Can early weaning in the previous lactation of beef cows affect the metabolism and postnatal development of female offspring?

Can early weaning in the previous lactation of beef cows affect the metabolism and postnatal development of female offspring? | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Can early weaning in the previous lactation of beef cows affect the metabolism and postnatal development of female offspring? Thiago Kan Nishimura, Matheus Sousa de Paula Carlis, Ana Clara Degan Matos, and 7 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5882997/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 25 Jun, 2025 Read the published version in Tropical Animal Health and Production → Version 1 posted 4 You are reading this latest preprint version Abstract We aimed to compare the effects of early (EW; 150 days) or conventional (CW; 240 days) weaning during early pregnancy on the postnatal metabolism, development, and productive performance of female calves born from secondiparous (SEC) and multiparous (MULT) cows. Fifty-five Nelore female calves were used: 25 from EW cows (10 SEC, 15 MULT) and 30 from CW cows (15 SEC, 15 MULT). From 90 to 150 days, the female calves received creep-feed (5g/kg of body weight [BW]). After weaning, female calves were maintained on pastures and received 10 g/kg of BW supplement until 16 months (mo). From 12 to 16 mo, heifers were evaluated every 28 ± 3 days for BW, body condition score (BCS), and average daily gain (ADG), calculated from weight measurements. Carcass traits (ribeye area [REA], backfat thickness [BFT], and rump fat thickness [RFT]) were assessed by ultrasound, and blood samples were collected for serum concentration of IGF-I, leptin, and plasma glucose. At 5 and 14 mo, a subgroup of 22 heifers (n = 10 for EW and 12 for CW) was selected for liver biopsy to evaluate the gene expression of IGF-I, IGFBP , and GHR . No interactions were observed between dam parity, weaning strategy, or time for BW, BCS, ADG, REA, serum concentration for IGF-I, leptin, and plasma concentration for glucose ( P > 0.1 ). A significant time effect ( P < 0.05 ) indicated increased BW, BCS, LMA, BFT, and RTF over time. Heifers from MULT cows were 2.67 kg heavier from 13 to 15 mo than heifers from SEC cows ( P = 0.04 ). Dam parity affected BCS ( P = 0.01 ); heifers from MULT cows had greater BCS than SEC group. For carcass traits, a dam parity by weaning interaction ( P = 0.04 ) in RTF indicated that EW-SEC heifers presented a lower fat deposition than EW-MULT and CW heifers. IGF-I gene expression was 1.4-fold greater ( P = 0.01 ) at 5 mo than at 14 mo. For IGFBP gene expression, a dam parity × time interaction was observed ( P = 0.05 ), with heifers from MULT cows showing a 1.8-fold greater expression at 14 mo than at 5 mo. In conclusion, the early weaning applied to dams in the previous lactation did not affect the subsequent offspring's productive performance or metabolic parameters, except for a reduction in rump fat deposition in heifers from SEC cows that were early weaned. Beef cattle body development heifer Nelore nutritional status Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 1. Introduction Milk is an essential nutritional source for calf growth during the first months of life. However, from the fourth month of lactation in Nelore cows, it no longer meets the nutritional needs of the calves (Costa e Silva et al. 2015). In extensive tropical systems, predominant in Brazil with Zebu beef breeds, weaning generally occurs between 7 and 8 months of age (Ferraz & Felício. 2010). To maintain a 12-month calving interval, cows must conceive by 75 days postpartum, which presents a significant challenge due to the increased energy requirements of lactating cows (Restle et al. 2001; Vaz et al. 2010; Wiseman et al. 2019). Moreover, as gestation progresses, lactating cows have a reduced ability to accumulate body reserves, which can compromise fetal development and lower pregnancy rates in the subsequent breeding season (Nishimura et al. 2023a). This effect is even more pronounced in primiparous cows, as they require more energy for growth than mature cows (Nasem 2016). Early weaning in beef cows is a strategy used to reduce energy requirements (de Oliveira et al. 2019; Wiseman et al. 2019). Additionally, this practice provides a window for body reserve recovery (Nishimura et al. 2023a), as in the last trimester of gestation, nutritional demands increase and homeorhetic changes reduce rumen size to accommodate the expanding gravid uterus, impacting voluntary feed intake by the cow (Moreira et al. 2024, in press ). Regarding the weaned calves, previous publications from our research group indicated that early weaning may reduce body weight only during the weaning period. However, post-weaning performance, both productive in bulls (Abitante et al. 2024) and reproductive in heifers (Nishimura et al. 2023a), is not affected. Developmental programming emerged from evidence linking low birth weight, caused by poor maternal nutrition, to the incidence of metabolic diseases in adulthood (Barker et al. 2002). These modifications in the maternal environment can modulate tissue development and fetal metabolism (Dahlen et al. 2021; Costa et al. 2022; Menezes et al. 2023), regulated by genes (Paradis et al. 2017), resulting in primarily irreversible consequences for postnatal outcomes in offspring (Du et al. 2010). Studies on maternal nutrition in cattle have focused mainly on the second and last trimesters of gestation (Moriel et al. 2021; Barcelos et al. 2022), with emphasis on the effects of protein supplementation on offspring development in tropical conditions such as Brazil (Marquez et al. 2017; Rodrigues et al. 2020; Ramírez-Zamudio et al. 2022; Nascimento et al. 2024; Costa et al. 2022; Cracco et al. 2023). In our research model, however, early weaning, coinciding with approximately 80 days of gestation, can redirect energy previously used for lactation to other physiological functions, such as fetal development and maternal body reserve maintenance. This effect may have implications for offspring outcomes, potentially different from those observed in studies involving maternal supplementation, although this has yet to be investigated. Thus, the present study aimed to evaluate the effect of early or conventional weaning and cow parity order in Nelore cows (secondiparous [SEC] and multiparous [MULT]) on their female offspring's growth and postnatal metabolism. 2. Material and Methods This experiment was approved by the Commission on Ethics in Animal Use of the College of Animal Science and Food Engineering (FZEA) of the University of São Paulo (USP) (CEUA Nº: 2350310123) and was conducted at the Fernando Costa campus of the University of São Paulo in Pirassununga, SP. 2.1 Animals and Experimental Design Primiparous (PRIMI) and MULT Nelore cows that became pregnant (n = 208) through TAI using semen from three Nelore sires during the 2020 breeding season were assigned to early weaning (EW) at 150 days (average: 149 ± 2) or conventional weaning (CW) at 240 days (average: 247 ± 2). Detailed information regarding the treatments and their effects on cow performance, hormone levels, metabolites, and pregnancy outcomes has been previously reported by Nishimura et al. 2023a. Among these cows, during the 2021 calving season (September to October), 55 female calves (25 born from cows that underwent early weaning [15 born from MULT cows, and 10 from SEC cows] and 30 born from cows that underwent conventional weaning [15 born from MULT cows, and 15 from SEC cows) were used as experimental units in the current experiment ( Fig. 1 ). 2.2 General Management At birth, all calves were identified with a tattoo, treated with a navel iodine dip, and received antiparasitic treatment (Doramectina, Dectomax®, 1 mL). Their body weight (BW) was also recorded. Based on the calving date, cow-calf pairs were assigned to 40 to 50 pairs of breeding groups each. These groups were managed in Urochloa ssp. paddocks with free access to water and daily protein supplementation. During the dry season (April to September), they received a supplement containing 30.1% crude protein (CP) and 42.0% total digestible nutrients (TDN) at a rate of 1 g/kg of BW, while during the wet season (October to March), the supplement contained 26.1% CP and 50.5% TDN at the same rate. Starting at 90 days of age, calves had access to supplemental creep-feed in a designated creep area (5 × 10 m) with 2.5 linear meters of bunk space designed to exclude cows. The creep-feed aimed for an average intake of 5 g/kg of BW per day and provided a supplement with 26.3% CP and 80.7% TDN (Table 1 ). Table 1 Ingredient composition of cow´s supplement and creep-feed and grazing supplement to Nelore cows and heifers programmed by early or conventional weaning of the previous offspring. Cow supplement A Calf supplement B Ingredient Protein supplement – Dry season Energy and protein supplement – Wet season Creep-feed Energy and protein supplement – Grazing period Ingredient, % dry matter Corn ground 32.50 48.50 59.50 63.98 Soybean meal ─ ─ 35.00 24.89 Cottonseed meal 25.00 40.00 ─ ─ Salt 25.00 5.00 4.00 5.59 Urea 10.00 4.00 ─ 3.32 Mineral supplement, % 1 7.50 2.50 1.50 2.21 Chemical composition, % 2 DM 93.02 90.60 86.18 80.36 CP 41.05 31.65 23.76 32.30 EE 1.86 2.83 2.48 2.60 ADF ─ ─ 10.11 10.40 NDF 10.31 16.16 22.49 4.80 Ash ─ ─ 7.90 6.20 1 Mineral supplement included: 1.00% trace mineral premix holding 230g Ca, 160g P, 60g S, 160mg Co, 160mg Cu, 135mg I, 2.700mg Mn, 8.100mg Zn, and 4.000 of monensin sodium. 2 DM= dry matter, CP = crude protein, EE = ether extract, ADF = acid detergent fiber, NDF = neutral detergent fiber. A Cows received dry season supplement from May to October and wet season supplement from November to April. B Calves received creep feed from 90 days until 5 months of live, thereafter, received energy and protein supplement from 5 to 16 month. All calves were weaned at 150 ± 1 days of age through permanent separation from their dams in a single event (Enríquez et al., 2011). After weaning, they were moved to separate Urochloa ssp. pastures (Table 2 ) for a backgrounding phase. During this period, calves received a daily protein supplement targeting 5 g/kg of BW for one month (29.7% CP and 80.7% TDN). Subsequently, supplementation increased to 7 g/kg of BW for two weeks, followed by 10 g/kg of BW until they reached 16 months of age. Table 2 Chemical composition of forage (Urochloa brizantha cv. Marandu) during the experiment period for cow-calf and heifer´s grazing phase. Item Cow-calf forage Grazing phase forage Rain season Dry season Rain season Pre-dry-season Dry season Chemical composition, % of DM1 DM,% of NM 35.63 65.44 19.47 22.18 69.89 CP 6.67 4.05 12.80 4.30 4.10 EE 1.20 0.99 2.60 1.70 1.30 ADF 39.37 44.29 51.30 42.90 48.10 NDF 71.09 72.63 66.50 76.30 79.80 Lignin 4.14 4.52 4.30 4.60 4.70 Ash 7.00 6.35 8.50 8.10 7.30 1 DM = dry matter, NM = natural matter. CP = crude protein, NDF = neutral detergent fiber, ADF = acid detergent fiber, EE = ether extract 2.3 Dam Uterine Artery Hemodynamics At 5.5 and 8.5 months of pregnancy, Doppler ultrasonography was performed on 50 cows (25 PRIMI [12 early-weaned and 13 conventional-weaned] and 25 MULT [13 early-weaned and 12 conventional-weaned]) that became pregnant during the 2020 breeding season to assess uteroplacental hemodynamics (Fig. 1 ). Uterine artery hemodynamics, both ipsilateral and contralateral to the conceptus, were evaluated using color Doppler ultrasonography (MyLab Delta, Esaote Healthcare, Italy) equipped with a 7.5 MHz linear transducer. The uterine artery was identified transrectally by tracing the abdominal aorta to the external iliac artery's origin, and the internal iliac artery was located by moving the probe caudally. Cardiac cycle waveforms from at least two independent ultrasound scans were analyzed to determine systolic velocity (s; cm/s), diastolic velocity (d; cm/s), the s:d ratio, pulsatility index, and resistance index, using the device's preset functions. Time-averaged maximum velocity (TAMV) was calculated with the formula: (s - d)/pulsatility index. Uterine blood flow (UBF) was calculated using the following equation: mean velocity x vessel area x 60 s. 2.4 Body weight, Body Condition Score and Carcass Traits Body weight was measured using a barn scale and recorded at eight time points: at birth, 5 months (150.4 ± 1.39 days of age), 8 months (246.5 ± 1.74 days of age), 12 months (11.4 ± 0.11 months of age), 13 months (12.3 ± 0.11 months of age), 14 months (13.5 ± 0.11 months of age), 15 months (14.4 ± 0.11 months of age), and 16 months (16.3 ± 0.11 months of age). Body condition score (BCS) was assessed on a 1 to 9 scale, where 1 represents emaciated and 9 represents obese, at four time points: 12 months, 13 months, 14 months, and 15 months of age, following the methodology of Wagner (1988). The average daily gain (ADG) was calculated for seven intervals: from birth to 5 months (representing ADG from birth to 150 days of age), from 5 to 8 months (corresponding to ADG during this period), from 8 to 12 months (representing ADG from 8 to 12 months of age), from 12 to 13 months (representing ADG during this one month), from 13 to 14 months (corresponding to ADG during this interval), from 14 to 15 months (representing ADG during this period), and from 15 to 16 months (representing ADG during this interval). During the backgrounding period, calves were weighed at birth, 5 months, 8 months, and every 28 ± 4 days after reaching 12 months of age. The average daily gain (ADG) was calculated using the following equation: ADG, kg/day = (last weight – initial weight) / (days between weighing) Ribeye area (REA), back fat thickness (BFT), and rump fat thickness (RFT) were measured via ultrasound at 13, 14, and 15 months of age. REA and BFT measurements were obtained from cross-sectional images of the Longissimus thoracis muscle between the 12th and 13th ribs. RFT measurements were taken by positioning the transducer at the junction of the gluteus medius and biceps femoris muscles, located between the hip and pin bones (Silva et al., 2012). All measurements were performed by a single operator using ultrasound equipment (EXAGO, IMV Technologies, L’Aigle, France) with a 3.5 MHz, 172 mm linear array transducer. The captured images were analyzed with Lince® V.1.5 software (M&S Consultoria Agropecuária Ltd., Pirassununga, SP, Brazil). 2.5 Blood Samples Blood samples (approximately 10 mL) were collected at 13, 14, and 15 months of age via jugular venipuncture into evacuated tubes (BD Vacutainer®, São Paulo, Brazil). Tubes without an anticoagulant were used for serum separation to analyze leptin and Insulin-like Growth Factor I (IGF-I) concentrations, while tubes containing sodium fluoride were used to separate plasma for glucose concentration analysis. Tubes without anticoagulant were allowed to clot at room temperature before being placed on ice, while sodium fluoride tubes were immediately placed on ice. All samples were centrifuged at 2800 × g for 15 minutes at 4ºC, and two 1.5 mL aliquots of serum and plasma were stored at − 20ºC until analysis. Serum IGF-I concentrations were determined using a chemiluminescent assay on a Dimension EXL 200 Integrated Biochemistry System with the IMMULITE® 1000 commercial IGF-I kit (Siemens Healthcare Diagnostics, Munich, Germany). The intra-assay coefficient of variation and sensitivity was 1.58% and 20 ng/mL, respectively. Plasma glucose concentrations were measured using a colorimetric test on an automated analyzer (Mindray BC-2800 Vet®, China) with a commercial kit (Labtest, Ref. 133-2/500). Serum leptin concentrations were analyzed via Enzyme-Linked Immunosorbent Assay (ELISA) at the Molecular Physiology and Endocrinology Laboratory of the University of São Paulo (LFEM – VRA, USP) using a Bovine Leptin ELISA Kit (EZ Assays, USA). 2.6 Hepatic Sampling Liver biopsies were collected at two time points: 5 months (150 ± 1 days of age) and 14 months (13.7 ± 0.11 months of age). The procedure was conducted on a subset of 22 heifers, including 10 from the early weaning group (7 from MULT cows and 3 from PRIMI cows) and 12 from the conventional weaning group (6 from MULT cows and 6 from PRIMI cows), following the method described by Gröhn and Lindberg (1982). The biopsy site was identified at the intersection of the right 11th and 12th intercostal spaces and the line extending from the right acromion to the tuber coxae. The area was clipped, scrubbed with 2% chlorhexidine (Rioquímica, Brazil), disinfected with 70% ethanol, and anesthetized with a subcutaneous injection of 3–5 mL of 2% lidocaine (Dorfin, Ceva, Brazil). A stab incision was made in the skin, and the biopsy was performed using a 14 g × 15 cm soft tissue biopsy needle (REF 0BM1415; Biomedical Sri Via., Italy). Four tissue fragments were collected, placed in cryotubes, and immediately stored in liquid nitrogen. They were subsequently stored in a freezer at − 80ºC until gene expression analysis. 2.7 Total RNA Extraction, cDNA Synthesis, and Quantitative Real-Time Reverse Transcriptase Polymerase Chain Reaction (qPCR) For RNA extraction, liver tissue was homogenized in liquid nitrogen using a multibed shocker and immediately mixed with an extraction reagent (TRIzol, Life Technologies, Frederick, USA) following the manufacturer's instructions. The procedures for determining the total RNA concentration, cDNA synthesis, and quantitative PCR (qPCR) were carried out as previously described (Rio Feltrin et al., 2024). The relative abundance of transcripts for GHR , IGF-I , and IGFBP was analyzed using SYBR Green PCR Master Mix (Life Technologies) for the amplification reactions, which were conducted on a Step One Plus thermocycler (Applied Biosystems Real-Time PCR System; Life Technologies). The optimized primer (Table 3 ) pairs were designed using the primer design platform from the National Center of Biotechnology Information (NCBI) ( https://www.ncbi.nlm.nih.gov/tools/primer-blast/ ) based on the mRNA sequence of target genes obtained from the RefSeq database, on Genebank ( https://www.ncbi.nlm.nih.gov/genbank/ ) and the specificity of the primer were checked by BLAST (NCBI, https://blast.ncbi.nlm.nih.gov/Blast.cgi ). Furthermore, GeNorm software ( http://genorm.cmgg.be ) was used to select reference genes, and Glyceraldehyde-3-Phosphate Dehydrogenase ( GAPDH ) and Hypoxanthine Phosphoribosyl transferase ( HPRT ) were used as an endogenous control. Were used LinRegPCR software to determine qPCR efficiency and quantification cycle (Cq) values per sample. Quantification was performed after normalization of the target gene expression values by the geometric mean of the endogenous Control expression values, as described by Pfaffl (2001). Table 3 Protein symbol, protein name, forward (F) and reverse (R) primer sequence, base pair (BP), R2 of the standard curve efficiency of the genes tested by the qPCR technique. Protein Symbol Protein Name Forward (F) and Reverse (R) Primer Sequence Base Pair (PB) R 2 of the standard curve Standard curve efficiency IGF-I Insulin growth factor I a F: CCAGACAGGAATCGTGGATG 89 0.96 1.90 R: ACTTGGCGGGCTTGAGAG IGFBP-I Insulin growth factor binding protein I a F: AGCACAGACACCCAGAACTTCT 86 0.97 1.89 R: TCAGCGTGTCTTCCATTTCC GHR Growth hormone receptor F: TTCTGGGAATCCTAAATTCACCAA 91 0.98 1.87 R: CTGTAAACTGTGATTAGCCCCATCT HPRT Hypoxanthine phosphoribosyltransferase F: TGGAGAAGGTGTTTATTCCTCATG 105 0.98 1.87 R: CACAGAGGGCCACAATGTGA ACTB β-actin a F: GGATGAGGCTCAGAGCAAGAGA 153 0.98 1.87 R: TCGTCCCAGTTGGTGACGAT Superscript letters in protein name: a (Carriquiry et al., 2009). Table 4. Uterine blood flow perfusion on the uterine artery at 5.5 and 8.5 months of gestation in Nelore cows (primiparous and multiparous) submitted to early (150 days) and conventional (240 days) weaning. Early Conventional P -Values Primiparous Cows (n = 12) Multiparous Cows (n = 13) Primiparous Cows (n = 13) Multiparous Cows (n = 12) Dam´s Parity Weaning Strategy Dam´s parity x Weaning strategy Ipsilateral diameter (mm) at 5.5 mo 7.51 ± 0.32 Y 7.74 ± 0.46 Y 7.05 ± 0.17 Y 7.99 ± 0.37 Y 0.10 0.76 0.32 at 8.5 mo 11.35 ± 0.50 X 11.20 ± 0.56 X 10.96 ± 0.35 X 11.81 ± 0.46 X 0.46 0.81 0.30 Contralateral diameter (mm) at 5.5 mo 4.29 ± 0.25 Y 4.56 ± 0.36 Y 4.17 ± 0.25 Y 5.58 ± 0.50 Y 0.02 0.21 0.11 at 8.5 mo 6.49 ± 0.26 X 6.29 ± 0.49 BX 6.32 ± 0.36 X 7.96 ± 0.52 AX 0.09 0.08 0.03 Ipsilateral RI (0–1) at 5.5 mo 0.49 ± 0.01 Y 0.49 ± 0.01 Y 0.50 ± 0.01 Y 0.50 ± 0.02 Y 0.91 0.79 0.91 at 8.5 mo 0.45 ± 0.02 X 0.46 ± 0.02 X 0.46 ± 0.01 X 0.48 ± 0.02 X 0.51 0.40 0.94 Contralateral RI (0–1) at 5.5 mo 0.57 ± 0.02 0.56 ± 0.02 0.56 ± 0.02 0.58 ± 0.02 0.71 0.83 0.63 at 8.5 mo 0.53 ± 0.02 0.56 ± 0.02 0.35 ± 0.02 0.55 ± 0.03 0.38 0.88 0.9 Ipsilateral TAMV (cm/s) at 5.5 mo 120.47 ± 10.08 Y 106.83 ± 6.29 Y 114.49 ± 3.77 Y 100.37 ± 6.77 Y 0.05 0.37 0.97 at 8.5 mo 150.52 ± 13.22 X 152.69 ± 9.96 X 155.74 ± 8.90 X 143.76 ± 8.50 X 0.63 0.85 0.49 Contralateral TAMV (cm/s) at 5.5 mo 45.54 ± 5.87 YZ 41.30 ± 5.29 Z 47.54 ± 5.00 YZ 49.68 ± 7.45 YZ 0.86 0.38 0.59 at 8.5 mo 92.13 ± 12.71 X 69.36 ± 9.48 XY 92.45 ± 12.35 X 86.96 ± 14.77 X 0.25 0.47 0.48 Ipsilateral UBF (L/min) at 5.5 mo 3.34 ± 0.45 Y 3.06 ± 0.33 Y 2.71 ± 0.17 Y 3.07 ± 0.38 Y 0.89 0.37 0.36 at 8.5 mo 8.96 ± 0.76 X 8.86 ± 0.67 X 8.82 ± 0.60 X 9.47 ± 0.82 X 0.70 0.74 0.60 Contralateral UBF (L/min) at 5.5 mo 0.44 ± 0.11 Y 0.45 ± 0.10 Y 0.43 ± 0.07 Y 0.78 ± 0.15 Y 0.12 0.15 0.14 at 8.5 mo 1.96 ± 0.36 X 1.62 ± 0.41 X 1.94 ± 0.36 X 2.86 ± 0.61 X 0.91 0.13 0.12 Abbreviations: RI, resistance index; UBF, uterine blood flow. Notes. A−B Main effects of interactions between treatment group and cows’ parity order category. XY Within a group means with a different letter differed between 5.5 and 8.5 mo ( P ≤ 0.05). otes. A−B 2.8 Statistical Analyses All statistical analyses were performed using SAS (version 9.2, SAS Institute Inc., Cary, NC USA). The experiment was analyzed as a 2 × 2 factorial with the main factors of the dam´s parity order [PRIMI and MULT for the hemodynamic characteristics, and SEC and MULT for the other characteristics] and weaning strategy [early and conventional]). The continuous dependent variables (BW, REA, RFT, BFT, BCS, gene expression, and uterine artery hemodynamics) were evaluated for the normality of the residuals by the Shapiro-Wilk test and homogeneity of variance by Levene´s test. When a normal distribution was not followed by the raw data, data were transformed into natural logarithms or ranked. Data were analyzed using PROC MIXED considering the effects of the weaning strategy, the dam´s parity, time, and their respective interaction. Results were expressed as mean ± SEM or proportion. Significant differences were declared at P ≤ 0.05 and a tendency was declared when P > 0.05 and P ≤ 0.10. 3. Results 3.1 Uterine Artery Blood Flow A significant triple interaction of parity × weaning strategy × time was not detected for any characteristic of uterine artery blood flow at 5.5 and 8.5 mo of pregnancy ( Table 4 ). At 5.5 mo, the diameter of the contralateral uterine artery was affected by dam’s parity ( P = 0.02 ), demonstrating that MULT cows presented a larger uterine artery than PRIMI cows. The TAMV of the ipsilateral uterine artery was affected by parity ( P = 0.05 ), demonstrating that PRIMI cows presented a higher TAMV than MULT cows. At 8.5 mo, only a significant interaction of weaning strategy × parity ( P = 0.03) was detected for the size of the contralateral uterine artery. A larger contralateral uterine artery was observed in MULT cows submitted to the conventional weaning, whereas no difference was observed between treatments in PRIMI cows. A time effect was observed for ipsilateral and contralateral uterine artery diameter, ipsilateral RI, ipsilateral TAMV, and ipsilateral and contralateral UBF. The time effect demonstrated that the above-mentioned variables increased from 5.5 mo to 8.5 mo, regardless of parity and weaning strategy ( Table 4 ). 3.2 Measures of Body Growth and Condition Score Heifer BW was not impacted by weaning strategy, dam´s parity, or time interactions for any time point evaluated. Heifers born from SEC cows tended ( P = 0.08 ) to be lighter than heifers from MULT over time points. When each moment of the evaluation was analyzed separately, heifers born from SEC cows tended to be lighter than heifers from MULT cows at 14 mo. An effect of time was also observed ( P < 0.0001 ) regardless of the weaning strategy or dam´s parity, demonstrating that body weight increases over time (Fig. 2 ). The weaning strategy, the dam´s parity, and time interactions did not affect the average daily gain. Still, it was affected by time ( P < 0.0001 ) regardless of the weaning strategy or the dam´s parity. The time effect demonstrated that the ADG increases after weaning until 15 mo, showing the greatest ADG between 14 to 15 mo (Fig. 3 ). The BCS was not impacted by the weaning strategy, the dam´s parity, or time interactions; however, it was affected by the dam´s parity ( P = 0.01 ) and time ( P < 0.0001 ). Heifers from MULT cows presented greater BCS than heifers born from SEC cows at 12 (4.00 ± 0.10 vs. 3.60 ± 0.10) and 14 mo (4.90 ± 0.11 vs. 4.56 ± 0.10) of age. Body condition score increased from 12 to 15 mo (Fig. 4 ). The REA and RFT of heifers were not impacted by weaning strategy, dam parity, or time interactions. The ribeye area and RFT were affected only by time ( P < 0.0001 ), showing that REA and RFT increased over the time points, regardless of weaning strategy or dam´s parity. The back fat thickness was affected by the dam´s parity by time interaction ( P = 0.008 ), by time ( P < 0.0001 ), and dam´s parity ( P = 0.01 ). The dam´s parity by time interaction showed that heifers from SEC cows presented a continuous BFT at 13 and 14 mo, and increased until 15 mo, while heifers from MULT cows presented a constant growth from 13 to 15 mo (Fig. 5 ). 3.3 Circulating Concentrations of Metabolites The plasma circulating concentrations of glucose, and serum concentration of IGF-I and leptin were not affected by interactions among weaning strategy, dam´s parity, or time. For plasma concentration of glucose and serum concentration of IGF-I (Fig. 6 ), only a significant effect of time ( P < 0.0001 and P = 0.02 , respectively) and a tendency for dam’s parity were detected ( P = 0.056 and P = 0.07 , respectively). The effect of time demonstrated that while the serum IGF-I concentrations increased from 12 to 16 mo of age, the plasma glucose concentrations decreased. The serum IGF-I at 12 and 16 mo of age, and plasma glucose concentrations at 12 and 14 mo of age, tended to be greater in heifers born from SEC than in MULT cows. 5.4.4. Hepatic Gene Expression Hepatic expression of GHR was not affect by the main effects of the dam´s parity, weaning strategy, and time, or their interactions (Fig. 7 ). Similarly, the hepatic expression of IGF-I was not influenced by dam´s parity, weaning strategy, or time interactions. However, it was significantly affect by time ( P = 0.01 ), with a lower expression of IGF-I observed at 14 mo than at 5 mo of age. The hepatic gene expression for IGFPB-I was only affected by the dam´s parity by time interaction ( P = 0.05 ), with 14 mo heifers from MULT cows having a higher IGFPB-I expression than heifers from SEC cows (Fig. 7 ). 4. Discussion Most studies on maternal nutrition focus on dietary restriction or supplementation, primarily from the second trimester of gestation, assessing the impact on offspring growth and productive performance in both taurine cattle (Long et al. 2011; Brockus et al. 2016a, b) and zebu cattle under tropical conditions (Marquez et al. 2017; Rodrigues et al. 2020; Ramírez-Zamudio et al. 2022; Nascimento et al. 2024; Costa et al. 2022; Cracco et al. 2023). However, the present study is the first to compare the effect of weaning time during the previous lactation on fetal development and its impacts on postnatal growth and metabolism of female Nelore offspring. Previous findings from the cows in this study indicated that early weaning positively influenced the metabolic status of the dams, as evidenced by better body condition, higher body weight, improved pregnancy rates in the subsequent breeding season, and an estimated increase in maternal tissue and gestational component weight (Nishimura et al., 2023a). However, early weaning did not seem to affect the body development of the heifers from birth or postnatal metabolism when compared to those born from dams subjected to conventional weaning. While Nishimura et al. (2023a) reported greater gestational component weights in early-weaned cows in the same herd, no significant differences in birth weight were observed in the present study. This discrepancy may be due to the use of equations for estimating gestational components (Gionbelli et al., 2015), which do not differentiate between fetal weight and other components like amniotic fluid and placenta. As a result, the increased weight of these gestational components may reflect the contribution of these elements alone, without directly influencing fetal weight. The uterine blood flow during pregnancy is essential for normal placental function and impacts fetal growth and development, influencing the health of the offspring throughout their subsequent life course (Reynolds et al. 2006). The formation of the uterine vascular network is intense during the first trimester of pregnancy (Reynolds et al. 2023), a period in which the number of placentomes is established (Neto et al. 2009) and remains constant throughout gestation (Laven & Peters 2001). The greater estimated weight of gestational components observed by Nishimura et al. (2023a) in early-weaned cows in this study may be related to the fact that these cows were in a phase of pregnancy (~ 74 days) where the redistribution of energy previously directed to lactation could have favored the development of these tissues, resulting in their greater formation. However, the results of this study regarding uterine blood supply to the fetus did not show significant changes during early pregnancy (~ 75 days), except at ~ 165 days of gestation, when multiparous cows from the conventional weaning group presented a larger contralateral uterine artery diameter compared to multiparous cows from the early weaning group. The absence of differences in uterine blood flow at ~ 75 days of gestation may be due to the relatively low nutritional demands of the fetus at this stage (Van Eetvelde et al. 2016), meaning that adaptations are not necessary. When fetal nutritional demands increase, as in the last trimester of pregnancy, dams that faced nutritional restriction during early gestation may compensate for placentome formation with an increase in size (Van Eetvelde et al. 2016), resulting in greater uterine blood flow associated with the larger mass of these structures (Ferrell, 1991). This study observed parity effects at ~ 75 days of gestation, with higher blood supply in multiparous cows due to a larger contralateral uterine artery size and greater blood flow in the ipsilateral artery. Growing dams have a high nutrient allocation priority for maternal tissue growth. On the other hand, the nutritional requirements of gestation at this early stage are relatively low, allowing pregnancy to proceed even with lower nutrient allocation (Van Eetvelde et al. 2016), which may explain why the uterine blood flow observed in secondiparous cows was lower. The dam´s parity effect observed on uterine blood supply could be associated with the increased growth and body development of the offspring from multiparous Nelore cows. Heifers from multiparous cows were heavier at 14 mo, and presented a greater BCS, BFT, and hepatic IGFBP-I upregulated at 14 mo than heifers born from secondiparous cows; but unexpectedly, heifers from secondiparous cows had greater circulating IGF-I and glucose concentration than heifers from multiparous cows. However, the greater body weight in heifers from multiparous cows could be caused by an effect during the suckling period, since according to Bitencourt et al. (2020) Nelore multiparous cows presented a higher milk production than primiparous or secundiparous cows. Nelore calves that had higher ingestion of milk during the lactational period presented a higher ADG during this period and consequently higher body weight at weaning (Nishimura et al. 2023b). Once heifers from multiparous cows presented a higher body weight, the BCS and BFT increased following the heifer's body development. It is known that the BCS evaluation is a good predictor of body fat deposition and reflects a good nutritional status (Ayres et al., 2014). A high correlation exists between heifers' body weight, body weight gain, BCS, and body fat deposition (Kause et al. 2014; Brunes et al. 2022), demonstrating that these characteristics can be evaluated for sexual precocity in young Nelore heifers. These features are good predictors of the heifer’s health and influence the heifer’s puberty onset, as time to puberty depends on many factors such as age, weight gain, genetics, fat deposition, and others (D’Occhio et al. 2019). According to the heifer’s development, some bloodstream metabolites and hormones are important for puberty onset, such as IGF-I, leptin, and glucose (Samadi et al. 2014). High circulating levels of IGF-I in early life can be related to earlier puberty onset in Bos taurus heifers, and IGF-I serum concentration is positively related to positive energy balance and good nutrition status associated with high fertility in cows (Ferraz et al. 2018). In addition, levels of leptin increase according to fat deposition, and adipose tissue is an important endocrine element that produces leptin and impacts the onset of puberty by stimulating the kisspeptin neurons in the hypothalamus and stimulating the secretion of GnRH (Cardoso et al. 2014). Prepubertal heifers during their body development deposit adipose tissue and increase leptin levels until stimulate kisspeptin release for pubertal maturation of GnRH neurons (Smith et al. 2006; Backholer et al. 2010). Glucose is another important metabolite that is influenced by nutritional conditions and affects hypothalamic areas for GnRH secretion (Evans and Anderson, 2017). Cows in better nutritional condition present a higher circulating glucose concentration, and heifers grazing improved pastures reach puberty earlier with a higher BCS compared to conventional pastures (Samadi et al. 2013, 2014). According to Samadi et al. (2014), levels of glucose increased following the heifer’s development. The glucose concentration during gestation changes according to the fetus's development and increased glucose requirements as gestation progresses. Ruminants generally use amino acids as precursors for gluconeogenesis to increase glucose circulatory levels (Moreira et al. 2021). For these reasons body energy mobilization is important. Interestingly, in the current trail BCS increased in heifers during the rearing period, but a decrease in glucose concentration was observed. Unfortunately, feed intake was not measured in the present study; however, this decrease in glucose concentration can be associated with the reduction in ADG from 15 to 16 mo, potentially due to reduced feed intake during this period. The reduction in forage quality and amount when heifers reached about 15 mo could be associated with the reduction in feed intake during this period changing the production and utilization of glucose by tissues, as suggested by others (Moreira et al. 2021). Despite the serum IGF-I concentration increasing over time in this study, the hepatic IGF-I gene expression decreased between 5 and 14 mo, while the IGFBP gene expression was higher at 14 mo in heifers from multiparous cows. This opposite profile of IGF-I serum concentrations and hepatic gene expression for IGF-I could be caused by a negative feedback mechanism of circulating IGF-I in the liver or by levels of IGFBP in the bloodstream. On the other hand, IGF-I hepatic production is directly dependent on GH binding in his receptor GHR (Mirzaie et al. 2023). The low expression of GHR1A reduces hepatic and circulatory IGF-I circulation, however, this effect is not likely in the present study as GHR gene expression was not altered between 5 and 14 mo. Although hepatic IGFBP gene expression was not altered over time, it may not reflect the IGFBP expression in circulation, as mRNA and protein levels for several proteins could not correspond (Bach, 2018). The IGF binding protein has the function of prolonging the IGF-I half-life and regulating their movement into the tissues (Bach, 2018). Therefore, the lower IGF-I concentration at 14 mo can also be related to a higher gene expression of IGFBP (Bach, 2018), having more IGF-I binding to the IGFBP and a lower free IGF-I concentration at this time point. In conclusion, the early weaning of the previous offspring at 150 days did not influence the uterine blood flow during the gestational phase and body development after birth. Heifers born from multiparous Nelore cows had greater body weight, BCS, BFT, and gene expression for IGFPB-I than those born from secondiparous cows. This effect can be due to greater nutritional support during suckling when multiparous cows produce more milk than first and second-parous cows (Restle et al. 2003). Thus, early weaning of the previous offspring did not influence the productive performance of the next generation but heifers from multiparous cows independently of the weaning strategy had improved characteristics that may favor their productive performance. Declarations Competing Interests The authors have no relevant financial or non-financial interests to disclose. Funding This work was supported by the São Paulo State Research Support Foundation (FAPESP [grant number 2017/18937-0]), National Council for Scientific and Technological Development Council (CNPq), and Biogenesis-Bagó Animal Ltda. Author contributions All authors contributed to the study conception and design. Material preparation, data collection and analysis were performed by Thiago Kan Nishimura, Matheus Sousa de Paula Carlis, Ana Clara Degan Matos, Isabela Rio Feltrin, Rodrigo Silva Goulart, Germán Darío Ramírez Zamudio, Saulo Luz Silva, Arlindo Saran Netto, Paulo Roberto Leme and Guilherme Pugliesi. The first draft of the manuscript was written by Thiago Kan Nishimura and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript. Acknowledgments The authors would like to acknowledge the University of São Paulo – Campus Fernando Costa for providing the animals and animals facilities. Sincere appreciation is also expressed to the staff of the University of São Paulo the students of the Department of Animal Reproduction from the School of Veterinary Medicine and Animal Science and the students of the Department of Animal Science from the School of Animal Science and Food Engineering. The authors acknowledge Paulo Fantinato for all the knowledge shared and help with hepatic biopsy. The authors also acknowledge FAPESP (2017/18937-0) for the financial support and CNPq for the scholarship provided to the first author, and also Biogenesis-Bagó Animal Ltda for providing estrus synchronization products for this study. Data Availability All data supporting the reported results can be found in this article. References Abitante G, Leme PR, de Paula Carlis MS, Ramírez-Zamudio GD, Gomes BIP, de Andrade LB, Goulart RS, Pugliesi G, Saran Netto A, Dahlen CR, Silva SL (2024). Effects of Early Weaning on Performance and Carcass Quality of Nellore Young Bulls. Animals (Basel) 14(5):779. doi: 10.3390/ani14050779. Ayres H, Ferreira RM, Torres-Júnior JRS, Demétrio CGB, Sá Filho MF, Gimenes LU, Penteado L, D’Occhio MJ, Baruselli OS (2014). Inferences of body energy reserves on conception rate ofsuckled Zebu beef cows subjected to timed artificial insemination followed by natural mating. Theriogenology 82:529–536. doi:10.1016/j.theriogenology.2014.04.026. Bach LA (2018). 40 years of IGF1: IGF-binding proteins. J. Mol. Endocrinol 61:T11–T28. doi:10.1530/JME-17-0254. Backholer K, Smith JT, Rao A, Pereira A, Iqbal J, Ogawa S, Li Q, Clarke IJ (2010). Kisspeptin cells in the ewe brain respond to leptin and communicate with neuropeptide Y and proopiomelanocortin cells. Endocrinology 151:2233–2243. doi:10.1210/en.2009-1190. Barcelos SS, Nascimento KB, Silva TED, Mezzomo R, Alves KS, de Souza Duarte M, Gionbelli MP (2022). The Effects of Prenatal Diet on Calf Performance and Perspectives for Fetal Programming Studies: A Meta-Analytical Investigation. Animals (Basel) 12(16):2145. doi: 10.3390/ani12162145. Barker DJP, Eriksson JG, Forsén T, Osmond C (2002). Fetal origins of adult disease: Strength of effects and biological basis. Int. J. Epidemiol 31:1235–1239. doi:10.1093/ije/31.6.1235. Bitencourt, MF, Cerdótes L, Restle J, Costa PT, Fernandes TA, Ferreira OGL, Silveira DD, Vaz RZ (2020). Age and calving time affects production efficiency of beef cows and their calves. An Acad Bras Cienc 20181058. doi:10.1590/0001-3765202020181058. Brockus KE, Hart CG, Fleming BO, Smith T, Ward SH, Lemley CO (2016a). Effects of Supplementing Holstein Heifers with Dietary Melatonin during Late Gestation on Growth and Cardiovascular Measurements of their Offspring. Reprod. Domest. Anim 51:240–247. doi:10.1111/RDA.12672. Brockus KE, Hart CG, Gilfeather CL, Fleming BO, Lemley CO (2016b). Dietary melatonin alters uterine artery hemodynamics in pregnant Holstein heifers. Domest. Anim. Endocrinol 55:1–10. doi:10.1016/j.domaniend.2015.10.006. Brunes LC, Baldi FS, Costa MFOE, Quintans G, Banchero G, Lôbo RB, Claudio U (2022). Early growth , backfat thickness and body condition has major effect on early heifer pregnancy in Nellore cattle. Annals of the Brazilian Academy of Sciences 94:1–18. doi:10.1590/0001-3765202120191559. Cardoso RC, Alves BRC, Prezotto LD, Thorson JF, Tedeschi LO, Keisler DH, Park CS, Amstalden M, Williams GL (2014). Use of a stair-step compensatory gain nutritional regimen to program the onset of puberty in beef heifers. J. Anim. Sci. 92:2942–2949. doi:10.2527/jas.2014-7713. Carriquiry M, Weber WJ, Fahrenkrug SC, Crooker BA (2009). Hepatic gene expression in multiparous Holstein cows treated with bovine somatotropin and fed n-3 fatty acids in early lactation 1. J. Dairy Sci. 92:4889–4900. doi:10.3168/jds.2008-1676. Costa e Silva LF, Engle TE, de Valadares Filho S, Rotta PP, Villadiego FAC, Silva FAS, Martins EC, Silva LHR, Paulino MF (2015). Nellore cows and their calves during the lactation period: Performance, intake, milk composition, and total apparent digestibility. Trop. Anim. Health Prod. 47:735–741. doi: 10.1007/s11250-015-0787-6. Costa TC, Lourenço PEC, Souza RO, Lopes MM, Araújo RD, Santos MM, Luciano LP, Massensini JD, Chalfun LLH, Rennó LN, Sampaio CB, Veroneze R, Paulino PVR, Gionbelli MP, Duarte MS (2022). Ruminal undegradable protein enriched diet during late gestation of beef cows affects maternal metabolism and offspring’s skeletal muscle development. Animal Feed Science and Technology 291:115400. https://doi.org/10.1016/j.anifeedsci.2022.115400. Cracco RC, Ruy IM, Polizel GHG, Fernandes AC, Furlan É, Baldin GC, Santos GEC, Santana MHA (2023). Evaluation of Maternal Nutrition Effects in the Lifelong Performance of Male Beef Cattle Offspring. Vet Sci. 10(7):443. doi: 10.3390/vetsci10070443. Dahlen CR, Borowicz PP, Ward AK, Caton JS, Czernik M, Palazzese L, Loi P, Reynolds LP (2021). Programming of Embryonic Development. Int J Mol Sci. 22(21):11668. doi: 10.3390/ijms222111668. D'Occhio MJ, Baruselli PS, Campanile G (2019). Influence of nutrition, body condition, and metabolic status on reproduction in female beef cattle: A review. Theriogenology 125:277-284. doi: 10.1016/j.theriogenology.2018.11.010. Du M, Tong J, Zhao J, Underwood KR, Zhu M, Ford SP, Nathanielsz PW (2010). Fetal programming of skeletal muscle development in ruminant animals. J Anim Sci. 88:E51-60. doi: 10.2527/jas.2009-2311. Enríquez D, Hötzel MJ, Ungerfeld R (2011). Minimising the stress of weaning of beef calves: a review. Acta Vet Scand. 53:28. https://doi.org/10.1186/1751-0147-53-28. Evans MC, Anderson GM (2017). Neuroendocrine integration of nutritional signals on reproduction. J. Mol. Endocrinol. 58:R107–R128. doi:10.1530/JME-16-0212. Ferraz JBS, de Felício PE (2010). Production systems – An example from Brazil. Meat Science. 84:238-243. https://doi.org/10.1016/j.meatsci.2009.06.006. Ferraz MVC, Pires AV, Santos MH, Silva RG, Oliveira GB, Polizel DM, Biehl MV, Sartori R, Nogueira GP (2018). A combination of nutrition and genetics is able to reduce age at puberty in Nelore heifers to below 18 months. Animal 12(3):569-574. doi: 10.1017/S1751731117002464. Ferrell CL (1991). Maternal and fetal influences on uterine and conceptus development in the cow: II. Blood flow and nutrient flux. Journal of Animal Science 69(5):1954-1965. doi: 10.2527/1991.6951954x. Gionbelli MP, Duarte MS, Valadares Filho SC, Detmann E, Chizzotti ML, Rodrigues FC, Zanetti D, Gionbelli TR, Machado MG (2015). Achieving body weight adjustments for feeding status and pregnant or non-pregnant condition in beef cows. PLoS One 10(3):e0112111. doi: 10.1371/journal.pone.0112111. Gröhn Y, Lindberg LA (1982). Methodological aspects of the microscopy of bovine liver biopsies. J. Comp. Pathol. 92:567–578. doi:10.1016/0021-9975(82)90009-3. Kause A, Mikkola L, Strandén I, Sirkko K (2014). Genetic parameters for carcass weight, conformation and fat in five beef cattle breeds. Animal 9:35–42. doi:10.1017/S1751731114001992. Laven RA, & Peters AR (2001). Gross morphometry of the bovine placentome during gestation. Reproduction in Domestic Animals 36(6):289-296. doi: 10.1046/j.1439-0531.2001.00297.x. Long NM, Tousley CB, Underwood KR, Paisley SI, Means WJ, Hess BW, Du M, Ford SP (2012). Effects of early- to mid-gestational undernutrition with or without protein supplementation on offspring growth, carcass characteristics, and adipocyte size in beef cattle. J Anim Sci. 90(1):197-206. doi: 10.2527/jas.2011-4237. Marquez DC, Paulino MF, Rennó LN, Villadiego FC, Ortega RM, Moreno DS, Martins LS, de Almeida DM, Gionbelli MP, Manso MR, Melo LP, Moura FH, Duarte MS (2017). Supplementation of grazing beef cows during gestation as a strategy to improve skeletal muscle development of the offspring. Animal 11(12):2184-2192. doi: 10.1017/S1751731117000982. Menezes ACB, Dahlen CR, McCarthy KL, Kassetas CJ, Baumgaertner F, Kirsch JD, Dorsam ST, Neville TL, Ward AK, Borowicz PP, Reynolds LP, Sedivec KK, Forcherio JC, Scott R, Caton JS, Crouse MS (2023). Fetal Hepatic Lipidome Is More Greatly Affected by Maternal Rate of Gain Compared with Vitamin and Mineral Supplementation at day 83 of Gestation. Metabolites 13(2):175. doi: 10.3390/metabo13020175. Mirzaie S, Yousefi AR, Masoumi R, Rostami B, Amanlou H (2023). The effect of dietary pioglitazone supplementation on milk yield, insulin sensitivity and GH–IGF-I axis in Holstein dairy cows during the transition period. Vet. Med. Sci. 9:336–344. doi:10.1002/vms3.1018. Moreira GM, Aguiar GL, Meneses JAM, Luz MH, Monteiro MGBB, Lara L, Ladeira MM, Souza JC, Souza Duarte M, Gionbelli MP (2021). The course of pregnancy changes general metabolism and affects ruminal epithelium activity pattern in Zebu beef heifers. Livest. Sci. 248: 104496. doi:10.1016/j.livsci.2021.104496. Moreira GM, Aguiar GL, Meneses JAM, Nascimento KB, Ramirez-Zamudio GD, Costa TC, Duarte MS, Casagrande DR, Gionbelli MP (2024). Pregnancy affects maternal performance, feed intake, and digestion kinetics parameters in beef heifers. Journal of Animal Science. ( In press ). Moriel P, Palmer EA, Harvey KM, Cooke RF (2021). Improving beef progeny performance through developmental programming. Frontiers in Animal Science 2:728635. https://doi.org/10.3389/fanim.2021.728635. Nascimento KB, Galvão MC, Meneses JAM, Ramírez-Zamudio GD, Pereira DG, Paulino PVR, Casagrande DR, Gionbelli TRS, Ladeira MM, Duarte MS, Loor JJ, Gionbelli MP (2024). Maternal protein supplementation during mid-gestation improves offspring performance and metabolism in beef cows. J Anim Sci. 102:skae058. doi: 10.1093/jas/skae058. Nasem (National Academies of Sciences, Engineering and Medicine) (2016). Nutrient Requirements of Beef Cattle. 8th rev. Washington, DC: The National Academies Press. Neto ACD, Morceli JAB, Fonseca RD, Ambrósio CE, Pereira FT, Miglino MA (2009). Biometrics evolution of the embryonic and fetal annexes in cows obtained by natural mating, at 10 to 70 days of gestation. Pesquisa Veterinária Brasileira 29:859-862. https://doi.org/10.1590/S0100-736X2009001000014. Nishimura TK, da Silva AG, Abitante G, Dahlen CR, Goulart RS, Zamudio GDR, Luz Silva S, Santana MHA, Saran Netto A, Leme PR, Pugliesi G (2023). Effects of early weaning on the reproductive performance of suckled Nelore cows in the subsequent breeding season. J Anim Sci. 101:skad330. doi: 10.1093/jas/skad330. Nishimura TK, Goulart RS, Ramírez-Zamudio GD, Silva AG, Paula Carlis MS, Abitante G, Silva SL, Dahlen CR, Netto AS, Leme PR, Pugliesi G (2023b). Effects of early weaning on productive and reproductive performance of Nelore heifers. J. Anim. Sci. 101:1–13. doi:10.1093/jas/skad379. de Oliveira LOF, de Abreu UGP, da Costa Gomes R, Nogueira É, Silva JCB, Costa TG (2019). Productive performance of pre-weaned calves reared in the Pantanal. Cienc. Anim. Bras. 20:1–12. doi:10.1590/1809-6891v20e-51187. Paradis F, Wood KM, Swanson KC, Miller SP, McBride BW, Fitzsimmons C (2017). Maternal nutrient restriction in mid-to-late gestation influences fetal mRNA expression in muscle tissues in beef cattle. BMC Genomics 18(1):632. doi: 10.1186/s12864-017-4051-5. Pfaffl MW (2001). A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29:e45. doi: 10.1093/nar/29.9.e45. Ramírez-Zamudio GD, da Cruz WF, Schoonmaker JP, de Resende FD, Siqueira GR, Neto ORM, Gionbelli TRS, Teixeira PD, Rodrigues LM, Gionbelli MP, Ladeira MM (2022). Effect of rumen-protected fat on performance, carcass characteristics and beef quality of the progeny from Nellore cows fed by different planes of nutrition during gestation. Livestock Science 258: 104851. https://doi.org/10.1016/j.livsci.2022.104851. Rio Feltrin I, Guimarães da Silva A, Rocha CC, Ferraz PA, da Silva Rosa PM, Martins T, Coelho da Silveira J, Oliveira ML, Binelli M, Pugliesi G, Membrive CMB (2024). Effects of 17β-estradiol on the uterine luteolytic cascade in bovine females at the end of diestrus. Theriogenology 213:1-10. doi: 10.1016/j.theriogenology.2023.09.019. Restle J, Vaz RZ, Alves Filho DC, De LC Bernardes, RA, Pascoal LL, De Senna DB, Polli VA (2001). Desempenho de vacas Charolês e Nelore desterneiradas aos três ou sete meses. Rev. Bras. Zootec. 30: 499–507. doi:10.1590/s1516-35982001000200029. Restle J, Pacheco PS, Moletta JL, Brondani IL, Cerdótes L (2003). Grupo genético e nível nutricional pós-parto na produção e composição do leite de vacas de corte. Rev. Bras. Zootec. 32:585–597. doi:10.1590/s1516-35982003000300010. Reynolds LP, Caton JS, Redmer DA, Grazul-Bilska AT, Vonnahme KA, Borowicz PP, Luther JS, Wallace JM, Wu G, Spencer TE (2006). Evidence for altered placental blood flow and vascularity in compromised pregnancies. J Physiol. 572:51-8. doi: 10.1113/jphysiol.2005.104430. Reynolds LP, Dahlen CR, Ward AK, Crouse MS, Borowicz PP, Davila-Ruiz BJ, Kanjanaruch C, Bochantin KA, McLean KJ, McCarthy KL, Menezes ACB, Diniz WJS, Cushman RA, Caton JS (2023). Role of the placenta in developmental programming: Observations from models using large animals. Anim Reprod Sci. 257:107322. doi: 10.1016/j.anireprosci.2023.107322. Rodrigues LM, Schoonmaker JP, Resende FD, Siqueira GR, Neto ORM, Gionbelli MP, Gionbelli TRS, Ladeira MM (2020). Effects of protein supplementation on Nellore cows’ reproductive performance, growth, myogenesis, lipogenesis and intestine development of the progeny. Animal Production Science 61:371-380. https://doi.org/10.1071/AN20498. Samadi F, Phillips NJ, Blache D, Martin GB, D'Occhio MJ (2013). Interrelationships of nutrition, metabolic hormones and resumption of ovulation in multiparous suckled beef cows on subtropical pastures. Anim Reprod Sci. 137(3-4):137-44. doi: 10.1016/j.anireprosci.2012.12.012. Samadi F, Blache D, Martin GB, D'Occhio MJ (2014). Nutrition, metabolic profiles and puberty in Brahman (Bos indicus) beef heifers. Anim Reprod Sci. 146(3-4):134-42. doi: 10.1016/j.anireprosci.2014.03.004. Silva SdL, Tarouco JU, Ferraz JBS, Gomes RdC, Leme PR, Navajas EA (2012). Prediction of retail beef yield, trimfat and proportion of high-valued cuts in Nellore cattle using ultrasound live measurements. Rev. Bras. Zootec. 41:2025–2031. https://doi.org/10.1590/S1516-35982012000900009. Smith JT, Acohido BV, Clifton DK, Steiner RA (2006). KiSS-1 neurones are direct targets for leptin in the ob/ob mouse. J. Neuroendocrinol. 18:298–303. doi:10.1111/j.1365-2826.2006.01417.x. Van Eetvelde M, Kamal MM, Hostens M, Vandaele L, Fiems LO, Opsomer G (2016). Evidence for placental compensation in cattle. Animal 10(8):1342-1350. https://doi.org/10.1017/S1751731116000318. Vaz RZ, Lobato JFP (2010). Effect of weaning age on beef heifers growth until 14/15 months of age. Rev. Bras. Zootec. 39:289–298. doi: 10.1590/S1516-35982010000200010. Wagner JJ (1988). Carcass composition in mature hereford cows : estimation and effect on dally metabolizable energy r equ ir em ent during. J. Anim. Sci. 66:603–612. doi: 10.2527/jas1988.663603x. Wiseman A, Redden M, McGee A, Spencer C, Reuter R, Horn G, Lalman D (2019). Effects of timing of weaning on energy utilization in primiparous beef cows and post-weaning performance of their progeny1. J Anim Sci. 97(3):1198-1211. doi: 10.1093/jas/skz019. Cite Share Download PDF Status: Published Journal Publication published 25 Jun, 2025 Read the published version in Tropical Animal Health and Production → Version 1 posted Reviewers agreed at journal 10 Feb, 2025 Reviewers invited by journal 03 Feb, 2025 Editor assigned by journal 27 Jan, 2025 First submitted to journal 27 Jan, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5882997","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":410496509,"identity":"62127e2f-e326-425e-8d5f-b8d602044e6c","order_by":0,"name":"Thiago Kan Nishimura","email":"","orcid":"","institution":"University of Sao Paulo: Universidade de Sao Paulo","correspondingAuthor":false,"prefix":"","firstName":"Thiago","middleName":"Kan","lastName":"Nishimura","suffix":""},{"id":410496510,"identity":"88cab1e7-a18a-4963-800d-0eb60ea0c858","order_by":1,"name":"Matheus Sousa de Paula Carlis","email":"","orcid":"","institution":"University of Sao Paulo: Universidade de Sao Paulo","correspondingAuthor":false,"prefix":"","firstName":"Matheus","middleName":"Sousa de Paula","lastName":"Carlis","suffix":""},{"id":410496511,"identity":"d2a5305d-383b-4b33-b2fd-8c46f28f27f1","order_by":2,"name":"Ana Clara Degan Matos","email":"","orcid":"","institution":"University of Sao Paulo: Universidade de Sao Paulo","correspondingAuthor":false,"prefix":"","firstName":"Ana","middleName":"Clara Degan","lastName":"Matos","suffix":""},{"id":410496512,"identity":"76d918fe-ff9f-4cb5-8b34-98f43dcd6dac","order_by":3,"name":"Isabella Rio Feltrin","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA/klEQVRIie3Qr2vDQBTA8XcEniqLfSMi/8ILg6RiY/9KwqA1YQwqVlVOdaYQmz9jMCgVEw8qavIHRJXMRE20ZkxM7BZVCpdUTtyXgzsOPtwPAJfrH4bdeBoDeKIEgMD/21Z6iDCZKQURQ671AIEzYtYyQK78bdscmEJAT7bH9/HjTT1tG7XZ24+gSRKVTJFGTEVamsV1nrCqZj0E4mDEpHS4YhGhbF3nSGqZ2om/+wp+mO41+oeOvJXTtp9AHgfm+ZnGEXTkldK4n1D+HK2YHpaILJUhZfWZcFbZSVjs1s33/PauQO+jmcsiK17Mjx03dnJyw9P1BcDOXS6XywW/GjtTHji1EJAAAAAASUVORK5CYII=","orcid":"https://orcid.org/0000-0001-9747-9385","institution":"University of Sao Paulo: Universidade de Sao Paulo","correspondingAuthor":true,"prefix":"","firstName":"Isabella","middleName":"Rio","lastName":"Feltrin","suffix":""},{"id":410496513,"identity":"ccf1d8dc-4209-4de7-b147-10e4fc188149","order_by":4,"name":"Rodrigo Silva Goulart","email":"","orcid":"","institution":"University of Sao Paulo: Universidade de Sao Paulo","correspondingAuthor":false,"prefix":"","firstName":"Rodrigo","middleName":"Silva","lastName":"Goulart","suffix":""},{"id":410496514,"identity":"8f0ab8b2-ec30-4675-a259-25f3866e2457","order_by":5,"name":"Germán Darío Ramírez Zamudio","email":"","orcid":"","institution":"University of Sao Paulo: Universidade de Sao Paulo","correspondingAuthor":false,"prefix":"","firstName":"Germán","middleName":"Darío Ramírez","lastName":"Zamudio","suffix":""},{"id":410496515,"identity":"a6c81231-a9da-406a-bedd-c7e4a3b1e06c","order_by":6,"name":"Saulo Luz Silva","email":"","orcid":"","institution":"University of Sao Paulo: Universidade de Sao Paulo","correspondingAuthor":false,"prefix":"","firstName":"Saulo","middleName":"Luz","lastName":"Silva","suffix":""},{"id":410496516,"identity":"07075e8f-7788-4d3d-b2b5-e90bf95670c2","order_by":7,"name":"Arlindo Saran Netto","email":"","orcid":"","institution":"University of Sao Paulo: Universidade de Sao Paulo","correspondingAuthor":false,"prefix":"","firstName":"Arlindo","middleName":"Saran","lastName":"Netto","suffix":""},{"id":410496517,"identity":"23fdcae2-fc14-434c-afad-89cd0587f09f","order_by":8,"name":"Paulo Roberto Leme","email":"","orcid":"","institution":"University of Sao Paulo: Universidade de Sao Paulo","correspondingAuthor":false,"prefix":"","firstName":"Paulo","middleName":"Roberto","lastName":"Leme","suffix":""},{"id":410496518,"identity":"ceaebe21-73c7-425b-8a0b-7f3af592399c","order_by":9,"name":"Guilherme Pugliesi","email":"","orcid":"","institution":"University of Sao Paulo: Universidade de Sao Paulo","correspondingAuthor":false,"prefix":"","firstName":"Guilherme","middleName":"","lastName":"Pugliesi","suffix":""}],"badges":[],"createdAt":"2025-01-22 18:09:44","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5882997/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5882997/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s11250-025-04535-z","type":"published","date":"2025-06-25T15:57:33+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":75495891,"identity":"fe64ec33-c934-49cd-8f68-d6eab7027da2","added_by":"auto","created_at":"2025-02-05 08:15:20","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":60816,"visible":true,"origin":"","legend":"\u003cp\u003eSchematic of experimental design to evaluate the productive performance of Nelore heifers fetal programmed by early (150 days) or conventional (240 days) weaning strategies of the previous offspring. Abbreviations: BCS: body condition score; IGF-I: insulin-like growth factor-I, TAI: timed artificial insemination.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-5882997/v1/a780c1a4119adb49cd94ca4c.png"},{"id":75496468,"identity":"f9dd0863-cdd8-42a3-9878-2843f5c8b1d5","added_by":"auto","created_at":"2025-02-05 08:23:20","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":68289,"visible":true,"origin":"","legend":"\u003cp\u003eMean ± SEM of body weight in Nelore heifers from secondiparous (SEC) and multiparous (MULT) dams that were fetal programmed by early (150 d of age) or conventional (240 d of age) weaning of the previous offspring. Main effects of dam´s parity (D), and time (T) that were significant or approached are shown. (#) Indicate tendency (\u003cem\u003eP \u003c/em\u003e\u0026gt; 0.05 ≤ 0.1) in weight within times.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-5882997/v1/336a47f8f8bcd9cf953d683f.png"},{"id":75496470,"identity":"d9c44edb-359b-4b70-99c7-8905f44d8a38","added_by":"auto","created_at":"2025-02-05 08:23:20","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":39020,"visible":true,"origin":"","legend":"\u003cp\u003eMean ± SEM of average daily gain in Nelore heifers from secondiparous (SEC) and multiparous (MULT) dams that were fetal programmed by early (150 d of age) or conventional (240 d of age) weaning of the previous offspring. Main effects of time (T) that were significant or approached are shown.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-5882997/v1/1fdc7095f7741aad4f8b94f9.png"},{"id":75495893,"identity":"5704e12b-277c-4ada-8ea1-c36edf714acf","added_by":"auto","created_at":"2025-02-05 08:15:20","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":51858,"visible":true,"origin":"","legend":"\u003cp\u003eMean ± SEM of body condition score in Nelore heifers from secondiparous (SEC) and multiparous (MULT) dams that were fetal programmed by early (150 d of age) or conventional (240 d of age) weaning of the previous offspring. Main effects of dam´s parity (D), and time (T) that were significant or approached are shown. (*) Indicate difference (\u003cem\u003eP \u003c/em\u003e\u0026lt; 0.05) in weight among times.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-5882997/v1/1ab3220218709fa346351d84.png"},{"id":75496471,"identity":"17f0a32e-7a9f-4c74-82eb-7db1c65676ec","added_by":"auto","created_at":"2025-02-05 08:23:20","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":42531,"visible":true,"origin":"","legend":"\u003cp\u003eMean ± SEM of back fat thickness (BFT) in Nelore heifers from secondiparous (SEC) and multiparous (MULT) dams that were fetal programmed by early (150 d of age) or conventional (240 d of age) weaning of the previous offspring. Main effects of dam´s parity (D), time (T), and dam´s parity by time interaction (D*T) that were significant or approached are shown. (*) Indicate difference (\u003cem\u003eP \u003c/em\u003e\u0026lt; 0.05) in weight among times\u003csup\u003e. a-c\u003c/sup\u003e Within a group, means without a common letter differed (\u003cem\u003eP \u003c/em\u003e\u0026lt; 0.05).\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-5882997/v1/0248d63a4690123105a07fb8.png"},{"id":75497597,"identity":"d2a7618b-0c8f-43cf-b96b-de509322db23","added_by":"auto","created_at":"2025-02-05 08:31:20","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":79514,"visible":true,"origin":"","legend":"\u003cp\u003eMean ± SEM of serum IGF-I and plasma glucose concentration in Nelore heifers from secondiparous (SEC) and multiparous (MULT) dams that were fetal programmed by early (150 d of age) or conventional (240 d of age) weaning of the previous offspring. Main effects of dam´s parity (D), and time (T) that were significant or approached are shown. (*) Indicate difference (\u003cem\u003eP \u003c/em\u003e\u0026lt; 0.05) in IGF-I, and glucose concentration among times and (#) indicate a tendency (\u003cem\u003eP \u003c/em\u003e\u0026gt; 0.05 and \u003cem\u003eP \u003c/em\u003e≤ 0.1) among times. \u003csup\u003ea-c\u003c/sup\u003e Within a group, means without a common letter differed (\u003cem\u003eP \u003c/em\u003e\u0026lt; 0.05).\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-5882997/v1/5c1cf76dc0519d7a4fe80651.png"},{"id":75495901,"identity":"eddaf400-85e5-4a87-a060-98cbaa9964f5","added_by":"auto","created_at":"2025-02-05 08:15:20","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":71738,"visible":true,"origin":"","legend":"\u003cp\u003eMean ± SEM of hepatic gene expression at 5 and 14 mo of age in Nelore heifers from secondiparous (SEC) and multiparous (MULT) dams that were fetal programmed by early (150 d of age) or conventional (240 d of age) weaning of the previous offspring. Main effects of dam´s parity (D), time (T), and dam´s parity and time interaction (D*T) that were significant or approached are shown. (*) Indicate difference (\u003cem\u003eP \u003c/em\u003e\u0026lt; 0.05) and (#) indicates a tendency (\u003cem\u003eP \u003c/em\u003e\u0026gt; 0.05 and \u003cem\u003eP \u003c/em\u003e≤ 0.1) among times.\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-5882997/v1/ef2fedcc8423c1056103369c.png"},{"id":85686207,"identity":"ec9d6025-bcbd-43eb-b396-1c288ed00214","added_by":"auto","created_at":"2025-06-30 16:04:53","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1706954,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5882997/v1/72e3a1f3-9797-46ba-b426-94675b18ff48.pdf"}],"financialInterests":"","formattedTitle":"Can early weaning in the previous lactation of beef cows affect the metabolism and postnatal development of female offspring?","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eMilk is an essential nutritional source for calf growth during the first months of life. However, from the fourth month of lactation in Nelore cows, it no longer meets the nutritional needs of the calves (Costa e Silva et al. 2015). In extensive tropical systems, predominant in Brazil with Zebu beef breeds, weaning generally occurs between 7 and 8 months of age (Ferraz \u0026amp; Fel\u0026iacute;cio. 2010). To maintain a 12-month calving interval, cows must conceive by 75 days postpartum, which presents a significant challenge due to the increased energy requirements of lactating cows (Restle et al. 2001; Vaz et al. 2010; Wiseman et al. 2019). Moreover, as gestation progresses, lactating cows have a reduced ability to accumulate body reserves, which can compromise fetal development and lower pregnancy rates in the subsequent breeding season (Nishimura et al. 2023a). This effect is even more pronounced in primiparous cows, as they require more energy for growth than mature cows (Nasem 2016).\u003c/p\u003e \u003cp\u003eEarly weaning in beef cows is a strategy used to reduce energy requirements (de Oliveira et al. 2019; Wiseman et al. 2019). Additionally, this practice provides a window for body reserve recovery (Nishimura et al. 2023a), as in the last trimester of gestation, nutritional demands increase and homeorhetic changes reduce rumen size to accommodate the expanding gravid uterus, impacting voluntary feed intake by the cow (Moreira et al. 2024, \u003cem\u003ein press\u003c/em\u003e). Regarding the weaned calves, previous publications from our research group indicated that early weaning may reduce body weight only during the weaning period. However, post-weaning performance, both productive in bulls (Abitante et al. 2024) and reproductive in heifers (Nishimura et al. 2023a), is not affected.\u003c/p\u003e \u003cp\u003eDevelopmental programming emerged from evidence linking low birth weight, caused by poor maternal nutrition, to the incidence of metabolic diseases in adulthood (Barker et al. 2002). These modifications in the maternal environment can modulate tissue development and fetal metabolism (Dahlen et al. 2021; Costa et al. 2022; Menezes et al. 2023), regulated by genes (Paradis et al. 2017), resulting in primarily irreversible consequences for postnatal outcomes in offspring (Du et al. 2010). Studies on maternal nutrition in cattle have focused mainly on the second and last trimesters of gestation (Moriel et al. 2021; Barcelos et al. 2022), with emphasis on the effects of protein supplementation on offspring development in tropical conditions such as Brazil (Marquez et al. 2017; Rodrigues et al. 2020; Ram\u0026iacute;rez-Zamudio et al. 2022; Nascimento et al. 2024; Costa et al. 2022; Cracco et al. 2023).\u003c/p\u003e \u003cp\u003eIn our research model, however, early weaning, coinciding with approximately 80 days of gestation, can redirect energy previously used for lactation to other physiological functions, such as fetal development and maternal body reserve maintenance. This effect may have implications for offspring outcomes, potentially different from those observed in studies involving maternal supplementation, although this has yet to be investigated. Thus, the present study aimed to evaluate the effect of early or conventional weaning and cow parity order in Nelore cows (secondiparous [SEC] and multiparous [MULT]) on their female offspring's growth and postnatal metabolism.\u003c/p\u003e"},{"header":"2. Material and Methods","content":"\u003cp\u003e This experiment was approved by the Commission on Ethics in Animal Use of the College of Animal Science and Food Engineering (FZEA) of the University of S\u0026atilde;o Paulo (USP) (CEUA N\u0026ordm;: 2350310123) and was conducted at the Fernando Costa campus of the University of S\u0026atilde;o Paulo in Pirassununga, SP.\u003c/p\u003e \u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e\u003cb\u003e2.1 Animals and Experimental Design\u003c/b\u003e\u003c/h2\u003e \u003cp\u003ePrimiparous (PRIMI) and MULT Nelore cows that became pregnant (n\u0026thinsp;=\u0026thinsp;208) through TAI using semen from three Nelore sires during the 2020 breeding season were assigned to early weaning (EW) at 150 days (average: 149\u0026thinsp;\u0026plusmn;\u0026thinsp;2) or conventional weaning (CW) at 240 days (average: 247\u0026thinsp;\u0026plusmn;\u0026thinsp;2). Detailed information regarding the treatments and their effects on cow performance, hormone levels, metabolites, and pregnancy outcomes has been previously reported by Nishimura et al. 2023a. Among these cows, during the 2021 calving season (September to October), 55 female calves (25 born from cows that underwent early weaning [15 born from MULT cows, and 10 from SEC cows] and 30 born from cows that underwent conventional weaning [15 born from MULT cows, and 15 from SEC cows) were used as experimental units in the current experiment \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e\u003cb\u003e).\u003c/b\u003e\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2 General Management\u003c/h2\u003e \u003cp\u003eAt birth, all calves were identified with a tattoo, treated with a navel iodine dip, and received antiparasitic treatment (Doramectina, Dectomax\u0026reg;, 1 mL). Their body weight (BW) was also recorded. Based on the calving date, cow-calf pairs were assigned to 40 to 50 pairs of breeding groups each. These groups were managed in \u003cem\u003eUrochloa ssp.\u003c/em\u003e paddocks with free access to water and daily protein supplementation. During the dry season (April to September), they received a supplement containing 30.1% crude protein (CP) and 42.0% total digestible nutrients (TDN) at a rate of 1 g/kg of BW, while during the wet season (October to March), the supplement contained 26.1% CP and 50.5% TDN at the same rate. Starting at 90 days of age, calves had access to supplemental creep-feed in a designated creep area (5 \u0026times; 10 m) with 2.5 linear meters of bunk space designed to exclude cows. The creep-feed aimed for an average intake of 5 g/kg of BW per day and provided a supplement with 26.3% CP and 80.7% TDN (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eIngredient composition of cow\u0026acute;s supplement and creep-feed and grazing supplement to Nelore cows and heifers programmed by early or conventional weaning of the previous offspring.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eCow supplement\u003csup\u003eA\u003c/sup\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c6\" namest=\"c5\"\u003e \u003cp\u003eCalf supplement\u003csup\u003eB\u003c/sup\u003e\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIngredient\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eProtein supplement \u0026ndash; Dry season\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eEnergy and protein supplement \u0026ndash; Wet season\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003eCreep-feed\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eEnergy and protein supplement \u0026ndash; Grazing period\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"6\" nameend=\"c6\" namest=\"c1\"\u003e \u003cp\u003eIngredient, % dry matter\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCorn ground\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e32.50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e48.50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e59.50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e63.98\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSoybean meal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e─\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e─\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e35.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e24.89\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCottonseed meal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e25.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e40.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e─\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e─\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSalt\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e25.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e4.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e5.59\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eUrea\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e10.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e─\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e3.32\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMineral supplement, %\u003csup\u003e1\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e7.50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2.50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e2.21\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"6\" nameend=\"c6\" namest=\"c1\"\u003e \u003cp\u003eChemical composition, %\u003csup\u003e2\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDM\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e93.02\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e90.60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e86.18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e80.36\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e41.05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e31.65\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e23.76\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e32.30\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eEE\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1.86\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2.83\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2.48\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e2.60\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eADF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e─\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e─\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e10.11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e10.40\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNDF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e10.31\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e16.16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e22.49\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e4.80\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAsh\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e─\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e─\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e7.90\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e6.20\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"6\" nameend=\"c6\" namest=\"c1\"\u003e \u003cp\u003e\u003csup\u003e1\u003c/sup\u003eMineral supplement included: 1.00% trace mineral premix holding 230g Ca, 160g P, 60g S, 160mg Co, 160mg Cu, 135mg I, 2.700mg Mn, 8.100mg Zn, and 4.000 of monensin sodium.\u003c/p\u003e \u003cp\u003e\u003csup\u003e2\u003c/sup\u003eDM= dry matter, CP\u0026thinsp;=\u0026thinsp;crude protein, EE\u0026thinsp;=\u0026thinsp;ether extract, ADF\u0026thinsp;=\u0026thinsp;acid detergent fiber, NDF\u0026thinsp;=\u0026thinsp;neutral detergent fiber.\u003c/p\u003e \u003cp\u003e\u003csup\u003eA\u003c/sup\u003eCows received dry season supplement from May to October and wet season supplement from November to April.\u003c/p\u003e \u003cp\u003e\u003csup\u003eB\u003c/sup\u003eCalves received creep feed from 90 days until 5 months of live, thereafter, received energy and protein supplement from 5 to 16 month.\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eAll calves were weaned at 150\u0026thinsp;\u0026plusmn;\u0026thinsp;1 days of age through permanent separation from their dams in a single event (Enr\u0026iacute;quez et al., 2011). After weaning, they were moved to separate \u003cem\u003eUrochloa ssp.\u003c/em\u003e pastures (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e) for a backgrounding phase. During this period, calves received a daily protein supplement targeting 5 g/kg of BW for one month (29.7% CP and 80.7% TDN). Subsequently, supplementation increased to 7 g/kg of BW for two weeks, followed by 10 g/kg of BW until they reached 16 months of age.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eChemical composition of forage (Urochloa brizantha cv. Marandu) during the experiment period for cow-calf and heifer\u0026acute;s grazing phase.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"7\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eItem\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eCow-calf forage\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colspan=\"3\" nameend=\"c7\" namest=\"c5\"\u003e \u003cp\u003eGrazing phase forage\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eRain season\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDry season\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eRain season\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003ePre-dry-season\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eDry season\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"7\" nameend=\"c7\" namest=\"c1\"\u003e \u003cp\u003eChemical composition, % of DM1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDM,% of NM\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e35.63\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e65.44\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e19.47\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e22.18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e69.89\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e6.67\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4.05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e12.80\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e4.30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e4.10\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eEE\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1.20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2.60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e1.70\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e1.30\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eADF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e39.37\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e44.29\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e51.30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e42.90\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e48.10\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNDF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e71.09\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e72.63\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e66.50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e76.30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e79.80\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLignin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4.14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4.52\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e4.30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e4.60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e4.70\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAsh\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e7.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e6.35\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e8.50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e8.10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e7.30\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"7\" nameend=\"c7\" namest=\"c1\"\u003e \u003cp\u003e\u003csup\u003e1\u003c/sup\u003eDM = dry matter, NM\u0026thinsp;=\u0026thinsp;natural matter. CP\u0026thinsp;=\u0026thinsp;crude protein, NDF\u0026thinsp;=\u0026thinsp;neutral detergent fiber, ADF\u0026thinsp;=\u0026thinsp;acid detergent fiber, EE\u0026thinsp;=\u0026thinsp;ether extract\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3 Dam Uterine Artery Hemodynamics\u003c/h2\u003e \u003cp\u003eAt 5.5 and 8.5 months of pregnancy, Doppler ultrasonography was performed on 50 cows (25 PRIMI [12 early-weaned and 13 conventional-weaned] and 25 MULT [13 early-weaned and 12 conventional-weaned]) that became pregnant during the 2020 breeding season to assess uteroplacental hemodynamics (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Uterine artery hemodynamics, both ipsilateral and contralateral to the conceptus, were evaluated using color Doppler ultrasonography (MyLab Delta, Esaote Healthcare, Italy) equipped with a 7.5 MHz linear transducer. The uterine artery was identified transrectally by tracing the abdominal aorta to the external iliac artery's origin, and the internal iliac artery was located by moving the probe caudally. Cardiac cycle waveforms from at least two independent ultrasound scans were analyzed to determine systolic velocity (s; cm/s), diastolic velocity (d; cm/s), the s:d ratio, pulsatility index, and resistance index, using the device's preset functions. Time-averaged maximum velocity (TAMV) was calculated with the formula: (s - d)/pulsatility index. Uterine blood flow (UBF) was calculated using the following equation: mean velocity x vessel area x 60 s.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4 Body weight, Body Condition Score and Carcass Traits\u003c/h2\u003e \u003cp\u003eBody weight was measured using a barn scale and recorded at eight time points: at birth, 5 months (150.4\u0026thinsp;\u0026plusmn;\u0026thinsp;1.39 days of age), 8 months (246.5\u0026thinsp;\u0026plusmn;\u0026thinsp;1.74 days of age), 12 months (11.4\u0026thinsp;\u0026plusmn;\u0026thinsp;0.11 months of age), 13 months (12.3\u0026thinsp;\u0026plusmn;\u0026thinsp;0.11 months of age), 14 months (13.5\u0026thinsp;\u0026plusmn;\u0026thinsp;0.11 months of age), 15 months (14.4\u0026thinsp;\u0026plusmn;\u0026thinsp;0.11 months of age), and 16 months (16.3\u0026thinsp;\u0026plusmn;\u0026thinsp;0.11 months of age). Body condition score (BCS) was assessed on a 1 to 9 scale, where 1 represents emaciated and 9 represents obese, at four time points: 12 months, 13 months, 14 months, and 15 months of age, following the methodology of Wagner (1988).\u003c/p\u003e \u003cp\u003eThe average daily gain (ADG) was calculated for seven intervals: from birth to 5 months (representing ADG from birth to 150 days of age), from 5 to 8 months (corresponding to ADG during this period), from 8 to 12 months (representing ADG from 8 to 12 months of age), from 12 to 13 months (representing ADG during this one month), from 13 to 14 months (corresponding to ADG during this interval), from 14 to 15 months (representing ADG during this period), and from 15 to 16 months (representing ADG during this interval).\u003c/p\u003e \u003cp\u003eDuring the backgrounding period, calves were weighed at birth, 5 months, 8 months, and every 28\u0026thinsp;\u0026plusmn;\u0026thinsp;4 days after reaching 12 months of age. The average daily gain (ADG) was calculated using the following equation:\u003c/p\u003e \u003cp\u003eADG, kg/day = (last weight \u0026ndash; initial weight) / (days between weighing)\u003c/p\u003e \u003cp\u003eRibeye area (REA), back fat thickness (BFT), and rump fat thickness (RFT) were measured via ultrasound at 13, 14, and 15 months of age. REA and BFT measurements were obtained from cross-sectional images of the \u003cem\u003eLongissimus thoracis\u003c/em\u003e muscle between the 12th and 13th ribs. RFT measurements were taken by positioning the transducer at the junction of the gluteus medius and biceps femoris muscles, located between the hip and pin bones (Silva et al., 2012). All measurements were performed by a single operator using ultrasound equipment (EXAGO, IMV Technologies, L\u0026rsquo;Aigle, France) with a 3.5 MHz, 172 mm linear array transducer. The captured images were analyzed with Lince\u0026reg; V.1.5 software (M\u0026amp;S Consultoria Agropecu\u0026aacute;ria Ltd., Pirassununga, SP, Brazil).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5 Blood Samples\u003c/h2\u003e \u003cp\u003eBlood samples (approximately 10 mL) were collected at 13, 14, and 15 months of age via jugular venipuncture into evacuated tubes (BD Vacutainer\u0026reg;, S\u0026atilde;o Paulo, Brazil). Tubes without an anticoagulant were used for serum separation to analyze leptin and Insulin-like Growth Factor I (IGF-I) concentrations, while tubes containing sodium fluoride were used to separate plasma for glucose concentration analysis.\u003c/p\u003e \u003cp\u003eTubes without anticoagulant were allowed to clot at room temperature before being placed on ice, while sodium fluoride tubes were immediately placed on ice. All samples were centrifuged at 2800 \u0026times; g for 15 minutes at 4\u0026ordm;C, and two 1.5 mL aliquots of serum and plasma were stored at \u0026minus;\u0026thinsp;20\u0026ordm;C until analysis. Serum IGF-I concentrations were determined using a chemiluminescent assay on a Dimension EXL 200 Integrated Biochemistry System with the IMMULITE\u0026reg; 1000 commercial IGF-I kit (Siemens Healthcare Diagnostics, Munich, Germany). The intra-assay coefficient of variation and sensitivity was 1.58% and 20 ng/mL, respectively. Plasma glucose concentrations were measured using a colorimetric test on an automated analyzer (Mindray BC-2800 Vet\u0026reg;, China) with a commercial kit (Labtest, Ref. 133-2/500). Serum leptin concentrations were analyzed via Enzyme-Linked Immunosorbent Assay (ELISA) at the Molecular Physiology and Endocrinology Laboratory of the University of S\u0026atilde;o Paulo (LFEM \u0026ndash; VRA, USP) using a Bovine Leptin ELISA Kit (EZ Assays, USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6 Hepatic Sampling\u003c/h2\u003e \u003cp\u003eLiver biopsies were collected at two time points: 5 months (150\u0026thinsp;\u0026plusmn;\u0026thinsp;1 days of age) and 14 months (13.7\u0026thinsp;\u0026plusmn;\u0026thinsp;0.11 months of age). The procedure was conducted on a subset of 22 heifers, including 10 from the early weaning group (7 from MULT cows and 3 from PRIMI cows) and 12 from the conventional weaning group (6 from MULT cows and 6 from PRIMI cows), following the method described by Gr\u0026ouml;hn and Lindberg (1982).\u003c/p\u003e \u003cp\u003eThe biopsy site was identified at the intersection of the right 11th and 12th intercostal spaces and the line extending from the right acromion to the tuber coxae. The area was clipped, scrubbed with 2% chlorhexidine (Rioqu\u0026iacute;mica, Brazil), disinfected with 70% ethanol, and anesthetized with a subcutaneous injection of 3\u0026ndash;5 mL of 2% lidocaine (Dorfin, Ceva, Brazil). A stab incision was made in the skin, and the biopsy was performed using a 14 g \u0026times; 15 cm soft tissue biopsy needle (REF 0BM1415; Biomedical Sri Via., Italy). Four tissue fragments were collected, placed in cryotubes, and immediately stored in liquid nitrogen. They were subsequently stored in a freezer at \u0026minus;\u0026thinsp;80\u0026ordm;C until gene expression analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.7 Total RNA Extraction, cDNA Synthesis, and Quantitative Real-Time Reverse Transcriptase Polymerase Chain Reaction (qPCR)\u003c/h2\u003e \u003cp\u003eFor RNA extraction, liver tissue was homogenized in liquid nitrogen using a multibed shocker and immediately mixed with an extraction reagent (TRIzol, Life Technologies, Frederick, USA) following the manufacturer's instructions. The procedures for determining the total RNA concentration, cDNA synthesis, and quantitative PCR (qPCR) were carried out as previously described (Rio Feltrin et al., 2024). The relative abundance of transcripts for \u003cem\u003eGHR\u003c/em\u003e, \u003cem\u003eIGF-I\u003c/em\u003e, and \u003cem\u003eIGFBP\u003c/em\u003e was analyzed using SYBR Green PCR Master Mix (Life Technologies) for the amplification reactions, which were conducted on a Step One Plus thermocycler (Applied Biosystems Real-Time PCR System; Life Technologies). The optimized primer (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e) pairs were designed using the primer design platform from the National Center of Biotechnology Information (NCBI) (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ncbi.nlm.nih.gov/tools/primer-blast/\u003c/span\u003e\u003cspan address=\"https://www.ncbi.nlm.nih.gov/tools/primer-blast/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) based on the mRNA sequence of target genes obtained from the RefSeq database, on Genebank (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ncbi.nlm.nih.gov/genbank/\u003c/span\u003e\u003cspan address=\"https://www.ncbi.nlm.nih.gov/genbank/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) and the specificity of the primer were checked by BLAST (NCBI, \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://blast.ncbi.nlm.nih.gov/Blast.cgi\u003c/span\u003e\u003cspan address=\"https://blast.ncbi.nlm.nih.gov/Blast.cgi\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). Furthermore, GeNorm software (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://genorm.cmgg.be\u003c/span\u003e\u003cspan address=\"http://genorm.cmgg.be\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) was used to select reference genes, and Glyceraldehyde-3-Phosphate Dehydrogenase (\u003cem\u003eGAPDH\u003c/em\u003e) and Hypoxanthine Phosphoribosyl transferase (\u003cem\u003eHPRT\u003c/em\u003e) were used as an endogenous control. Were used LinRegPCR software to determine qPCR efficiency and quantification cycle (Cq) values per sample. Quantification was performed after normalization of the target gene expression values by the geometric mean of the endogenous Control expression values, as described by Pfaffl (2001).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eProtein symbol, protein name, forward (F) and reverse (R) primer sequence, base pair (BP), R2 of the standard curve efficiency of the genes tested by the qPCR technique.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eProtein Symbol\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eProtein Name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eForward (F) and Reverse (R) Primer Sequence\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eBase Pair (PB)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eR\u003csup\u003e2\u003c/sup\u003e of the standard curve\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eStandard curve efficiency\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eIGF-I\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eInsulin growth factor I\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: CCAGACAGGAATCGTGGATG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e89\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e0.96\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e1.90\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR: ACTTGGCGGGCTTGAGAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eIGFBP-I\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eInsulin growth factor binding protein I\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: AGCACAGACACCCAGAACTTCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e86\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e0.97\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e1.89\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR: TCAGCGTGTCTTCCATTTCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eGHR\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eGrowth hormone receptor\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: TTCTGGGAATCCTAAATTCACCAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e91\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e0.98\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e1.87\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR: CTGTAAACTGTGATTAGCCCCATCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eHPRT\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eHypoxanthine phosphoribosyltransferase\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: TGGAGAAGGTGTTTATTCCTCATG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e105\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e0.98\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e1.87\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR: CACAGAGGGCCACAATGTGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eACTB\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eβ-actin\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: GGATGAGGCTCAGAGCAAGAGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e153\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e0.98\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e1.87\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR: TCGTCCCAGTTGGTGACGAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"6\" nameend=\"c6\" namest=\"c1\"\u003e \u003cp\u003eSuperscript letters in protein name: \u003csup\u003ea\u003c/sup\u003e(Carriquiry et al., 2009).\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"No\" id=\"Taba\" border=\"1\"\u003e \u003ccolgroup cols=\"11\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c9\" colnum=\"9\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c10\" colnum=\"10\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c11\" colnum=\"11\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colspan=\"10\" nameend=\"c10\" namest=\"c1\"\u003e \u003cp\u003eTable\u0026nbsp;4. Uterine blood flow perfusion on the uterine artery at 5.5 and 8.5 months of gestation in Nelore cows (primiparous and multiparous) submitted to early (150 days) and conventional (240 days) weaning.\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"1\" nameend=\"c11\" namest=\"c11\"\u003e\u0026nbsp;\u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eEarly\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c6\" namest=\"c5\"\u003e \u003cp\u003eConventional\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colspan=\"4\" nameend=\"c11\" namest=\"c8\"\u003e \u003cp\u003e\u003cem\u003eP\u003c/em\u003e-Values\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimiparous Cows\u003c/p\u003e \u003cp\u003e(n\u0026thinsp;=\u0026thinsp;12)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMultiparous Cows\u003c/p\u003e \u003cp\u003e(n\u0026thinsp;=\u0026thinsp;13)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003ePrimiparous Cows\u003c/p\u003e \u003cp\u003e(n\u0026thinsp;=\u0026thinsp;13)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMultiparous Cows\u003c/p\u003e \u003cp\u003e(n\u0026thinsp;=\u0026thinsp;12)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eDam\u0026acute;s Parity\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eWeaning Strategy\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c11\" namest=\"c10\"\u003e \u003cp\u003eDam\u0026acute;s parity x Weaning strategy\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eIpsilateral diameter (mm)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c11\" namest=\"c10\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eat 5.5 mo\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e7.51\u0026thinsp;\u0026plusmn;\u0026thinsp;0.32\u003csup\u003eY\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e7.74\u0026thinsp;\u0026plusmn;\u0026thinsp;0.46\u003csup\u003eY\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e7.05\u0026thinsp;\u0026plusmn;\u0026thinsp;0.17\u003csup\u003eY\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e7.99\u0026thinsp;\u0026plusmn;\u0026thinsp;0.37\u003csup\u003eY\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.76\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c11\" namest=\"c10\"\u003e \u003cp\u003e0.32\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eat 8.5 mo\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e11.35\u0026thinsp;\u0026plusmn;\u0026thinsp;0.50\u003csup\u003eX\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e11.20\u0026thinsp;\u0026plusmn;\u0026thinsp;0.56\u003csup\u003eX\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e10.96\u0026thinsp;\u0026plusmn;\u0026thinsp;0.35\u003csup\u003eX\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e11.81\u0026thinsp;\u0026plusmn;\u0026thinsp;0.46\u003csup\u003eX\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.46\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.81\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c11\" namest=\"c10\"\u003e \u003cp\u003e0.30\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eContralateral diameter (mm)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c11\" namest=\"c10\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eat 5.5 mo\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4.29\u0026thinsp;\u0026plusmn;\u0026thinsp;0.25\u003csup\u003eY\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4.56\u0026thinsp;\u0026plusmn;\u0026thinsp;0.36\u003csup\u003eY\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e4.17\u0026thinsp;\u0026plusmn;\u0026thinsp;0.25\u003csup\u003eY\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e5.58\u0026thinsp;\u0026plusmn;\u0026thinsp;0.50\u003csup\u003eY\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u003cb\u003e0.02\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c11\" namest=\"c10\"\u003e \u003cp\u003e0.11\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eat 8.5 mo\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e6.49\u0026thinsp;\u0026plusmn;\u0026thinsp;0.26\u003csup\u003eX\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e6.29\u0026thinsp;\u0026plusmn;\u0026thinsp;0.49\u003csup\u003eBX\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e6.32\u0026thinsp;\u0026plusmn;\u0026thinsp;0.36\u003csup\u003eX\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e7.96\u0026thinsp;\u0026plusmn;\u0026thinsp;0.52\u003csup\u003eAX\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u003cb\u003e0.09\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e\u003cb\u003e0.08\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c11\" namest=\"c10\"\u003e \u003cp\u003e\u003cb\u003e0.03\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eIpsilateral RI (0\u0026ndash;1)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c11\" namest=\"c10\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eat 5.5 mo\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.49\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003csup\u003eY\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.49\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003csup\u003eY\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.50\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003csup\u003eY\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.50\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003csup\u003eY\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.91\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.79\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c11\" namest=\"c10\"\u003e \u003cp\u003e0.91\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eat 8.5 mo\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.45\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003csup\u003eX\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.46\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003csup\u003eX\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.46\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003csup\u003eX\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.48\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003csup\u003eX\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.51\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c11\" namest=\"c10\"\u003e \u003cp\u003e0.94\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eContralateral RI (0\u0026ndash;1)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c11\" namest=\"c10\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eat 5.5 mo\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.57\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.56\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.56\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.58\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.71\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.83\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c11\" namest=\"c10\"\u003e \u003cp\u003e0.63\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eat 8.5 mo\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.53\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.56\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.35\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.55\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.38\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.88\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c11\" namest=\"c10\"\u003e \u003cp\u003e0.9\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eIpsilateral TAMV (cm/s)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c11\" namest=\"c10\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eat 5.5 mo\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e120.47\u0026thinsp;\u0026plusmn;\u0026thinsp;10.08\u003csup\u003eY\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e106.83\u0026thinsp;\u0026plusmn;\u0026thinsp;6.29\u003csup\u003eY\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e114.49\u0026thinsp;\u0026plusmn;\u0026thinsp;3.77\u003csup\u003eY\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e100.37\u0026thinsp;\u0026plusmn;\u0026thinsp;6.77\u003csup\u003eY\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u003cb\u003e0.05\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.37\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c11\" namest=\"c10\"\u003e \u003cp\u003e0.97\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eat 8.5 mo\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e150.52\u0026thinsp;\u0026plusmn;\u0026thinsp;13.22\u003csup\u003eX\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e152.69\u0026thinsp;\u0026plusmn;\u0026thinsp;9.96\u003csup\u003eX\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e155.74\u0026thinsp;\u0026plusmn;\u0026thinsp;8.90\u003csup\u003eX\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e143.76\u0026thinsp;\u0026plusmn;\u0026thinsp;8.50\u003csup\u003eX\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.63\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.85\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c11\" namest=\"c10\"\u003e \u003cp\u003e0.49\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eContralateral TAMV (cm/s)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c11\" namest=\"c10\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eat 5.5 mo\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e45.54\u0026thinsp;\u0026plusmn;\u0026thinsp;5.87\u003csup\u003eYZ\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e41.30\u0026thinsp;\u0026plusmn;\u0026thinsp;5.29\u003csup\u003eZ\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e47.54\u0026thinsp;\u0026plusmn;\u0026thinsp;5.00\u003csup\u003eYZ\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e49.68\u0026thinsp;\u0026plusmn;\u0026thinsp;7.45\u003csup\u003eYZ\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.86\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.38\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c11\" namest=\"c10\"\u003e \u003cp\u003e0.59\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eat 8.5 mo\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e92.13\u0026thinsp;\u0026plusmn;\u0026thinsp;12.71\u003csup\u003eX\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e69.36\u0026thinsp;\u0026plusmn;\u0026thinsp;9.48\u003csup\u003eXY\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e92.45\u0026thinsp;\u0026plusmn;\u0026thinsp;12.35\u003csup\u003eX\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e86.96\u0026thinsp;\u0026plusmn;\u0026thinsp;14.77\u003csup\u003eX\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.47\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c11\" namest=\"c10\"\u003e \u003cp\u003e0.48\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eIpsilateral UBF (L/min)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c11\" namest=\"c10\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eat 5.5 mo\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3.34\u0026thinsp;\u0026plusmn;\u0026thinsp;0.45\u003csup\u003eY\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3.06\u0026thinsp;\u0026plusmn;\u0026thinsp;0.33\u003csup\u003eY\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2.71\u0026thinsp;\u0026plusmn;\u0026thinsp;0.17\u003csup\u003eY\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e3.07\u0026thinsp;\u0026plusmn;\u0026thinsp;0.38\u003csup\u003eY\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.89\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.37\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c11\" namest=\"c10\"\u003e \u003cp\u003e0.36\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eat 8.5 mo\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e8.96\u0026thinsp;\u0026plusmn;\u0026thinsp;0.76\u003csup\u003eX\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e8.86\u0026thinsp;\u0026plusmn;\u0026thinsp;0.67\u003csup\u003eX\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e8.82\u0026thinsp;\u0026plusmn;\u0026thinsp;0.60\u003csup\u003eX\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e9.47\u0026thinsp;\u0026plusmn;\u0026thinsp;0.82\u003csup\u003eX\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.70\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.74\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c11\" namest=\"c10\"\u003e \u003cp\u003e0.60\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eContralateral UBF (L/min)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c11\" namest=\"c10\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eat 5.5 mo\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.44\u0026thinsp;\u0026plusmn;\u0026thinsp;0.11\u003csup\u003eY\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.45\u0026thinsp;\u0026plusmn;\u0026thinsp;0.10\u003csup\u003eY\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.43\u0026thinsp;\u0026plusmn;\u0026thinsp;0.07\u003csup\u003eY\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.78\u0026thinsp;\u0026plusmn;\u0026thinsp;0.15\u003csup\u003eY\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c11\" namest=\"c10\"\u003e \u003cp\u003e0.14\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eat 8.5 mo\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1.96\u0026thinsp;\u0026plusmn;\u0026thinsp;0.36\u003csup\u003eX\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1.62\u0026thinsp;\u0026plusmn;\u0026thinsp;0.41\u003csup\u003eX\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.94\u0026thinsp;\u0026plusmn;\u0026thinsp;0.36\u003csup\u003eX\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e2.86\u0026thinsp;\u0026plusmn;\u0026thinsp;0.61\u003csup\u003eX\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.91\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c11\" namest=\"c10\"\u003e \u003cp\u003e0.12\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"10\" nameend=\"c10\" namest=\"c1\"\u003e \u003cp\u003eAbbreviations: RI, resistance index; UBF, uterine blood flow.\u003c/p\u003e \u003cp\u003eNotes. \u003csup\u003eA\u0026minus;B\u003c/sup\u003eMain effects of interactions between treatment group and cows\u0026rsquo; parity order category.\u003c/p\u003e \u003cp\u003e\u003csup\u003eXY\u003c/sup\u003e Within a group means with a different letter differed between 5.5 and 8.5 mo (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026le;\u0026thinsp;0.05).\u003c/p\u003e \u003cp\u003eotes. \u003csup\u003eA\u0026minus;B\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c11\" namest=\"c11\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.8 Statistical Analyses\u003c/h2\u003e \u003cp\u003eAll statistical analyses were performed using SAS (version 9.2, SAS Institute Inc., Cary, NC USA). The experiment was analyzed as a 2 \u0026times; 2 factorial with the main factors of the dam\u0026acute;s parity order [PRIMI and MULT for the hemodynamic characteristics, and SEC and MULT for the other characteristics] and weaning strategy [early and conventional]). The continuous dependent variables (BW, REA, RFT, BFT, BCS, gene expression, and uterine artery hemodynamics) were evaluated for the normality of the residuals by the Shapiro-Wilk test and homogeneity of variance by Levene\u0026acute;s test. When a normal distribution was not followed by the raw data, data were transformed into natural logarithms or ranked. Data were analyzed using PROC MIXED considering the effects of the weaning strategy, the dam\u0026acute;s parity, time, and their respective interaction. Results were expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM or proportion. Significant differences were declared at \u003cem\u003eP\u0026thinsp;\u0026le;\u0026thinsp;0.05\u003c/em\u003e and a tendency was declared when \u003cem\u003eP\u0026thinsp;\u0026gt;\u0026thinsp;0.05\u003c/em\u003e and \u003cem\u003eP\u0026thinsp;\u0026le;\u0026thinsp;0.10.\u003c/em\u003e\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e3.1 Uterine Artery Blood Flow\u003c/h2\u003e \u003cp\u003eA significant triple interaction of parity \u0026times; weaning strategy \u0026times; time was not detected for any characteristic of uterine artery blood flow at 5.5 and 8.5 mo of pregnancy (\u003cb\u003eTable\u0026nbsp;4\u003c/b\u003e). At 5.5 mo, the diameter of the contralateral uterine artery was affected by dam\u0026rsquo;s parity (\u003cem\u003eP\u0026thinsp;=\u0026thinsp;0.02\u003c/em\u003e), demonstrating that MULT cows presented a larger uterine artery than PRIMI cows. The TAMV of the ipsilateral uterine artery was affected by parity (\u003cem\u003eP\u0026thinsp;=\u0026thinsp;0.05\u003c/em\u003e), demonstrating that PRIMI cows presented a higher TAMV than MULT cows. At 8.5 mo, only a significant interaction of weaning strategy \u0026times; parity (\u003cem\u003eP\u0026thinsp;=\u0026thinsp;0.03)\u003c/em\u003e was detected for the size of the contralateral uterine artery. A larger contralateral uterine artery was observed in MULT cows submitted to the conventional weaning, whereas no difference was observed between treatments in PRIMI cows. A time effect was observed for ipsilateral and contralateral uterine artery diameter, ipsilateral RI, ipsilateral TAMV, and ipsilateral and contralateral UBF. The time effect demonstrated that the above-mentioned variables increased from 5.5 mo to 8.5 mo, regardless of parity and weaning strategy (\u003cb\u003eTable\u0026nbsp;4\u003c/b\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e3.2 Measures of Body Growth and Condition Score\u003c/h2\u003e \u003cp\u003eHeifer BW was not impacted by weaning strategy, dam\u0026acute;s parity, or time interactions for any time point evaluated. Heifers born from SEC cows tended (\u003cem\u003eP\u0026thinsp;=\u0026thinsp;0.08\u003c/em\u003e) to be lighter than heifers from MULT over time points. When each moment of the evaluation was analyzed separately, heifers born from SEC cows tended to be lighter than heifers from MULT cows at 14 mo. An effect of time was also observed (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.0001\u003c/em\u003e) regardless of the weaning strategy or dam\u0026acute;s parity, demonstrating that body weight increases over time (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). The weaning strategy, the dam\u0026acute;s parity, and time interactions did not affect the average daily gain. Still, it was affected by time (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.0001\u003c/em\u003e) regardless of the weaning strategy or the dam\u0026acute;s parity. The time effect demonstrated that the ADG increases after weaning until 15 mo, showing the greatest ADG between 14 to 15 mo (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe BCS was not impacted by the weaning strategy, the dam\u0026acute;s parity, or time interactions; however, it was affected by the dam\u0026acute;s parity (\u003cem\u003eP\u0026thinsp;=\u0026thinsp;0.01\u003c/em\u003e) and time (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.0001\u003c/em\u003e). Heifers from MULT cows presented greater BCS than heifers born from SEC cows at 12 (4.00\u0026thinsp;\u0026plusmn;\u0026thinsp;0.10 \u003cem\u003evs.\u003c/em\u003e 3.60\u0026thinsp;\u0026plusmn;\u0026thinsp;0.10) and 14 mo (4.90\u0026thinsp;\u0026plusmn;\u0026thinsp;0.11 \u003cem\u003evs.\u003c/em\u003e 4.56\u0026thinsp;\u0026plusmn;\u0026thinsp;0.10) of age. Body condition score increased from 12 to 15 mo (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe REA and RFT of heifers were not impacted by weaning strategy, dam parity, or time interactions. The ribeye area and RFT were affected only by time (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.0001\u003c/em\u003e), showing that REA and RFT increased over the time points, regardless of weaning strategy or dam\u0026acute;s parity. The back fat thickness was affected by the dam\u0026acute;s parity by time interaction (\u003cem\u003eP\u0026thinsp;=\u0026thinsp;0.008\u003c/em\u003e), by time (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.0001\u003c/em\u003e), and dam\u0026acute;s parity (\u003cem\u003eP\u0026thinsp;=\u0026thinsp;0.01\u003c/em\u003e). The dam\u0026acute;s parity by time interaction showed that heifers from SEC cows presented a continuous BFT at 13 and 14 mo, and increased until 15 mo, while heifers from MULT cows presented a constant growth from 13 to 15 mo (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e3.3 Circulating Concentrations of Metabolites\u003c/h2\u003e \u003cp\u003eThe plasma circulating concentrations of glucose, and serum concentration of IGF-I and leptin were not affected by interactions among weaning strategy, dam\u0026acute;s parity, or time. For plasma concentration of glucose and serum concentration of IGF-I (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e), only a significant effect of time (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.0001\u003c/em\u003e and \u003cem\u003eP\u0026thinsp;=\u0026thinsp;0.02\u003c/em\u003e, respectively) and a tendency for dam\u0026rsquo;s parity were detected (\u003cem\u003eP\u0026thinsp;=\u0026thinsp;0.056\u003c/em\u003e and \u003cem\u003eP\u0026thinsp;=\u0026thinsp;0.07\u003c/em\u003e, respectively). The effect of time demonstrated that while the serum IGF-I concentrations increased from 12 to 16 mo of age, the plasma glucose concentrations decreased. The serum IGF-I at 12 and 16 mo of age, and plasma glucose concentrations at 12 and 14 mo of age, tended to be greater in heifers born from SEC than in MULT cows.\u003c/p\u003e \u003cdiv id=\"Sec15\" class=\"Section3\"\u003e \u003ch2\u003e5.4.4. Hepatic Gene Expression\u003c/h2\u003e \u003cp\u003eHepatic expression of \u003cem\u003eGHR\u003c/em\u003e was not affect by the main effects of the dam\u0026acute;s parity, weaning strategy, and time, or their interactions (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e). Similarly, the hepatic expression of \u003cem\u003eIGF-I\u003c/em\u003e was not influenced by dam\u0026acute;s parity, weaning strategy, or time interactions. However, it was significantly affect by time (\u003cem\u003eP\u0026thinsp;=\u0026thinsp;0.01\u003c/em\u003e), with a lower expression of \u003cem\u003eIGF-I\u003c/em\u003e observed at 14 mo than at 5 mo of age. The hepatic gene expression for \u003cem\u003eIGFPB-I\u003c/em\u003e was only affected by the dam\u0026acute;s parity by time interaction (\u003cem\u003eP\u0026thinsp;=\u0026thinsp;0.05\u003c/em\u003e), with 14 mo heifers from MULT cows having a higher \u003cem\u003eIGFPB-I\u003c/em\u003e expression than heifers from SEC cows (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eMost studies on maternal nutrition focus on dietary restriction or supplementation, primarily from the second trimester of gestation, assessing the impact on offspring growth and productive performance in both taurine cattle (Long et al. 2011; Brockus et al. 2016a, b) and zebu cattle under tropical conditions (Marquez et al. 2017; Rodrigues et al. 2020; Ram\u0026iacute;rez-Zamudio et al. 2022; Nascimento et al. 2024; Costa et al. 2022; Cracco et al. 2023). However, the present study is the first to compare the effect of weaning time during the previous lactation on fetal development and its impacts on postnatal growth and metabolism of female Nelore offspring.\u003c/p\u003e \u003cp\u003ePrevious findings from the cows in this study indicated that early weaning positively influenced the metabolic status of the dams, as evidenced by better body condition, higher body weight, improved pregnancy rates in the subsequent breeding season, and an estimated increase in maternal tissue and gestational component weight (Nishimura et al., 2023a). However, early weaning did not seem to affect the body development of the heifers from birth or postnatal metabolism when compared to those born from dams subjected to conventional weaning. While Nishimura et al. (2023a) reported greater gestational component weights in early-weaned cows in the same herd, no significant differences in birth weight were observed in the present study. This discrepancy may be due to the use of equations for estimating gestational components (Gionbelli et al., 2015), which do not differentiate between fetal weight and other components like amniotic fluid and placenta. As a result, the increased weight of these gestational components may reflect the contribution of these elements alone, without directly influencing fetal weight.\u003c/p\u003e \u003cp\u003eThe uterine blood flow during pregnancy is essential for normal placental function and impacts fetal growth and development, influencing the health of the offspring throughout their subsequent life course (Reynolds et al. 2006). The formation of the uterine vascular network is intense during the first trimester of pregnancy (Reynolds et al. 2023), a period in which the number of placentomes is established (Neto et al. 2009) and remains constant throughout gestation (Laven \u0026amp; Peters 2001). The greater estimated weight of gestational components observed by Nishimura et al. (2023a) in early-weaned cows in this study may be related to the fact that these cows were in a phase of pregnancy (~\u0026thinsp;74 days) where the redistribution of energy previously directed to lactation could have favored the development of these tissues, resulting in their greater formation. However, the results of this study regarding uterine blood supply to the fetus did not show significant changes during early pregnancy (~\u0026thinsp;75 days), except at ~\u0026thinsp;165 days of gestation, when multiparous cows from the conventional weaning group presented a larger contralateral uterine artery diameter compared to multiparous cows from the early weaning group. The absence of differences in uterine blood flow at ~\u0026thinsp;75 days of gestation may be due to the relatively low nutritional demands of the fetus at this stage (Van Eetvelde et al. 2016), meaning that adaptations are not necessary. When fetal nutritional demands increase, as in the last trimester of pregnancy, dams that faced nutritional restriction during early gestation may compensate for placentome formation with an increase in size (Van Eetvelde et al. 2016), resulting in greater uterine blood flow associated with the larger mass of these structures (Ferrell, 1991). This study observed parity effects at ~\u0026thinsp;75 days of gestation, with higher blood supply in multiparous cows due to a larger contralateral uterine artery size and greater blood flow in the ipsilateral artery. Growing dams have a high nutrient allocation priority for maternal tissue growth. On the other hand, the nutritional requirements of gestation at this early stage are relatively low, allowing pregnancy to proceed even with lower nutrient allocation (Van Eetvelde et al. 2016), which may explain why the uterine blood flow observed in secondiparous cows was lower.\u003c/p\u003e \u003cp\u003eThe dam\u0026acute;s parity effect observed on uterine blood supply could be associated with the increased growth and body development of the offspring from multiparous Nelore cows. Heifers from multiparous cows were heavier at 14 mo, and presented a greater BCS, BFT, and hepatic \u003cem\u003eIGFBP-I\u003c/em\u003e upregulated at 14 mo than heifers born from secondiparous cows; but unexpectedly, heifers from secondiparous cows had greater circulating IGF-I and glucose concentration than heifers from multiparous cows. However, the greater body weight in heifers from multiparous cows could be caused by an effect during the suckling period, since according to Bitencourt et al. (2020) Nelore multiparous cows presented a higher milk production than primiparous or secundiparous cows. Nelore calves that had higher ingestion of milk during the lactational period presented a higher ADG during this period and consequently higher body weight at weaning (Nishimura et al. 2023b).\u003c/p\u003e \u003cp\u003eOnce heifers from multiparous cows presented a higher body weight, the BCS and BFT increased following the heifer's body development. It is known that the BCS evaluation is a good predictor of body fat deposition and reflects a good nutritional status (Ayres et al., 2014). A high correlation exists between heifers' body weight, body weight gain, BCS, and body fat deposition (Kause et al. 2014; Brunes et al. 2022), demonstrating that these characteristics can be evaluated for sexual precocity in young Nelore heifers. These features are good predictors of the heifer\u0026rsquo;s health and influence the heifer\u0026rsquo;s puberty onset, as time to puberty depends on many factors such as age, weight gain, genetics, fat deposition, and others (D\u0026rsquo;Occhio et al. 2019). According to the heifer\u0026rsquo;s development, some bloodstream metabolites and hormones are important for puberty onset, such as IGF-I, leptin, and glucose (Samadi et al. 2014). High circulating levels of IGF-I in early life can be related to earlier puberty onset in \u003cem\u003eBos taurus\u003c/em\u003e heifers, and IGF-I serum concentration is positively related to positive energy balance and good nutrition status associated with high fertility in cows (Ferraz et al. 2018). In addition, levels of leptin increase according to fat deposition, and adipose tissue is an important endocrine element that produces leptin and impacts the onset of puberty by stimulating the kisspeptin neurons in the hypothalamus and stimulating the secretion of GnRH (Cardoso et al. 2014). Prepubertal heifers during their body development deposit adipose tissue and increase leptin levels until stimulate kisspeptin release for pubertal maturation of GnRH neurons (Smith et al. 2006; Backholer et al. 2010).\u003c/p\u003e \u003cp\u003eGlucose is another important metabolite that is influenced by nutritional conditions and affects hypothalamic areas for GnRH secretion (Evans and Anderson, 2017). Cows in better nutritional condition present a higher circulating glucose concentration, and heifers grazing improved pastures reach puberty earlier with a higher BCS compared to conventional pastures (Samadi et al. 2013, 2014). According to Samadi et al. (2014), levels of glucose increased following the heifer\u0026rsquo;s development. The glucose concentration during gestation changes according to the fetus's development and increased glucose requirements as gestation progresses. Ruminants generally use amino acids as precursors for gluconeogenesis to increase glucose circulatory levels (Moreira et al. 2021). For these reasons body energy mobilization is important. Interestingly, in the current trail BCS increased in heifers during the rearing period, but a decrease in glucose concentration was observed. Unfortunately, feed intake was not measured in the present study; however, this decrease in glucose concentration can be associated with the reduction in ADG from 15 to 16 mo, potentially due to reduced feed intake during this period. The reduction in forage quality and amount when heifers reached about 15 mo could be associated with the reduction in feed intake during this period changing the production and utilization of glucose by tissues, as suggested by others (Moreira et al. 2021).\u003c/p\u003e \u003cp\u003eDespite the serum IGF-I concentration increasing over time in this study, the hepatic IGF-I gene expression decreased between 5 and 14 mo, while the \u003cem\u003eIGFBP\u003c/em\u003e gene expression was higher at 14 mo in heifers from multiparous cows. This opposite profile of IGF-I serum concentrations and hepatic gene expression for IGF-I could be caused by a negative feedback mechanism of circulating IGF-I in the liver or by levels of IGFBP in the bloodstream. On the other hand, IGF-I hepatic production is directly dependent on GH binding in his receptor GHR (Mirzaie et al. 2023). The low expression of \u003cem\u003eGHR1A\u003c/em\u003e reduces hepatic and circulatory IGF-I circulation, however, this effect is not likely in the present study as \u003cem\u003eGHR\u003c/em\u003e gene expression was not altered between 5 and 14 mo. Although hepatic \u003cem\u003eIGFBP\u003c/em\u003e gene expression was not altered over time, it may not reflect the \u003cem\u003eIGFBP\u003c/em\u003e expression in circulation, as mRNA and protein levels for several proteins could not correspond (Bach, 2018). The IGF binding protein has the function of prolonging the IGF-I half-life and regulating their movement into the tissues (Bach, 2018). Therefore, the lower IGF-I concentration at 14 mo can also be related to a higher gene expression of \u003cem\u003eIGFBP\u003c/em\u003e (Bach, 2018), having more IGF-I binding to the IGFBP and a lower free IGF-I concentration at this time point.\u003c/p\u003e \u003cp\u003eIn conclusion, the early weaning of the previous offspring at 150 days did not influence the uterine blood flow during the gestational phase and body development after birth. Heifers born from multiparous Nelore cows had greater body weight, BCS, BFT, and gene expression for \u003cem\u003eIGFPB-I\u003c/em\u003e than those born from secondiparous cows. This effect can be due to greater nutritional support during suckling when multiparous cows produce more milk than first and second-parous cows (Restle et al. 2003). Thus, early weaning of the previous offspring did not influence the productive performance of the next generation but heifers from multiparous cows independently of the weaning strategy had improved characteristics that may favor their productive performance.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003ch2\u003eCompeting Interests\u003c/h2\u003e \u003cp\u003eThe authors have no relevant financial or non-financial interests to disclose.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e \u003cp\u003eThis work was supported by the S\u0026atilde;o Paulo State Research Support Foundation (FAPESP [grant number 2017/18937-0]), National Council for Scientific and Technological Development Council (CNPq), and Biogenesis-Bag\u0026oacute; Animal Ltda.\u003c/p\u003e\u003ch2\u003eAuthor contributions\u003c/h2\u003e \u003cp\u003eAll authors contributed to the study conception and design. Material preparation, data collection and analysis were performed by Thiago Kan Nishimura, Matheus Sousa de Paula Carlis, Ana Clara Degan Matos, Isabela Rio Feltrin, Rodrigo Silva Goulart, Germ\u0026aacute;n Dar\u0026iacute;o Ram\u0026iacute;rez Zamudio, Saulo Luz Silva, Arlindo Saran Netto, Paulo Roberto Leme and Guilherme Pugliesi. The first draft of the manuscript was written by Thiago Kan Nishimura and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript.\u003c/p\u003e\u003ch2\u003eAcknowledgments\u003c/h2\u003e \u003cp\u003eThe authors would like to acknowledge the University of S\u0026atilde;o Paulo \u0026ndash; Campus Fernando Costa for providing the animals and animals facilities. Sincere appreciation is also expressed to the staff of the University of S\u0026atilde;o Paulo the students of the Department of Animal Reproduction from the School of Veterinary Medicine and Animal Science and the students of the Department of Animal Science from the School of Animal Science and Food Engineering. The authors acknowledge Paulo Fantinato for all the knowledge shared and help with hepatic biopsy. The authors also acknowledge FAPESP (2017/18937-0) for the financial support and CNPq for the scholarship provided to the first author, and also Biogenesis-Bag\u0026oacute; Animal Ltda for providing estrus synchronization products for this study.\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e \u003cp\u003eAll data supporting the reported results can be found in this article.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAbitante G, Leme PR, de Paula Carlis MS, Ram\u0026iacute;rez-Zamudio GD, Gomes BIP, de Andrade LB, Goulart RS, Pugliesi G, Saran Netto A, Dahlen CR, Silva SL (2024). Effects of Early Weaning on Performance and Carcass Quality of Nellore Young Bulls. Animals (Basel) 14(5):779. doi: 10.3390/ani14050779.\u003c/li\u003e\n\u003cli\u003eAyres H, Ferreira RM, Torres-J\u0026uacute;nior JRS, Dem\u0026eacute;trio CGB, S\u0026aacute; Filho MF, Gimenes LU, Penteado L, D\u0026rsquo;Occhio MJ, Baruselli OS (2014). Inferences of body energy reserves on conception rate ofsuckled Zebu beef cows subjected to timed artificial insemination followed by natural mating. Theriogenology 82:529\u0026ndash;536. doi:10.1016/j.theriogenology.2014.04.026. \u003c/li\u003e\n\u003cli\u003eBach LA (2018). 40 years of IGF1: IGF-binding proteins. J. Mol. Endocrinol 61:T11\u0026ndash;T28. doi:10.1530/JME-17-0254.\u003c/li\u003e\n\u003cli\u003eBackholer K, Smith JT, Rao A, Pereira A, Iqbal J, Ogawa S, Li Q, Clarke IJ (2010). Kisspeptin cells in the ewe brain respond to leptin and communicate with neuropeptide Y and proopiomelanocortin cells. Endocrinology 151:2233\u0026ndash;2243. doi:10.1210/en.2009-1190.\u003c/li\u003e\n\u003cli\u003eBarcelos SS, Nascimento KB, Silva TED, Mezzomo R, Alves KS, de Souza Duarte M, Gionbelli MP (2022). The Effects of Prenatal Diet on Calf Performance and Perspectives for Fetal Programming Studies: A Meta-Analytical Investigation. Animals (Basel) 12(16):2145. doi: 10.3390/ani12162145.\u003c/li\u003e\n\u003cli\u003eBarker DJP, Eriksson JG, Fors\u0026eacute;n T, Osmond C (2002). Fetal origins of adult disease: Strength of effects and biological basis. Int. J. Epidemiol 31:1235\u0026ndash;1239. doi:10.1093/ije/31.6.1235.\u003c/li\u003e\n\u003cli\u003eBitencourt, MF, Cerd\u0026oacute;tes L, Restle J, Costa PT, Fernandes TA, Ferreira OGL, Silveira DD, Vaz RZ (2020). Age and calving time affects production efficiency of beef cows and their calves. An Acad Bras Cienc 20181058. doi:10.1590/0001-3765202020181058. \u003c/li\u003e\n\u003cli\u003eBrockus KE, Hart CG, Fleming BO, Smith T, Ward SH, Lemley CO (2016a). Effects of Supplementing Holstein Heifers with Dietary Melatonin during Late Gestation on Growth and Cardiovascular Measurements of their Offspring. Reprod. Domest. Anim 51:240\u0026ndash;247. doi:10.1111/RDA.12672.\u003c/li\u003e\n\u003cli\u003eBrockus KE, Hart CG, Gilfeather CL, Fleming BO, Lemley CO (2016b). Dietary melatonin alters uterine artery hemodynamics in pregnant Holstein heifers. Domest. Anim. Endocrinol 55:1\u0026ndash;10. doi:10.1016/j.domaniend.2015.10.006. \u003c/li\u003e\n\u003cli\u003eBrunes LC, Baldi FS, Costa MFOE, Quintans G, Banchero G, L\u0026ocirc;bo RB, Claudio U (2022). Early growth , backfat thickness and body condition has major effect on early heifer pregnancy in Nellore cattle. Annals of the Brazilian Academy of Sciences 94:1\u0026ndash;18. doi:10.1590/0001-3765202120191559.\u003c/li\u003e\n\u003cli\u003eCardoso RC, Alves BRC, Prezotto LD, Thorson JF, Tedeschi LO, Keisler DH, Park CS, Amstalden M, Williams GL (2014). Use of a stair-step compensatory gain nutritional regimen to program the onset of puberty in beef heifers. J. Anim. Sci. 92:2942\u0026ndash;2949. doi:10.2527/jas.2014-7713.\u003c/li\u003e\n\u003cli\u003eCarriquiry M, Weber WJ, Fahrenkrug SC, Crooker BA (2009). Hepatic gene expression in multiparous Holstein cows treated with bovine somatotropin and fed n-3 fatty acids in early lactation 1. J. Dairy Sci. 92:4889\u0026ndash;4900. doi:10.3168/jds.2008-1676. \u003c/li\u003e\n\u003cli\u003eCosta e Silva LF, Engle TE, de Valadares Filho S, Rotta PP, Villadiego FAC, Silva FAS, Martins EC, Silva LHR, Paulino MF (2015). Nellore cows and their calves during the lactation period: Performance, intake, milk composition, and total apparent digestibility. Trop. Anim. Health Prod. 47:735\u0026ndash;741. doi: 10.1007/s11250-015-0787-6.\u003c/li\u003e\n\u003cli\u003eCosta TC, Louren\u0026ccedil;o PEC, Souza RO, Lopes MM, Ara\u0026uacute;jo RD, Santos MM, Luciano LP, Massensini JD, Chalfun LLH, Renn\u0026oacute; LN, Sampaio CB, Veroneze R, Paulino PVR, Gionbelli MP, Duarte MS (2022). Ruminal undegradable protein enriched diet during late gestation of beef cows affects maternal metabolism and offspring\u0026rsquo;s skeletal muscle development. Animal Feed Science and Technology 291:115400. https://doi.org/10.1016/j.anifeedsci.2022.115400.\u003c/li\u003e\n\u003cli\u003eCracco RC, Ruy IM, Polizel GHG, Fernandes AC, Furlan \u0026Eacute;, Baldin GC, Santos GEC, Santana MHA (2023). Evaluation of Maternal Nutrition Effects in the Lifelong Performance of Male Beef Cattle Offspring. Vet Sci. 10(7):443. doi: 10.3390/vetsci10070443.\u003c/li\u003e\n\u003cli\u003eDahlen CR, Borowicz PP, Ward AK, Caton JS, Czernik M, Palazzese L, Loi P, Reynolds LP (2021). Programming of Embryonic Development. Int J Mol Sci. 22(21):11668. doi: 10.3390/ijms222111668.\u003c/li\u003e\n\u003cli\u003eD\u0026apos;Occhio MJ, Baruselli PS, Campanile G (2019). Influence of nutrition, body condition, and metabolic status on reproduction in female beef cattle: A review. Theriogenology 125:277-284. doi: 10.1016/j.theriogenology.2018.11.010.\u003c/li\u003e\n\u003cli\u003eDu M, Tong J, Zhao J, Underwood KR, Zhu M, Ford SP, Nathanielsz PW (2010). Fetal programming of skeletal muscle development in ruminant animals. J Anim Sci. 88:E51-60. doi: 10.2527/jas.2009-2311.\u003c/li\u003e\n\u003cli\u003eEnr\u0026iacute;quez D, H\u0026ouml;tzel MJ, Ungerfeld R (2011). Minimising the stress of weaning of beef calves: a review. Acta Vet Scand. 53:28. https://doi.org/10.1186/1751-0147-53-28.\u003c/li\u003e\n\u003cli\u003eEvans MC, Anderson GM (2017). Neuroendocrine integration of nutritional signals on reproduction. J. Mol. Endocrinol. 58:R107\u0026ndash;R128. doi:10.1530/JME-16-0212.\u003c/li\u003e\n\u003cli\u003eFerraz JBS, de Fel\u0026iacute;cio PE (2010). Production systems \u0026ndash; An example from Brazil. Meat Science. 84:238-243. https://doi.org/10.1016/j.meatsci.2009.06.006.\u003c/li\u003e\n\u003cli\u003eFerraz MVC, Pires AV, Santos MH, Silva RG, Oliveira GB, Polizel DM, Biehl MV, Sartori R, Nogueira GP (2018). A combination of nutrition and genetics is able to reduce age at puberty in Nelore heifers to below 18 months. Animal 12(3):569-574. doi: 10.1017/S1751731117002464.\u003c/li\u003e\n\u003cli\u003eFerrell CL (1991). Maternal and fetal influences on uterine and conceptus development in the cow: II. Blood flow and nutrient flux. Journal of Animal Science 69(5):1954-1965. doi: 10.2527/1991.6951954x.\u003c/li\u003e\n\u003cli\u003eGionbelli MP, Duarte MS, Valadares Filho SC, Detmann E, Chizzotti ML, Rodrigues FC, Zanetti D, Gionbelli TR, Machado MG (2015). Achieving body weight adjustments for feeding status and pregnant or non-pregnant condition in beef cows. PLoS One 10(3):e0112111. doi: 10.1371/journal.pone.0112111.\u003c/li\u003e\n\u003cli\u003eGr\u0026ouml;hn Y, Lindberg LA (1982). Methodological aspects of the microscopy of bovine liver biopsies. J. Comp. Pathol. 92:567\u0026ndash;578. doi:10.1016/0021-9975(82)90009-3.\u003c/li\u003e\n\u003cli\u003eKause A, Mikkola L, Strand\u0026eacute;n I, Sirkko K (2014). Genetic parameters for carcass weight, conformation and fat in five beef cattle breeds. Animal 9:35\u0026ndash;42. doi:10.1017/S1751731114001992. \u003c/li\u003e\n\u003cli\u003eLaven RA, \u0026amp; Peters AR (2001). Gross morphometry of the bovine placentome during gestation. Reproduction in Domestic Animals 36(6):289-296. doi: 10.1046/j.1439-0531.2001.00297.x.\u003c/li\u003e\n\u003cli\u003eLong NM, Tousley CB, Underwood KR, Paisley SI, Means WJ, Hess BW, Du M, Ford SP (2012). Effects of early- to mid-gestational undernutrition with or without protein supplementation on offspring growth, carcass characteristics, and adipocyte size in beef cattle. J Anim Sci. 90(1):197-206. doi: 10.2527/jas.2011-4237.\u003c/li\u003e\n\u003cli\u003eMarquez DC, Paulino MF, Renn\u0026oacute; LN, Villadiego FC, Ortega RM, Moreno DS, Martins LS, de Almeida DM, Gionbelli MP, Manso MR, Melo LP, Moura FH, Duarte MS (2017). Supplementation of grazing beef cows during gestation as a strategy to improve skeletal muscle development of the offspring. Animal 11(12):2184-2192. doi: 10.1017/S1751731117000982.\u003c/li\u003e\n\u003cli\u003eMenezes ACB, Dahlen CR, McCarthy KL, Kassetas CJ, Baumgaertner F, Kirsch JD, Dorsam ST, Neville TL, Ward AK, Borowicz PP, Reynolds LP, Sedivec KK, Forcherio JC, Scott R, Caton JS, Crouse MS (2023). Fetal Hepatic Lipidome Is More Greatly Affected by Maternal Rate of Gain Compared with Vitamin and Mineral Supplementation at day 83 of Gestation. Metabolites 13(2):175. doi: 10.3390/metabo13020175.\u003c/li\u003e\n\u003cli\u003eMirzaie S, Yousefi AR, Masoumi R, Rostami B, Amanlou H (2023). The effect of dietary pioglitazone supplementation on milk yield, insulin sensitivity and GH\u0026ndash;IGF-I axis in Holstein dairy cows during the transition period. Vet. Med. Sci. 9:336\u0026ndash;344. doi:10.1002/vms3.1018.\u003c/li\u003e\n\u003cli\u003eMoreira GM, Aguiar GL, Meneses JAM, Luz MH, Monteiro MGBB, Lara L, Ladeira MM, Souza JC, Souza Duarte M, Gionbelli MP (2021). The course of pregnancy changes general metabolism and affects ruminal epithelium activity pattern in Zebu beef heifers. Livest. Sci. 248: 104496. doi:10.1016/j.livsci.2021.104496.\u003c/li\u003e\n\u003cli\u003eMoreira GM, Aguiar GL, Meneses JAM, Nascimento KB, Ramirez-Zamudio GD, Costa TC, Duarte MS, Casagrande DR, Gionbelli MP (2024). Pregnancy affects maternal performance, feed intake, and digestion kinetics parameters in beef heifers. Journal of Animal Science. (\u003cem\u003eIn press\u003c/em\u003e).\u003c/li\u003e\n\u003cli\u003eMoriel P, Palmer EA, Harvey KM, Cooke RF (2021). Improving beef progeny performance through developmental programming. Frontiers in Animal Science 2:728635. https://doi.org/10.3389/fanim.2021.728635.\u003c/li\u003e\n\u003cli\u003eNascimento KB, Galv\u0026atilde;o MC, Meneses JAM, Ram\u0026iacute;rez-Zamudio GD, Pereira DG, Paulino PVR, Casagrande DR, Gionbelli TRS, Ladeira MM, Duarte MS, Loor JJ, Gionbelli MP (2024). Maternal protein supplementation during mid-gestation improves offspring performance and metabolism in beef cows. J Anim Sci. 102:skae058. doi: 10.1093/jas/skae058.\u003c/li\u003e\n\u003cli\u003eNasem (National Academies of Sciences, Engineering and Medicine) (2016). Nutrient Requirements of Beef Cattle. 8th rev. Washington, DC: The National Academies Press.\u003c/li\u003e\n\u003cli\u003eNeto ACD, Morceli JAB, Fonseca RD, Ambr\u0026oacute;sio CE, Pereira FT, Miglino MA (2009). Biometrics evolution of the embryonic and fetal annexes in cows obtained by natural mating, at 10 to 70 days of gestation. Pesquisa Veterin\u0026aacute;ria Brasileira 29:859-862. https://doi.org/10.1590/S0100-736X2009001000014.\u003c/li\u003e\n\u003cli\u003eNishimura TK, da Silva AG, Abitante G, Dahlen CR, Goulart RS, Zamudio GDR, Luz Silva S, Santana MHA, Saran Netto A, Leme PR, Pugliesi G (2023). Effects of early weaning on the reproductive performance of suckled Nelore cows in the subsequent breeding season. J Anim Sci. 101:skad330. doi: 10.1093/jas/skad330.\u003c/li\u003e\n\u003cli\u003eNishimura TK, Goulart RS, Ram\u0026iacute;rez-Zamudio GD, Silva AG, Paula Carlis MS, Abitante G, Silva SL, Dahlen CR, Netto AS, Leme PR, Pugliesi G (2023b). Effects of early weaning on productive and reproductive performance of Nelore heifers. J. Anim. Sci. 101:1\u0026ndash;13. doi:10.1093/jas/skad379.\u003c/li\u003e\n\u003cli\u003ede Oliveira LOF, de Abreu UGP, da Costa Gomes R, Nogueira \u0026Eacute;, Silva JCB, Costa TG (2019). Productive performance of pre-weaned calves reared in the Pantanal. Cienc. Anim. Bras. 20:1\u0026ndash;12. doi:10.1590/1809-6891v20e-51187.\u003c/li\u003e\n\u003cli\u003eParadis F, Wood KM, Swanson KC, Miller SP, McBride BW, Fitzsimmons C (2017). Maternal nutrient restriction in mid-to-late gestation influences fetal mRNA expression in muscle tissues in beef cattle. BMC Genomics 18(1):632. doi: 10.1186/s12864-017-4051-5.\u003c/li\u003e\n\u003cli\u003ePfaffl MW (2001). A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29:e45. doi: 10.1093/nar/29.9.e45.\u003c/li\u003e\n\u003cli\u003eRam\u0026iacute;rez-Zamudio GD, da Cruz WF, Schoonmaker JP, de Resende FD, Siqueira GR, Neto ORM, Gionbelli TRS, Teixeira PD, Rodrigues LM, Gionbelli MP, Ladeira MM (2022). Effect of rumen-protected fat on performance, carcass characteristics and beef quality of the progeny from Nellore cows fed by different planes of nutrition during gestation. Livestock Science 258: 104851. https://doi.org/10.1016/j.livsci.2022.104851.\u003c/li\u003e\n\u003cli\u003eRio Feltrin I, Guimar\u0026atilde;es da Silva A, Rocha CC, Ferraz PA, da Silva Rosa PM, Martins T, Coelho da Silveira J, Oliveira ML, Binelli M, Pugliesi G, Membrive CMB (2024). Effects of 17\u0026beta;-estradiol on the uterine luteolytic cascade in bovine females at the end of diestrus. Theriogenology 213:1-10. doi: 10.1016/j.theriogenology.2023.09.019.\u003c/li\u003e\n\u003cli\u003eRestle J, Vaz RZ, Alves Filho DC, De LC Bernardes, RA, Pascoal LL, De Senna DB, Polli VA (2001). Desempenho de vacas Charol\u0026ecirc;s e Nelore desterneiradas aos tr\u0026ecirc;s ou sete meses. Rev. Bras. Zootec. 30: 499\u0026ndash;507. doi:10.1590/s1516-35982001000200029.\u003c/li\u003e\n\u003cli\u003eRestle J, Pacheco PS, Moletta JL, Brondani IL, Cerd\u0026oacute;tes L (2003). Grupo gen\u0026eacute;tico e n\u0026iacute;vel nutricional p\u0026oacute;s-parto na produ\u0026ccedil;\u0026atilde;o e composi\u0026ccedil;\u0026atilde;o do leite de vacas de corte. Rev. Bras. Zootec. 32:585\u0026ndash;597. doi:10.1590/s1516-35982003000300010. \u003c/li\u003e\n\u003cli\u003eReynolds LP, Caton JS, Redmer DA, Grazul-Bilska AT, Vonnahme KA, Borowicz PP, Luther JS, Wallace JM, Wu G, Spencer TE (2006). Evidence for altered placental blood flow and vascularity in compromised pregnancies. J Physiol. 572:51-8. doi: 10.1113/jphysiol.2005.104430.\u003c/li\u003e\n\u003cli\u003eReynolds LP, Dahlen CR, Ward AK, Crouse MS, Borowicz PP, Davila-Ruiz BJ, Kanjanaruch C, Bochantin KA, McLean KJ, McCarthy KL, Menezes ACB, Diniz WJS, Cushman RA, Caton JS (2023). Role of the placenta in developmental programming: Observations from models using large animals. Anim Reprod Sci. 257:107322. doi: 10.1016/j.anireprosci.2023.107322.\u003c/li\u003e\n\u003cli\u003eRodrigues LM, Schoonmaker JP, Resende FD, Siqueira GR, Neto ORM, Gionbelli MP, Gionbelli TRS, Ladeira MM (2020). Effects of protein supplementation on Nellore cows\u0026rsquo; reproductive performance, growth, myogenesis, lipogenesis and intestine development of the progeny. Animal Production Science 61:371-380. https://doi.org/10.1071/AN20498. \u003c/li\u003e\n\u003cli\u003eSamadi F, Phillips NJ, Blache D, Martin GB, D\u0026apos;Occhio MJ (2013). Interrelationships of nutrition, metabolic hormones and resumption of ovulation in multiparous suckled beef cows on subtropical pastures. Anim Reprod Sci. 137(3-4):137-44. doi: 10.1016/j.anireprosci.2012.12.012.\u003c/li\u003e\n\u003cli\u003eSamadi F, Blache D, Martin GB, D\u0026apos;Occhio MJ (2014). Nutrition, metabolic profiles and puberty in Brahman (Bos indicus) beef heifers. Anim Reprod Sci. 146(3-4):134-42. doi: 10.1016/j.anireprosci.2014.03.004.\u003c/li\u003e\n\u003cli\u003eSilva SdL, Tarouco JU, Ferraz JBS, Gomes RdC, Leme PR, Navajas EA (2012). Prediction of retail beef yield, trimfat and proportion of high-valued cuts in Nellore cattle using ultrasound live measurements. Rev. Bras. Zootec. 41:2025\u0026ndash;2031. https://doi.org/10.1590/S1516-35982012000900009.\u003c/li\u003e\n\u003cli\u003eSmith JT, Acohido BV, Clifton DK, Steiner RA (2006). KiSS-1 neurones are direct targets for leptin in the ob/ob mouse. J. Neuroendocrinol. 18:298\u0026ndash;303. doi:10.1111/j.1365-2826.2006.01417.x.\u003c/li\u003e\n\u003cli\u003eVan Eetvelde M, Kamal MM, Hostens M, Vandaele L, Fiems LO, Opsomer G (2016). Evidence for placental compensation in cattle. Animal 10(8):1342-1350. https://doi.org/10.1017/S1751731116000318.\u003c/li\u003e\n\u003cli\u003eVaz RZ, Lobato JFP (2010). Effect of weaning age on beef heifers growth until 14/15 months of age. Rev. Bras. Zootec. 39:289\u0026ndash;298. doi: 10.1590/S1516-35982010000200010. \u003c/li\u003e\n\u003cli\u003eWagner JJ (1988). Carcass composition in mature hereford cows : estimation and effect on dally metabolizable energy r equ ir em ent during. J. Anim. Sci. 66:603\u0026ndash;612. doi: 10.2527/jas1988.663603x.\u003c/li\u003e\n\u003cli\u003eWiseman A, Redden M, McGee A, Spencer C, Reuter R, Horn G, Lalman D (2019). Effects of timing of weaning on energy utilization in primiparous beef cows and post-weaning performance of their progeny1. J Anim Sci. 97(3):1198-1211. doi: 10.1093/jas/skz019.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":true,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"tropical-animal-health-and-production","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"trop","sideBox":"Learn more about [Tropical Animal Health and Production](https://www.springer.com/journal/11250)","snPcode":"11250","submissionUrl":"https://submission.nature.com/new-submission/11250/3","title":"Tropical Animal Health and Production","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Beef cattle, body development, heifer, Nelore, nutritional status","lastPublishedDoi":"10.21203/rs.3.rs-5882997/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5882997/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eWe aimed to compare the effects of early (EW; 150 days) or conventional (CW; 240 days) weaning during early pregnancy on the postnatal metabolism, development, and productive performance of female calves born from secondiparous (SEC) and multiparous (MULT) cows. Fifty-five Nelore female calves were used: 25 from EW cows (10 SEC, 15 MULT) and 30 from CW cows (15 SEC, 15 MULT). From 90 to 150 days, the female calves received creep-feed (5g/kg of body weight [BW]). After weaning, female calves were maintained on pastures and received 10 g/kg of BW supplement until 16 months (mo). From 12 to 16 mo, heifers were evaluated every 28\u0026thinsp;\u0026plusmn;\u0026thinsp;3 days for BW, body condition score (BCS), and average daily gain (ADG), calculated from weight measurements. Carcass traits (ribeye area [REA], backfat thickness [BFT], and rump fat thickness [RFT]) were assessed by ultrasound, and blood samples were collected for serum concentration of IGF-I, leptin, and plasma glucose. At 5 and 14 mo, a subgroup of 22 heifers (n\u0026thinsp;=\u0026thinsp;10 for EW and 12 for CW) was selected for liver biopsy to evaluate the gene expression of \u003cem\u003eIGF-I, IGFBP\u003c/em\u003e, and \u003cem\u003eGHR\u003c/em\u003e. No interactions were observed between dam parity, weaning strategy, or time for BW, BCS, ADG, REA, serum concentration for IGF-I, leptin, and plasma concentration for glucose (\u003cem\u003eP\u0026thinsp;\u0026gt;\u0026thinsp;0.1\u003c/em\u003e). A significant time effect (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e) indicated increased BW, BCS, LMA, BFT, and RTF over time. Heifers from MULT cows were 2.67 kg heavier from 13 to 15 mo than heifers from SEC cows (\u003cem\u003eP\u0026thinsp;=\u0026thinsp;0.04\u003c/em\u003e). Dam parity affected BCS (\u003cem\u003eP\u0026thinsp;=\u0026thinsp;0.01\u003c/em\u003e); heifers from MULT cows had greater BCS than SEC group. For carcass traits, a dam parity by weaning interaction (\u003cem\u003eP\u0026thinsp;=\u0026thinsp;0.04\u003c/em\u003e) in RTF indicated that EW-SEC heifers presented a lower fat deposition than EW-MULT and CW heifers. \u003cem\u003eIGF-I\u003c/em\u003e gene expression was 1.4-fold greater (\u003cem\u003eP\u0026thinsp;=\u0026thinsp;0.01\u003c/em\u003e) at 5 mo than at 14 mo. For \u003cem\u003eIGFBP\u003c/em\u003e gene expression, a dam parity \u0026times; time interaction was observed (\u003cem\u003eP\u0026thinsp;=\u0026thinsp;0.05\u003c/em\u003e), with heifers from MULT cows showing a 1.8-fold greater expression at 14 mo than at 5 mo. In conclusion, the early weaning applied to dams in the previous lactation did not affect the subsequent offspring's productive performance or metabolic parameters, except for a reduction in rump fat deposition in heifers from SEC cows that were early weaned.\u003c/p\u003e","manuscriptTitle":"Can early weaning in the previous lactation of beef cows affect the metabolism and postnatal development of female offspring?","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-02-05 08:15:15","doi":"10.21203/rs.3.rs-5882997/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"reviewerAgreed","content":"","date":"2025-02-10T11:00:21+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-02-03T11:36:47+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-01-27T12:46:50+00:00","index":"","fulltext":""},{"type":"submitted","content":"Tropical Animal Health and Production","date":"2025-01-27T07:30:58+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"tropical-animal-health-and-production","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"trop","sideBox":"Learn more about [Tropical Animal Health and Production](https://www.springer.com/journal/11250)","snPcode":"11250","submissionUrl":"https://submission.nature.com/new-submission/11250/3","title":"Tropical Animal Health and Production","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"27ea1fac-ab53-4979-ad85-305d8d9f870f","owner":[],"postedDate":"February 5th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-06-30T16:02:35+00:00","versionOfRecord":{"articleIdentity":"rs-5882997","link":"https://doi.org/10.1007/s11250-025-04535-z","journal":{"identity":"tropical-animal-health-and-production","isVorOnly":false,"title":"Tropical Animal Health and Production"},"publishedOn":"2025-06-25 15:57:33","publishedOnDateReadable":"June 25th, 2025"},"versionCreatedAt":"2025-02-05 08:15:15","video":"","vorDoi":"10.1007/s11250-025-04535-z","vorDoiUrl":"https://doi.org/10.1007/s11250-025-04535-z","workflowStages":[]},"version":"v1","identity":"rs-5882997","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5882997","identity":"rs-5882997","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}