Impact of Autophagy and Proteasome inhibition on denervation-induced Skeletal Muscle Atrophy

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher
AI-generated summary by claude@2026-07, 2026-07-14

This study investigated the impact of autophagy and proteasome inhibition on denervation-induced skeletal muscle atrophy in rats, finding both systems are interdependent and autophagy inhibition more effectively attenuates atrophy.

One-sentence paraphrase of the abstract; not a substitute for reading it. No clinical advice. How this works

AI-generated deep summary by claude@2026-07, 2026-07-14 · read from full text

This preprint studied denervation-induced skeletal muscle atrophy in 6-week-old male Wistar rats, testing for interactions between autophagy and the ubiquitin–proteasome system (UPS) using autophagy (chloroquine) and UPS/proteasome inhibition (bortezomib/Velcade), alone or in combination, after sciatic nerve crush for 3 or 7 days. Across multiple readouts (histology, RT-qPCR, western blots for muscle markers and autophagy/UPS-related proteins, and calpain activity and oxidative/inflammatory signaling markers), denervation elevated ROS and pro-atrophic pathways including TWEAK/FoxO3/NF-κB/Smad3/4 and increased markers of both UPS E3 ligases (Atrogin1, MuRF1) and autophagy (LC3β, Atg5, p62, LAMP2A, PINK1), with protein degradation regulation showing mutual dependence between autophagy and proteasome activity. The authors report that autophagy inhibition attenuated muscle atrophy more than proteasome inhibition, and that inhibition of one system affected the other. A major caveat is that this is an unreviewed preprint (not journal peer reviewed), and the work is limited to a rat denervation model with inhibitor pharmacology rather than direct genetic manipulation. The paper does not explicitly discuss endometriosis or adenomyosis; it was included in the corpus via a keyword match in the upstream search index.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Abstract

Abstract Skeletal muscle (SkM) mass loss is directly related to increased oxidative stress, inflammation, and muscle protein degradation mediated by proteolytic systems. Growing evidence suggests the interdependency of autophagy and UPS in the progression of SkM atrophy. Hence, the current study was performed to understand the interdependency of autophagy and UPS and their impact on SkM atrophy. 6-week-old male Wister rats undergone denervation were randomized into different treated groups for one week alone and in conjunction with UPS and autophagy inhibitors. Further assessments were achieved by morphological aberration (via histopathology), mRNA (via RT-qPCR), protein expression of muscle-specific markers (via western blotting), calpain activity (via Zymography) and biochemical alteration. In denervated rats, treatment mainly with chloroquine and somehow with velcade tried to normalize the activity of mitochondrial complex I and IV, calpains activity, levels of ROS, pro-atrophic markers TWEAK, FoxO3, NFkB, Smad3/4, UPS promoting E3 ligases; Atrogin1, MuRF1, autophagy promoting factors; LC3β, Atg5, p62, LAMP2A, PINK1 and myosin heavy chain. In denervated skeletal muscles, inhibition of autophagy affects the activity of proteasome and vice versa. Hence, autophagy and UPS both are interdependent systems in SkM atrophy. Autophagy inhibition attenuates muscle atrophy more precisely than proteasomal and both systems inhibitions.
Full text 162,774 characters · extracted from preprint-html · click to expand
Impact of Autophagy and Proteasome inhibition on denervation-induced Skeletal Muscle Atrophy | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Impact of Autophagy and Proteasome inhibition on denervation-induced Skeletal Muscle Atrophy Ajay Singh, Rajesh Dabur This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5360477/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Skeletal muscle (SkM) mass loss is directly related to increased oxidative stress, inflammation, and muscle protein degradation mediated by proteolytic systems. Growing evidence suggests the interdependency of autophagy and UPS in the progression of SkM atrophy. Hence, the current study was performed to understand the interdependency of autophagy and UPS and their impact on SkM atrophy. 6-week-old male Wister rats undergone denervation were randomized into different treated groups for one week alone and in conjunction with UPS and autophagy inhibitors. Further assessments were achieved by morphological aberration (via histopathology), mRNA (via RT-qPCR), protein expression of muscle-specific markers (via western blotting), calpain activity (via Zymography) and biochemical alteration. In denervated rats, treatment mainly with chloroquine and somehow with velcade tried to normalize the activity of mitochondrial complex I and IV, calpains activity, levels of ROS, pro-atrophic markers TWEAK, FoxO3, NFkB, Smad3/4, UPS promoting E3 ligases; Atrogin1, MuRF1, autophagy promoting factors; LC3β, Atg5, p62, LAMP2A, PINK1 and myosin heavy chain. In denervated skeletal muscles, inhibition of autophagy affects the activity of proteasome and vice versa. Hence, autophagy and UPS both are interdependent systems in SkM atrophy. Autophagy inhibition attenuates muscle atrophy more precisely than proteasomal and both systems inhibitions. Sciatic nerve injury Skeletal muscle atrophy Oxidative stress Inflammation autophagy inhibition and Proteasome inhibition Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Introduction Skeletal muscle (SkM) is composed of discrete bundles of muscle fibres, each of which is wrapped by sarcolemma. Skeletal muscle atrophy (SkMA) is defined as the reduction in size of myofibers resulting from the depletion of proteins, organelles, and other cytoplasmic components. Muscle mass depletion can be observed under various conditions, including denervation or nerve damage, lack of physical exercise, fasting, exposure to microgravity, and the presence of certain diseases such as Type 2 diabetic Mellitus, cancer, AIDS, cardiac and renal failure [ 1 ]. The interconnection between nerves, particularly the sciatic nerve, and SkM is crucial for the preservation of their strength and physiological functioning. Upon receiving stimulation, nerve fibres secrete acetylcholine (Ach), which induces depolarisation and repolarisation of SkM and facilitates multiple interconnected intracellular signals and biological processes. Sciatic nerve injury disrupts the transmission of information from neurones to the muscle. This is marked by a gradual decline in motor neurones and ACh at the neuromuscular junctions (NMJ). An interruption in the neuronal signal at the NMJ leads to an increase in the expression of acetylcholine receptors (AChRs) on the outer membrane of the junction. This causes the depolarisation of muscle fibres to stretch, resulting in an increased permeability of the sarcolemma. This increased permeability is achieved by opening calcium-gated channels and connexin/pannexin hemi channels. This resulted in an elevated influx of Ca 2+ into the sarcoplasm and the opening of the mitochondrial permeability transition pore (mPTP), causing depolarisation of the mitochondria. This not only triggers the formation of reactive oxygen species (ROS), but also initiates inflammation and protein breakdown (catabolism) in the muscles. Oxidative stress significantly hampers the activation of the PI3K/AKT signalling pathway and activates the TWEAK, FoxO and NF-κB signalling pathways. Calcium influx additionally triggers cAMP, cGMP, calcineurin signalling, mitophagy, and apoptosis. Through these molecular pathways, denervation promotes the autophagy and UPS turnover to enhance protein catabolism, in turn SkMA [ 2 ]. UPS, a complex protease composed of multiple subunits, detects the ubiquitin chains attached to proteins that are short-lived, soluble, and unfolded or misfolded. These ubiquitin chains are added to the proteins by E3 ligases. Autophagy eliminates insoluble protein clumps, long-lived proteins, and defective organelles. The initial evidence of the connection between UPS and autophagy arose from the identification of ubiquitinylated protein by both systems. Currently, there are some evidences suggesting interactions between UPS and autophagy. Furthermore, specific factors such as FoxO1/3, p62, NF-kB, Smad3, ubiquitination at different positions, and mitophagy have been identified as crosslinking factors. The suppression of one system impacts the functioning of other proteolytic systems and vice versa [ 3 ]. The present study aims to elucidate the interactions between the autophagy system and UPS in denervation-induced SkMA by utilizing particular inhibitors. Materials and Methods Chemicals Velcade, Chloroquine, poly-L-lysine, Ponceau-S, DPX, TRI reagent, triton X-100, isopentane were procured from Sigma-Aldrich (St Louis, USA). Citrate buffer (pH=4.5), 0.9% saline, PBS, sucrose, formalin, chloroform, ethanol, acetonitrile, acetone, sodium orthovanadate (Na3VO4), sodium fluoride, EDTA, tris HCL, NaOH, HCl, sodium acetate buffer, phosphate buffer, sodium phosphate buffer, glycine, glacial acetic acid, H 2 O 2 , potassium dichromate, dichromate acetic acid reagent, sodium carbonate, nitro blue tetrazolium(NBT), hydroxylamine hydrochloride, n-butanol, pyridine, TBA, sodium azide, TCA, eosin, hematoxylin, acid alcohol, diastase, periodic acid, Schiff’s reagent, absolute ethanol, xylene, 5,5′dithiobis 2′-nitrobenzoic acid (DTNB), tris(hydroxymethyl) aminomethane, hexadecyltrimethy ammonium bromide (HTAB), 37% formaldehyde solution were purchased from Merck, Life Sciences, Germany. Optimal cutting temperature embedding medium (OCT), RevertAid First StrandcDNA synthesis kit, RNA laterTM stabilizing solution was purchased from Thermo Scientific, USA. Maxima SYBR green/ROX qPCR master mix was purchased from Genetix Biotech Asia Pvt. Ltd. Forward and reverse primers were synthesized from Eurofins Pvt. Ltd India. Sodium dodecyl-sulfate (SDS), sodium orthovanadate, 37% paraformaldehyde, sodium azide, ponceau’S, β-mercaptoethanol, pyrimidine, tween-20, acrylamide, tritonX-100, poly-l-lysine, N, N, N’ N’- tetramethyl ethylenediamine (TEMED), nonidet P-40, bis-acrylamide, xylene, was procured from Merck Life science Pvt. Ltd. Isoflurane was purchased from troikaa pharmaceutical Ltd. Animals grouping and treatment: Animal experimentation was performed as per guidelines of the Committee for Control and Supervision of Experiments on Animals (CPCSEA), India, post ethical approval form Institutional Animal Ethical Committee, Maharishi Dayanand university, Rohtak, vide letter no.282-93 Dated 11-12-21. 9 weeks old healthy male Wistar rat weighing 160-200 g, were procured form Lala Lajpat Rai University of Veterinary and Animal Sciences, Hisar. Then the animals were acclimatized for 2 weeks under controlled environment with 25°C temperature and 12-hour light/dark circulation, at central animal house facility, Maharishi Dayanand university, Rohtak. After the acclimation period animals were randomly divided into 8 groups with 9 animals per group. Sample size was calculated via power analysis with statistical power (0.8) and P-value (P<0.005) using G*Power (v. 3.1.9.4). Body weight of all animals was continuously observed during the entire study period. During the study, Group-1 (control group) animals were fed with normal water and diet without undergoing any surgery or treatment. Group-2 (denervated group) undergone sciatic nerve crush surgery followed with normal water and diet. Group-3 also undergone sciatic denervation surgery but administered with subsequent Velcade (0.15mg/kg) treatment alongside normal water and diet. Group-4 undergone sciatic denervation surgery but administered with subsequent chloroquine (50mg/kg) treatment alongside normal water and diet. Group-5 undergone sciatic denervation surgery and administered with subsequent chloroquine (50mg/kg) with velcade (0.15mg/kg) treatment alongside normal water and diet. For denervation, under constant flow of isoflurane (anesthesia) and oxygen, left tibialis anterior muscle was exposed and an 8-10-mm piece of sciatic nerve was cut out. After the dosing of velcade, chloroquine and their cocktail, half of the animals from each group were sacrificed at Day-3 (post-denervation), while the remaining half were sacrificed on Day-7 to harvest their skeletal muscles such as soleus, tibialis anterior, gastrocnemius, and quadriceps. After harvesting, a part of gastrocnemius muscle was embedded with optimum cutting temperature (OCT) media under freezing conditions in liquid nitrogen cooled isopentane. However, a small part of gastrocnemius muscles was stored in RNA letter solution while other muscles were undergone to direct cryopreservation and storage at -80°C. Atrophy Rate and Histology The weights of freshly excised muscles were measured. The gastrocnemius muscle weight/body weight (GMW/BW) ratio was calculated to measure the atrophy rate to assess skeletal muscle atrophy. For histological study, Gastrocnemius muscle was rinsed in saline post-harvest and embedded in OCT in liquid nitrogen-cooled Isopentane. Cross-sections measuring 7µm were obtained using Thermo scientific cryostat (CRYOSTAR NX50). Obtained sections are processed for hematoxylin and eosin (H&E) staining and ATPase staining. Comparative changes in muscle sections were determined using NIS element 4.30 software (Nikon, US). Calpain Zymography Caseinolytic zymography was performed to monitor calcium-activated protease in test and control samples. Crushed quadricep muscle (50mg) was pre-incubated in lysis buffer (100Mm Tris-Cl base pH-8.0, 5Mm EDTA, 10mM 2- mercaptoethanol, 0.1% Triton X-100, 5mM NaF, 1mM Na3VO4) for 15 min and homogenized for 15 min. Homogenate was incubated for 30 min at 4ºC and centrifuged at 12000 rpm for 20 min. The resultant supernatant was taken out for protein quantification using the Bradford reagent. Meantime casein (0.3%) was copolymerized with Polyacrylamide separating gel and a pre-run at 80V for 30 min at 4ºC was performed using running buffer (25mM Tris-Cl, pH-8.3, 192mM glycine, 1mM EDTA). The quantified protein sample was mixed with loading buffer (300mM Tris-Cl, pH 6.8, 40% glycerol, 0.02% bromophenol blue, and 200mM DTT) and electrophoresed at 80V for 3hr at 4ºC. The casein gels were rinsed with distilled water and incubated in calcium buffer (50mMTris-Cl,4mM CaCl2,10mM 2-mercaptoethanol) at room temperature for overnight. After incubation gels were stained with 1%coomassie blue for 1hr. followed by overnight distaining. Calpain bands were visualized on white light trans-illuminator and analyzed using Image J software [4]. Reverse Transcription Real Time-Polymerase Chain Reaction (RT-qPCR ): Total RNA was extracted from gastrocnemius muscle stored in RNA later solution using the Trizol method as described previously by Yadav et al., 2021. Isolated RNA was quantified using NanoDrop™ 2000/2000c Spectrophotometers (ThermoScientific), and cRNA was synthesized using a cDNA Thermo scientific synthesis kit. RT-qPCR was performed on the Rotor-Gene Q amplifier (Qiagen, USA) and Maxima SYBR green/ROX qPCR master mix (Genetix Biotech Asia Pvt. Ltd.). The reaction cycle consisted of hot start at 95 °C for 10 min, then 40 cycles of denaturation at 95 °C for 15 sec, annealing at 60 °C for the 30s, and extension at 72 °C for 30s. Gene expression was analyzed using Rotor-Gene Assay Manager v2.1. Targeted genes were normalized, comparing the GAPDH expression pattern as internal control, and 2-(ΔΔCT) was calculated to compare the expression of control, denervated and treated animals [5]. Table 1: List of forward and reverse primer sequences used in RT-qPCR. S. No. Gene Forward primer Reverse primer 1 GAPDH 5’-AGACAGCCGCATCTTCTTGT-3’ 5’-TGATGGCAACAATGTCCACT-3’ 2 Atrogin-1 5’-GTCGCAGCCAAGAAGAGAAAGA-3’ 5’-TGCTATCAGCTCCAACAGCCTT-3’ 3 MuRF-1 5’-TAACTGCATCTCCATGCTGGTG-3’ 5’-TGGCGTAGAGGGTGTCAAACTT-3’ 4 TWEAK 5’-GCTACGACCGCCAGATTGGG-3’ 5’-GCCAGCACACCGTTCACCAG-3’ 5 LC3 beta 5’- AAACGAAGAAATGGGCTGTG -3’ 5’- GAAGGGGCAAAGGACTGATT -3’ 6 ATG5 5’ - GATGTCCGACTTATTCGAGAGC-3’ 5’ -TTGAGCTGTAAGCGCCTTCTA-3’ 7 p62 5′-TGGAGTCGGATAACTGCTCAGGAG-3′ 5′-AGACTGGAGTTCACCTGTGGATGG-3′ 8 NF-kB p65 5′ ACGATCTGTTTCCCCTCATCT 3′ 5′ TGCTTCTCTCCCCAGGAATA 3′ 9 TNFa 5-‘GGTGGACCGCAACAACGCAATCTA-3’ 5’-GGGTGGCCATGAGGAGCAGGAA-3’ 10 Smad 3 5′-AGCACACAATAACTTGGACC-3′ 5′-TAAGACACACTGGAACAGCGGATG-3′ 11 Smad 4 5’-CCACCAACTTCCCCAACATT-3’ 5’-TGCAGTCCTACTTCCAGTCCAG-3’ 12 Foxo3a 5’-CGGCTCACTTTGTCCCAGAT-3’ 5’-TCTTGCCAGTCCCTTCGTTC-3’ 13 p53 5’-TCAAGCCTTCCAACCTC-3’ 5’-GCAGCCCACAGACCAAA-3’ 14 PINK1 5′-TACCGCTTCTTCCGCCAGTCG-3′ 5’-GCTCTCCGCCTGCTTCTCCTC-3’ 15 Caspase3 5’-AGCTGATTTGACCATTTGCCTGAA-3’ 5’-CCGGGACGCGAAGTGCTATTGGTAC-3’ 16 Bax 5’- TCAAGCCTTCCAACCTC -3’ 5’- GCAGCCCACAGACCAAA -3’ 17 Bcl2 5’-CCGGGACGCGAAGTGCTATTGGTAC-3’ 5’-AGCTGATTTGACCATTTGCCTGAA-3’ 18 mTOR 5’-GGCCACCGTGTGTGTAAGAA-3’ 5’-GACCCTGCACTGAGATCCTG-3’ 19 Akt 5’-TCACCTCTGAGACCGACACC-3’ 5’-ACTGGCTGAGTAGGAGAACTGG-3’ Immunoblotting : The 50 mg quadricep muscle was homogenized in 500ul lysis buffer composed of Tris-HCl (50 mM), NaCl (200 mM), NP-40 (0.3%), Na3VO4 (1.0 mM), NaF (50 mM) and protease inhibitors cocktail. The lysate was centrifuged for 15 min at 12,000 g, and the supernatant was collected. The total protein was quantified using Bradford assay. Approx 8-15 µg of quantified protein from each sample was mixed with loading buffer (5X) containing 1.0 M tris HCL, 0.02 % bromophenol blue, 5 % β-mercaptoethanol, 30 % glycerol, and 10 % SDS separately. Samples were boiled for 5 minutes, loaded and separated on precast stacking gel (6%) and resolving gel of different percentages like 10 %, and 12 % depending upon the molecular weight of the targeted protein. Separated proteins were transferred into 0.22 µm nitrocellulose membrane by providing the constant current supply of 400 mA for a period of 1.5 h. Transferred blots were stained with Ponceau-S dye solution (0.25g of Ponceau S in 0.5 ml of acetic acid and 50 ml of distilled water) to confirm the equal transfer of separated protein and then washed with TBST for 5 minutes. Overnight block the blots in a 5% blocking buffer (5% BSA dissolved in TBST). After blocking, blots were washed thrice for 5 minutes with TBST, followed by a 3-hour incubation of primary antibodies, including anti-MuRF-1, anti-Atrogin-1, anti-LAMP2A, anti-Bax, anti-MyHC, anti-Akt ser473 , anti-Bcl2, and anti-actin. Afterward, wash the blot thrice for 5-5 minutes with TBST to remove the unbound primary antibody, and incubate the blots in the secondary antibody for 60 minutes. After secondary antibody incubation, blots were again washed 5 times for 5-5 minutes with TBST to eliminate unbound secondary antibodies. Supersignal TM West Pico Plus Chemiluminescent substrate was used to visualize the bands using the chemiluminescent MPP system (Biorad Pvt. Ltd.) and band intensity was analyzed using ImageJ software [5]. Biochemical assays i. Preparation of tissue homogenate and enzyme assays: Sufficient volume of Gastrocnemius muscle sample (10%w/v) from each group was lysed in buffer [(50mM Tris-Cl, 200 mM NaCl, 0.3% NP-40 and 1mM DTT, pH 8.0), 50 mM NaF, 1mM Na orthovanadate, 50 µl benzamidine and 10 µl protease inhibitor cocktail] for 10 min at 4°C, followed by centrifugation at 12,000 rpm at 4ºC for 10 min. post-centrifugation the supernatant was collected and total protein estimation was done with Bradford standard curve equation. The supernatant was used in below mention assays. ii. Mitochondrial Complex 1 activity assay: Briefly, the assay system was developed in 0.2M Glycyl glycine buffer (pH 8.5), 6 mM NADH in 2mM Glycyl glycine buffer, 10.5mM cytochrome C, 0.02M sodium bicarbonate. After mixing of 0.35ml of 0.2M Glycyl glycine buffer (pH 8.5) in 0.1ml of 10.5mM cytochrome C, 0.1ml of 6 mM NADH and 2.4 ml of H 2 O, 10ul of protein homogenate was added along with 20ul of 0.02M sodium bicarbonate. The enzyme activity was measured spectrophotometrically at 550 nm [6]. iii. Mitochondrial Complex 4 activity assay: Briefly, following the addition of 0.7 ml of 75mM sodium phosphate buffer (pH 7.8) in 0.1ml of 0.3 mM of reduced cytochrome C (reduced with the help of few pellets of sodium borohydride, pH 7), 10ul of protein homogenate was added. The enzyme activity was measured spectrophotometrically at 550 nm [7]. iv. Total ROS assay: 2,7-Dichlorofluorescin (DCFH) was used as a fluorescent probe to measure the rate of oxidant production in the various fresh tissue homogenates. Briefly, the assay buffer contained 130 mmol/L KCl, 5 mmol/L MgCl2, 20 mmol/L NaH2PO4, 20 mmol/L Tris-HCl and 30 mmol/L glucose (pH 7.4), with a total volume of 1mL. The assay was initiated with the addition of 100 uM DCFH-diacetate (DCFH-DA) dissolved in methanol and add 100 uL of tissue homogenate, and the mixture was incubated at 37°C for 30 min. This allowed DCFH-DA to be cleaved by intracellular esterase to derive free DCFH. The rate of oxidation from DCFH to 2,7- dichlorofluorescein (DCF), which is indicative of oxidant production, was followed at an excitation wavelength of 488 nm and emission wavelength of 525 nm for 30 min using a Horiba Fluorolog TM fluorescent spectrometer [8]. v. Creatine kinase (CK) activity assay: The activity of CK was measured using a commercial kit and as per instructions from the manufacturer. The detection kit accompanied R1 reagent (Lot: S101905) and R2 reagent (Lot: S101905; ERBA Transasia Bio-medical LTD.) was added to the tissue homogenate/serum and CK was quantified with help of standard curves. vi. Proteasome activity assay: Homogenize the skeletal muscles (~50 mg) in a lysis buffer containing 50 mM Tris-HCl (pH 7.5), 5 mM EDTA, 1 mM DTT, and 0.5% NP-40. Centrifuge the homogenate at 14,000 g for 10 minutes at 4°C to obtain the supernatant, which contains the proteasome enzyme. Determine the protein concentration using a BCA assay. For the assay, incubate equal amounts of protein (20-50 μg) with a fluorogenic peptide substrate such as Suc-LLVY-AMC (50 μM final concentration) in assay buffer (50 mM Tris-HCl, pH 7.5, 5 mM EDTA, 0.5 mM DTT) at 37°C. The release of fluorescent AMC (7-amino-4-methylcoumarin) is measured using a fluorescence plate reader with an excitation wavelength of 380 nm and emission at 460 nm. The proteasome activity is expressed as the increase in fluorescence over time and can be normalized to the protein content [9]. Statistical Analysis Results were statistically signified through one-way/two analysis of variance (ANOVA) applied in GraphPad Prism version 7.04 and the significance considered at p-value≤0.05. Power analysis clarifies that the total sample of 65 Wister rats were provided 80% power i.e., α= 0.05 and β=0.20 for determination of significant difference among the treatments. Results Analysis of Body Weight and Muscle Weight Nerve injury or denervation typically results in significant muscle atrophy and subsequent loss of body weight. The loss of neural input to muscles leads to decreased muscle mass and strength, which in turn affects overall body composition. In experimental models, such as denervated rats, this muscle wasting is evident through reductions in both muscle weight and overall body weight. Change in body weight Following sciatic resection, a decrease in body weight of the denervated rats resulted in a weight of 166 ± 2.6 g on 3rd day, which was statistically significant. The weight on the 7th day was 144.8 ± 2.21 g, in contrast to the healthy control group, which weighed 204 ± 10.73g. The intervention of velcade in denervated animals resulted in a somewhat increased body weight, which reached 168.8 ± 7.3g on the third day, as depicted in Fig. 1 A. Additionally, a significant elevation in body weight was observed on the seventh day of the intervention, with a value of 175 ± 8.6g. Supplementation of chloroquine in denervated animals significantly increased the body weight of denervated animals, with a recorded weight of 194 ± 10.6g on day 3 and 197 ± 1.63g on day 7. On days 3 and 7, a cocktail of velcade and chloroquine supplementation somewhat increased the body weight by 168 ± 8.71g and 151.8 ± 3.9g, respectively (Fig. 1 A ) . Changes in individual muscle weights In denervated animals, the average weight of gastrocnemius was significantly decreased to 0.298 ± 0.005 g and 0.259 ± 0.015g on day 3 and 7 post-denervation, respectively, compared to the sham control 0.378 ± 0.015g. The present study observed that only chloroquine administration significantly increased the weight of gastrocnemius to 0.380 ± 0.008g on day 3 of denervation. On day 7, velcade and chloroquine both significantly increased their weight to 0.330 ± 0.035g and 0.340 ± 0.007g, respectively (Fig. 1 C ) . Moreover, the average weight of the soleus muscle significantly decreased to 0.085 ± 0.005 g and 0.082 ± 0.001 g on days 3 and 7 post-denervation, respectively, compared to the sham control, which was 0.111 ± 0.007 g. No treatment notably increased the soleus weight on day 3 post-denervation. However, by day 7, treatments with velcade and chloroquine significantly increased the muscle weight to 0.096 ± 0.006 g and 0.107 ± 0.005g, respectively ( Fig. 1 D ) . The tibialis anterior (TA) muscle weight was decreased to 0.082 ± 0.008 g and 0.075 ± 0.007 g on days 3 and 7 post-denervation, respectively, compared to the healthy weight of 0.096 ± 0.008 g. No treatments significantly increased TA weight on day 3. However, by day 7, velcade and chloroquine treatments significantly increased TA weight to 0.091 ± 0.005 g and 0.090 ± 0.002 g, respectively ( Fig. 1 E ) . Additionally, the average weight of the quadriceps decreased to 1.33 ± 0.057g and 1.22 ± 0.065g on days 3 and 7 of denervation, respectively, compared to the control rats, which had an average weight of 1.82 ± 0.16g. This study found that administering chloroquine significantly increased the quadriceps weight to 1.7 ± 0.09g on day 3 post-denervation. By day 7, both velcade and chloroquine significantly increased the quadriceps weight to 1.55 ± 0.19g and 1.62 ± 0.154g, respectively ( Fig. 1 F ) . Atrophy rate The rate and extent of atrophy can vary depending on the severity of denervation. Denervation significantly contributes to reduced muscle quality and quantity to promote atrophy rate. In the present study, on days 3 and 7 post-denervation, the rate of atrophy was increased, to 2.14 ± 0.2 and 2.42 ± 0.09, respectively, compared to the control group (1.7 ± 0.07). On day 3 of intervention, velcade and chloroquine and their cocktail significantly reduced the rate of atrophy ( Fig. 1 B ) . The reduction in atrophy rate was 1.83 ± 0.13, 1.77 ± 0.09, and 1.82 ± 0.19 for velcade, chloroquine and cocktail-supplemented groups, respectively. On day 7 after denervation, these interventions significantly reduced the atrophy rate, to 1.72 ± 0.12, 1.78 ± 0.14, and 2.32 ± 0.19, respectively. Analysis of Biochemical Markers in skeletal muscle Creatine kinase activity Sciatic injury initiates creatine kinase leakage from the muscular tissue. This process, in turn, leads to a deficiency in the high-energy product phosphocreatine and an altered metabolic state in the muscle's energy system [ 10 ]. In animals that underwent sciatic nerve resection, phosphocreatine levels were reduced, attributable to a decrease in creatine kinase activity measured as 1.34 ± 0.02 U/L and 2 ± 0.02 U/L on day 3 and day 7, respectively, compared to healthy rats as 2.8 ± 0.01. On day 3, the intervention of chloroquine yielded a significant improvement in membrane integrity, consequently resulting in the cessation of creatine kinase leakage, hence leading to a marked increase in creatine kinase activity to 1.74 ± 0.03 U/L. Likewise, on day 7, the intervention of chloroquine yielded a significant increase in creatine kinase activity to 2.74 ± 0.05 U/L. However, other treatments failed to normalize CK levels in denervation ( Fig. 2 A ) . Oxidative stress in various groups As discussed earlier, nerve injury ultimately promotes oxidative stress in skeletal muscles via increasing Ca 2+ levels in the myoplasm and the mitochondrial matrix. ROS levels in muscle tissue were assessed to evaluate the antioxidant efficacy of velcade, chloroquine, and their combination in denervated rat muscles. Denervated muscles exhibited significantly elevated ROS levels on days 3 and 7 compared to sham controls. Administration of the cocktail further increased ROS levels, while velcade and chloroquine reduced ROS levels ( Fig. 2 B ) . Mitochondrial complexes In denervation, prolonged accumulation of ROS in skeletal muscle leads to mitochondrial dysfunction. These conditions lead to reduced activity and efficiency of the electron transport chain complexes (I-V), resulting in decreased ATP production and again increased ROS generation [ 11 ]. In rats with denervation-induced neuropathy, there was a notable reduction in the activity of mitochondrial respiratory chain complex I on days 3 and 7, with values decreasing to 5.6 ± 1.1 and 3.7 ± 0.7 nmol/min/mg protein, respectively, compared to healthy control rats (9.26 ± 1 nmol/min/mg protein). Administration of velcade and cocktail significantly preserved complex I activity on day 3 to 5.6 ± 0.4 and 5.22 ± 1.1 nmol/min/mg protein, respectively. Chloroquine alone significantly preserved complex I activity to 9.1 ± 0.7 and 8.5 ± 0.2 nmol/min/mg protein on day 3 and 7, respectively ( Fig. 2 C ) . Regarding mitochondrial complex IV, denervated rats showed reduced activity on days 3 and 7, with values dropping to 34.8 ± 1.8 and 22.6 ± 1.3 nmol/min/mg protein, respectively, compared to healthy rats (49.9 ± 2.18 nmol/min/mg protein). Only chloroquine administration significantly preserved complex IV activity on day 3 to 52.9 ± 3.9 nmol/min/mg protein. On day 7, chloroquine alone preserved complex IV activity significantly to 48.6 ± 0.4 nmol/min/mg protein ( Fig. 2 D ) . 26S Proteasome activity Increased activity of E3 ubiquitin ligases like MuRF1 and MAFbx/atrogin-1 enhances protein ubiquitination, providing more substrates for the 26S proteasome. This accelerated breakdown of muscle proteins significantly contributes to the loss of muscle mass and function. Understanding proteasomal activity in SkMA is crucial for developing targeted therapies against atrophy [ 12 ]. In the present study, there was a notable elevation in proteasomal activity, reaching 2613.8 ± 321 RFU on day 3 and 2898 ± 215 RFU on day 7, compared to healthy rats at 1572 ± 122 RFU. Treatment with velcade, chloroquine, and their combination significantly reduced proteasomal activity on day 3 to 856.8 ± 189 RFU, 2197.9 ± 199 RFU, and 1256.8 ± 85 RFU respectively. By day 7, velcade alone significantly decreased proteasome activity to 711.3 ± 256 RFU, but none of the treatments normalized its levels by day 7 ( Fig. 2 E ) . Histological changes in atrophic and treated groups Sciatic nerve injury can lead to fragmentation, degeneration, fiber switching, and degradation of myo-proteins [ 13 ]. To study the effects of treatments on atrophy-mediated muscle fiber changes, sections of the gastrocnemius muscle were stained using different staining procedures. In denervated groups, Fig. 3 shows that after 3 and 7 days of denervation, the splitting of muscle fibers, narcosis, and vacuolization occurred to promote muscle fiber degeneration compared to sham control. While chloroquine intervened groups exhibited reduced intercellular space and fragmentation, improving fiber regeneration on day 3. At day 7 of denervation, both Velcade and chloroquine treatments were found to be effective, but not the cocktail treatment. Additionally, area of gastrocnemius muscle cells was significantly reduced on day 3 and 7, post denervation. Only chloroquine intervention tried to prevent that reduction in area of denervated cells (Fig. 2 F). Gastrocnemius muscles are more likely to switch from fast fibers (type IIa/b) to slow (type I) in skeletal muscle atrophy. The current study investigated the change in fiber types based on myofibril ATPase activity. The gastrocnemius muscle of the denervation group showed more (60%) dark fibers (type I) compared to the sham control (26%). Among the treatments, chloroquine (particularly at day 7) resulted in decreased dark-type fibers to 42% and increased light myofibers (type IIa/b) compared to the denervated ( Fig. 4 ) . Treatment with chloroquine, as compared to velcade, maintained or increases muscle weight regards of fiber type composition of skeletal muscles on day 7. Calpains Zymography: Calpains are calcium-dependent cysteine proteases that play a vital role in skeletal muscle remodelling. Sciatic nerve injury permanently disrupts calcium homeostasis, leading to an increase in the cytoplasmic calcium level in the muscle, which activates calpains. Once activated, these proteases cleave myofibril proteins such as desmin, troponin, titin, and vimentin, thereby leading to UPS degradation [ 14 ]. Therefore, in the present study, we investigated the activity of calpain isoforms in SkMA. On day 3, in denervated rats ( Fig. 5 ) , the activity of calpain 3, µ-calpain and m-calpain was ~ 4 times, 13 times and 8 times, respectively, more than activity in healthy muscles. Velcade, chloroquine, and their cocktail were found effective in suppressing the enhanced activity of calpains in denervated muscles. Velcade intervention suppressed the activity of only m-calpain 1.6 times, compared to denervated rats. Chloroquine treatment suppressed the activity of calpain 3, µ-calpain, and m-calpain to ~ 0.8 times, 0.6 times, and 0.75 times, respectively, than denervated animals. Cocktail treatment suppressed the activity to ~ 0.68 times, 0.56 times, and 0.62 times, respectively, then denervated rats. On day 7, the activity of calpain 3, µ-calpain, and m-calpain was ~ 2 times, 3.6 times, and 1.4 times, respectively, more than activity in healthy muscles. The intervention of chloroquine and cocktail reduced the activity of m-Calpain in denervated muscles significantly, whereas velcade did not ( Fig. 5 ) . Impact of interventions on Akt signalling and inflammatory genes: Denervation impacts protein anabolism and mitochondrial function in skeletal muscle. Both conditions lead to reduced protein synthesis and increased protein breakdown, disrupting the balance of muscle protein homeostasis. Denervation interrupts neuromuscular signalling, causing increased calcium influx and oxidative stress, which activates proteolytic pathways. Denervation mediated activation of Forkhead box O (FoxO) transcription factors upregulate the expression of atrophy-related genes and promote muscle protein degradation. This process is further exacerbated by inflammation, as denervation induces the production of pro-inflammatory cytokines that contribute to muscle wasting [ 11 ]. In the present study, total RNA was isolated from gastrocnemius muscles, quantified, reverse transcribed to cDNA, and finally analyzed using qPCR. At days 3 and 7 post-denervation, the levels of Akt gene expression were upregulated to 1.74 ± 0.3-fold and 1.9 ± 0.2-fold, respectively. However, on day 3 and 7, administration of a cocktail intervention in denervated animals significantly upregulated Akt expression to 2.3 ± 0.1-fold and 2.42 ± 0.1-fold, respectively. By day 3, upregulation of Akt to 2.03 ± 0.27-fold was observed exclusively in the velcade-treated group, however, chloroquine treatment tried to normalise the conditions ( Fig. 6 ). Moreover, there was a significant upregulation in the expression of the mTOR gene by approximately 2.12 ± 0.2 and 1.7 ± 0.17 folds, respectively, at day 3 and day 7 following denervation. Treatment with velcade, chloroquine, and a combination of both significantly increased mTOR levels on day 3 to 2.8 ± 0.15, 2.78 ± 0.2, and 3.1 ± 0.3 folds, respectively. On day 7, velcade, chloroquine and their combinational treatment showed significant upregulation of mTOR to 2.3 ± 0.25, 2.71 ± 0.3 and 3.4 ± 0.4 folds, respectively. On day 3 and day 7 post-denervation, the expression of the FoxO3 gene was significantly increased by 3.14 ± 0.5 folds and 4.8 ± 0.5 folds, respectively. By day 7, FoxO3 levels were significantly downregulated in the velcade and chloroquine-treated groups to 3.6 ± 0.7 folds and 1.60 ± 0.5 folds, respectively ( Fig. 6 ) . Regarding the Tweak gene, its expression increased by 3 ± 0.6 folds and 2.4 ± 0.13 folds on days 3 and 7 post-denervation, respectively, compared to healthy rats. Chloroquine and cocktail interventions on day 3 downregulated Tweak expression to 1.5 ± 0.5 folds and 1.24 ± 0.4 folds, respectively, compared to denervated animals. On day 7, only chloroquine intervention downregulated Tweak to 1.11 ± 0.3 folds ( Fig. 6 ) . On the third- and seventh days following denervation, TNFα gene expression increased significantly by 2.56 ± 1.1 and 2.09 ± 0.9 folds, respectively, compared to healthy control rats. Treatment with chloroquine and a combination of interventions (cocktail) further elevated TNFα levels on day 3 to 5.45 ± 0.7 and 10.55 ± 1.09 folds, respectively, compared to denervated animals. By day 7, all interventions led to a further increase in TNFα expression in denervated rats ( Fig. 6 ) . On day-3 and day-7 post-denervation, the expression levels of the NFkB gene were significantly increased by approximately 2.3 ± 0.1 and 1.58 ± 0.08 folds, respectively, compared to control rats. Treatment with velcade, chloroquine, and a combination of both on day 3 resulted in a downregulation of NFkB expression to 1.57 ± 0.04, 2.06 ± 0.29, and 0.55 ± 0.09 folds, respectively, compared to denervated animals. By day 7, only chloroquine treatment led to a decrease in NFkB expression to 1.13 ± 0.08 folds ( Fig. 6 ) . 4.9.5 Expression of catabolism-promoting genes: Three days and seven days after denervation, Smad3 gene expression levels were notably increased by 2.3 ± 0.4 folds and 4.8 ± 0.37 folds, respectively, compared to controls. No treatment exhibited significant downregulation of Smad3 on day 3 post-denervation. However, on day 7, treatment with velcade, chloroquine, and the cocktail led to reductions in Smad3 expression to 6.8 ± 0.8 folds, 1.82 ± 0.35 folds, and 2.8 ± 0.46 folds, respectively, compared to denervated animals (Fig. 7 ). On the third- and seventh-days following denervation, there was a significant increase in Smad4 gene expression by 2.08 ± 0.4 and 4.9 ± 0.3 folds, respectively, compared to control rats. No treatment on day 3 showed significant downregulation of Smad4. However, by day 7, treatment with velcade, chloroquine, and a combination treatment significantly reduced Smad4 levels to 3.2 ± 0.5 folds, 1.18 ± 0.35 folds, and 2.7 ± 0.4 folds, respectively ( Fig. 7 ). Given the roles of the UPS in SkMA, we investigated the effects of various treatments on these proteolytic systems. Specifically, we analyzed the expression of UPS-promoting E3 ligases such as Atrogin1 and MuRF1 in denervated and diabetic rat muscles. This comprehensive gene expression analysis aimed to elucidate the molecular mechanisms by which these pharmacological interventions impact UPS-mediated SkMA. The expression levels of the Atrogin1 gene were found to be significantly upregulated following denervation, reaching 3.05 ± 0.64-fold on day 3 and 2.62 ± 0.14-fold on day 7. Upon intervention with velcade, chloroquine, and their combination in denervated animals, Atrogin1 expression on day 3 was further elevated to 4.3 ± 0.36-fold, 4.19 ± 0.09-fold, and 3.62 ± 0.33-fold, respectively. By day 7, these interventions resulted in Atrogin1 levels of 1.72 ± 0.35-fold, 1.6 ± 0.2-fold, and 4.28 ± 0.45-fold, respectively ( Fig. 7 ) . The MuRF1 gene expression levels were significantly upregulated, showing a 2.9 ± 0.11-fold increase on day 3 and a 2.8 ± 0.23-fold increase on day 7 following denervation. On day 3, only denervated animals treated with velcade with chloroquine decreases MuRF1 expression to a significant level of 2.07 ± 0.3-fold. By day 7, the MuRF1 level was significantly downregulated to 1.7 ± 0.38-fold, only in the velcade-treated group ( Fig. 7 ) . Denervation significantly impacts autophagy in skeletal muscle, contributing to muscle atrophy. In denervation, the loss of neural input disrupts calcium homeostasis and increases oxidative stress, leading to enhanced autophagy activation. This process is mediated by the upregulation of autophagy-related genes and increased formation of autophagosomes. On day 3 and day 7 following nerve injury, the expression of the p62 gene was notably increased by 1.43 ± 0.34 folds and 2.49 ± 0.31 folds, respectively, compared to rats without nerve injury. Treatment with velcade, chloroquine, and a combination of both further increased p62 expression on day 3 to 2.16 ± 0.24, 2.51 ± 0.2, and 2.74 ± 0.3 folds, respectively, compared to animals with nerve injury alone. On day 7, the expression levels rose to 3.6 ± 0.46 folds, 3.13 ± 0.5 folds, and 3.65 ± 0.41 folds, respectively ( Fig. 7 ) . On days 3 and 7 post-denervation, LC3β gene expression levels increased to 1.74 ± 0.3-fold and 1.48 ± 0.3-fold, respectively. On day 3, treatment with velcade, chloroquine, and their combination in denervated animals resulted in LC3β levels of 1.75 ± 0.18-fold, 1.15 ± 0.1-fold, and 1.17 ± 0.2-fold, respectively. By day 7, these treatments led to LC3β levels of 1.31 ± 0.16-fold, 0.83 ± 0.2-fold, and 1.07 ± 0.3-fold, respectively ( Fig. 7 ) . Level of autophagy and apoptosis regulating genes: Additionally, at day 3 and day 7 post-denervation, the expression levels of the Atg5 gene were significantly elevated, reaching 1.74 ± 0.07-fold and 1.99 ± 0.3-fold increases, respectively. On day 3 and 7, treatment with only chloroquine in denervated animals resulted significant reduction in Atg5 levels to 1.19 ± 0.09-fold and 0.79 ± 0.20, respectively ( Fig. 8 ). Similarly, the expression levels of the mitophagy-promoting gene i.e., Pink1, on days 3 and 7 following denervation, were observed to increase by 1.8 ± 0.07-fold and 2.4 ± 0.3-fold, respectively. On day 3 and 7 after denervation, only chloroquine intervention significantly downregulated the Pink1 to 1 ± 0.19-fold and 0.6 ± 0.07-fold, respectively ( Fig. 8 ). In denervation, the loss of nerve supply disrupts neuromuscular junctions, leading to increased calcium influx and mitochondrial dysfunction. This triggers the release of pro-apoptotic factors like cytochrome-c and activates caspase-9 and caspase-3, key players in the apoptotic cascade. While apoptosis is less studied in skeletal muscle atrophy, elevated levels of these apoptosis-inducing factors have been reported in denervated muscles. Thus, in the present study, we analyzed the effect of UPS and autophagy inhibition on apoptosis-regulating genes such as p53, caspase-3, Bax, and Bcl2. Three days and seven days after denervation, the expression of the p53 gene increased significantly by 4.51 ± 1.03 and 10.05 ± 1.1 folds, respectively, compared to control rats. On day 3, treatment with the cocktail further elevated p53 expression to 9.8 ± 1 folds. By day 7, velcade, chloroquine, and cocktail treatments resulted in p53 levels of 12.8 ± 1.2 folds, 6.3 ± 1.1 folds, and 8.93 ± 1.1 folds, respectively ( Fig. 8 ) . At days 3 and 7 following denervation, Bcl2 gene expression was 0.47 ± 0.14 and 0.75 ± 0.08-fold, respectively. Administration of velcade, chloroquine, and their combination on day 3 in denervated animals resulted in Bcl2 levels 0.33 ± 0.07-fold, 0.23 ± 0.14-fold, and 0.15 ± 0.04-fold, respectively. By day 7, these treatments yielded Bcl2 levels of 0.51 ± 0.09-fold, 0.48 ± 0.02-fold, and 0.5 ± 0.07-fold, respectively ( Fig. 8 ) . At days 3 and 7 post-denervation, Caspase3 gene expression levels increased to 2.1 ± 0.5 folds and 2.2 ± 0.16 folds, respectively. On day 3, interventions with velcade, chloroquine, and their combination in denervated animals resulted in Caspase3 expression levels of 2.8 ± 0.2 folds, 3.1 ± 0.3 folds, and 4.6 ± 0.31 folds, respectively. By day 7, Caspase3 levels reached to 2.8 ± 0.2 folds, 3.02 ± 0.2 folds, and 5.2 ± 0.05 folds, respectively ( Fig. 8 ) . At day 3 and day 7 post-denervation, levels of the Bax gene were upregulated as 1.3 ± 0.17 folds and 1.7 ± 0.14 folds, respectively. On day 3, interventions of velcade, chloroquine, and their cocktail in denervated animals upregulate the level of Bax as 2.2 ± 0.6 folds, 3.3 ± 0.13 folds, and 4.08 ± 0.25 folds, respectively. On day 7, the level of Bax was 3.27 ± 0.06 folds, 3.94 ± 0.2 folds, and 6.27 ± 0.3 folds, respectively ( Fig. 8 ) . 4.7 Differential expression of proteins in skeletal muscles Denervation-induced SkMA involves a complex molecular mechanism where several proteins play critical roles. Loss of nervous input leads to modulate Akt activity, upregulates atrophy-related genes, particularly MuRF1 (Muscle RING Finger 1), which ubiquitinates and targets myofibrillar proteins like myosin heavy chain (MyHC) and actin for degradation by the proteasome. Concurrently, LAMP 2A levels increase, promoting autophagy, which further contributes to the breakdown of SkM proteins. Additionally, denervation alters the balance between pro-apoptotic Bax and anti-apoptotic Bcl2 proteins, initiating caspase mediated atrophy. The combined effects of these pathways lead to the progressive loss of SkM mass and function characteristic of atrophy. In our current research, we investigated the levels of phosphorylated Akt, MuRF1, LAMP 2A, myosin heavy chain (MyHC), actin, Bax, and Bcl2 at the translational level in denervated and treated groups. At day 3 and day 7 post-denervation, phosphorylated-Akt levels were significantly elevated to 1.6-fold and 1.7-fold, respectively. Velcade alone leads to an increased to 1.8-folds in p-Akt at day 3, but the effect is less pronounced to 1.7-folds by day 7. Chloroquine alone shows an initial decrease to 0.6-folds in p-Akt at day 3 but increased to 1.8-folds by day 7. The combination of velcade and chloroquine results in the highest p-Akt levels i.e., 2.7-folds, indicating a potential synergistic effect ( Fig. 9 A ) . Denervation and the combination of velcade and chloroquine influenced MuRF1 E3 ligase levels differently over time. Denervation increased MuRF1 levels to 1.4 and 1.5-folds at day 3 and day 7, respectively. Velcade treatment consistently elevated MuRF1 levels to 1.4-folds at day 3 but reduced to 0.8-folds at day 7. Chloroquine treatment tried to normalized the MuRF1 at day 3 and day 7 post-denervation. The combination of Velcade and chloroquine resulted in the highest MuRF1 levels at day 7 (1.8-folds), suggesting a potential synergistic effect. In conclusion, the data suggests that MuRF1 levels are dynamically regulated by these treatments, with velcade showing a time-dependent effect, chloroquine showing a suppressing effect, and the combination treatment resulting in the highest levels of MuRF1 ( Fig. 9 B ) . Denervation after 3 and 7 days significantly increased LAMP 2A levels to 2.1 and 2.3-folds, respectively. Velcade treatment suppressed the LAMP 2A levels to 1.5 and 1 folds at both day 3 and day 7, respectively, indicating its impact on lysosomal function. Chloroquine treatment highlighted a significant decrease to 1.3 and 1-fold by day 3 and 7, respectively. The combination of velcade and chloroquine results in the highest LAMP 2A levels at day 3 (2.8-folds) but a reduction by day 7 (1.8-folds). In conclusion, the data suggests that LAMP 2A protein levels are vigorously regulated by denervation and systems inhibition. Denervation significantly elevates LAMP 2A levels, with velcade and chloroquine alone showing suppressive effects. Cocktail treatment initially increased LAMP 2A levels significantly but shows a reduction over time ( Fig. 9 C ) . In denervated and cocktail treated groups, Bax protein levels was elevated to 1.1 and 1.5-folds, respectively, at day 3. Chloroquine treatment shown a marked increase of 1.9 and 1.7-folds in Bax levels at both time points, indicating a pro-apoptotic response. The combination treatment consistently resulted in the highest Bax levels to 1.9-fold, particularly at day 7 ( Fig. 9 D ) . Denervation generally reduced BCl2 protein levels to 0.9-folds, particularly by day 7. Velcade treatment further reduced BCl2 levels to 0.8 and 0.6-folds by day 3 and 7, respectively. Chloroquine treatment consistently lowered BCl2 levels to 0.7 and 0.5-folds, at day 3 and 7, respectively. The cocktail treatment shows a significant reduction in BCl2 levels at both day 3 and day 7, with a more pronounced effect at day 3 ( Fig. 9 E ) . Denervation significantly decreased MyHC levels to 0.7-folds at day 3, followed by day 7 (0.4-folds). Velcade treatment consistently reduced MyHC levels to 0.6-folds and 0.3 folds at both time points. Chloroquine treatment also decreased MyHC levels to 0.5-folds at day 3, but normalized it on day 7 ( Fig. 9 F ) . Discussion Sciatic nerve injury results in impaired neuromuscular transmission, causing an influx of Ca2 + in skeletal muscles. This leads to the generation of free radicals, oxidative stress, increased activity of the UPS, and increased mitophagy/autophagy processes [ 15 ]. The UPS and autophagy both are key pathways responsible for skeletal muscle atrophy, with some evidences suggesting their interdependency [ 16 ]. Understanding this relationship is vital for developing therapies to combat muscle loss. In the present study, chloroquine treatment normalized the ROS, more effectively than velcade and combine supplementation. Levels of inflammatory cytokines such as TWEAK, TNF-α and NF-kB were found upregulated in denervation. However, supplementation of chloroquine normalized TWEAK and NF-kB levels in gastrocnemius muscle. Denervation induced ROS and inflammation activate the FoxO3 [ 17 ], found to upregulated at day 3 and 7. By day 7, FoxO3 levels were significantly downregulated in the velcade and chloroquine-treated groups. It is also reported that FoxO3a alleviates the inflammation and oxidative stress via regulating TGF-β signaling [ 18 ]. Sciatic nerve injury escalated the mRNA level of TGF-β and its downstream transcription factors i.e. Smad 3/4 in atrophied skeletal muscle. However, significant reductions in the level of Smad 3/4 genes were observed after autophagy as well as proteasome inhibition. Transcription factors such as FoxO3a, NF-kB and Smad3/4 can activate the both UPS promoting E3 ligases such as Atrogin1 and MuRF1, and autophagy promoting factors such as LC3β, Atg5 and LAMP 2A [ 16 ]. During denervation, upregulation in the levels of Atrogin1 and MuRF1 were normalized after autophagy inhibition and to a less extent after proteasome inhibition, particularly at day 7. This was further confirmed with increased activity of 26S proteasome in denervated muscles, however normalized via velcade treatment. Denervation was found to upregulate the autophagy-promoting genes or proteins such as LC3β, Atg5 and LAMP 2A at day 3 and 7. These are found to be suppressed after autophagy inhibition more precisely than proteasome or both system inhibition. Due to this increased oxidative stress, inflammation, proteasome activity and autophagy in denervation, area of gastrocnemius muscle cells was significantly reduced on day 3 and 7. Only chloroquine intervention prevented the reduction in area of denervated muscle fibers. Additionally, treatment with chloroquine, as compared to velcade, maintained or increases muscle weight regards of fiber type composition of skeletal muscles on day 7. Thus, autophagy inhibition with chloroquine effectively counteracts atrophy (more than proteasome inhibition), preserving muscle cell area, body weight, muscle weight, atrophy rate, and histology of muscle fibers . In case of proteasome inhibition, upregulation in the level of autophagy promoting genes such as Atg5 and p62, along with pro-apoptotic factors such as caspase3 and Bax was observed. Additionally, in autophagy inhibition or in inhibition of both systems, there was a further upregulation in levels of caspase3 and Bax in denervated muscles. The Western blotting results demonstrated that Bcl2 protein levels were reduced in denervated muscle, and this suppression was enhanced by velcade and chloroquine treatments. Nevertheless, the combined administration slightly elevated Bcl2 levels on day 7, but the increase was not statistically significant. These observations confirmed the increased apoptosis after autophagy and proteasome inhibition. This highlights a complex interplay between proteolytic pathways in regulating muscle apoptosis and homeostasis during denervation. Studies have shown that calpain has the ability to stimulate the activation of caspase-3, while active caspase-3 can in turn amplify calpain activity. Also, it has been found that inhibiting calpain can lead to a notable reduction in caspase-3-like activity. Additionally, research has indicated the significance of calpain-dependent cleavage of calpastatin in regulating caspase-3 activation during apoptosis [ 19 ]. Similar correlation has been observed in the current study. Denervation-induced calcium influx in muscle cells was observed to upregulates the activities of calpain 3, µ- and m-calpain along with caspase-3, significantly. Instead of reduction, proteasomal inhibition promoted the µ- and m-calpains as well as caspase-3 activities in denervated muscles. It was further correlated with decreased levels of Bcl2 and increased levels of Bax. However, autophagy inhibition (alone or with proteasome inhibition) significantly reduced the activities of calpains in skeletal muscles. Protein anabolic factors Akt and mTOR showed increased expression on days 3 and 7 post denervation. This upregulation was further enhanced by the concurrent administration of velcade and chloroquine at transcription as well as translation level, significantly. Thus, velcade and chloroquine promote protein anabolism in denervated muscles, evidenced by increased skeletal muscles weight and whole-body weight. Additionally, activities mitochondrial complexes I and IV were notably reduced in denervation, but inhibition of autophagy or proteasome system substantially restored these activities. It was further confirmed by increased expression levels of the mitophagy-promoting gene i.e., Pink1, on days 3 and 7 following denervation. The Pink1 level was significantly restored by chloroquine intervention and not by velcade, leading to the normalization of autophagy. The observation is further corroborated by chloroquine being more effective than velcade in preventing fiber type switching or restoring fiber types. The effectiveness of velcade was observed predominantly on day 7, however, the co-administration of velcade and chloroquine did not result in a significant improvement in the body weight of denervated rats. Moreover, inhibition of both proteasome and autophagy promoted the atrophic conditions instead of impede. The effects of VC intervention were found to be similar to denervation-induced skeletal muscle atrophy, as seen in increased ROS production, inhibition of mitochondrial complexes, and increased proteasome activity, leading to an increased rate of atrophy. Concurrent use of velcade and chloroquine did not significantly affect the levels of TWEAK, TNF-α, FoxO3, NF-ĸB, Atrogin1, and MurF1 in denervated animals. VC treatment also resulted in decreased levels of Atg and LAMP2A compared to individual velcade and chloroquine treatments, with no impact on Pink1. Additionally, VC intervention increased caspase-3 and Bax levels while decreasing Bcl2 levels, indicating changes in apoptotic gene expression. The current observations emphasizes that the inhibition of UPS activity boosts the expression of autophagy-promoting genes and vice versa , demonstrating the mutual reliance of these systems. For example, inhibition of autophagy or the proteasome, the protein p62 (also called SQSTM1) was found to be upregulated, which serves as an adapter protein to transfer the protein degradation burden from the affected system to the operational one. This mechanism ensures cellular protein quality control even if one of the main degradation pathways is not functioning. Overall, chloroquine mediated autophagy inhibition was observed to normalized the inflammation, oxidative stress, mitochondrial activity, protein catabolism, UPS and autophagy promoting factors and activity of calpains. Thus, autophagy inhibition was found to be more effectively modulate muscle atrophy than proteasomal inhibition, clearly demonstrated by muscle compactness, fiber cross diameter, and fiber type switching. Hence, targeting autophagy may provide a more effective therapeutic strategy for reducing muscle degradation, as opposed to solely inhibiting the 26S proteasome or using a combination approach. Conclusion Sciatic nerve resection in male Wistar rats induces significant skeletal muscle atrophy, characterized by weight loss, fiber type shift, and biochemical alterations. The latest findings highlight that suppression of UPS activity enhances the expression of autophagy-promoting genes and vice versa, indicating the interdependence of these systems mainly through p62, an adapter protein. However, in denervated muscles, chloroquine suppresses the level of pro-atrophic markers more effectively than velcade. Present study also indicate the prominent role of apoptosis in skeletal muscle atrophy after the failure of UPS and autophagy, clearly indicated by decreased body and muscle weights, histological alterations and modulation of apoptotic factors, which is quite uncommon in SkM due to fused cells. However, further studies are required to establish clear role of apoptosis in skeletal muscle atrophy. Moreover, the study revealed that inhibition of UPS led to a boost in calpain activity, whereas inhibition of autophagy increased the levels of certain apoptotic markers. This suggests a significant interdependence among the four proteolytic systems. The research results emphasize the effectiveness of autophagy inhibition in reducing muscle atrophy and preserving muscle function. However, the study suggests that simultaneous inhibition of the proteasome along with autophagy may not be advantageous and could potentially exacerbate muscle pathology. These findings demonstrate the promise of targeting autophagy pathways as a novel approach to combating skeletal muscle atrophy. Therefore, chloroquine could be repurposed for the prevention and treatment of muscle loss. Declarations Ethical Approval: Approved by the Institutional Animal Ethics Committee of Maharshi Dayanand University, Rohtak, as per their letter no. 282-93 Dated 11-12-21. Consent to Participate: NA Consent to Publish: Yes. Authors Contributions: Ajay Singh: Perform practical work and write manuscript. Rajesh Dabur: Writing- review & editing, Supervision, conceptualization. Funding: None Competing Interests: The authors declare that there is no conflict of interest. Availability of data and materials: I confirm that all data and material is included in my main manuscript file. Acknowledgments This work was supported and funded by Maharishi Dayanand University, Rohtak. References Mukund K, Subramaniam S (2020) Skeletal muscle: A review of molecular structure and function, in health and disease. Wiley Interdiscip Rev Syst Biol Med 12 Muller FL, Song W, Jang YC et al (2007) Denervation-induced skeletal muscle atrophy is associated with increased mitochondrial ROS production. Am J Physiol Regul Integr Comp Physiol 293. https://doi.org/10.1152/ajpregu.00767.2006 Singh A, Yadav A, Phogat J, Dabur R (2021) Dynamics and Interplay between Autophagy and Ubiquitin-proteasome system Coordination in Skeletal Muscle Atrophy. Curr Mol Pharmacol 15. https://doi.org/10.2174/1874467214666210806163851 Yadav A, Singh A, Phogat J et al (2021) Magnoflorine prevent the skeletal muscle atrophy via Akt/mTOR/FoxO signal pathway and increase slow-MyHC production in streptozotocin-induced diabetic rats. J Ethnopharmacol 267. https://doi.org/10.1016/j.jep.2020.113510 Yadav A, Singh A, Phogat J et al (2021) Magnoflorine prevent the skeletal muscle atrophy via Akt/mTOR/FoxO signal pathway and increase slow-MyHC production in streptozotocin-induced diabetic rats. J Ethnopharmacol 267:113510. https://doi.org/10.1016/j.jep.2020.113510 Siu PM, Alway SE (2005) Mitochondria-associated apoptotic signalling in denervated rat skeletal muscle. J Physiol. https://doi.org/10.1113/jphysiol.2004.081083 Lee J, Giordano S, Zhang J (2012) Autophagy, mitochondria and oxidative stress: Cross-talk and redox signalling. Biochem J 441:523–540 Reiniers MJ, de Haan LR, Reeskamp LF et al (2021) Analysis and optimization of conditions for the use of 2′,7′-dichlorofluorescein diacetate in cultured hepatocytes. Antioxidants 10. https://doi.org/10.3390/antiox10050674 Schipper-Krom S, Sanz AS, van Bodegraven EJ et al (2019) Visualizing Proteasome Activity and Intracellular Localization Using Fluorescent Proteins and Activity-Based Probes. Front Mol Biosci 6. https://doi.org/10.3389/fmolb.2019.00056 Wallimann T, Tokarska-Schlattner M, Schlattner U (2011) The creatine kinase system and pleiotropic effects of creatine. Amino Acids 40 Chen X, Ji Y, Liu R et al (2023) Mitochondrial dysfunction: roles in skeletal muscle atrophy. J Transl Med 21 Bodine SC, Baehr LM (2014) Skeletal muscle atrophy and the E3 ubiquitin ligases MuRF1 and MAFbx/atrogin-1. Am J Physiol Endocrinol Metab Ventre DM, Cluff A, Gagnon C et al (2021) The effects of low intensity focused ultrasonic stimulation on dorsal root ganglion neurons and Schwann cells in vitro. J Neurosci Res 99. https://doi.org/10.1002/jnr.24700 Hyatt HW, Powers SK (2020) The Role of Calpains in Skeletal Muscle Remodeling with Exercise and Inactivity-induced Atrophy. Int J Sports Med 41 Yadav A, Dabur R (2024) Skeletal muscle atrophy after sciatic nerve damage: Mechanistic insights. Eur J Pharmacol 970 Singh A, Phogat J, Yadav A, Dabur R (2021) The dependency of autophagy and ubiquitin proteasome system during skeletal muscle atrophy. Biophys Rev 13 Dávila D, Torres-Aleman I (2008) Neuronal death by oxidative stress involves activation of FOXO3 through a two-arm pathway that activates stress kinases and attenuates insulin-like growth factor I signaling. Mol Biol Cell 19. https://doi.org/10.1091/mbc.E07-08-0811 Xu S, Zhang X, Ma Y et al (2022) FOXO3a Alleviates the Inflammation and Oxidative Stress via Regulating TGF-β and HO-1 in Ankylosing Spondylitis. Front Immunol 13. https://doi.org/10.3389/fimmu.2022.935534 Nelson WB, Smuder AJ, Hudson MB et al (2012) Cross-talk between the calpain and caspase-3 proteolytic systems in the diaphragm during prolonged mechanical ventilation. Crit Care Med. https://doi.org/10.1097/CCM.0b013e318246bb5d . 40: Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5360477","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":372883176,"identity":"0462bfc6-f223-4217-b27f-8883dfa4022e","order_by":0,"name":"Ajay Singh","email":"","orcid":"","institution":"Maharshi Dayanand University","correspondingAuthor":false,"prefix":"","firstName":"Ajay","middleName":"","lastName":"Singh","suffix":""},{"id":372883177,"identity":"7dc94428-e357-409a-890a-036191a9c866","order_by":1,"name":"Rajesh Dabur","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA6UlEQVRIiWNgGAWjYHCCBAbGBmYGAwYGxgcMDAdI08JsQKwWBpgWNgmitJi3H3j48OcOa3lzidxn1Tw1d+T4GZgfPrqBR4vMmYRkY94z6YY7Z6Sb3eY59sxYsoHN2DgHjxYJhoQ0aca2w4wbbqSx3eZhO5y44QAPmzReLfwP0n/+bDtsD9JSzPOPGC0SCWkMvG1AlUAtzGAGYS0PkqV529KTd/Y8Y5ac23fYWLKZkF/4cxI//myztt3Onsb44c23w3L87M0PH+PTwsDAkwBnMvGASGa8ykGA/QCcyfiDoOpRMApGwSgYiQAACM1OF934PRgAAAAASUVORK5CYII=","orcid":"","institution":"Maharshi Dayanand University","correspondingAuthor":true,"prefix":"","firstName":"Rajesh","middleName":"","lastName":"Dabur","suffix":""}],"badges":[],"createdAt":"2024-10-30 10:08:45","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5360477/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5360477/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":68941783,"identity":"127a0124-3e80-460a-84ce-46b67a9c3913","added_by":"auto","created_at":"2024-11-13 18:09:31","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":452196,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"Figures20241113T232119.6461.png","url":"https://assets-eu.researchsquare.com/files/rs-5360477/v1/1f93713e8e7ba87382b9bf4f.png"},{"id":68941331,"identity":"743209fc-16e4-48f6-9663-9025252aa75f","added_by":"auto","created_at":"2024-11-13 18:01:31","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":159321,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"Figures20241113T232119.6462.png","url":"https://assets-eu.researchsquare.com/files/rs-5360477/v1/fa7f55ba3b881f9eb47693c6.png"},{"id":68941335,"identity":"3a2c9b40-acba-474f-92e8-acc1a471b7e4","added_by":"auto","created_at":"2024-11-13 18:01:31","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":2238143,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"Figures20241113T232119.6463.png","url":"https://assets-eu.researchsquare.com/files/rs-5360477/v1/5a85460545695b1e48441234.png"},{"id":68941339,"identity":"b09aa41a-c756-4333-8624-54a9846e2972","added_by":"auto","created_at":"2024-11-13 18:01:31","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":2024821,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"Figures20241113T232119.6464.png","url":"https://assets-eu.researchsquare.com/files/rs-5360477/v1/cc0f872154fcb5d88b3d05dc.png"},{"id":68941340,"identity":"b6a76a84-c169-46a7-91bd-660575279e29","added_by":"auto","created_at":"2024-11-13 18:01:31","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":453138,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"Figures20241113T232119.6465.png","url":"https://assets-eu.researchsquare.com/files/rs-5360477/v1/8c4f69ad05c70a02e3c41e7c.png"},{"id":68942283,"identity":"6ccaca81-816f-47d1-a9cb-951d2d4ad63b","added_by":"auto","created_at":"2024-11-13 18:17:31","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":133987,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"Figures20241113T232119.6466.png","url":"https://assets-eu.researchsquare.com/files/rs-5360477/v1/60931b4e76c328900e10cf26.png"},{"id":68941337,"identity":"8a79b71a-cab1-441d-b70e-200a02c042c7","added_by":"auto","created_at":"2024-11-13 18:01:31","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":137961,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"Figures20241113T232119.6467.png","url":"https://assets-eu.researchsquare.com/files/rs-5360477/v1/922c651e9947debeb1eeb9b3.png"},{"id":68941336,"identity":"f74736d0-3c5d-4cee-ad7f-cdc01a7a303f","added_by":"auto","created_at":"2024-11-13 18:01:31","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":137456,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"Figures20241113T232119.6468.png","url":"https://assets-eu.researchsquare.com/files/rs-5360477/v1/012b0675605568e737a33a55.png"},{"id":68941338,"identity":"6c10835f-8bd8-477e-b9fb-43cec0a3c837","added_by":"auto","created_at":"2024-11-13 18:01:31","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":352841,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"Figures20241113T232119.6469.png","url":"https://assets-eu.researchsquare.com/files/rs-5360477/v1/f6005b4acda033539e4a6195.png"},{"id":74483932,"identity":"607f783e-c164-477e-a700-ffb4273f5a4b","added_by":"auto","created_at":"2025-01-22 17:17:15","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":7202253,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5360477/v1/bcec745c-c7c8-4a71-be65-a2d37ce04b20.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Impact of Autophagy and Proteasome inhibition on denervation-induced Skeletal Muscle Atrophy","fulltext":[{"header":"Introduction","content":"\u003cp\u003eSkeletal muscle (SkM) is composed of discrete bundles of muscle fibres, each of which is wrapped by sarcolemma. Skeletal muscle atrophy (SkMA) is defined as the reduction in size of myofibers resulting from the depletion of proteins, organelles, and other cytoplasmic components. Muscle mass depletion can be observed under various conditions, including denervation or nerve damage, lack of physical exercise, fasting, exposure to microgravity, and the presence of certain diseases such as Type 2 diabetic Mellitus, cancer, AIDS, cardiac and renal failure [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. The interconnection between nerves, particularly the sciatic nerve, and SkM is crucial for the preservation of their strength and physiological functioning. Upon receiving stimulation, nerve fibres secrete acetylcholine (Ach), which induces depolarisation and repolarisation of SkM and facilitates multiple interconnected intracellular signals and biological processes. Sciatic nerve injury disrupts the transmission of information from neurones to the muscle. This is marked by a gradual decline in motor neurones and ACh at the neuromuscular junctions (NMJ). An interruption in the neuronal signal at the NMJ leads to an increase in the expression of acetylcholine receptors (AChRs) on the outer membrane of the junction. This causes the depolarisation of muscle fibres to stretch, resulting in an increased permeability of the sarcolemma. This increased permeability is achieved by opening calcium-gated channels and connexin/pannexin hemi channels. This resulted in an elevated influx of Ca\u003csup\u003e2+\u003c/sup\u003e into the sarcoplasm and the opening of the mitochondrial permeability transition pore (mPTP), causing depolarisation of the mitochondria. This not only triggers the formation of reactive oxygen species (ROS), but also initiates inflammation and protein breakdown (catabolism) in the muscles. Oxidative stress significantly hampers the activation of the PI3K/AKT signalling pathway and activates the TWEAK, FoxO and NF-κB signalling pathways. Calcium influx additionally triggers cAMP, cGMP, calcineurin signalling, mitophagy, and apoptosis. Through these molecular pathways, denervation promotes the autophagy and UPS turnover to enhance protein catabolism, in turn SkMA [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eUPS, a complex protease composed of multiple subunits, detects the ubiquitin chains attached to proteins that are short-lived, soluble, and unfolded or misfolded. These ubiquitin chains are added to the proteins by E3 ligases. Autophagy eliminates insoluble protein clumps, long-lived proteins, and defective organelles. The initial evidence of the connection between UPS and autophagy arose from the identification of ubiquitinylated protein by both systems. Currently, there are some evidences suggesting interactions between UPS and autophagy. Furthermore, specific factors such as FoxO1/3, p62, NF-kB, Smad3, ubiquitination at different positions, and mitophagy have been identified as crosslinking factors. The suppression of one system impacts the functioning of other proteolytic systems and vice versa [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. The present study aims to elucidate the interactions between the autophagy system and UPS in denervation-induced SkMA by utilizing particular inhibitors.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cp\u003e\u003cstrong\u003eChemicals\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eVelcade, Chloroquine, poly-L-lysine, Ponceau-S, DPX, TRI reagent, triton X-100, isopentane were procured from Sigma-Aldrich (St Louis, USA). Citrate buffer (pH=4.5), 0.9% saline, PBS, sucrose, formalin, chloroform, ethanol, acetonitrile, acetone, sodium orthovanadate (Na3VO4), sodium fluoride, EDTA, tris HCL, NaOH, HCl, sodium acetate buffer, phosphate buffer, sodium phosphate buffer, glycine, glacial acetic acid, H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e, potassium dichromate, dichromate acetic acid reagent, sodium carbonate, nitro blue tetrazolium(NBT), hydroxylamine hydrochloride, n-butanol, pyridine, TBA, sodium azide, TCA, eosin, hematoxylin, acid alcohol, diastase, periodic acid, Schiff\u0026rsquo;s reagent, absolute ethanol, xylene, 5,5\u0026prime;dithiobis 2\u0026prime;-nitrobenzoic acid (DTNB), tris(hydroxymethyl) aminomethane, hexadecyltrimethy ammonium bromide (HTAB), 37% formaldehyde solution were purchased from Merck, Life Sciences, Germany. Optimal cutting temperature embedding medium (OCT), RevertAid First StrandcDNA synthesis kit, RNA laterTM stabilizing solution was purchased from Thermo Scientific, USA. Maxima SYBR green/ROX qPCR master mix was purchased from Genetix Biotech Asia Pvt. Ltd. Forward and reverse primers were synthesized from Eurofins Pvt. Ltd India. Sodium dodecyl-sulfate (SDS), sodium orthovanadate, 37% paraformaldehyde, sodium azide, ponceau\u0026rsquo;S, \u0026beta;-mercaptoethanol, pyrimidine, tween-20, acrylamide, tritonX-100, poly-l-lysine, N, N, N\u0026rsquo; N\u0026rsquo;- tetramethyl ethylenediamine (TEMED), nonidet P-40, bis-acrylamide, xylene, was procured from Merck Life science Pvt. Ltd.\u0026nbsp;Isoflurane was purchased from troikaa pharmaceutical Ltd.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAnimals grouping and treatment:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAnimal experimentation was performed as per guidelines of the Committee for Control and Supervision of Experiments on Animals (CPCSEA), India, post ethical approval form Institutional Animal Ethical Committee, Maharishi Dayanand university, Rohtak, vide letter no.282-93 Dated 11-12-21. 9 weeks old healthy male Wistar rat weighing 160-200 g, were procured form Lala Lajpat Rai University of Veterinary and Animal Sciences, Hisar. Then the animals were acclimatized for 2 weeks under controlled environment with 25\u0026deg;C temperature and 12-hour light/dark circulation, at central animal house facility, Maharishi Dayanand university, Rohtak. After the acclimation period animals were randomly divided into 8 groups with 9 animals per group. Sample size was calculated via power analysis with statistical power (0.8) and P-value (P\u0026lt;0.005) using G*Power\u0026nbsp;(v. 3.1.9.4). Body weight of all animals was continuously observed during the entire study period. During the study, Group-1 (control group) animals were fed with normal water and diet without undergoing any surgery or treatment. Group-2 (denervated group) undergone sciatic nerve crush surgery followed with normal water and diet. Group-3 also undergone sciatic denervation surgery but administered with subsequent Velcade (0.15mg/kg) treatment alongside normal water and diet. Group-4 undergone sciatic denervation surgery but administered with subsequent chloroquine (50mg/kg) treatment alongside normal water and diet. Group-5 undergone sciatic denervation surgery and administered with subsequent chloroquine (50mg/kg) with velcade (0.15mg/kg) treatment alongside normal water and diet.\u003c/p\u003e\n\u003cp\u003eFor denervation, under constant flow of isoflurane (anesthesia) and oxygen, left tibialis anterior muscle was exposed and an 8-10-mm piece of sciatic nerve was cut out. After the dosing of velcade, chloroquine and their cocktail, half of the animals from each group were sacrificed at Day-3 (post-denervation), while the remaining half were sacrificed on Day-7 to harvest their skeletal muscles such as soleus, tibialis anterior, gastrocnemius, and quadriceps. After harvesting, a part of gastrocnemius muscle was embedded with optimum cutting temperature (OCT) media under freezing conditions in liquid nitrogen cooled isopentane. However, a small part of gastrocnemius muscles was stored in RNA letter solution while other muscles were undergone to direct cryopreservation and storage at -80\u0026deg;C.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAtrophy Rate and\u003c/strong\u003e \u003cstrong\u003eHistology\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe weights of freshly excised muscles were measured. The gastrocnemius muscle weight/body weight (GMW/BW) ratio was calculated to measure the atrophy rate to assess skeletal muscle atrophy. For histological study, Gastrocnemius muscle was rinsed in saline post-harvest and embedded in OCT in liquid nitrogen-cooled Isopentane. Cross-sections measuring 7\u0026micro;m were obtained using Thermo scientific cryostat (CRYOSTAR NX50). Obtained sections are processed for hematoxylin and eosin (H\u0026amp;E) staining and ATPase staining. Comparative changes in muscle sections were determined using NIS element 4.30 software (Nikon, US).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCalpain Zymography\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCaseinolytic zymography was performed to monitor calcium-activated protease in test and control samples. Crushed quadricep muscle (50mg) was pre-incubated in lysis buffer (100Mm Tris-Cl base pH-8.0, 5Mm EDTA, 10mM 2- mercaptoethanol, 0.1% Triton X-100, 5mM NaF, 1mM Na3VO4) for 15 min and homogenized for 15 min. Homogenate was incubated for 30 min at 4\u0026ordm;C and centrifuged at 12000 rpm for 20 min. The resultant supernatant was taken out for protein quantification using the Bradford reagent. Meantime casein (0.3%) was copolymerized with Polyacrylamide separating gel and a pre-run at 80V for 30 min at 4\u0026ordm;C was performed using running buffer (25mM Tris-Cl, pH-8.3, 192mM glycine, 1mM EDTA). The quantified protein sample was mixed with loading buffer (300mM Tris-Cl, pH 6.8, 40% glycerol, 0.02% bromophenol blue, and 200mM DTT) and electrophoresed at 80V for 3hr at 4\u0026ordm;C. The casein gels were rinsed with distilled water and incubated in calcium buffer (50mMTris-Cl,4mM CaCl2,10mM 2-mercaptoethanol) at room temperature for overnight. After incubation gels were stained with 1%coomassie blue for 1hr. followed by overnight distaining. Calpain bands were visualized on white light trans-illuminator and analyzed using Image J software [4].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eReverse Transcription Real Time-Polymerase Chain Reaction (RT-qPCR\u003c/strong\u003e\u003cstrong\u003e):\u0026nbsp;\u003c/strong\u003eTotal RNA was extracted from gastrocnemius muscle stored in RNA later solution using the Trizol method as described previously by Yadav \u003cem\u003eet al.,\u003c/em\u003e 2021. Isolated RNA was quantified using NanoDrop\u0026trade; 2000/2000c Spectrophotometers (ThermoScientific), and cRNA was synthesized using a cDNA Thermo scientific synthesis kit. RT-qPCR was performed on the Rotor-Gene Q amplifier (Qiagen, USA) and Maxima SYBR green/ROX qPCR master mix (Genetix Biotech Asia Pvt. Ltd.). The reaction cycle consisted of hot start at 95 \u0026deg;C for 10 min, then 40 cycles of denaturation at 95 \u0026deg;C for 15 sec, annealing at 60 \u0026deg;C for the 30s, and extension at 72 \u0026deg;C for 30s. Gene expression was analyzed using Rotor-Gene Assay Manager v2.1. Targeted genes were normalized, comparing the GAPDH expression pattern as internal control, and 2-(\u0026Delta;\u0026Delta;CT) was calculated to compare the expression of control, denervated and treated animals [5].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 1:\u0026nbsp;\u003c/strong\u003eList of forward and reverse primer sequences used in RT-qPCR.\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"652\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 5.82822%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eS. No.\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 12.1166%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eGene\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 41.5644%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eForward primer\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 40.4908%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eReverse primer\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 5.82822%;\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 12.1166%;\"\u003e\n \u003cp\u003eGAPDH\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 41.5644%;\"\u003e\n \u003cp\u003e5\u0026rsquo;-AGACAGCCGCATCTTCTTGT-3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 40.4908%;\"\u003e\n \u003cp\u003e5\u0026rsquo;-TGATGGCAACAATGTCCACT-3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 5.82822%;\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 12.1166%;\"\u003e\n \u003cp\u003eAtrogin-1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 41.5644%;\"\u003e\n \u003cp\u003e5\u0026rsquo;-GTCGCAGCCAAGAAGAGAAAGA-3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 40.4908%;\"\u003e\n \u003cp\u003e5\u0026rsquo;-TGCTATCAGCTCCAACAGCCTT-3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 5.82822%;\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 12.1166%;\"\u003e\n \u003cp\u003eMuRF-1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 41.5644%;\"\u003e\n \u003cp\u003e5\u0026rsquo;-TAACTGCATCTCCATGCTGGTG-3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 40.4908%;\"\u003e\n \u003cp\u003e5\u0026rsquo;-TGGCGTAGAGGGTGTCAAACTT-3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 5.82822%;\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 12.1166%;\"\u003e\n \u003cp\u003eTWEAK\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 41.5644%;\"\u003e\n \u003cp\u003e5\u0026rsquo;-GCTACGACCGCCAGATTGGG-3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 40.4908%;\"\u003e\n \u003cp\u003e5\u0026rsquo;-GCCAGCACACCGTTCACCAG-3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 5.82822%;\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 12.1166%;\"\u003e\n \u003cp\u003eLC3 beta\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 41.5644%;\"\u003e\n \u003cp\u003e5\u0026rsquo;- AAACGAAGAAATGGGCTGTG -3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 40.4908%;\"\u003e\n \u003cp\u003e5\u0026rsquo;- GAAGGGGCAAAGGACTGATT -3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 5.82822%;\"\u003e\n \u003cp\u003e6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 12.1166%;\"\u003e\n \u003cp\u003eATG5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 41.5644%;\"\u003e\n \u003cp\u003e5\u0026rsquo; - GATGTCCGACTTATTCGAGAGC-3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 40.4908%;\"\u003e\n \u003cp\u003e5\u0026rsquo; -TTGAGCTGTAAGCGCCTTCTA-3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 5.82822%;\"\u003e\n \u003cp\u003e7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 12.1166%;\"\u003e\n \u003cp\u003ep62\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 41.5644%;\"\u003e\n \u003cp\u003e5\u0026prime;-TGGAGTCGGATAACTGCTCAGGAG-3\u0026prime;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 40.4908%;\"\u003e\n \u003cp\u003e5\u0026prime;-AGACTGGAGTTCACCTGTGGATGG-3\u0026prime;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 5.82822%;\"\u003e\n \u003cp\u003e\u0026nbsp;8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 12.1166%;\"\u003e\n \u003cp\u003eNF-kB p65\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 41.5644%;\"\u003e\n \u003cp\u003e5\u0026prime; ACGATCTGTTTCCCCTCATCT 3\u0026prime;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 40.4908%;\"\u003e\n \u003cp\u003e5\u0026prime; TGCTTCTCTCCCCAGGAATA 3\u0026prime;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 5.82822%;\"\u003e\n \u003cp\u003e\u0026nbsp;9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 12.1166%;\"\u003e\n \u003cp\u003eTNFa\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 41.5644%;\"\u003e\n \u003cp\u003e5-\u0026lsquo;GGTGGACCGCAACAACGCAATCTA-3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 40.4908%;\"\u003e\n \u003cp\u003e5\u0026rsquo;-GGGTGGCCATGAGGAGCAGGAA-3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 5.82822%;\"\u003e\n \u003cp\u003e\u0026nbsp;10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 12.1166%;\"\u003e\n \u003cp\u003eSmad 3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 41.5644%;\"\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; 5\u0026prime;-AGCACACAATAACTTGGACC-3\u0026prime;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 40.4908%;\"\u003e\n \u003cp\u003e5\u0026prime;-TAAGACACACTGGAACAGCGGATG-3\u0026prime;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 5.82822%;\"\u003e\n \u003cp\u003e\u0026nbsp;11\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 12.1166%;\"\u003e\n \u003cp\u003eSmad 4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 41.5644%;\"\u003e\n \u003cp\u003e5\u0026rsquo;-CCACCAACTTCCCCAACATT-3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 40.4908%;\"\u003e\n \u003cp\u003e5\u0026rsquo;-TGCAGTCCTACTTCCAGTCCAG-3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 5.82822%;\"\u003e\n \u003cp\u003e\u0026nbsp;12\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 12.1166%;\"\u003e\n \u003cp\u003eFoxo3a\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 41.5644%;\"\u003e\n \u003cp\u003e5\u0026rsquo;-CGGCTCACTTTGTCCCAGAT-3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 40.4908%;\"\u003e\n \u003cp\u003e5\u0026rsquo;-TCTTGCCAGTCCCTTCGTTC-3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 5.82822%;\"\u003e\n \u003cp\u003e\u0026nbsp;13\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 12.1166%;\"\u003e\n \u003cp\u003ep53\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 41.5644%;\"\u003e\n \u003cp\u003e5\u0026rsquo;-TCAAGCCTTCCAACCTC-3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 40.4908%;\"\u003e\n \u003cp\u003e5\u0026rsquo;-GCAGCCCACAGACCAAA-3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 5.82822%;\"\u003e\n \u003cp\u003e\u0026nbsp;14\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 12.1166%;\"\u003e\n \u003cp\u003ePINK1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 41.5644%;\"\u003e\n \u003cp\u003e5\u0026prime;-TACCGCTTCTTCCGCCAGTCG-3\u0026prime;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 40.4908%;\"\u003e\n \u003cp\u003e5\u0026rsquo;-GCTCTCCGCCTGCTTCTCCTC-3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 5.82822%;\"\u003e\n \u003cp\u003e15\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 12.1166%;\"\u003e\n \u003cp\u003eCaspase3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 41.5644%;\"\u003e\n \u003cp\u003e5\u0026rsquo;-AGCTGATTTGACCATTTGCCTGAA-3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 40.4908%;\"\u003e\n \u003cp\u003e5\u0026rsquo;-CCGGGACGCGAAGTGCTATTGGTAC-3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 5.82822%;\"\u003e\n \u003cp\u003e16\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 12.1166%;\"\u003e\n \u003cp\u003eBax\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 41.5644%;\"\u003e\n \u003cp\u003e5\u0026rsquo;- TCAAGCCTTCCAACCTC -3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 40.4908%;\"\u003e\n \u003cp\u003e5\u0026rsquo;- GCAGCCCACAGACCAAA -3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 5.82822%;\"\u003e\n \u003cp\u003e\u0026nbsp;17\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 12.1166%;\"\u003e\n \u003cp\u003eBcl2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 41.5644%;\"\u003e\n \u003cp\u003e5\u0026rsquo;-CCGGGACGCGAAGTGCTATTGGTAC-3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 40.4908%;\"\u003e\n \u003cp\u003e5\u0026rsquo;-AGCTGATTTGACCATTTGCCTGAA-3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 5.82822%;\"\u003e\n \u003cp\u003e\u0026nbsp;18\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 12.1166%;\"\u003e\n \u003cp\u003emTOR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 41.5644%;\"\u003e\n \u003cp\u003e5\u0026rsquo;-GGCCACCGTGTGTGTAAGAA-3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 40.4908%;\"\u003e\n \u003cp\u003e5\u0026rsquo;-GACCCTGCACTGAGATCCTG-3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 5.82822%;\"\u003e\n \u003cp\u003e\u0026nbsp;19\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 12.1166%;\"\u003e\n \u003cp\u003eAkt\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 41.5644%;\"\u003e\n \u003cp\u003e5\u0026rsquo;-TCACCTCTGAGACCGACACC-3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 40.4908%;\"\u003e\n \u003cp\u003e5\u0026rsquo;-ACTGGCTGAGTAGGAGAACTGG-3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;Immunoblotting\u003c/strong\u003e\u003cstrong\u003e:\u0026nbsp;\u003c/strong\u003eThe 50 mg quadricep muscle was homogenized in 500ul lysis buffer composed of Tris-HCl (50 mM), NaCl (200 mM), NP-40 (0.3%), Na3VO4 (1.0 mM), NaF (50 mM) and protease inhibitors cocktail. The lysate was centrifuged for 15 min at 12,000 g, and the supernatant was collected. The total protein was quantified using Bradford assay. Approx 8-15 \u0026micro;g of quantified protein from each sample was mixed with loading buffer (5X) containing 1.0 M tris HCL, 0.02 % bromophenol blue, 5 % \u0026beta;-mercaptoethanol, 30 % glycerol, and 10 % SDS separately. Samples were boiled for 5 minutes, loaded and separated on precast stacking gel (6%) and resolving gel of different percentages like 10 %, and 12 % depending upon the molecular weight of the targeted protein. Separated proteins were transferred into 0.22 \u0026micro;m nitrocellulose membrane by providing the constant current supply of 400 mA for a period of 1.5 h. Transferred blots were stained with Ponceau-S dye solution (0.25g of Ponceau S in 0.5 ml of acetic acid and 50 ml of distilled water) to confirm the equal transfer of separated protein and then washed with TBST for 5 minutes. Overnight block the blots in a 5% blocking buffer (5% BSA dissolved in TBST). After blocking, blots were washed thrice for 5\u0026nbsp;minutes\u0026nbsp;with TBST, followed by a 3-hour incubation of primary antibodies, including anti-MuRF-1, anti-Atrogin-1, anti-LAMP2A, anti-Bax, anti-MyHC, anti-Akt\u003csup\u003eser473\u003c/sup\u003e, anti-Bcl2, and anti-actin. Afterward, wash the blot thrice for 5-5\u0026nbsp;minutes\u0026nbsp;with TBST to remove the unbound primary antibody, and incubate the blots in the secondary antibody for 60\u0026nbsp;minutes. After secondary antibody incubation, blots were again washed 5 times for 5-5 minutes with TBST to eliminate unbound secondary antibodies. Supersignal\u003csup\u003eTM\u003c/sup\u003e West Pico Plus Chemiluminescent substrate was used to visualize the bands using the chemiluminescent MPP system (Biorad Pvt. Ltd.) and band intensity was analyzed using ImageJ software [5].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eBiochemical assays\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ei. Preparation of tissue homogenate and enzyme assays:\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSufficient volume of Gastrocnemius muscle sample (10%w/v) from each group was lysed in buffer [(50mM Tris-Cl, 200 mM NaCl, 0.3% NP-40 and 1mM DTT, pH 8.0), 50 mM NaF, 1mM Na orthovanadate, 50 \u0026micro;l benzamidine and 10 \u0026micro;l protease inhibitor cocktail] for 10 min at 4\u0026deg;C, followed by centrifugation at 12,000 rpm at 4\u0026ordm;C for 10 min. post-centrifugation the supernatant was collected and total protein estimation was done with Bradford standard curve equation. The supernatant was used in below mention assays.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eii. \u0026nbsp;Mitochondrial Complex 1 activity assay:\u0026nbsp;\u003c/strong\u003e Briefly, the assay system was developed in 0.2M Glycyl glycine buffer (pH 8.5), 6 mM NADH in 2mM Glycyl glycine buffer, 10.5mM cytochrome C, 0.02M sodium bicarbonate. After mixing of 0.35ml of 0.2M Glycyl glycine buffer (pH 8.5) in 0.1ml of 10.5mM cytochrome C, 0.1ml of 6 mM NADH and 2.4 ml of H\u003csub\u003e2\u003c/sub\u003eO, 10ul of protein homogenate was added along with 20ul of 0.02M sodium bicarbonate. The enzyme activity was measured spectrophotometrically at 550 nm\u0026nbsp;[6].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eiii. Mitochondrial Complex 4 activity assay:\u0026nbsp;\u003c/strong\u003eBriefly, following the addition of 0.7 ml of 75mM sodium phosphate buffer (pH 7.8) in 0.1ml of 0.3 mM of reduced cytochrome C (reduced with the help of few pellets of sodium borohydride, pH 7), 10ul of protein homogenate was added. The enzyme activity was measured spectrophotometrically at 550 nm\u0026nbsp;[7].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eiv. Total ROS assay:\u0026nbsp;\u003c/strong\u003e2,7-Dichlorofluorescin (DCFH) was used as a fluorescent probe to measure the rate of oxidant production in the various fresh tissue homogenates. Briefly, the assay buffer contained 130 mmol/L KCl, 5 mmol/L MgCl2, 20 mmol/L NaH2PO4, 20 mmol/L Tris-HCl and 30 mmol/L glucose (pH 7.4), with a total volume of 1mL. The assay was initiated with the addition of 100 uM DCFH-diacetate (DCFH-DA) dissolved in methanol and add 100 uL of tissue homogenate, and the mixture was incubated at 37\u0026deg;C for 30 min. This allowed DCFH-DA to be cleaved by intracellular esterase to derive free DCFH. The rate of oxidation from DCFH to 2,7- dichlorofluorescein (DCF), which is indicative of oxidant production, was followed at an excitation wavelength of 488 nm and emission wavelength of 525 nm for 30 min using a Horiba Fluorolog \u003csup\u003eTM\u003c/sup\u003e fluorescent spectrometer [8].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ev. \u0026nbsp;Creatine kinase (CK) activity assay:\u003c/strong\u003e The activity of CK was measured using a commercial kit and as per instructions from the manufacturer. The detection kit accompanied R1 reagent (Lot: S101905) and R2 reagent (Lot: S101905; ERBA Transasia Bio-medical LTD.) was added to the tissue homogenate/serum and CK was quantified with help of standard curves.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003evi. Proteasome activity assay:\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHomogenize the skeletal muscles (~50 mg) in a lysis buffer containing 50 mM Tris-HCl (pH 7.5), 5 mM EDTA, 1 mM DTT, and 0.5% NP-40. Centrifuge the homogenate at 14,000 g for 10 minutes at 4\u0026deg;C to obtain the supernatant, which contains the proteasome enzyme. Determine the protein concentration using a BCA assay. For the assay, incubate equal amounts of protein (20-50 \u0026mu;g) with a fluorogenic peptide substrate such as Suc-LLVY-AMC (50 \u0026mu;M final concentration) in assay buffer (50 mM Tris-HCl, pH 7.5, 5 mM EDTA, 0.5 mM DTT) at 37\u0026deg;C. The release of fluorescent AMC (7-amino-4-methylcoumarin) is measured using a fluorescence plate reader with an excitation wavelength of 380 nm and emission at 460 nm. The proteasome activity is expressed as the increase in fluorescence over time and can be normalized to the protein content [9].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical Analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eResults were statistically signified through one-way/two analysis of variance (ANOVA) applied in GraphPad Prism version 7.04 and the significance considered at p-value\u0026le;0.05. Power analysis clarifies that the total sample of 65 Wister rats were provided 80% power i.e., \u0026alpha;= 0.05 and \u0026beta;=0.20 for determination of significant difference among the treatments.\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eAnalysis of Body Weight and Muscle Weight\u003c/h2\u003e \u003cp\u003eNerve injury or denervation typically results in significant muscle atrophy and subsequent loss of body weight. The loss of neural input to muscles leads to decreased muscle mass and strength, which in turn affects overall body composition. In experimental models, such as denervated rats, this muscle wasting is evident through reductions in both muscle weight and overall body weight.\u003c/p\u003e \u003cp\u003e \u003cstrong\u003eChange in body weight\u003c/strong\u003e \u003cp\u003eFollowing sciatic resection, a decrease in body weight of the denervated rats resulted in a weight of 166\u0026thinsp;\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003e\u0026plusmn;\u003c/span\u003e\u0026thinsp;2.6 g on 3rd day, which was statistically significant. The weight on the 7th day was 144.8\u0026thinsp;\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003e\u0026plusmn;\u003c/span\u003e\u0026thinsp;2.21 g, in contrast to the healthy control group, which weighed 204\u0026thinsp;\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003e\u0026plusmn;\u003c/span\u003e\u0026thinsp;10.73g. The intervention of velcade in denervated animals resulted in a somewhat increased body weight, which reached 168.8\u0026thinsp;\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003e\u0026plusmn;\u003c/span\u003e\u0026thinsp;7.3g on the third day, as depicted in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA. Additionally, a significant elevation in body weight was observed on the seventh day of the intervention, with a value of 175\u0026thinsp;\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003e\u0026plusmn;\u003c/span\u003e\u0026thinsp;8.6g. Supplementation of chloroquine in denervated animals significantly increased the body weight of denervated animals, with a recorded weight of 194\u0026thinsp;\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003e\u0026plusmn;\u003c/span\u003e\u0026thinsp;10.6g on day 3 and 197\u0026thinsp;\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003e\u0026plusmn;\u003c/span\u003e\u0026thinsp;1.63g on day 7. On days 3 and 7, a cocktail of velcade and chloroquine supplementation somewhat increased the body weight by 168\u0026thinsp;\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003e\u0026plusmn;\u003c/span\u003e\u0026thinsp;8.71g and 151.8\u0026thinsp;\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003e\u0026plusmn;\u003c/span\u003e\u0026thinsp;3.9g, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA\u003cb\u003e)\u003c/b\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003eChanges in individual muscle weights\u003c/strong\u003e \u003cp\u003eIn denervated animals, the average weight of gastrocnemius was significantly decreased to 0.298\u0026thinsp;\u0026plusmn;\u0026thinsp;0.005 g and 0.259\u0026thinsp;\u0026plusmn;\u0026thinsp;0.015g on day 3 and 7 post-denervation, respectively, compared to the sham control 0.378\u0026thinsp;\u0026plusmn;\u0026thinsp;0.015g. The present study observed that only chloroquine administration significantly increased the weight of gastrocnemius to 0.380\u0026thinsp;\u0026plusmn;\u0026thinsp;0.008g on day 3 of denervation. On day 7, velcade and chloroquine both significantly increased their weight to 0.330\u0026thinsp;\u0026plusmn;\u0026thinsp;0.035g and 0.340\u0026thinsp;\u0026plusmn;\u0026thinsp;0.007g, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC\u003cb\u003e)\u003c/b\u003e. Moreover, the average weight of the soleus muscle significantly decreased to 0.085\u0026thinsp;\u0026plusmn;\u0026thinsp;0.005 g and 0.082\u0026thinsp;\u0026plusmn;\u0026thinsp;0.001 g on days 3 and 7 post-denervation, respectively, compared to the sham control, which was 0.111\u0026thinsp;\u0026plusmn;\u0026thinsp;0.007 g. No treatment notably increased the soleus weight on day 3 post-denervation. However, by day 7, treatments with velcade and chloroquine significantly increased the muscle weight to 0.096\u0026thinsp;\u0026plusmn;\u0026thinsp;0.006 g and 0.107\u0026thinsp;\u0026plusmn;\u0026thinsp;0.005g, respectively \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD\u003cb\u003e)\u003c/b\u003e.\u003c/p\u003e \u003c/p\u003e \u003cp\u003eThe tibialis anterior (TA) muscle weight was decreased to 0.082\u0026thinsp;\u0026plusmn;\u0026thinsp;0.008 g and 0.075\u0026thinsp;\u0026plusmn;\u0026thinsp;0.007 g on days 3 and 7 post-denervation, respectively, compared to the healthy weight of 0.096\u0026thinsp;\u0026plusmn;\u0026thinsp;0.008 g. No treatments significantly increased TA weight on day 3. However, by day 7, velcade and chloroquine treatments significantly increased TA weight to 0.091\u0026thinsp;\u0026plusmn;\u0026thinsp;0.005 g and 0.090\u0026thinsp;\u0026plusmn;\u0026thinsp;0.002 g, respectively \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE\u003cb\u003e)\u003c/b\u003e. Additionally, the average weight of the quadriceps decreased to 1.33\u0026thinsp;\u0026plusmn;\u0026thinsp;0.057g and 1.22\u0026thinsp;\u0026plusmn;\u0026thinsp;0.065g on days 3 and 7 of denervation, respectively, compared to the control rats, which had an average weight of 1.82\u0026thinsp;\u0026plusmn;\u0026thinsp;0.16g. This study found that administering chloroquine significantly increased the quadriceps weight to 1.7\u0026thinsp;\u0026plusmn;\u0026thinsp;0.09g on day 3 post-denervation. By day 7, both velcade and chloroquine significantly increased the quadriceps weight to 1.55\u0026thinsp;\u0026plusmn;\u0026thinsp;0.19g and 1.62\u0026thinsp;\u0026plusmn;\u0026thinsp;0.154g, respectively \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eF\u003cb\u003e)\u003c/b\u003e.\u003c/p\u003e \u003cp\u003e \u003cstrong\u003eAtrophy rate\u003c/strong\u003e \u003cp\u003eThe rate and extent of atrophy can vary depending on the severity of denervation. Denervation significantly contributes to reduced muscle quality and quantity to promote atrophy rate. In the present study, on days 3 and 7 post-denervation, the rate of atrophy was increased, to 2.14\u0026thinsp;\u0026plusmn;\u0026thinsp;0.2 and 2.42\u0026thinsp;\u0026plusmn;\u0026thinsp;0.09, respectively, compared to the control group (1.7\u0026thinsp;\u0026plusmn;\u0026thinsp;0.07). On day 3 of intervention, velcade and chloroquine and their cocktail significantly reduced the rate of atrophy \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB\u003cb\u003e)\u003c/b\u003e. The reduction in atrophy rate was 1.83\u0026thinsp;\u0026plusmn;\u0026thinsp;0.13, 1.77\u0026thinsp;\u0026plusmn;\u0026thinsp;0.09, and 1.82\u0026thinsp;\u0026plusmn;\u0026thinsp;0.19 for velcade, chloroquine and cocktail-supplemented groups, respectively. On day 7 after denervation, these interventions significantly reduced the atrophy rate, to 1.72\u0026thinsp;\u0026plusmn;\u0026thinsp;0.12, 1.78\u0026thinsp;\u0026plusmn;\u0026thinsp;0.14, and 2.32\u0026thinsp;\u0026plusmn;\u0026thinsp;0.19, respectively.\u003c/p\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eAnalysis of Biochemical Markers in skeletal muscle\u003c/h2\u003e \u003cp\u003e \u003cstrong\u003eCreatine kinase activity\u003c/strong\u003e \u003cp\u003eSciatic injury initiates creatine kinase leakage from the muscular tissue. This process, in turn, leads to a deficiency in the high-energy product phosphocreatine and an altered metabolic state in the muscle's energy system [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. In animals that underwent sciatic nerve resection, phosphocreatine levels were reduced, attributable to a decrease in creatine kinase activity measured as 1.34\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02 U/L and 2\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02 U/L on day 3 and day 7, respectively, compared to healthy rats as 2.8\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01. On day 3, the intervention of chloroquine yielded a significant improvement in membrane integrity, consequently resulting in the cessation of creatine kinase leakage, hence leading to a marked increase in creatine kinase activity to 1.74\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03 U/L. Likewise, on day 7, the intervention of chloroquine yielded a significant increase in creatine kinase activity to 2.74\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05 U/L. However, other treatments failed to normalize CK levels in denervation \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA\u003cb\u003e)\u003c/b\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003eOxidative stress in various groups\u003c/strong\u003e \u003cp\u003eAs discussed earlier, nerve injury ultimately promotes oxidative stress in skeletal muscles via increasing Ca\u003csup\u003e2+\u003c/sup\u003e levels in the myoplasm and the mitochondrial matrix. ROS levels in muscle tissue were assessed to evaluate the antioxidant efficacy of velcade, chloroquine, and their combination in denervated rat muscles. Denervated muscles exhibited significantly elevated ROS levels on days 3 and 7 compared to sham controls. Administration of the cocktail further increased ROS levels, while velcade and chloroquine reduced ROS levels \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB\u003cb\u003e)\u003c/b\u003e.\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003eMitochondrial complexes\u003c/strong\u003e \u003cp\u003eIn denervation, prolonged accumulation of ROS in skeletal muscle leads to mitochondrial dysfunction. These conditions lead to reduced activity and efficiency of the electron transport chain complexes (I-V), resulting in decreased ATP production and again increased ROS generation [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. In rats with denervation-induced neuropathy, there was a notable reduction in the activity of mitochondrial respiratory chain complex I on days 3 and 7, with values decreasing to 5.6\u0026thinsp;\u0026plusmn;\u0026thinsp;1.1 and 3.7\u0026thinsp;\u0026plusmn;\u0026thinsp;0.7 nmol/min/mg protein, respectively, compared to healthy control rats (9.26\u0026thinsp;\u0026plusmn;\u0026thinsp;1 nmol/min/mg protein). Administration of velcade and cocktail significantly preserved complex I activity on day 3 to 5.6\u0026thinsp;\u0026plusmn;\u0026thinsp;0.4 and 5.22\u0026thinsp;\u0026plusmn;\u0026thinsp;1.1 nmol/min/mg protein, respectively. Chloroquine alone significantly preserved complex I activity to 9.1\u0026thinsp;\u0026plusmn;\u0026thinsp;0.7 and 8.5\u0026thinsp;\u0026plusmn;\u0026thinsp;0.2 nmol/min/mg protein on day 3 and 7, respectively \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC\u003cb\u003e)\u003c/b\u003e.\u003c/p\u003e \u003c/p\u003e \u003cp\u003eRegarding mitochondrial complex IV, denervated rats showed reduced activity on days 3 and 7, with values dropping to 34.8\u0026thinsp;\u0026plusmn;\u0026thinsp;1.8 and 22.6\u0026thinsp;\u0026plusmn;\u0026thinsp;1.3 nmol/min/mg protein, respectively, compared to healthy rats (49.9\u0026thinsp;\u0026plusmn;\u0026thinsp;2.18 nmol/min/mg protein). Only chloroquine administration significantly preserved complex IV activity on day 3 to 52.9\u0026thinsp;\u0026plusmn;\u0026thinsp;3.9 nmol/min/mg protein. On day 7, chloroquine alone preserved complex IV activity significantly to 48.6\u0026thinsp;\u0026plusmn;\u0026thinsp;0.4 nmol/min/mg protein \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD\u003cb\u003e)\u003c/b\u003e.\u003c/p\u003e \u003cp\u003e \u003cstrong\u003e26S Proteasome activity\u003c/strong\u003e \u003cp\u003eIncreased activity of E3 ubiquitin ligases like MuRF1 and MAFbx/atrogin-1 enhances protein ubiquitination, providing more substrates for the 26S proteasome. This accelerated breakdown of muscle proteins significantly contributes to the loss of muscle mass and function. Understanding proteasomal activity in SkMA is crucial for developing targeted therapies against atrophy [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. In the present study, there was a notable elevation in proteasomal activity, reaching 2613.8\u0026thinsp;\u0026plusmn;\u0026thinsp;321 RFU on day 3 and 2898\u0026thinsp;\u0026plusmn;\u0026thinsp;215 RFU on day 7, compared to healthy rats at 1572\u0026thinsp;\u0026plusmn;\u0026thinsp;122 RFU. Treatment with velcade, chloroquine, and their combination significantly reduced proteasomal activity on day 3 to 856.8\u0026thinsp;\u0026plusmn;\u0026thinsp;189 RFU, 2197.9\u0026thinsp;\u0026plusmn;\u0026thinsp;199 RFU, and 1256.8\u0026thinsp;\u0026plusmn;\u0026thinsp;85 RFU respectively. By day 7, velcade alone significantly decreased proteasome activity to 711.3\u0026thinsp;\u0026plusmn;\u0026thinsp;256 RFU, but none of the treatments normalized its levels by day 7 \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE\u003cb\u003e)\u003c/b\u003e.\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003eHistological changes in atrophic and treated groups\u003c/strong\u003e \u003cp\u003eSciatic nerve injury can lead to fragmentation, degeneration, fiber switching, and degradation of myo-proteins [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. To study the effects of treatments on atrophy-mediated muscle fiber changes, sections of the gastrocnemius muscle were stained using different staining procedures. In denervated groups, Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e shows that after 3 and 7 days of denervation, the splitting of muscle fibers, narcosis, and vacuolization occurred to promote muscle fiber degeneration compared to sham control. While chloroquine intervened groups exhibited reduced intercellular space and fragmentation, improving fiber regeneration on day 3. At day 7 of denervation, both Velcade and chloroquine treatments were found to be effective, but not the cocktail treatment. Additionally, area of gastrocnemius muscle cells was significantly reduced on day 3 and 7, post denervation. Only chloroquine intervention tried to prevent that reduction in area of denervated cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/p\u003e \u003cp\u003eGastrocnemius muscles are more likely to switch from fast fibers (type IIa/b) to slow (type I) in skeletal muscle atrophy. The current study investigated the change in fiber types based on myofibril ATPase activity. The gastrocnemius muscle of the denervation group showed more (60%) dark fibers (type I) compared to the sham control (26%). Among the treatments, chloroquine (particularly at day 7) resulted in decreased dark-type fibers to 42% and increased light myofibers (type IIa/b) compared to the denervated \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e. Treatment with chloroquine, as compared to velcade, maintained or increases muscle weight regards of fiber type composition of skeletal muscles on day 7.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eCalpains Zymography:\u003c/h2\u003e \u003cp\u003eCalpains are calcium-dependent cysteine proteases that play a vital role in skeletal muscle remodelling. Sciatic nerve injury permanently disrupts calcium homeostasis, leading to an increase in the cytoplasmic calcium level in the muscle, which activates calpains. Once activated, these proteases cleave myofibril proteins such as desmin, troponin, titin, and vimentin, thereby leading to UPS degradation [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Therefore, in the present study, we investigated the activity of calpain isoforms in SkMA.\u003c/p\u003e \u003cp\u003eOn day 3, in denervated rats \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e, the activity of calpain 3, \u0026micro;-calpain and m-calpain was ~\u0026thinsp;4 times, 13 times and 8 times, respectively, more than activity in healthy muscles. Velcade, chloroquine, and their cocktail were found effective in suppressing the enhanced activity of calpains in denervated muscles. Velcade intervention suppressed the activity of only m-calpain 1.6 times, compared to denervated rats. Chloroquine treatment suppressed the activity of calpain 3, \u0026micro;-calpain, and m-calpain to ~\u0026thinsp;0.8 times, 0.6 times, and 0.75 times, respectively, than denervated animals. Cocktail treatment suppressed the activity to ~\u0026thinsp;0.68 times, 0.56 times, and 0.62 times, respectively, then denervated rats.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eOn day 7, the activity of calpain 3, \u0026micro;-calpain, and m-calpain was ~\u0026thinsp;2 times, 3.6 times, and 1.4 times, respectively, more than activity in healthy muscles. The intervention of chloroquine and cocktail reduced the activity of m-Calpain in denervated muscles significantly, whereas velcade did not \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eImpact of interventions on Akt signalling and inflammatory genes:\u003c/h2\u003e \u003cp\u003eDenervation impacts protein anabolism and mitochondrial function in skeletal muscle. Both conditions lead to reduced protein synthesis and increased protein breakdown, disrupting the balance of muscle protein homeostasis. Denervation interrupts neuromuscular signalling, causing increased calcium influx and oxidative stress, which activates proteolytic pathways. Denervation mediated activation of Forkhead box O (FoxO) transcription factors upregulate the expression of atrophy-related genes and promote muscle protein degradation. This process is further exacerbated by inflammation, as denervation induces the production of pro-inflammatory cytokines that contribute to muscle wasting [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn the present study, total RNA was isolated from gastrocnemius muscles, quantified, reverse transcribed to cDNA, and finally analyzed using qPCR. At days 3 and 7 post-denervation, the levels of Akt gene expression were upregulated to 1.74\u0026thinsp;\u0026plusmn;\u0026thinsp;0.3-fold and 1.9\u0026thinsp;\u0026plusmn;\u0026thinsp;0.2-fold, respectively. However, on day 3 and 7, administration of a cocktail intervention in denervated animals significantly upregulated Akt expression to 2.3\u0026thinsp;\u0026plusmn;\u0026thinsp;0.1-fold and 2.42\u0026thinsp;\u0026plusmn;\u0026thinsp;0.1-fold, respectively. By day 3, upregulation of Akt to 2.03\u0026thinsp;\u0026plusmn;\u0026thinsp;0.27-fold was observed exclusively in the velcade-treated group, however, chloroquine treatment tried to normalise the conditions \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e\u003cb\u003e).\u003c/b\u003e Moreover, there was a significant upregulation in the expression of the mTOR gene by approximately 2.12\u0026thinsp;\u0026plusmn;\u0026thinsp;0.2 and 1.7\u0026thinsp;\u0026plusmn;\u0026thinsp;0.17 folds, respectively, at day 3 and day 7 following denervation. Treatment with velcade, chloroquine, and a combination of both significantly increased mTOR levels on day 3 to 2.8\u0026thinsp;\u0026plusmn;\u0026thinsp;0.15, 2.78\u0026thinsp;\u0026plusmn;\u0026thinsp;0.2, and 3.1\u0026thinsp;\u0026plusmn;\u0026thinsp;0.3 folds, respectively. On day 7, velcade, chloroquine and their combinational treatment showed significant upregulation of mTOR to 2.3\u0026thinsp;\u0026plusmn;\u0026thinsp;0.25, 2.71\u0026thinsp;\u0026plusmn;\u0026thinsp;0.3 and 3.4\u0026thinsp;\u0026plusmn;\u0026thinsp;0.4 folds, respectively. On day 3 and day 7 post-denervation, the expression of the FoxO3 gene was significantly increased by 3.14\u0026thinsp;\u0026plusmn;\u0026thinsp;0.5 folds and 4.8\u0026thinsp;\u0026plusmn;\u0026thinsp;0.5 folds, respectively. By day 7, FoxO3 levels were significantly downregulated in the velcade and chloroquine-treated groups to 3.6\u0026thinsp;\u0026plusmn;\u0026thinsp;0.7 folds and 1.60\u0026thinsp;\u0026plusmn;\u0026thinsp;0.5 folds, respectively \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eRegarding the Tweak gene, its expression increased by 3\u0026thinsp;\u0026plusmn;\u0026thinsp;0.6 folds and 2.4\u0026thinsp;\u0026plusmn;\u0026thinsp;0.13 folds on days 3 and 7 post-denervation, respectively, compared to healthy rats. Chloroquine and cocktail interventions on day 3 downregulated Tweak expression to 1.5\u0026thinsp;\u0026plusmn;\u0026thinsp;0.5 folds and 1.24\u0026thinsp;\u0026plusmn;\u0026thinsp;0.4 folds, respectively, compared to denervated animals. On day 7, only chloroquine intervention downregulated Tweak to 1.11\u0026thinsp;\u0026plusmn;\u0026thinsp;0.3 folds \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e. On the third- and seventh days following denervation, TNFα gene expression increased significantly by 2.56\u0026thinsp;\u0026plusmn;\u0026thinsp;1.1 and 2.09\u0026thinsp;\u0026plusmn;\u0026thinsp;0.9 folds, respectively, compared to healthy control rats. Treatment with chloroquine and a combination of interventions (cocktail) further elevated TNFα levels on day 3 to 5.45\u0026thinsp;\u0026plusmn;\u0026thinsp;0.7 and 10.55\u0026thinsp;\u0026plusmn;\u0026thinsp;1.09 folds, respectively, compared to denervated animals. By day 7, all interventions led to a further increase in TNFα expression in denervated rats \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e.\u003c/p\u003e \u003cp\u003eOn day-3 and day-7 post-denervation, the expression levels of the NFkB gene were significantly increased by approximately 2.3\u0026thinsp;\u0026plusmn;\u0026thinsp;0.1 and 1.58\u0026thinsp;\u0026plusmn;\u0026thinsp;0.08 folds, respectively, compared to control rats. Treatment with velcade, chloroquine, and a combination of both on day 3 resulted in a downregulation of NFkB expression to 1.57\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04, 2.06\u0026thinsp;\u0026plusmn;\u0026thinsp;0.29, and 0.55\u0026thinsp;\u0026plusmn;\u0026thinsp;0.09 folds, respectively, compared to denervated animals. By day 7, only chloroquine treatment led to a decrease in NFkB expression to 1.13\u0026thinsp;\u0026plusmn;\u0026thinsp;0.08 folds \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e4.9.5 Expression of catabolism-promoting genes:\u003c/h2\u003e \u003cp\u003eThree days and seven days after denervation, Smad3 gene expression levels were notably increased by 2.3\u0026thinsp;\u0026plusmn;\u0026thinsp;0.4 folds and 4.8\u0026thinsp;\u0026plusmn;\u0026thinsp;0.37 folds, respectively, compared to controls. No treatment exhibited significant downregulation of Smad3 on day 3 post-denervation. However, on day 7, treatment with velcade, chloroquine, and the cocktail led to reductions in Smad3 expression to 6.8\u0026thinsp;\u0026plusmn;\u0026thinsp;0.8 folds, 1.82\u0026thinsp;\u0026plusmn;\u0026thinsp;0.35 folds, and 2.8\u0026thinsp;\u0026plusmn;\u0026thinsp;0.46 folds, respectively, compared to denervated animals (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e). On the third- and seventh-days following denervation, there was a significant increase in Smad4 gene expression by 2.08\u0026thinsp;\u0026plusmn;\u0026thinsp;0.4 and 4.9\u0026thinsp;\u0026plusmn;\u0026thinsp;0.3 folds, respectively, compared to control rats. No treatment on day 3 showed significant downregulation of Smad4. However, by day 7, treatment with velcade, chloroquine, and a combination treatment significantly reduced Smad4 levels to 3.2\u0026thinsp;\u0026plusmn;\u0026thinsp;0.5 folds, 1.18\u0026thinsp;\u0026plusmn;\u0026thinsp;0.35 folds, and 2.7\u0026thinsp;\u0026plusmn;\u0026thinsp;0.4 folds, respectively \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e\u003cb\u003e).\u003c/b\u003e\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eGiven the roles of the UPS in SkMA, we investigated the effects of various treatments on these proteolytic systems. Specifically, we analyzed the expression of UPS-promoting E3 ligases such as Atrogin1 and MuRF1 in denervated and diabetic rat muscles. This comprehensive gene expression analysis aimed to elucidate the molecular mechanisms by which these pharmacological interventions impact UPS-mediated SkMA. The expression levels of the Atrogin1 gene were found to be significantly upregulated following denervation, reaching 3.05\u0026thinsp;\u0026plusmn;\u0026thinsp;0.64-fold on day 3 and 2.62\u0026thinsp;\u0026plusmn;\u0026thinsp;0.14-fold on day 7. Upon intervention with velcade, chloroquine, and their combination in denervated animals, Atrogin1 expression on day 3 was further elevated to 4.3\u0026thinsp;\u0026plusmn;\u0026thinsp;0.36-fold, 4.19\u0026thinsp;\u0026plusmn;\u0026thinsp;0.09-fold, and 3.62\u0026thinsp;\u0026plusmn;\u0026thinsp;0.33-fold, respectively. By day 7, these interventions resulted in Atrogin1 levels of 1.72\u0026thinsp;\u0026plusmn;\u0026thinsp;0.35-fold, 1.6\u0026thinsp;\u0026plusmn;\u0026thinsp;0.2-fold, and 4.28\u0026thinsp;\u0026plusmn;\u0026thinsp;0.45-fold, respectively \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e. The MuRF1 gene expression levels were significantly upregulated, showing a 2.9\u0026thinsp;\u0026plusmn;\u0026thinsp;0.11-fold increase on day 3 and a 2.8\u0026thinsp;\u0026plusmn;\u0026thinsp;0.23-fold increase on day 7 following denervation. On day 3, only denervated animals treated with velcade with chloroquine decreases MuRF1 expression to a significant level of 2.07\u0026thinsp;\u0026plusmn;\u0026thinsp;0.3-fold. By day 7, the MuRF1 level was significantly downregulated to 1.7\u0026thinsp;\u0026plusmn;\u0026thinsp;0.38-fold, only in the velcade-treated group \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e.\u003c/p\u003e \u003cp\u003eDenervation significantly impacts autophagy in skeletal muscle, contributing to muscle atrophy. In denervation, the loss of neural input disrupts calcium homeostasis and increases oxidative stress, leading to enhanced autophagy activation. This process is mediated by the upregulation of autophagy-related genes and increased formation of autophagosomes. On day 3 and day 7 following nerve injury, the expression of the p62 gene was notably increased by 1.43\u0026thinsp;\u0026plusmn;\u0026thinsp;0.34 folds and 2.49\u0026thinsp;\u0026plusmn;\u0026thinsp;0.31 folds, respectively, compared to rats without nerve injury. Treatment with velcade, chloroquine, and a combination of both further increased p62 expression on day 3 to 2.16\u0026thinsp;\u0026plusmn;\u0026thinsp;0.24, 2.51\u0026thinsp;\u0026plusmn;\u0026thinsp;0.2, and 2.74\u0026thinsp;\u0026plusmn;\u0026thinsp;0.3 folds, respectively, compared to animals with nerve injury alone. On day 7, the expression levels rose to 3.6\u0026thinsp;\u0026plusmn;\u0026thinsp;0.46 folds, 3.13\u0026thinsp;\u0026plusmn;\u0026thinsp;0.5 folds, and 3.65\u0026thinsp;\u0026plusmn;\u0026thinsp;0.41 folds, respectively \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e. On days 3 and 7 post-denervation, LC3β gene expression levels increased to 1.74\u0026thinsp;\u0026plusmn;\u0026thinsp;0.3-fold and 1.48\u0026thinsp;\u0026plusmn;\u0026thinsp;0.3-fold, respectively. On day 3, treatment with velcade, chloroquine, and their combination in denervated animals resulted in LC3β levels of 1.75\u0026thinsp;\u0026plusmn;\u0026thinsp;0.18-fold, 1.15\u0026thinsp;\u0026plusmn;\u0026thinsp;0.1-fold, and 1.17\u0026thinsp;\u0026plusmn;\u0026thinsp;0.2-fold, respectively. By day 7, these treatments led to LC3β levels of 1.31\u0026thinsp;\u0026plusmn;\u0026thinsp;0.16-fold, 0.83\u0026thinsp;\u0026plusmn;\u0026thinsp;0.2-fold, and 1.07\u0026thinsp;\u0026plusmn;\u0026thinsp;0.3-fold, respectively \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eLevel of autophagy and apoptosis regulating genes:\u003c/h2\u003e \u003cp\u003eAdditionally, at day 3 and day 7 post-denervation, the expression levels of the Atg5 gene were significantly elevated, reaching 1.74\u0026thinsp;\u0026plusmn;\u0026thinsp;0.07-fold and 1.99\u0026thinsp;\u0026plusmn;\u0026thinsp;0.3-fold increases, respectively. On day 3 and 7, treatment with only chloroquine in denervated animals resulted significant reduction in Atg5 levels to 1.19\u0026thinsp;\u0026plusmn;\u0026thinsp;0.09-fold and 0.79\u0026thinsp;\u0026plusmn;\u0026thinsp;0.20, respectively \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e\u003cb\u003e).\u003c/b\u003e Similarly, the expression levels of the mitophagy-promoting gene i.e., Pink1, on days 3 and 7 following denervation, were observed to increase by 1.8\u0026thinsp;\u0026plusmn;\u0026thinsp;0.07-fold and 2.4\u0026thinsp;\u0026plusmn;\u0026thinsp;0.3-fold, respectively. On day 3 and 7 after denervation, only chloroquine intervention significantly downregulated the Pink1 to 1\u0026thinsp;\u0026plusmn;\u0026thinsp;0.19-fold and 0.6\u0026thinsp;\u0026plusmn;\u0026thinsp;0.07-fold, respectively \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e\u003cb\u003e).\u003c/b\u003e\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eIn denervation, the loss of nerve supply disrupts neuromuscular junctions, leading to increased calcium influx and mitochondrial dysfunction. This triggers the release of pro-apoptotic factors like cytochrome-c and activates caspase-9 and caspase-3, key players in the apoptotic cascade. While apoptosis is less studied in skeletal muscle atrophy, elevated levels of these apoptosis-inducing factors have been reported in denervated muscles. Thus, in the present study, we analyzed the effect of UPS and autophagy inhibition on apoptosis-regulating genes such as p53, caspase-3, Bax, and Bcl2.\u003c/p\u003e \u003cp\u003eThree days and seven days after denervation, the expression of the p53 gene increased significantly by 4.51\u0026thinsp;\u0026plusmn;\u0026thinsp;1.03 and 10.05\u0026thinsp;\u0026plusmn;\u0026thinsp;1.1 folds, respectively, compared to control rats. On day 3, treatment with the cocktail further elevated p53 expression to 9.8\u0026thinsp;\u0026plusmn;\u0026thinsp;1 folds. By day 7, velcade, chloroquine, and cocktail treatments resulted in p53 levels of 12.8\u0026thinsp;\u0026plusmn;\u0026thinsp;1.2 folds, 6.3\u0026thinsp;\u0026plusmn;\u0026thinsp;1.1 folds, and 8.93\u0026thinsp;\u0026plusmn;\u0026thinsp;1.1 folds, respectively \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e. At days 3 and 7 following denervation, Bcl2 gene expression was 0.47\u0026thinsp;\u0026plusmn;\u0026thinsp;0.14 and 0.75\u0026thinsp;\u0026plusmn;\u0026thinsp;0.08-fold, respectively. Administration of velcade, chloroquine, and their combination on day 3 in denervated animals resulted in Bcl2 levels 0.33\u0026thinsp;\u0026plusmn;\u0026thinsp;0.07-fold, 0.23\u0026thinsp;\u0026plusmn;\u0026thinsp;0.14-fold, and 0.15\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04-fold, respectively. By day 7, these treatments yielded Bcl2 levels of 0.51\u0026thinsp;\u0026plusmn;\u0026thinsp;0.09-fold, 0.48\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02-fold, and 0.5\u0026thinsp;\u0026plusmn;\u0026thinsp;0.07-fold, respectively \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e.\u003c/p\u003e \u003cp\u003eAt days 3 and 7 post-denervation, Caspase3 gene expression levels increased to 2.1\u0026thinsp;\u0026plusmn;\u0026thinsp;0.5 folds and 2.2\u0026thinsp;\u0026plusmn;\u0026thinsp;0.16 folds, respectively. On day 3, interventions with velcade, chloroquine, and their combination in denervated animals resulted in Caspase3 expression levels of 2.8\u0026thinsp;\u0026plusmn;\u0026thinsp;0.2 folds, 3.1\u0026thinsp;\u0026plusmn;\u0026thinsp;0.3 folds, and 4.6\u0026thinsp;\u0026plusmn;\u0026thinsp;0.31 folds, respectively. By day 7, Caspase3 levels reached to 2.8\u0026thinsp;\u0026plusmn;\u0026thinsp;0.2 folds, 3.02\u0026thinsp;\u0026plusmn;\u0026thinsp;0.2 folds, and 5.2\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05 folds, respectively \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e. At day 3 and day 7 post-denervation, levels of the Bax gene were upregulated as 1.3\u0026thinsp;\u0026plusmn;\u0026thinsp;0.17 folds and 1.7\u0026thinsp;\u0026plusmn;\u0026thinsp;0.14 folds, respectively. On day 3, interventions of velcade, chloroquine, and their cocktail in denervated animals upregulate the level of Bax as 2.2\u0026thinsp;\u0026plusmn;\u0026thinsp;0.6 folds, 3.3\u0026thinsp;\u0026plusmn;\u0026thinsp;0.13 folds, and 4.08\u0026thinsp;\u0026plusmn;\u0026thinsp;0.25 folds, respectively. On day 7, the level of Bax was 3.27\u0026thinsp;\u0026plusmn;\u0026thinsp;0.06 folds, 3.94\u0026thinsp;\u0026plusmn;\u0026thinsp;0.2 folds, and 6.27\u0026thinsp;\u0026plusmn;\u0026thinsp;0.3 folds, respectively \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003e4.7 Differential expression of proteins in skeletal muscles\u003c/h2\u003e \u003cp\u003eDenervation-induced SkMA involves a complex molecular mechanism where several proteins play critical roles. Loss of nervous input leads to modulate Akt activity, upregulates atrophy-related genes, particularly MuRF1 (Muscle RING Finger 1), which ubiquitinates and targets myofibrillar proteins like myosin heavy chain (MyHC) and actin for degradation by the proteasome. Concurrently, LAMP 2A levels increase, promoting autophagy, which further contributes to the breakdown of SkM proteins. Additionally, denervation alters the balance between pro-apoptotic Bax and anti-apoptotic Bcl2 proteins, initiating caspase mediated atrophy. The combined effects of these pathways lead to the progressive loss of SkM mass and function characteristic of atrophy. In our current research, we investigated the levels of phosphorylated Akt, MuRF1, LAMP 2A, myosin heavy chain (MyHC), actin, Bax, and Bcl2 at the translational level in denervated and treated groups.\u003c/p\u003e \u003cp\u003eAt day 3 and day 7 post-denervation, phosphorylated-Akt levels were significantly elevated to 1.6-fold and 1.7-fold, respectively. Velcade alone leads to an increased to 1.8-folds in p-Akt at day 3, but the effect is less pronounced to 1.7-folds by day 7. Chloroquine alone shows an initial decrease to 0.6-folds in p-Akt at day 3 but increased to 1.8-folds by day 7. The combination of velcade and chloroquine results in the highest p-Akt levels i.e., 2.7-folds, indicating a potential synergistic effect \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eA\u003cb\u003e)\u003c/b\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eDenervation and the combination of velcade and chloroquine influenced MuRF1 E3 ligase levels differently over time. Denervation increased MuRF1 levels to 1.4 and 1.5-folds at day 3 and day 7, respectively. Velcade treatment consistently elevated MuRF1 levels to 1.4-folds at day 3 but reduced to 0.8-folds at day 7. Chloroquine treatment tried to normalized the MuRF1 at day 3 and day 7 post-denervation. The combination of Velcade and chloroquine resulted in the highest MuRF1 levels at day 7 (1.8-folds), suggesting a potential synergistic effect. In conclusion, the data suggests that MuRF1 levels are dynamically regulated by these treatments, with velcade showing a time-dependent effect, chloroquine showing a suppressing effect, and the combination treatment resulting in the highest levels of MuRF1 \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eB\u003cb\u003e)\u003c/b\u003e.\u003c/p\u003e \u003cp\u003eDenervation after 3 and 7 days significantly increased LAMP 2A levels to 2.1 and 2.3-folds, respectively. Velcade treatment suppressed the LAMP 2A levels to 1.5 and 1 folds at both day 3 and day 7, respectively, indicating its impact on lysosomal function. Chloroquine treatment highlighted a significant decrease to 1.3 and 1-fold by day 3 and 7, respectively. The combination of velcade and chloroquine results in the highest LAMP 2A levels at day 3 (2.8-folds) but a reduction by day 7 (1.8-folds). In conclusion, the data suggests that LAMP 2A protein levels are vigorously regulated by denervation and systems inhibition. Denervation significantly elevates LAMP 2A levels, with velcade and chloroquine alone showing suppressive effects. Cocktail treatment initially increased LAMP 2A levels significantly but shows a reduction over time \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eC\u003cb\u003e)\u003c/b\u003e.\u003c/p\u003e \u003cp\u003eIn denervated and cocktail treated groups, Bax protein levels was elevated to 1.1 and 1.5-folds, respectively, at day 3. Chloroquine treatment shown a marked increase of 1.9 and 1.7-folds in Bax levels at both time points, indicating a pro-apoptotic response. The combination treatment consistently resulted in the highest Bax levels to 1.9-fold, particularly at day 7 \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eD\u003cb\u003e)\u003c/b\u003e.\u003c/p\u003e \u003cp\u003eDenervation generally reduced BCl2 protein levels to 0.9-folds, particularly by day 7. Velcade treatment further reduced BCl2 levels to 0.8 and 0.6-folds by day 3 and 7, respectively. Chloroquine treatment consistently lowered BCl2 levels to 0.7 and 0.5-folds, at day 3 and 7, respectively. The cocktail treatment shows a significant reduction in BCl2 levels at both day 3 and day 7, with a more pronounced effect at day 3 \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eE\u003cb\u003e)\u003c/b\u003e.\u003c/p\u003e \u003cp\u003eDenervation significantly decreased MyHC levels to 0.7-folds at day 3, followed by day 7 (0.4-folds). Velcade treatment consistently reduced MyHC levels to 0.6-folds and 0.3 folds at both time points. Chloroquine treatment also decreased MyHC levels to 0.5-folds at day 3, but normalized it on day 7 \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eF\u003cb\u003e)\u003c/b\u003e.\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eSciatic nerve injury results in impaired neuromuscular transmission, causing an influx of Ca2\u0026thinsp;+\u0026thinsp;in skeletal muscles. This leads to the generation of free radicals, oxidative stress, increased activity of the UPS, and increased mitophagy/autophagy processes [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. The UPS and autophagy both are key pathways responsible for skeletal muscle atrophy, with some evidences suggesting their interdependency [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Understanding this relationship is vital for developing therapies to combat muscle loss. In the present study, chloroquine treatment normalized the ROS, more effectively than velcade and combine supplementation. Levels of inflammatory cytokines such as TWEAK, TNF-α and NF-kB were found upregulated in denervation. However, supplementation of chloroquine normalized TWEAK and NF-kB levels in gastrocnemius muscle. Denervation induced ROS and inflammation activate the FoxO3 [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e], found to upregulated at day 3 and 7. By day 7, FoxO3 levels were significantly downregulated in the velcade and chloroquine-treated groups. It is also reported that FoxO3a alleviates the inflammation and oxidative stress via regulating TGF-β signaling [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Sciatic nerve injury escalated the mRNA level of TGF-β and its downstream transcription factors i.e. Smad 3/4 in atrophied skeletal muscle. However, significant reductions in the level of Smad 3/4 genes were observed after autophagy as well as proteasome inhibition.\u003c/p\u003e \u003cp\u003eTranscription factors such as FoxO3a, NF-kB and Smad3/4 can activate the both UPS promoting E3 ligases such as Atrogin1 and MuRF1, and autophagy promoting factors such as LC3β, Atg5 and LAMP 2A [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. During denervation, upregulation in the levels of Atrogin1 and MuRF1 were normalized after autophagy inhibition and to a less extent after proteasome inhibition, particularly at day 7. This was further confirmed with increased activity of 26S proteasome in denervated muscles, however normalized via velcade treatment. Denervation was found to upregulate the autophagy-promoting genes or proteins such as LC3β, Atg5 and LAMP 2A at day 3 and 7. These are found to be suppressed after autophagy inhibition more precisely than proteasome or both system inhibition. Due to this increased oxidative stress, inflammation, proteasome activity and autophagy in denervation, area of gastrocnemius muscle cells was significantly reduced on day 3 and 7. Only chloroquine intervention prevented the reduction in area of denervated muscle fibers. Additionally, treatment with chloroquine, as compared to velcade, maintained or increases muscle weight regards of fiber type composition of skeletal muscles on day 7. Thus, autophagy inhibition with chloroquine effectively counteracts atrophy (more than proteasome inhibition), preserving muscle cell area, body weight, muscle weight, atrophy rate, and histology of muscle fibers .\u003c/p\u003e \u003cp\u003eIn case of proteasome inhibition, upregulation in the level of autophagy promoting genes such as Atg5 and p62, along with pro-apoptotic factors such as caspase3 and Bax was observed. Additionally, in autophagy inhibition or in inhibition of both systems, there was a further upregulation in levels of caspase3 and Bax in denervated muscles. The Western blotting results demonstrated that Bcl2 protein levels were reduced in denervated muscle, and this suppression was enhanced by velcade and chloroquine treatments. Nevertheless, the combined administration slightly elevated Bcl2 levels on day 7, but the increase was not statistically significant. These observations confirmed the increased apoptosis after autophagy and proteasome inhibition. This highlights a complex interplay between proteolytic pathways in regulating muscle apoptosis and homeostasis during denervation.\u003c/p\u003e \u003cp\u003eStudies have shown that calpain has the ability to stimulate the activation of caspase-3, while active caspase-3 can in turn amplify calpain activity. Also, it has been found that inhibiting calpain can lead to a notable reduction in caspase-3-like activity. Additionally, research has indicated the significance of calpain-dependent cleavage of calpastatin in regulating caspase-3 activation during apoptosis [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Similar correlation has been observed in the current study. Denervation-induced calcium influx in muscle cells was observed to upregulates the activities of calpain 3, \u0026micro;- and m-calpain along with caspase-3, significantly. Instead of reduction, proteasomal inhibition promoted the \u0026micro;- and m-calpains as well as caspase-3 activities in denervated muscles. It was further correlated with decreased levels of Bcl2 and increased levels of Bax. However, autophagy inhibition (alone or with proteasome inhibition) significantly reduced the activities of calpains in skeletal muscles.\u003c/p\u003e \u003cp\u003eProtein anabolic factors Akt and mTOR showed increased expression on days 3 and 7 post denervation. This upregulation was further enhanced by the concurrent administration of velcade and chloroquine at transcription as well as translation level, significantly. Thus, velcade and chloroquine promote protein anabolism in denervated muscles, evidenced by increased skeletal muscles weight and whole-body weight. Additionally, activities mitochondrial complexes I and IV were notably reduced in denervation, but inhibition of autophagy or proteasome system substantially restored these activities. It was further confirmed by increased expression levels of the mitophagy-promoting gene i.e., Pink1, on days 3 and 7 following denervation. The Pink1 level was significantly restored by chloroquine intervention and not by velcade, leading to the normalization of autophagy. The observation is further corroborated by chloroquine being more effective than velcade in preventing fiber type switching or restoring fiber types.\u003c/p\u003e \u003cp\u003eThe effectiveness of velcade was observed predominantly on day 7, however, the co-administration of velcade and chloroquine did not result in a significant improvement in the body weight of denervated rats. Moreover, inhibition of both proteasome and autophagy promoted the atrophic conditions instead of impede. The effects of VC intervention were found to be similar to denervation-induced skeletal muscle atrophy, as seen in increased ROS production, inhibition of mitochondrial complexes, and increased proteasome activity, leading to an increased rate of atrophy. Concurrent use of velcade and chloroquine did not significantly affect the levels of TWEAK, TNF-α, FoxO3, NF-ĸB, Atrogin1, and MurF1 in denervated animals. VC treatment also resulted in decreased levels of Atg and LAMP2A compared to individual velcade and chloroquine treatments, with no impact on Pink1. Additionally, VC intervention increased caspase-3 and Bax levels while decreasing Bcl2 levels, indicating changes in apoptotic gene expression.\u003c/p\u003e \u003cp\u003eThe current observations emphasizes that the inhibition of UPS activity boosts the expression of autophagy-promoting genes and \u003cem\u003evice versa\u003c/em\u003e, demonstrating the mutual reliance of these systems. For example, inhibition of autophagy or the proteasome, the protein p62 (also called SQSTM1) was found to be upregulated, which serves as an adapter protein to transfer the protein degradation burden from the affected system to the operational one. This mechanism ensures cellular protein quality control even if one of the main degradation pathways is not functioning. Overall, chloroquine mediated autophagy inhibition was observed to normalized the inflammation, oxidative stress, mitochondrial activity, protein catabolism, UPS and autophagy promoting factors and activity of calpains. Thus, autophagy inhibition was found to be more effectively modulate muscle atrophy than proteasomal inhibition, clearly demonstrated by muscle compactness, fiber cross diameter, and fiber type switching. Hence, targeting autophagy may provide a more effective therapeutic strategy for reducing muscle degradation, as opposed to solely inhibiting the 26S proteasome or using a combination approach.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eSciatic nerve resection in male Wistar rats induces significant skeletal muscle atrophy, characterized by weight loss, fiber type shift, and biochemical alterations. The latest findings highlight that suppression of UPS activity enhances the expression of autophagy-promoting genes and vice versa, indicating the interdependence of these systems mainly through p62, an adapter protein. However, in denervated muscles, chloroquine suppresses the level of pro-atrophic markers more effectively than velcade. Present study also indicate the prominent role of apoptosis in skeletal muscle atrophy after the failure of UPS and autophagy, clearly indicated by decreased body and muscle weights, histological alterations and modulation of apoptotic factors, which is quite uncommon in SkM due to fused cells. However, further studies are required to establish clear role of apoptosis in skeletal muscle atrophy. Moreover, the study revealed that inhibition of UPS led to a boost in calpain activity, whereas inhibition of autophagy increased the levels of certain apoptotic markers. This suggests a significant interdependence among the four proteolytic systems.\u003c/p\u003e \u003cp\u003eThe research results emphasize the effectiveness of autophagy inhibition in reducing muscle atrophy and preserving muscle function. However, the study suggests that simultaneous inhibition of the proteasome along with autophagy may not be advantageous and could potentially exacerbate muscle pathology. These findings demonstrate the promise of targeting autophagy pathways as a novel approach to combating skeletal muscle atrophy. Therefore, chloroquine could be repurposed for the prevention and treatment of muscle loss.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthical Approval:\u0026nbsp;\u003c/strong\u003eApproved by the Institutional Animal Ethics Committee of Maharshi Dayanand University, Rohtak, as per their letter no. 282-93 Dated 11-12-21.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to Participate:\u0026nbsp;\u003c/strong\u003eNA\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to Publish:\u0026nbsp;\u003c/strong\u003eYes.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors Contributions:\u0026nbsp;\u003c/strong\u003eAjay Singh: Perform practical work and write manuscript. Rajesh Dabur: Writing- review \u0026amp; editing, Supervision, conceptualization.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding:\u0026nbsp;\u003c/strong\u003eNone\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interests:\u0026nbsp;\u003c/strong\u003eThe authors declare that there is no conflict of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials:\u0026nbsp;\u003c/strong\u003eI confirm that all data and material is included in my main manuscript file.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported and funded by Maharishi Dayanand University, Rohtak.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eMukund K, Subramaniam S (2020) Skeletal muscle: A review of molecular structure and function, in health and disease. Wiley Interdiscip Rev Syst Biol Med 12\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMuller FL, Song W, Jang YC et al (2007) Denervation-induced skeletal muscle atrophy is associated with increased mitochondrial ROS production. Am J Physiol Regul Integr Comp Physiol 293. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1152/ajpregu.00767.2006\u003c/span\u003e\u003cspan address=\"10.1152/ajpregu.00767.2006\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSingh A, Yadav A, Phogat J, Dabur R (2021) Dynamics and Interplay between Autophagy and Ubiquitin-proteasome system Coordination in Skeletal Muscle Atrophy. Curr Mol Pharmacol 15. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.2174/1874467214666210806163851\u003c/span\u003e\u003cspan address=\"10.2174/1874467214666210806163851\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYadav A, Singh A, Phogat J et al (2021) Magnoflorine prevent the skeletal muscle atrophy via Akt/mTOR/FoxO signal pathway and increase slow-MyHC production in streptozotocin-induced diabetic rats. J Ethnopharmacol 267. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jep.2020.113510\u003c/span\u003e\u003cspan address=\"10.1016/j.jep.2020.113510\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYadav A, Singh A, Phogat J et al (2021) Magnoflorine prevent the skeletal muscle atrophy via Akt/mTOR/FoxO signal pathway and increase slow-MyHC production in streptozotocin-induced diabetic rats. J Ethnopharmacol 267:113510. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jep.2020.113510\u003c/span\u003e\u003cspan address=\"10.1016/j.jep.2020.113510\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSiu PM, Alway SE (2005) Mitochondria-associated apoptotic signalling in denervated rat skeletal muscle. J Physiol. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1113/jphysiol.2004.081083\u003c/span\u003e\u003cspan address=\"10.1113/jphysiol.2004.081083\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee J, Giordano S, Zhang J (2012) Autophagy, mitochondria and oxidative stress: Cross-talk and redox signalling. Biochem J 441:523\u0026ndash;540\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eReiniers MJ, de Haan LR, Reeskamp LF et al (2021) Analysis and optimization of conditions for the use of 2\u0026prime;,7\u0026prime;-dichlorofluorescein diacetate in cultured hepatocytes. Antioxidants 10. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/antiox10050674\u003c/span\u003e\u003cspan address=\"10.3390/antiox10050674\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchipper-Krom S, Sanz AS, van Bodegraven EJ et al (2019) Visualizing Proteasome Activity and Intracellular Localization Using Fluorescent Proteins and Activity-Based Probes. Front Mol Biosci 6. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fmolb.2019.00056\u003c/span\u003e\u003cspan address=\"10.3389/fmolb.2019.00056\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWallimann T, Tokarska-Schlattner M, Schlattner U (2011) The creatine kinase system and pleiotropic effects of creatine. Amino Acids 40\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen X, Ji Y, Liu R et al (2023) Mitochondrial dysfunction: roles in skeletal muscle atrophy. J Transl Med 21\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBodine SC, Baehr LM (2014) Skeletal muscle atrophy and the E3 ubiquitin ligases MuRF1 and MAFbx/atrogin-1. Am J Physiol Endocrinol Metab\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVentre DM, Cluff A, Gagnon C et al (2021) The effects of low intensity focused ultrasonic stimulation on dorsal root ganglion neurons and Schwann cells in vitro. J Neurosci Res 99. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/jnr.24700\u003c/span\u003e\u003cspan address=\"10.1002/jnr.24700\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHyatt HW, Powers SK (2020) The Role of Calpains in Skeletal Muscle Remodeling with Exercise and Inactivity-induced Atrophy. Int J Sports Med 41\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYadav A, Dabur R (2024) Skeletal muscle atrophy after sciatic nerve damage: Mechanistic insights. Eur J Pharmacol 970\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSingh A, Phogat J, Yadav A, Dabur R (2021) The dependency of autophagy and ubiquitin proteasome system during skeletal muscle atrophy. Biophys Rev 13\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eD\u0026aacute;vila D, Torres-Aleman I (2008) Neuronal death by oxidative stress involves activation of FOXO3 through a two-arm pathway that activates stress kinases and attenuates insulin-like growth factor I signaling. Mol Biol Cell 19. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1091/mbc.E07-08-0811\u003c/span\u003e\u003cspan address=\"10.1091/mbc.E07-08-0811\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXu S, Zhang X, Ma Y et al (2022) FOXO3a Alleviates the Inflammation and Oxidative Stress via Regulating TGF-β and HO-1 in Ankylosing Spondylitis. Front Immunol 13. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fimmu.2022.935534\u003c/span\u003e\u003cspan address=\"10.3389/fimmu.2022.935534\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNelson WB, Smuder AJ, Hudson MB et al (2012) Cross-talk between the calpain and caspase-3 proteolytic systems in the diaphragm during prolonged mechanical ventilation. Crit Care Med. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1097/CCM.0b013e318246bb5d\u003c/span\u003e\u003cspan address=\"10.1097/CCM.0b013e318246bb5d\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. 40:\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Sciatic nerve injury, Skeletal muscle atrophy, Oxidative stress, Inflammation, autophagy inhibition and Proteasome inhibition","lastPublishedDoi":"10.21203/rs.3.rs-5360477/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5360477/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eSkeletal muscle (SkM) mass loss is directly related to increased oxidative stress, inflammation, and muscle protein degradation mediated by proteolytic systems. Growing evidence suggests the interdependency of autophagy and UPS in the progression of SkM atrophy. Hence, the current study was performed to understand the interdependency of autophagy and UPS and their impact on SkM atrophy. 6-week-old male Wister rats undergone denervation were randomized into different treated groups for one week alone and in conjunction with UPS and autophagy inhibitors. Further assessments were achieved by morphological aberration (via histopathology), mRNA (via RT-qPCR), protein expression of muscle-specific markers (via western blotting), calpain activity (via Zymography) and biochemical alteration. In denervated rats, treatment mainly with chloroquine and somehow with velcade tried to normalize the activity of mitochondrial complex I and IV, calpains activity, levels of ROS, pro-atrophic markers TWEAK, FoxO3, NFkB, Smad3/4, UPS promoting E3 ligases; Atrogin1, MuRF1, autophagy promoting factors; LC3β, Atg5, p62, LAMP2A, PINK1 and myosin heavy chain. In denervated skeletal muscles, inhibition of autophagy affects the activity of proteasome and vice versa. Hence, autophagy and UPS both are interdependent systems in SkM atrophy. Autophagy inhibition attenuates muscle atrophy more precisely than proteasomal and both systems inhibitions.\u003c/p\u003e","manuscriptTitle":"Impact of Autophagy and Proteasome inhibition on denervation-induced Skeletal Muscle Atrophy","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-11-13 18:01:26","doi":"10.21203/rs.3.rs-5360477/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"54e8524c-2096-4019-a1b8-0592ff4950a0","owner":[],"postedDate":"November 13th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-02-20T07:23:34+00:00","versionOfRecord":[],"versionCreatedAt":"2024-11-13 18:01:26","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-5360477","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5360477","identity":"rs-5360477","version":["v1"]},"buildId":"_2-kVJe1T_tPrBINL-cwx","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00
unpaywall
last seen: 2026-05-26T02:00:01.498150+00:00
License: CC-BY-4.0