Low Malaria Infection After a Decade of Effective Implementation of Preventive Measures and Speciation of Plasmodium SP Among Pregnant Women Attending an Antenatal Clinic in Benue State, Nigeria

preprint OA: closed CC-BY-NC-SA-4.0
📄 Open PDF Full text JSON View at publisher
AI-generated deep summary by claude@2026-07, 2026-07-03 · read from full text

This cross-sectional study evaluated malaria infection status and risk factors among pregnant women attending the antenatal clinic of the Federal Medical Centre, Makurdi, Benue State, Nigeria, and determined Plasmodium species using Giemsa-stained thick/thin smears and nested PCR. Among 305 properly analyzed blood samples, malaria infection was 11/305 (3.6%), with higher infection rates reported for women with secondary education and for those in the second trimester, and age groups ≤20 and 21–30 years identified as significant predictors; the paper also assessed environmental factors such as drainage and stagnant water around premises. Nested PCR identified Plasmodium falciparum with MSP-1 (K1 and MAD20 families) and MSP-2 (FC27 and 3D7 families). A major limitation is that participants who were sick and those with improperly filled questionnaires or incorrectly preserved samples were excluded, which may affect representativeness, and the preprint does not provide peer-reviewed validation. The paper does not explicitly discuss endometriosis or adenomyosis; it was included in the corpus via a keyword match in the upstream search index.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Abstract

Abstract Malaria remains a serious public health threat to rural and urban inhabitants of tropical and subtropical poor communities. This study reassessed the malaria infection and its risk factors among pregnant women, and determined the speciation of the genus Plasmodium. The laboratory used a thick and thin smear Giemsa-stained and nested Polymerase Chain Reaction techniques. The infection was 11 (3.6%). Pregnant women who attended secondary school significantly had higher infection, 6(8.2%) (χ2=14.49, p = 0.012), as well as those in the second trimester, 7(7.3%) (χ2=15.47, p = 0.035). The significant predictors of infection were the age groups ≤ 20 years and 21–30 years with crude odds ratios (cOR) of 1.17 (%95CI:0.55–5.38; p = 0.000), and 2.67 (%95CI:1.90–6.18; p = 0.000) respectively. Pregnant women with secondary education, and those in the second trimester respectively had significant cOR of 5.40 (%95CI:2.23–40.76; p = 0.000), and 0.23 (%95CI:0.04–1.17; p = 0.040). Pregnant women who did not have drainage around their premises had a cOR of 6.62 (%95CI:1.25–40.65; p = 0.000), as well as those who had stagnant water around premises with cOR = 7.24 (%95CI:1.29–66.55; p = 0.001). The nested PCR found Plasmodium falciparum with two distinct Merozoite Surface Proteins MSP-1 having K1 and MAD20 families, and MSP-2 having FC27 and 3D7 families. It was recommended that there should be more enlightenment on keeping the drainage clean, clearing of bushes around the environment, using long lasting insecticide treated nets and wearing protective clothing especially at night to protect oneself against mosquito bites.
Full text 135,807 characters · extracted from preprint-html · click to expand
Low Malaria Infection After a Decade of Effective Implementation of Preventive Measures and Speciation of Plasmodium SP Among Pregnant Women Attending an Antenatal Clinic in Benue State, Nigeria | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Low Malaria Infection After a Decade of Effective Implementation of Preventive Measures and Speciation of Plasmodium SP Among Pregnant Women Attending an Antenatal Clinic in Benue State, Nigeria Mary C Swem, Emamanuel B Wama, Vera Y Akwa, Collins A. Swem, Boursou Djafsia, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7442925/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Malaria remains a serious public health threat to rural and urban inhabitants of tropical and subtropical poor communities. This study reassessed the malaria infection and its risk factors among pregnant women, and determined the speciation of the genus Plasmodium . The laboratory used a thick and thin smear Giemsa-stained and nested Polymerase Chain Reaction techniques. The infection was 11 (3.6%). Pregnant women who attended secondary school significantly had higher infection, 6(8.2%) (χ 2 = 14.49, p = 0.012), as well as those in the second trimester, 7(7.3%) (χ 2 = 15.47, p = 0.035). The significant predictors of infection were the age groups ≤ 20 years and 21–30 years with crude odds ratios (cOR) of 1.17 (%95CI:0.55–5.38; p = 0.000), and 2.67 (%95CI:1.90–6.18; p = 0.000) respectively. Pregnant women with secondary education, and those in the second trimester respectively had significant cOR of 5.40 (%95CI:2.23–40.76; p = 0.000), and 0.23 (%95CI:0.04–1.17; p = 0.040). Pregnant women who did not have drainage around their premises had a cOR of 6.62 (%95CI:1.25–40.65; p = 0.000), as well as those who had stagnant water around premises with cOR = 7.24 (%95CI:1.29–66.55; p = 0.001). The nested PCR found Plasmodium falciparum with two distinct Merozoite Surface Proteins MSP-1 having K1 and MAD20 families, and MSP-2 having FC27 and 3D7 families. It was recommended that there should be more enlightenment on keeping the drainage clean, clearing of bushes around the environment, using long lasting insecticide treated nets and wearing protective clothing especially at night to protect oneself against mosquito bites. speciation Plasmodium sp merozoites implementation prevention Figures Figure 1 Figure 2 Figure 3 Introduction Malaria continues to remain a serious public health concern in rural and urban areas of tropical and subtropical poor communities of the world. It is a life-threatening vector-borne parasitic infection causing morbidities and death to several children, pregnant women, and adults [ 1 ]. Currently, there is an increase in malaria burden around the world with an estimated 263 million cases [ 2 ]. In sub-Saharan Africa, most of the increased cases were found in the highland and lowland countries such as Ethiopia, Nigeria, Uganda, and the Democratic Republic of Congo. Currently, Nigeria has the highest burden of malaria among individuals in Africa and the world [ 2 ]. In sub-Saharan Africa, the health of pregnant women is adversely affected by malaria, and it remains a debilitating issue of pregnancy among the poor inhabitants [ 3 , 4 ]. Subsequently, it contributes to maternal anaemia, foetal and maternal mortality, low birth weight and still birth, abortion, headache, and other uncontrollable manifestations [ 5 , 6 ]. Pregnant women have severe malaria with higher rates of miscarriage, intrauterine demise, premature delivery, low-birth-weight neonates, and neonatal death [ 7 ]. It has been observed that there is genetic diversity of Plasmodium species affecting malaria treatment among individuals around the world and causing resistance to the prescribed drugs [ 8 , 9 ]. During laboratory examinations, the most spread technique in identifying the polymorphic genes of the Plasmodium species is polymerase chain reaction (PCR) amplification. It has discovered the merozoite surface proteins 1 and 2 (MSP-1 and MSP-2), and the glutamate-rich protein (GLURP) [ 10 , 11 ]. The merozoite surface proteins 1 and 2 have various genomic changes in different geographical endemic areas [ 12 ]. Benue State is a north-central zone area of Nigeria that had malaria endemicity with respective infections of 76.9% in Gboko Local Government Area (LGA) [ 13 ] and 65.9% in Makurdi [ 14 ]. The infection is a public health problem, particularly among vulnerable individuals such as pregnant women and infants of less than 5 years [ 15 ]. Several studies determined the infection level of malaria in pregnancy, but none have been conducted with the genetic characterization of Plasmodium species in Benue State, Nigeria. This study reassessed the status of malaria infection after fifteen (15) years of effective implementation of preventive measures. It also determined the molecular characterization of the Plasmodium species as well as the risk factors for malaria infection among the pregnant women attending the antenatal clinic of the Federal Medical Centre (FMC), Makurdi, Benue State, Nigeria. Materials and Methods Study Area The study was undertaken at the antenatal clinic of the Federal Medical Centre, Makurdi, Benue State, Nigeria. It is located at latitude 7°43’N and longitude 8 º 32'E. It is located within the Guinea savannah region of Nigeria. The warmest period in the area is the month of February with 37.6°C, while the coldest period is the month of August with 22.0°C (https://weatherandclimate.com/nigeria/benue/makurdi). There are two distinct seasons, the wet season from April to October, and the dry season from November to March (https://weatherandclimate.com/nigeria/benue/makurdi). Most of the city dwellers are civil servants, military/police, traders, farmers, fishermen, and artisans. Ethical approval Prior to the World Medical Association (WMA) for humans, the Declaration of Helsinki was granted by the Ethical Committee of the Federal Medical Centre, Makurdi, Benue State, Nigeria (FMH/FMC/MED.108/VOL.I/X) for the study. The study participants' anonymity was maintained and the findings were treated with utmost confidentiality. Participants who were positive by microscopy were advised to go for malaria treatment. Study Population and Sample Size Determination The study population consisted of pregnant women who were attending the antenatal clinic at the Federal Medical Centre, Makurdi, Benue State, Nigeria. The recruitment of the study participants was carried out after the consent of each participant in the study. The minimum Sample size was determined using the formula described by Kramer [16]. N , where: n = Sample size p = prevalence (68.3%) obtained by Amuta et al. [14] z = 1.96 which is the standard normal distribution at a 95% confidence interval. d = Precision/allowable error (which is 5% = 0.05) Thus N = = 332 Study Design, inclusion and exclusion of participants The study was cross-sectional, and a systematic random sampling was used to enroll the willing pregnant women who gave their consent. The study was conducted from March 2022 to June 2022. Three hundred and forty-one (341) consented pregnant women were enrolled in the study. During the interactions to fill the questionnaires, Thirteen pregnant women (n=13) who did not properly fill them were excluded. Those who were sick (n=9) were also excluded, as well as those who came late during the interview (n=5). Three hundred and fourteen (n=314) were included, but three samples (n=3) were excluded for wrong dried blood preservation on Whatmann paper for the PCR. For microscopic analysis six samples (n=6) were excluded for wrong preparation. Three hundred and five (305) blood samples were properly examined (Fig. 1) Questionnaire administration Before the laboratory procedures, a well-structured questionnaire was issued to each participant. The socio-demographic data, information on the gestational period and parity, preventive measures and intermittent preventive drug therapy, and the risk factors for the infection were requested from each participant. The requirement was based on the voluntary participation of each pregnant woman, and a verbal briefing on the importance of the study was provided to each participant. Laboratory procedures Microscopy Five (5) mL of venous blood was collected aseptically from each pregnant woman into a labelled EDTA bottle. A thick and thin smear slide was made from venous blood of each willing pregnant woman. Each slide was stained with 10% Giemsa solution and allowed to dry before microscopic examination. The films were used for malaria parasite identification using the x100 oil immersion objective of the microscope [17]. Polymerase chain reaction (PCR) procedures, amplification, and electrophoresis for Plasmodium species A 10 μL blood samples were blotted on 0.5 × 2 cm strips of 3 mm Whatman filter No. 1 and dried in a laminar flow hood. The dried blood spots (DBS) were preserved in a zip-lock bag with one to three desiccants and packed in a big brown envelope for shipment for molecular analysis. In the molecular laboratory, the DNA was extracted from the dried blood spot (DBS) on the Whatman filter paper using the hole puncher to appropriate sizes. It was placed into 1.5 µL microcentrifuge tubes. This method was performed using the Zymo DNA extraction protocol [18]. The extraction technique was the QUICK-DNA TM Miniprep Plus Kit, and solid tissue (25 mg) protocol. Ninety-five (95) µl of water, 95 µL of solid tissue buffer, and 10 µL of protokinase K were added to the 25 mg of tissue sample and thoroughly mixed. It was then incubated at 55% for 3 hours. Two (2) volumes of genomic binding buffer were added to the supernatant and thoroughly mixed. The mixture was transferred to a Zymo-spin TM 11 ⸰ C XL column in a collection tube, centrifuged for one (1) minute at 1200 G, and the collection tube was discarded with the flow through. Four hundred (400) µL of DNA pre-wash buffer was added to the column in a new collection tube and centrifuged for one (1) minute and the collection tube was emptied. Seven hundred (700) µL of g-DNA wash buffer was added and centrifuged for one (1) minute and the collection tube was emptied. Two hundred (200) µL of g-DNA wash buffer was added and centrifuged for one (1) minute and the collection tube discarded with the flow through. It was transferred to a clean microcentrifuge tube to elute the DNA. Fifty (50) µL of DNA elution buffer was added and incubated for five (5) minutes and then centrifuged for one (1) minute. The polymerase chain reaction (PCR) adopted the procedures of Snounou and Balbir [23]. The PCR amplification was carried out in two phases. For the genus Plasmodium , the primary malaria PCR was amplified using 1.6-1.7 kilobases (kb) amplicons using rPLU1 and rPLU5. The secondary PCR was performed for the Plasmodium species using the genus-specific primers rFAL1 and rFAL2 under the same cyclic conditions to yield a 206 base pair fragment for Plasmodium falciparum (Table 1). The PCR procedures for Merozoite Surface Protein ( MSP ) 1 and 2 used the surface antigen loci . The primer M1-OF was the specific sequence for the primary MSP-1 genotype with M1-OR as the variable size. M2-OF was the primary MSP-2 genotype, and M2-OR was the variable size. The DNA template was amplified using Nested PCR with second-round primers specific to allelic families. The primers M1-KF and M1-KR secondary to MSP-1 were used to detect K1 allelic family, while M1-MF and M1-MR secondary to MSP-1 detected MAD 20. The primers M1-RF and M1-RR secondary to MSP-1 detected the RO33 allelic family. The M2-FCF and M2-FCR secondary to MSP-2 detected FC27 allelic family, while the primers M2-ICF and M2-ICR secondary to MSP-2 detected 3D7 allelic family (Table 2). The PCR products were separated by gel electrophoresis on a 2.5% agarose gel stained with ethidium bromide along with a 100 bp DNA size marker. Upon completion of the gel electrophoresis, gels were placed in a gel imaging cabinet and digitally photographed under UV light. Data Analysis The qualitative variables from the questionnaires were attributed to the ordinal numbers and were entered into Microsoft Excel 2016 and then exported to IBM Statistical Package for the Social Sciences (SPSS) for Windows version 26 (IBM Corp., Armonk, N.Y., USA). The variables of socio-demographic, gestational, and parity were categorized with an interval of 10 years for the age groups; 1-3 months as first trimester, 4-6 months second trimester, and 7-9 months as third trimester for the gestational period of pregnancy. For parity, the pregnant women were classified as primiparous for one child, secundiparous for two children, and multiparous for more than two children. The association of the categorized variables and the malaria infection was analyzed using the Chi-square (χ 2 ) test. The multinomial regression model with an equation of . f(x) is known as the dependent variable. The independent variables known as predictors of malaria in the area were socio-demographic status, gestation and parity, intermittent preventive therapy, sanitation, hygiene, and drainage around houses. The significant difference level was at p≤ 0.05. Results Description of socio-demographic, gestational stage and parity of pregnant women attending an antenatal clinic in Federal Medical Centre, Makurdi, Benue State, Nigeria. Table 3 describes the variables of the pregnant women attending the antenatal clinic in Federal Medical Centre, Makurdi, Benue State, Nigeria. Participants living in urban areas were 286 (93.7%), while those in rural areas were 19 (6.2%). Pregnant women who had ≤ 20 years were 6 (1.9%), while those having 21-30 years were 235 (77.0%). Pregnant women with primary education were 9(2.9%), while those with tertiary education were 158 (51.8%). Traders were 145 (47.5%), while students were 50 (16.4%). Married pregnant women were 283 (92.7%) and non-married were 22 (7.2%). Pregnant women in the first trimester were 51 (16.7%), while those in the third trimester were 158 (51.8%). The primiparous pregnant women were 114(37.3%), while the multiparous were 65 (21.3%). Malaria infection in relation to socio-demographic, gestational, parity, intermittent preventive therapy, and drainage of the environment around houses of pregnant women attending antenatal clinic at Federal Medical Centre, Makurdi, Benue State, Nigeria. Table 4 shows malaria infection in relation to socio-demographic, gestational, and parity of pregnant women attending the antenatal clinic at Federal Medical Centre, Makurdi, Benue State, Nigeria. An infection of 11 (3.6%) was reported among the pregnant women. Those who had secondary education significantly had higher malaria infection, 6 (8.2%) (χ 2 = 14.49, p=0.012), as well as those who were in the second trimester, 7 (7.3%) (χ 2 = 15.47, p=0.035 ). Predictors of malaria infection among pregnant women attending antenatal clinic at Federal Medical Centre, Makurdi, Benue State, Nigeria. The predictors of malaria among pregnant women attending the antenatal clinic at Federal Medical Centre, Makurdi, Benue State, Nigeria are shown in Table 5. The age groups ≤ 20 years and 21-30 years exposed pregnant women to malaria infection with crude odds ratios (cOR) of 1.17 (95%CI: 0.55 - 5.38; p=0.000 ) and 2.67 (95%CI: 1.90-6.18; p=0.000 ) respectively. The educational status and gestational age showed that pregnant women with secondary education had a cOR of 5.40 (95%CI:2.23-40.76; p=0.000) and those in the second trimester had 0.23 (95%CI:0.04-1.17; p=0.043 ) respectively. Pregnant women who did not have drainage around their premises had a cOR of 6.62 (95%CI: 1.25-40.65; p=0.000 ), as well as those who had stagnant water around their premises with cOR=7.24 (95%CI: 1.29 - 66.55; p=0.001 ). Genetic diversity of Plasmodium falciparum Merozoites Surface Protein-1 (MSP-1) and Merozoite Surface Protein-2 (MSP-2) and the allelic families in pregnant women attending the antenatal clinic of Federal Medical Centre, Makurdi, Benue State, Nigeria. The nested PCR indicated that Plasmodium falciparum was the only species found with MSP-1 and MSP-2 families during amplification. MSP-1 had two (2) allelic families and was classified as K1 with 100 bp (18.2%, 2/11), 250 bp (9.1%, 1/11), and 275 bp (9.1%, 1/11), and MAD with 200 bp (9.1%, 1/11) (Figure 2). MSP-2 had two (2) allelic families and classified as FC 27 with 320 bp (9.1%, 1/11) and 350 bp (18.2%, 2/11), and 3D7 with 430 bp (9.1%, 1/11), 450 bp (27.3%, 3/11) and 510 bp (36.4%, 4/11) (Figure 3). Discussion In sub-Saharan Africa, pregnant women are usually vulnerable to malaria which has consequential issues on their immune systems and foetuses. This study reassessed malaria in pregnancy a decade after a first assessment [14]. The low malaria infection observed was an application and implementation of the preventive and control measures by the pregnant women in the areas. Such measures were implemented by the Federal Government of Nigeria around 2010 after the recommendations of the preventive and control program in pregnancy by the World Health Organization policies [19]. The application of such rules reduced the high rate of morbidities and deaths among infected pregnant women in Benue State, Nigeria. The reduced infection level has also been reported in other areas in Nigeria such as Lagos State [20] and Bauchi State [21]. This low level of infection among pregnant women was the effective use of the long-lasting treated nets against mosquito bites. They were also instructed to adhere to the use of Sulfadoxine-Pyrimethamine (SP) in pregnancy as recommended by the World Health Organization [22]. The high infection at the second trimester could be due to the Plasmodium sp immune disorders at various pregnancy stages. Plasmodium sp has been known for the sequestration of the immune system by inducing an inflammatory response, as well as a lack of optimal placental function, and a reduction in foetal nutrient transportation [23]. The malaria-infected pregnant women in the second trimester are also affected by the complications caused by the cytokines. It is also known that malaria in pregnancy promotes the expression of IL-1β, IL-2, IL-8, IFN-γ, TNF-α, and TGF-β [24, 25]. The findings of other previous studies reported high malaria infection in the second trimester of pregnancy in Nigeria and other West African countries [26, 27]. The residency of pregnant women around the swampy environment was also displayed during the focus group interactions. This might also be a result of Plasmodium falciparum resistance of the immune system to the antimalarial drug given. The negligence of pregnant women towards the use of the intermittent preventive treatment nets could be another cause of the infection. Such issues have been reported in Uganda [28]. It could also be that the pregnant women were not complying with the prescription of the drugs [29]. The pregnant women of the age groups ≤ 20 years and 21-30 years, and those with a secondary level of education were predicted to be more exposed to malaria infection. It could be the ignorant attitude of those pregnant women towards the wearing of protective clothes against mosquito' bites. They are usually involved in farming vegetable crops along the agricultural riverine sites of the River Benue. The young women within those age groups may lack the awareness of using preventive measures against malaria at the onset of pregnancy. It may be that at that level there might be an immune suppression, or loss of acquired immunity to malaria [30]. The absence of fluent drainage and the presence of stagnant water were predicted as breeding sites of mosquitoes. The drainages were not well evacuated as people dump their refuse thereby allowing very good breeding sites for Anopheles. It is pertinent to note that mosquitoes breed freely in such gutters and drainages as observed in Nigeria [31] and Ghana [32]. In this study, the molecular characterization found only Plasmodium falciparum among the pregnant women in Makurdi metropolis, Benue State, Nigeria. The polymerase chain reaction (PCR) was highly sensitive and consistent in the detection of Plasmodium falciparum . Previous studies found that P. falciparum was the predominant strain for individuals in Nigeria [10,33], and sub-Saharan Africa [34, 35]. P. falciparum isolates showed genetic diversity in this study with highly polymorphic markers such as the merozoites’ surface protein-1 ( MSP -1) and merozoites’ surface protein-2 ( MSP -2). The amplification of MSP-1 found K1 and MAD20 families, while MSP-2 found FC27 and 3D7 at different frequencies. This effect could be the challenges to the resistance of the parasite, and complexity to the treatment among the pregnant women on Sulfadoxine-Pyrimethamine. A previous study reported such issues of various polymorphic markers of Plasmodium falciparum [8, 11, 32]. The unprompted and unenthusiastic action for the blood preservation during packaging for evacuation to the molecular laboratory was a limitation to the study. Conclusion A low malaria infection was found among the pregnant women attending the antenatal clinic of the Federal Medical Centre, Makurdi, Benue State, Nigeria. The age groups ≤ 20 and 21-30 years, secondary school education, second trimester, provision of drainage, and presence of stagnant water were the risk factors for malaria infection among the pregnant women in Makurdi, Benue State, Nigeria. The nested PCR indicated that pregnant women were infected with only Plasmodium falciparum . Two distinct Merozoite Surface Proteins MSP-1 with K1 and MAD20 clones, and MSP-2 with FC27 and 3D7 clones were observed. It was recommended that there should be more enlightenment and application on keeping the drainage clean, clearing of bushes around the houses, and wearing protective clothing especially at night against mosquito bites. Pregnant women should be encouraged to comply with the laid-down strategies of the malaria control programs as it has been observed in this study that non-compliance was the reason why some of the pregnant women were infected with malaria. Abbreviations - PCR Polymerase Chain Reaction - MSP-1 Merozoite Surface Proteins-1 - MSP-2 Merozoite Surface Proteins-2 - GLURP Glutamate-rich Protein - LGA Local Government Area - FMC Federal Medical Centre - WMA World Medical Association - DBS Dried Blood Spots - DNA Deoxyribonucleic acid - SPSS Statistical Package for the Social Sciences - CI Confidence Interval - cOR crude Odd Ratio - SP Sulfadoxine-Pyrimethamine - IL Interleukins - IFN Interferons - TGF Transforming Growth Factor Declarations Ethical approval Consent for publication The authors have consented to publish this manuscript with BMC Infectious Diseases Availability of data and material Data will be available if needed. Competing interests There is no competing interest in this research Funding This research did not receive any grant to support this research Authors’ contributions Conceptualization, data curation, and design of the study: AEU, KSL, HRS, SCIA Laboratory work, Data curation, and Literature review: SCIA, AVY, WBE, DB, EES; Statistical analysis : HRS ; Data curation and write-up of the manuscript: SMC, HRS; Review and editing of the manuscript: AEU, KSL, HRS, SMC, AVY, WBE, DB, EES, SCIA. Acknowledgements The research team remains grateful to the ethical committee of the Federal Medical Centre, Makurdi, Benue State, Nigeria for the approval of the research (FMH/FMC/MED.108/VOL.I/X). The Director of the Federal Medical Centre, Makurdi, Benue State, and the Head of the Department of Laboratory Services are gratefully acknowledged. The research team is grateful to all the pregnant women who participated in this study. We remain grateful to Prof. F.T., Ikpa for his efforts during the molecular analysis. All the midwives and nurses who assisted during sample collection, focus group discussion, and questionnaire interviews are gratefully acknowledged. References World Malaria Report. Addressing inequity in the global malaria response. Geneva: World Health Organization 2024. Licence: CC BY-NC-SA 3.0 IGO. World Health Organization (WHO). Geneva: World Health Organization 2023. Licence: CC BY-NC-SA 3.0 IGO. Valentina R, Daniel JW, Jennifer R, et al. Global estimates of the number of pregnancies at risk of malaria from 2007 to 2020: A demographic study. Lancet Glob Hlth. 2023;11:e40–47. Bakken L, Iversen PO. The impact of malaria during pregnancy on low birth weight in East-Africa: a topical review. Malar J. 2021;20:348. https://doi.org/10.1186/s12936-021-03883-z . World Health Statistics. Monitoring health for the SDGs, sustainable development goals. Geneva: World Health Organization 2018. Licence: CC BY-NC-SA 3.0 IGO. Roll Back Malaria (RBM). Partnership To End Malaria Annual Report 2018. https://endmalaria.org/sites/default/files/RBM%20Annual%20Report%2020 EN.pdf Tegegne B, Getie S, Lemma W, et al. Performance of loop-mediate isothermal amplification (LAMP) for the diagnosis of malaria among malaria suspected pregnant women in Northwest Ethiopia. Malar J. 2017;16(1):34. 10.1186/s12936-017-1692-4 . Alruwaili M, Elderdery AY, Ejaz H, et al. Genotyping and characterizing Plasmodium falciparum to reveal genetic diversity and multiplicity of Infection by merozoite surface proteins 1 and 2 (msp-1 and msp-2) and Glutamate-Rich Protein (glurp) genes. Trop Med Infect Dis. 2024;9:284. https://doi.org/10.3390/tropicalmed9110284 . Adedolapo BO, Damilola EO, Ure CM, et al. Genetic diversity of Plasmodium falciparum in people living with HIV in Ogbomoso, Nigeria: Implications for malaria transmission and treatment. Mal World J. 2025;16(8):1–1. https://doi.org/10.5281/zenodo.15175103 . Võ TC, Lê HG, Kang JM, et al. Genetic polymorphism of merozoite surface protein 1 and merozoite surface protein 2 in the Vietnam Plasmodium falciparum population. BMC Infect Dis. 2024;24:1216. https://doi.org/10.1186/s12879-024-10116-6 . Akoniyon OP, Akibinu M, Adeleke MA et al. Comparative study of genetic diversity and multiplicity of infection in uncomplicated Plasmodium falciparum infections in selected regions of pre-elimination and high transmission settings using MSP1 and MSP 2 Genes. Pathog. 2024;13(2):172. https://doi.org/10.3390/pathogens13020172 Baina MT, Lissom AA, Doulamo NV et al. Comparative study of Plasmodium falciparum msp-1 and msp-2 genetic diversity in isolates from rural and urban areas in the south of Brazzaville, Republic of Congo. Pathog. 2023;12(5):742. https://doi.org/10.3390/pathogens12050742 Houmsou RS, Amuta EU, Sar TT, et al. Malaria infection in pregnant women attending antenantal clinics in Gboko, Benue State, Nigeria. Int’l J Acad Res. 2010;2:33–6. Amuta E, Houmsou R, Wama E, et al. Malarial infection among antenatal and maternity clinics attendees at the Federal Medical Centre, Makurdi, Benue State, Nigeria. Infect Dis Rep. 2014;6(1):5050. 10.4081/idr.2014.5050 . World Health Statistics. Monitoring health for the sustainable development goals (SDGs). World Health Organization, Geneva. World Health Organization. 2024. 9789240094703. https://iris.who.int/handle/10665/376869 Kramer MS. Clinical epidemiology and biostatistics. First ed. Berlin: Springer; 1988. p. 157. Cheesbrough M. (2010) District Laboratory Practice in Tropical Countries. 2nd Edition, Cambridge University Press, Cambridge, United Kingdom. Snounou G, Balbir S. Nested PCR analysis of Plasmodium parasites. Meth Mol Med. 2002;72:189–203. World Health Organization (WHO). WHO recommendations on antenatal care for a positive pregnancy experience: summary. Geneva, Switzerland: WHO 2018. Licence: CC BY-NC-SA 3.0 IGO. Oluwagbemiga A, Bamidele A, Babatunde A, et al. Prevalence of malaria in pregnant women attending antenatal clinic in primary health centres in Lagos, southwest, Nigeria. J Adv Med Med Res. 2018;25(12):1–9. 10.9734/JAMMR/2018/39620 . Kadas AS, Okon KO, Alkali M, et al. Low prevalence of asymptomatic malaria in Pregnancy among subjects attending antenatal clinic at a tertiary hospital in Bauchi, Nigeria: A preliminary report. J Adv Med Med Res. 2019;29:1–8. World Health Organization. WHO policy brief for the implementation of intermittent preventive treatment of malaria in pregnancy using sulfadoxine pyrimethamine (IPTp-SP).WHO/HTM/GMP/2014.4 World Health Organization 2014. All rights reserved. Omer FM, Kurtzhals JAL, Riley EM. Maintaining the immunological balance in parasitic infections: A Role for TGF-β? Parasitol Today. 2000;16(1):18–23. https://doi.org/10.1016/S0169-4758(99)01562-8 . Sánchez KE, Spencer LM. Pregnancy-associated malaria: Effects of cytokine and chemokine expression. Trav Med Inf Dis. 2022;47:102282. https://doi.org/10.1016/j.tmaid.2022.102282 . The Lancet null. Miscarriage: worldwide reform of care is needed. Lancet. 2021;397(21):1597. 10.1016/S0140-6736 . Ali R, North-Eastern. Nigeria J Appl Sci Environ Mgt. 2022;26(6):1063–6. https://dx.doi.org/10.4314/jasem.v26i6.10 . Isha B, Walker P, Tagbor H, et al. Seasonal dynamics of malaria in pregnancy in west Africa: evidence for carriage of infections acquired before pregnancy until first contact with antenatal care. Am J Trop Med Hyg. 2018;98(2):534–42. 10.4269/ajtmh.17-0620 . Mbonye AK, Bygbjerg I, Magnussen P. Intermittent preventive treatment of malaria in pregnancy: Evaluation of a new delivery approach and the policy implications for malaria control in Uganda. Hlth Policy. 2007;81:228–41. Grietens KP, Gies S, Coulibaly SO, et al. Bottlenecks for high coverage of intermittent preventive treatment in pregnancy: The case of adolescent pregnancies in rural Burkina Faso. PLoS ONE. 2010;5:e12013. Wogu M. Prevalence of malaria parasite infection among pregnant women attending antenatal clinics in Port Harcourt, Rivers State, Nigeria. Intl J Trop Dis Hlth. 2014;3:126–32. https://doi.org/10.9734/IJTDH/2013/2738 . Abu BE, Amankwah OP, Adjei KE, et al. Factors associated with malaria in pregnancy among women attending ANC clinics in selected districts of the Ashanti Region, Ghana. Malar J. 2025;24(8). https://doi.org/10.1186/s12936-025-05244-6 . Opute AO, Akinkunmi JA, Funsho AO, et al. Genetic diversity of Plasmodium falciparum isolates in Nigeria. A review. Egypt J Med Hum Gen. 2022;23:129. https://doi.org/10.1186/s43042-022-00340-7 . Nundu SS, Culleton R, Simpson SV, et al. Malaria parasite species composition of Plasmodium infections among asymptomatic and symptomatic school-age children in rural and urban areas of Kinshasa, Democratic Republic of Congo. Malar J. 2021;20(1):389. 10.1186/s12936-021-03919-4 . Dao F, Dembele L, Diarra B, et al. The Prevalence of Human Plasmodium Species during Peak Transmission Seasons from 2016 to 2021 in the rural commune of Ntjiba, Mali. Trop Med Infect Dis. 2023;8:438. https://doi.org/10.3390/tropicalmed8090438 . Wångdahl A, Bogale RT, Eliasson I, et al. Malaria parasite prevalence in sub- Saharan African migrants screened in Sweden: a cross-sectional study. Lancet Regl Hlth Eur. 2023;27:100581. https://doi.org/10.1016/j.lanepe.2022.100581 . Tables Table 1: Primary and secondary primers for Plasmodium species PCR round Primers’ names Sequences (5’-3’) Amplicon size (basepair) Species Primary reaction rPLU1 rPLU5 TCAAAGATTAAGCCATGCAAGTGA CCTGTTGTTGCCTTAAACTCC 1.6-1.7 kb Plasmodium sp Secondary reaction (Nested PCR) rFAL1 rFAL2 TTAAACTGGTTTGGGAAAACCAAATATATT ACACAATGAACTCAATCATGACTACCCGTC 206 bp P. falciparum rOVA1 rOVA2 ATCTCTTTTGCTATTTTTTAG TATTGGAGA GGAAAAGGACACATTAATTGT ATCCTAGTG 800 bp P. ovale rMAL1 rMAL2 ATAACATAGTTGTACGTTAAG AATAACCGC AAAATTCCCATGCATAAAAAA TTATACAAA 144 bp P. malariae rVIV1 rVIV2 CGCTTCTAGCTTAATCCACAT AACTGATAC ACTTCCAAGCCGAAGCAAAGA AAGTCCTTA 120 bp P. vivax Table 2: Sequences of primers for MSP-1 and MSP-2 and allelic family Genotype PCR round Primers names Sequence (5’-3’) Allelic families MSP-1 Primary M1-OF CTAGAAGCTTTAGAAGATGCAGTATTG M1-OR CTTAAATAGTATTCTAATTCAAGTGGATCA Secondary M1-KF AAATGAAGAAGAAATTACTACAAAAGGTGC K1 M1-KR GCTTGCATCAGCTGGAGGGCTTGCACCAGA M1-MF AAATGAAGGAACAAGTGGAACAGCTGTTAC MAD 20 M1-MR ATCTGAAGGATTTGTACGTCTTGAATTACC M1-RF TAAAGGATGGAGCAAATACTCAAGTTGTTG RO33 M1-RR CATCTGAAGGATTTGCAGCACCTGGAGATC MSP-2 Primary M2-OF ATGAAGGTAATTAAAACATTGTCTATTATA M2-OR CTTTGTTACCATCGGTACATTCTT Secondary M2-FCF AATACTAAGAGTGTAGGTGCARATGCTCCA FC27 M2-FCR TTTTATTTGGTGCATTGCCAGAACTTGAAC M2-ICF AGAAGTATGGCAGAAAGTAACCTYCTACT 3D7 M2-ICR GATTGTAATTCGGGGGATTCAGTTTGTTCG Table 3: Description of socio-demographic, gestational stage and parity of pregnant women attending an antenatal clinic in Federal Medical Centre, Makurdi, Benue State, Nigeria. Variables Number (N=305), n (%) Infection 11 ( 3.6) Location Urban Rural 286 (93.7) 19 ( 6.2) Age (years) ≤ 20 21-30 31-40 41-50 6 ( 1.9) 235 (77.0) 63 (20.6) 1 ( 0.3) Education Primary school Secondary school Tertiary school 9 ( 2.9) 129 (42.3) 158 (51.8) Occupation Student Business Civil servant Trader Others 50 (16.4) 130 (42.6) 37 (12.1) 15 ( 4.9) 73 (23.9) Marital status Married Non-married 283 (92.7) 22 ( 7.2) Gestational stage First trimester Second trimester Third trimester 51 (16.7) 96 (31.4) 158 (51.8) Parity Primiparous Secundiparous Multiparous 114 (37.3) 126 (41.3) 65 (21.3) Table 4: Malaria infection in relation to socio-demographic, gestational, and parity of pregnant women attending antenatal clinic at Federal Medical Centre, Makurdi, Benue State, Nigeria. Variales Malaria infection No. exam Positive (%) χ 2 P-value Infection 305 11 ( 3.6) Age (years) ≤ 20 21-30 31-40 41-50 6 235 64 1 1 (16.9) 6 ( 2.6) 4 ( 6.3) 0 ( 0.0) 5.09 0.165 Education Primary Secondary Tertiary 9 129 158 0( 0.0) 8(6.2) 3(1.9) 4.49 0.212 Occupation Student Business Civil servant Others 37 130 37 73 3(6.0) 3(2.3) 1(2.7) 3(4.1) 1.99 0.736 Marital status Married Unmarried 283 22 9(3.2) 2(9.1) 2.05 0.152 Gestational stage First trimester Second trimester Third trimester 51 96 158 1( 2.0) 7(7.3) 3(1.9) 15.47 0.035 Parity Primiparous Secundiparous Multiparous 114 126 65 5( 4.4) 6( 4.8) 0(0.0) 3.11 0.211 LLTINs = Long-Lasting Treated Insecticide Nets First trimester: 1-3 months Second trimester: 4-6 months Third trimester: 7-9 months Table 5: Multinomial logistic regression analysis showing important predictors as socio-demographic, gestational, parity, intermittent preventive therapy and drainages around houses of pregnant women attending antenatal clinic at Federal Medical Centre, Makurdi, Benue State, Nigeria to malaria. Independent variables crude OR (%95CI) p Socio-demographic Age (years) ≤ 20 21-30 31-40 Education Primary Secondary Tertiary Occupation Student Business Civil servant Others 1.17 (0.55 - 5.38) 2.67 (1.90 - 6.18) - 4.32 (1.01 - 23.71) 5.40 (2.23 - 40.76) - 0.98 (0.11 - 8.56) 1.86 (0.26 - 13.27) 0.71 (0.04 - 12.66) - 0.000 0.000 - 0.101 0.003 - 0.990 0.533 0.814 - Gestational stage First trimester Second trimester Third trimester Parity Primiparous Secundiparous Multiparous 1.10 (0.08 - 14.66) 0.23 (0.04 - 1.17) - 7.64 (2.31 - 57.12) 1.05 (0.19 - 4.67) - 0.931 0.047 - 0.977 0.974 - Intermittent preventive therapy No Yes 0.25 (0.04 - 1.32) - 0.413 - Sanitation and hygiene around houses with provision of drainage or not No Yes Presence of stagnant water around houses Yes No 3.32 (0.08 - 6.77) - 7.24 (1.29 - 66.55) - 0.000 - 0.001 - Plates Plate 1 to 6 are available in the Supplementary Files section. Additional Declarations No competing interests reported. Supplementary Files Appendices.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7442925","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":507401220,"identity":"026538af-3535-49b3-bdff-ed92cfa1b844","order_by":0,"name":"Mary C Swem","email":"","orcid":"","institution":"Taraba State University","correspondingAuthor":false,"prefix":"","firstName":"Mary","middleName":"C","lastName":"Swem","suffix":""},{"id":507401221,"identity":"f5c672e5-1c67-4e75-9280-ab1aa774c3f9","order_by":1,"name":"Emamanuel B Wama","email":"","orcid":"","institution":"Taraba State University","correspondingAuthor":false,"prefix":"","firstName":"Emamanuel","middleName":"B","lastName":"Wama","suffix":""},{"id":507401222,"identity":"ca9d385a-42fc-4e89-9f75-cf98f02fed3c","order_by":2,"name":"Vera Y Akwa","email":"","orcid":"","institution":"Taraba State University","correspondingAuthor":false,"prefix":"","firstName":"Vera","middleName":"Y","lastName":"Akwa","suffix":""},{"id":507401223,"identity":"a4ab0941-f5b4-447f-9dd0-3830ca2dea41","order_by":3,"name":"Collins A. Swem","email":"","orcid":"","institution":"Federal Medical Centre","correspondingAuthor":false,"prefix":"","firstName":"Collins","middleName":"A.","lastName":"Swem","suffix":""},{"id":507401224,"identity":"c9824fe7-1970-468c-8a34-c6d1de73144b","order_by":4,"name":"Boursou Djafsia","email":"","orcid":"","institution":"University of Garoua","correspondingAuthor":false,"prefix":"","firstName":"Boursou","middleName":"","lastName":"Djafsia","suffix":""},{"id":507401225,"identity":"4e95c43a-258d-49a0-a0ca-8b5ca6aa6152","order_by":5,"name":"Serge E Eteme","email":"","orcid":"","institution":"University of Yaoundé I","correspondingAuthor":false,"prefix":"","firstName":"Serge","middleName":"E","lastName":"Eteme","suffix":""},{"id":507401226,"identity":"341d13d1-5347-42bc-bddc-1a2351bcd718","order_by":6,"name":"Robert S Houmsou","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA10lEQVRIiWNgGAWjYHACNijNfABISMiQooUtAaSFhxQtPAZgkqB68/4DbA8+tm2z55fI+fzqRo0FDwP74aMb8GmRuZHAbjiz7XbizBm526xzjgEdxpOWdgOfFgkJBjZp3rbbCQY3crcZ57ABtUjwmOHXwn8ArMXe4EbOM+Ocf8RoYUgAa2HccCOH+XFuGzFaJBLbJGecA/ql55kZc26fBA8bQb/wHz4m8aHstj0/e/Ljzznf6uT42Q8fw6uFgYGxAcZikwCT+JWjAuYPpKgeBaNgFIyCkQMAq/ZBeFXEoOMAAAAASUVORK5CYII=","orcid":"","institution":"Taraba State University","correspondingAuthor":true,"prefix":"","firstName":"Robert","middleName":"S","lastName":"Houmsou","suffix":""},{"id":507401227,"identity":"b09ca621-fa88-4a87-a342-d997114cd83a","order_by":7,"name":"Santaya L Kela","email":"","orcid":"","institution":"Federal University Kashere","correspondingAuthor":false,"prefix":"","firstName":"Santaya","middleName":"L","lastName":"Kela","suffix":""},{"id":507401228,"identity":"c8e02536-22d5-4d9f-a05e-ec0998696933","order_by":8,"name":"Elizabeth U Amuta","email":"","orcid":"","institution":"Joseph Sarwuan Tarka University","correspondingAuthor":false,"prefix":"","firstName":"Elizabeth","middleName":"U","lastName":"Amuta","suffix":""}],"badges":[],"createdAt":"2025-08-23 18:53:15","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7442925/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7442925/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":90289948,"identity":"a8f046c3-f267-4ddb-8b36-9b5ef8a54a1a","added_by":"auto","created_at":"2025-09-01 07:11:37","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":55559,"visible":true,"origin":"","legend":"\u003cp\u003eFlow chart showing exclusion and inclusion of the pregnant women\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-7442925/v1/b6596c68c48e9a0f35a3a60f.png"},{"id":90289946,"identity":"113492b8-0c46-46a2-9701-c31baa26f639","added_by":"auto","created_at":"2025-09-01 07:11:37","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":104377,"visible":true,"origin":"","legend":"\u003cp\u003eGenetic diversity of \u003cem\u003ePlasmodium\u003c/em\u003e \u003cem\u003efalciparum\u003c/em\u003e MSP-1 and allelic Families in pregnant women attending antenatal clinic of Federal Medical Centre, Makurdi, Benue State, Nigeria.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-7442925/v1/4221bfad97615fba067dd0cd.png"},{"id":90289947,"identity":"b931d54d-32c7-4a7d-a09f-f6b052074a07","added_by":"auto","created_at":"2025-09-01 07:11:37","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":102453,"visible":true,"origin":"","legend":"\u003cp\u003eGenetic diversity of \u003cem\u003ePlasmodium\u003c/em\u003e \u003cem\u003efalciparum\u003c/em\u003e MSP-2 and allelic families in pregnant women attending antenatal clinic of Federal Medical Centre, Makurdi, Benue State, Nigeria.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-7442925/v1/b7608de131ebf92eba932c33.png"},{"id":90290389,"identity":"da8ab78c-08da-4acd-975b-a3721c2b5275","added_by":"auto","created_at":"2025-09-01 07:19:38","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1569008,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7442925/v1/27512f32-e06e-4437-b59f-eaab6f2c15d4.pdf"},{"id":90289949,"identity":"03bdc77d-d4c9-4fef-9959-94276d4bf17c","added_by":"auto","created_at":"2025-09-01 07:11:37","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":728453,"visible":true,"origin":"","legend":"","description":"","filename":"Appendices.docx","url":"https://assets-eu.researchsquare.com/files/rs-7442925/v1/c8b4f60592159669e08af958.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"\u003cp\u003eLow Malaria Infection After a Decade of Effective Implementation of Preventive Measures and Speciation of Plasmodium SP Among Pregnant Women Attending an Antenatal Clinic in Benue State, Nigeria\u003c/p\u003e","fulltext":[{"header":"Introduction","content":"\u003cp\u003eMalaria continues to remain a serious public health concern in rural and urban areas of tropical and subtropical poor communities of the world. It is a life-threatening vector-borne parasitic infection causing morbidities and death to several children, pregnant women, and adults [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Currently, there is an increase in malaria burden around the world with an estimated 263\u0026nbsp;million cases [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. In sub-Saharan Africa, most of the increased cases were found in the highland and lowland countries such as Ethiopia, Nigeria, Uganda, and the Democratic Republic of Congo. Currently, Nigeria has the highest burden of malaria among individuals in Africa and the world [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eIn sub-Saharan Africa, the health of pregnant women is adversely affected by malaria, and it remains a debilitating issue of pregnancy among the poor inhabitants [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Subsequently, it contributes to maternal anaemia, foetal and maternal mortality, low birth weight and still birth, abortion, headache, and other uncontrollable manifestations [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Pregnant women have severe malaria with higher rates of miscarriage, intrauterine demise, premature delivery, low-birth-weight neonates, and neonatal death [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eIt has been observed that there is genetic diversity of \u003cem\u003ePlasmodium\u003c/em\u003e species affecting malaria treatment among individuals around the world and causing resistance to the prescribed drugs [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. During laboratory examinations, the most spread technique in identifying the polymorphic genes of the \u003cem\u003ePlasmodium\u003c/em\u003e species is polymerase chain reaction (PCR) amplification. It has discovered the merozoite surface proteins 1 and 2 (MSP-1 and MSP-2), and the glutamate-rich protein (GLURP) [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. The merozoite surface proteins 1 and 2 have various genomic changes in different geographical endemic areas [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eBenue State is a north-central zone area of Nigeria that had malaria endemicity with respective infections of 76.9% in Gboko Local Government Area (LGA) [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e] and 65.9% in Makurdi [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. The infection is a public health problem, particularly among vulnerable individuals such as pregnant women and infants of less than 5 years [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Several studies determined the infection level of malaria in pregnancy, but none have been conducted with the genetic characterization of \u003cem\u003ePlasmodium\u003c/em\u003e species in Benue State, Nigeria. This study reassessed the status of malaria infection after fifteen (15) years of effective implementation of preventive measures. It also determined the molecular characterization of the \u003cem\u003ePlasmodium\u003c/em\u003e species as well as the risk factors for malaria infection among the pregnant women attending the antenatal clinic of the Federal Medical Centre (FMC), Makurdi, Benue State, Nigeria.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cp\u003e\u003cstrong\u003eStudy Area\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe study was undertaken at the antenatal clinic of the Federal Medical Centre, Makurdi, Benue State, Nigeria. It is located at latitude 7\u0026deg;43\u0026rsquo;N and longitude 8\u003csup\u003e\u0026ordm;\u003c/sup\u003e32\u0026apos;E. It is located within the Guinea savannah region of Nigeria. The warmest period in the area is the month of February with 37.6\u0026deg;C, while the coldest period is the month of August with 22.0\u0026deg;C (https://weatherandclimate.com/nigeria/benue/makurdi). There are two distinct seasons, the wet season from April to October, and the dry season from November to March (https://weatherandclimate.com/nigeria/benue/makurdi). Most of the city dwellers are civil servants, military/police, traders, farmers, fishermen, and artisans.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthical approval\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePrior to the World Medical Association (WMA) for humans, the\u0026nbsp;Declaration of Helsinki was granted by the Ethical Committee of the Federal Medical Centre, Makurdi, Benue State, Nigeria (FMH/FMC/MED.108/VOL.I/X) for the study. The study participants\u0026apos; anonymity was maintained and the findings were treated with utmost confidentiality. Participants who were positive by microscopy were advised to go for malaria treatment.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStudy Population and Sample Size Determination\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe study population consisted of pregnant women who were attending the antenatal clinic at the Federal Medical Centre, Makurdi, Benue State, Nigeria. The recruitment of the study participants was carried out after the consent of each participant in the study.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe minimum Sample size was determined using the formula described by Kramer [16].\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eN\u0026nbsp;\u003cimg width=\"127\" height=\"20\" src=\"https://myfiles.space/user_files/127393_c7e80a1c9bb65875/127393_custom_files/img1756709757.gif\" alt=\"image\"\u003e, where:\u0026nbsp;\u003c/p\u003e\n\u003cp\u003en = Sample size \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u003c/p\u003e\n\u003cp\u003ep = prevalence (68.3%) obtained by Amuta \u003cem\u003eet al.\u003c/em\u003e [14]\u003c/p\u003e\n\u003cp\u003ez = 1.96 which is the standard normal distribution at a 95% confidence interval.\u003c/p\u003e\n\u003cp\u003ed = Precision/allowable error (which is 5% = 0.05)\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThus \u0026nbsp; \u0026nbsp;N = \u003cimg width=\"282\" height=\"20\" src=\"https://myfiles.space/user_files/127393_c7e80a1c9bb65875/127393_custom_files/img1756709757.gif\" alt=\"image\"\u003e\u0026nbsp;= 332\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStudy Design, inclusion and exclusion of participants\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe study was cross-sectional, and a systematic random sampling was used to enroll the willing pregnant women who gave their consent. \u0026nbsp;The study was conducted from March 2022 to June 2022. Three hundred and forty-one (341) consented pregnant women were enrolled in the study. During the interactions to fill the questionnaires, Thirteen pregnant women (n=13) who did not properly fill them were excluded. Those who were sick (n=9) were also excluded, as well as those who came late during the interview (n=5). Three hundred and fourteen (n=314) were included, but three samples (n=3) were excluded for wrong dried blood preservation on Whatmann paper for the PCR. For microscopic analysis six samples (n=6) were excluded for wrong preparation. Three hundred and five (305) blood samples were properly examined (Fig. 1)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eQuestionnaire administration\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBefore the laboratory procedures, a well-structured questionnaire was issued to each participant. The socio-demographic data, information on the gestational period and parity, preventive measures and intermittent preventive drug therapy, and the risk factors for the infection were requested from each participant. The requirement was based on the voluntary participation of each pregnant woman, and a verbal briefing on the importance of the study was provided to each participant. \u0026nbsp;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eLaboratory procedures\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMicroscopy\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFive (5) mL of venous blood was collected aseptically from each pregnant woman into a labelled EDTA bottle. A thick and thin smear slide was made from venous blood of each willing pregnant woman. Each slide was stained with 10% Giemsa solution and allowed to dry before microscopic examination. The films were used for malaria parasite identification using the x100 oil immersion objective of the microscope [17].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePolymerase chain reaction (PCR) procedures, amplification, and electrophoresis for \u003cem\u003ePlasmodium\u003c/em\u003e species\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA 10 \u0026mu;L blood samples were blotted on 0.5 \u0026times; 2 cm strips of 3 mm Whatman filter No. 1 and dried in a laminar flow hood. The dried blood spots (DBS) were preserved in a zip-lock bag with one to three desiccants and packed in a big brown envelope for shipment for molecular analysis.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn the molecular laboratory,\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003ethe DNA was extracted from the dried blood spot (DBS) on the Whatman filter paper using the hole puncher to appropriate sizes. It was placed into 1.5 \u0026micro;L microcentrifuge tubes. This method was performed using the Zymo DNA extraction protocol [18]. The extraction technique was the QUICK-DNA\u003csup\u003eTM\u0026nbsp;\u003c/sup\u003eMiniprep Plus Kit, and solid tissue (25 mg) protocol. Ninety-five (95) \u0026micro;l of water, 95 \u0026micro;L of solid tissue buffer, and 10 \u0026micro;L of protokinase K were added to the 25 mg of tissue sample and thoroughly mixed. It was then incubated at 55% for 3 hours. Two (2) volumes of genomic binding buffer were added to the supernatant and thoroughly mixed. The mixture was transferred to a Zymo-spin\u003csup\u003eTM\u003c/sup\u003e11\u003csup\u003e⸰\u003c/sup\u003eC XL column in a collection tube, centrifuged for one (1) minute at 1200 G, and the collection tube was discarded with the flow through. Four hundred (400) \u0026micro;L of DNA pre-wash buffer was added to the column in a new collection tube and centrifuged for one (1) minute and the collection tube was emptied. Seven hundred (700) \u0026micro;L of g-DNA wash buffer was added and centrifuged for one (1) minute and the collection tube was emptied. Two hundred (200) \u0026micro;L of g-DNA wash buffer was added and centrifuged for one (1) minute and the collection tube discarded with the flow through. It was transferred to a clean microcentrifuge tube to elute the DNA. Fifty (50) \u0026micro;L of DNA elution buffer was added and incubated for five (5) minutes and then centrifuged for one (1) minute.\u003c/p\u003e\n\u003cp\u003eThe polymerase chain reaction (PCR) adopted the procedures of Snounou and Balbir [23]. The PCR amplification was carried out in two phases. For the genus \u003cem\u003ePlasmodium\u003c/em\u003e, the primary malaria PCR was amplified using 1.6-1.7 kilobases (kb) amplicons using rPLU1 and rPLU5. The secondary PCR was performed for the \u003cem\u003ePlasmodium\u003c/em\u003e species using the genus-specific primers rFAL1 and rFAL2 under the same cyclic conditions to yield a 206 base pair fragment for \u003cem\u003ePlasmodium falciparum\u0026nbsp;\u003c/em\u003e(Table 1).\u003c/p\u003e\n\u003cp\u003eThe PCR procedures for Merozoite Surface Protein (\u003cem\u003eMSP\u003c/em\u003e) 1 and 2 used the surface antigen loci\u003cem\u003e.\u0026nbsp;\u003c/em\u003eThe primer M1-OF was the specific sequence for the primary MSP-1 genotype with M1-OR as the variable size. M2-OF was the primary MSP-2 genotype, and M2-OR was the variable size. The DNA template was amplified using Nested PCR with second-round primers specific to allelic families. The primers M1-KF and M1-KR secondary to \u003cem\u003eMSP-1\u003c/em\u003e were used to detect K1 allelic family, while M1-MF and M1-MR secondary to \u003cem\u003eMSP-1\u003c/em\u003e detected MAD 20. The primers M1-RF and M1-RR secondary to \u003cem\u003eMSP-1\u003c/em\u003e detected the RO33 allelic family. The M2-FCF and M2-FCR secondary to \u003cem\u003eMSP-2\u003c/em\u003e detected FC27 allelic family, while the primers M2-ICF and M2-ICR secondary to MSP-2 detected 3D7 allelic family (Table 2).\u003c/p\u003e\n\u003cp\u003eThe PCR products were separated by gel electrophoresis on a 2.5% agarose gel stained with ethidium bromide along with a 100 bp DNA size marker. Upon completion of the gel electrophoresis, gels were placed in a gel imaging cabinet and digitally photographed under UV light.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe qualitative variables from the questionnaires were attributed to the ordinal numbers and were entered into Microsoft Excel 2016 and then exported to IBM Statistical Package for the Social Sciences (SPSS) for Windows version 26 (IBM Corp., Armonk, N.Y., USA). The variables of socio-demographic, gestational, and parity were categorized with an interval of 10 years for the age groups; 1-3 months as first trimester, 4-6 months \u0026nbsp;second trimester, and 7-9 months as third trimester for the gestational period of pregnancy. For parity, the pregnant women were classified as primiparous for one child, secundiparous for two children, and multiparous for more than two children. The association of the categorized variables and the malaria infection was analyzed using the Chi-square (\u0026chi;\u003csup\u003e2\u003c/sup\u003e) test. The multinomial regression model with an equation of \u003cimg width=\"372\" height=\"20\" src=\"https://myfiles.space/user_files/127393_c7e80a1c9bb65875/127393_custom_files/img1756709757.gif\" alt=\"image\"\u003e. \u003cem\u003ef(x)\u003c/em\u003e is known as the dependent variable. The independent variables known as predictors of malaria in the area were socio-demographic status, gestation and parity, intermittent preventive therapy, sanitation, hygiene, and drainage around houses. The significant difference level was at p\u0026le; 0.05.\u0026nbsp;\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eDescription of socio-demographic, gestational stage and parity of pregnant women \u0026nbsp; \u0026nbsp; \u0026nbsp; attending an antenatal clinic in Federal Medical Centre, Makurdi, Benue State, Nigeria.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTable 3 describes the variables of the pregnant women attending the antenatal clinic in Federal Medical Centre, Makurdi, Benue State, Nigeria. \u0026nbsp;Participants living in urban areas were 286 (93.7%), while those in rural areas were 19 (6.2%). Pregnant women who had \u0026le; 20 years were 6 (1.9%), while those having 21-30 years were 235 (77.0%). Pregnant women with primary education were 9(2.9%), while those with tertiary education were 158 (51.8%). Traders were 145 (47.5%), while students were 50 (16.4%). Married pregnant women were 283 (92.7%) and non-married were 22 (7.2%). Pregnant women in the first trimester were 51 (16.7%), while those in the third trimester were 158 (51.8%). The primiparous pregnant women were 114(37.3%), while the multiparous were 65 (21.3%).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMalaria infection in relation to socio-demographic, gestational, parity, intermittent preventive therapy, and drainage of the environment around houses of pregnant women attending antenatal clinic at Federal Medical Centre, Makurdi, Benue State, Nigeria.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTable 4 shows malaria infection in relation to socio-demographic, gestational, and parity of pregnant women attending the antenatal clinic at Federal Medical Centre, Makurdi, Benue State, Nigeria. An infection of 11 (3.6%) was reported among the pregnant women. Those who had secondary education significantly had higher malaria infection, 6 (8.2%) (\u0026chi;\u003csup\u003e2\u003c/sup\u003e\u003csub\u003e=\u003c/sub\u003e14.49, p=0.012), as well as those who were in the second trimester, 7 (7.3%) (\u0026chi;\u003csup\u003e2\u003c/sup\u003e\u003csub\u003e=\u003c/sub\u003e15.47, \u003cem\u003ep=0.035\u003c/em\u003e). \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePredictors of malaria infection among pregnant women attending antenatal clinic at Federal Medical Centre, Makurdi, Benue State, Nigeria.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe predictors of malaria among pregnant women attending the antenatal clinic at Federal Medical Centre, Makurdi, Benue State, Nigeria are shown in Table 5. The age groups \u0026le; 20 years and 21-30 years exposed pregnant women to malaria infection with crude odds ratios (cOR) of 1.17 (95%CI: 0.55 - 5.38; \u003cem\u003ep=0.000\u003c/em\u003e) and 2.67 (95%CI: 1.90-6.18; \u003cem\u003ep=0.000\u003c/em\u003e) respectively. The educational status and gestational age showed that pregnant women with secondary education had a cOR of 5.40 (95%CI:2.23-40.76; p=0.000) and those in the second trimester had 0.23 (95%CI:0.04-1.17; \u003cem\u003ep=0.043\u003c/em\u003e) respectively. Pregnant women who did not have drainage around their premises had a cOR of 6.62 (95%CI: 1.25-40.65; \u003cem\u003ep=0.000\u003c/em\u003e), as well as those who had stagnant water around their premises with cOR=7.24 (95%CI: 1.29 - 66.55; \u003cem\u003ep=0.001\u003c/em\u003e).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eGenetic diversity of \u003cem\u003ePlasmodium falciparum\u003c/em\u003e Merozoites Surface Protein-1 (MSP-1) and Merozoite Surface Protein-2 (MSP-2) and the allelic families in pregnant women attending the antenatal clinic of Federal Medical Centre, Makurdi, Benue State, Nigeria.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe nested PCR indicated that \u003cem\u003ePlasmodium falciparum\u003c/em\u003e was the only species found with MSP-1 and MSP-2 families during amplification. MSP-1 had two (2) allelic families and was classified as K1 with 100 bp (18.2%, 2/11), 250 bp (9.1%, 1/11), and 275 bp (9.1%, 1/11), and MAD with 200 bp (9.1%, 1/11) (Figure 2). MSP-2 had two (2) allelic families and classified as FC 27 with 320 bp (9.1%, 1/11) and 350 bp (18.2%, 2/11), and 3D7 with 430 bp (9.1%, 1/11), 450 bp (27.3%, 3/11) and 510 bp (36.4%, 4/11) (Figure 3).\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn sub-Saharan Africa, pregnant women are usually vulnerable to malaria which has consequential issues on their immune systems and foetuses. This study reassessed malaria in pregnancy a decade after a first assessment [14]. The low malaria infection observed was an application and implementation of the preventive and control measures by the pregnant women in the areas. Such measures were implemented by the Federal Government of Nigeria around 2010 after the recommendations of the preventive and control program in pregnancy by the World Health Organization policies [19]. \u0026nbsp;The application of such rules reduced the high rate of morbidities and deaths among infected pregnant women in Benue State, Nigeria. The reduced infection level has also been reported in other areas in Nigeria such as Lagos State [20] and Bauchi State [21]. This low level of infection among pregnant women was the effective use of the long-lasting treated nets against mosquito bites. They were also instructed to adhere to the use of Sulfadoxine-Pyrimethamine (SP) in pregnancy as recommended by the World Health Organization [22].\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe high infection at the second trimester could be due to the \u003cem\u003ePlasmodium\u003c/em\u003e sp immune disorders at various pregnancy stages. \u003cem\u003ePlasmodium\u003c/em\u003e sp has been known for the sequestration of the immune system by inducing an inflammatory response, as well as a lack of optimal placental function, and a reduction in foetal nutrient transportation [23]. The malaria-infected pregnant women in the second trimester are also affected by the complications caused by the cytokines. It is also known that malaria in pregnancy promotes the expression of IL-1\u0026beta;, IL-2, IL-8, IFN-\u0026gamma;, TNF-\u0026alpha;, and TGF-\u0026beta; [24, 25]. The findings of other previous studies reported high malaria infection in the second trimester of pregnancy in Nigeria and other West African countries [26, 27].\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe residency of pregnant women around the swampy environment was also displayed during the focus group interactions. This might also be a result of \u003cem\u003ePlasmodium falciparum\u003c/em\u003e resistance of the immune system to the antimalarial drug given. The negligence of pregnant women towards the use of the intermittent preventive treatment nets could be another cause of the infection. Such issues have been reported in Uganda [28]. It could also be that the pregnant women were not complying with the prescription of the drugs [29].\u003c/p\u003e\n\u003cp\u003eThe pregnant women of the age groups \u0026le; 20 years and 21-30 years, and those with a secondary level of education were predicted to be more exposed to malaria infection. It could be the ignorant attitude of those pregnant women towards the wearing of protective clothes against mosquito\u0026apos; bites. They are usually involved in farming vegetable crops along the agricultural riverine sites of the River Benue. The young women within those age groups may lack the awareness of using preventive measures against malaria at the onset of pregnancy. It may be that at that level there might be an immune suppression, or loss of acquired immunity to malaria [30].\u003c/p\u003e\n\u003cp\u003eThe absence of fluent drainage and the presence of stagnant water were predicted as breeding sites of mosquitoes. The drainages were not well evacuated as people dump their refuse thereby allowing very good breeding sites for Anopheles. It is pertinent to note that mosquitoes breed freely in such gutters and drainages as observed in Nigeria [31] and Ghana [32].\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn this study, the molecular characterization found only \u003cem\u003ePlasmodium falciparum\u0026nbsp;\u003c/em\u003eamong the pregnant women in Makurdi metropolis, Benue State, Nigeria. The polymerase chain reaction (PCR) was highly sensitive and consistent in the detection of\u0026nbsp;\u003cem\u003ePlasmodium falciparum\u003c/em\u003e.\u0026nbsp;Previous\u0026nbsp;studies found that \u003cem\u003eP. falciparum\u003c/em\u003e was the predominant strain for individuals in Nigeria [10,33], and sub-Saharan Africa [34, 35]. \u003cem\u003eP. falciparum\u003c/em\u003e isolates showed genetic diversity in this study with highly polymorphic markers such as the merozoites\u0026rsquo; surface protein-1 (\u003cem\u003eMSP\u003c/em\u003e-1) and merozoites\u0026rsquo; surface protein-2 (\u003cem\u003eMSP\u003c/em\u003e-2). The amplification of MSP-1 found K1 and MAD20 families, while MSP-2 found FC27 and 3D7 at different frequencies. This effect could be the challenges to the resistance of the parasite, and complexity to the treatment among the pregnant women on\u0026nbsp;Sulfadoxine-Pyrimethamine. A previous study reported such issues of various polymorphic markers of \u003cem\u003ePlasmodium falciparum\u003c/em\u003e [8, 11, 32].\u003c/p\u003e\n\u003cp\u003eThe unprompted and unenthusiastic action for the blood preservation during packaging for evacuation to the molecular laboratory was a limitation to the study. \u0026nbsp;\u0026nbsp;\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eA low malaria infection was found among the pregnant women attending the antenatal clinic of the Federal Medical Centre, Makurdi, Benue State, Nigeria. The age groups \u0026le; 20 and 21-30 years, secondary school education, second trimester, provision of drainage, and presence of stagnant water were the risk factors for malaria infection among the pregnant women in Makurdi, Benue State, Nigeria. The nested PCR indicated that pregnant women were infected with only \u003cem\u003ePlasmodium falciparum\u003c/em\u003e.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eTwo distinct Merozoite Surface Proteins \u003cem\u003eMSP-1\u0026nbsp;\u003c/em\u003ewith\u003cem\u003e\u0026nbsp;K1\u0026nbsp;\u003c/em\u003eand \u003cem\u003eMAD20\u0026nbsp;\u003c/em\u003eclones,\u003cem\u003e\u0026nbsp;\u003c/em\u003eand\u003cem\u003e\u0026nbsp;MSP-2\u0026nbsp;\u003c/em\u003ewith FC27 and 3D7 clones were observed. \u0026nbsp;It was recommended that there should be more enlightenment and application on keeping the drainage clean, clearing of bushes around the houses, and wearing protective clothing especially at night against mosquito bites. Pregnant women should be encouraged to comply with the laid-down strategies of the malaria control programs as it has been observed in this study that non-compliance was the reason why some of the pregnant women were infected with malaria.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cdiv class=\"DefinitionList\"\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003e\u003cb\u003e- PCR\u003c/b\u003e\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003ePolymerase Chain Reaction\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003e\u003cb\u003e- MSP-1\u003c/b\u003e\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eMerozoite Surface Proteins-1\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003e\u003cb\u003e- MSP-2\u003c/b\u003e\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eMerozoite Surface Proteins-2\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003e\u003cb\u003e- GLURP\u003c/b\u003e\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eGlutamate-rich Protein\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003e\u003cb\u003e- LGA\u003c/b\u003e\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eLocal Government Area\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003e\u003cb\u003e- FMC\u003c/b\u003e\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eFederal Medical Centre\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003e\u003cb\u003e- WMA\u003c/b\u003e\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eWorld Medical Association\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003e\u003cb\u003e- DBS\u003c/b\u003e\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eDried Blood Spots\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003e\u003cb\u003e- DNA\u003c/b\u003e\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eDeoxyribonucleic acid\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003e\u003cb\u003e- SPSS\u003c/b\u003e\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eStatistical Package for the Social Sciences\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003e\u003cb\u003e- CI\u003c/b\u003e\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eConfidence Interval\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003e\u003cb\u003e- cOR\u003c/b\u003e\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003ecrude Odd Ratio\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003e\u003cb\u003e- SP\u003c/b\u003e\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eSulfadoxine-Pyrimethamine\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003e\u003cb\u003e- IL\u003c/b\u003e\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eInterleukins\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003e\u003cb\u003e- IFN\u003c/b\u003e\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eInterferons\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003e\u003cb\u003e- TGF\u003c/b\u003e\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eTransforming Growth Factor\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthical approval\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors have consented to publish this manuscript with BMC Infectious Diseases\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and material\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eData will be available if needed.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThere is no competing interest in this research\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research did not receive any grant to support this research\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConceptualization, data curation, and design of the study:\u0026nbsp;\u003c/strong\u003eAEU, KSL, HRS, SCIA \u003cstrong\u003eLaboratory work, Data curation, and Literature review:\u003c/strong\u003e SCIA, AVY, WBE, DB, EES; \u003cstrong\u003eStatistical analysis\u003c/strong\u003e:\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eHRS\u003cstrong\u003e;\u003c/strong\u003e \u003cstrong\u003eData curation and write-up of the manuscript:\u0026nbsp;\u003c/strong\u003eSMC, HRS;\u003cstrong\u003e\u0026nbsp;Review\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eand editing of the manuscript:\u003c/strong\u003e AEU, KSL, HRS, SMC, AVY, WBE, DB, EES, SCIA.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe research team remains grateful to the ethical committee of the Federal Medical Centre, Makurdi, Benue State, Nigeria for the approval of the research (FMH/FMC/MED.108/VOL.I/X). The Director of the Federal Medical Centre, Makurdi, Benue State, and the Head of the Department of Laboratory Services are gratefully acknowledged. The research team is grateful to all the pregnant women who participated in this study. We remain grateful to Prof. F.T., Ikpa for his efforts during the molecular analysis. All the midwives and nurses who assisted during sample collection, focus group discussion, and questionnaire interviews are gratefully acknowledged.\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eWorld Malaria Report. Addressing inequity in the global malaria response. Geneva: World Health Organization 2024. Licence: CC BY-NC-SA 3.0 IGO.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWorld Health Organization (WHO). Geneva: World Health Organization 2023. Licence: CC BY-NC-SA 3.0 IGO.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eValentina R, Daniel JW, Jennifer R, et al. Global estimates of the number of pregnancies at risk of malaria from 2007 to 2020: A demographic study. Lancet Glob Hlth. 2023;11:e40\u0026ndash;47.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBakken L, Iversen PO. The impact of malaria during pregnancy on low birth weight in East-Africa: a topical review. Malar J. 2021;20:348. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s12936-021-03883-z\u003c/span\u003e\u003cspan address=\"10.1186/s12936-021-03883-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWorld Health Statistics. Monitoring health for the SDGs, sustainable development goals. Geneva: World Health Organization 2018. Licence: CC BY-NC-SA 3.0 IGO.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRoll Back Malaria (RBM). Partnership To End Malaria Annual Report 2018. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://endmalaria.org/sites/default/files/RBM%20Annual%20Report%2020 EN.pdf\u003c/span\u003e\u003cspan address=\"https://endmalaria.org/sites/default/files/RBM%20Annual%20Report%2020 EN.pdf\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTegegne B, Getie S, Lemma W, et al. Performance of loop-mediate isothermal amplification (LAMP) for the diagnosis of malaria among malaria suspected pregnant women in Northwest Ethiopia. Malar J. 2017;16(1):34. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s12936-017-1692-4\u003c/span\u003e\u003cspan address=\"10.1186/s12936-017-1692-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAlruwaili M, Elderdery AY, Ejaz H, et al. Genotyping and characterizing \u003cem\u003ePlasmodium falciparum\u003c/em\u003e to reveal genetic diversity and multiplicity of Infection by merozoite surface proteins 1 and 2 (msp-1 and msp-2) and Glutamate-Rich Protein (glurp) genes. Trop Med Infect Dis. 2024;9:284. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/tropicalmed9110284\u003c/span\u003e\u003cspan address=\"10.3390/tropicalmed9110284\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAdedolapo BO, Damilola EO, Ure CM, et al. Genetic diversity of \u003cem\u003ePlasmodium falciparum\u003c/em\u003e in people living with HIV in Ogbomoso, Nigeria: Implications for malaria transmission and treatment. Mal World J. 2025;16(8):1\u0026ndash;1. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.5281/zenodo.15175103\u003c/span\u003e\u003cspan address=\"10.5281/zenodo.15175103\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eV\u0026otilde; TC, L\u0026ecirc; HG, Kang JM, et al. Genetic polymorphism of merozoite surface protein 1 and merozoite surface protein 2 in the Vietnam \u003cem\u003ePlasmodium falciparum\u003c/em\u003e population. BMC Infect Dis. 2024;24:1216. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s12879-024-10116-6\u003c/span\u003e\u003cspan address=\"10.1186/s12879-024-10116-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAkoniyon OP, Akibinu M, Adeleke MA et al. Comparative study of genetic diversity and multiplicity of infection in uncomplicated \u003cem\u003ePlasmodium falciparum\u003c/em\u003e infections in selected regions of pre-elimination and high transmission settings using \u003cem\u003eMSP1\u003c/em\u003e and \u003cem\u003eMSP 2\u003c/em\u003e Genes. Pathog. 2024;13(2):172. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/pathogens13020172\u003c/span\u003e\u003cspan address=\"10.3390/pathogens13020172\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBaina MT, Lissom AA, Doulamo NV et al. Comparative study of \u003cem\u003ePlasmodium falciparum msp-1\u003c/em\u003e and \u003cem\u003emsp-2\u003c/em\u003e genetic diversity in isolates from rural and urban areas in the south of Brazzaville, Republic of Congo. Pathog. 2023;12(5):742. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/pathogens12050742\u003c/span\u003e\u003cspan address=\"10.3390/pathogens12050742\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHoumsou RS, Amuta EU, Sar TT, et al. Malaria infection in pregnant women attending antenantal clinics in Gboko, Benue State, Nigeria. Int\u0026rsquo;l J Acad Res. 2010;2:33\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAmuta E, Houmsou R, Wama E, et al. Malarial infection among antenatal and maternity clinics attendees at the Federal Medical Centre, Makurdi, Benue State, Nigeria. Infect Dis Rep. 2014;6(1):5050. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.4081/idr.2014.5050\u003c/span\u003e\u003cspan address=\"10.4081/idr.2014.5050\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWorld Health Statistics. Monitoring health for the sustainable development goals (SDGs). World Health Organization, Geneva. World Health Organization. 2024. 9789240094703. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://iris.who.int/handle/10665/376869\u003c/span\u003e\u003cspan address=\"https://iris.who.int/handle/10665/376869\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKramer MS. Clinical epidemiology and biostatistics. First ed. Berlin: Springer; 1988. p. 157.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCheesbrough M. (2010) District Laboratory Practice in Tropical Countries. 2nd Edition, Cambridge University Press, Cambridge, United Kingdom.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSnounou G, Balbir S. Nested PCR analysis of \u003cem\u003ePlasmodium\u003c/em\u003e parasites. Meth Mol Med. 2002;72:189\u0026ndash;203.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWorld Health Organization (WHO). WHO recommendations on antenatal care for a positive pregnancy experience: summary. Geneva, Switzerland: WHO 2018. Licence: CC BY-NC-SA 3.0 IGO.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eOluwagbemiga A, Bamidele A, Babatunde A, et al. Prevalence of malaria in pregnant women attending antenatal clinic in primary health centres in Lagos, southwest, Nigeria. J Adv Med Med Res. 2018;25(12):1\u0026ndash;9. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.9734/JAMMR/2018/39620\u003c/span\u003e\u003cspan address=\"10.9734/JAMMR/2018/39620\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKadas AS, Okon KO, Alkali M, et al. Low prevalence of asymptomatic malaria in Pregnancy among subjects attending antenatal clinic at a tertiary hospital in Bauchi, Nigeria: A preliminary report. J Adv Med Med Res. 2019;29:1\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWorld Health Organization. WHO policy brief for the implementation of intermittent preventive treatment of malaria in pregnancy using sulfadoxine pyrimethamine (IPTp-SP).WHO/HTM/GMP/2014.4 World Health Organization 2014. All rights reserved.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eOmer FM, Kurtzhals JAL, Riley EM. Maintaining the immunological balance in parasitic infections: A Role for TGF-β? Parasitol Today. 2000;16(1):18\u0026ndash;23. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/S0169-4758(99)01562-8\u003c/span\u003e\u003cspan address=\"10.1016/S0169-4758(99)01562-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eS\u0026aacute;nchez KE, Spencer LM. Pregnancy-associated malaria: Effects of cytokine and chemokine expression. Trav Med Inf Dis. 2022;47:102282. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.tmaid.2022.102282\u003c/span\u003e\u003cspan address=\"10.1016/j.tmaid.2022.102282\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eThe Lancet null. Miscarriage: worldwide reform of care is needed. Lancet. 2021;397(21):1597. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/S0140-6736\u003c/span\u003e\u003cspan address=\"10.1016/S0140-6736\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAli R, North-Eastern. Nigeria J Appl Sci Environ Mgt. 2022;26(6):1063\u0026ndash;6. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://dx.doi.org/10.4314/jasem.v26i6.10\u003c/span\u003e\u003cspan address=\"10.4314/jasem.v26i6.10\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eIsha B, Walker P, Tagbor H, et al. Seasonal dynamics of malaria in pregnancy in west Africa: evidence for carriage of infections acquired before pregnancy until first contact with antenatal care. Am J Trop Med Hyg. 2018;98(2):534\u0026ndash;42. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.4269/ajtmh.17-0620\u003c/span\u003e\u003cspan address=\"10.4269/ajtmh.17-0620\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMbonye AK, Bygbjerg I, Magnussen P. Intermittent preventive treatment of malaria in pregnancy: Evaluation of a new delivery approach and the policy implications for malaria control in Uganda. Hlth Policy. 2007;81:228\u0026ndash;41.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGrietens KP, Gies S, Coulibaly SO, et al. Bottlenecks for high coverage of intermittent preventive treatment in pregnancy: The case of adolescent pregnancies in rural Burkina Faso. PLoS ONE. 2010;5:e12013.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWogu M. Prevalence of malaria parasite infection among pregnant women attending antenatal clinics in Port Harcourt, Rivers State, Nigeria. Intl J Trop Dis Hlth. 2014;3:126\u0026ndash;32. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.9734/IJTDH/2013/2738\u003c/span\u003e\u003cspan address=\"10.9734/IJTDH/2013/2738\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAbu BE, Amankwah OP, Adjei KE, et al. Factors associated with malaria in pregnancy among women attending ANC clinics in selected districts of the Ashanti Region, Ghana. Malar J. 2025;24(8). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s12936-025-05244-6\u003c/span\u003e\u003cspan address=\"10.1186/s12936-025-05244-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eOpute AO, Akinkunmi JA, Funsho AO, et al. Genetic diversity of \u003cem\u003ePlasmodium falciparum\u003c/em\u003e isolates in Nigeria. A review. Egypt J Med Hum Gen. 2022;23:129. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s43042-022-00340-7\u003c/span\u003e\u003cspan address=\"10.1186/s43042-022-00340-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNundu SS, Culleton R, Simpson SV, et al. Malaria parasite species composition of \u003cem\u003ePlasmodium\u003c/em\u003e infections among asymptomatic and symptomatic school-age children in rural and urban areas of Kinshasa, Democratic Republic of Congo. Malar J. 2021;20(1):389. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s12936-021-03919-4\u003c/span\u003e\u003cspan address=\"10.1186/s12936-021-03919-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDao F, Dembele L, Diarra B, et al. The Prevalence of Human \u003cem\u003ePlasmodium\u003c/em\u003e Species during Peak Transmission Seasons from 2016 to 2021 in the rural commune of Ntjiba, Mali. Trop Med Infect Dis. 2023;8:438. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/tropicalmed8090438\u003c/span\u003e\u003cspan address=\"10.3390/tropicalmed8090438\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eW\u0026aring;ngdahl A, Bogale RT, Eliasson I, et al. Malaria parasite prevalence in sub- Saharan African migrants screened in Sweden: a cross-sectional study. Lancet Regl Hlth Eur. 2023;27:100581. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.lanepe.2022.100581\u003c/span\u003e\u003cspan address=\"10.1016/j.lanepe.2022.100581\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003eTable 1: Primary and secondary primers for \u003cem\u003ePlasmodium\u003c/em\u003e species\u0026nbsp;\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003e\u003cstrong\u003ePCR round\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 107px;\"\u003e\n \u003cp\u003e\u003cstrong\u003ePrimers\u0026rsquo; names\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 396px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eSequences (5\u0026rsquo;-3\u0026rsquo;)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 201px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eAmplicon size (basepair)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 136px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eSpecies\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003e\u003cstrong\u003ePrimary reaction\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 107px;\"\u003e\n \u003cp\u003erPLU1\u003c/p\u003e\n \u003cp\u003erPLU5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 396px;\"\u003e\n \u003cp\u003eTCAAAGATTAAGCCATGCAAGTGA\u003c/p\u003e\n \u003cp\u003eCCTGTTGTTGCCTTAAACTCC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 201px;\"\u003e\n \u003cp\u003e1.6-1.7 kb\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 136px;\"\u003e\n \u003cp\u003e\u003cem\u003ePlasmodium\u003c/em\u003e sp\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eSecondary reaction\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e(Nested PCR)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 107px;\"\u003e\n \u003cp\u003erFAL1\u003c/p\u003e\n \u003cp\u003erFAL2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 396px;\"\u003e\n \u003cp\u003eTTAAACTGGTTTGGGAAAACCAAATATATT\u003c/p\u003e\n \u003cp\u003eACACAATGAACTCAATCATGACTACCCGTC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 201px;\"\u003e\n \u003cp\u003e\u0026nbsp;206 bp\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 136px;\"\u003e\n \u003cp\u003e\u003cem\u003eP. falciparum\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 107px;\"\u003e\n \u003cp\u003erOVA1\u003c/p\u003e\n \u003cp\u003erOVA2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 396px;\"\u003e\n \u003cp\u003eATCTCTTTTGCTATTTTTTAG TATTGGAGA\u003c/p\u003e\n \u003cp\u003eGGAAAAGGACACATTAATTGT ATCCTAGTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 201px;\"\u003e\n \u003cp\u003e\u0026nbsp; 800 bp\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 136px;\"\u003e\n \u003cp\u003e\u003cem\u003eP. ovale\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 107px;\"\u003e\n \u003cp\u003erMAL1\u003c/p\u003e\n \u003cp\u003erMAL2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 396px;\"\u003e\n \u003cp\u003eATAACATAGTTGTACGTTAAG AATAACCGC\u003c/p\u003e\n \u003cp\u003eAAAATTCCCATGCATAAAAAA TTATACAAA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 201px;\"\u003e\n \u003cp\u003e\u0026nbsp; 144 bp\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 136px;\"\u003e\n \u003cp\u003e\u003cem\u003eP. malariae\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 107px;\"\u003e\n \u003cp\u003erVIV1\u003c/p\u003e\n \u003cp\u003erVIV2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 396px;\"\u003e\n \u003cp\u003eCGCTTCTAGCTTAATCCACAT AACTGATAC\u003c/p\u003e\n \u003cp\u003eACTTCCAAGCCGAAGCAAAGA AAGTCCTTA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 201px;\"\u003e\n \u003cp\u003e\u0026nbsp;120 bp\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 136px;\"\u003e\n \u003cp\u003e\u003cem\u003eP. vivax\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTable 2: Sequences of primers for MSP-1 and MSP-2 and allelic family\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 75px;\"\u003e\n \u003cp\u003eGenotype\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 95px;\"\u003e\n \u003cp\u003ePCR round\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003ePrimers names\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 510px;\"\u003e\n \u003cp\u003eSequence (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 136px;\"\u003e\n \u003cp\u003eAllelic families\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 75px;\"\u003e\n \u003cp\u003eMSP-1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 95px;\"\u003e\n \u003cp\u003ePrimary\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003eM1-OF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 510px;\"\u003e\n \u003cp\u003eCTAGAAGCTTTAGAAGATGCAGTATTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 136px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 75px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 95px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003eM1-OR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 510px;\"\u003e\n \u003cp\u003eCTTAAATAGTATTCTAATTCAAGTGGATCA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 136px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 75px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 95px;\"\u003e\n \u003cp\u003eSecondary\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003eM1-KF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 510px;\"\u003e\n \u003cp\u003eAAATGAAGAAGAAATTACTACAAAAGGTGC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 136px;\"\u003e\n \u003cp\u003eK1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 75px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 95px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003eM1-KR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 510px;\"\u003e\n \u003cp\u003eGCTTGCATCAGCTGGAGGGCTTGCACCAGA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 136px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 75px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 95px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003eM1-MF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 510px;\"\u003e\n \u003cp\u003eAAATGAAGGAACAAGTGGAACAGCTGTTAC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 136px;\"\u003e\n \u003cp\u003eMAD 20\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 75px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 95px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003eM1-MR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 510px;\"\u003e\n \u003cp\u003eATCTGAAGGATTTGTACGTCTTGAATTACC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 136px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 75px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 95px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003eM1-RF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 510px;\"\u003e\n \u003cp\u003eTAAAGGATGGAGCAAATACTCAAGTTGTTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 136px;\"\u003e\n \u003cp\u003eRO33\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 75px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 95px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003eM1-RR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 510px;\"\u003e\n \u003cp\u003eCATCTGAAGGATTTGCAGCACCTGGAGATC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 136px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 75px;\"\u003e\n \u003cp\u003eMSP-2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 95px;\"\u003e\n \u003cp\u003ePrimary\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003eM2-OF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 510px;\"\u003e\n \u003cp\u003eATGAAGGTAATTAAAACATTGTCTATTATA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 136px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 75px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 95px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003eM2-OR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 510px;\"\u003e\n \u003cp\u003eCTTTGTTACCATCGGTACATTCTT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 136px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 75px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 95px;\"\u003e\n \u003cp\u003eSecondary\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003eM2-FCF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 510px;\"\u003e\n \u003cp\u003eAATACTAAGAGTGTAGGTGCARATGCTCCA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 136px;\"\u003e\n \u003cp\u003eFC27\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 75px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 95px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003eM2-FCR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 510px;\"\u003e\n \u003cp\u003eTTTTATTTGGTGCATTGCCAGAACTTGAAC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 136px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 75px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 95px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003eM2-ICF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 510px;\"\u003e\n \u003cp\u003eAGAAGTATGGCAGAAAGTAACCTYCTACT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 136px;\"\u003e\n \u003cp\u003e3D7\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 75px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 95px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003eM2-ICR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 510px;\"\u003e\n \u003cp\u003eGATTGTAATTCGGGGGATTCAGTTTGTTCG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 136px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTable 3: Description of socio-demographic, gestational stage and parity of pregnant women attending an antenatal clinic in Federal Medical Centre, Makurdi, Benue \u0026nbsp;State, Nigeria.\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"568\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 284px;\"\u003e\n \u003cp\u003eVariables\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 284px;\"\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; Number (N=305), n (%)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 284px;\"\u003e\n \u003cp\u003eInfection\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 284px;\"\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;11 ( \u0026nbsp; 3.6)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 284px;\"\u003e\n \u003cp\u003eLocation\u003c/p\u003e\n \u003cul\u003e\n \u003cli\u003eUrban\u003c/li\u003e\n \u003cli\u003eRural\u003c/li\u003e\n \u003c/ul\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 284px;\"\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;286 (93.7)\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;19 ( 6.2)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 284px;\"\u003e\n \u003cp\u003eAge (years)\u003c/p\u003e\n \u003cul\u003e\n \u003cli\u003e\u0026le; 20 \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;\u003c/li\u003e\n \u003cli\u003e21-30 \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;\u003c/li\u003e\n \u003cli\u003e31-40 \u0026nbsp; \u0026nbsp;\u0026nbsp;\u003c/li\u003e\n \u003cli\u003e41-50 \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;\u003c/li\u003e\n \u003c/ul\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 284px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; 6 ( 1.9)\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;235 (77.0)\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;63 (20.6)\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; 1 ( 0.3)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 284px;\"\u003e\n \u003cp\u003eEducation\u003c/p\u003e\n \u003cul\u003e\n \u003cli\u003ePrimary school\u003c/li\u003e\n \u003cli\u003eSecondary school\u003c/li\u003e\n \u003cli\u003eTertiary school\u003c/li\u003e\n \u003c/ul\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 284px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; 9 ( 2.9)\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;129 (42.3)\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;158 (51.8)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 284px;\"\u003e\n \u003cp\u003eOccupation\u003c/p\u003e\n \u003cul\u003e\n \u003cli\u003eStudent\u003c/li\u003e\n \u003cli\u003eBusiness\u003c/li\u003e\n \u003cli\u003eCivil servant\u003c/li\u003e\n \u003cli\u003eTrader\u003c/li\u003e\n \u003cli\u003eOthers\u003c/li\u003e\n \u003c/ul\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 284px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;50 (16.4)\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;130 (42.6)\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;37 (12.1)\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;15 ( 4.9)\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;73 (23.9)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 284px;\"\u003e\n \u003cp\u003eMarital status\u003c/p\u003e\n \u003cul\u003e\n \u003cli\u003eMarried\u003c/li\u003e\n \u003cli\u003eNon-married\u003c/li\u003e\n \u003c/ul\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 284px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;283 (92.7)\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;22 ( 7.2)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 284px;\"\u003e\n \u003cp\u003eGestational stage\u003c/p\u003e\n \u003cul\u003e\n \u003cli\u003eFirst trimester\u003c/li\u003e\n \u003cli\u003eSecond trimester\u003c/li\u003e\n \u003cli\u003eThird trimester\u003c/li\u003e\n \u003c/ul\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 284px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;51 (16.7)\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;96 (31.4)\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;158 (51.8)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 284px;\"\u003e\n \u003cp\u003eParity\u003c/p\u003e\n \u003cul\u003e\n \u003cli\u003ePrimiparous\u003c/li\u003e\n \u003cli\u003eSecundiparous\u003c/li\u003e\n \u003cli\u003eMultiparous\u003c/li\u003e\n \u003c/ul\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 284px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;114 (37.3)\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;126 (41.3)\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;65 (21.3)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTable 4: Malaria infection in relation to socio-demographic, gestational, and parity of \u0026nbsp;pregnant women attending antenatal clinic at Federal Medical Centre, \u0026nbsp;Makurdi, Benue State, Nigeria.\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"592\" style=\"margin-right: calc(2%); width: 98%;\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 255px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003eVariales\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 27.4672%;\"\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Malaria infection\u003c/p\u003e\n \u003cp\u003eNo. exam \u0026nbsp; \u0026nbsp; \u0026nbsp; Positive (%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 13.1364%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026chi;\u003csup\u003e2\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 19.574%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp;P-value\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 255px;\"\u003e\n \u003cp\u003eInfection\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 27.4672%;\"\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; 305 \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; 11 ( \u0026nbsp;3.6)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 13.1364%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 19.574%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 255px;\"\u003e\n \u003cp\u003eAge (years)\u003c/p\u003e\n \u003cul\u003e\n \u003cli\u003e\u0026le; 20\u003c/li\u003e\n \u003cli\u003e21-30\u003c/li\u003e\n \u003cli\u003e31-40\u003c/li\u003e\n \u003cli\u003e41-50\u003c/li\u003e\n \u003c/ul\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10.5434%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; 6\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; 235\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; 64\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; 1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 17.0286%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp;1 (16.9)\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp;6 ( 2.6)\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp;4 ( 6.3)\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp;0 ( 0.0)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 13.1363%;\"\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; 5.09\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 19.574%;\"\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp;0.165\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 255px;\"\u003e\n \u003cp\u003eEducation\u003c/p\u003e\n \u003cul\u003e\n \u003cli\u003ePrimary\u003c/li\u003e\n \u003cli\u003eSecondary\u003c/li\u003e\n \u003cli\u003eTertiary\u003c/li\u003e\n \u003c/ul\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10.5434%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; 9\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; 129\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; 158\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 17.0286%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; 0( 0.0)\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; 8(6.2)\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; 3(1.9)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 13.1363%;\"\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp;4.49\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 19.574%;\"\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp;0.212\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 255px;\"\u003e\n \u003cp\u003eOccupation\u003c/p\u003e\n \u003cul\u003e\n \u003cli\u003eStudent\u003c/li\u003e\n \u003cli\u003eBusiness\u003c/li\u003e\n \u003cli\u003eCivil servant\u003c/li\u003e\n \u003cli\u003eOthers\u003c/li\u003e\n \u003c/ul\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10.5434%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; 37\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; 130\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; 37\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; 73\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 17.0286%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; 3(6.0) \u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; 3(2.3)\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; 1(2.7) \u0026nbsp;\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; 3(4.1) \u0026nbsp; \u0026nbsp;\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 13.1363%;\"\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp;1.99\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 19.574%;\"\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp;0.736\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 255px;\"\u003e\n \u003cp\u003eMarital status\u003c/p\u003e\n \u003cul\u003e\n \u003cli\u003eMarried\u003c/li\u003e\n \u003cli\u003eUnmarried\u003c/li\u003e\n \u003c/ul\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10.5434%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; 283\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; 22\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 17.0286%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; 9(3.2)\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; 2(9.1)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 13.1363%;\"\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp;2.05\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 19.574%;\"\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp;0.152\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 255px;\"\u003e\n \u003cp\u003eGestational stage\u003c/p\u003e\n \u003cul\u003e\n \u003cli\u003eFirst trimester\u003c/li\u003e\n \u003cli\u003eSecond trimester\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eThird trimester\u0026nbsp;\u003c/li\u003e\n \u003c/ul\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10.5434%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;51\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;96\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp;158\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 17.0286%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; 1( 2.0)\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; 7(7.3)\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; 3(1.9)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 13.1363%;\"\u003e\n \u003cp\u003e15.47\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 19.574%;\"\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp;0.035\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 255px;\"\u003e\n \u003cp\u003eParity\u003c/p\u003e\n \u003cul\u003e\n \u003cli\u003ePrimiparous\u003c/li\u003e\n \u003cli\u003eSecundiparous\u003c/li\u003e\n \u003cli\u003eMultiparous\u003c/li\u003e\n \u003c/ul\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10.5434%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp;114\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp;126\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;65\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 17.0286%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; 5( 4.4)\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; 6( 4.8)\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; 0(0.0)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 13.1363%;\"\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; 3.11\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 19.574%;\"\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp;0.211\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eLLTINs = Long-Lasting Treated Insecticide Nets\u003c/p\u003e\n\u003cp\u003eFirst trimester: 1-3 months\u003c/p\u003e\n\u003cp\u003eSecond trimester: 4-6 months\u003c/p\u003e\n\u003cp\u003eThird trimester: 7-9 months\u003c/p\u003e\n\u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n\u003cp\u003eTable 5: Multinomial logistic regression analysis showing important predictors as socio-demographic, gestational, parity, intermittent preventive therapy and drainages around houses of pregnant women attending antenatal clinic at Federal Medical Centre, Makurdi, Benue State, Nigeria to malaria.\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"551\" style=\"margin-right: calc(2%); width: 98%;\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 48.5139%;\"\u003e\n \u003cp\u003eIndependent variables\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 35.7111%;\"\u003e\n \u003cp\u003ecrude OR (%95CI)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 85px;\"\u003e\n \u003cp\u003ep\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 48.5139%;\"\u003e\n \u003cp\u003eSocio-demographic\u003c/p\u003e\n \u003cp\u003eAge (years)\u003c/p\u003e\n \u003cp\u003e\u0026le; 20\u003c/p\u003e\n \u003cp\u003e21-30\u003c/p\u003e\n \u003cp\u003e31-40\u003c/p\u003e\n \u003cp\u003eEducation\u003c/p\u003e\n \u003cp\u003ePrimary\u003c/p\u003e\n \u003cp\u003eSecondary\u003c/p\u003e\n \u003cp\u003eTertiary\u003c/p\u003e\n \u003cp\u003eOccupation\u003c/p\u003e\n \u003cp\u003eStudent\u003c/p\u003e\n \u003cp\u003eBusiness\u003c/p\u003e\n \u003cp\u003eCivil servant\u003c/p\u003e\n \u003cp\u003eOthers\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 35.7111%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e1.17 (0.55 - 5.38)\u003c/p\u003e\n \u003cp\u003e2.67 (1.90 - 6.18)\u003c/p\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e4.32 (1.01 - 23.71)\u003c/p\u003e\n \u003cp\u003e5.40 (2.23 - 40.76)\u003c/p\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e0.98 (0.11 - 8.56)\u003c/p\u003e\n \u003cp\u003e1.86 (0.26 - 13.27)\u003c/p\u003e\n \u003cp\u003e0.71 (0.04 - 12.66)\u003c/p\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 85px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e0.000\u003c/p\u003e\n \u003cp\u003e0.000\u003c/p\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e0.101\u003c/p\u003e\n \u003cp\u003e0.003\u003c/p\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e0.990\u003c/p\u003e\n \u003cp\u003e0.533\u003c/p\u003e\n \u003cp\u003e0.814\u003c/p\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 48.5139%;\"\u003e\n \u003cp\u003eGestational stage\u003c/p\u003e\n \u003cp\u003eFirst trimester\u003c/p\u003e\n \u003cp\u003eSecond trimester\u003c/p\u003e\n \u003cp\u003eThird trimester\u003c/p\u003e\n \u003cp\u003eParity\u003c/p\u003e\n \u003cp\u003ePrimiparous\u003c/p\u003e\n \u003cp\u003eSecundiparous\u003c/p\u003e\n \u003cp\u003eMultiparous\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 35.7111%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e1.10 (0.08 - 14.66)\u003c/p\u003e\n \u003cp\u003e0.23 (0.04 - 1.17)\u003c/p\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e7.64 (2.31 - 57.12)\u003c/p\u003e\n \u003cp\u003e1.05 (0.19 - 4.67)\u003c/p\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 85px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e0.931\u003c/p\u003e\n \u003cp\u003e0.047\u003c/p\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e0.977\u003c/p\u003e\n \u003cp\u003e0.974\u003c/p\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 48.5139%;\"\u003e\n \u003cp\u003eIntermittent preventive therapy\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; No\u003c/p\u003e\n \u003cp\u003eYes\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 35.7111%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e0.25 (0.04 - 1.32)\u003c/p\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 85px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e0.413\u003c/p\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 48.5139%;\"\u003e\n \u003cp\u003eSanitation and hygiene around houses\u003c/p\u003e\n \u003cp\u003ewith provision of drainage or not\u003c/p\u003e\n \u003cp\u003eNo\u003c/p\u003e\n \u003cp\u003eYes\u003c/p\u003e\n \u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n \u003cp\u003ePresence of stagnant water around houses\u003c/p\u003e\n \u003cp\u003eYes\u003c/p\u003e\n \u003cp\u003eNo\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 35.7111%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e3.32 (0.08 - 6.77)\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e7.24 (1.29 - 66.55)\u003c/p\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 85px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e0.000\u003c/p\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e0.001\u003c/p\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e"},{"header":"Plates","content":"\u003cp\u003ePlate 1 to 6 are available in the Supplementary Files section.\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"speciation, Plasmodium sp, merozoites, implementation, prevention","lastPublishedDoi":"10.21203/rs.3.rs-7442925/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7442925/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eMalaria remains a serious public health threat to rural and urban inhabitants of tropical and subtropical poor communities. This study reassessed the malaria infection and its risk factors among pregnant women, and determined the speciation of the genus \u003cem\u003ePlasmodium\u003c/em\u003e. The laboratory used a thick and thin smear Giemsa-stained and nested Polymerase Chain Reaction techniques. The infection was 11 (3.6%). Pregnant women who attended secondary school significantly had higher infection, 6(8.2%) (χ\u003csup\u003e2\u003c/sup\u003e\u003csub\u003e=\u003c/sub\u003e14.49, p\u0026thinsp;=\u0026thinsp;0.012), as well as those in the second trimester, 7(7.3%) (χ\u003csup\u003e2\u003c/sup\u003e\u003csub\u003e=\u003c/sub\u003e15.47, p\u0026thinsp;=\u0026thinsp;0.035). The significant predictors of infection were the age groups\u0026thinsp;\u0026le;\u0026thinsp;20 years and 21\u0026ndash;30 years with crude odds ratios (cOR) of 1.17 (%95CI:0.55\u0026ndash;5.38; p\u0026thinsp;=\u0026thinsp;0.000), and 2.67 (%95CI:1.90\u0026ndash;6.18; p\u0026thinsp;=\u0026thinsp;0.000) respectively. Pregnant women with secondary education, and those in the second trimester respectively had significant cOR of 5.40 (%95CI:2.23\u0026ndash;40.76; p\u0026thinsp;=\u0026thinsp;0.000), and 0.23 (%95CI:0.04\u0026ndash;1.17; p\u0026thinsp;=\u0026thinsp;0.040). Pregnant women who did not have drainage around their premises had a cOR of 6.62 (%95CI:1.25\u0026ndash;40.65; p\u0026thinsp;=\u0026thinsp;0.000), as well as those who had stagnant water around premises with cOR\u0026thinsp;=\u0026thinsp;7.24 (%95CI:1.29\u0026ndash;66.55; p\u0026thinsp;=\u0026thinsp;0.001). The nested PCR found \u003cem\u003ePlasmodium falciparum\u003c/em\u003e with two distinct Merozoite Surface Proteins \u003cem\u003eMSP-1\u003c/em\u003e having \u003cem\u003eK1\u003c/em\u003e and \u003cem\u003eMAD20\u003c/em\u003e families, and \u003cem\u003eMSP-2\u003c/em\u003e having FC27 and 3D7 families. It was recommended that there should be more enlightenment on keeping the drainage clean, clearing of bushes around the environment, using long lasting insecticide treated nets and wearing protective clothing especially at night to protect oneself against mosquito bites.\u003c/p\u003e","manuscriptTitle":"Low Malaria Infection After a Decade of Effective Implementation of Preventive Measures and Speciation of Plasmodium SP Among Pregnant Women Attending an Antenatal Clinic in Benue State, Nigeria","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-09-01 07:11:33","doi":"10.21203/rs.3.rs-7442925/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"a742966b-b307-4c21-aa34-70acf340b240","owner":[],"postedDate":"September 1st, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-09-01T07:11:33+00:00","versionOfRecord":[],"versionCreatedAt":"2025-09-01 07:11:33","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7442925","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7442925","identity":"rs-7442925","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00
unpaywall
last seen: 2026-05-26T02:00:01.498150+00:00
License: CC-BY-NC-SA-4.0