Establishment and characterization of functional sheep endometrial luminal epithelial organoids

Establishment and characterization of functional sheep endometrial luminal epithelial organoids | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Establishment and characterization of functional sheep endometrial luminal epithelial organoids Jiahe Guo, Xinai Huang, Rongxin Xia, Qin Gao, Hua Yang, Qingyang Mai, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6818248/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background The luminal epithelium of the sheep endometrium plays a pivotal role in embryo implantation. However, there is currently a lack of in vitro models that accurately mimic its physiological functions. Although endometrial organoid systems have been well established in humans and mice, comparable models for ruminants remain underdeveloped due to their unique reproductive physiology. Therefore, establishing an organoid model that faithfully recapitulates the characteristics of the sheep endometrial luminal epithelium is essential for advancing our understanding of embryo implantation in this species. Results In this study, we systematically optimized the culture system and found that the combined supplementation of WNT3A, CHIR99021, and Y-27632 significantly improved the efficiency of organoid formation from sheep endometrial luminal epithelial cells. Notably, the innovative introduction of an EPHA1 agonist further promoted the development of functional organoids with a stable diameter exceeding 100 µm and mature morphological features. These organoids exhibited typical luminal epithelial characteristics, including microvilli, tight junctions, and secretory vesicles, expressed key epithelial markers (KRT18, TROP2, and EPCAM), and achieved an apical-out polarity in up to 86% of structures—effectively simulating the in vivo implantation microenvironment. Upon hormonal stimulation, the organoids displayed responses consistent with those of native tissue. Transcriptomic analysis confirmed a high degree of similarity between the organoids and primary endometrial luminal epithelium. Functional co-culture experiments further demonstrated that these organoids significantly promoted blastocyst proliferation and achieved stable adhesion with trophoblast cells. Conclusion This study reports the first successful establishment of a stable and functional sheep endometrial luminal epithelial organoid model that closely mimics the structural and physiological features of the native tissue. This model provides a powerful in vitro platform for investigating the mechanisms of embryo implantation in ruminants and lays a solid foundation for the development of diagnostic and therapeutic strategies for reproductive disorders in livestock. Endometrial organoid Sheep Luminal epithelium Polarity regulation Embryo implantation Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Embryo implantation is a highly coordinated physiological process that critically depends on the establishment of uterine receptivity within a specific spatiotemporal window[ 1 – 4 ]. As the first maternal cells to interact with the embryo, luminal epithelial cells (LE) play a central role in embryo recognition, adhesion, and bidirectional signaling [ 5 , 6 ]. Through the regulated expression of adhesion molecules, secretion of chemokines, and release of exosomes, LE cells create a specialized microenvironment essential for successful implantation [ 7 – 10 ]. Consequently, the structural integrity, polarity status, and molecular signature of LE cells serve as key indicators of endometrial receptivity. Sheep hold significant economic value in agriculture and serve as an important model for studying maternal-fetal crosstalk due to their unique uterine anatomy and embryo developmental features [ 11 ]. Unlike invasive implantation observed in some species, sheep embryos attach via non-invasive adhesion, primarily relying on communication between the LE and trophoblast cells at specialized uterine structures called caruncles[ 12 ]. Investigating the structural and functional dynamics of LE cells during receptivity establishment can provide crucial insights into the regulatory mechanisms governing maternal-fetal interactions in ruminants, thereby advancing reproductive efficiency. However, studying luminal epithelial cell function in vitro remains technically challenging. Conventional two-dimensional (2D) monolayer cultures fail to recapitulate the three-dimensional (3D) physiological microenvironment of the endometrium[ 13 , 14 ]. The absence of basement membrane-derived mechanical stimuli and 3D extracellular matrix (ECM) biochemical gradients disrupts authentic cell-matrix interactions[ 14 ]. Furthermore, primary uterine epithelial cells in 2D culture systems are prone to phenotypic drift, morphological alterations, and accelerated senescence/apoptosis, making long-term stable passaging difficult to achieve[ 15 ]. Compounding these issues, the lack of in vivo hormonal regulatory networks significantly impairs the cells' dynamic responsiveness to estrogen/progesterone fluctuations. Consequently, such in vitro models cannot accurately simulate physiological cellular behaviors, particularly limiting investigations into spatiotemporal-specific signaling crosstalk at the embryo-maternal interface[ 16 ]. Organoids, serving as sophisticated three-dimensional (3D) in vitro models, are typically generated through either adult stem cell self-organization or directed differentiation of pluripotent stem cells. These systems have become invaluable tools for physiological and pathological studies across various tissues, with their primary advantage lying in the high-fidelity recapitulation of structural-functional units of organs[ 17 , 18 ]. In endometrial research, successful establishment of organoids has been reported in both humans and mice. Most existing endometrial organoids are derived from glandular epithelium components and demonstrate partial recapitulation of uterine gland functions[ 19 ]. A landmark study by Sato et al. pioneered the uterine organoid culture system in mice, utilizing a Wnt/R-spondin/Noggin-based medium that effectively maintains the stemness and differentiation potential of uterine epithelial cells in vitro [ 19 ]. Subsequent advancements in human endometrial organoids were achieved by Turco et al., whose model exhibited long-term culture stability while preserving glandular epithelial morphology and secretory functions. Notably, these human organoids could mimic different functional phases of the menstrual cycle through characteristic hormonal responses[ 20 ]. Building upon these foundations, researchers have adapted similar protocols to develop porcine endometrial organoids capable of embryo adhesion[ 21 ]. However, it's important to note that current endometrial organoid systems are predominantly glandular in origin, with FOXA2-positive cells constituting the majority population in these cultures [ 22 ]. In contrast, the establishment of luminal epithelium-derived organoids remains relatively understudied, primarily due to three technical hurdles: First, the inherent scarcity of luminal epithelial cells within endometrial tissues presents an isolation challenge. While glandular epithelial cells are relatively abundant and therefore more readily obtained during tissue digestion, luminal epithelial cells constitute a minor population[ 23 ]. Second, luminal epithelium demonstrates significantly reduced stem cell potential compared to its glandular counterpart. This is evidenced by the markedly lower proportion of LGR5-positive cells in luminal populations, which directly correlates with their diminished expansion capacity in vitro[ 24 ]. Third, conventional protease digestion protocols lack the specificity to effectively discriminate between these two epithelial subtypes. Consequently, most current endometrial organoid systems inevitably produce mixed-cell populations containing both luminal and glandular derivatives [ 22 , 25 ]. To date, no systematic studies have established luminal epithelium-derived organoids in ruminants. Notably, the caruncular regions of ruminant endometria possess a distinctive histological advantage - their natural absence of glandular structures provides an unparalleled source for isolating pure luminal epithelial populations [ 26 ]. This unique anatomical characteristic effectively circumvents the common contamination by glandular epithelium that plagues organoid derivation in other species. This study aims to pioneer the development of luminal epithelial organoids derived from ovine uterine caruncles, systematically characterizing their morphological features, polarity dynamics, hormonal responses, and embryo-interaction capabilities. As the first dedicated model of ruminant luminal epithelium, this work will address a significant gap in reproductive biology research by providing an authentic platform to investigate embryo implantation mechanisms and maternal-fetal communication. The unique caruncular origin of these organoids capitalizes on the natural absence of glandular contamination in ruminant uterine structures, enabling unprecedented purity in luminal epithelial modeling. Beyond advancing fundamental understanding of uterine biology, this model establishes crucial groundwork for developing physiologically relevant embryo co-culture systems, with potential applications ranging from improved livestock breeding strategies to insights into human reproductive health. Material and Methods 2.1 Uterine tissue collection For ovine endometrial luminal epithelial organoid isolation, fresh uterine were collected from a local abattoir and transported on ice to the laboratory within 2 hours post-slaughter. Under sterile conditions, tissues were thoroughly rinsed with ice-cold PBS (C0221A, Beyotime Biotechnology) before longitudinal incision to expose the endometrial surface. Using meticulous dissection techniques, apical caruncular tissues (≈ 5×5 mm) were exclusively harvested from each horn (4 explants per horn) while carefully avoiding intercaruncular regions to ensure luminal epithelial purity. Collected explants were immediately processed for enzymatic digestion, while control samples from adjacent regions were fixed in 4% paraformaldehyde (P0099, Beyotime Biotechnology) for subsequent morphological and immunofluorescence validation. This standardized protocol ensures consistent yield of high-quality luminal epithelium while maintaining tissue integrity for comparative analyses. 2.2 The isolation of endometrial luminal epithelium in sheep and the formation of organoids The enzymatic dissociation of ovine endometrial caruncles was performed based on established protocols with modifications [ 20 , 27 ]. Briefly, excised caruncular tissues were minced into 0.5 mm³ cubes using sterile scalpels and digested at 37°C in RPMI 1640 medium (Thermo Fisher Scientific) supplemented with 0.5 mg/ml DNase I, 2 mg/ml collagenase I, and 0.1 mg/ml hyaluronidase (all from Sigma), with gentle shaking at 200 r/min for 60 minutes. A volume of 5 ml digestion solution was used per 0.5 mm³ of tissue. The digested suspension was filtered through 100 µm cell strainers (Corning) and washed extensively with HBSS buffer. To maximize cell recovery, the strainers were inverted and back-flushed with culture medium to collect residual cell clusters. After centrifugation, the cell pellet was resuspended in ice-cold Matrigel (Corning) at a 1:20 (v/v) ratio. For organoid culture, 50 µl of the Matrigel-cell mixture was plated as domes in 24-well plates (Costar) and allowed to solidify at 37°C for 20 minutes before overlaying with 250 µl of organoid expansion medium (ExM; see Table 1 for composition). The medium was refreshed every 2–3 days, and organoids were passaged every 7–10 days by mechanical dissociation. For cryopreservation, organoids were recovered using Cell Recovery Solution (Corning) and resuspended in Recovery Cell Freezing Medium (Thermo Fisher Scientific). Table 1 Details of organoid expansion medium (EXM) Product Company Product Number Final Concentration Advanced DMEM/F12 GIBCO 12634010 1× N2 supplement GIBCO 17502048 1× B27 supplement minus vitamin A GIBCO 12587010 1× Penicillin and streptomycin GIBCO 15140148 100µg/ml N-Acetyl-L-cysteine MCE HY-B0215 1.25mM Recombinant human EGF SinoBiological 10605-H01H 50ng/ml Recombinant human Noggin SinoBiological 10267-HNAH 100ng/ml Recombinant human Rspondin-1 SinoBiological 11083-H08H 200ng/ml Recombinant human FGF-10 SinoBiological 10573-HNAE 100ng/ml Recombinant human HGF SinoBiological 10463-HNAS 50ng/ml A83-01 MCE HY-10432 500nM Nicotinamide MCE HY-B0150 10nM WNT3A SinoBiological WNT007-02H 200ng/ml CHIR99201 MCE HY-10182 2 µM Y-27632 MCE HY-10071 10µM SB202190 MCE HY-10295 2 µM Recombinant human EPHA1 SinoBiological 15789-H02H 100ng/ml 2.3. Determination of the formation efficiency of endometrial luminal epithelial organoids in sheep To isolate organoids from Matrigel, Cell Recovery Solution was used to dissolve the matrix, followed by extensive pipetting (100–200 repetitions) to dissociate organoid clusters. The suspension was then digested with TrypLE Express (Invitrogen, 12604-013) at 37°C for 5–7 minutes to achieve single-cell dissociation. After washing with culture medium, the cell suspension was filtered through a 40 µm cell strainer (Corning, 352340) to ensure single-cell homogeneity. Cell viability was determined by trypan blue exclusion using an automated cell counter (A49862, Thermo Fisher Scientific). For growth factor requirement assays and organoid formation efficiency experiments (Figure. 1E), 20,000 viable cells were resuspended in 50 µL Matrigel droplets and plated in 24-well plates. Each experimental condition included three technical replicates. Organoid formation was quantified at day 9 post-seeding under standardized microscopic examination (10 random fields/well at 100× magnification). Only structures exhibiting clear luminal morphology with diameter ≥ 50 µm were counted as valid organoids. 2.4. Polarity inversion of endometrial luminal epithelial organoids To initiate polarity conversion, organoids were first liberated from Matrigel using Cell Recovery Solution in expansion medium. The organoid suspension was centrifuged at 20 ×g for 3 minutes at room temperature and washed twice with Advanced DMEM/F12 (Gibco). For suspension culture, organoids were seeded into 24-well ultra-low attachment plates (Corning, 3473) at a density of 50 organoids per well in 500 µL of organoid culture medium. To ensure uniform distribution, plates were gently swirled immediately after seeding. During the suspension culture period, organoid clusters were mechanically dispersed twice daily using wide-bore pipette tips to prevent excessive aggregation. Medium replacement was performed every three days through the following protocol: organoid suspensions were transferred to conical tubes using wide-orifice pipettes, allowed to settle by gravity for 5 minutes (or alternatively centrifuged at 20 ×g for 30 seconds), followed by careful aspiration of 80% supernatant volume. The organoid pellets were then resuspended in fresh pre-warmed medium and replated into new ultra-low attachment plates. 2.5. Hormone treatment of endometrial luminal epithelial organoids Ovine endometrial luminal epithelium organoids were treated with 10 nM β-estradiol (E2, Sigma E4389), 1 µM medroxyprogesterone acetate (MPA, MCE HY-B0469), and 10 ng/mL Interferon τ (IFN-τ ,MCE HY-P71798) based on established concentrations[ 28 – 30 ]. Following 4 days of basal culture (Day 0–4) and polarity reversion on Day 4, treatments were initiated: control (no hormones), E2 (10 nM from Day 6), E2 + MPA (E2 from Day 6 plus 1 µM MPA from Day 8), and E2 + MPA + IFN-τ (with 10 ng/mL IFN-τ added from Day 10), continuing through Day 12 to simulate physiological hormonal responses. All treatments used ≤ 0.01% DMSO as vehicle, with medium changes every 48 hours under standard culture conditions (37°C, 5% CO₂). 2.6. HE and PAS staining Endometrial organoids and tissue samples were fixed in 4% paraformaldehyde (tissues for 24 hours, organoids for 30 minutes at 4°C), followed by paraffin embedding. Organoids were pre-embedded in 1% agarose (Melford, MB1200) prior to paraffin embedding. Sections of 4 µm thickness were prepared for histological staining. The hematoxylin and eosin (H&E) staining procedure included: deparaffinization and rehydration, hematoxylin staining for 5 minutes, differentiation and bluing, eosin staining for 1 minute, dehydration and clearing, and mounting. The periodic acid-Schiff (PAS) staining procedure included: oxidation with 0.5% periodic acid for 10 minutes, incubation with Schiff's reagent in the dark for 15 minutes, counterstaining with hematoxylin, dehydration, and mounting. All stained sections were examined using a Nikon (ECLIPSE Ti2)optical microscope. 2.7. Immunofluorescence Basal-out and apical-out organoids were fixed at room temperature with 4% paraformaldehyde (PFA) for 30 minutes, followed by multiple washes with PBS. The organoids were then permeabilized with 0.5% Triton X-100 in PBS for 20 minutes and washed thoroughly with PBS. Subsequently, samples were incubated in PBS containing 5% BSA at room temperature for 1 hour to block nonspecific binding. After removing the blocking solution, primary antibodies diluted in 1% BSA/PBS (see Table 2 for details) were added and incubated overnight at 4°C. Table 2 Details of antibodies used Antibodies Cat No. RRID Source Dilution of IF Dilution of WB PGR A0321 AB_2757125 ABclonal, Wuhan, China - 1:1000 SPP1 A5814 AB_2766566 ABclonal, Wuhan, China - 1:1000 TGFB1 A15103 AB_2761987 ABclonal, Wuhan, China - 1:1000 MMP-2 A6247 AB_2766854 ABclonal, Wuhan, China - 1:1000 PCNA A13336 AB_2760192 ABclonal, Wuhan, China - 1:1000 CCND1 A1301 AB_2759856 ABclonal, Wuhan, China - 1:1000 CDK4 A0366 AB_2757151 ABclonal, Wuhan, China - 1:1000 KRT-18 A1022 AB_2744510 ABclonal, Wuhan, China 1:200 EPCAM A1177 AB_2758746 ABclonal, Wuhan, China 1:200 TROP2 A8129 AB_2772506 ABclonal, Wuhan, China 1:200 KRT-7 A4357 AB_2863248 ABclonal, Wuhan, China 1:200 GATA3 ab182747 AB_2924543 Abcam, Shanghai, China 1:200 FABP3 A5312 AB_2766124 ABclonal, Wuhan, China 1:200 ZO-1 ab307799 AB_2924544 Abcam, Shanghai, China 1:100 β-actin AC026 AB_2768234 ABclonal, Wuhan, China - 1:5000 Following several PBS washes, secondary antibodies provided by Thermo Fisher Scientific were applied at a dilution of 1:400, including Alexa Fluor 488 goat anti-mouse IgG1 (A21121), Alexa Fluor 568 goat anti-rabbit (A11011), or Alexa Fluor 647 (A21244). Nuclei were counterstained with DAPI (Sigma, D9542). After staining, samples were washed three times with PBS, 5 minutes each. The organoids were then transferred to confocal dishes and imaged using a Zeiss confocal microscope with ZEN software. Tissue sections were processed using the same staining protocol. 2.8. Electron microscopy For ultrastructural analysis, organoids were fixed in either: (1) 4% glutaraldehyde/0.1 M HEPES (pH 7.4) at 4°C for 12 h, then post-fixed with 1% osmium ferricyanide (RT, 12 h) and 2% uranyl acetate in 0.05 M maleate buffer (pH 5.5, RT, 12 h); or (2) 0.5% glutaraldehyde/0.2 M sodium cacodylate (pH 7.2, 30 min) followed by reduced osmium tetroxide (1% OsO4/1.5% potassium ferrocyanide, RT, 60 min) and 0.5% magnesium uranyl acetate (4°C, 16 h). All samples were dehydrated through graded ethanol (70–100%), transitioned with acetonitrile (2×), and embedded in Quetol epoxy or Epon resin. Ultrathin sections of 70 nm thickness were prepared using a Leica UCT ultramicrotome. Transmission electron microscopy (TEM) was performed using a JEOL JEM-1400 microscope. Images were acquired with an Olympus SIS Quemesa 11-megapixel digital camera system. 2.9.Western blot analysis Western blot analysis was performed according to our previously described procedure, with minor modifications[ 31 ]. Briefly, proteins were extracted from tissues and cells using RIPA buffer and quantified with a BCA Protein Assay Kit (P0012S, Beyotime). A total of 20 µg of protein was loaded onto a 12% SDS-PAGE gel (Invitrogen, Shanghai, China) and transferred to PVDF membranes (Millipore, USA). After blocking with 5% non-fat milk, the membranes were incubated overnight at 4°C with primary antibodies (Table 2 ), followed by incubation with a secondary antibody for 1 hour. Protein signals were detected using an enhanced chemiluminescence kit and visualized with a detection system (Fujifilm, Tokyo, Japan), and the images were analyzed using ImageJ software. Each experiment was repeated at least three times. Original Western blot data are shown in Supplementary. 2.10.RNA isolation and quantitative real-time PCR (qRT-PCR) analysis Total RNA was extracted from uterine tissues and EECs using the TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol. The purity and concentration of the extracted RNA were assessed by measuring the absorbance at 260/280 nm using a UV spectrophotometer (GeneQuant 1300, GE Healthcare Life Sciences, UK). The RNA was then subjected to reverse transcription and fluorescence quantification using kits from TransGen Biotech (Beijing, China; AU341 and AQ602, respectively). Primer pairs were designed using Primer 5 software (Premier Biosoft, Palo Alto, CA, USA) and validated through the Basic Local Alignment Search Tool (BLAST; NCBI, USA). RNase/DNase-free water was used as a blank control in place of cDNA samples. mRNA expression levels were quantified using the 2-∆∆CT method, with ACTB as the reference gene for normalization. The primer sequences are listed in Table 3 . Each experiment was repeated at least three times. Table 3 Primer sequences used for this study Items Primer sequence (5’-3’) Fragment Size (bp) Gene bank No FORWARD Reverse PGR CCTGTGGAAGCTGTAAGGTC AGTTCCGAAAACCTCCAAGA 171 XM_027979146.3 SPP1 TCACAGGGGACTGGACTCTT GGTTTAACTGGAAGGGCGGA 117 NM_001009224.1 TGFB1 ACACACAGTACAGCAAGGTCC CACGTAGTACACGATGGGCA 113 NM_001009400.2 MUC1 TCTCATTGCCCTGGTTGTGT TAGGGGCTCCGTTTGGTACT 156 XM_027976040.2 PCNA TGCAGATGTACCCCTTGTTGT CATCCTCGATCTTGGGAGCC 83 XM_004014340.5 CCND1 ATCAGATGTGACCCGGACTG CCCTCAAATGTTCACGTCGC 183 XM_027959928.2 CDK4 CAGTGTACAAGGCCCGTGAT GACGTCCATGAGCCTGACAA 176 NM_001127269.1 MMP-2 CGCTTCCAGGGCACATCTTA CAGTGGACATGGCAGTCTCG 133 NM_001166180.1 ACTB TCAGCAAGCAGGAGTACGAC ACGAGGCCAATCTCATCTCG 137 NM_001009784.3 2.11. RNA-seq and Bioinformatics analysis Total RNA was extracted from endometrial tissue using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. The quantity, purity, and integrity of RNA were assessed using a NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA) and an Agilent 2100 Bioanalyzer. All RNA samples had RNA integrity numbers (RIN) greater than 7.0. Ribosomal RNA (rRNA) was removed using the Epicentre Ribo-zero™ rRNA Removal Kit (Epicentre Technologies, USA), and strand-specific RNA-seq libraries were constructed using the NEBNext® Ultra™ Directional RNA Library Prep Kit (New England Biolabs, USA). Paired-end sequencing (150 bp reads, PE150) was performed on the Illumina NovaSeq™ 6000 platform (LC-Bio Technology Co., Ltd., Hangzhou, China). The original sequencing data are shown in Supplementary Dataset 3. Differential expression analysis was performed using DESeq2 (v1.34.0) in R/Bioconductor (v4.1.0). Raw RNA-seq counts were normalized via variance-stabilizing transformation (VST) to correct for library size differences. A negative binomial generalized linear model identified differentially expressed genes (DEGs) between experimental groups, with significance thresholds of |log2 fold-change| ≥ 1 and Benjamini-Hochberg adjusted *p*-value < 0.05. Functional enrichment analysis of DEGs was conducted using topGO (v2.50.0) with Fisher’s exact test, annotating Gene Ontology terms and biological pathways (adjusted *p*-value < 0.05). A Euclidean distance matrix was computed from the normalized expression profiles of DEGs of using `stats::dist`. Hierarchical clustering was performed via `hclust` (method = "average linkage"). To systematically identify outliers, the dynamic tree-cutting algorithm `WGCNA::cutreeDynamic` was applied with parameters `deepSplit = 2` (enhanced cluster separation) and `minClusterSize = 3` (minimum samples per cluster). This partitioned the dendrogram into subgroups, flagging samples deviating from major clusters. 2.12. Organoid co-culture with hatched blastocysts and trophoblast adhesion analysis The in vitro embryo production followed established protocols [ 32 ], where blastocysts were cultured in modified SOF medium until D6/D7[ 33 ]. Upon zona pellucida hatching on D8, hatched blastocysts were transferred to the center of low-adhesion 24-well plates containing 500 µL endometrial luminal epithelium organoid medium, with 100 apical-out (APR-OUT) organoids seeded at the periphery for co-culture. For trophoblast adhesion assays, trophoblast cells isolated from early-gestation ovine placenta (characterization shown in Supplementary Figure. S1) were plated to confluency in 48-well plates. Forty hormone-pretreated organoids were carefully overlaid onto the trophoblast monolayer and allowed to settle naturally. Adhesion kinetics were assessed at 1, 2, 4, 6, 8, 24, and 48-hour intervals through gentle washing: pre-warmed PBS (37°C) was slowly added along the well walls (1 mL/well), incubated briefly, then the plate was rocked 3–5 times to suspend non-adherent cells. After careful PBS aspiration (avoiding monolayer disruption), this wash cycle was repeated 1–2 times to preserve adherent cell integrity while removing unbound organoids. Adherent organoids were quantified microscopically at each timepoint. 2.13. Statistical analysis Data were analyzed using SPSS 28.0.1.1 and are presented as the means ± standard error of the mean (SEM) from at least three independent experiments. Comparisons between two groups were conducted using a t -test with statistical significance defined as * p < 0.05 and high significance as ** p < 0.01. To compare between more than two groups, a one-way ANOVA followed by Tukey’s post hoc test (statistical significance of p < 0.05) was used. Results Optimization of Ovine Endometrial Luminal Epithelial Organoid Culture: Protocol Development and Medium Refinement We established a three-dimensional organoid culture system using luminal epithelial cells isolated from ovine endometrial caruncles (Fig. 1 A). Under optimized conditions, these cells self-organized into functional organoids exceeding 100 µm in diameter within 8 days. As suitable culture media for ovine endometrial luminal epithelium were previously undefined, we modified existing murine endometrial organoid protocols. Initial screening showed that while neither WNT3A nor CHIR99021 alone effectively promoted organoid formation, their combination significantly improved formation efficiency (p < 0.01). Subsequent addition of Y-27632 (ROCK inhibitor) further enhanced organoid yield, though the average diameter remained below 100 µm (Fig. 1 B, 1 C, 1 E) (p < 0.01). To address this, we incorporated SB202190 (p38 MAPK inhibitor), which increased organoid size but still failed to consistently surpass 100 µm (p < 0.01). Cell-cell communication analysis of our scRNA-seq data (to be published) revealed EPHA pathway activation in luminal epithelium, prompting EPHA1 agonist supplementation (10 nM). This modification significantly promoted organoid enlargement, reliably achieving diameters > 100 µm (Fig. 1 B, 1 C, 1 E) (p < 0.01). Further analysis of media components demonstrated that FGF10, EGF, HGF, NOG and A83-01 were essential for organoid formation, while RSPO1 (R-Spondin1) proved non-essential (Fig. 1 D). The organoids maintained stable passage capability through at least 6 generations, with persistent proliferative activity confirmed by KI67 immunostaining in F6 cultures (Fig. 1 F). Characteristic analysis of Endometrial Luminal Epithelial organoids in sheep Histological and ultrastructural characterization confirmed that the luminal epithelial organoids faithfully recapitulated key morphological and functional features of native endometrial tissue. Hematoxylin and eosin (H&E) staining revealed the formation of distinct luminal structures within the organoids (Fig. 2 A), while periodic acid-Schiff (PAS) staining demonstrated abundant mucin secretion into these luminal spaces (Fig. 2 B). Transmission electron microscopy (TEM) analysis showed: (1) dense microvilli coverage on the apical surface (black arrows, Fig. 2 C), (2) well-developed desmosomes at cell-cell junctions (white arrows, Fig. 2 C), and (3) numerous secretory vesicles adjacent to microvilli (black arrows, Fig. 2 D). Immunofluorescence staining confirmed strong expression of characteristic luminal epithelial markers including Keratin 18 ( KRT-18 ), Trophoblast Cell Surface Antigen 2 ( TROP2 ), and Epithelial Cell Adhesion Molecule ( EPCAM ) (Fig. 2 E). The polarized distribution pattern of EPCAM particularly demonstrated proper epithelial polarity establishment in vitro. Notably, the expression profiles of these markers in organoids closely mirrored their spatial distribution patterns in native uterine tissue (Fig. 2 F). Collectively, these comprehensive analyses demonstrate that our endometrial luminal epithelial organoids successfully recapitulate the histological architecture and secretory functions of in vivo luminal epithelium at multiple biological scales. Polarity reversal in ovine endometrial luminal epithelial organoids During growth in Matrigel, sheep endometrial luminal epithelial organoids exhibit a basal-out polarity, with the basal side facing the matrix and the apical side enclosed within the organoid lumen. To mimic the in vivo orientation of luminal epithelial cells with apical surfaces facing outward, we released the organoids from Matrigel and cultured them in suspension on low-attachment plates to induce polarity reversal (Fig. 3 A). After 48 hours of suspension culture, compared with unreversed organoids, the reversed organoids displayed clearer boundaries and evident epithelial textures (Fig. 3 B). Immunofluorescence analysis at 24 hours of suspension culture showed that 76% of the organoids had undergone partial polarity reversal, exhibiting mixed apical-in and apical-out features (Figs. 3 C and 3 D). After 48 hours, 86% of the organoids had fully reversed to an apical-out configuration (Figs. 3 C and 3 D). To investigate the impact of polarity reversal on organoid proliferation and development, we compared the average size of organoids cultured in suspension with those continuously grown in Matrigel, as outlined in the experimental design (Fig. 3 E). Organoids were removed from Matrigel on day 4 (D4) and transferred to suspension culture. From day 8 (D8) onward, the average size of apical-out organoids was significantly smaller than that of basal-out organoids (p < 0.05). Throughout the subsequent culture period, apical-out organoids consistently remained smaller than their basal-out counterparts at the corresponding time points (p < 0.05) (Fig. 3 F). Quantification of Marker of Proliferation Ki-67-positive cells on day 14 revealed a significantly higher percentage of proliferative cells in basal-out organoids compared to apical-out organoids (p < 0.05) (Fig. 3 G). These findings indicate that the apical-out organoids exhibit a markedly reduced proliferative capacity compared to basal-out organoids. Hormone Responsiveness in Apical-Out and Basal-Out Organoids To elucidate the differential responses of Apical-Out and Basal-Out organoids to reproductive hormones and IFN-τ, we administered three treatments (E2, E2 + MPA, and E2 + MPA + IFN-τ; Fig. 4 A). QRT-PCR analysis demonstrated that Progesterone Receptor ( PGR ) mRNA expression level was exclusively upregulated by E2 (p < 0.05; Fig. 4 B), whereas Secreted Phosphoprotein 1 ( SPP1 ) mRNA expression level responded robustly to E2 (p < 0.05) and exhibited further enhancement with MPA co-treatment (p < 0.05; Fig. 4 C). Transforming Growth Factor Beta 1 ( TGFB1 ) mRNA expression level displayed a triphasic regulatory pattern—E2-induced activation (p < 0.05), MPA-mediated suppression (p < 0.05), and IFN-τ-dependent rescue (p < 0.05; Fig. 4 D)—while Mucin 1 ( MUC1 ) mRNA expression level showed progressive upregulation across treatments (intergroup p < 0.05; Fig. 4 E). Notably, Matrix Metalloproteinase-2 ( MMP-2 ) mRNA expression level peaked under E2 + MPA (p < 0.05) but was attenuated by IFN-τ (p < 0.05; Fig. 4 F), and proliferation markers Proliferating Cell Nuclear Antigen ( PCNA ), Cyclin D1 ( CCND1 ) and Cyclin-Dependent Kinase 4 ( CDK4 ) were induced by E2 (p < 0.05) yet suppressed by MPA (p < 0.05; Figs. 4 G-I). Western blotting analysis validated these transcriptional changes in Apical-Out organoids at the protein level (Figs. 4 J-K). E2 emerges as the master regulator governing endometrial receptivity-associated genes in organoids. MPA exhibits synergistic potentiation of gene expression, particularly for SPP1 and MUC1. IFN-τ demonstrates pathway-specific modulation, selectively targeting the TGFB1/MMP-2 signaling axis. Apical-Out organoids transcriptionally recapitulate luminal epithelium To evaluate the similarity between Apical-Out organoids and native tissues, we generated bulk RNA-seq data for luminal epithelial cells and stromal cells using our lab's previously published single-cell RNA sequencing data of early pregnant Hu sheep endometrium (Supplementary Dataset 1). Concurrently, we performed transcriptome sequencing of Apical-Out organoids under the conditions described in Fig. 4 A and conducted integrated analysis. Differential expression analysis between luminal epithelial and stromal cells identified 3,996 significantly differentially expressed genes (Supplementary Dataset 2). Hierarchical clustering analysis based on these genes demonstrated that the organoids clustered more closely with luminal epithelial cells than with stromal cells (Fig. 5 A), further confirming their luminal epithelial characteristics. To better define the genetic signature of endometrial luminal epithelium, we performed comparative analysis among luminal epithelial cells, IFN-τ + E2 + MPA-treated organoids, and stromal cells. This revealed 752 genes that were significantly upregulated (fold change ≥ 2, p ≤ 0.01) in organoids compared to native endometrial luminal epithelial cells (Fig. 5 B). GO enrichment analysis showed these differentially expressed genes were significantly associated with epithelial cell characteristics (Fig. 5 C). Key markers were identified, including epithelial cell markers ( CDH1 , KRT-18 , and EPCAM ), mucosal secretory cell markers (MUC1), and established ovine luminal epithelial markers ( WFDC2 , IGFBP2 ) (Fig. 2 D). Transcriptome analysis demonstrated that estrogen treatment significantly upregulated estrogen-responsive genes ( PCNA , PGR , VEGF ) in the organoids. Following E2 + MPA treatment, progesterone-activated genes ( KLF9 , FOXO3 , ENPP5 ) showed increased expression. Moreover, E2 + MPA + IFN-τ treatment induced substantial expression of interferon-stimulated genes ( MX2 , ISG15 , IFIT3 ) (Fig. 2 E). These findings collectively indicate that the organoids faithfully recapitulate the transcriptional profile of native luminal epithelial cells and exhibit physiological responses to reproductive hormones that mirror in vivo conditions. Effects of organoids on blastocyst development and their adhesive interactions with trophoblasts To investigate the regulatory effects of endometrial organoids on embryonic development and trophoblast adhesion in a simulated maternal uterine microenvironment, we co-cultured in vitro-fertilized embryos with endometrial luminal epithelial organoids. Embryos were cultured for 8 days to the hatched blastocyst stage (Fig. 6 B) and then co-cultured with organoids for an additional 4 days (Fig. 6 A, C). After 4 days of co-culture, embryos in the organoid co-culture group exhibited a significantly larger diameter (500.70 ± 32.54 µm; P < 0.05) compared to the control group (416.36 ± 32.59 µm; P < 0.05), representing a 20.25% increase in average diameter (Fig. 6 D). These results suggest that secretory factors from endometrial organoids enhance embryonic proliferation. To model organoid-trophoblast interactions, we co-cultured 40 organoids with a confluent monolayer of trophoblast cells in 24-well plates. Organoids began adhering to trophoblasts within 1 hour, with adhesion efficiency increasing significantly over time (Fig. 6 F). By 8 hours, nearly all organoids had adhered to the trophoblast layer (Fig. 6 F). After 24 hours, organoids showed extensive fusion with the underlying trophoblasts, accompanied by loss of spherical structure (Fig. 6 E). By 48 hours, new cells had migrated radially from the adherent organoids (Fig. 6 E). Notably, organoid adhesion capacity remained stable across multiple passages, with no significant differences observed after 6 hours of co-culture (Fig. 6 G). However, hormonal treatments significantly accelerated adhesion kinetics: E2 + MPA and E2 + MPA + IFN-τ treated organoids showed significantly higher adhesion rates than controls at both 2 and 4 hours, with E2 alone also enhancing adhesion by 4 hours (Fig. 6 H). All hormone-treated groups achieved complete adhesion by 6 hours, demonstrating that E2 and MPA synergistically promote organoid-trophoblast adhesion, while IFN-τ provided no additional benefit beyond the E2 + MPA combination. Discussion As organoid technology becomes increasingly prevalent in reproductive biology studies, researchers have successfully developed endometrial organoid models across multiple species, enabling precise simulation of intricate in vivo microenvironments and cellular dynamic [ 34 , 35 ].Compared to mice and humans, ruminants exhibit a more complex uterine structure and species-specific cyclic regulatory mechanisms. Therefore, establishing a sheep endometrial organoid model not only holds significant theoretical importance but also provides a powerful tool for investigating reproductive regulation mechanisms in ruminant species [ 36 , 37 ]. This study focuses on the luminal epithelium (LE) of the endometrium, a critical cell population that plays a pivotal role during embryo implantation. The LE is functionally specialized for embryo recognition, signal sensing, and initial adhesion, making it indispensable for successful pregnancy establishment [ 38 , 39 ]. Using mechanical dissociation combined with enzymatic digestion, we successfully isolated a luminal epithelium-enriched cell population from ovine endometrial caruncle tissue. Subsequently, we established a stable organoid culture system in three-dimensional Matrigel matrix. During culture optimization, we demonstrated that the combination of WNT3A and CHIR99021 synergistically promotes organoid formation efficiency. WNT3A, a canonical WNT pathway ligand, activates β-catenin-dependent transcriptional regulation, while CHIR99021, a potent GSK3β inhibitor, synergistically enhances downstream WNT signaling activity [ 40 , 41 ]. We observed that WNT3A alone yielded suboptimal organoid formation efficiency, whereas combinatorial treatment with CHIR99021 significantly increased both organoid number and diameter. These findings align with the WNT-dependent characteristics observed in human and murine endometrial organoid models, yet reveal a stronger synergistic pathway dependence in ovine systems. This suggests that ovine luminal epithelium may possess a higher activation threshold for WNT signaling[ 19 , 22 ]. Notably, the combined application of Y-27632 and SB202190 significantly enhanced both the adult stemness and proliferative capacity of luminal epithelial cells. This represents a technical innovation in our culture system optimization. Intriguingly, we observed a similar phenomenon during the establishment of ovine ruminal epithelial organoids, suggesting a conserved role of these two factors in maintaining stemness properties across different ovine epithelial lineages [ 42 ]. Notably, our study represents the first attempt to incorporate EPHA1 signaling modulators, revealing their critical role in both promoting organoid formation and maintaining cellular polarity. EPHA1, a membrane-bound tyrosine kinase receptor, plays multifaceted roles in epithelial cell organization, intercellular communication, and tissue boundary maintenance. Notably, this receptor has been demonstrated to promote proliferative activity in bovine endometrial epithelial cells[ 43 , 44 ]. Supplementation of the organoid culture system with an EPHA1 agonist resulted in significantly increased organoid diameter, indicating that EPHA1 signaling potently promotes organoid proliferation and development. These findings provide the first evidence for the functional role of EPHA1 signaling in uterine organoid formation, establishing a foundation for future investigations into its mechanistic involvement in embryo implantation-related tissue remodeling. In summary, the successful establishment of ovine endometrial luminal epithelium organoids requires coordinated regulation of multiple signaling pathways. Our systematic optimization demonstrates that: (1) WNT3A/CHIR99021 maintains stemness properties, (2) Y-27632/SB202190 enhances cellular viability and stability, and (3) EPHA1 signaling mediates proliferative activity. This refined culture system not only provides a technical platform for robust reconstruction of endometrial luminal architecture, but also establishes a critical foundation for modeling the embryo-uterine dialog microenvironment. During the establishment of ovine endometrial luminal epithelium organoids, evaluating their structural and phenotypic recapitulation is critical for validating the physiological relevance of the organoid model[ 45 ]. Through comprehensive histological staining, ultrastructural analysis, and phenotypic marker characterization, we systematically validated the ability of organoids to recapitulate key features of luminal epithelium. At the structural level, organoids developed vesicle-like cavities and exhibited mucin secretory activity—hallmarks of polarized epithelial differentiation. These findings collectively demonstrate the organoids’ functional competence in mimicking the uterine luminal microenvironment. Glycans and mucins constitute essential secretory components of the endometrium that critically support embryonic development and implantation[ 46 ]. Notably, PAS-positive staining confirmed the secretion of glycoprotein-like substances by the organoids, demonstrating their ability to recapitulate the endocrine functionality of the native endometrium. Furthermore, microvilli serve as critical sensory and regulatory structures for epithelial cells to perceive and adapt to their microenvironment[ 46 ]. Transmission electron microscopy (TEM) revealed well-developed microvilli and secretory vesicles, providing ultrastructural evidence for the functional maturation of differentiated epithelium in these organoids. Phenotypic characterization revealed consistent expression of luminal epithelial markers (KRT18, TROP2, and EPCAM) in the organoids, confirming their tissue origin and recapitulation of in vivo expression patterns[ 47 ]. However, the organoids currently lack a fully developed basement membrane and stromal cell support, which may compromise their long-term culture stability and maturation. To address this limitation, future studies could integrate co-culture systems or biomechanical stimulation to enhance structural complexity and functional fidelity[ 45 , 48 ]. In vivo, embryo implantation requires direct contact between endometrial luminal epithelium and trophoblasts. Conventional epithelial organoids exhibit an "Apical-IN" polarity (apical surface facing the lumen, basolateral side outward), which limits their ability to fully simulate the intrauterine environment, particularly for studying physiological processes involving luminal interactions[ 49 ]. To address this limitation, we developed an Apical-OUT polarity reversal model, inspired by intestinal and murine endometrial organoid systems [ 50 , 51 ], where the apical surface is exposed to the culture medium to better mimic the natural uterine luminal interface. During polarity reversal, organoids exhibited slight flattening with reduced or absent luminal structures, likely due to reorganization of cell junctions and cytoskeletal arrangements. The polarity reversal was completed within approximately 48 hours - significantly faster than observed in murine intestinal organoids, possibly due to their larger luminal cavities requiring more time for structural reorganization. Notably, suspended Apical-OUT organoids showed significantly reduced size compared to Matrigel-embedded cultures after day 8. KI67 staining revealed moderately decreased proliferative activity in reversed organoids, suggesting polarity alteration may impose transient proliferative suppression. This phenotypic shift may stem from cytoskeletal remodeling during polarity reversal and loss of cell-matrix interactions, warranting further investigation into its mechanistic basis and functional implications. The endometrial function is critically regulated by the cyclic actions of reproductive hormones, particularly estradiol (E2) and progesterone (P4), which determine uterine receptivity and the opening/closing of the implantation window[ 52 ]. Therefore, evaluating the hormonal responsiveness of organoid models serves as a crucial indicator of their physiological relevance and in vivo mimicry capability. Through systematic analysis of the response characteristics to reproductive hormones and IFN-τ in both Apical-Out and Basal-Out organoids, our study provides profound insights into the molecular regulatory mechanisms of endometrial epithelial cells under different polarity states. Despite their distinct morphological differences, we made the striking observation that these two polarity-variant organoid models exhibited highly consistent gene expression profiles upon hormonal and IFN-τ stimulation. This significant finding establishes an important foundation for the application of organoid models in reproductive biology research. The results clearly demonstrate the central role of E2 in regulating endometrial receptivity. The specific response of PGR to E2 (Fig. 4 B) aligns with established estrogen regulatory mechanisms[ 53 ]. Notably, the expression patterns of SPP1 and MUC1 (Fig. 4 C, 4 E) faithfully recapitulate the molecular signatures of epithelial cells during the implantation window in vivo. The synergistic enhancement of SPP1 by MPA is particularly striking, underscoring progesterone's unique role in embryo adhesion [ 54 ]. The dynamic regulation of TGFB1 (Fig. 4 D) further reveals the intricate crosstalk between hormonal and embryonic signals. The reversal of MPA’s inhibitory effect by IFN-τ highlights its critical function in maintaining immune homeostasis at the maternal-fetal interface. This pattern closely mirrors the hormonal response of endometrial epithelial cells in vivo, confirming that the organoid system effectively mimics the physiological hormonal milieu [ 55 , 56 ]. The expression changes in proliferation-related genes (Fig. 4 G-I) accurately replicate the proliferation-differentiation switch observed in the endometrium during embryo implantation. The pro-proliferative effect of E2 contrasts sharply with the suppressive role of MPA, while the "neutral" response to IFN-τ aligns with its known immunomodulatory function [ 57 , 58 ]. The regulation of MMP-2 (Fig. 4 F) is particularly noteworthy—its peak expression under E2 + MPA treatment and subsequent IFN-τ-mediated suppression likely reflect the embryo's precise control over stromal remodeling. Western blot analysis (Fig. 4 J-K) further validates these findings at the protein level, reinforcing the robustness of our conclusions. Although Apical-Out organoids exhibit slightly reduced proliferative capacity, their consistent hormonal responsiveness makes them an ideal model for studying the uterine luminal microenvironment. Our study not only confirms the reliability of organoids in simulating endometrial physiology but, more importantly, reveals that polarity has a limited impact on epithelial cell functional regulation. These findings establish a solid foundation for future research on maternal-fetal crosstalk using Apical-Out organoids and provide key insights for developing more physiologically relevant in vitro models. To further validate the molecular-level recapitulation of luminal epithelium by our engineered organoids, we performed an integrative analysis comparing their transcriptomic profiles with bulk RNA-seq (BULK-seq) data generated from endometrial single-cell sequencing. Cluster analysis demonstrated that the overall transcriptional signature of the organoids exhibited greater similarity to luminal epithelium than to stromal cells, indicating successful preservation of luminal epithelial transcriptional characteristics during in vitro culture. These findings are consistent with previous observations in both human and murine uterine organoid studies, confirming that organoids can maintain stable epithelial lineage expression independent of stromal cell support [ 20 , 22 ]. This comparative transcriptomic analysis provides compelling evidence that our organoid model faithfully captures the essential molecular attributes of native luminal epithelium. Differential expression analysis further revealed that the organoids and luminal epithelium shared high expression levels of multiple epithelial marker genes (including CDH1, KRT18, and EPCAM), as well as pregnancy-specific functional molecules WFDC2 and IGFBP2. These findings not only demonstrate the model's fidelity in maintaining cellular lineage identity but also suggest its potential secretory functionality. Notably, the epithelial secretory capacity plays a crucial role in supporting early embryonic development by producing glycoproteins, cytokines, and chemokines - processes whose regulation fundamentally depends on the organoid system's ability to faithfully recapitulate hormonal and signaling pathway responses [ 9 , 59 ]. In terms of hormonal responsiveness, the organoids demonstrated characteristic upregulation of key downstream genes (including PCNA, PGR, and KLF9) following estrogen and progesterone treatment, effectively mimicking the hormone-sensitive features of endometrium during either the menstrual cycle or early pregnancy. Particularly noteworthy was the robust upregulation of interferon pathway effectors (MX2, ISG15, and IFIT3) under combined E2 + MPA + IFN-τ stimulation, which precisely recapitulates the maternal immune response during embryonic recognition observed in vivo [ 55 ]. These results collectively demonstrate the organoid system's dual competence in responding to both reproductive endocrine signals and embryonic cues, thereby establishing a biologically relevant in vitro platform for modeling the implantation window. Building upon these findings, we further investigated the potential of endometrial organoids to recapitulate key aspects of maternal-embryo crosstalk during early implantation. Co-culture experiments revealed that the organoids significantly enhanced in vitro growth of day-8 blastocysts, suggesting their capacity to secrete embryotrophic factors that promote proliferation and survival. While the N2 + B27 culture system has been shown to support embryonic proliferation in vitro, it fails to fully mimic the rapid blastocyst elongation observed in vivo [ 60 ]. To address this limitation, we supplemented the N2/B27 medium with additional factors known to enhance luminal epithelial activity. This modified formulation supported limited blastocyst expansion even in the absence of organoids, but co-culture with organoids resulted in significantly accelerated growth kinetics (p < 0.01). The observed increase in blastocyst volume could originate from either trophectoderm or inner cell mass proliferation - a distinction requiring future lineage-specific marker analysis. Notably, recent metabolomic studies have identified multiple critical metabolites in organoid-conditioned media [ 61 ]. Our established co-culture system, when combined with such multi-omics approaches (e.g., metabolomics and proteomics), will enable systematic identification of key embryotrophic factors. This strategy promises to bridge the current gap between in vitro models and the complex embryonic development occurring in utero. While conventional in vitro models for studying maternal-fetal interactions in ruminants have primarily relied on two-dimensional (2D) co-culture systems of endometrial epithelial cells and trophoblasts[ 62 , 63 ], the present study developed an advanced three-dimensional model using Apical-Out endometrial luminal epithelial organoids co-cultured with trophoblast cells. Our results demonstrated that the organoids established stable adhesions with trophoblasts within remarkably short time periods, while maintaining consistent adhesive capacity across multiple passages - indicating excellent experimental reproducibility and translational potential of this model. Notably, reproductive hormones significantly enhanced organoid-trophoblast adhesion, with the E2 + MPA and E2 + MPA + IFN-τ treatment groups achieving particularly high attachment ratios in minimal time. This hormone-responsive pattern closely recapitulates the enhanced endometrial-trophoblast interactions observed during in vivo pregnancy under hormonal regulation [ 26 ], thereby confirming the superior physiological relevance of our ovine luminal epithelial organoid system for modeling hormone-mediated uterus-embryo crosstalk. In summary, this study demonstrates that the established ovine endometrial organoids not only recapitulate the structural and secretory characteristics of luminal epithelium, but also functionally promote embryonic development and trophoblast adhesion. However, several important limitations remain: (1) The absence of stromal cells, immune cells and other functional cell types in the culture system deprives luminal epithelial cells of critical paracrine signaling from these cellular components, thus failing to fully mimic the in vivo microenvironment; (2) While responsive to E2, P4 and IFN-τ, the static hormone concentrations and timing in vitro cannot precisely replicate the dynamic fluctuations during estrous cycles; (3) Although supporting blastocyst proliferation and trophoblast adhesion, the proliferation patterns differ substantially from in vivo conditions, as evidenced by the markedly slower conceptus elongation in vitro, making complete simulation of ovine blastocyst-endometrium adhesion exceptionally challenging. Future studies should integrate microfluidic devices, co-culture matrix systems and 3D bioprinting technologies to develop more physiologically relevant maternal-fetal interface models with enhanced complexity, thereby providing an improved foundation for reconstructing ruminant uterus-embryo interactions that better approximate in vivo conditions [ 64 , 65 ]. Conclusion This study successfully established ovine endometrial luminal epithelial organoids by optimizing signaling pathways (WNT3A/CHIR99021/EPHA1 agonist) and identifying essential medium components (FGF10/EGF/HGF/NOG/A83-01). These organoids faithfully replicated luminal epithelial-specific features, including polarized architecture (microvilli, desmosomes), mucin secretion, and hormone-responsive gene expression (PGR, SPP1, MUC1). Notably, polarity orientation critically influenced functionality: apical-out organoids exhibited reduced proliferation compared to basal-out counterparts but retained transcriptional fidelity to native luminal epithelium. Hormonal regulation studies revealed E2 as a master driver of receptivity genes, while MPA synergistically amplified secretory functions, and IFN-τ selectively modulated TGFB1/MMP-2 signaling. Functionally, luminal epithelial organoids enhanced blastocyst expansion (20% size increase) and accelerated trophoblast adhesion under E2 + MPA treatment, mirroring physiological embryo-maternal interactions. This model provides a luminal epithelium-centric platform to dissect polarity-dependent endometrial dynamics, hormone-IFN-τ crosstalk, and implantation mechanisms, offering novel insights for reproductive research and therapeutic development. Abbreviations Abbreviation Full Name/Definition APH-OUT Apical-out polarity Basal-Out Basal-out polarity EPHA1 Ephrin Type-A Receptor 1 ExM Organoid Expansion Medium FGF10 Fibroblast Growth Factor 10 FOXO3 Forkhead Box O3 GO Gene Ontology H&E Hematoxylin and Eosin HGF Hepatocyte Growth Factor IFN-τ Interferon-Tau IFIT3 Interferon-Induced Protein with Tetratricopeptide Repeats 3 IGFBP2 Insulin-Like Growth Factor Binding Protein 2 ISG15 Interferon-Stimulated Gene 15 KI67 Marker of Proliferation Ki-67 KLF9 Krüppel-Like Factor 9 KRT18 Keratin 18 LE Luminal Epithelium LysoPC Lysophosphatidylcholine MPA Medroxyprogesterone Acetate MMP-2 Matrix Metalloproteinase-2 MUC1 Mucin 1 MX2 MX Dynamin-Like GTPase 2 NOG Noggin PAS Periodic Acid-Schiff PCNA Proliferating Cell Nuclear Antigen PEDV Porcine Epidemic Diarrhea Virus PGR Progesterone Receptor RSPO1 R-Spondin1 SEM Standard Error of the Mean SPP1 Secreted Phosphoprotein 1 TEM Transmission Electron Microscopy TGFB1 Transforming Growth Factor Beta 1 TROP2 Trophoblast Cell Surface Antigen 2 VEGF Vascular Endothelial Growth Factor WFDC2 WAP Four-Disulfide Core Domain 2 WNT3A Wnt Family Member 3A Declarations Funding This project was supported by the International (Regional) Cooperation and Exchange Program of the National Natural Science Foundation of China (Grant No. 3221101716) Acknowledgements This study supported by the high-performance computing platform of Bioinformatics Center, Nanjing Agricultural University Conflict of Interest Statement The authors declare no competing financial interest. Author contributions Jiahe Guo designed and performed most of the experiments. Xinai, Huang, Rongxin Xia and Qin Gao assisted in sample collection and analyzed the data. Hua yang and Qingyang Mai contributed to the experimental part. Guomin Zhang,Yanli Zhang and Mingtian Deng interpreted the data. Jiahe Guo drafted the manuscript with input from all the authors. Feng Wang supervised the study and administrated the project. All authors read and approved the final manuscript. Data Availability Statement The datasets used and analyzed during the current study are available from the corresponding author on reasonable request. Ethics approval statement All animal procedures were ethically approved by the Ethics Committee of Nanjing Agricultural University, China (SYXK2022-0031). References Deng N, Li G, Zhang L, Wang P, Liu M, He B, Tang Y, Cai H, Lu J, Wang H, Deng W, Bao H, Kong S (2024) H3K27me3 timely dictates uterine epithelial transcriptome remodeling and thus transformation essential for normal embryo implantation. Cell Death Differ 31:1013–1028 Mole MA, Weberling A, Fassler R, Campbell A, Fishel S, Zernicka-Goetz M (2021) Integrin beta1 coordinates survival and morphogenesis of the embryonic lineage upon implantation and pluripotency transition. Cell Rep 34:108834 Lai ZZ, Wang Y, Zhou WJ, Liang Z, Shi JW, Yang HL, Xie F, Chen WD, Zhu R, Zhang C, Mei J, Zhao JY, Ye JF, Zhang T, Li MQ (2022) Single-cell transcriptome profiling of the human endometrium of patients with recurrent implantation failure, Theranostics. 12:6527–6547 Zhou W, Van Sinderen M, Rainczuk K, Menkhorst E, Sorby K, Osianlis T, Pangestu M, Santos L, Rombauts L, Rosello-Diez A, Dimitriadis E (2024) Dysregulated miR-124-3p in endometrial epithelial cells reduces endometrial receptivity by altering polarity and adhesion. Proc Natl Acad Sci U S A 121:e2401071121 van der Weijden VA, Puntar B, Rudolf Vegas A, Milojevic V, Schanzenbach CI, Kowalewski MP, Drews B, Ulbrich SE (2019) Endometrial luminal epithelial cells sense embryo elongation in the roe deer independent of interferon-taudagger. Biol Reprod 101:882–892 Quinn KE, Matson BC, Wetendorf M, Caron KM (2020) Pinopodes: Recent advancements, current perspectives, and future directions. Mol Cell Endocrinol 501:110644 Lim W, Bae H, Bazer FW, Song G (2017) Functional Roles of Eph A-Ephrin A1 System in Endometrial Luminal Epithelial Cells During Early Pregnancy. J Cell Physiol 232:1527–1538 Zlotkowska A, Andronowska A (2019) Chemokines as the modulators of endometrial epithelial cells remodelling. Sci Rep 9:12968 Yoo I, Lee S, Cheon Y, Park TS, Ka H (2025) CD40 ligand and CD40: expression, regulation and function at the maternal-conceptus interface in pigs, Reproduction. 169 Ng YH, Rome S, Jalabert A, Forterre A, Singh H, Hincks CL, Salamonsen LA (2013) Endometrial exosomes/microvesicles in the uterine microenvironment: a new paradigm for embryo-endometrial cross talk at implantation. PLoS ONE. 8e58502 Yang Q, Liu J, Wang Y, Zhao W, Wang W, Cui J, Yang J, Yue Y, Zhang S, Chu M, Lyu Q, Ma L, Tang Y, Hu Y, Miao K, Zhao H, Tian J (2022) An L., A proteomic atlas of ligand-receptor interactions at the ovine maternal-fetal interface reveals the role of histone lactylation in uterine remodeling. J Biol Chem 298:101456 Davenport KM, Ortega MS, Johnson GA, Seo H, Spencer TE (2023) Review: Implantation and placentation in ruminants, Animal. 17 Suppl 1:100796 Ahn J, Yoon MJ, Hong SH, Cha H, Lee D, Koo HS, Ko JE, Lee J, Oh S, Jeon NL, Kang YJ (2021) Three-dimensional microengineered vascularised endometrium-on-a-chip. Hum Reprod 36:2720–2731 Eissa AM, Barros FSV, Vrljicak P, Brosens JJ, Cameron NR (2018) Enhanced Differentiation Potential of Primary Human Endometrial Cells Cultured on 3D Scaffolds, Biomacromolecules. 19:3343–3350 Valentijn AJ, Saretzki G, Tempest N, Critchley HO, Hapangama DK (2015) Human endometrial epithelial telomerase is important for epithelial proliferation and glandular formation with potential implications in endometriosis. Hum Reprod 30:2816–2828 Classen-Linke I, Kusche M, Knauthe R, Beier HM (1997) Establishment of a human endometrial cell culture system and characterization of its polarized hormone responsive epithelial cells. Cell Tissue Res 287:171–185 Clevers H (2016) Modeling Development and Disease with Organoids, Cell. 165:1586–1597 Corsini NS, Knoblich JA (2022) Human organoids: New strategies and methods for analyzing human development and disease. Cell 185:2756–2769 Boretto M, Cox B, Noben M, Hendriks N, Fassbender A, Roose H, Amant F, Timmerman D, Tomassetti C, Vanhie A, Meuleman C, Ferrante M, Vankelecom H (2017) Development of organoids from mouse and human endometrium showing endometrial epithelium physiology and long-term expandability. Development 144:1775–1786 Turco MY, Gardner L, Hughes J, Cindrova-Davies T, Gomez MJ, Farrell L, Hollinshead M, Marsh SGE, Brosens JJ, Critchley HO, Simons BD, Hemberger M, Koo BK, Moffett A, Burton GJ (2017) Long-term, hormone-responsive organoid cultures of human endometrium in a chemically defined medium. Nat Cell Biol 19:568–577 Saadeldin IM, Han A, Bang S, Kang H, Kim H, Abady MM, Jeong JS, Kwon HJ, Lee S, Cho J (2024) Generation of porcine endometrial organoids and their use as a model for enhancing embryonic attachment and elongation. Reproduction. 167 Fitzgerald HC, Dhakal P, Behura SK, Schust DJ, Spencer TE (2019) Self-renewing endometrial epithelial organoids of the human uterus. Proc Natl Acad Sci U S A 116:23132–23142 Spencer TE, Kelleher AM, Bartol FF (2019) Development and Function of Uterine Glands in Domestic Animals. Annu Rev Anim Biosci 7:125–147 Seishima R, Leung C, Yada S, Murad KBA, Tan LT, Hajamohideen A, Tan SH, Itoh H, Murakami K, Ishida Y, Nakamizo S, Yoshikawa Y, Wong E, Barker N (2019) Neonatal Wnt-dependent Lgr5 positive stem cells are essential for uterine gland development. Nat Commun 10:5378 Xu QX, Zhang WQ, Lu L, Wang KZ, Su RW (2023) Distinguish Characters of Luminal and Glandular Epithelium from Mouse Uterus Using a Novel Enzyme-Based Separation Method, Reprod Sci. 30:1867–1877 Spencer TE, Johnson GA, Bazer FW, Burghardt RC (2004) Implantation mechanisms: insights from the sheep. Reproduction 128:657–668 Haider S, Gamperl M, Burkard TR, Kunihs V, Kaindl U, Junttila S, Fiala C, Schmidt K, Mendjan S, Knofler M, Latos PA (2019) Estrogen Signaling Drives Ciliogenesis in Human Endometrial Organoids, Endocrinology. 160:2282–2297 Chen Y, Antoniou E, Liu Z, Hearne LB, Roberts RM (2007) A microarray analysis for genes regulated by interferon-tau in ovine luminal epithelial cells, Reproduction. 134:123–135 An SY, Gao XX, Wang ZB, Liang YX, Wang ST, Xiao SH, Xia JT, You PH, Wang F, Zhang GM (2020) Estradiol-17beta regulates proliferation and apoptosis of sheep endometrial epithelial cells by regulating the relative abundance of YAP1. Anim Reprod Sci 215:106328 Gilfeather CL, Lemley CO (2016) Effects of Interferon-Tau and Steroids on Cytochrome P450 Activity in Bovine Endometrial Epithelial Cells, Reprod Domest Anim. 51:415–420 Gao X, Yao X, Li X, Liang Y, Liu Z, Wang Z, Li K, Li Y, Zhang G, Wang F (2021) Roles of WNT6 in Sheep Endometrial Epithelial Cell Cycle Progression and Uterine Glands Organogenesis. Vet Sci. 8 Cocero MJ, Marigorta P, Novillo F, Folch J, Sanchez P, Alabart JL, Lahoz B (2019) Ovine oocytes display a similar germinal vesicle configuration and global DNA methylation at prepubertal and adult ages, Theriogenology. 138:154–163 Ramos-Ibeas P, Lamas-Toranzo I, Martinez-Moro A, de Frutos C, Quiroga AC, Zurita E, Bermejo-Alvarez P (2020) Embryonic disc formation following post-hatching bovine embryo development in vitro, Reproduction. 160:579–589 Shibata S, Endo S, Nagai LAE, Oike EHK, Kobayashi A, Kitamura N, Hori A, Nashimoto T, Nakato Y, Hamada R, Kaji H, Kikutake H, Suyama C, Saito M, Yaegashi M, Okae N, Arima H (2024) Modeling embryo-endometrial interface recapitulating human embryo implantation. Sci Adv 10:eadi4819 Tian J, Yang J, Chen T, Yin Y, Li N, Li Y, Luo X, Dong E, Tan H, Ma Y, Li T (2023) Generation of Human Endometrial Assembloids with a Luminal Epithelium using Air-Liquid Interface Culture Methods, Adv Sci (Weinh). 10:e2301868 Spencer TE, Hayashi K, Hu J, Carpenter KD (2005) Comparative developmental biology of the mammalian uterus. Curr Top Dev Biol 68:85–122 Spencer TE, Sandra O, Wolf E (2008) Genes involved in conceptus-endometrial interactions in ruminants: insights from reductionism and thoughts on holistic approaches, Reproduction. 135:165–179 Wang HQ, Liu Y, Li D, Liu JY, Jiang Y, He Y, Zhou JD, Wang ZL, Tang XY, Zhang Y, Zhen X, Cao ZW, Sheng XQ, Yang CF, Yue QL, Ding LJ, Hu YL, Hu ZB, Li CJ, Yan GJ, Sun HX (2023) Maternal and embryonic signals cause functional differentiation of luminal epithelial cells and receptivity establishment. Dev Cell 58:2376–2392 e2376 Bazer FW, Spencer TE, Johnson GA, Burghardt RC, Wu G (2009) Comparative aspects of implantation, Reproduction. 138:195–209 Li S, Ren Q (2020) Effects of Arsenic on wnt/beta-catenin Signaling Pathway: A Systematic Review and Meta-analysis. Chem Res Toxicol 33:1458–1467 Drakhlis L, Devadas SB, Zweigerdt R (2021) Generation of heart-forming organoids from human pluripotent stem cells. Nat Protoc 16:5652–5672 Xu Z, Xu X, Yang B, Mi Y, Wang J (2023) 3D sheep rumen epithelial structures driven from single cells in vitro. Vet Res 54:104 Lim W, Bae H, Bazer FW, Song G (2019) Ephrin A1 promotes proliferation of bovine endometrial cells with abundant expression of proliferating cell nuclear antigen and cyclin D1 changing the cell population at each stage of the cell cycle. J Cell Physiol 234:4864–4873 Adu-Gyamfi EA, Czika A, Liu TH, Gorleku PN, Fondjo LA, Djankpa FT, Ding YB, Wang YX (2021) Ephrin and Eph receptor signaling in female reproductive physiology and pathologydagger, Biol Reprod. 104:71–82 Gu ZY, Jia SZ, Liu S, Leng JH (2020) Endometrial Organoids: A New Model for the Research of Endometrial-Related Diseasesdagger, Biol Reprod. 103:918–926 Achache H, Revel A (2006) Endometrial receptivity markers, the journey to successful embryo implantation. Hum Reprod Update 12:731–746 Giudice LC, Liu B, Irwin JC (2025) Endometriosis and adenomyosis unveiled through single-cell glasses. Am J Obstet Gynecol 232:S105–S123 Sternberg AK, Izmaylova L, Buck VU, Classen-Linke I, Leube RE (2024) An Assessment of the Mechanophysical and Hormonal Impact on Human Endometrial Epithelium Mechanics and Receptivity. Int J Mol Sci 25 Kakni P, Lopez-Iglesias C, Truckenmuller R, Habibovic P, Giselbrecht S (2023) PSC-derived intestinal organoids with apical-out orientation as a tool to study nutrient uptake, drug absorption and metabolism. Front Mol Biosci 10:1102209 Co JY, Margalef-Catala M, Li X, Mah AT, Kuo CJ, Monack DM, Amieva MR (2019) Controlling Epithelial Polarity: A Human Enteroid Model for Host-Pathogen Interactions, Cell Rep. 26:2509–2520e2504 Ahmad V, Yeddula SGR, Telugu B, Spencer TE, Kelleher AM (2024) Development of Polarity-Reversed Endometrial Epithelial Organoids, Reproduction. 167 Yang T, Zhao J, Liu F, Li Y (2022) Lipid metabolism and endometrial receptivity. Hum Reprod Update 28:858–889 Motta IG, da Silva AG, Feltrin IR, Souza SV, Degan Mattos AC, Morelli KG, Castro T, Nishimura TK, Ginther OJ, Pugliesi G (2025) Effects of estradiol on PGF(2alpha) synthesis and corpus luteum function during early pregnancy in beef heifers, Theriogenology. 237:49–60 Dunlap KA, Erikson DW, Burghardt RC, White FJ, Reed KM, Farmer JL, Spencer TE, Magness RR, Bazer FW, Bayless KJ, Johnson GA (2008) Progesterone and placentation increase secreted phosphoprotein one (SPP1 or osteopontin) in uterine glands and stroma for histotrophic and hematotrophic support of ovine pregnancy. Biol Reprod 79:983–990 Johnson GA, Bazer FW, Burghardt RC, Seo H, Wu G, Cain JW, Pohler KG (2024) The history of interferon-stimulated genes in pregnant cattle, sheep, and pigs, Reproduction. 168 Brooks K, Burns GW, Moraes JG, Spencer TE (2016) Analysis of the Uterine Epithelial and Conceptus Transcriptome and Luminal Fluid Proteome During the Peri-Implantation Period of Pregnancy in Sheep, Biol Reprod. 95:88 Baranda-Avila N, Mendoza-Rodriguez CA, Morimoto S, Langley E, Cerbon M (2009) Molecular mechanism of cell proliferation in rodent uterus during the estrous cycle. J Steroid Biochem Mol Biol 113:259–268 Chaney HL, Grose LF, Charpigny G, Behura SK, Sheldon IM, Cronin JG, Lonergan P, Spencer TE, Mathew DJ (2021) Conceptus-induced, interferon tau-dependent gene expression in bovine endometrial epithelial and stromal cellsdagger, Biol Reprod. 104:669–683 Seo H, Frank JW, Burghardt RC, Bazer FW, Johnson GA (2020) Integrins and OPN localize to adhesion complexes during placentation in sheep, Reproduction. 160:521–532 Ramos-Ibeas P, Gonzalez-Brusi L, Used MT, Cocero MJ, Marigorta P, Alberio R, Bermejo-Alvarez P (2022) In vitro culture of ovine embryos up to early gastrulating stages, Development. 149 Simintiras CA, Dhakal P, Ranjit C, Fitzgerald HC, Balboula AZ, Spencer TE (2021) Capture and metabolomic analysis of the human endometrial epithelial organoid secretome. Proc Natl Acad Sci U S A 118 Nakamura K, Kusama K, Bai R, Sakurai T, Isuzugawa K, Godkin JD, Suda Y, Imakawa K (2016) Induction of IFNT-Stimulated Genes by Conceptus-Derived Exosomes during the Attachment Period. PLoS ONE 11:e0158278 Chen X, Tang L, Pan Y, Xie Y, Jin H, Xiang X, Wang Z (2025) oar-miR-29a promotes the establishment of endometrial receptivity by targeting CDC42 in sheep, Theriogenology. 237:22–32 Saorin G, Caligiuri I, Rizzolio F (2023) Microfluidic organoids-on-a-chip: The future of human models. Semin Cell Dev Biol 144:41–54 Gnecco JS, Brown A, Buttrey K, Ives C, Goods BA, Baugh L, Hernandez-Gordillo V, Loring M, Isaacson KB, Griffith LG (2023) Organoid co-culture model of the human endometrium in a fully synthetic extracellular matrix enables the study of epithelial-stromal crosstalk. Med 4:554–579e559 Additional Declarations No competing interests reported. Supplementary Files CCND1RawWesternBlotFigure4J.tif.tif CDK4RawWesternBlotFigure4J.tif.tif PCNARawWesternBlotFigure4J.tif.tif MMP2RawWesternBlotFigure4J.tif.tif MUC1RawWesternBlotFigure4J.tif.tif PGRRawWesternBlotFigure4J.tif.tif SPP1RawWesternBlotFigure4J.tif.tif actinRawWesternBlotFigure4J.tif.tif TGFB1RawWesternBlotFigure4J.tif.tif supplementarymaterial.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6818248","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":484556001,"identity":"077715b3-1d69-41a1-b0a1-e91fa57f13ce","order_by":0,"name":"Jiahe Guo","email":"","orcid":"","institution":"Sanya institute of Nanjing Agricultural University, Nanjing Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Jiahe","middleName":"","lastName":"Guo","suffix":""},{"id":484556002,"identity":"3409f790-ee40-4075-9f07-b950c5e02abe","order_by":1,"name":"Xinai Huang","email":"","orcid":"","institution":"Sanya institute of Nanjing Agricultural University, Nanjing Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Xinai","middleName":"","lastName":"Huang","suffix":""},{"id":484556003,"identity":"de3a3a25-8f03-43ba-9e04-ff7f11d3cc06","order_by":2,"name":"Rongxin Xia","email":"","orcid":"","institution":"Nanjing Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Rongxin","middleName":"","lastName":"Xia","suffix":""},{"id":484556004,"identity":"3023ee5f-d441-4c23-b4ec-382fc941be32","order_by":3,"name":"Qin Gao","email":"","orcid":"","institution":"Sanya institute of Nanjing Agricultural University, Nanjing Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Qin","middleName":"","lastName":"Gao","suffix":""},{"id":484556005,"identity":"6672caab-858f-4a46-a893-a1e36a595ebe","order_by":4,"name":"Hua Yang","email":"","orcid":"","institution":"Sanya institute of Nanjing Agricultural University, Nanjing Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Hua","middleName":"","lastName":"Yang","suffix":""},{"id":484556006,"identity":"5d19961b-0333-472d-bae2-b61ee266532c","order_by":5,"name":"Qingyang Mai","email":"","orcid":"","institution":"Nanjing Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Qingyang","middleName":"","lastName":"Mai","suffix":""},{"id":484556007,"identity":"c6719711-7252-42a4-9134-387966602daa","order_by":6,"name":"Mingtian Deng","email":"","orcid":"","institution":"Sanya institute of Nanjing Agricultural University, Nanjing Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Mingtian","middleName":"","lastName":"Deng","suffix":""},{"id":484556008,"identity":"9ced6810-f2d5-426e-ac8f-1dfefbaf55eb","order_by":7,"name":"Guomin Zhang","email":"","orcid":"","institution":"Nanjing Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Guomin","middleName":"","lastName":"Zhang","suffix":""},{"id":484556009,"identity":"745c758b-3663-4b42-a787-0560b808db8b","order_by":8,"name":"Yanli Zhang","email":"","orcid":"","institution":"Sanya institute of Nanjing Agricultural University, Nanjing Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Yanli","middleName":"","lastName":"Zhang","suffix":""},{"id":484556010,"identity":"582498a0-551f-4684-b77b-b401aa851095","order_by":9,"name":"Feng Wang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAyklEQVRIiWNgGAWjYNCCCgZmMM1DtI4DZ0jWcrANyiBKC3/74YOPP867w84/I4Hxwds2BnlzQlokzqQlGxzc9oxZ4kYCs+HcNgbDnQ0EtBgw5JhJHNx2mJnhRgKbNG8bQ4LBAUJa+N9//3FwzmFm+RsJ7L+J0yKRw8ZwsOEwswHQFmaitEjceGYscebYYWbDMw+bJeeckzDcQEgLf3/yww8VNYeT5Y4nH/zwpsxGnqAtMJDMwMDYALKVSPVAYEe80lEwCkbBKBhxAADSM0C6Th5BnwAAAABJRU5ErkJggg==","orcid":"","institution":"Sanya institute of Nanjing Agricultural University, Nanjing Agricultural University","correspondingAuthor":true,"prefix":"","firstName":"Feng","middleName":"","lastName":"Wang","suffix":""}],"badges":[],"createdAt":"2025-06-04 08:38:31","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6818248/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6818248/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":86684128,"identity":"863d104a-e8d5-4146-bdaa-2b5eb4808137","added_by":"auto","created_at":"2025-07-14 13:37:07","extension":"jpeg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":345848,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEstablishment and optimization of ovine endometrial luminal epithelial organoid culture system. A.\u003c/strong\u003e Schematic workflow for generating luminal epithelial organoids from ovine endometrial caruncles. \u003cstrong\u003eB.\u003c/strong\u003e Screening of culture conditions. Organoids were cultured in basal medium (containing FGF10, A83-01, HGF, Noggin, Rspondin-1, EGF, and nicotinamide) with additional factors to create nine treatment groups (T1–T9). Organoid yield was quantified (n = 3 biological replicates). \u003cstrong\u003eC. \u003c/strong\u003eAverage organoid diameter across treatment groups (T1–T9). \u003cstrong\u003eD. \u003c/strong\u003eEffect of withdrawal of individual growth factors from ExM on the average diameter of organoids. Organoids were cultured in complete ExM and in ExM lacking one of the following factors: EGF, NOG, RSPO1, FGF10, A8301, or HGF.\u003cstrong\u003eE.\u003c/strong\u003e Representative images for conditions T1-T9 in Fig. 1B. Scale bar: 100 μm. \u003cstrong\u003eF.\u003c/strong\u003e Morphological evaluation of organoids at passages P0 and P6 by light microscopy, with proliferation assessed via KI67 immunofluorescence. Scale bars: 100 μm (light microscopy), 20 μm (immunofluorescence). Data are presented as mean ± SEM.Different superscript letters (a–e) denote statistically significant differences (\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05).\u003c/p\u003e","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-6818248/v1/ebe8704a604533e481ff08d1.jpeg"},{"id":86683688,"identity":"8911d8a6-30db-4279-8243-818107272ebd","added_by":"auto","created_at":"2025-07-14 13:29:07","extension":"jpeg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":539758,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMorphological characterization of endometrial luminal epithelial organoids. \u003c/strong\u003eA. Hematoxylin and eosin (H\u0026amp;E) staining of endometrial luminal epithelial organoids. B. Periodic acid-Schiff (PAS) staining of endometrial luminal epithelial organoids. C. Transmission electron microscopy (TEM) analysis of ultrastructural features:(CI) Apical microvilli (black arrows) and intercellular desmosomes (white arrows) are visible. (CII) Secretory vesicles (black arrows) are abundant at the base of microvilli. D. Immunofluorescence staining confirms high expression of luminal epithelial markers (KRT-18, TROP2, EPCAM). F. Expression patterns of luminal epithelial markers in native endometrial tissue. Scale bars: A-B, D: 50 μm; C: 1 μm; F: 100 μm.\u003c/p\u003e","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-6818248/v1/ab2871abb5b2776c21ed9a1f.jpeg"},{"id":86685042,"identity":"94a0d610-91c9-4d35-97dd-21b5eeca7224","added_by":"auto","created_at":"2025-07-14 13:45:07","extension":"jpeg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":306228,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePolarity reversal and proliferative capacity analysis of ovine endometrial luminal epithelial organoids. \u003c/strong\u003eA. Schematic of polarity reversal protocol: Organoids were released from Matrigel and cultured in suspension using low-attachment plates to induce apical-out (Apical-OUT) polarity. B. Morphological comparison after 48-hour suspension culture, showing clearly defined boundaries and distinct epithelial texture in reversed organoids (versus non-reversed controls). C. Immunofluorescence analysis of ZO-1 expression patterns during polarity reversal. D. Proportion of different luminal epithelial organoid types during polarity reversal over time. E.\u003cstrong\u003e \u003c/strong\u003eOrganoid proliferative capacity assessment workflow. F. Longitudinal size analysis of different organoid types. G. KI67 immunofluorescence staining quantification in D14 organoids by type. Scale bars: B and G: 50 μm; C: 20 μm. Significant differences between groups were determined by two-tailed unpaired Student's t-test (*p\u0026lt;0.05, **p\u0026lt;0.01). Data are expressed as mean ± SEM.\u003c/p\u003e","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-6818248/v1/7845242c50c2757b18f9e883.jpeg"},{"id":86685649,"identity":"cddb8bdd-1190-44a0-9a8f-0df4abe078f3","added_by":"auto","created_at":"2025-07-14 13:53:07","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":77171,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eComparative analysis of hormonal responses between Apical-Out and Basal-Out organoids to reproductive hormones and IFN-τ. \u003c/strong\u003eA. Schematic of experimental design: Both organoid types were treated with either E2, E2+MPA, or E2+MPA+IFN-τ. B-I.\u003cstrong\u003e \u003c/strong\u003eRelative PGR, SPP1, TGFB1, MUC1, MMP2, PCNA, CCND1, and CDK4 mRNA levels in hormone-treated organoids. J-K. Relative protein levels of PGR, SPP1, TGFB1, MUC1, MMP2, PCNA, CCND1, and CDK4 in hormone-treated Apical-Out organoids. Data are presented as mean ± SEM. Different superscript letters (a–e) denote statistically significant differences (\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05).\u003c/p\u003e","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-6818248/v1/cc8774c70e5e2c8bdc1d2342.png"},{"id":86683693,"identity":"b91ebc62-05c3-4b14-8d2a-bc4eb20ce0bd","added_by":"auto","created_at":"2025-07-14 13:29:07","extension":"jpeg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":396034,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eApical-Out organoids recapitulate the in vivo state of luminal epithelium transcriptionally. \u003c/strong\u003eA. Hierarchical clustering of 3,996 differentially expressed genes (luminal epithelium vs. stromal cells in vivo) demonstrates transcriptional similarity between organoids and native luminal epithelium, while stromal cells form a distinct cluster. B. Venn diagram identifies 752 co-upregulated genes (fold change ≥2, p≤0.01) shared between luminal epithelium and organoids relative to stroma. C. Gene ontology (GO) analysis of the 752 co-upregulated genes (TOPGO v2.50.0; Benjamini-Hochberg corrected p≤0.05) reveals top 10 enriched biological processes (-log10[p-value]), predominantly associated with epithelial functions. D.\u003cstrong\u003e \u003c/strong\u003eValidation of epithelial marker expression in native luminal epithelial cells, stromal cells, and organoids, including general epithelial markers (CDH1, KRT18, EPCAM), mucosal secretory cell markers (MUC1), and ovine-specific luminal epithelial markers (WFDC2, IGFBP2). E.\u003cstrong\u003e \u003c/strong\u003eHeatmap of differentially expressed genes in endometrial organoids under distinct hormonal treatments.\u003c/p\u003e","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-6818248/v1/dc12cb409db3ca07088cd8c6.jpeg"},{"id":86683695,"identity":"2d949ad5-e470-4e63-ba95-f403f45ca2c0","added_by":"auto","created_at":"2025-07-14 13:29:07","extension":"jpeg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":353150,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffects of endometrial luminal epithelial organoids on embryo development and their adhesion with trophoblast cells. \u003c/strong\u003eA. Schematic workflow of blastocyst-organoid co-culture system. B. Morphology of freshly hatched blastocysts (Day 8). C. Design of the non-contact co-culture model: blastocysts cultured centrally in 24-well plates with organoids placed peripherally to permit nutrient exchange without physical adhesion. D. Morphological diagrams of incubated blastocysts after co-culture with Apical-Out\u003cstrong\u003e \u003c/strong\u003eorganoids for four days. E. Time-dependent morphological and structural remodeling during organoid-trophoblast co-culture. F. Adhesion kinetics analysis of Apical-Out\u003cstrong\u003e \u003c/strong\u003eorganoids. G. Verification of adhesion stability of organoids in different generations. H. Adhesion efficiency analysis of Apical-Out endometrial luminal epithelial organoids cultured in distinct hormonal milieus. Data are presented as mean ± SEM. Different superscript letters (a–c) denote statistically significant differences (\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05).\u003c/p\u003e","description":"","filename":"floatimage6.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-6818248/v1/2c952fe6135aecf6962ac70c.jpeg"},{"id":86687025,"identity":"666bac2c-03e5-45f6-bcfd-ff3beef99bba","added_by":"auto","created_at":"2025-07-14 14:01:10","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3915284,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6818248/v1/20fb1874-f418-4ad9-9184-92382513781b.pdf"},{"id":86685040,"identity":"dbbd8228-bcf9-496e-a260-95f7b44c850d","added_by":"auto","created_at":"2025-07-14 13:45:07","extension":"tif","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":292796,"visible":true,"origin":"","legend":"","description":"","filename":"CCND1RawWesternBlotFigure4J.tif.tif","url":"https://assets-eu.researchsquare.com/files/rs-6818248/v1/b5cc1625072021f6a99fd6de.tif"},{"id":86683682,"identity":"29d27d28-706b-4f16-b208-ceb0688bffad","added_by":"auto","created_at":"2025-07-14 13:29:07","extension":"tif","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":379480,"visible":true,"origin":"","legend":"","description":"","filename":"CDK4RawWesternBlotFigure4J.tif.tif","url":"https://assets-eu.researchsquare.com/files/rs-6818248/v1/d36b1da6928bd77877cd3044.tif"},{"id":86684130,"identity":"4f8d5e7b-f5ac-4bf5-9f71-8a8ed3647e80","added_by":"auto","created_at":"2025-07-14 13:37:07","extension":"tif","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":283588,"visible":true,"origin":"","legend":"","description":"","filename":"PCNARawWesternBlotFigure4J.tif.tif","url":"https://assets-eu.researchsquare.com/files/rs-6818248/v1/1463da2f0f1069898c561e6d.tif"},{"id":86683690,"identity":"f44f2985-8007-4385-b170-90e27e3af429","added_by":"auto","created_at":"2025-07-14 13:29:07","extension":"tif","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":492100,"visible":true,"origin":"","legend":"","description":"","filename":"MMP2RawWesternBlotFigure4J.tif.tif","url":"https://assets-eu.researchsquare.com/files/rs-6818248/v1/261fff6696e55a65dfddd7e6.tif"},{"id":86684136,"identity":"264f7314-d110-4930-ba51-6ff021ee07bd","added_by":"auto","created_at":"2025-07-14 13:37:08","extension":"tif","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":446844,"visible":true,"origin":"","legend":"","description":"","filename":"MUC1RawWesternBlotFigure4J.tif.tif","url":"https://assets-eu.researchsquare.com/files/rs-6818248/v1/1595a500c507fd551c597fbc.tif"},{"id":86683703,"identity":"707fe6c4-7229-4c5e-a732-3a25e362ea76","added_by":"auto","created_at":"2025-07-14 13:29:08","extension":"tif","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":501456,"visible":true,"origin":"","legend":"","description":"","filename":"PGRRawWesternBlotFigure4J.tif.tif","url":"https://assets-eu.researchsquare.com/files/rs-6818248/v1/358d68866f1d453d9e7b73b4.tif"},{"id":86683706,"identity":"48ac29fa-c79f-4af8-88fd-9fe05c28fe76","added_by":"auto","created_at":"2025-07-14 13:29:08","extension":"tif","order_by":6,"title":"","display":"","copyAsset":false,"role":"supplement","size":439036,"visible":true,"origin":"","legend":"","description":"","filename":"SPP1RawWesternBlotFigure4J.tif.tif","url":"https://assets-eu.researchsquare.com/files/rs-6818248/v1/229713a8cc021a2591caac68.tif"},{"id":86684139,"identity":"daa55651-f0af-4271-bb5d-c0f010a4b3b7","added_by":"auto","created_at":"2025-07-14 13:37:08","extension":"tif","order_by":7,"title":"","display":"","copyAsset":false,"role":"supplement","size":543140,"visible":true,"origin":"","legend":"","description":"","filename":"actinRawWesternBlotFigure4J.tif.tif","url":"https://assets-eu.researchsquare.com/files/rs-6818248/v1/31e4995d9a06e8375b55bb33.tif"},{"id":86684138,"identity":"30122cb6-f236-422f-885f-992abf9dcc33","added_by":"auto","created_at":"2025-07-14 13:37:08","extension":"tif","order_by":8,"title":"","display":"","copyAsset":false,"role":"supplement","size":329716,"visible":true,"origin":"","legend":"","description":"","filename":"TGFB1RawWesternBlotFigure4J.tif.tif","url":"https://assets-eu.researchsquare.com/files/rs-6818248/v1/b3be91120cad96c130043f0d.tif"},{"id":86683697,"identity":"b4031375-734f-4ecb-9afb-69a606a947df","added_by":"auto","created_at":"2025-07-14 13:29:07","extension":"docx","order_by":9,"title":"","display":"","copyAsset":false,"role":"supplement","size":337314,"visible":true,"origin":"","legend":"","description":"","filename":"supplementarymaterial.docx","url":"https://assets-eu.researchsquare.com/files/rs-6818248/v1/056a5edaf9b21c6482e3eac5.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Establishment and characterization of functional sheep endometrial luminal epithelial organoids","fulltext":[{"header":"Introduction","content":"\u003cp\u003eEmbryo implantation is a highly coordinated physiological process that critically depends on the establishment of uterine receptivity within a specific spatiotemporal window[\u003cspan additionalcitationids=\"CR2 CR3\" citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. As the first maternal cells to interact with the embryo, luminal epithelial cells (LE) play a central role in embryo recognition, adhesion, and bidirectional signaling [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Through the regulated expression of adhesion molecules, secretion of chemokines, and release of exosomes, LE cells create a specialized microenvironment essential for successful implantation [\u003cspan additionalcitationids=\"CR8 CR9\" citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Consequently, the structural integrity, polarity status, and molecular signature of LE cells serve as key indicators of endometrial receptivity.\u003c/p\u003e\u003cp\u003eSheep hold significant economic value in agriculture and serve as an important model for studying maternal-fetal crosstalk due to their unique uterine anatomy and embryo developmental features [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Unlike invasive implantation observed in some species, sheep embryos attach via non-invasive adhesion, primarily relying on communication between the LE and trophoblast cells at specialized uterine structures called caruncles[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Investigating the structural and functional dynamics of LE cells during receptivity establishment can provide crucial insights into the regulatory mechanisms governing maternal-fetal interactions in ruminants, thereby advancing reproductive efficiency. However, studying luminal epithelial cell function in vitro remains technically challenging. Conventional two-dimensional (2D) monolayer cultures fail to recapitulate the three-dimensional (3D) physiological microenvironment of the endometrium[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. The absence of basement membrane-derived mechanical stimuli and 3D extracellular matrix (ECM) biochemical gradients disrupts authentic cell-matrix interactions[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eFurthermore, primary uterine epithelial cells in 2D culture systems are prone to phenotypic drift, morphological alterations, and accelerated senescence/apoptosis, making long-term stable passaging difficult to achieve[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Compounding these issues, the lack of in vivo hormonal regulatory networks significantly impairs the cells' dynamic responsiveness to estrogen/progesterone fluctuations. Consequently, such in vitro models cannot accurately simulate physiological cellular behaviors, particularly limiting investigations into spatiotemporal-specific signaling crosstalk at the embryo-maternal interface[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eOrganoids, serving as sophisticated three-dimensional (3D) in vitro models, are typically generated through either adult stem cell self-organization or directed differentiation of pluripotent stem cells. These systems have become invaluable tools for physiological and pathological studies across various tissues, with their primary advantage lying in the high-fidelity recapitulation of structural-functional units of organs[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. In endometrial research, successful establishment of organoids has been reported in both humans and mice. Most existing endometrial organoids are derived from glandular epithelium components and demonstrate partial recapitulation of uterine gland functions[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. A landmark study by Sato et al. pioneered the uterine organoid culture system in mice, utilizing a Wnt/R-spondin/Noggin-based medium that effectively maintains the stemness and differentiation potential of uterine epithelial cells in vitro [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Subsequent advancements in human endometrial organoids were achieved by Turco et al., whose model exhibited long-term culture stability while preserving glandular epithelial morphology and secretory functions. Notably, these human organoids could mimic different functional phases of the menstrual cycle through characteristic hormonal responses[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Building upon these foundations, researchers have adapted similar protocols to develop porcine endometrial organoids capable of embryo adhesion[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. However, it's important to note that current endometrial organoid systems are predominantly glandular in origin, with FOXA2-positive cells constituting the majority population in these cultures [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eIn contrast, the establishment of luminal epithelium-derived organoids remains relatively understudied, primarily due to three technical hurdles: First, the inherent scarcity of luminal epithelial cells within endometrial tissues presents an isolation challenge. While glandular epithelial cells are relatively abundant and therefore more readily obtained during tissue digestion, luminal epithelial cells constitute a minor population[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Second, luminal epithelium demonstrates significantly reduced stem cell potential compared to its glandular counterpart. This is evidenced by the markedly lower proportion of LGR5-positive cells in luminal populations, which directly correlates with their diminished expansion capacity in vitro[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Third, conventional protease digestion protocols lack the specificity to effectively discriminate between these two epithelial subtypes. Consequently, most current endometrial organoid systems inevitably produce mixed-cell populations containing both luminal and glandular derivatives [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eTo date, no systematic studies have established luminal epithelium-derived organoids in ruminants. Notably, the caruncular regions of ruminant endometria possess a distinctive histological advantage - their natural absence of glandular structures provides an unparalleled source for isolating pure luminal epithelial populations [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. This unique anatomical characteristic effectively circumvents the common contamination by glandular epithelium that plagues organoid derivation in other species.\u003c/p\u003e\u003cp\u003eThis study aims to pioneer the development of luminal epithelial organoids derived from ovine uterine caruncles, systematically characterizing their morphological features, polarity dynamics, hormonal responses, and embryo-interaction capabilities. As the first dedicated model of ruminant luminal epithelium, this work will address a significant gap in reproductive biology research by providing an authentic platform to investigate embryo implantation mechanisms and maternal-fetal communication. The unique caruncular origin of these organoids capitalizes on the natural absence of glandular contamination in ruminant uterine structures, enabling unprecedented purity in luminal epithelial modeling. Beyond advancing fundamental understanding of uterine biology, this model establishes crucial groundwork for developing physiologically relevant embryo co-culture systems, with potential applications ranging from improved livestock breeding strategies to insights into human reproductive health.\u003c/p\u003e"},{"header":"Material and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003e2.1 Uterine tissue collection\u003c/h2\u003e\u003cp\u003eFor ovine endometrial luminal epithelial organoid isolation, fresh uterine were collected from a local abattoir and transported on ice to the laboratory within 2 hours post-slaughter. Under sterile conditions, tissues were thoroughly rinsed with ice-cold PBS (C0221A, Beyotime Biotechnology) before longitudinal incision to expose the endometrial surface. Using meticulous dissection techniques, apical caruncular tissues (\u0026asymp;\u0026thinsp;5\u0026times;5 mm) were exclusively harvested from each horn (4 explants per horn) while carefully avoiding intercaruncular regions to ensure luminal epithelial purity. Collected explants were immediately processed for enzymatic digestion, while control samples from adjacent regions were fixed in 4% paraformaldehyde (P0099, Beyotime Biotechnology) for subsequent morphological and immunofluorescence validation. This standardized protocol ensures consistent yield of high-quality luminal epithelium while maintaining tissue integrity for comparative analyses.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003e2.2 The isolation of endometrial luminal epithelium in sheep and the formation of organoids\u003c/h3\u003e\n\u003cp\u003eThe enzymatic dissociation of ovine endometrial caruncles was performed based on established protocols with modifications [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. Briefly, excised caruncular tissues were minced into 0.5 mm\u0026sup3; cubes using sterile scalpels and digested at 37\u0026deg;C in RPMI 1640 medium (Thermo Fisher Scientific) supplemented with 0.5 mg/ml DNase I, 2 mg/ml collagenase I, and 0.1 mg/ml hyaluronidase (all from Sigma), with gentle shaking at 200 r/min for 60 minutes. A volume of 5 ml digestion solution was used per 0.5 mm\u0026sup3; of tissue. The digested suspension was filtered through 100 \u0026micro;m cell strainers (Corning) and washed extensively with HBSS buffer. To maximize cell recovery, the strainers were inverted and back-flushed with culture medium to collect residual cell clusters. After centrifugation, the cell pellet was resuspended in ice-cold Matrigel (Corning) at a 1:20 (v/v) ratio. For organoid culture, 50 \u0026micro;l of the Matrigel-cell mixture was plated as domes in 24-well plates (Costar) and allowed to solidify at 37\u0026deg;C for 20 minutes before overlaying with 250 \u0026micro;l of organoid expansion medium (ExM; see Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e for composition). The medium was refreshed every 2\u0026ndash;3 days, and organoids were passaged every 7\u0026ndash;10 days by mechanical dissociation. For cryopreservation, organoids were recovered using Cell Recovery Solution (Corning) and resuspended in Recovery Cell Freezing Medium (Thermo Fisher Scientific).\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eDetails of organoid expansion medium (EXM)\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"4\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eProduct\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCompany\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eProduct Number\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eFinal Concentration\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eAdvanced DMEM/F12\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGIBCO\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e12634010\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e1\u0026times;\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eN2 supplement\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGIBCO\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e17502048\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e1\u0026times;\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eB27 supplement minus vitamin A\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGIBCO\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e12587010\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e1\u0026times;\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePenicillin and streptomycin\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGIBCO\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e15140148\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e100\u0026micro;g/ml\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eN-Acetyl-L-cysteine\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eMCE\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eHY-B0215\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e1.25mM\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eRecombinant human EGF\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSinoBiological\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e10605-H01H\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e50ng/ml\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eRecombinant human Noggin\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSinoBiological\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e10267-HNAH\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e100ng/ml\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eRecombinant human Rspondin-1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSinoBiological\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e11083-H08H\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e200ng/ml\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eRecombinant human FGF-10\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSinoBiological\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e10573-HNAE\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e100ng/ml\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eRecombinant human HGF\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSinoBiological\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e10463-HNAS\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e50ng/ml\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eA83-01\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eMCE\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eHY-10432\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e500nM\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eNicotinamide\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eMCE\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eHY-B0150\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e10nM\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eWNT3A\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSinoBiological\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eWNT007-02H\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e200ng/ml\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCHIR99201\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eMCE\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eHY-10182\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e2 \u0026micro;M\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eY-27632\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eMCE\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eHY-10071\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e10\u0026micro;M\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSB202190\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eMCE\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eHY-10295\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e2 \u0026micro;M\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eRecombinant human EPHA1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSinoBiological\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e15789-H02H\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e100ng/ml\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\n\u003ch3\u003e2.3. Determination of the formation efficiency of endometrial luminal epithelial organoids in sheep\u003c/h3\u003e\n\u003cp\u003eTo isolate organoids from Matrigel, Cell Recovery Solution was used to dissolve the matrix, followed by extensive pipetting (100\u0026ndash;200 repetitions) to dissociate organoid clusters. The suspension was then digested with TrypLE Express (Invitrogen, 12604-013) at 37\u0026deg;C for 5\u0026ndash;7 minutes to achieve single-cell dissociation. After washing with culture medium, the cell suspension was filtered through a 40 \u0026micro;m cell strainer (Corning, 352340) to ensure single-cell homogeneity. Cell viability was determined by trypan blue exclusion using an automated cell counter (A49862, Thermo Fisher Scientific). For growth factor requirement assays and organoid formation efficiency experiments (Figure. 1E), 20,000 viable cells were resuspended in 50 \u0026micro;L Matrigel droplets and plated in 24-well plates. Each experimental condition included three technical replicates. Organoid formation was quantified at day 9 post-seeding under standardized microscopic examination (10 random fields/well at 100\u0026times; magnification). Only structures exhibiting clear luminal morphology with diameter\u0026thinsp;\u0026ge;\u0026thinsp;50 \u0026micro;m were counted as valid organoids.\u003c/p\u003e\n\u003ch3\u003e2.4. Polarity inversion of endometrial luminal epithelial organoids\u003c/h3\u003e\n\u003cp\u003eTo initiate polarity conversion, organoids were first liberated from Matrigel using Cell Recovery Solution in expansion medium. The organoid suspension was centrifuged at 20 \u0026times;g for 3 minutes at room temperature and washed twice with Advanced DMEM/F12 (Gibco). For suspension culture, organoids were seeded into 24-well ultra-low attachment plates (Corning, 3473) at a density of 50 organoids per well in 500 \u0026micro;L of organoid culture medium. To ensure uniform distribution, plates were gently swirled immediately after seeding. During the suspension culture period, organoid clusters were mechanically dispersed twice daily using wide-bore pipette tips to prevent excessive aggregation. Medium replacement was performed every three days through the following protocol: organoid suspensions were transferred to conical tubes using wide-orifice pipettes, allowed to settle by gravity for 5 minutes (or alternatively centrifuged at 20 \u0026times;g for 30 seconds), followed by careful aspiration of 80% supernatant volume. The organoid pellets were then resuspended in fresh pre-warmed medium and replated into new ultra-low attachment plates.\u003c/p\u003e\n\u003ch3\u003e2.5. Hormone treatment of endometrial luminal epithelial organoids\u003c/h3\u003e\n\u003cp\u003eOvine endometrial luminal epithelium organoids were treated with 10 nM β-estradiol (E2, Sigma E4389), 1 \u0026micro;M medroxyprogesterone acetate (MPA, MCE HY-B0469), and 10 ng/mL Interferon τ (IFN-τ ,MCE HY-P71798) based on established concentrations[\u003cspan additionalcitationids=\"CR29\" citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Following 4 days of basal culture (Day 0\u0026ndash;4) and polarity reversion on Day 4, treatments were initiated: control (no hormones), E2 (10 nM from Day 6), E2\u0026thinsp;+\u0026thinsp;MPA (E2 from Day 6 plus 1 \u0026micro;M MPA from Day 8), and E2\u0026thinsp;+\u0026thinsp;MPA\u0026thinsp;+\u0026thinsp;IFN-τ (with 10 ng/mL IFN-τ added from Day 10), continuing through Day 12 to simulate physiological hormonal responses. All treatments used\u0026thinsp;\u0026le;\u0026thinsp;0.01% DMSO as vehicle, with medium changes every 48 hours under standard culture conditions (37\u0026deg;C, 5% CO₂).\u003c/p\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003e2.6. HE and PAS staining\u003c/h2\u003e\u003cp\u003eEndometrial organoids and tissue samples were fixed in 4% paraformaldehyde (tissues for 24 hours, organoids for 30 minutes at 4\u0026deg;C), followed by paraffin embedding. Organoids were pre-embedded in 1% agarose (Melford, MB1200) prior to paraffin embedding. Sections of 4 \u0026micro;m thickness were prepared for histological staining. The hematoxylin and eosin (H\u0026amp;E) staining procedure included: deparaffinization and rehydration, hematoxylin staining for 5 minutes, differentiation and bluing, eosin staining for 1 minute, dehydration and clearing, and mounting. The periodic acid-Schiff (PAS) staining procedure included: oxidation with 0.5% periodic acid for 10 minutes, incubation with Schiff's reagent in the dark for 15 minutes, counterstaining with hematoxylin, dehydration, and mounting. All stained sections were examined using a Nikon (ECLIPSE Ti2)optical microscope.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003e2.7. Immunofluorescence\u003c/h3\u003e\n\u003cp\u003eBasal-out and apical-out organoids were fixed at room temperature with 4% paraformaldehyde (PFA) for 30 minutes, followed by multiple washes with PBS. The organoids were then permeabilized with 0.5% Triton X-100 in PBS for 20 minutes and washed thoroughly with PBS. Subsequently, samples were incubated in PBS containing 5% BSA at room temperature for 1 hour to block nonspecific binding. After removing the blocking solution, primary antibodies diluted in 1% BSA/PBS (see Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e for details) were added and incubated overnight at 4\u0026deg;C.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eDetails of antibodies used\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"6\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eAntibodies\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCat No.\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eRRID\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eSource\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003eDilution of IF\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c6\"\u003e\u003cp\u003eDilution of WB\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003ePGR\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eA0321\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAB_2757125\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eABclonal, Wuhan, China\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e1:1000\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eSPP1\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eA5814\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAB_2766566\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eABclonal, Wuhan, China\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e1:1000\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eTGFB1\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eA15103\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAB_2761987\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eABclonal, Wuhan, China\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e1:1000\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eMMP-2\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eA6247\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAB_2766854\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eABclonal, Wuhan, China\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e1:1000\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003ePCNA\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eA13336\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAB_2760192\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eABclonal, Wuhan, China\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e1:1000\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eCCND1\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eA1301\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAB_2759856\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eABclonal, Wuhan, China\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e1:1000\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eCDK4\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eA0366\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAB_2757151\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eABclonal, Wuhan, China\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e1:1000\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eKRT-18\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eA1022\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAB_2744510\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eABclonal, Wuhan, China\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e1:200\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eEPCAM\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eA1177\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAB_2758746\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eABclonal, Wuhan, China\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e1:200\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eTROP2\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eA8129\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAB_2772506\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eABclonal, Wuhan, China\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e1:200\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eKRT-7\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eA4357\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAB_2863248\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eABclonal, Wuhan, China\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e1:200\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eGATA3\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eab182747\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAB_2924543\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eAbcam, Shanghai, China\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e1:200\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eFABP3\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eA5312\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAB_2766124\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eABclonal, Wuhan, China\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e1:200\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eZO-1\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eab307799\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAB_2924544\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eAbcam, Shanghai, China\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e1:100\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eβ-actin\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAC026\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAB_2768234\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eABclonal, Wuhan, China\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e1:5000\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003eFollowing several PBS washes, secondary antibodies provided by Thermo Fisher Scientific were applied at a dilution of 1:400, including Alexa Fluor 488 goat anti-mouse IgG1 (A21121), Alexa Fluor 568 goat anti-rabbit (A11011), or Alexa Fluor 647 (A21244). Nuclei were counterstained with DAPI (Sigma, D9542). After staining, samples were washed three times with PBS, 5 minutes each. The organoids were then transferred to confocal dishes and imaged using a Zeiss confocal microscope with ZEN software. Tissue sections were processed using the same staining protocol.\u003c/p\u003e\n\u003ch3\u003e2.8. Electron microscopy\u003c/h3\u003e\n\u003cp\u003eFor ultrastructural analysis, organoids were fixed in either: (1) 4% glutaraldehyde/0.1 M HEPES (pH 7.4) at 4\u0026deg;C for 12 h, then post-fixed with 1% osmium ferricyanide (RT, 12 h) and 2% uranyl acetate in 0.05 M maleate buffer (pH 5.5, RT, 12 h); or (2) 0.5% glutaraldehyde/0.2 M sodium cacodylate (pH 7.2, 30 min) followed by reduced osmium tetroxide (1% OsO4/1.5% potassium ferrocyanide, RT, 60 min) and 0.5% magnesium uranyl acetate (4\u0026deg;C, 16 h). All samples were dehydrated through graded ethanol (70\u0026ndash;100%), transitioned with acetonitrile (2\u0026times;), and embedded in Quetol epoxy or Epon resin. Ultrathin sections of 70 nm thickness were prepared using a Leica UCT ultramicrotome. Transmission electron microscopy (TEM) was performed using a JEOL JEM-1400 microscope. Images were acquired with an Olympus SIS Quemesa 11-megapixel digital camera system.\u003c/p\u003e\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003e2.9.Western blot analysis\u003c/h2\u003e\u003cp\u003eWestern blot analysis was performed according to our previously described procedure, with minor modifications[\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. Briefly, proteins were extracted from tissues and cells using RIPA buffer and quantified with a BCA Protein Assay Kit (P0012S, Beyotime). A total of 20 \u0026micro;g of protein was loaded onto a 12% SDS-PAGE gel (Invitrogen, Shanghai, China) and transferred to PVDF membranes (Millipore, USA). After blocking with 5% non-fat milk, the membranes were incubated overnight at 4\u0026deg;C with primary antibodies (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e), followed by incubation with a secondary antibody for 1 hour. Protein signals were detected using an enhanced chemiluminescence kit and visualized with a detection system (Fujifilm, Tokyo, Japan), and the images were analyzed using ImageJ software. Each experiment was repeated at least three times. Original Western blot data are shown in Supplementary.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003e2.10.RNA isolation and quantitative real-time PCR (qRT-PCR) analysis\u003c/h2\u003e\u003cp\u003eTotal RNA was extracted from uterine tissues and EECs using the TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer\u0026rsquo;s protocol. The purity and concentration of the extracted RNA were assessed by measuring the absorbance at 260/280 nm using a UV spectrophotometer (GeneQuant 1300, GE Healthcare Life Sciences, UK). The RNA was then subjected to reverse transcription and fluorescence quantification using kits from TransGen Biotech (Beijing, China; AU341 and AQ602, respectively). Primer pairs were designed using Primer 5 software (Premier Biosoft, Palo Alto, CA, USA) and validated through the Basic Local Alignment Search Tool (BLAST; NCBI, USA). RNase/DNase-free water was used as a blank control in place of cDNA samples. mRNA expression levels were quantified using the 2-∆∆CT method, with ACTB as the reference gene for normalization. The primer sequences are listed in Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e. Each experiment was repeated at least three times.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003ePrimer sequences used for this study\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"5\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eItems\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e\u003cp\u003ePrimer sequence (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eFragment Size (bp)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eGene bank No\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003eFORWARD\u003c/b\u003e\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cb\u003eReverse\u003c/b\u003e\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003ePGR\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003eCCTGTGGAAGCTGTAAGGTC\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cb\u003eAGTTCCGAAAACCTCCAAGA\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e\u003cb\u003e171\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eXM_027979146.3\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eSPP1\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003eTCACAGGGGACTGGACTCTT\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cb\u003eGGTTTAACTGGAAGGGCGGA\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e\u003cb\u003e117\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eNM_001009224.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eTGFB1\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003eACACACAGTACAGCAAGGTCC\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cb\u003eCACGTAGTACACGATGGGCA\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e\u003cb\u003e113\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eNM_001009400.2\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eMUC1\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003eTCTCATTGCCCTGGTTGTGT\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cb\u003eTAGGGGCTCCGTTTGGTACT\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e\u003cb\u003e156\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eXM_027976040.2\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003ePCNA\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003eTGCAGATGTACCCCTTGTTGT\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cb\u003eCATCCTCGATCTTGGGAGCC\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e\u003cb\u003e83\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eXM_004014340.5\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eCCND1\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003eATCAGATGTGACCCGGACTG\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cb\u003eCCCTCAAATGTTCACGTCGC\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e\u003cb\u003e183\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eXM_027959928.2\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eCDK4\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003eCAGTGTACAAGGCCCGTGAT\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cb\u003eGACGTCCATGAGCCTGACAA\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e\u003cb\u003e176\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eNM_001127269.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eMMP-2\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003eCGCTTCCAGGGCACATCTTA\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cb\u003eCAGTGGACATGGCAGTCTCG\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e\u003cb\u003e133\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eNM_001166180.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eACTB\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003eTCAGCAAGCAGGAGTACGAC\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cb\u003eACGAGGCCAATCTCATCTCG\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e\u003cb\u003e137\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eNM_001009784.3\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003e2.11. RNA-seq and Bioinformatics analysis\u003c/h2\u003e\u003cp\u003eTotal RNA was extracted from endometrial tissue using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer\u0026rsquo;s instructions. The quantity, purity, and integrity of RNA were assessed using a NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA) and an Agilent 2100 Bioanalyzer. All RNA samples had RNA integrity numbers (RIN) greater than 7.0. Ribosomal RNA (rRNA) was removed using the Epicentre Ribo-zero\u0026trade; rRNA Removal Kit (Epicentre Technologies, USA), and strand-specific RNA-seq libraries were constructed using the NEBNext\u0026reg; Ultra\u0026trade; Directional RNA Library Prep Kit (New England Biolabs, USA). Paired-end sequencing (150 bp reads, PE150) was performed on the Illumina NovaSeq\u0026trade; 6000 platform (LC-Bio Technology Co., Ltd., Hangzhou, China). The original sequencing data are shown in Supplementary Dataset 3.\u003c/p\u003e\u003cp\u003eDifferential expression analysis was performed using DESeq2 (v1.34.0) in R/Bioconductor (v4.1.0). Raw RNA-seq counts were normalized via variance-stabilizing transformation (VST) to correct for library size differences. A negative binomial generalized linear model identified differentially expressed genes (DEGs) between experimental groups, with significance thresholds of |log2 fold-change| \u0026ge; 1 and Benjamini-Hochberg adjusted *p*-value\u0026thinsp;\u0026lt;\u0026thinsp;0.05. Functional enrichment analysis of DEGs was conducted using topGO (v2.50.0) with Fisher\u0026rsquo;s exact test, annotating Gene Ontology terms and biological pathways (adjusted *p*-value\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u003c/p\u003e\u003cp\u003eA Euclidean distance matrix was computed from the normalized expression profiles of DEGs of using `stats::dist`. Hierarchical clustering was performed via `hclust` (method = \"average linkage\"). To systematically identify outliers, the dynamic tree-cutting algorithm `WGCNA::cutreeDynamic` was applied with parameters `deepSplit\u0026thinsp;=\u0026thinsp;2` (enhanced cluster separation) and `minClusterSize\u0026thinsp;=\u0026thinsp;3` (minimum samples per cluster). This partitioned the dendrogram into subgroups, flagging samples deviating from major clusters.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003e2.12. Organoid co-culture with hatched blastocysts and trophoblast adhesion analysis\u003c/h2\u003e\u003cp\u003eThe in vitro embryo production followed established protocols [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e], where blastocysts were cultured in modified SOF medium until D6/D7[\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. Upon zona pellucida hatching on D8, hatched blastocysts were transferred to the center of low-adhesion 24-well plates containing 500 \u0026micro;L endometrial luminal epithelium organoid medium, with 100 apical-out (APR-OUT) organoids seeded at the periphery for co-culture. For trophoblast adhesion assays, trophoblast cells isolated from early-gestation ovine placenta (characterization shown in Supplementary Figure. S1) were plated to confluency in 48-well plates. Forty hormone-pretreated organoids were carefully overlaid onto the trophoblast monolayer and allowed to settle naturally. Adhesion kinetics were assessed at 1, 2, 4, 6, 8, 24, and 48-hour intervals through gentle washing: pre-warmed PBS (37\u0026deg;C) was slowly added along the well walls (1 mL/well), incubated briefly, then the plate was rocked 3\u0026ndash;5 times to suspend non-adherent cells. After careful PBS aspiration (avoiding monolayer disruption), this wash cycle was repeated 1\u0026ndash;2 times to preserve adherent cell integrity while removing unbound organoids. Adherent organoids were quantified microscopically at each timepoint.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\u003ch2\u003e2.13. Statistical analysis\u003c/h2\u003e\u003cp\u003eData were analyzed using SPSS 28.0.1.1 and are presented as the means\u0026thinsp;\u0026plusmn;\u0026thinsp;standard error of the mean (SEM) from at least three independent experiments. Comparisons between two groups were conducted using a \u003cem\u003et\u003c/em\u003e-test with statistical significance defined as *\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 and high significance as **\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01. To compare between more than two groups, a one-way ANOVA followed by Tukey\u0026rsquo;s post hoc test (statistical significance of \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) was used.\u003c/p\u003e\u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\u003ch2\u003eOptimization of Ovine Endometrial Luminal Epithelial Organoid Culture: Protocol Development and Medium Refinement\u003c/h2\u003e\u003cp\u003eWe established a three-dimensional organoid culture system using luminal epithelial cells isolated from ovine endometrial caruncles (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). Under optimized conditions, these cells self-organized into functional organoids exceeding 100 \u0026micro;m in diameter within 8 days. As suitable culture media for ovine endometrial luminal epithelium were previously undefined, we modified existing murine endometrial organoid protocols. Initial screening showed that while neither WNT3A nor CHIR99021 alone effectively promoted organoid formation, their combination significantly improved formation efficiency (p\u0026thinsp;\u0026lt;\u0026thinsp;0.01). Subsequent addition of Y-27632 (ROCK inhibitor) further enhanced organoid yield, though the average diameter remained below 100 \u0026micro;m (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB, \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC, \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE) (p\u0026thinsp;\u0026lt;\u0026thinsp;0.01). To address this, we incorporated SB202190 (p38 MAPK inhibitor), which increased organoid size but still failed to consistently surpass 100 \u0026micro;m (p\u0026thinsp;\u0026lt;\u0026thinsp;0.01). Cell-cell communication analysis of our scRNA-seq data (to be published) revealed EPHA pathway activation in luminal epithelium, prompting EPHA1 agonist supplementation (10 nM). This modification significantly promoted organoid enlargement, reliably achieving diameters\u0026thinsp;\u0026gt;\u0026thinsp;100 \u0026micro;m (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB, \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC, \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE) (p\u0026thinsp;\u0026lt;\u0026thinsp;0.01). Further analysis of media components demonstrated that FGF10, EGF, HGF, NOG and A83-01 were essential for organoid formation, while RSPO1 (R-Spondin1) proved non-essential (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). The organoids maintained stable passage capability through at least 6 generations, with persistent proliferative activity confirmed by KI67 immunostaining in F6 cultures (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eF).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\u003ch2\u003eCharacteristic analysis of Endometrial Luminal Epithelial organoids in sheep\u003c/h2\u003e\u003cp\u003eHistological and ultrastructural characterization confirmed that the luminal epithelial organoids faithfully recapitulated key morphological and functional features of native endometrial tissue. Hematoxylin and eosin (H\u0026amp;E) staining revealed the formation of distinct luminal structures within the organoids (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA), while periodic acid-Schiff (PAS) staining demonstrated abundant mucin secretion into these luminal spaces (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). Transmission electron microscopy (TEM) analysis showed: (1) dense microvilli coverage on the apical surface (black arrows, Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC), (2) well-developed desmosomes at cell-cell junctions (white arrows, Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC), and (3) numerous secretory vesicles adjacent to microvilli (black arrows, Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD). Immunofluorescence staining confirmed strong expression of characteristic luminal epithelial markers including Keratin 18 (\u003cem\u003eKRT-18\u003c/em\u003e), Trophoblast Cell Surface Antigen 2 (\u003cem\u003eTROP2\u003c/em\u003e), and Epithelial Cell Adhesion Molecule (\u003cem\u003eEPCAM\u003c/em\u003e) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE). The polarized distribution pattern of \u003cem\u003eEPCAM\u003c/em\u003e particularly demonstrated proper epithelial polarity establishment in vitro. Notably, the expression profiles of these markers in organoids closely mirrored their spatial distribution patterns in native uterine tissue (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF). Collectively, these comprehensive analyses demonstrate that our endometrial luminal epithelial organoids successfully recapitulate the histological architecture and secretory functions of in vivo luminal epithelium at multiple biological scales.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e\u003ch2\u003ePolarity reversal in ovine endometrial luminal epithelial organoids\u003c/h2\u003e\u003cp\u003eDuring growth in Matrigel, sheep endometrial luminal epithelial organoids exhibit a basal-out polarity, with the basal side facing the matrix and the apical side enclosed within the organoid lumen. To mimic the in vivo orientation of luminal epithelial cells with apical surfaces facing outward, we released the organoids from Matrigel and cultured them in suspension on low-attachment plates to induce polarity reversal (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). After 48 hours of suspension culture, compared with unreversed organoids, the reversed organoids displayed clearer boundaries and evident epithelial textures (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). Immunofluorescence analysis at 24 hours of suspension culture showed that 76% of the organoids had undergone partial polarity reversal, exhibiting mixed apical-in and apical-out features (Figs.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC and \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD). After 48 hours, 86% of the organoids had fully reversed to an apical-out configuration (Figs.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC and \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eTo investigate the impact of polarity reversal on organoid proliferation and development, we compared the average size of organoids cultured in suspension with those continuously grown in Matrigel, as outlined in the experimental design (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE). Organoids were removed from Matrigel on day 4 (D4) and transferred to suspension culture. From day 8 (D8) onward, the average size of apical-out organoids was significantly smaller than that of basal-out organoids (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Throughout the subsequent culture period, apical-out organoids consistently remained smaller than their basal-out counterparts at the corresponding time points (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF). Quantification of Marker of Proliferation Ki-67-positive cells on day 14 revealed a significantly higher percentage of proliferative cells in basal-out organoids compared to apical-out organoids (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eG). These findings indicate that the apical-out organoids exhibit a markedly reduced proliferative capacity compared to basal-out organoids.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e\u003ch2\u003eHormone Responsiveness in Apical-Out and Basal-Out Organoids\u003c/h2\u003e\u003cp\u003eTo elucidate the differential responses of Apical-Out and Basal-Out organoids to reproductive hormones and IFN-τ, we administered three treatments (E2, E2\u0026thinsp;+\u0026thinsp;MPA, and E2\u0026thinsp;+\u0026thinsp;MPA\u0026thinsp;+\u0026thinsp;IFN-τ; Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). QRT-PCR analysis demonstrated that Progesterone Receptor (\u003cem\u003ePGR\u003c/em\u003e) mRNA expression level was exclusively upregulated by E2 (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05; Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB), whereas Secreted Phosphoprotein 1 (\u003cem\u003eSPP1\u003c/em\u003e) mRNA expression level responded robustly to E2 (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) and exhibited further enhancement with MPA co-treatment (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05; Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). Transforming Growth Factor Beta 1 (\u003cem\u003eTGFB1\u003c/em\u003e) mRNA expression level displayed a triphasic regulatory pattern\u0026mdash;E2-induced activation (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), MPA-mediated suppression (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), and IFN-τ-dependent rescue (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05; Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD)\u0026mdash;while Mucin 1 (\u003cem\u003eMUC1\u003c/em\u003e) mRNA expression level showed progressive upregulation across treatments (intergroup p\u0026thinsp;\u0026lt;\u0026thinsp;0.05; Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE). Notably, Matrix Metalloproteinase-2 (\u003cem\u003eMMP-2\u003c/em\u003e) mRNA expression level peaked under E2\u0026thinsp;+\u0026thinsp;MPA (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) but was attenuated by IFN-τ (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05; Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF), and proliferation markers Proliferating Cell Nuclear Antigen (\u003cem\u003ePCNA\u003c/em\u003e), Cyclin D1 (\u003cem\u003eCCND1\u003c/em\u003e) and Cyclin-Dependent Kinase 4 (\u003cem\u003eCDK4\u003c/em\u003e) were induced by E2 (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) yet suppressed by MPA (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05; Figs.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eG-I). Western blotting analysis validated these transcriptional changes in Apical-Out organoids at the protein level (Figs.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eJ-K). E2 emerges as the master regulator governing endometrial receptivity-associated genes in organoids. MPA exhibits synergistic potentiation of gene expression, particularly for SPP1 and MUC1. IFN-τ demonstrates pathway-specific modulation, selectively targeting the TGFB1/MMP-2 signaling axis.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec21\" class=\"Section2\"\u003e\u003ch2\u003eApical-Out organoids transcriptionally recapitulate luminal epithelium\u003c/h2\u003e\u003cp\u003eTo evaluate the similarity between Apical-Out organoids and native tissues, we generated bulk RNA-seq data for luminal epithelial cells and stromal cells using our lab's previously published single-cell RNA sequencing data of early pregnant Hu sheep endometrium (Supplementary Dataset 1). Concurrently, we performed transcriptome sequencing of Apical-Out organoids under the conditions described in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA and conducted integrated analysis. Differential expression analysis between luminal epithelial and stromal cells identified 3,996 significantly differentially expressed genes (Supplementary Dataset 2). Hierarchical clustering analysis based on these genes demonstrated that the organoids clustered more closely with luminal epithelial cells than with stromal cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA), further confirming their luminal epithelial characteristics.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eTo better define the genetic signature of endometrial luminal epithelium, we performed comparative analysis among luminal epithelial cells, IFN-τ\u0026thinsp;+\u0026thinsp;E2\u0026thinsp;+\u0026thinsp;MPA-treated organoids, and stromal cells. This revealed 752 genes that were significantly upregulated (fold change\u0026thinsp;\u0026ge;\u0026thinsp;2, p\u0026thinsp;\u0026le;\u0026thinsp;0.01) in organoids compared to native endometrial luminal epithelial cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). GO enrichment analysis showed these differentially expressed genes were significantly associated with epithelial cell characteristics (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). Key markers were identified, including epithelial cell markers (\u003cem\u003eCDH1\u003c/em\u003e, \u003cem\u003eKRT-18\u003c/em\u003e, and \u003cem\u003eEPCAM\u003c/em\u003e), mucosal secretory cell markers (MUC1), and established ovine luminal epithelial markers (\u003cem\u003eWFDC2\u003c/em\u003e, \u003cem\u003eIGFBP2\u003c/em\u003e) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD).\u003c/p\u003e\u003cp\u003eTranscriptome analysis demonstrated that estrogen treatment significantly upregulated estrogen-responsive genes (\u003cem\u003ePCNA\u003c/em\u003e, \u003cem\u003ePGR\u003c/em\u003e, \u003cem\u003eVEGF\u003c/em\u003e) in the organoids. Following E2\u0026thinsp;+\u0026thinsp;MPA treatment, progesterone-activated genes (\u003cem\u003eKLF9\u003c/em\u003e, \u003cem\u003eFOXO3\u003c/em\u003e, \u003cem\u003eENPP5\u003c/em\u003e) showed increased expression. Moreover, E2\u0026thinsp;+\u0026thinsp;MPA\u0026thinsp;+\u0026thinsp;IFN-τ treatment induced substantial expression of interferon-stimulated genes (\u003cem\u003eMX2\u003c/em\u003e, \u003cem\u003eISG15\u003c/em\u003e, \u003cem\u003eIFIT3\u003c/em\u003e) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE). These findings collectively indicate that the organoids faithfully recapitulate the transcriptional profile of native luminal epithelial cells and exhibit physiological responses to reproductive hormones that mirror in vivo conditions.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec22\" class=\"Section2\"\u003e\u003ch2\u003eEffects of organoids on blastocyst development and their adhesive interactions with trophoblasts\u003c/h2\u003e\u003cp\u003eTo investigate the regulatory effects of endometrial organoids on embryonic development and trophoblast adhesion in a simulated maternal uterine microenvironment, we co-cultured in vitro-fertilized embryos with endometrial luminal epithelial organoids. Embryos were cultured for 8 days to the hatched blastocyst stage (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB) and then co-cultured with organoids for an additional 4 days (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA, C).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eAfter 4 days of co-culture, embryos in the organoid co-culture group exhibited a significantly larger diameter (500.70\u0026thinsp;\u0026plusmn;\u0026thinsp;32.54 \u0026micro;m; P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) compared to the control group (416.36\u0026thinsp;\u0026plusmn;\u0026thinsp;32.59 \u0026micro;m; P\u0026thinsp;\u0026lt;\u0026thinsp;0.05), representing a 20.25% increase in average diameter (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eD). These results suggest that secretory factors from endometrial organoids enhance embryonic proliferation. To model organoid-trophoblast interactions, we co-cultured 40 organoids with a confluent monolayer of trophoblast cells in 24-well plates. Organoids began adhering to trophoblasts within 1 hour, with adhesion efficiency increasing significantly over time (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eF). By 8 hours, nearly all organoids had adhered to the trophoblast layer (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eF). After 24 hours, organoids showed extensive fusion with the underlying trophoblasts, accompanied by loss of spherical structure (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eE). By 48 hours, new cells had migrated radially from the adherent organoids (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eE). Notably, organoid adhesion capacity remained stable across multiple passages, with no significant differences observed after 6 hours of co-culture (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eG). However, hormonal treatments significantly accelerated adhesion kinetics: E2\u0026thinsp;+\u0026thinsp;MPA and E2\u0026thinsp;+\u0026thinsp;MPA\u0026thinsp;+\u0026thinsp;IFN-τ treated organoids showed significantly higher adhesion rates than controls at both 2 and 4 hours, with E2 alone also enhancing adhesion by 4 hours (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eH). All hormone-treated groups achieved complete adhesion by 6 hours, demonstrating that E2 and MPA synergistically promote organoid-trophoblast adhesion, while IFN-τ provided no additional benefit beyond the E2\u0026thinsp;+\u0026thinsp;MPA combination.\u003c/p\u003e\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eAs organoid technology becomes increasingly prevalent in reproductive biology studies, researchers have successfully developed endometrial organoid models across multiple species, enabling precise simulation of intricate in vivo microenvironments and cellular dynamic [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e].Compared to mice and humans, ruminants exhibit a more complex uterine structure and species-specific cyclic regulatory mechanisms. Therefore, establishing a sheep endometrial organoid model not only holds significant theoretical importance but also provides a powerful tool for investigating reproductive regulation mechanisms in ruminant species [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eThis study focuses on the luminal epithelium (LE) of the endometrium, a critical cell population that plays a pivotal role during embryo implantation. The LE is functionally specialized for embryo recognition, signal sensing, and initial adhesion, making it indispensable for successful pregnancy establishment [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e, \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. Using mechanical dissociation combined with enzymatic digestion, we successfully isolated a luminal epithelium-enriched cell population from ovine endometrial caruncle tissue. Subsequently, we established a stable organoid culture system in three-dimensional Matrigel matrix. During culture optimization, we demonstrated that the combination of WNT3A and CHIR99021 synergistically promotes organoid formation efficiency. WNT3A, a canonical WNT pathway ligand, activates β-catenin-dependent transcriptional regulation, while CHIR99021, a potent GSK3β inhibitor, synergistically enhances downstream WNT signaling activity [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. We observed that WNT3A alone yielded suboptimal organoid formation efficiency, whereas combinatorial treatment with CHIR99021 significantly increased both organoid number and diameter. These findings align with the WNT-dependent characteristics observed in human and murine endometrial organoid models, yet reveal a stronger synergistic pathway dependence in ovine systems. This suggests that ovine luminal epithelium may possess a higher activation threshold for WNT signaling[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Notably, the combined application of Y-27632 and SB202190 significantly enhanced both the adult stemness and proliferative capacity of luminal epithelial cells. This represents a technical innovation in our culture system optimization. Intriguingly, we observed a similar phenomenon during the establishment of ovine ruminal epithelial organoids, suggesting a conserved role of these two factors in maintaining stemness properties across different ovine epithelial lineages [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. Notably, our study represents the first attempt to incorporate EPHA1 signaling modulators, revealing their critical role in both promoting organoid formation and maintaining cellular polarity. EPHA1, a membrane-bound tyrosine kinase receptor, plays multifaceted roles in epithelial cell organization, intercellular communication, and tissue boundary maintenance. Notably, this receptor has been demonstrated to promote proliferative activity in bovine endometrial epithelial cells[\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e, \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. Supplementation of the organoid culture system with an EPHA1 agonist resulted in significantly increased organoid diameter, indicating that EPHA1 signaling potently promotes organoid proliferation and development. These findings provide the first evidence for the functional role of EPHA1 signaling in uterine organoid formation, establishing a foundation for future investigations into its mechanistic involvement in embryo implantation-related tissue remodeling. In summary, the successful establishment of ovine endometrial luminal epithelium organoids requires coordinated regulation of multiple signaling pathways. Our systematic optimization demonstrates that: (1) WNT3A/CHIR99021 maintains stemness properties, (2) Y-27632/SB202190 enhances cellular viability and stability, and (3) EPHA1 signaling mediates proliferative activity. This refined culture system not only provides a technical platform for robust reconstruction of endometrial luminal architecture, but also establishes a critical foundation for modeling the embryo-uterine dialog microenvironment.\u003c/p\u003e\u003cp\u003eDuring the establishment of ovine endometrial luminal epithelium organoids, evaluating their structural and phenotypic recapitulation is critical for validating the physiological relevance of the organoid model[\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. Through comprehensive histological staining, ultrastructural analysis, and phenotypic marker characterization, we systematically validated the ability of organoids to recapitulate key features of luminal epithelium. At the structural level, organoids developed vesicle-like cavities and exhibited mucin secretory activity\u0026mdash;hallmarks of polarized epithelial differentiation. These findings collectively demonstrate the organoids\u0026rsquo; functional competence in mimicking the uterine luminal microenvironment. Glycans and mucins constitute essential secretory components of the endometrium that critically support embryonic development and implantation[\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. Notably, PAS-positive staining confirmed the secretion of glycoprotein-like substances by the organoids, demonstrating their ability to recapitulate the endocrine functionality of the native endometrium. Furthermore, microvilli serve as critical sensory and regulatory structures for epithelial cells to perceive and adapt to their microenvironment[\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. Transmission electron microscopy (TEM) revealed well-developed microvilli and secretory vesicles, providing ultrastructural evidence for the functional maturation of differentiated epithelium in these organoids. Phenotypic characterization revealed consistent expression of luminal epithelial markers (KRT18, TROP2, and EPCAM) in the organoids, confirming their tissue origin and recapitulation of in vivo expression patterns[\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]. However, the organoids currently lack a fully developed basement membrane and stromal cell support, which may compromise their long-term culture stability and maturation. To address this limitation, future studies could integrate co-culture systems or biomechanical stimulation to enhance structural complexity and functional fidelity[\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e, \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eIn vivo, embryo implantation requires direct contact between endometrial luminal epithelium and trophoblasts. Conventional epithelial organoids exhibit an \"Apical-IN\" polarity (apical surface facing the lumen, basolateral side outward), which limits their ability to fully simulate the intrauterine environment, particularly for studying physiological processes involving luminal interactions[\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. To address this limitation, we developed an Apical-OUT polarity reversal model, inspired by intestinal and murine endometrial organoid systems [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e, \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e], where the apical surface is exposed to the culture medium to better mimic the natural uterine luminal interface. During polarity reversal, organoids exhibited slight flattening with reduced or absent luminal structures, likely due to reorganization of cell junctions and cytoskeletal arrangements. The polarity reversal was completed within approximately 48 hours - significantly faster than observed in murine intestinal organoids, possibly due to their larger luminal cavities requiring more time for structural reorganization. Notably, suspended Apical-OUT organoids showed significantly reduced size compared to Matrigel-embedded cultures after day 8. KI67 staining revealed moderately decreased proliferative activity in reversed organoids, suggesting polarity alteration may impose transient proliferative suppression. This phenotypic shift may stem from cytoskeletal remodeling during polarity reversal and loss of cell-matrix interactions, warranting further investigation into its mechanistic basis and functional implications.\u003c/p\u003e\u003cp\u003eThe endometrial function is critically regulated by the cyclic actions of reproductive hormones, particularly estradiol (E2) and progesterone (P4), which determine uterine receptivity and the opening/closing of the implantation window[\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e]. Therefore, evaluating the hormonal responsiveness of organoid models serves as a crucial indicator of their physiological relevance and in vivo mimicry capability. Through systematic analysis of the response characteristics to reproductive hormones and IFN-τ in both Apical-Out and Basal-Out organoids, our study provides profound insights into the molecular regulatory mechanisms of endometrial epithelial cells under different polarity states. Despite their distinct morphological differences, we made the striking observation that these two polarity-variant organoid models exhibited highly consistent gene expression profiles upon hormonal and IFN-τ stimulation. This significant finding establishes an important foundation for the application of organoid models in reproductive biology research. The results clearly demonstrate the central role of E2 in regulating endometrial receptivity. The specific response of PGR to E2 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB) aligns with established estrogen regulatory mechanisms[\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e]. Notably, the expression patterns of SPP1 and MUC1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC, \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE) faithfully recapitulate the molecular signatures of epithelial cells during the implantation window in vivo. The synergistic enhancement of SPP1 by MPA is particularly striking, underscoring progesterone's unique role in embryo adhesion [\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e]. The dynamic regulation of TGFB1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD) further reveals the intricate crosstalk between hormonal and embryonic signals. The reversal of MPA\u0026rsquo;s inhibitory effect by IFN-τ highlights its critical function in maintaining immune homeostasis at the maternal-fetal interface. This pattern closely mirrors the hormonal response of endometrial epithelial cells in vivo, confirming that the organoid system effectively mimics the physiological hormonal milieu [\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e, \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eThe expression changes in proliferation-related genes (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eG-I) accurately replicate the proliferation-differentiation switch observed in the endometrium during embryo implantation. The pro-proliferative effect of E2 contrasts sharply with the suppressive role of MPA, while the \"neutral\" response to IFN-τ aligns with its known immunomodulatory function [\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e, \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e]. The regulation of \u003cem\u003eMMP-2\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF) is particularly noteworthy\u0026mdash;its peak expression under E2\u0026thinsp;+\u0026thinsp;MPA treatment and subsequent IFN-τ-mediated suppression likely reflect the embryo's precise control over stromal remodeling. Western blot analysis (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eJ-K) further validates these findings at the protein level, reinforcing the robustness of our conclusions. Although Apical-Out organoids exhibit slightly reduced proliferative capacity, their consistent hormonal responsiveness makes them an ideal model for studying the uterine luminal microenvironment. Our study not only confirms the reliability of organoids in simulating endometrial physiology but, more importantly, reveals that polarity has a limited impact on epithelial cell functional regulation. These findings establish a solid foundation for future research on maternal-fetal crosstalk using Apical-Out organoids and provide key insights for developing more physiologically relevant in vitro models.\u003c/p\u003e\u003cp\u003eTo further validate the molecular-level recapitulation of luminal epithelium by our engineered organoids, we performed an integrative analysis comparing their transcriptomic profiles with bulk RNA-seq (BULK-seq) data generated from endometrial single-cell sequencing. Cluster analysis demonstrated that the overall transcriptional signature of the organoids exhibited greater similarity to luminal epithelium than to stromal cells, indicating successful preservation of luminal epithelial transcriptional characteristics during in vitro culture. These findings are consistent with previous observations in both human and murine uterine organoid studies, confirming that organoids can maintain stable epithelial lineage expression independent of stromal cell support [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. This comparative transcriptomic analysis provides compelling evidence that our organoid model faithfully captures the essential molecular attributes of native luminal epithelium.\u003c/p\u003e\u003cp\u003eDifferential expression analysis further revealed that the organoids and luminal epithelium shared high expression levels of multiple epithelial marker genes (including CDH1, KRT18, and EPCAM), as well as pregnancy-specific functional molecules WFDC2 and IGFBP2. These findings not only demonstrate the model's fidelity in maintaining cellular lineage identity but also suggest its potential secretory functionality. Notably, the epithelial secretory capacity plays a crucial role in supporting early embryonic development by producing glycoproteins, cytokines, and chemokines - processes whose regulation fundamentally depends on the organoid system's ability to faithfully recapitulate hormonal and signaling pathway responses [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eIn terms of hormonal responsiveness, the organoids demonstrated characteristic upregulation of key downstream genes (including PCNA, PGR, and KLF9) following estrogen and progesterone treatment, effectively mimicking the hormone-sensitive features of endometrium during either the menstrual cycle or early pregnancy. Particularly noteworthy was the robust upregulation of interferon pathway effectors (MX2, ISG15, and IFIT3) under combined E2\u0026thinsp;+\u0026thinsp;MPA\u0026thinsp;+\u0026thinsp;IFN-τ stimulation, which precisely recapitulates the maternal immune response during embryonic recognition observed in vivo [\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e]. These results collectively demonstrate the organoid system's dual competence in responding to both reproductive endocrine signals and embryonic cues, thereby establishing a biologically relevant in vitro platform for modeling the implantation window. Building upon these findings, we further investigated the potential of endometrial organoids to recapitulate key aspects of maternal-embryo crosstalk during early implantation. Co-culture experiments revealed that the organoids significantly enhanced in vitro growth of day-8 blastocysts, suggesting their capacity to secrete embryotrophic factors that promote proliferation and survival. While the N2\u0026thinsp;+\u0026thinsp;B27 culture system has been shown to support embryonic proliferation in vitro, it fails to fully mimic the rapid blastocyst elongation observed in vivo [\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e]. To address this limitation, we supplemented the N2/B27 medium with additional factors known to enhance luminal epithelial activity. This modified formulation supported limited blastocyst expansion even in the absence of organoids, but co-culture with organoids resulted in significantly accelerated growth kinetics (p\u0026thinsp;\u0026lt;\u0026thinsp;0.01). The observed increase in blastocyst volume could originate from either trophectoderm or inner cell mass proliferation - a distinction requiring future lineage-specific marker analysis. Notably, recent metabolomic studies have identified multiple critical metabolites in organoid-conditioned media [\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e]. Our established co-culture system, when combined with such multi-omics approaches (e.g., metabolomics and proteomics), will enable systematic identification of key embryotrophic factors. This strategy promises to bridge the current gap between in vitro models and the complex embryonic development occurring in utero. While conventional in vitro models for studying maternal-fetal interactions in ruminants have primarily relied on two-dimensional (2D) co-culture systems of endometrial epithelial cells and trophoblasts[\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e, \u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e], the present study developed an advanced three-dimensional model using Apical-Out endometrial luminal epithelial organoids co-cultured with trophoblast cells. Our results demonstrated that the organoids established stable adhesions with trophoblasts within remarkably short time periods, while maintaining consistent adhesive capacity across multiple passages - indicating excellent experimental reproducibility and translational potential of this model. Notably, reproductive hormones significantly enhanced organoid-trophoblast adhesion, with the E2\u0026thinsp;+\u0026thinsp;MPA and E2\u0026thinsp;+\u0026thinsp;MPA\u0026thinsp;+\u0026thinsp;IFN-τ treatment groups achieving particularly high attachment ratios in minimal time. This hormone-responsive pattern closely recapitulates the enhanced endometrial-trophoblast interactions observed during in vivo pregnancy under hormonal regulation [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e], thereby confirming the superior physiological relevance of our ovine luminal epithelial organoid system for modeling hormone-mediated uterus-embryo crosstalk.\u003c/p\u003e\u003cp\u003eIn summary, this study demonstrates that the established ovine endometrial organoids not only recapitulate the structural and secretory characteristics of luminal epithelium, but also functionally promote embryonic development and trophoblast adhesion. However, several important limitations remain: (1) The absence of stromal cells, immune cells and other functional cell types in the culture system deprives luminal epithelial cells of critical paracrine signaling from these cellular components, thus failing to fully mimic the in vivo microenvironment; (2) While responsive to E2, P4 and IFN-τ, the static hormone concentrations and timing in vitro cannot precisely replicate the dynamic fluctuations during estrous cycles; (3) Although supporting blastocyst proliferation and trophoblast adhesion, the proliferation patterns differ substantially from in vivo conditions, as evidenced by the markedly slower conceptus elongation in vitro, making complete simulation of ovine blastocyst-endometrium adhesion exceptionally challenging. Future studies should integrate microfluidic devices, co-culture matrix systems and 3D bioprinting technologies to develop more physiologically relevant maternal-fetal interface models with enhanced complexity, thereby providing an improved foundation for reconstructing ruminant uterus-embryo interactions that better approximate in vivo conditions [\u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e64\u003c/span\u003e, \u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e65\u003c/span\u003e].\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThis study successfully established ovine endometrial luminal epithelial organoids by optimizing signaling pathways (WNT3A/CHIR99021/EPHA1 agonist) and identifying essential medium components (FGF10/EGF/HGF/NOG/A83-01). These organoids faithfully replicated luminal epithelial-specific features, including polarized architecture (microvilli, desmosomes), mucin secretion, and hormone-responsive gene expression (PGR, SPP1, MUC1). Notably, polarity orientation critically influenced functionality: apical-out organoids exhibited reduced proliferation compared to basal-out counterparts but retained transcriptional fidelity to native luminal epithelium. Hormonal regulation studies revealed E2 as a master driver of receptivity genes, while MPA synergistically amplified secretory functions, and IFN-τ selectively modulated TGFB1/MMP-2 signaling. Functionally, luminal epithelial organoids enhanced blastocyst expansion (20% size increase) and accelerated trophoblast adhesion under E2\u0026thinsp;+\u0026thinsp;MPA treatment, mirroring physiological embryo-maternal interactions. This model provides a luminal epithelium-centric platform to dissect polarity-dependent endometrial dynamics, hormone-IFN-τ crosstalk, and implantation mechanisms, offering novel insights for reproductive research and therapeutic development.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eAbbreviation\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eFull Name/Definition\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eAPH-OUT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eApical-out polarity\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eBasal-Out\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eBasal-out polarity\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eEPHA1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eEphrin Type-A Receptor 1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eExM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eOrganoid Expansion Medium\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eFGF10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eFibroblast Growth Factor 10\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eFOXO3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eForkhead Box O3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eGO\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eGene Ontology\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eH\u0026amp;E\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eHematoxylin and Eosin\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eHGF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eHepatocyte Growth Factor\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eIFN-\u0026tau;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eInterferon-Tau\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eIFIT3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eInterferon-Induced Protein with Tetratricopeptide Repeats 3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eIGFBP2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eInsulin-Like Growth Factor Binding Protein 2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eISG15\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eInterferon-Stimulated Gene 15\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eKI67\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eMarker of Proliferation Ki-67\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eKLF9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eKr\u0026uuml;ppel-Like Factor 9\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eKRT18\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eKeratin 18\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eLE\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eLuminal Epithelium\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eLysoPC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eLysophosphatidylcholine\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eMPA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eMedroxyprogesterone Acetate\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eMMP-2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eMatrix Metalloproteinase-2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eMUC1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eMucin 1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eMX2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eMX Dynamin-Like GTPase 2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eNOG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eNoggin\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003ePAS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003ePeriodic Acid-Schiff\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003ePCNA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eProliferating Cell Nuclear Antigen\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003ePEDV\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003ePorcine Epidemic Diarrhea Virus\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003ePGR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eProgesterone Receptor\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eRSPO1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eR-Spondin1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eSEM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eStandard Error of the Mean\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eSPP1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eSecreted Phosphoprotein 1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eTEM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eTransmission Electron Microscopy\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eTGFB1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eTransforming Growth Factor Beta 1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eTROP2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eTrophoblast Cell Surface Antigen 2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eVEGF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eVascular Endothelial Growth Factor\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eWFDC2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eWAP Four-Disulfide Core Domain 2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eWNT3A\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eWnt Family Member 3A\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eFunding\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis project was supported by the\u0026nbsp;International (Regional) Cooperation and Exchange Program of the National Natural Science Foundation of China (Grant No. 3221101716)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study supported by the high-performance computing platform of Bioinformatics Center, Nanjing Agricultural University\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of Interest Statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing financial interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eJiahe Guo designed and performed most of the experiments. Xinai, Huang, Rongxin Xia and Qin Gao assisted in sample collection and analyzed the data. Hua yang and Qingyang Mai contributed to the experimental part. Guomin Zhang,Yanli Zhang and Mingtian Deng interpreted the data. Jiahe Guo drafted the manuscript with input from all the authors. Feng Wang supervised the study and administrated the project. All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability Statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets used and analyzed during the current study are available from the corresponding author on reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll animal procedures were ethically approved by the Ethics Committee of Nanjing Agricultural University, China (SYXK2022-0031).\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eDeng N, Li G, Zhang L, Wang P, Liu M, He B, Tang Y, Cai H, Lu J, Wang H, Deng W, Bao H, Kong S (2024) H3K27me3 timely dictates uterine epithelial transcriptome remodeling and thus transformation essential for normal embryo implantation. Cell Death Differ 31:1013\u0026ndash;1028\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMole MA, Weberling A, Fassler R, Campbell A, Fishel S, Zernicka-Goetz M (2021) Integrin beta1 coordinates survival and morphogenesis of the embryonic lineage upon implantation and pluripotency transition. Cell Rep 34:108834\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLai ZZ, Wang Y, Zhou WJ, Liang Z, Shi JW, Yang HL, Xie F, Chen WD, Zhu R, Zhang C, Mei J, Zhao JY, Ye JF, Zhang T, Li MQ (2022) Single-cell transcriptome profiling of the human endometrium of patients with recurrent implantation failure, Theranostics. 12:6527\u0026ndash;6547\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhou W, Van Sinderen M, Rainczuk K, Menkhorst E, Sorby K, Osianlis T, Pangestu M, Santos L, Rombauts L, Rosello-Diez A, Dimitriadis E (2024) Dysregulated miR-124-3p in endometrial epithelial cells reduces endometrial receptivity by altering polarity and adhesion. Proc Natl Acad Sci U S A 121:e2401071121\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003evan der Weijden VA, Puntar B, Rudolf Vegas A, Milojevic V, Schanzenbach CI, Kowalewski MP, Drews B, Ulbrich SE (2019) Endometrial luminal epithelial cells sense embryo elongation in the roe deer independent of interferon-taudagger. Biol Reprod 101:882\u0026ndash;892\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eQuinn KE, Matson BC, Wetendorf M, Caron KM (2020) Pinopodes: Recent advancements, current perspectives, and future directions. Mol Cell Endocrinol 501:110644\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLim W, Bae H, Bazer FW, Song G (2017) Functional Roles of Eph A-Ephrin A1 System in Endometrial Luminal Epithelial Cells During Early Pregnancy. J Cell Physiol 232:1527\u0026ndash;1538\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZlotkowska A, Andronowska A (2019) Chemokines as the modulators of endometrial epithelial cells remodelling. Sci Rep 9:12968\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYoo I, Lee S, Cheon Y, Park TS, Ka H (2025) CD40 ligand and CD40: expression, regulation and function at the maternal-conceptus interface in pigs, Reproduction. 169\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNg YH, Rome S, Jalabert A, Forterre A, Singh H, Hincks CL, Salamonsen LA (2013) Endometrial exosomes/microvesicles in the uterine microenvironment: a new paradigm for embryo-endometrial cross talk at implantation. PLoS ONE. 8e58502\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYang Q, Liu J, Wang Y, Zhao W, Wang W, Cui J, Yang J, Yue Y, Zhang S, Chu M, Lyu Q, Ma L, Tang Y, Hu Y, Miao K, Zhao H, Tian J (2022) An L., A proteomic atlas of ligand-receptor interactions at the ovine maternal-fetal interface reveals the role of histone lactylation in uterine remodeling. J Biol Chem 298:101456\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDavenport KM, Ortega MS, Johnson GA, Seo H, Spencer TE (2023) Review: Implantation and placentation in ruminants, Animal. 17 Suppl 1:100796\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAhn J, Yoon MJ, Hong SH, Cha H, Lee D, Koo HS, Ko JE, Lee J, Oh S, Jeon NL, Kang YJ (2021) Three-dimensional microengineered vascularised endometrium-on-a-chip. Hum Reprod 36:2720\u0026ndash;2731\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eEissa AM, Barros FSV, Vrljicak P, Brosens JJ, Cameron NR (2018) Enhanced Differentiation Potential of Primary Human Endometrial Cells Cultured on 3D Scaffolds, Biomacromolecules. 19:3343\u0026ndash;3350\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eValentijn AJ, Saretzki G, Tempest N, Critchley HO, Hapangama DK (2015) Human endometrial epithelial telomerase is important for epithelial proliferation and glandular formation with potential implications in endometriosis. Hum Reprod 30:2816\u0026ndash;2828\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eClassen-Linke I, Kusche M, Knauthe R, Beier HM (1997) Establishment of a human endometrial cell culture system and characterization of its polarized hormone responsive epithelial cells. Cell Tissue Res 287:171\u0026ndash;185\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eClevers H (2016) Modeling Development and Disease with Organoids, Cell. 165:1586\u0026ndash;1597\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCorsini NS, Knoblich JA (2022) Human organoids: New strategies and methods for analyzing human development and disease. Cell 185:2756\u0026ndash;2769\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBoretto M, Cox B, Noben M, Hendriks N, Fassbender A, Roose H, Amant F, Timmerman D, Tomassetti C, Vanhie A, Meuleman C, Ferrante M, Vankelecom H (2017) Development of organoids from mouse and human endometrium showing endometrial epithelium physiology and long-term expandability. Development 144:1775\u0026ndash;1786\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTurco MY, Gardner L, Hughes J, Cindrova-Davies T, Gomez MJ, Farrell L, Hollinshead M, Marsh SGE, Brosens JJ, Critchley HO, Simons BD, Hemberger M, Koo BK, Moffett A, Burton GJ (2017) Long-term, hormone-responsive organoid cultures of human endometrium in a chemically defined medium. Nat Cell Biol 19:568\u0026ndash;577\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSaadeldin IM, Han A, Bang S, Kang H, Kim H, Abady MM, Jeong JS, Kwon HJ, Lee S, Cho J (2024) Generation of porcine endometrial organoids and their use as a model for enhancing embryonic attachment and elongation. Reproduction. 167\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFitzgerald HC, Dhakal P, Behura SK, Schust DJ, Spencer TE (2019) Self-renewing endometrial epithelial organoids of the human uterus. Proc Natl Acad Sci U S A 116:23132\u0026ndash;23142\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSpencer TE, Kelleher AM, Bartol FF (2019) Development and Function of Uterine Glands in Domestic Animals. Annu Rev Anim Biosci 7:125\u0026ndash;147\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSeishima R, Leung C, Yada S, Murad KBA, Tan LT, Hajamohideen A, Tan SH, Itoh H, Murakami K, Ishida Y, Nakamizo S, Yoshikawa Y, Wong E, Barker N (2019) Neonatal Wnt-dependent Lgr5 positive stem cells are essential for uterine gland development. Nat Commun 10:5378\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eXu QX, Zhang WQ, Lu L, Wang KZ, Su RW (2023) Distinguish Characters of Luminal and Glandular Epithelium from Mouse Uterus Using a Novel Enzyme-Based Separation Method, Reprod Sci. 30:1867\u0026ndash;1877\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSpencer TE, Johnson GA, Bazer FW, Burghardt RC (2004) Implantation mechanisms: insights from the sheep. Reproduction 128:657\u0026ndash;668\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHaider S, Gamperl M, Burkard TR, Kunihs V, Kaindl U, Junttila S, Fiala C, Schmidt K, Mendjan S, Knofler M, Latos PA (2019) Estrogen Signaling Drives Ciliogenesis in Human Endometrial Organoids, Endocrinology. 160:2282\u0026ndash;2297\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChen Y, Antoniou E, Liu Z, Hearne LB, Roberts RM (2007) A microarray analysis for genes regulated by interferon-tau in ovine luminal epithelial cells, Reproduction. 134:123\u0026ndash;135\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAn SY, Gao XX, Wang ZB, Liang YX, Wang ST, Xiao SH, Xia JT, You PH, Wang F, Zhang GM (2020) Estradiol-17beta regulates proliferation and apoptosis of sheep endometrial epithelial cells by regulating the relative abundance of YAP1. Anim Reprod Sci 215:106328\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGilfeather CL, Lemley CO (2016) Effects of Interferon-Tau and Steroids on Cytochrome P450 Activity in Bovine Endometrial Epithelial Cells, Reprod Domest Anim. 51:415\u0026ndash;420\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGao X, Yao X, Li X, Liang Y, Liu Z, Wang Z, Li K, Li Y, Zhang G, Wang F (2021) Roles of WNT6 in Sheep Endometrial Epithelial Cell Cycle Progression and Uterine Glands Organogenesis. Vet Sci. 8\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCocero MJ, Marigorta P, Novillo F, Folch J, Sanchez P, Alabart JL, Lahoz B (2019) Ovine oocytes display a similar germinal vesicle configuration and global DNA methylation at prepubertal and adult ages, Theriogenology. 138:154\u0026ndash;163\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRamos-Ibeas P, Lamas-Toranzo I, Martinez-Moro A, de Frutos C, Quiroga AC, Zurita E, Bermejo-Alvarez P (2020) Embryonic disc formation following post-hatching bovine embryo development in vitro, Reproduction. 160:579\u0026ndash;589\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eShibata S, Endo S, Nagai LAE, Oike EHK, Kobayashi A, Kitamura N, Hori A, Nashimoto T, Nakato Y, Hamada R, Kaji H, Kikutake H, Suyama C, Saito M, Yaegashi M, Okae N, Arima H (2024) Modeling embryo-endometrial interface recapitulating human embryo implantation. Sci Adv 10:eadi4819\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTian J, Yang J, Chen T, Yin Y, Li N, Li Y, Luo X, Dong E, Tan H, Ma Y, Li T (2023) Generation of Human Endometrial Assembloids with a Luminal Epithelium using Air-Liquid Interface Culture Methods, Adv Sci (Weinh). 10:e2301868\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSpencer TE, Hayashi K, Hu J, Carpenter KD (2005) Comparative developmental biology of the mammalian uterus. Curr Top Dev Biol 68:85\u0026ndash;122\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSpencer TE, Sandra O, Wolf E (2008) Genes involved in conceptus-endometrial interactions in ruminants: insights from reductionism and thoughts on holistic approaches, Reproduction. 135:165\u0026ndash;179\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang HQ, Liu Y, Li D, Liu JY, Jiang Y, He Y, Zhou JD, Wang ZL, Tang XY, Zhang Y, Zhen X, Cao ZW, Sheng XQ, Yang CF, Yue QL, Ding LJ, Hu YL, Hu ZB, Li CJ, Yan GJ, Sun HX (2023) Maternal and embryonic signals cause functional differentiation of luminal epithelial cells and receptivity establishment. Dev Cell 58:2376\u0026ndash;2392 e2376\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBazer FW, Spencer TE, Johnson GA, Burghardt RC, Wu G (2009) Comparative aspects of implantation, Reproduction. 138:195\u0026ndash;209\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLi S, Ren Q (2020) Effects of Arsenic on wnt/beta-catenin Signaling Pathway: A Systematic Review and Meta-analysis. Chem Res Toxicol 33:1458\u0026ndash;1467\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDrakhlis L, Devadas SB, Zweigerdt R (2021) Generation of heart-forming organoids from human pluripotent stem cells. Nat Protoc 16:5652\u0026ndash;5672\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eXu Z, Xu X, Yang B, Mi Y, Wang J (2023) 3D sheep rumen epithelial structures driven from single cells in vitro. Vet Res 54:104\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLim W, Bae H, Bazer FW, Song G (2019) Ephrin A1 promotes proliferation of bovine endometrial cells with abundant expression of proliferating cell nuclear antigen and cyclin D1 changing the cell population at each stage of the cell cycle. J Cell Physiol 234:4864\u0026ndash;4873\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAdu-Gyamfi EA, Czika A, Liu TH, Gorleku PN, Fondjo LA, Djankpa FT, Ding YB, Wang YX (2021) Ephrin and Eph receptor signaling in female reproductive physiology and pathologydagger, Biol Reprod. 104:71\u0026ndash;82\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGu ZY, Jia SZ, Liu S, Leng JH (2020) Endometrial Organoids: A New Model for the Research of Endometrial-Related Diseasesdagger, Biol Reprod. 103:918\u0026ndash;926\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAchache H, Revel A (2006) Endometrial receptivity markers, the journey to successful embryo implantation. Hum Reprod Update 12:731\u0026ndash;746\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGiudice LC, Liu B, Irwin JC (2025) Endometriosis and adenomyosis unveiled through single-cell glasses. Am J Obstet Gynecol 232:S105\u0026ndash;S123\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSternberg AK, Izmaylova L, Buck VU, Classen-Linke I, Leube RE (2024) An Assessment of the Mechanophysical and Hormonal Impact on Human Endometrial Epithelium Mechanics and Receptivity. Int J Mol Sci 25\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKakni P, Lopez-Iglesias C, Truckenmuller R, Habibovic P, Giselbrecht S (2023) PSC-derived intestinal organoids with apical-out orientation as a tool to study nutrient uptake, drug absorption and metabolism. Front Mol Biosci 10:1102209\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCo JY, Margalef-Catala M, Li X, Mah AT, Kuo CJ, Monack DM, Amieva MR (2019) Controlling Epithelial Polarity: A Human Enteroid Model for Host-Pathogen Interactions, Cell Rep. 26:2509\u0026ndash;2520e2504\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAhmad V, Yeddula SGR, Telugu B, Spencer TE, Kelleher AM (2024) Development of Polarity-Reversed Endometrial Epithelial Organoids, Reproduction. 167\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYang T, Zhao J, Liu F, Li Y (2022) Lipid metabolism and endometrial receptivity. Hum Reprod Update 28:858\u0026ndash;889\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMotta IG, da Silva AG, Feltrin IR, Souza SV, Degan Mattos AC, Morelli KG, Castro T, Nishimura TK, Ginther OJ, Pugliesi G (2025) Effects of estradiol on PGF(2alpha) synthesis and corpus luteum function during early pregnancy in beef heifers, Theriogenology. 237:49\u0026ndash;60\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDunlap KA, Erikson DW, Burghardt RC, White FJ, Reed KM, Farmer JL, Spencer TE, Magness RR, Bazer FW, Bayless KJ, Johnson GA (2008) Progesterone and placentation increase secreted phosphoprotein one (SPP1 or osteopontin) in uterine glands and stroma for histotrophic and hematotrophic support of ovine pregnancy. Biol Reprod 79:983\u0026ndash;990\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJohnson GA, Bazer FW, Burghardt RC, Seo H, Wu G, Cain JW, Pohler KG (2024) The history of interferon-stimulated genes in pregnant cattle, sheep, and pigs, Reproduction. 168\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBrooks K, Burns GW, Moraes JG, Spencer TE (2016) Analysis of the Uterine Epithelial and Conceptus Transcriptome and Luminal Fluid Proteome During the Peri-Implantation Period of Pregnancy in Sheep, Biol Reprod. 95:88\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBaranda-Avila N, Mendoza-Rodriguez CA, Morimoto S, Langley E, Cerbon M (2009) Molecular mechanism of cell proliferation in rodent uterus during the estrous cycle. J Steroid Biochem Mol Biol 113:259\u0026ndash;268\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChaney HL, Grose LF, Charpigny G, Behura SK, Sheldon IM, Cronin JG, Lonergan P, Spencer TE, Mathew DJ (2021) Conceptus-induced, interferon tau-dependent gene expression in bovine endometrial epithelial and stromal cellsdagger, Biol Reprod. 104:669\u0026ndash;683\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSeo H, Frank JW, Burghardt RC, Bazer FW, Johnson GA (2020) Integrins and OPN localize to adhesion complexes during placentation in sheep, Reproduction. 160:521\u0026ndash;532\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRamos-Ibeas P, Gonzalez-Brusi L, Used MT, Cocero MJ, Marigorta P, Alberio R, Bermejo-Alvarez P (2022) In vitro culture of ovine embryos up to early gastrulating stages, Development. 149\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSimintiras CA, Dhakal P, Ranjit C, Fitzgerald HC, Balboula AZ, Spencer TE (2021) Capture and metabolomic analysis of the human endometrial epithelial organoid secretome. Proc Natl Acad Sci U S A 118\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNakamura K, Kusama K, Bai R, Sakurai T, Isuzugawa K, Godkin JD, Suda Y, Imakawa K (2016) Induction of IFNT-Stimulated Genes by Conceptus-Derived Exosomes during the Attachment Period. PLoS ONE 11:e0158278\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChen X, Tang L, Pan Y, Xie Y, Jin H, Xiang X, Wang Z (2025) oar-miR-29a promotes the establishment of endometrial receptivity by targeting CDC42 in sheep, Theriogenology. 237:22\u0026ndash;32\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSaorin G, Caligiuri I, Rizzolio F (2023) Microfluidic organoids-on-a-chip: The future of human models. Semin Cell Dev Biol 144:41\u0026ndash;54\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGnecco JS, Brown A, Buttrey K, Ives C, Goods BA, Baugh L, Hernandez-Gordillo V, Loring M, Isaacson KB, Griffith LG (2023) Organoid co-culture model of the human endometrium in a fully synthetic extracellular matrix enables the study of epithelial-stromal crosstalk. Med 4:554\u0026ndash;579e559\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Endometrial organoid, Sheep, Luminal epithelium, Polarity regulation, Embryo implantation","lastPublishedDoi":"10.21203/rs.3.rs-6818248/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6818248/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e\u003cp\u003eThe luminal epithelium of the sheep endometrium plays a pivotal role in embryo implantation. However, there is currently a lack of in vitro models that accurately mimic its physiological functions. Although endometrial organoid systems have been well established in humans and mice, comparable models for ruminants remain underdeveloped due to their unique reproductive physiology. Therefore, establishing an organoid model that faithfully recapitulates the characteristics of the sheep endometrial luminal epithelium is essential for advancing our understanding of embryo implantation in this species.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e\u003cp\u003eIn this study, we systematically optimized the culture system and found that the combined supplementation of WNT3A, CHIR99021, and Y-27632 significantly improved the efficiency of organoid formation from sheep endometrial luminal epithelial cells. Notably, the innovative introduction of an EPHA1 agonist further promoted the development of functional organoids with a stable diameter exceeding 100 \u0026micro;m and mature morphological features. These organoids exhibited typical luminal epithelial characteristics, including microvilli, tight junctions, and secretory vesicles, expressed key epithelial markers (KRT18, TROP2, and EPCAM), and achieved an apical-out polarity in up to 86% of structures\u0026mdash;effectively simulating the in vivo implantation microenvironment. Upon hormonal stimulation, the organoids displayed responses consistent with those of native tissue. Transcriptomic analysis confirmed a high degree of similarity between the organoids and primary endometrial luminal epithelium. Functional co-culture experiments further demonstrated that these organoids significantly promoted blastocyst proliferation and achieved stable adhesion with trophoblast cells.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e\u003cp\u003eThis study reports the first successful establishment of a stable and functional sheep endometrial luminal epithelial organoid model that closely mimics the structural and physiological features of the native tissue. This model provides a powerful in vitro platform for investigating the mechanisms of embryo implantation in ruminants and lays a solid foundation for the development of diagnostic and therapeutic strategies for reproductive disorders in livestock.\u003c/p\u003e","manuscriptTitle":"Establishment and characterization of functional sheep endometrial luminal epithelial organoids","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-07-14 13:29:02","doi":"10.21203/rs.3.rs-6818248/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"365ae8e5-d997-4a18-bc13-d192ef391a97","owner":[],"postedDate":"July 14th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2026-04-16T14:11:56+00:00","versionOfRecord":[],"versionCreatedAt":"2025-07-14 13:29:02","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-6818248","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6818248","identity":"rs-6818248","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}