026aring;s JK, et al. Raised serum levels of interleukin-18 is associated with disease progression and may contribute to virological treatment failure in HIV-1-infected patients. Clin Exp Immunol. 2003;132:462-66.\u003c/li\u003e\n\u003cli\u003evan de Veerdonk FL, Wever PC, Hermans MH, Fijnheer R, Joosten LA, van der Meer JW, et al. IL-18 serum concentration is markedly elevated in acute EBV infection and can serve as a marker for disease severity. J Infect Dis. 2012;206:197-201.\u003c/li\u003e\n\u003cli\u003eHuang KJ, Su IJ, Theron M, Wu YC, Lai SK, Liu CC, et al. An interferon-gamma-related cytokine storm in SARS patients. J Med Virol. 2005;75:185-94.\u003c/li\u003e\n\u003cli\u003eLiao G, Liao Y, Li D, Fu Z, Wu S, Cheng D, et al. Human Platelet Lysate Maintains Stemness of Umbilical Cord-Derived Mesenchymal Stromal Cells and Promote Lung Repair in Rat Bronchopulmonary Dysplasia. Front Cell Dev Biol. 2021;9:722953.\u003c/li\u003e\n\u003cli\u003eLiao Y, Li G, Zhang X, Huang W, Xie D, Dai G, et al. Cardiac Nestin + Mesenchymal Stromal Cells Enhance Healing of Ischemic Heart through Periostin-Mediated M2 Macrophage Polarization. Mol Ther. 2020;28:855-73.\u003c/li\u003e\n\u003cli\u003ePatel SA, Meyer JR, Greco SJ, Corcoran KE, Bryan M, Rameshwar P. Mesenchymal stem cells protect breast cancer cells through regulatory T cells: role of mesenchymal stem cell-derived TGF-beta. J Immunol. 2010;184:5885-94.\u003c/li\u003e\n\u003cli\u003eMorris G, Bortolasci CC, Puri BK, Marx W, O\u0026apos;Neil A, Athan E, et al. The cytokine storms of COVID-19, H1N1 influenza, CRS and MAS compared. Can one sized treatment fit all? Cytokine. 2021;144:155593.\u003c/li\u003e\n\u003cli\u003eRodrigues TS, de S\u0026aacute; KSG, Ishimoto AY, Becerra A, Oliveira S, Almeida L, et al. Inflammasomes are activated in response to SARS-CoV-2 infection and are associated with COVID-19 severity in patients. J Exp Med. 2021;218:e20201707.\u003c/li\u003e\n\u003cli\u003eButt Y, Kurdowska A, Allen TC. Acute Lung Injury: A Clinical and Molecular Review. Arch Pathol Lab Med. 2016;140:345-50.\u003c/li\u003e\n\u003cli\u003eMakabe H, Kojika M, Takahashi G, Matsumoto N, Shibata S, Suzuki Y, et al. Interleukin-18 levels reflect the long-term prognosis of acute lung injury and acute respiratory distress syndrome. J Anesth. 2012;26:658-63.\u003c/li\u003e\n\u003cli\u003eDinarello CA, Novick D, Kim S, Kaplanski G. Interleukin-18 and IL-18 binding protein. Front Immunol. 2013;4:289.\u003c/li\u003e\n\u003cli\u003eAbbate A, Toldo S, Marchetti C, Kron J, Van Tassell BW, Dinarello CA. Interleukin-1 and the Inflammasome as Therapeutic Targets in Cardiovascular Disease. Circ Res. 2020;126:1260-80.\u003c/li\u003e\n\u003cli\u003eWaterman RS, Tomchuck SL, Henkle SL, Betancourt AM. A new mesenchymal stem cell (MSC) paradigm: polarization into a pro-inflammatory MSC1 or an Immunosuppressive MSC2 phenotype. PLoS One. 2010;5:e10088.\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003e\u003cstrong\u003eTable 1. Primers used for the amplification of human transcripts by real-time quantitative PCR\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellpadding=\"0\" cellspacing=\"0\" width=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.16382252559727%\"\u003e\n \u003cp\u003e\u003cstrong\u003eGenes\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"42.491467576791806%\"\u003e\n \u003cp\u003e\u003cstrong\u003eForward sequence (5\u0026rsquo; to 3\u0026rsquo;)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"43.34470989761092%\"\u003e\n \u003cp\u003e\u003cstrong\u003eReverse sequence (5\u0026rsquo; to 3\u0026rsquo;)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.16382252559727%\"\u003e\n \u003cp\u003eGAPDH\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"42.491467576791806%\"\u003e\n \u003cp\u003eGTCTCCTCTGACTTCAACAGCG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"43.34470989761092%\"\u003e\n \u003cp\u003eACCACCCTGTTGCTGTAGCCAA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.16382252559727%\"\u003e\n \u003cp\u003eVCAM1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"42.491467576791806%\"\u003e\n \u003cp\u003eGATTCTGTGCCCACAGTAAGGC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"43.34470989761092%\"\u003e\n \u003cp\u003eTGGTCACAGAGCCACCTTCTTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.16382252559727%\"\u003e\n \u003cp\u003eICAM1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"42.491467576791806%\"\u003e\n \u003cp\u003eAGCGGCTGACGTGTGCAGTAAT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"43.34470989761092%\"\u003e\n \u003cp\u003eTCTGAGACCTCTGGCTTCGTCA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.16382252559727%\"\u003e\n \u003cp\u003eMMP1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"42.491467576791806%\"\u003e\n \u003cp\u003eATGAAGCAGCCCAGATGTGGAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"43.34470989761092%\"\u003e\n \u003cp\u003eTGGTCCACATCTGCTCTTGGCA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.16382252559727%\"\u003e\n \u003cp\u003eMMP2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"42.491467576791806%\"\u003e\n \u003cp\u003eAGCGAGTGGATGCCGCCTTTAA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"43.34470989761092%\"\u003e\n \u003cp\u003eCATTCCAGGCATCTGCGATGAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.16382252559727%\"\u003e\n \u003cp\u003eCCL2 (MCP1)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"42.491467576791806%\"\u003e\n \u003cp\u003eAGAATCACCAGCAGCAAGTGTCC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"43.34470989761092%\"\u003e\n \u003cp\u003eTCCTGAACCCACTTCTGCTTGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.16382252559727%\"\u003e\n \u003cp\u003eCCL5 (RANTES)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"42.491467576791806%\"\u003e\n \u003cp\u003eCCTGCTGCTTTGCCTACATTGC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"43.34470989761092%\"\u003e\n \u003cp\u003eACACACTTGGCGGTTCTTTCGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.16382252559727%\"\u003e\n \u003cp\u003eCCL7 (MCP3)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"42.491467576791806%\"\u003e\n \u003cp\u003eACAGAAGGACCACCAGTAGCCA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"43.34470989761092%\"\u003e\n \u003cp\u003eGGTGCTTCATAAAGTCCTGGACC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.16382252559727%\"\u003e\n \u003cp\u003eCXCL1 (GRO \u0026alpha;)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"42.491467576791806%\"\u003e\n \u003cp\u003eAGCTTGCCTCAATCCTGCATCC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"43.34470989761092%\"\u003e\n \u003cp\u003eTCCTTCAGGAACAGCCACCAGT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.16382252559727%\"\u003e\n \u003cp\u003eCXCL2 (GRO \u0026beta;)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"42.491467576791806%\"\u003e\n \u003cp\u003eGGCAGAAAGCTTGTCTCAACCC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"43.34470989761092%\"\u003e\n \u003cp\u003eCTCCTTCAGGAACAGCCACCAA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.16382252559727%\"\u003e\n \u003cp\u003eCXCL5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"42.491467576791806%\"\u003e\n \u003cp\u003eCAGACCACGCAAGGAGTTCATC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"43.34470989761092%\"\u003e\n \u003cp\u003eTTCCTTCCCGTTCTTCAGGGAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.16382252559727%\"\u003e\n \u003cp\u003eCXCL8 (IL8)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"42.491467576791806%\"\u003e\n \u003cp\u003eGAGAGTGATTGAGAGTGGACCAC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"43.34470989761092%\"\u003e\n \u003cp\u003eCACAACCCTCTGCACCCAGTTT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.16382252559727%\"\u003e\n \u003cp\u003eCXCL12 (SDF1)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"42.491467576791806%\"\u003e\n \u003cp\u003eCTCAACACTCCAAACTGTGCCC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"43.34470989761092%\"\u003e\n \u003cp\u003eCTCCAGGTACTCCTGAATCCAC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.16382252559727%\"\u003e\n \u003cp\u003eNGF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"42.491467576791806%\"\u003e\n \u003cp\u003eACCCGCAACATTACTGTGGACC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"43.34470989761092%\"\u003e\n \u003cp\u003eGACCTCGAAGTCCAGATCCTGA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.16382252559727%\"\u003e\n \u003cp\u003eTGF-\u0026beta;1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"42.491467576791806%\"\u003e\n \u003cp\u003eTACCTGAACCCGTGTTGCTCTC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"43.34470989761092%\"\u003e\n \u003cp\u003eGTTGCTGAGGTATCGCCAGGAA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.16382252559727%\"\u003e\n \u003cp\u003eIGF1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"42.491467576791806%\"\u003e\n \u003cp\u003eCTCTTCAGTTCGTGTGTGGAGAC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"43.34470989761092%\"\u003e\n \u003cp\u003eCAGCCTCCTTAGATCACAGCTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.16382252559727%\"\u003e\n \u003cp\u003eEGF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"42.491467576791806%\"\u003e\n \u003cp\u003eTGCGATGCCAAGCAGTCTGTGA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"43.34470989761092%\"\u003e\n \u003cp\u003eGCATAGCCCAATCTGAGAACCAC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.16382252559727%\"\u003e\n \u003cp\u003eFGF2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"42.491467576791806%\"\u003e\n \u003cp\u003eAGCGGCTGTACTGCAAAAACGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"43.34470989761092%\"\u003e\n \u003cp\u003eCCTTTGATAGACACAACTCCTCTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.16382252559727%\"\u003e\n \u003cp\u003eHGF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"42.491467576791806%\"\u003e\n \u003cp\u003eGAGAGTTGGGTTCTTACTGCACG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"43.34470989761092%\"\u003e\n \u003cp\u003eCTCATCTCCTCTTCCGTGGACA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.16382252559727%\"\u003e\n \u003cp\u003eIDO1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"42.491467576791806%\"\u003e\n \u003cp\u003eGCCTGATCTCATAGAGTCTGGC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"43.34470989761092%\"\u003e\n \u003cp\u003eTGCATCCCAGAACTAGACGTGC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.16382252559727%\"\u003e\n \u003cp\u003ePGE2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"42.491467576791806%\"\u003e\n \u003cp\u003eTCAAGATGTACGTGGTGGCC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"43.34470989761092%\"\u003e\n \u003cp\u003eCAGAAAGGAGTAGACGAAGCC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.16382252559727%\"\u003e\n \u003cp\u003eTSG6\u0026nbsp;(TNFAIP6)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"42.491467576791806%\"\u003e\n \u003cp\u003eTCACCTACGCAGAAGCTAAGGC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"43.34470989761092%\"\u003e\n \u003cp\u003eTCCAACTCTGCCCTTAGCCATC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"14.16382252559727%\"\u003e\n \u003cp\u003ePD-L1 (CD274)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"42.491467576791806%\"\u003e\n \u003cp\u003eTGCCGACTACAAGCGAATTACTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"43.34470989761092%\"\u003e\n \u003cp\u003eCTGCTTGTCCAGATGACTTCGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 2. Primers used for the amplification of mouse transcripts by real-time quantitative PCR\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellpadding=\"0\" cellspacing=\"0\" width=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"11.794871794871796%\"\u003e\n \u003cp\u003eGenes\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"42.56410256410256%\"\u003e\n \u003cp\u003eForward sequence (5\u0026rsquo; to 3\u0026rsquo;)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"45.64102564102564%\"\u003e\n \u003cp\u003eReverse sequence (5\u0026rsquo; to 3\u0026rsquo;)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"11.794871794871796%\"\u003e\n \u003cp\u003eGAPDH\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"42.56410256410256%\"\u003e\n \u003cp\u003eCATCACTGCCACCCAGAAGACTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"45.64102564102564%\"\u003e\n \u003cp\u003eATGCCAGTGAGCTTCCCGTTCAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"11.794871794871796%\"\u003e\n \u003cp\u003eIFN-\u0026gamma;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"42.56410256410256%\"\u003e\n \u003cp\u003eCAGCAACAGCAAGGCGAAAAAGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"45.64102564102564%\"\u003e\n \u003cp\u003eTTTCCGCTTCCTGAGGCTGGAT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"11.794871794871796%\"\u003e\n \u003cp\u003eTNF-\u0026alpha;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"42.56410256410256%\"\u003e\n \u003cp\u003eGGTGCCTATGTCTCAGCCTCTT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"45.64102564102564%\"\u003e\n \u003cp\u003eGCCATAGAACTGATGAGAGGGAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"11.794871794871796%\"\u003e\n \u003cp\u003eIL-1\u0026beta;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"42.56410256410256%\"\u003e\n \u003cp\u003eTGGACCTTCCAGGATGAGGACA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"45.64102564102564%\"\u003e\n \u003cp\u003eGTTCATCTCGGAGCCTGTAGTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"11.794871794871796%\"\u003e\n \u003cp\u003eIL-6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"42.56410256410256%\"\u003e\n \u003cp\u003eTACCACTTCACAAGTCGGAGGC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"45.64102564102564%\"\u003e\n \u003cp\u003eCTGCAAGTGCATCATCGTTGTTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"11.794871794871796%\"\u003e\n \u003cp\u003eIL-10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"42.56410256410256%\"\u003e\n \u003cp\u003eCGGGAAGACAATAACTGCACCC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"45.64102564102564%\"\u003e\n \u003cp\u003eCGGTTAGCAGTATGTTGTCCAGC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"11.794871794871796%\"\u003e\n \u003cp\u003eIL-18\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"42.56410256410256%\"\u003e\n \u003cp\u003eGACAGCCTGTGTTCGAGGATATG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"45.64102564102564%\"\u003e\n \u003cp\u003eTGTTCTTACAGGAGAGGGTAGAC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"11.794871794871796%\"\u003e\n \u003cp\u003eViral matrix protein 1 (M1)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"42.56410256410256%\"\u003e\n \u003cp\u003eGACCRATCCTGTCACCTCTGAC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"45.64102564102564%\"\u003e\n \u003cp\u003eGGGCATTYTGGACAAAKCGTCTACG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"cell-death-and-disease","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"cddis","sideBox":"Learn more about [Cell Death \u0026 Disease](http://www.nature.com/cddis/)","snPcode":"41419","submissionUrl":"https://mts-cddis.nature.com/cgi-bin/main.plex","title":"Cell Death \u0026 Disease","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"COVID-19, severe pneumonia, IL-18, hUC-MSCs, immunosuppression, precision therapy","lastPublishedDoi":"10.21203/rs.3.rs-2012946/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-2012946/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eCoronavirus disease 2019 (COVID-19) treatments are still urgently needed for critically and severely ill patients. Human umbilical cord-mesenchymal stem cells (hUC-MSCs) infusion has therapeutic benefits in COVID-19 patients; however, uncertain therapeutic efficacy has been reported in severe patients. In this study, we selected an appropriate cytokine, IL-18, based on the special cytokine expression profile in severe pneumonia of mice induced by H1N1virus to prime hUC-MSCs \u003cem\u003ein vitro\u003c/em\u003e and improve the therapeutic effect of hUC-MSCs \u003cem\u003ein vivo\u003c/em\u003e. \u003cem\u003eIn vitro\u003c/em\u003e, we demonstrated that IL-18-primed hUC-MSCs (IL18-hUCMSC) have higher proliferative ability than non-primed hUC-MSCs (hUCMSCcon), and there was no significant difference in their migration capacity. In addition, VCAM-1, MMP-1, TGF-β1, and some chemokines (CCL2 and CXCL12, for example) are more highly expressed in IL18-hUCMSCs. We found that IL18-hUCMSC significantly enhanced the immunosuppressive effect on CD3\u003csup\u003e+\u003c/sup\u003e T-cells. \u003cem\u003eIn vivo\u003c/em\u003e, we demonstrated that IL18-hUCMSC infusion could reduce the body weight loss caused by a viral infection and significantly improve the survival rate. Of note, IL18-hUCMSC can also significantly attenuate certain clinical symptoms, including reduced activity, ruffled fur, hunched backs, and lung injuries. Pathologically, IL18-hUCMSC transplantation significantly enhanced the inhibition of inflammation, viral load, fibrosis, and cell apoptosis in acute lung injuries. Notably, IL18-hUCMSC treatment has a superior inhibitory effect on T-cell exudation and proinflammatory cytokine secretion in bronchoalveolar lavage fluid (BALF). Altogether, IL-18 is a promising cytokine that can prime hUC-MSCs to improve the efficacy of precision therapy against viral-induced pneumonia, such as COVID-19.\u003c/p\u003e","manuscriptTitle":"Interleukin-18-primed human umbilical cord-mesenchymal stem cells achieve superior therapeutic efficacy for severe viral pneumonia via enhancing T-cell immunosuppression","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2022-09-13 21:09:05","doi":"10.21203/rs.3.rs-2012946/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"revise","date":"2022-10-03T10:54:45+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"This content is not available.","date":"2022-09-25T17:13:40+00:00","index":1,"fulltext":"This content is not available."},{"type":"editorInvitedReview","content":"This content is not available.","date":"2022-09-21T22:56:20+00:00","index":2,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2022-09-13T12:55:57+00:00","index":2,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2022-09-12T06:32:50+00:00","index":1,"fulltext":"This content is not available."},{"type":"reviewersInvited","content":"","date":"2022-09-11T23:06:06+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2022-08-30T11:44:27+00:00","index":"","fulltext":""},{"type":"submitted","content":"Cell Death \u0026 Disease","date":"2022-08-30T08:41:42+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2022-08-30T08:41:42+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"cell-death-and-disease","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"cddis","sideBox":"Learn more about [Cell Death \u0026 Disease](http://www.nature.com/cddis/)","snPcode":"41419","submissionUrl":"https://mts-cddis.nature.com/cgi-bin/main.plex","title":"Cell Death \u0026 Disease","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"8d654cba-0640-4330-91a5-16fed7d73fd5","owner":[],"postedDate":"September 13th, 2022","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2023-01-28T08:06:12+00:00","versionOfRecord":{"articleIdentity":"rs-2012946","link":"https://doi.org/10.1038/s41419-023-05597-3","journal":{"identity":"cell-death-and-disease","isVorOnly":false,"title":"Cell Death \u0026 Disease"},"publishedOn":"2023-01-28 05:00:00","publishedOnDateReadable":"January 28th, 2023"},"versionCreatedAt":"2022-09-13 21:09:05","video":"","vorDoi":"10.1038/s41419-023-05597-3","vorDoiUrl":"https://doi.org/10.1038/s41419-023-05597-3","workflowStages":[]},"version":"v1","identity":"rs-2012946","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-2012946","identity":"rs-2012946","version":["v1"]},"buildId":"_2-kVJe1T_tPrBINL-cwx","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}