Ginsenoside Rb1 inhibits oxidative stress and ferroptosis to alleviate salpingitis infertility by down-regulating PTGS2 and up-regulating GPX4.

OA: gold CC-BY-NC-ND-4.0
AI-generated summary by qwen3.7-flash, 2026-09-01

Ginsenoside Rb1 alleviates salpingitis infertility by down-regulating PTGS2 and up-regulating GPX4, thereby inhibiting oxidative stress and ferroptosis to improve reproductive outcomes in mouse models.

One-sentence paraphrase of the abstract; not a substitute for reading it. No clinical advice. How this works

AI-generated deep summary by qwen3.7-flash, 2026-08-24 · read from full text

This study investigated the therapeutic potential of ginsenoside Rb1 in treating salpingitis-induced infertility by examining its effects on oxidative stress and ferroptosis in a mouse model infected with Chlamydia trachomatis. The researchers found that Rb1 administration significantly improved pregnancy rates and litter sizes while reducing inflammation, oxidative damage, and cell death markers in fallopian tube tissues. Mechanistically, the treatment was shown to down-regulate PTGS2 expression and up-regulate GPX4, thereby inhibiting the ferroptosis pathway that contributes to tubal dysfunction. Relevance to endometriosis: PTGS2 is explicitly noted as elevated in ectopic endometrial stromal cells within the fallopian tube, linking the inflammatory mechanism studied here to endometriosis pathology, although the paper's primary focus remains salpingitis.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Abstract

BackgroundSalpingitis infertility (SI) is a common disease among women of childbearing age, referring secondary infertility caused by acute or chronic salpingitis. Ginsenoside Rb1 (Rb1) has been confirmed to be an effective drug agent SI. Nevertheless, the underlying mechanism by which Rb1 acts on SI remains unclear.MethodsFemale mice and FT194 cells were employed as experimental subjects to establish SI models. HE staining was performed to evaluate the morphology changes of fallopian tube tissues. ELISA assays were conducted to determine the levels of inflammatory factors. Commercial kits were performed to examine the contents of MDA, SOD and Fe2+. Western blot and IHC were used to determine protein levels. Cell viability and proliferation were assessed via CCK-8 and EdU assay, respectively.ResultsRb1 alleviated pathological lesions in fallopian tubal tissues, improved the pregnancy rate and litter size of SI mice and mitigated inflammation, oxidative stress and ferroptosis in both in vivo mouse and in vitro cell models of SI. In SI models, PTGS2 expression was upregulated while GPX4 expression was downregulated and these abnormal expression patterns were reversed by Rb1 treatment. PTGS2 knockdown inhibited ferroptosis and elevated the pregnancy rate and litter size of SI mice, whereas GPX4 knockdown abolished the above beneficial effects. Moreover, PTGS2 was found to downregulate GPX4 expression in SI models under Rb1 intervention.ConclusionRb1 treatment decreased PTGS2 expression and increased GPX4 expression, thereby enhancing cell viability and proliferation, alleviating oxidative stress and ferroptosis, and ultimately ameliorating SI.
Full text 36,940 characters · extracted from pmc-nxml · 10 sections · click to expand

Ethics

All animal experiments were approved by the Laboratory Animal Ethics Committee of Hunan University of Chinese Medicine (No. LL2023030806).

Funding

This study is supported by the Postgraduate Scientific Research Innovation Project of Hunan Province (No. CX20230814 ).

Methods

Female C57BL/6J mice (6-8 weeks old) were purchased form slack Jingda experimental animal Co., Ltd., (Changsha, China). Following one week of adaptive feeding, the mice were randomly divided into experimental groups. with 8 mice per each group. To investigate the effects of Rb1 (Shanghai Tauto Biotech Co, China) on SI, mice were assigned to five groups: Sham, SI, SI + low-dose Rb1, SI + medium-dose Rb1, SI + high-dose Rb1. To probe the role of ferroptosis in SI mice, mice were divided into Sham, SI, SI + Rb1, SI + Rb1 + erastin groups or alternatively into Sham, SI, SI + Ferrostatin-1 (Fer-1), SI + Fer-1+ Rb1 groups. To probe the role of the PTGS2/GPX4 axis in SI mice, mice were divided into Sham, SI + sh-NC, SI + sh-PTGS2+sh-NC, SI + sh-PTGS2+sh-GPX4 groups. The mouse SI model was established as previously reported [ 2 , 17 ]. Briefly, mice were anesthetized and intravaginally inoculated with 1 × 10 7 IFU of Chlamydia trachomatis . To mimic repeated infections and exacerbate infection-induced infertility, a secondary homologous challenge was performed 4-6 weeks after the primary infection, using the same inoculation procedure. After the infection cycle, female mice were co-housed with fertility male mice for mating. Female body weight was monitored daily for 21 consecutive days. Pregnancy was confirmed when body weight remained stably increased for three consecutive days. The pregnancy rate of female mice and average litter size in each group were statistically analyzed. Following Chlamydia trachomatis infection, mice were intraperitoneally administered low, medium and high doses of Rb1 (1, 10 and 20 mg kg −1 , respectively) for 2 w [ 18 , 19 ]. Mice were intraperitoneally injected with erastin (Selleck, USA) at 25 mg kg −1 or Fer-1 (Selleck, USA) at 4 mg kg −1 . Mice were intraperitoneally injected with 1 × 10 9  PFU adenovirus carrying sh-PTGS2 or sh-GPX4 (GenePharma, China), followed by SI model establishment and Rb1 intervention. Subsequently, samples were collected for subsequent experiments. All animal experiments were approved by the Laboratory Animal Ethics Committee of Hunan University of Chinese Medicine. FT194 cells (#CRL-3445, ATCC, USA) were grown in DMEM-F12 medium (Thermo Fisher Scientific) supplemented with 2% Ultroser G serum (PALL, France) and 1% penicillin/streptomycin. To establish the SI cell model, FT194 cells were stimulated with 10 μg/mL lipopolysaccharide (LPS) for 24 h. To investigate the effects of Rb1 on SI cells, FT194 cells were treated with 30 μM Rb1 according to a previous study [ 20 ]. FT194 cells were treated with Rb1 and LPS for 24 h. For cell transfection, sh-SGPX4, oe-PTGS2 and their corresponding control vectors (sh-NC, oe-NC) were purchased from GenePharma. FT194 cells were implanted onto 6-well plates overnight. Following the instructions, the above plasmids were transfected into FT194 cells using Lipofectamine™ 3000 (Invitrogen, USA). At 48 h post-transfection, the transfected FT194 cells were subjected to subsequent experiments. Supernatants of fallopian tube homogenates and FT194 cell cultures were collected. Following centrifugation, the levels of TNF-α, IL-6 and IL-1β were detected by correspondent kits purchased from Thermo Fisher Scientific (USA), in accordance with the manufacturer's instructions. Total RNA was extracted from mice tissues and FT194 cells using TRIzol reagent (Beyotime). Then, cDNA synthesis was performed using Script Reverse Transcription Reagent Kit (TaKaRa, Japan). Quantitative real-time PCR was then conducted using SYBR Premix Ex Taq (Takara) on an ABI Prism 7500 RT PCR system (Applied Biosystems, USA). The primer sequences were as follows. mPTGS2 (F): TGCAGAATTGAAAGCCCTCT; mPTGS2 (R): GCTCGGCTTCCAGTATTGAG. mGPX4 (F): CCGGCTACAACGTCAAGTTT; mGPX4 (R): ACGCAGCCGTTCTTATCAAT. mβ-actin (F): CCCAGCACAATGAAGATCAAGATCAT; mβ-actin (R): ATCTGCTGGAAGGTGGACAGCGA. hPTGS2 (F): TTCCTCCTGTGCCTGATGATT; hPTGS2 (R): AAACTGATGCGTGAAGTGCTG. hGPX4 (F): GTAACCAGTTCGGGAAGCAG; hGPX4 (R): TGTCGATGAGGAACTGTGGA. hβ-actin (F): CCCTGGAGAAGAGCTACGAG; hβ-actin (R): CGTACAGGTCTTTGCGGATG. mPTGS2 (F): TGCAGAATTGAAAGCCCTCT; mPTGS2 (R): GCTCGGCTTCCAGTATTGAG. mGPX4 (F): CCGGCTACAACGTCAAGTTT; mGPX4 (R): ACGCAGCCGTTCTTATCAAT. mβ-actin (F): CCCAGCACAATGAAGATCAAGATCAT; mβ-actin (R): ATCTGCTGGAAGGTGGACAGCGA. hPTGS2 (F): TTCCTCCTGTGCCTGATGATT; hPTGS2 (R): AAACTGATGCGTGAAGTGCTG. hGPX4 (F): GTAACCAGTTCGGGAAGCAG; hGPX4 (R): TGTCGATGAGGAACTGTGGA. hβ-actin (F): CCCTGGAGAAGAGCTACGAG; hβ-actin (R): CGTACAGGTCTTTGCGGATG. By means of 2 −ΔΔCt formula, The relative expression of genes was calculate based on reference gene β-actin. Total proteins were extracted from mouse fallopian tube tissues and FT194 cells using RIPA lysis buffer (Beyotime, China). Total proteins were extracted from mouse fallopian tube tissues and FT194 cells using SDS-PAGE. Next, the separated proteins were transferred onto PVDF membranes. After blocking by skimmed milk (5%), primary antibodies including anti-GPX4 (1:3000, PA5-18545, Thermo Fisher Scientific), anti-NOX1 (1:2000, PA5-103220, Thermo Fisher Scientific), anti-xCT (1:500, 711589, Thermo Fisher Scientific), ACSL4 (PA5-27137, 1:5000, Thermo Fisher Scientific), 4-HNE (A700-303, 1:1000, Thermo Fisher Scientific), PTGS2 (1:500, 35-8200, Thermo Fisher Scientific) and β-actin (1:10000, MA1-140, Thermo Fisher Scientific) were applied to incubate the PVDF membranes overnight at 4 °C and HRP-conjugated secondary antibody (Beyotime) was conducted to incubate the membranes for 1 h, ECL kit (Beyotime) was used to visualize the protein bands. The densitometry analysis was evaluated by using ImageJ. IHC was performed to determine GPX4 expression in mouse fallopian tube tissues. In short, fallopian tubes were embedded using 4% paraformaldehyde and paraffin. Around 5 μm sections were prepared. After repaired the antigen and soaked with 1% BSA for 20 min. The sections were incubated with primary antibody against GPX4 (Thermo Fisher Scientific) overnight at 4 °C, followed by incubation with HRP-labeled antibody. Subsequently, the sections were counterstained with diaminobenzidine (DAB). Finally, the images were observed under an optical microscope (Olympus, Japan). Mouse fallopian tube tissues were fixed using 4% paraformaldehyde and embedded in paraffin. Then, the samples were cut into 4 μm sections, dehydrated in ethanol, and stained with hematoxylin and eosin. The stained sections were pictured using an optical microscope with a camera (Olympus, Japan). Fallopian tubes were homogenized and FT194 cells were collected. After centrifugation, the supernatants were obtained and commercial kits relating to MDA, Fe 2+ and SOD were used for detecting MDA, Fe 2+ and SOD levels in fallopian tubes and FT194 cells following the instructions of kits. All commercial kits were purchased from Nanjing Jiancheng (China). For tissue ROS detection, fresh tissues were harvested, washed with ice-cold PBS, and sectioned into 5-μm frozen slices via a cryostat (Leica, Germany). For cellular ROS detection, cells were seeded in 24-well plates. Tissue sections and cells were subjected to incubation with 10 μmol/L DCFH-DA staining solution (Beyotime) at 37 °C for 20 min. After three consecutive washes with PBS to terminate the staining reaction, fluorescence signals were visualized under a fluorescence microscope. FT194 cells receiving indicated treatments were seeded in 96-well plates at a density of 5 × 10 3  cells/well and incubated for 24 h. Then, 10 μL CCK-8 reagent (Beyotime) was added to each well and incubated at 37 °C for 1 h. Finally, the absorbance was examined at a wavelength of 450 nm. BeyoClick™ EdU-488 cell proliferation test kit (Beyotime) was used to detect FT194 cell proliferation. In short, FT194 cells were incubated with 10 μM EdU solution for 2 h, and followed by fixation with formaldehyde and permeabilization with 0.5% Triton X-100. The cells were stained with Click reaction buffer. Afterwards, DAPI was used to counterstain cells. The stained FT194 cells were observed and photographed using a fluorescence microscope (Olympus, Japan). The percentage of EdU positive cells was quantified using Image J software. GraphPad Prism 9 was used for data analysis. All results were shown as the mean ± standard deviation (SD). One-way analysis of variance was adopted to determine statistical differences between groups. Differences were considered statistically significant at P < 0.05. All data were collected from three independent repeated experiments.

Results

To investigate the effects of Rb1 on SI, SI model mice were treated with low (L), medium (M) and high (H) doses of Rb1. As presented in Fig. 1 A, HE staining revealed severe pathological lesions in the fallopian tube tissues of SI model mice, including massive inflammatory cell infiltration, flattened and atrophic mucosal folds, luminal dilation, hydrosalpinx, and tissue looseness. Low dose Rb1 exerted only mild protective effects on tubal pathology, whereas medium- and high-doses Rb1 markedly improved tissue morphology. Specifically, the fallopian tube villous wall structure became distinct, the lumen became smooth, ciliary numbers were increased, and normal branch structures were restored. Besides, the levels of inflammatory factors including IL-6, IL-1β and TNF-α were evidently elevated in SI model mice, and these abnormal changes were abolished by medium- and high-doses Rb1 treatment ( Fig. 1 B). Regarding oxidative stress status, SI model mice exhibited increased MDA level and decreased SOD levels, whereas medium- and high-doses Rb1 partially restored these oxidative stress abnormalities ( Fig. 1 C). More importantly, the pregnancy rate and litter size were markedly lower in the SI model group compared with the sham group. Rb1 treatment dose-dependently improved reproductive outcomes, and medium and high doses produced particularly prominent protective effects ( Table 1 ). Taken together, Rb1 alleviated SI in mice by inhibiting inflammation and oxidative stress. Fig. 1 Rb1 improved pathological features, inhibited inflammation and oxidative stress in SI mice A mouse model of SI was established and SI mice were treated with low, medium and high doses of Rb1. (A) Fallopian tube morphology was evaluated using HE staining. (B) Inflammatory factor levels were detected using ELISA. (C) MDA and SOD levels were examined using commercial kits. ∗∗p < 0.01, ∗∗∗p < 0.001. Table 1 Pregnancy rate and litter size in each group. Table 1 Pregnancy rate (%) Litter size (n) P value (Litter size) vs sham vs SI sham 100 6.8 ± 0.84 SI 20 0.2 ± 0.45 0.0016 SI + Rb1 (L) 20 0.2 ± 0.45 >0.9999 SI + Rb1 (M) 60 4.6 ± 4.22 0.0454 SI + Rb1 (H) 80 4.6 ± 2.7 0.0454 Rb1 improved pathological features, inhibited inflammation and oxidative stress in SI mice A mouse model of SI was established and SI mice were treated with low, medium and high doses of Rb1. (A) Fallopian tube morphology was evaluated using HE staining. (B) Inflammatory factor levels were detected using ELISA. (C) MDA and SOD levels were examined using commercial kits. ∗∗p < 0.01, ∗∗∗p < 0.001. Pregnancy rate and litter size in each group. According to the results shown in Fig. 1 , medium dose of Rb1 was selected for subsequent experiments. To investigate the effects of Rb1 on ferroptosis in SI mice, SI mice were treated with Fer-1 (an inhibitor of ferroptosis) alone, Rb1 alone, Fer-1 plus Rb1, or erastin (an inducer of ferroptosis) plus Rb1. As shown in Fig. 2 A and Fig. S1A , both Fer-1 and Rb1 monotherapy ameliorated pathological lesions in SI mice. However, combined treatment with Fer-1 and Rb1 did not exert additional protective effects compared with Fer-1 alone. Conversely, co-administration of Rb1 and erastin abolished the ameliorative effect of Rb1 on tubal pathological tissues. Similarly, Fer-1 or Rb1 alone inhibited IL-6, IL-1β and TNF-α levels in SI mice, whereas their combination failed to produce superior efficacy relative to Fer-1 monotherapy. In contrast, erastin reversed the suppressive effect of Rb1 on these proinflammatory cytokines ( Fig. 2 B and Fig. S1B ). In addition, Fer-1 or Rb1 monotherapy decreased MDA levels and increased SOD levels in SI mice. Nevertheless, Fer-1/Rb1 combined treatment did not show more prominent improvements than Fer-1 monotherapy. Meanwhile, co-administration of Rb1 and erastin abrogated the regulatory effects of Rb1 on MDA and SOD levels ( Fig. 2 C and Fig. S1C ). In terms of ferroptosis-related molecules, SI mice exhibited markedly downregulated expression of GPX4 and xCT, alongside upregulated expression of NOX1, ACSL4 and 4-HNE. Notably, both Fer-1 and Rb1 treatment reversed these abnormal ferroptosis-associated molecular changes. However, Fer-1 and Rb1 combination did not exert stronger regulatory effects than Fer-1 monotherapy. Furthermore, erastin reversed Rb1-induced upregulation of GPX4 and xCT as well as Rb1-induced downregulation of NOX1, ACSL4 and 4-HNE ( Fig. 2 D–E and Fig. S1D ). Furthermore, Fe 2+ and ROS levels were elevated dramatically in SI mice. Fer-1 or Rb1 treatment effectively downregulated Fe 2+ and ROS levels, while their combination did not achieve better efficacy than Fer-1 monotherapy. Conversely, erastin abolished the inhibitory effect of Rb1 on SI-induced Fe 2+ and ROS overproduction ( Fig. 2 F–G and Fig. S1E–F ). Notably, Fer-1 or Rb1 treatment improved pregnancy rate and litter size in SI mice compared with the untreated SI model group. However, combined administration of Fer-1 and Rb1 did not yield better therapeutic outcomes than Fer-1 monotherapy. Besides, erastin abrogated the reproductive protective effects of Rb1 ( Table 2 , Table 4 ). Collectively, Rb1 alleviates SI in mice by suppressing ferroptosis. Fig. 2 Rb1 inhibited ferroptosis to alleviate SI development in mice SI mice were treated with Rb1 and erastin. (A) Fallopian tube morphology was evaluated using HE staining. (B) Inflammatory factor levels were detected using ELISA. (C) MDA and SOD levels were examined using commercial kits. (D) GPX4, NOX1, ACSL4, 4-HNE and xCT expression was measured using Western blot. (E) GPX4 expression was detected using IHC assay. (F) Fe 2+ level was examined using a commercial kit. (G) ROS levels were detected using a DCFH-DA fluorescence probe. ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001. Table 2 Pregnancy rate and litter size in each group. Table 2 Pregnancy rate (%) Litter size (n) P value (Litter size) vs sham vs SI vs SI + Rb1 sham 100 4.2 ± 0.84 SI 20 0.2 ± 0.45 0.0027 SI + Rb1 60 3 ± 2.74 0.0368 SI + Rb1+Erastin 20 0.2 ± 0.45 0.0368 Rb1 inhibited ferroptosis to alleviate SI development in mice SI mice were treated with Rb1 and erastin. (A) Fallopian tube morphology was evaluated using HE staining. (B) Inflammatory factor levels were detected using ELISA. (C) MDA and SOD levels were examined using commercial kits. (D) GPX4, NOX1, ACSL4, 4-HNE and xCT expression was measured using Western blot. (E) GPX4 expression was detected using IHC assay. (F) Fe 2+ level was examined using a commercial kit. (G) ROS levels were detected using a DCFH-DA fluorescence probe. ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001. Pregnancy rate and litter size in each group. GPX4 is a crucial regulator of ferroptosis [ 21 ]. Here, FT194 cells were employed to establish an in vitro SI cell model. In SI cell model, GPX4 expression was decreased and this abnormality was reversed by Rb1 treatment. However, Rb1-induced upregulation of GPX4 expression was offset by GPX4 knockdown ( Fig. 3 A). Compared with control cells, cell viability and proliferation were inhibited in SI model cells, which were restored by Rb1 intervention. However, GPX4 knockdown impaired the promotional effects of Rb1 on cell viability and proliferation ( Fig. 3 B–C). Consistent with the in vivo mouse results, inflammatory factor levels were largely upregulated in SI model cells, whereas Rb1 reversed these changes. As expected, GPX4 knockdown abolished the inhibitory effects of Rb1 on inflammatory factor secretion ( Fig. 3 D). Furthermore, SI model cells exhibited increased MDA, Fe 2+ and ROS levels and decreased SOD levels compared to control cells and these oxidative stress abnormalities were alleviated by Rb1. GPX4 knockdown further abrogated Rb1-induced reduction in MDA, Fe 2+ and ROS levels induced Rb1-induced upregulation of SOD activity ( Fig. 3 E–F). Collectively, Rb1 upregulated GPX4 expression to inhibit oxidative stress and ferroptosis in SI cell model. Fig. 3 Rb1 inhibited oxidative stress and ferroptosis in SI cell model by elevating GPX4 expression FT194 cells were transfected with sh-GPX4 prior to the establishment of the SI cell model and subsequently treated with Rb1. (A) GPX4 expression was detected by RT-qPCR and Western blot. (B) Cell viability was examined using CCK-8. (C) Cell proliferation was detected by EdU assay. (D) Inflammatory factor levels were detected using ELISA. (E) MDA and SOD levels were examined using commercial kits. (F) Fe 2+ level was examined using a commercial kit. (G) ROS levels were detected using a DCFH-DA fluorescence probe. ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001. Rb1 inhibited oxidative stress and ferroptosis in SI cell model by elevating GPX4 expression FT194 cells were transfected with sh-GPX4 prior to the establishment of the SI cell model and subsequently treated with Rb1. (A) GPX4 expression was detected by RT-qPCR and Western blot. (B) Cell viability was examined using CCK-8. (C) Cell proliferation was detected by EdU assay. (D) Inflammatory factor levels were detected using ELISA. (E) MDA and SOD levels were examined using commercial kits. (F) Fe 2+ level was examined using a commercial kit. (G) ROS levels were detected using a DCFH-DA fluorescence probe. ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001. To further explore the regulatory mechanism by which the PTGS2/GPX4 axis affects ferroptosis in SI mice, mice were injected with adenoviruses carrying sh-PTGS2 and sh-GPX4 prior to SI model establishment. As illustrated in Fig. 4 A, PTGS2 knockdown ameliorated pathological lesions in SI fallopian tube tissues, whereas these protective effects were counteracted by GPX4 silencing. Specifically, PTGS2 knockdown reduced levels of IL-6, IL-1β and TNF-α andGPX4 downregulation abolished whereas these protective effects PTGS2 knockdown ( Fig. 4 B). In addition, PTGS2 silencing decreased MDA content and enhanced SOD activity in SI mice, and these regulatory effects were abrogated by GPX4 knockdown ( Fig. 4 C). Besides, SI model mice exhibited abnormally upregulated expression of PTGS2, NOX1, ACSL4, and 4-HNE, alongside abnormally downregulated expression of GPX4 and xCT. These molecular abnormalities were alleviated by PTGS2 knockdown. However, PTGS2 knockdown-induced downregulation of PTGS2, NOX1, ACSL4, and 4-HNE as well as elevation of GPX4 and xCT, were reversed by GPX4 knockdown ( Fig. 4 D). Furthermore, PTGS2 knockdown reduced Fe 2+ and ROS levels in SI mice, while GPX4 silencing abolished the inhibitory effects of PTGS2 knockdown on Fe 2+ and ROS accumulation ( Fig. 4 E–F). More importantly, PTGS2 knockdown improved the pregnancy rate and litter size of SI mice, whereas this reproductive protective effect was markedly reversed by GPX4 knockdown ( Table 3 ). Collectively, PTGS2 knockdown mitigated inflammation and suppressed ferroptosis in SI mice, and these protective effects can be abolished by GPX4 knockdown. Fig. 4 PTGS2 exacerbated oxidative stress and ferroptosis in SI mice through downregulation of GPX4 expression Mice were injected with adenoviruses carrying sh-PTGS2 and sh-GPX4 prior to SI model establishment. (A) Fallopian tube morphology was evaluated using HE staining. (B) Inflammatory factor levels were detected using ELISA. (C) MDA and SOD levels were examined using commercial kits. (D) PTGS2, GPX4, NOX1, ACSL4, 4-HNE and xCT expression was detected using Western blot. (E) Fe 2+ level was examined using a commercial kit. (F) ROS levels were detected using a DCFH-DA fluorescence probe. ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001. Table 3 Pregnancy rate and litter size in each group. Table 3 Pregnancy rate (%) Litter size (n) P value (Litter size) vs sham vs SI + sh-NC vs SI + sh-PTGS2+sh-NC sham 100 6.2 ± 1.3 SI + sh-NC 20 0.2 ± 0.45 0.0017 SI + sh-PTGS2+sh-NC 80 5.6 ± 3.21 0.0043 SI + sh-PTGS2+sh-GPX4 40 1.6 ± 2.3 0.0365 Table 4 Pregnancy rate and litter size in each group. Table 4 Pregnancy rate (%) Litter size (n) P value (Litter size) vs sham vs SI vs SI + Rb1 sham 100 7.6 ± 1.14 SI 20 0.2 ± 0.45 0.0004 SI + Ferrostatin-1 80 5.4 ± 3.05 0.0086 SI + Ferrostatin-1+Rb1 80 5 ± 2.92 0.9914 PTGS2 exacerbated oxidative stress and ferroptosis in SI mice through downregulation of GPX4 expression Mice were injected with adenoviruses carrying sh-PTGS2 and sh-GPX4 prior to SI model establishment. (A) Fallopian tube morphology was evaluated using HE staining. (B) Inflammatory factor levels were detected using ELISA. (C) MDA and SOD levels were examined using commercial kits. (D) PTGS2, GPX4, NOX1, ACSL4, 4-HNE and xCT expression was detected using Western blot. (E) Fe 2+ level was examined using a commercial kit. (F) ROS levels were detected using a DCFH-DA fluorescence probe. ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001. Pregnancy rate and litter size in each group. Pregnancy rate and litter size in each group. To probe the role of the PTGS2/GPX4 axis in SI, FT194 cells were transfected with oe-PTGS2 alone or oe-PTGS2 combined with oe-GPX4, followed by LPS induction to establish the SI cell model. As shown in Fig. 5 A, Rb1-induced PTGS2 downregulation and GPX4 upregulation were destroyed by PTGS2 overexpression. However, GPX4 overexpression restored GPX4 expression in oe-PTGS2 transfected-FT194 cells under Rb1 and LPS treatment, whereas it exerted no significant effect on PTGS2 expression. Besides, PTGS2 overexpression inhibited cell viability and proliferation in SI model cells treated with Rb1, and these inhibitory effects were reversed by GPX4 overexpression ( Fig. 5 B–C). PTGS2 overexpression enhanced inflammatory factor levels in Rb1-treated SI model cells, while GPX4 overexpression offset these abnormalities ( Fig. 5 D). Furthermore, PTGS2 overexpression reversed Rb1-induced decreases in MDA, Fe 2+ and ROS levels as well as Rb1-induced SOD upregulation. These detrimental effects caused by PTGS2 overexpression were compromised by GPX4 overexpression ( Fig. 5 E–G). Taken together, Rb1 decreased PTGS2 expression to enhance GPX4 expression, thus attenuating oxidative stress and ferroptosis in SI cell model. Fig. 5 Rb1 suppressed oxidative stress and ferroptosis by downregulating PTGS2 to upregulate GPX4 in SI cell model FT194 cells were transfected with oe-PTGS2 alone or combined with oe-GPX4 prior to the establishment of SI cell model, followed by Rb1 treatment. (A) PTGS2 and GPX4 expression was detected by RT-qPCR and Western blot. (B) Cell viability was examined using CCK-8. (C) Cell proliferation was detected by EdU assay. (D) Inflammatory factor levels were detected using ELISA. (E) MDA and SOD levels were examined using commercial kits. (F) Fe 2+ level was examined using a commercial kit. (G) ROS levels were detected using a DCFH-DA fluorescence probe. ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001. Rb1 suppressed oxidative stress and ferroptosis by downregulating PTGS2 to upregulate GPX4 in SI cell model FT194 cells were transfected with oe-PTGS2 alone or combined with oe-GPX4 prior to the establishment of SI cell model, followed by Rb1 treatment. (A) PTGS2 and GPX4 expression was detected by RT-qPCR and Western blot. (B) Cell viability was examined using CCK-8. (C) Cell proliferation was detected by EdU assay. (D) Inflammatory factor levels were detected using ELISA. (E) MDA and SOD levels were examined using commercial kits. (F) Fe 2+ level was examined using a commercial kit. (G) ROS levels were detected using a DCFH-DA fluorescence probe. ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001.

Authors'

Y.W.: Conceptualization, Investigation, Project administration, Resources, Validation, Supervision, Writing - Original Draft and Writing - Review & Editing. J.K.: Data Curation, Formal analysis, Methodology, Software and Visualization. All authors read and approved the final manuscript.

Clinical

Not applicable.

Discussion

SI caused by bacterial infection is a common gynecological disorder. In patients with SI, significant pathological alterations can be observed, including inflammation of the fallopian tube lining, adhesion formation and scarring [ 22 , 23 ]. Rb1 has been identified as a potential therapeutic agent for various diseases, such as ischemic stroke and neurological disorders, owing to its potent pharmacological activities [ 24 , 25 ]. In this study, we provided additional experimental evidence confirming that Rb1 exerted beneficial effects on SI treatment. More importantly, our findings revealed that Rb1 alleviated SI by suppressing inflammation, oxidative stress and ferroptosis through downregulating PTGS2 to upregulate GPX4 expression. Currently, oxidative stress was closely linked to infertility [ 26 , 27 ]. Besides, ferroptosis was closely related with female infertility [ 28 ]. Notably, ferroptosis has been implicated in LPS-induced endometritis, endometriosis-related infertility and primary ovarian insufficiency [ [29] , [30] , [31] ]. However, are oxidative stress and ferroptosis involved in the pathologic mechanisms of SI? To date, relevant research remains extremely limited, and merits further exploration. Notably, numerous studies have confirmed that ginsenoside Rb1 exhibited significant anti-oxidative, anti-inflammatory, and ferroptosis-regulating effects in various disease models [ 8 , 32 , 33 ]. In a diabetic rat model, Rb1 effectively alleviated streptozotocin-induced oxidative stress damage and improved pulmonary inflammation [ 6 ]. For doxorubicin-induced cardiotoxicity, Rb1 protected cardiomyocytes by inhibiting autophagy and ferroptosis [ 34 ]. In a neonatal rat model of hypoxic-ischemic brain injury, Rb1 reduced brain tissue damage by suppressing ferroptosis [ 32 ]. Additionally, Rb1 effectively inhibited oxidative stress-induced damage to ovarian granulosa cells through the Akt-FoxO1 signaling pathway [ 8 ]. In the present study, we established murine and cellular models of SI. We found that Rb1 ameliorated fallopian tube pathological damage, inhibited inflammatory responses and oxidative stress, and improved pregnancy rate and litter size in SI mice. Further verification through combined experiments with a ferroptosis inhibitor/inducer demonstrated that Rb1 alleviated the pathological progression of SI by inhibiting ferroptosis; its effect was comparable to that of the ferroptosis inhibitor Fer-1, whereas the ferroptosis inducer erastin could reverse the aforementioned protective effects of Rb1. Furthermore, the underlying molecular mechanism of Rb1 in SI was investigated. Encouragingly, a previous study validated the direct interaction between Rb1 and PTGS2 through multiple methods, including network pharmacology analysis, molecular docking simulations, and biotin-labeled Rb1 pull-down assays [ 35 ], suggesting that PTGS2 is likely a target through which Rb1 exerts its effects in SI. It was worth noting that PTGS2 inhibitors played a crucial role in reproductive medicine [ 36 , 37 ]. However, to date, there is no substantial evidence regarding whether PTGS2 is involved in the regulation of SI progression. Accumulating evidence has demonstrated the interaction between PTGS2 and oxidative stress in various diseases, such as acute lung injury, traumatic brain injury and diabetes [ [38] , [39] , [40] ]. In addition, PTGS2 could affect ferroptosis to participate in the pathogenesis of multi-diseases, including coronary artery atherosclerosis, coronary microembolization and hyperoxia-induced bronchopulmonary dysplasia [ 15 , 41 , 42 ]. Regrettably, there were no reports on how PTGS2 regulates oxidative stress and ferroptosis to influence SI progression. Here, we found that PTGS2 expression was largely elevated in SI models at animal and cellular levels, and Rb1 could downregulated PTGS2 expression in these SI models. Additionally, PTGS2 overexpression reversed Rb1-induced enhancement of tubal cell viability and proliferation as well as the Rb1-induced inhibition of oxidative stress and ferroptosis, in vitro experiments. Our findings confirmed that PTGS2 expression was regulated by Rb1 during SI. Some reports have revealed that PTGS2 could negatively regulate GPX4 expression and thereby affect ferroptosis [ 42 , 43 ]. For example, PTGS2 knockdown elevated GPX4 expression in a model of coronary microembolization [ 42 ]. As previously reported, GPX4 is the core regulator of ferroptosis [ 21 ]. In this study, we found that GPX4 expression was greatly decreased in SI samples, and Rb1 could upregulate GPX4 expression in both murine and cellular SI models. Besides, GPX4 knockdown reversed Rb1-mediated promotion of cell viability and proliferation as well as the Rb1-mediated suppression of oxidative stress and ferroptosis, in the SI cell model. Furthermore, PTGS2 knockdown alleviated inflammation and ferroptosis, and improved pregnancy rate and litter size in SI mice by upregulating GPX4; these beneficial improvements were reversed by GPX4 knockdown. Furthermore, PTGS2 overexpression decreased GPX4 expression and GPX4 overexpression could abolish PTGS2 overexpression-induced inhibition of cell viability and proliferation as well as promotion of oxidative stress and ferroptosis, in Rb1-treated SI cell model. Notably, mitochondrial dysfunction served as a core link connecting oxidative stress, ferroptosis, and inflammatory responses [ 44 , 45 ]. Previous studies have demonstrated that mitochondrial quality control (MQC) networks, including mitophagy, mitochondrial fission/fusion, and mitochondrial unfolded protein response (mtUPR), played pivotal roles in maintaining cellular homeostasis and mediating cell injury under stress conditions [ [46] , [47] , [48] , [49] , [50] , [51] , [52] , [53] , [54] ]. Although our study focused on the PTGS2/GPX4 axis, accumulating evidence supported the involvement of mitochondrial targets in the therapeutic effects of Rb1. For instance, Rb1 has been shown to regulate the NDUFS4-SIRT5-DUSP1 axis to modulate MQC and alleviate inflammatory injury in coronary microvessels [ 46 ], which was analogous to our finding that Rb1 mitigated SI by regulating oxidative stress and ferroptosis. Moreover, mitochondrial dysfunction-induced ferroptosis, as mediated by the DNA-PKcs-YAP1 axis in diabetic cardiomyopathy [ 55 ], highlighted the universal role of mitochondrial targets in ferroptosis-related diseases, including SI. Additionally, natural compounds similar to Rb1, such as tanshinone IIA and ligustrazine, exerted protective effects by regulating mitochondrial and endoplasmic reticulum function through specific molecular axes [ [56] , [57] , [58] , [59] ], further supporting that mitochondrial regulation is a key mechanism underlying the therapeutic effects of natural active components. Our findings complemented these studies by revealing that the PTGS2/GPX4 axis, regulated by Rb1, may indirectly modulate mitochondrial function to inhibit ferroptosis and oxidative stress in SI, providing a novel link between PTGS2/GPX4 signaling and mitochondrial homeostasis in female reproductive system disorders. In conclusion, we are the first to propose that Rb1 exerted a therapeutic effect on SI by mediating the PTGS2/GPX4 axis, which was characterized by alleviating the pathological features of fallopian tubal tissues, enhancing cell viability and proliferation of tubal cells, and inhibiting oxidative stress and ferroptosis in SI models. Our findings may provide insights into the molecular regulatory mechanisms underlying the effects of Rb1 on oxidative stress and ferroptosis in SI and offer targeted molecules for SI treatment. Despite these promising findings, several limitations should be acknowledged. First, although we demonstrated that Rb1 alleviated SI by regulating the PTGS2/GPX4 axis, the direct molecular interaction between Rb1 and PTGS2 was primarily supported by prior network pharmacology and pull-down assays, and further validation using techniques is needed to confirm direct binding in SI. Second, our experiments were conducted in murine and cellular models; thus, the translational potential of Rb1 to human SI patients remains to be established, and clinical evidence is currently lacking. Third, the long-term safety and efficacy of Rb1 treatment, as well as its potential effects on reproductive development and offspring health, have not been evaluated. Addressing these gaps will be essential before considering Rb1 as a viable therapeutic candidate for SI in clinical practice.

Introduction

Massive investigations have demonstrated that salpingitis was key cause of female infertility [ 1 ]. Accumulating evidences indicated that severe salpingitis damaged the fallopian tube mucosa, which further resulted in fimbrial adhesions, distal tubal obstruction, and hydrosalpinx [ 2 ]. Currently, the main clinical strategies for salpingitis infertility (SI) include laparoscopic surgery and antibacterial agents. Nevertheless, postoperative complications such as re-adhesion and re-obstruction frequently occur, leading to recurrent infertility. Broad-spectrum antibiotic therapy for SI yields unsatisfactory efficacy, accompanied by adverse reactions and a limited therapeutic effect on chronic inflammation induced by the fallopian tube dysfunction [ 3 , 4 ]. Accordingly, it is urgent to develop novel and effective therapeutic agents for SI treatment. Ginsenoside Rb1 (Rb1) is a highly abundant tetracyclic triterpenoid active ingredient isolated from ginseng and other Araliaceae plants, which exerts prominent anti-inflammation and antioxidation pharmacological effects [ 5 , 6 ]. Previous studies have reported that Rb1 alleviates monosodium iodate-induced osteoarthritis by inhibiting miR-21-5p/FGF18-mediated inflammatory responses [ 7 ]. Besides, it attenuated oxidative stress-induced injury in ovarian granulosa cells through modulating the Akt-FoxO1 pathway [ 8 ]. Considering the dual anti-inflammatory and antioxidant properties of Rb1, it targeted core pathological changes of infertility, including fallopian tube mucosal damage, ciliary dysfunction, and tissue fibrosis triggered by excessive inflammation and oxidative stress [ 9 , 10 ]. Accordingly, we speculate that Rb1 may regulate the pathological progression of SI by inhibiting inflammatory responses and alleviating oxidative stress damage. Nevertheless, the biological effects and underlying mechanisms of Rb1 in SI remain poorly understood. Prostaglandin-endoperoxide synthase 2 (PTGS2) is an inducible enzyme that participates in prostaglandin synthesis during inflammatory responses [ 11 ]. PTGS2 expression was elevated in ectopic endometrial stromal cells within the fallopian tube [ 12 ]. Ferroptosis is a distinctive form of cell death that differs from necrosis and apoptosis and has recently been identified as a pro-inflammatory cell death pathway [ 13 ]. Accumulating evidence indicated that ferroptosis was involved in staphylococcus aureus-induced endometritis [ 14 ], implying its potential role in SI progression. Notably, although ferroptosis has recently been reported to be associated with several inflammatory reproductive disorders, studies directly linking ferroptosis to the pathogenesis of SI remains extremely scarce. Previous research has documented that ferroptosis was driven by PTGS2 upregulation and GPX4 downregulation in advanced atherosclerotic lesions [ 15 ]. GPX4 served as a core regulator of ferroptosis [ 16 ]. Thus, we hypothesize that Rb1 may target the PTGS2/GPX4 axis to modulate ferroptosis, thereby ameliorating SI. On the basis of the above evidence and target prediction results from network pharmacology, we propose the following hypothesis: Rb1 downregulates PTGS2 expression and elevates GPX4 expression to retard the pathological progression of SI by enhancing cell viability and proliferation, and as well as suppressing oxidative stress and ferroptosis. This study not only highlights the therapeutic potential of Rb1 as a candidate agent for SI treatment, but also provides novel insights into clinical strategies for SI intervention via targeting the PTGS2/GPX4 signaling axis and modulating ferroptosis.

Coi Statement

The authors declare that they have no conflicts of interest.

Data Availability

All data generated or analyzed during this study are included in this article.

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: pmc-nxml

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2026) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

SciLite annotations

chemicals 26
ginsenoside rb1 ginsenoside rb1 ginsenoside rb1 sodium iodate prostaglandin erastin penicillin streptomycin lipopolysaccharide formaldehyde haematoxylin formaldehyde ethanol haematoxylin 2'-deoxyuridine formaldehyde triton erastin erastin erastin erastin ginsenoside rb1 doxorubicin erastin biotin pristinamycin iia
organisms 45
mus sp. transgenic mice mus sp. mus sp. sansam ginseng family plants staphylococcus aureus subsp. aureus str. mw2 transgenic mice mus sp. mus sp. mus sp. mus sp. mus sp. mus sp. transgenic mice mus sp. strain har-13 mus sp. mus sp. mus sp. mus sp. mus sp. unidentified adenovirus rodents rodents mus sp. transgenic mice transgenic mice transgenic mice mus sp. mus sp. mus sp. mus sp. mus sp. mus sp. mus sp. mus sp. transgenic mice unidentified adenovirus mus sp. zitter rats mus sp. rodents human

Source provenance

europepmc
last seen: 2026-08-30T09:23:35.175841+00:00
scilite
last seen: 2026-08-23T10:03:07.687773+00:00
unpaywall
last seen: 2026-08-24T06:27:14.670421+00:00
License: CC-BY-NC-ND-4.0