Enhancing Surveillance for Dengue Fever in Oyo State, Nigeria – a One Health Approach

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher

Abstract

Abstract Background The threat from Dengue Fever (DF) is fast becoming a global menace. The burden of DF in Oyo State and indeed in Nigeria remains unclear, as cases go underdiagnosed or misdiagnosed as malaria. This is attributable to poor health-seeking behavior of the population, weak surveillance systems, and poor health infrastructure. Consistent surveillance of this pathogen using a one-health approach is necessary to assess the public health impact, meteorological influence, vectoral abundance, high-risk groups, and locations associated with Dengue Virus (DENV) infections. Methods A cross-sectional study was conducted from Jan 2022 to April 2023. It involved screening DENV in 289 human blood samples and 1,015 Aedes species mosquitoes. Viral RNA was extracted and purified using Jena Bioscience Viral DNA + RNA purification kit. These were analyzed using the One-Step PrimeScript III RT-qPCR mix. Serological detection of DENV-specific antibodies IgM and IgG in humans was analyzed using a one-step lateral flow immunoassay cassette test kit. Patients who were DENV IgM positive were screened for Lassa Virus (LASV) to rule out coinfection. Adult Aedes mosquitoes were trapped using Biogents Sentinel Trap. Mosquitoes recovered were morphologically identified and classified using appropriate taxonomical keys. Meteorological data was obtained from NIMET. Data was abridged as proportions; correlation analysis was done to determine associations. Result The overall seroprevalence of DENV was 128/289 (44.2%) with 19/289 (6.6%) and 109/289 (37.7%) being IgM and IgG positive. DENV was detected all year round with more cases in the rainy season. LASV and DENV coinfection was detected in a participant. DENV RT-qPCR analysis in febrile patients and mosquitoes was negative. There was a high abundance of Aedes aegypti (79.5%) in all the locations surveyed with Aedes albopictus (12.3%) detected in Ido LGA and Ibadan South-East LGA while Aedes simpsoni (9.1%) was found at Iwajowa LGA. Mosquito populations varied during the study period in response to prevailing weather conditions. Conclusion The high seroprevalence in this study demonstrates an ongoing transmission and exposure to DENV in Oyo State, this further underscores the need to include DF as a differential diagnosis for febrile illnesses. Surveillance system strengthening, as well as timely, accessible, and sensitive laboratory diagnosis for DF, is advocated.
Full text 148,344 characters · extracted from preprint-html · click to expand
Enhancing Surveillance for Dengue Fever in Oyo State, Nigeria – a One Health Approach | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Enhancing Surveillance for Dengue Fever in Oyo State, Nigeria – a One Health Approach Olawale Sunday Animasaun, Joseph Ojonugwa Shaibu, Busayo Kayode Akomolafe, and 6 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4476878/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 29 Jan, 2025 Read the published version in One Health Outlook → Version 1 posted 5 You are reading this latest preprint version Abstract Background The threat from Dengue Fever (DF) is fast becoming a global menace. The burden of DF in Oyo State and indeed in Nigeria remains unclear, as cases go underdiagnosed or misdiagnosed as malaria. This is attributable to poor health-seeking behavior of the population, weak surveillance systems, and poor health infrastructure. Consistent surveillance of this pathogen using a one-health approach is necessary to assess the public health impact, meteorological influence, vectoral abundance, high-risk groups, and locations associated with Dengue Virus (DENV) infections. Methods A cross-sectional study was conducted from Jan 2022 to April 2023. It involved screening DENV in 289 human blood samples and 1,015 Aedes species mosquitoes. Viral RNA was extracted and purified using Jena Bioscience Viral DNA + RNA purification kit. These were analyzed using the One-Step PrimeScript III RT-qPCR mix. Serological detection of DENV-specific antibodies IgM and IgG in humans was analyzed using a one-step lateral flow immunoassay cassette test kit. Patients who were DENV IgM positive were screened for Lassa Virus (LASV) to rule out coinfection. Adult Aedes mosquitoes were trapped using Biogents Sentinel Trap. Mosquitoes recovered were morphologically identified and classified using appropriate taxonomical keys. Meteorological data was obtained from NIMET. Data was abridged as proportions; correlation analysis was done to determine associations. Result The overall seroprevalence of DENV was 128/289 (44.2%) with 19/289 (6.6%) and 109/289 (37.7%) being IgM and IgG positive. DENV was detected all year round with more cases in the rainy season. LASV and DENV coinfection was detected in a participant. DENV RT-qPCR analysis in febrile patients and mosquitoes was negative. There was a high abundance of Aedes aegypti (79.5%) in all the locations surveyed with Aedes albopictus (12.3%) detected in Ido LGA and Ibadan South-East LGA while Aedes simpsoni (9.1%) was found at Iwajowa LGA. Mosquito populations varied during the study period in response to prevailing weather conditions. Conclusion The high seroprevalence in this study demonstrates an ongoing transmission and exposure to DENV in Oyo State, this further underscores the need to include DF as a differential diagnosis for febrile illnesses. Surveillance system strengthening, as well as timely, accessible, and sensitive laboratory diagnosis for DF, is advocated. Dengue Fever Aedes mosquito Surveillance Diagnosis Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Dengue fever (DF) is an arboviral infection caused by dengue virus (DENV) of the Flaviviridae family. It is transmitted to humans through bites of infected mosquitoes of Aedes species . Four related but antigenically discrete serotypes (serotypes 1–4) with 62–67% sequence homology of the DENV have been identified. 1 The classification of the four serotypes was based on the immunological response of patients to primary DENV infection by one of the serotypes. A primary infection of DENV protects against a secondary infection by a homologous DENV serotype but confers partial and transient protection against a heterologous DENV serotype. 2 The incidence and magnitude of DF outbreaks have increased significantly as the virus itself and mosquito vector has both expanded geographically in tropical and subtropical regions. Consequently, 129 countries are at risk, with over 3.9 billion people and an estimated 96 million symptomatic cases with a projected 40,000 deaths each year 3 . Furthermore, in Africa and Asia, there is a high impending possibility for the re-emergence of sylvatic dengue in the human transmission cycle due to deforestation, climate change, and vector geographical expansion 4 . Dengue is a high-burden disease that disproportionately affects countries in the tropics and subtropics, many of which have limited healthcare resources. In Nigeria, DF is endemic in almost all the states nationwide and could be the leading cause of unclassified febrile illnesses 5 . Dengue fever has a mixed distribution among urban, and rural areas and was previously predominantly reported in urban areas than in rural areas 5 . In Oyo State and in Nigeria, DENV and other arboviruses have a high potential to cause serious public health impact, due to the high density of the competent disease vectors, the existence of pockets of unvaccinated and susceptible populations due to low Yellow Fever (YF) vaccination coverage and non-availability of vaccines for other arboviral infections. Other limitations include epidemiological gaps, slow detection of cases, as well as inadequate engagement of local healthcare providers in disease surveillance and management 6,23 . Central to the epidemiology of DENV and other arboviral infections, is the requirement for mosquito-borne transmission to primate hosts, these viruses are transmitted to man (and other vertebrates) by the bite of an arthropod vector, primarily mosquitoes. Despite the presence of the virus in the blood and bodily secretions during acute infection, DENV infection is not contagious. Consequently, available reservoirs of infectious viruses and high levels of vector populations are prerequisites for epidemic outbreaks. Having known this, Integrated vector management and control strategies, prompt case detection and management, are the main strategies for the prevention and control of dengue virus transmission. Many arboviruses are circulating in Nigeria, YF for example, has caused large epidemics in the past. There is also serologic evidence of human infection with YF, DF, West Nile and Zika virus. There are reports that many clinical arbovirus infections have been misdiagnosed as malaria and typhoid fever in the country 6 . DF endemicity in Oyo state and Nigeria as whole is an ongoing phenomenon with its attendant burden on the health, economical, socio-political spheres of the country. The magnitude of these is yet to be evaluated. Furthermore, DF has a propensity to be severe and life-threatening as seen with the Dengue Haemorrhagic Fever (DHF) and Dengue Shock Syndrome (DSS) forms of the disease. A seroprevalence study carried out in Osun state, South-west Nigeria, indicates that the IgG prevalence of DF is 77%. This indeed is very high, showing that this disease affects a large number of people and is most likely responsible for a great proportion of febrile illnesses often misdiagnosed for malaria due to lack of routine diagnosis 4,6 . The existence of several DENV serotypes in Nigeria, indicates that large and repeated epidemics of DHF/DSS may happen in the future. DF surveillance is therefore crucial for the monitoring of the disease frequency or trend, discovery of outbreaks or new mutation, to trigger timely interventions. Outbreak alerts are essential to mobilize vector control and to prepare healthcare delivery services in readiness for a surge in frequency. This should be viewed in the context of the challenges encountered in the process of discovering and producing efficacious and effective anti-DENV drugs and vaccine which are yet to be available. Entomological investigations have confirmed the presence of the vectors Aedes aegypti and Aedes africanus in several states across Nigeria 7 . These reflect the activities of several competent mosquito vectors, capable of transmitting arboviral infections from reservoirs to other hosts in the country 8 . Some of these mosquito vectors have been implicated following past arbovirus epidemics. Knowledge of the species composition and fluctuations that takes place in mosquito vector populations in response to abiotic environmental conditions, principally weather, is necessary to identify periods when these vectors thrive the most and when arboviruses are at their peak of transmission. A multidisciplinary and multisectoral collaboration, through a One Health approach which this study was designed to achieve, is therefore required to effectively prepare, detect, assess, and respond to emerging and endemic arboviral diseases. In this study we investigated the public health burden, meteorological influence, high-risk groups, and abundance of Aedes mosquitoes and DENV carriage rate of Aedes mosquito in Oyo State. Materials and Methods Study Area Oyo State is in the South-West geopolitical zone of Nigeria with Ibadan city as the capital. This State has 33 Local Governments Areas (LGAs) and 29 Local Council Development Areas (LCDAs) and a projected population of 9,233,010 with an annual growth rate of 3.4 according to the National Population Commission 2019 report. Study Location Human and entomological surveillance took place in 10 high-risk LGAs in Oyo State where confirmed cases of an arboviral or viral haemorhagic infection(s) had been reported by researchers, the State Ministry of Health and the Nigerian Centre for Disease Control (NCDC). Study Design This was a cross sectional study that involved human and entomological surveillance for DENV. The duration of study for human sampling was Jan 2022 to April 2023 while the entomological surveillance took place from April 2022 to April 2023. Population of the Study The study population were drawn from febrile in and out-patients attending selected healthcare facilities in the selected LGAs based on case definitions for DF which asserts that a DF suspected case is “anybody with acute febrile illness of 2-7 days duration with at least one or more of the following symptoms: headache, myalgia, arthralgia, rash, vomiting, anorexia, haemorhhagic manifestations and, leucopenia. Febrile patients with confirmed diagnosis of other infections and those outside study areas and non-consenting patients were excluded from the study. Sampling Techniques A purposive sampling technique was used in the enrollment of study participants for this study. This involves active case search in communities and health facilities involving house-to-house case finding, health facilities records, etc. Data Collection Techniques A quantitative approach using structured tools was adopted for data collection. Semi-structured interviewer-administered questionnaires were used to obtain information from selected consenting participants Sample Collection, Transportation, and Storage Five (5) mls of whole blood was aseptically collected via venipuncture into Ethylene Diamine Tetraacetic Acid (EDTA) anticoagulant bottle and transported from the field to the laboratory using a triple packaging system in a geostyle at +2 0 C to 4 0 C. The samples were centrifuged for 5mins at 3000 rpm to obtain the plasma which was aliquoted into two parts for serology and molecular testing and then stored frozen at -20 0 C. Laboratory analysis All laboratory processes were performed at the Center for Human Virology and Genomics, Nigerian Institute of Medical Research (NIMR), Yaba, Lagos, Nigeria. RNA Extraction Process: Following manufacturer’sinstructions, RNA was extracted from human plasma and mosquitoes (mechanically crushed) using Jena Bioscience Viral DNA+RNA purification Kit (Jena, Germany).Extracted RNAs were Stored at -20 o C for further processing. Real-Time PCR Analysis: One-step reverse transcriptase (RT) real-time (qPCR) was carried out to detect the pathogen using Quant Studio5 machine. The amplification steps encompass denaturation, primer annealing and elongation. Optimization of the PCR conditions was done for optimum amplification of the genes. Positive and negative controls were set up and run along with the test. PCR Mix Components: The PCR mix was made up of 25µl containing 10 µl enzyme mix, 0.8µl of forward and reverse primers; 0.4 µl for probes, 6 µl of nuclease free water and 5 µl of RNA template was set up. A Ctvalue of <38 was adjudged to be positive for viral pathogen. Cycling Conditions: Initial denaturation at 94˚C for 5mins, then by 36 cycles of denaturation at 94˚C for 30 sec, annealing at 55˚C for 30 secs and elongation at 72˚C for 45 sec. Followed by a final elongation step at 72˚C for 7 minutes and hold temperature at 10 ˚C. Primer and Probe used for the Detection of DENV Forward AAACCGCGTGTCGACTGTGC Reverse TAGGAAACGAAGGAATGCCACC Probe FAM-5’CACTTGGAATGCTGCAGGGACGAGGACC Serological analysis A one-step lateral flow immunoassay cassette test kit from Zijian Biotechnology, Shenzhen, China was used following manufacturers instruction for detection of Dengue Virus specific IgG and IgM while ReLASV® Pan-Lassa NP IgG ELISA Kit (Human anti-LASV NP Antibody) was used for detection of IgM antibodies against LASV for samples found positive to DENV Ig M. Entomological Surveillance Vector Trapping, Identification, Transportation and Processing Two entomological approaches were employed in the survey: Larval/Pupae survey and use of Biogents Sentinel Trap (BG Trap) for adult mosquito. The sampling of mosquitoes broadly targets Aedes species as studies have implicated its role in the transmission of a variety of viruses 9 . Mosquito Identification and Preservation Adult mosquitoes collected in the field and those reared to adults from immature collections were killed by freezing at -20º C for 20 min. The specimens were morphologically identified to species level using appropriate taxonomic keys, they were sorted out and identified by morphological characteristics with the key aids of Leopoldo M. Rueda 9 . They were later counted, recorded and introduced into well-labeled Eppendorf tubes containing RNA later(shield) and then stored frozen at -20 0 C. Data Management and Analysis Data was analyzed using Epi info Statistical package Version 7.0 and Microsoft Excel. Quantitative data was presented using tables and charts. Correlation analysis was used to test the association between Dengue Fever, Aedes mosquito vector abundance, and environmental factors (temperature, rainfall, and relative humidity). Ethical Considerations Ethical approval was obtained from the Institutional Review Board (IRB) of the Nigerian Institute of Medical Research (NIMR) IRB-19-006. Further permission was obtained from the Oyo State Ministry of Health Department of Public Health (SMOH/EPID/016/005) and the various officer-in -charge in the health care facilities before the commencement of the study. Informed consent was obtained from study participants. Results Sociodemographic of Study Participants A total of 289 febrile patients were enrolled into this study, there were more female respondents 164/289 (56.7%) and the age group 30-44 years constituted the majority 106(36.7%) (Table 1). Clinical symptoms among the DENV positive cases were high grade fever >38 o C 19/19 (100%), fatigue 12/19 (63.2%) and jaundice 2/19 (10.5%). Table 1 Socio-demographic Characteristics of Participants in Oyo State January 2022-April 2023 Variables Frequency(N=289) Percentage (%) Sex Male 125 43.3 Female 164 56.7 Age group in years 0-14 41 14.2 15-29 58 20.0 30-44 106 36.7 45-59 54 18.7 Above 60 30 10.4 Educational level No formal education 96 33.2 Primary 105 36.3 Secondary 58 20.0 Tertiary 30 10.4 Profession/Employment status Civil servant 45 17.0 Farming 59 20.4 Cattle Breeders 80 27.7 Self-employed 47 16.3 Trading Unemployed 28 10 9.7 3.5 Students 22 7.6 Molecular Results of Human and Mosquitoes Samples RT-qPCR analysis of the RNA extracted from all human blood samples collected from our study participants and mosquitoes’ samples were negative for DENV RNA. Serological Results The overall seroprevalence of DENV in Oyo state was 128/289 (44.3%) consisting of 19/289 (6.6%) and 109/289 (37.7%) IgM and IgG positive , 8/289 (2.8%) of the participants were simultaneously positive for IgM and IgG specific DENV (Figure 1). The distribution of DENV positive IgM patients by LGAs (Figure 2) showed five (26.3%) patients from Iwajowa LGA, four (21.1%) from Ibadan Southeast and Oluyole LGAs, two (10.5%) from Ido and Akinyele LGAs, with one person (5.3%) in both Kajola and Oyo East LGAs were identified Females 11/19(57.9%) and the age group 30-44 years were the most affected (Figure 3). A Patient was positive for both LASV IgM and DENV IgM. In this study, DENV positive cases were reported almost all year round with more cases reported in the months of the rainy season July to October (Figure 4). Also, there exists a trend in the abundance of Aedes mosquitoes recovered with increase in humidity and rainfall (Figure 5). Larval Survey and Adult Aedes Species Composition A total of 776 containers/tires were inspected from houses in 10 different communities in 10 LGAs of Oyo state, of these numbers, 254/500 (50.8%) of the houses had positive Aedes larvae/pupae and 361/776 (46.5%) of water retaining containers/tires had various positive immature stages of Aedes species (Table 2) . Adult Aedes mosquito was collected using BG trap, a total of 414 were recovered. The BG trap mimics convection currents created by a human body, it employs attractive visual cues, releases artificial emanations through a large surface area. It has a BG lure, a dispenser which releases a combination of non-toxic substances that are also found on human skin (ammonia, lactic acid and caproic acid) . There was a high abundance of Aedes aegypti in all the locations surveyed with fewer quantity of Aedes albopictus detected in Ido LGA and Ibadan South-east LGA while Aedes simpsoni was found at Iwajowa LGA (Table 3). The total Aedes species collected during the study period was 1015, consisting of Aedes aegypti 798/1015(78.6%) , Aedes albopictus 95/1015(12.3) and Aedes simpsoni 62/1012(9.1%) (Table 4). Anopheles and other species were also recovered from the 10 different communities in abundance. The number of mosquitoes recovered all over the study location during dry season was in the same range, there was however an appreciable increase all over the LGAs with Ido and Iwajowa having the highest Aedes mosquito abundance in rainy season followed by Ibadan South-East as seen in figure 6. Correlation coefficient r = 0.419166 , r = 0.568597, r = 0.601639 as seen in Table 5 all indicates a positive association between Dengue Fever vs No of Aedes Mosquito, Humidity and Rainfall respectively while r= -0.46593 shows a negative association between Dengue Fever vs temperature . The larval indices were high in all the communities sampled as seen in Table 6 Table 2: Household and Container Productivity of Aedes Species Per Community in Oyo State from April 2022 to April 2023 S/N LGA Location / Community Number of Houses Surveyed Number of Houses with Positive Aedes Pupae/Larvae Number of Containers/Tires Surveyed Number of Containers with Positive Aedes Larvae/Pupae 1 Ido Leo 50 23 94 41 2 Oyo East Araromi 50 34 75 32 3 Orelope Igboho 50 15 50 14 4 Ona Ara Kajola 50 16 92 18 5 Akinyele Falade- Olorisaoko 50 32 76 48 6 Oluyole Ire-Akari 50 28 71 45 7 Iwajowa Agbaruru 50 35 80 40 8 Ogbomoso South Arowomole 50 25 49 28 9 Ibarapa Central Igboora 50 21 67 37 10 Ibadan south east Oranyan 50 25 122 48 10 LGAs Total 500 254 (50.8%) 776 361 (46.5%) Table 3: Aedes(larval) Species Composition in Oyo State from Jan 2022 to April 2023 S/N LGA Community Aedes spp Number Total No 1 Ido Leo Ae. aegypti Ae. albopictus 89 33 122 2 Oyo East Araromi Ae. aegypti 54 54 3 Orelope Igboho Ae. aegypti 69 69 4 Ona Ara Kajola Ae. aegypti 40 40 5 Akinyele Falade- Olorisaoko Ae. aegypti 39 39 6 Oluyole Ire-Akari Ae. aegypti 47 47 7 Iwajowa Agbaruru Ae. aegypti Ae. simpsoni 82 25 107 8 Ogbomoso South Arowomole Ae. aegypti 21 21 9 Ibarapa Central Igboora Ae. aegypti 19 19 10 Ibadan Southeast Oranyan Ae. aegypti Ae. albopictus 71 12 83 Total 601 Table 4: Relative Abundance of all Aedes (Adult and Larval) Collected in Oyo State, Nigeria from April 2022 to April 2023 S/N Aedes Species Number Proportion 1 Aedes aegypti 798 78.6 2 3 Aedes albopictus Aedes simpsoni 125 92 12.3 9.1 Total 1015 100 Table 5: Correlation between DENV, Mosquitoes and environmental factors (Rainfall, Humidity and Temperature)Oyo State, Nigeria from January 2022 to April 2023 Dengue No of Aedes Mosquito Temperature Humidity Rainfall Dengue 1 No of Aedes Mosquito 0.419166* 1 Temperature -0.46593 -0.74949 1 Humidity 0.568597* 0.827154 -0.73563 1 Rainfall 0.601639 * 0.90958 -0.77836 0.923878 1 Interpretation: correlation coefficient r = 0.419166 , r = 0.568597, r = 0.601639 all indicates a positive and strong association between Dengue Fever vs No of Aedes Mosquito, Humidity and Rainfall respectively while r= -0.46593 shows a negative and weak association between Dengue Fever vs temperature Table 6 Larval Indices Aedes Collected in Oyo State from April 2022 to April 2023 S/N Local Government House index (%) Container index (%) Breteau Index (%) 1 Ido 46 43.6 82 2 Oyo East 68 42.7 64 3 Orelope 30 28 28 4 Ona Ara 32 19.6 36 5 Akinyele 64 63.2 96 6 Oluyole 56 63.4 90 7 Iwajowa 70 50 80 8 Ogbomoso South 50 57.1 56 9 Ibarapa Central 42 55.2 74 10 Ibadan Southeast 50 39.3 96 Generally, according to WHO guidelines larval index is considered low when House Index ˂ 5% and Breteau Index ˂ 4. It is high when House Index ≥5% and/or Breteau Index ≥4 3 . Discussion One Health is defined as the collaborative effort of multiple disciplines working locally, nationally and globally to attain optimal health for people, animals and the environment. The One Health paradigm emerged from the recognition that the wellbeing of humans, animals and ecosystems are interrelated and interdependent, and there is need for more systematic and cross-sectoral approaches to identifying and responding to global public health emergencies and other health threats arising at the human-animal ecosystem interface 10,11 . The One Health concept is, therefore, a worldwide strategy for expanding interdisciplinary collaborations and communications in all aspects of health care for humans, animals and the environment1 10,11 . Thus, this study adopted the one health approach in achieving the objectives of determining the sero-molecular prevalence of DENV, to assess the Aedes mosquito abundance and its arboviral carriage rate, as well as, to determine the influence of climatic and meteorological parameters on Aedes mosquito vector abundance in Oyo State, Nigeria. In Nigeria, there is growing evidence consequent upon lessons learned from response to previous outbreaks that no single sector/agency can sufficiently manage the challenges of myriads of public health threat battling the nation 10 . Experiences from the Lassa fever, COVID-19 outbreaks” responses and ongoing activities in combatting antimicrobial resistance have demonstrated the effectiveness of multi-sectoral, multi-agency approaches in dealing with public health issues. Consequently, the One Health approach has been advocated as the global framework for strengthening collaboration and capacities of the sectors and actors involved in health service delivery 10 . Dengue Fever Sero-Molecular Detection Prior to this study, the magnitude of DF in Oyo state and indeed in Nigeria remained unclear, as cases were underdiagnosed or misdiagnosed as malaria or referred to as pyrexia of unknown origin (PUO) if they fail to respond to antimalarial drugs 6,12 . The high detection rate (44.3%) of DENV among participants in this study, DF may arguably be responsible for some unclassified febrile illnesses; misdiagnosed as Malaria or as PUO. This is particularly so, because DF is usually not a differential diagnosis of acute febrile illness hence, testing is not usually requested. There is currently no ongoing surveillance activity dedicated to DF in Oyo state and the surveillance activity for DF in the NCDC needs to be strengthened. What exists are sero-prevalence and molecular studies carried out by individual researchers in various parts of the country which have confirmed high prevalence and transmission of DF in Nigeria 5,6,12 . Though DF has been declared a priority epidemic-prone disease, the reciprocal surveillance activity including testing of suspected cases or inclusion as differential testing for other VHF is missing. There are no sufficient morbidity and mortality data available on DF at the moment in Oyo state and Nigeria at large. In this study, DENV IgG was used to assess past exposure to infection, while DENV IgM to assess active or acute infection. The seroprevalence of 37.7% for DENV IgG was reported in this study which is in close range with the overall pooled DENV IgG prevalence of 32.8% reported by a systematic review and lower than a IgG seroprevalence of 77.0% previously reported by a study conducted in Osun State 4,12 . The DENV IgM seroprevalence of 6.6% reported in this study is lower than the IgM pooled seroprevalence of 16.8% reported by the same systematic review study and another study conducted previously conducted in Oyo State which reports IgM seroprevalence of 17.2% 12, 13 . The DENV positive IgM patients were seen mostly from Iwajowa LGA followed by Ibadan Southeast, Oluyole, Ido, Akinyele and Kajola LGAs, of the state. The relatively high prevalence of DENV in some of these LGAs could be due to the proximity of the localities to the dense rainforest which provide enabling breed sites for DENV vectors. This study also confirmed a high abundance of Aedes mosquitoes in the localities. More so, the primary host of the DENV, which is the non-human primates (NHP), is abundantly found in the forests 14 . From the aforementioned, it shows that this disease affects many people in Oyo state and is most likely responsible for a great proportion of febrile illnesses often misdiagnosed as malaria This study shows that the state is a high burden state for DENV and there is an urgent need to include DENV for routine diagnosis. The DENV RT-PCR for all samples tested were negative, this may be because DENV RNA is usually detectable in infected individuals a few days after infection till the sixth-day post-onset of clinical symptoms such as fever and headache 5 . In Nigeria where health-seeking behavior is poor and individuals tend to consult traditional, patent medicine vendors ahead of presenting at health care facilities and even when such patients come to the health facility, there is usually no routine laboratory testing capacity to screen for DENV, in such occasion DENV is usually missed out hence, it is possible that the samples were not obtained during the high infectious period 21,22 . DENV IgM is measurable from the third-day post symptom onset till the third month, while IgG is detectable from day 10 post-onset of symptoms and can remain detectable for months and years 16 . Hence, the serology test is more suitable for diagnosis, however, cross-reaction with other arbovirus and other limitations should be noted. In this study, some demographic and ecologic factors in the study location facilitated the spread of the DENV. The increase in DENV antibodies with age from adulthood suggests that infection occurs from middle to older age having an age range 15–29 followed by 30–44 with the highest proportion of DENV. Although seropositivity was higher in female participants, these results were not significant, suggesting that both sexes are equally infected in this region. More so, high level of IgG with low level of IgM, suggests infection in the past, thereby confirming the endemicity of DENV infection in the state. The high seroprevalence of DENV observed in this study may indicate poor level of public health interventions aimed at effectively controlling the vector transmission as well as interruption of the disease process. There is also the possibility of poor awareness of the presence of this disease in Oyo state and in Nigeria as a whole, hence, the reason for the absence of surveillance and routine testing. The high rate of urbanization in Oyo state equally explains the high prevalence of DENV especially in urban LGAs within Ibadan metropolis as the burden of DENV infection has been reported to be associated with the rising rate of urbanization, coupled with poor infrastructure in tropical and subtropical areas 10 . The mechanism behind the association between the high prevalence in DENV infection could be due to the high vector population and breeding sites because of urbanization and deforestation as reported in this study. The high number of these breeding sites is favoured by climatic as well as environmental patterns of Nigeria that encourage the development of mosquitoes hence, favouring enhanced DENV transmission 9,10 . Indeed, Aedes aegypti thrive better in warm and humid climatic conditions which typically exist in the study area 7 . This favours the survival of the mosquito eggs compared to the cold and temperate climatic regions which encourage hibernation while suppressing conservation and development 17,19 . In this study, cases of DENV were reported almost all year round with more cases reported in the rainy season of July to October. There also exists a positive and strong correlation between DF, humidity, and rainfall, this further demonstrates the high prevalence of arboviral disease in the rainy season. It will be of interest to conduct a similar study in the northern part of the country with lower rainfall and humidity and higher temperature. Entomological Findings and Detection of DENV in Aedes Mosquito Entomological findings from this study revealed a high abundance of Aedes aegypti in all the locations surveyed with few numbers of Aedes albopictus and Aedes simpsoni detected at Ido, Ibadan Southeast and Iwajowa LGAs respectively. This was observed all year round with month-by-month variation in mosquito abundance, mainly caused by rainfall as established by this study. A similar study conducted in Ekiti reported high recovery of Aedes aegypti which was attributed rainfall 7 . The all-year-round presence of Aedes species may be because their larvae can colonize and survive in almost all habitats such as barrels, drainages, tyres, pots, discarded plastics and bottles, and tanks from which they were trapped 7,8,9 . This study also revealed high larval indices as deduced from all the locations surveyed 3 . This is a surrogate marker and clear indication that those communities are at high risk of massive DF outbreaks and other arboviral diseases, in the presence of susceptible human population and competent disease vector 20 . In order to mitigate this, herd immunity to the prevalent arboviral disease through reactive mass vaccination for the vaccine preventable arboviral disease is advocated as well as massive, targeted vector control. In view of these, Oyo state is at risk of DF and other arboviral transmission, therefore multifaceted response actions are advocated. In essence many Aedes mosquito species collected in this study are known to be important vectors of arboviruses of public health importance. Furthermore, in this study high Aedes species abundance was found in months with high rainfall quantities with the peak in the months of July and August while the lowest number was in the month of February when there was little or no rains which agrees with a previous study done in Ibadan 16 . Mosquito populations varied during the study period in response to prevailing weather conditions. This research clearly demonstrates that changes in rainfall and relative humidity due to imminent climate changes and seasonal pattern variations modify the behavior and geographical distribution and abundance of Aedes mosquito vectors. Rainfall increases the opportunity for egg-laying by increasing the number of potential breeding sites for Aedes mosquitoes to lay eggs, which can reach adulthood within nine to twelve days, necessary for the mosquito life cycle. Rainfall is one of the climatic variables that aid in the multiplication of mosquito breeding places while humidity improves mosquito survival rates. The rainy season is a fertile period for breeding sites, which were numerous. Meteorological parameters are therefore good predictors of abundance of Aedes mosquitoes and their associated disease risks 8,12 . Coinfection of LASV and DENV So far, co-infection of DENV and LASV has not been well documented in Nigeria. In this study, both LASV and DENV were simultaneously laboratory confirmed in a 45year old male from Iwajowa LGA. The patient was positive for both LASV IgM and DENV IgM, this is similar to finding reported in Brazil which demonstrates co-infection of SARS-COV-2 and DENV 18 . This was the first case of human co-infection of DENV and LASV reported in Oyo State, Nigeria. This underscores the importance of an accurate and timely diagnosis for targeted and effective intervention. In conclusion, DF high seroprevalence rate documented in this study further underscores the need for heightened surveillance for this virus in Oyo State. Overall, these findings confirm ongoing transmission and exposure to DENV in Oyo State. Oyo State is therefore at significant risk of DENV and other arboviral outbreaks considering the high abundance of competent arboviral vectors, therefore multifaceted response actions are advocated. Findings from this study necessitate the need for the adoption of the One Health strategic approach to halt the spread of arboviral diseases. Contributions to Knowledge This study has provided useful information on the serostatus and ongoing transmission of DF in Oyo State and suggests the potential for a massive outbreak if the trends continue. Also, the Aedes specie vector abundance in Oyo State has been established. Declarations Ethical Considerations Ethical approval was obtained from the Institutional Review Board (IRB) of the Nigerian Institute of Medical Research (NIMR) IRB-19-006. Further permission was obtained from the Oyo State Ministry of Health Department of Public Health (SMOH/EPID/016/005) and the various officer-in-charge in the healthcare facilities before the commencement of the study. Informed consent was obtained from study participants. Consent for Publication Not applicable Availability of data and materials The datasets used and or analyzed during this current study are available from the corresponding author on reasonable request. Relevant data generated and analyzed during this study are included in the published article. Competing Interest All Authors declare that we do not have any competing interests. Funding This study was funded by Nigerian Institute of Medical Research (grant number 2NIMRGA-0026-21-0). Authors’ Contribution AOS and RAA conceptualized, designed the study, and embarked on fieldwork. JOS, OPA and BKA carried out the laboratory analysis. AOD provided expert guidance to the authors in performing the entomological surveillance. AOA, OTO, and IAO analyzed and interpreted the data. All authors were fully involved in every aspect of the work and contributed significantly, and all performed literature search, drafted the manuscript, and reviewed it for intellectual content. All authors approved the final manuscript before submission. Acknowledgements The authors acknowledge the valuable support provided by staff of the Centre for Human Genomics NIMR, especially Miss Fatimah Awonju, Miss Blessing Agada, and Mr. David Ojo regarding laboratory analysis part of this study. The Oyo State Ministry of Health Emergency Operations Centre staff led by the State Epidemiologist Dr Iyabo Kareem and the State Disease Surveillance and Notification Officer Mrs. Titilope Akinleye, State Laboratory Focal Person Mr Adigun Adeadayo for their support during the sample collection, active case search and entomological surveillance. We also appreciate the Entomology Team at the University of Ibadan led by Dr Ibrahim and Mr. Philips of the National Arbovirus and Vectors Research Centre for their support regarding the entomological surveillance aspect of this work. The teaching and non-teaching staff of the Department of Biological Sciences Lead City University led by the Head of Department Dr Felicia Adesina all well appreciated. References Katzelnick LC, Fonville JM, Gromowski GD, Bustos Arriaga J, Green A, James SL, Lau L, Montoya M, Wang C, VanBlargan LA, Russell CA, Thu HM, Pierson TC, Buchy P, Aaskov JG, Muñoz-Jordán JL, Vasilakis N, Gibbons RV, Tesh RB, Osterhaus AD, Fouchier RA, Durbin A, Simmons CP, Holmes EC, Harris E, Whitehead SS, Smith DJ. Dengue viruses cluster antigenically but not as discrete serotypes. Science 2015;349:1338-43. Reich NG, Shrestha S, King AA, Rohani P, Lessler J, Kalayanarooj S, Yoon IK, Gibbons RV, Burke DS, Cummings DA. Interactions between serotypes of dengue highlight epidemiological impact of crossimmunity. J R Soc Interface 2013;10:2013041 World Health Organisation. Guidelines for dengue surveillance and mosquito control.Western pacific Education in Action Series No 8. Geneva:WHO ;1995. M.A. Adeleke, M.A. Muhibi, E.I.O. Ajayi0, O.A. Idowu, M.T. Famodimu, & S.O.Olaniyan, Dengue virus specific immunoglobulin g antibodies among patients with febrile conditions in Osogbo, Southwestern Nigeria. Trop Biomed. 33(1), 2016, 1–7. I.A. Nasir, O.O. Agbede, A. Dangana, M. Baba, A.S. Haruna, Dengue virus non-structural Protein-1 expression and associated risk factors among febrile Patients attending University of Abuja Teaching Hospital, Nigeria. Virus Res , 2017;230:7-12. O.A. Adesina, & J.A. Adeniji, Incidence of Dengue virus infections in febrile episodes in Ile-Ife, Nigeria. Afr J Infect Dis 2016; 10:21-4. I.A. Simon-oke, & L.K Olofintoye., The Effect of Climatic Factors on the Distribution and Abundance of Mosquito Vectors in Ekiti State Journal of Biology, Agriculture and Healthcare www.iiste.org ISSN 2224-3208 (Paper) ISSN 2225-093X (Online) Vol.5, No.9, 2015. A.V. Opayele, J.A. Adeniji, K.T. Ibrahim, & O.D. Olaleye, Influence of Meteorological Variables on Diversity and Abundance of Mosquito Vectors in Two Livestock Farms in Ibadan, Nigeria: Public Health Implications J Mosq Res, 7(9), 2017, 70–78. doi:10.5376/jmr.2017.07.0009. Leopoldo M. Rueda Pictorial keys for the identification of mosquitoes (Diptera: Culicidae) associated with Dengue Virus Transmission (Zootaxa 589) 60 pp.; 30 cm. 3 2004 ISBN 1-877354-46-5 (Paperback) ISBN 1-877354-47-3 (Online edition) Shen, Kow-Ton Emerging Infectious Diseases and One Health: Implication for Public Health; International Journal of Environmental Research and Public Health , 19(15) 9081. 2022 https://doi.org/10.3390/ijerph19159081 Al Awaidy ST, Khamis F. Dengue fever: an emerging disease in Oman requiring urgent public health interventions. Oman Med J. 2019;34(2):91–93. doi: 10.5001/omj.201 A.U. Emeribe, I.N. Abdullahi, I.K. Isong, A.O. Emeribe, J.O. Nwofe, & B.I. Shuaib, Dengue virus is hyperendemic in Nigeria from 2009 to 2020: A contemporary systematic review. Infect Chemother, 53(2), 2021, 284–99. Oladipo E.K., C. Amanetu, T.A Gbadero , J.K. Oloke Detectable Anti-dengue Virus IgM Antibodies among Healthy Individuals In Ogbomoso, Oyo State, Nigeria American Journal of Infectious Diseases 10(2): 64-67,2014 Back, A.T. & Lundkvist, A. Dengue Viruses - An Overview. Infection Ecology & Epidemiology, 3(9), 2013, 11-16. Fagbami, A.H., Monath, T.P. & Fabiyi, A. Dengue virus infections in Nigeria: a survey for antibodies in monkeys and humans. Transactions of the Royal Society of Tropical Medicine and Hygiene, 71, 1977, 60–65. Oderinde BS, Mora-Cárdenas E, Carletti T, Baba MM, Marcello A. Prevalence of locally undetected acute infections of Flaviviruses in North-Eastern Nigeria. Virus Res 2020;286:198060. Baba, M.M. & Talle, M. The Effect of Climate on Dengue Virus Infections in Nigeria. New York Science Journal, 4(1), 2011, 28-33. Naira Bicudo,Eliana Bicudo,Julia Duarte Costa Co-infection of SARS-CoV-2 and Dengue virus: a clinical challenge Braz J infect Dis 24(5) 2020 452-454 Bhatt, S., Gething, P.W., Brady, O.J., Messina, J.P., Farlow, A.W. & Moyes, C.L, The global Distribution and Burden of Dengue. Nature, 496, 2011, 504-507. Faneye, A., Idika, N., Motayo, B.O., Adesanmi, A. & Afocha, E. Serological evidence of recent dengue virus infection among febrile children in a semi-arid zone. American Journal of Infectious Diseases, 9, 2013, 7-10. Olasehinde N.(2018). Healthcare Seeking Behaviour In Nigeria .Journal Of Population And Social Studies , 26(3),207-218 Ayukekbong J.A .,2014 Dengue Virus in Nigeria: Current Status and Future Perspective . British Journal of Virology ,1(3) :106-111. B. Bassey, E. Braka, F. Onyibe, Rosemary 2022, Changing Epidemiology of Yellow Fever Virus in Oyo State, Nigeria. BMC Public Health 22:467 Cite Share Download PDF Status: Published Journal Publication published 29 Jan, 2025 Read the published version in One Health Outlook → Version 1 posted Editorial decision: Major revision 11 Jul, 2024 Reviewers agreed at journal 09 Jul, 2024 Reviewers invited by journal 19 Jun, 2024 Editor assigned by journal 26 May, 2024 First submitted to journal 25 May, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4476878","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":316445179,"identity":"d720e75f-71c0-4925-93bc-c6d383878bf7","order_by":0,"name":"Olawale Sunday Animasaun","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABQ0lEQVRIiWNgGAWjYDACdhBRAGYagAgeqLgNEDM2HsCmhRmuGFVLGkhLA1FaYOAwmMSmhZ+Z+ZnEDwMbe4PbzRs/89TckdFtP/7wM++O83Zr2w8DbamxiUbTItnMZibZY5CWuOHOsWJpnmPPeMzO5BhL8565nbztTCJQy7G03AZULQaHGcxu8BgcTjC4kWMgzcN2mMfsQA6DNG/b7WSzA0AtjA2HMbWwf7v5x+C/PVCL8W+ef0At558//s3bdi7Z7PxDHFp4zG7zGBxg3HAjxwxoOJB7IwHEOGBndgO7LZLNPOW/ZQySE2feSCuznNsH0vLGzHJuW3KC2Q2gLQmYfuFnb99s+KbCzp7vRvLmG2++HbY3O5/++MbbNjsQ4+GDDzU26FpQABMPEicRrDIBj3IQYPyBxLEnoHgUjIJRMApGDgAAVrGA0EN8EYAAAAAASUVORK5CYII=","orcid":"https://orcid.org/0000-0002-5203-6174","institution":"Lead City University","correspondingAuthor":true,"prefix":"","firstName":"Olawale","middleName":"Sunday","lastName":"Animasaun","suffix":""},{"id":316445180,"identity":"432e1616-0129-4fa0-9ee3-ef2f3e03ad7d","order_by":1,"name":"Joseph Ojonugwa Shaibu","email":"","orcid":"","institution":"Nigerian Institute of Medical Research","correspondingAuthor":false,"prefix":"","firstName":"Joseph","middleName":"Ojonugwa","lastName":"Shaibu","suffix":""},{"id":316445181,"identity":"ce7ed55f-2a23-43ec-93b2-a27eb2e2f6f6","order_by":2,"name":"Busayo Kayode Akomolafe","email":"","orcid":"","institution":"Lead City University","correspondingAuthor":false,"prefix":"","firstName":"Busayo","middleName":"Kayode","lastName":"Akomolafe","suffix":""},{"id":316445182,"identity":"d3af83db-d198-45ad-b98a-8dfd17692184","order_by":3,"name":"Olamide Priscilla Animasaun","email":"","orcid":"","institution":"Federal University of Agriculture Abeokuta","correspondingAuthor":false,"prefix":"","firstName":"Olamide","middleName":"Priscilla","lastName":"Animasaun","suffix":""},{"id":316445183,"identity":"c01ee8cc-db36-40ad-a891-36577aace91d","order_by":4,"name":"Akinfemi Oyewumi Akinyode","email":"","orcid":"","institution":"Oyo State Government","correspondingAuthor":false,"prefix":"","firstName":"Akinfemi","middleName":"Oyewumi","lastName":"Akinyode","suffix":""},{"id":316445184,"identity":"0652c96f-ee08-451f-b769-09a5a519d04d","order_by":5,"name":"Olukemi Titilope Olugbade","email":"","orcid":"","institution":"Obafemi Awolowo University Teaching Hospital Complex","correspondingAuthor":false,"prefix":"","firstName":"Olukemi","middleName":"Titilope","lastName":"Olugbade","suffix":""},{"id":316445185,"identity":"d9644510-6f4b-46ef-8e67-8e97889b59d1","order_by":6,"name":"Ibukun Akinsola Omisakin","email":"","orcid":"","institution":"McPherson University","correspondingAuthor":false,"prefix":"","firstName":"Ibukun","middleName":"Akinsola","lastName":"Omisakin","suffix":""},{"id":316445186,"identity":"778f7c5b-75a0-4f6f-ab72-8729c0c4b7a0","order_by":7,"name":"Adedapo Olufemi Adeogun","email":"","orcid":"","institution":"Nigerian Institute of Medical Research","correspondingAuthor":false,"prefix":"","firstName":"Adedapo","middleName":"Olufemi","lastName":"Adeogun","suffix":""},{"id":316445187,"identity":"d47fe10d-20e4-4027-b497-f231763e8e19","order_by":8,"name":"Rosemary Ajuma Audu","email":"","orcid":"","institution":"Nigerian Institute of Medical Research","correspondingAuthor":false,"prefix":"","firstName":"Rosemary","middleName":"Ajuma","lastName":"Audu","suffix":""}],"badges":[],"createdAt":"2024-05-25 13:04:06","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4476878/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4476878/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s42522-024-00121-9","type":"published","date":"2025-01-29T15:57:52+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":60600031,"identity":"9a472c0a-f704-49bf-9545-272321e89552","added_by":"auto","created_at":"2024-07-18 16:00:38","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":23837,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSeroprevalence of DENV in Oyo state, Nigeria\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-4476878/v1/b878dd81e21d124e74995bd2.png"},{"id":60600029,"identity":"d1d5455c-b1ee-4a26-ac3a-741581c5d32b","added_by":"auto","created_at":"2024-07-18 16:00:38","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":31336,"visible":true,"origin":"","legend":"\u003cp\u003eDistribution of DENV IgM positive persons by Local Government Area in Oyo State, Nigeria\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-4476878/v1/3eb96b0a102b47ea4c4e274a.png"},{"id":60600035,"identity":"9a559579-6b7b-4a25-b1aa-808180f10faf","added_by":"auto","created_at":"2024-07-18 16:00:38","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":25848,"visible":true,"origin":"","legend":"\u003cp\u003eSex and Age Distribution of DENV IgM Confirmed Cases in Oyo State from Jan 2022 to April 2023\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-4476878/v1/b42e360bef6aad6770a916c4.png"},{"id":60600032,"identity":"040c6cb3-9b10-4362-8399-d13f7ebb632e","added_by":"auto","created_at":"2024-07-18 16:00:38","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":28059,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMonthly Distribution of DENV IgM Confirmed Cases in Oyo State from Jan\u003c/strong\u003euary\u003cstrong\u003e 2022 to April 2023\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-4476878/v1/82dac9b8c024479f349d0452.png"},{"id":60601936,"identity":"34f803b3-0011-4e76-ab44-a938165b3f1e","added_by":"auto","created_at":"2024-07-18 16:08:38","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":73765,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMonthly Abundance of Aedes Species with Environmental Factors\u003c/strong\u003e (\u003cstrong\u003eTemperature, Humidity, and Rainfall\u003c/strong\u003e)\u003cstrong\u003e in Oyo State Nigeria, May 2022 to April 2023\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-4476878/v1/3b265462fbf8479e8f15ff01.png"},{"id":60600033,"identity":"3dd95078-db5c-4d49-9a2c-7585a0d925f3","added_by":"auto","created_at":"2024-07-18 16:00:38","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":36048,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSeasonal abundance of all Aedes mosquitoes in selected LGAs in Oyo state May 2022 to April 2023\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-4476878/v1/6f31e8f6df794d1c8fc7617d.png"},{"id":75351303,"identity":"6c31b3e1-f993-40b0-9d2f-d29d6256d87f","added_by":"auto","created_at":"2025-02-03 16:09:10","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2134867,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4476878/v1/e58505e5-be9f-485a-9a70-9802301847fa.pdf"}],"financialInterests":"","formattedTitle":"Enhancing Surveillance for Dengue Fever in Oyo State, Nigeria – a One Health Approach","fulltext":[{"header":"Introduction","content":"\u003cp\u003eDengue fever (DF) is an arboviral infection caused by dengue virus (DENV) of the Flaviviridae family. It is transmitted to humans through bites of infected mosquitoes of \u003cem\u003eAedes species\u003c/em\u003e. Four related but antigenically discrete serotypes (serotypes 1\u0026ndash;4) with 62\u0026ndash;67% sequence homology of the DENV have been identified.\u003csup\u003e1\u003c/sup\u003e The classification of the four serotypes was based on the immunological response of patients to primary DENV infection by one of the serotypes. A primary infection of DENV protects against a secondary infection by a homologous DENV serotype but confers partial and transient protection against a heterologous DENV serotype.\u003csup\u003e2\u003c/sup\u003e\u003c/p\u003e \u003cp\u003eThe incidence and magnitude of DF outbreaks have increased significantly as the virus itself and mosquito vector has both expanded geographically in tropical and subtropical regions. Consequently, 129 countries are at risk, with over 3.9\u0026nbsp;billion people and an estimated 96\u0026nbsp;million symptomatic cases with a projected 40,000 deaths each year \u003csup\u003e3\u003c/sup\u003e. Furthermore, in Africa and Asia, there is a high impending possibility for the re-emergence of sylvatic dengue in the human transmission cycle due to deforestation, climate change, and vector geographical expansion\u003csup\u003e4\u003c/sup\u003e. Dengue is a high-burden disease that disproportionately affects countries in the tropics and subtropics, many of which have limited healthcare resources.\u003c/p\u003e \u003cp\u003eIn Nigeria, DF is endemic in almost all the states nationwide and could be the leading cause of unclassified febrile illnesses \u003csup\u003e5\u003c/sup\u003e. Dengue fever has a mixed distribution among urban, and rural areas and was previously predominantly reported in urban areas than in rural areas\u003csup\u003e5\u003c/sup\u003e. In Oyo State and in Nigeria, DENV and other arboviruses have a high potential to cause serious public health impact, due to the high density of the competent disease vectors, the existence of pockets of unvaccinated and susceptible populations due to low Yellow Fever (YF) vaccination coverage and non-availability of vaccines for other arboviral infections. Other limitations include epidemiological gaps, slow detection of cases, as well as inadequate engagement of local healthcare providers in disease surveillance and management\u003csup\u003e6,23\u003c/sup\u003e. Central to the epidemiology of DENV and other arboviral infections, is the requirement for mosquito-borne transmission to primate hosts, these viruses are transmitted to man (and other vertebrates) by the bite of an arthropod vector, primarily mosquitoes. Despite the presence of the virus in the blood and bodily secretions during acute infection, DENV infection is not contagious. Consequently, available reservoirs of infectious viruses and high levels of vector populations are prerequisites for epidemic outbreaks. Having known this, Integrated vector management and control strategies, prompt case detection and management, are the main strategies for the prevention and control of dengue virus transmission.\u003c/p\u003e \u003cp\u003eMany arboviruses are circulating in Nigeria, YF for example, has caused large epidemics in the past. There is also serologic evidence of human infection with YF, DF, West Nile and Zika virus. There are reports that many clinical arbovirus infections have been misdiagnosed as malaria and typhoid fever in the country\u003csup\u003e6\u003c/sup\u003e. DF endemicity in Oyo state and Nigeria as whole is an ongoing phenomenon with its attendant burden on the health, economical, socio-political spheres of the country. The magnitude of these is yet to be evaluated.\u003c/p\u003e \u003cp\u003eFurthermore, DF has a propensity to be severe and life-threatening as seen with the Dengue Haemorrhagic Fever (DHF) and Dengue Shock Syndrome (DSS) forms of the disease. A seroprevalence study carried out in Osun state, South-west Nigeria, indicates that the IgG prevalence of DF is 77%. This indeed is very high, showing that this disease affects a large number of people and is most likely responsible for a great proportion of febrile illnesses often misdiagnosed for malaria due to lack of routine diagnosis\u003csup\u003e4,6\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eThe existence of several DENV serotypes in Nigeria, indicates that large and repeated epidemics of DHF/DSS may happen in the future. DF surveillance is therefore crucial for the monitoring of the disease frequency or trend, discovery of outbreaks or new mutation, to trigger timely interventions. Outbreak alerts are essential to mobilize vector control and to prepare healthcare delivery services in readiness for a surge in frequency. This should be viewed in the context of the challenges encountered in the process of discovering and producing efficacious and effective anti-DENV drugs and vaccine which are yet to be available.\u003c/p\u003e \u003cp\u003eEntomological investigations have confirmed the presence of the vectors \u003cem\u003eAedes aegypti\u003c/em\u003e and \u003cem\u003eAedes africanus\u003c/em\u003e in several states across Nigeria\u003csup\u003e7\u003c/sup\u003e. These reflect the activities of several competent mosquito vectors, capable of transmitting arboviral infections from reservoirs to other hosts in the country\u003csup\u003e8\u003c/sup\u003e. Some of these mosquito vectors have been implicated following past arbovirus epidemics. Knowledge of the species composition and fluctuations that takes place in mosquito vector populations in response to abiotic environmental conditions, principally weather, is necessary to identify periods when these vectors thrive the most and when arboviruses are at their peak of transmission. A multidisciplinary and multisectoral collaboration, through a One Health approach which this study was designed to achieve, is therefore required to effectively prepare, detect, assess, and respond to emerging and endemic arboviral diseases. In this study we investigated the public health burden, meteorological influence, high-risk groups, and abundance of \u003cem\u003eAedes\u003c/em\u003e mosquitoes and DENV carriage rate of \u003cem\u003eAedes\u003c/em\u003e mosquito in Oyo State.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cp\u003e\u003cstrong\u003eStudy Area\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eOyo State is in the South-West geopolitical zone of Nigeria with Ibadan city as the capital. This State has 33 Local Governments Areas (LGAs) and 29 Local Council Development Areas (LCDAs) and a projected population of 9,233,010 with an annual growth rate of 3.4 according to the National Population Commission 2019 report.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStudy Location\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHuman and entomological surveillance took place in 10 high-risk LGAs in Oyo State where confirmed cases of an arboviral or viral haemorhagic infection(s) had been reported by researchers, the State Ministry of Health and the Nigerian Centre for Disease Control (NCDC).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStudy Design\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis was a cross sectional study that involved human and entomological surveillance for DENV. The duration of study for human sampling was Jan 2022 to April 2023 while the entomological surveillance took place from April 2022 to April 2023.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePopulation of the Study\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe study population were drawn from febrile in and out-patients attending selected healthcare facilities in the selected LGAs based on case definitions for DF which asserts that a DF suspected case is \u0026ldquo;anybody with acute febrile illness of 2-7 days duration with at least one or more of the following symptoms: headache, myalgia, arthralgia, rash, vomiting, anorexia, haemorhhagic manifestations and, leucopenia. Febrile patients with confirmed diagnosis of other infections and those outside study areas and non-consenting patients were excluded from the study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSampling Techniques\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA purposive sampling technique was used in the enrollment of study participants for this study.\u003c/p\u003e\n\u003cp\u003eThis involves active case search in communities and health facilities involving house-to-house case finding, health facilities records, etc.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Collection Techniques\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA quantitative approach using structured tools was adopted for data collection. Semi-structured interviewer-administered questionnaires were used to obtain information from selected consenting participants\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSample Collection, Transportation, and Storage\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFive (5) mls of whole blood was aseptically collected via venipuncture into Ethylene Diamine Tetraacetic Acid (EDTA) anticoagulant bottle and transported from the field to the laboratory using a triple packaging system in a geostyle at +2\u003csup\u003e0\u003c/sup\u003eC to 4\u003csup\u003e0\u003c/sup\u003eC. The samples were centrifuged for 5mins at 3000 rpm to obtain the plasma which was aliquoted into two parts for serology and molecular testing and then stored frozen at -20\u003csup\u003e0\u003c/sup\u003eC.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eLaboratory analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll laboratory processes were performed at the Center for Human Virology and Genomics, Nigerian Institute of Medical Research (NIMR), Yaba, Lagos, Nigeria.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eRNA Extraction Process:\u0026nbsp;\u003c/strong\u003eFollowing manufacturer\u0026rsquo;sinstructions, RNA was extracted from human plasma and mosquitoes (mechanically crushed) using Jena Bioscience Viral DNA+RNA purification Kit (Jena, Germany).Extracted RNAs were Stored at -20\u003csup\u003eo\u003c/sup\u003eC for further processing.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eReal-Time PCR Analysis:\u0026nbsp;\u003c/strong\u003eOne-step reverse transcriptase (RT) real-time (qPCR) was carried out to detect the pathogen using Quant Studio5 machine. The amplification steps encompass denaturation, primer annealing and elongation. Optimization of the PCR conditions was done for optimum amplification of the genes. Positive and negative controls were set up and run along with the test.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePCR Mix Components:\u0026nbsp;\u003c/strong\u003eThe PCR mix was made up of 25\u0026micro;l containing 10 \u0026micro;l enzyme mix, 0.8\u0026micro;l of forward and reverse primers; 0.4 \u0026micro;l for probes, 6 \u0026micro;l of nuclease free water and 5 \u0026micro;l of RNA template was set up. A Ctvalue of \u0026lt;38 was adjudged to be positive for viral pathogen.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCycling Conditions:\u0026nbsp;\u003c/strong\u003eInitial denaturation at 94˚C for 5mins, then by 36 cycles of denaturation at 94˚C for 30 sec, annealing at 55˚C for 30 secs and elongation at 72˚C for 45 sec. Followed by a final elongation step at 72˚C for 7 minutes and hold temperature at 10 ˚C.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePrimer and Probe used for the Detection of DENV\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eForward AAACCGCGTGTCGACTGTGC\u003c/p\u003e\n\u003cp\u003eReverse TAGGAAACGAAGGAATGCCACC\u003c/p\u003e\n\u003cp\u003eProbe FAM-5\u0026rsquo;CACTTGGAATGCTGCAGGGACGAGGACC\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSerological analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA one-step lateral flow immunoassay cassette test kit from Zijian Biotechnology, Shenzhen, China was used following manufacturers instruction for detection of Dengue Virus specific IgG and IgM while ReLASV\u0026reg; Pan-Lassa NP IgG ELISA Kit (Human anti-LASV NP Antibody) was used for detection of IgM antibodies against LASV for samples found positive to DENV Ig M.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEntomological Surveillance\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eVector Trapping, Identification, Transportation and Processing\u003c/p\u003e\n\u003cp\u003eTwo entomological approaches were employed in the survey: Larval/Pupae survey and use of Biogents Sentinel Trap (BG Trap) for adult mosquito. The sampling of mosquitoes broadly targets \u003cem\u003eAedes\u003c/em\u003e species as studies have implicated its role in the transmission of a variety of viruses\u003csup\u003e9\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMosquito Identification and Preservation\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAdult mosquitoes collected in the field and those reared to adults from immature collections were killed by freezing at -20\u0026ordm; C for 20 min. The specimens were morphologically identified to species level using appropriate taxonomic keys, they were sorted out and identified by morphological characteristics with the key aids of Leopoldo M. Rueda\u003csup\u003e9\u003c/sup\u003e. They were later counted, recorded and introduced into well-labeled Eppendorf tubes containing RNA later(shield) and then stored frozen at -20\u003csup\u003e0\u003c/sup\u003eC.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Management and Analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eData was analyzed using Epi info Statistical package Version 7.0 and Microsoft Excel. Quantitative data was presented using tables and charts. Correlation analysis was used to test the association between Dengue Fever, \u003cem\u003eAedes\u003c/em\u003e mosquito vector abundance, and environmental factors (temperature, rainfall, and relative humidity).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthical Considerations\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eEthical approval was obtained from the Institutional Review Board (IRB) of the Nigerian Institute of Medical Research (NIMR) IRB-19-006. Further permission was obtained from the Oyo State Ministry of Health Department of Public Health (SMOH/EPID/016/005) and the various officer-in -charge in the health care facilities before the commencement of the study. Informed consent was obtained from study participants.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eSociodemographic of Study Participants\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA total of 289 febrile patients were enrolled into this study, there were more female respondents 164/289 (56.7%) and the age group 30-44 years constituted the majority 106(36.7%) (Table 1). Clinical symptoms among the DENV positive cases were high grade fever \u0026gt;38\u003csup\u003eo\u003c/sup\u003eC 19/19 (100%), fatigue 12/19 (63.2%) and jaundice 2/19 (10.5%).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 1 Socio-demographic Characteristics of Participants in Oyo State January 2022-April 2023\u003c/strong\u003e \u0026nbsp;\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" align=\"\" width=\"720\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"38.41886269070735%\"\u003e\n \u003cp\u003e\u003cstrong\u003eVariables\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"26.768377253814148%\"\u003e\n \u003cp\u003e\u003cstrong\u003eFrequency(N=289)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"34.8127600554785%\"\u003e\n \u003cp\u003e\u003cstrong\u003ePercentage (%)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"38.41886269070735%\"\u003e\n \u003cp\u003e\u003cstrong\u003eSex\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"26.768377253814148%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"34.8127600554785%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"38.41886269070735%\"\u003e\n \u003cp\u003eMale\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"26.768377253814148%\"\u003e\n \u003cp\u003e125\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"34.8127600554785%\"\u003e\n \u003cp\u003e43.3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"38.41886269070735%\"\u003e\n \u003cp\u003eFemale\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"26.768377253814148%\"\u003e\n \u003cp\u003e164 \u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"34.8127600554785%\"\u003e\n \u003cp\u003e56.7\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"38.41886269070735%\"\u003e\n \u003cp\u003e\u003cstrong\u003eAge group in years\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"26.768377253814148%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"34.8127600554785%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"38.41886269070735%\" valign=\"top\"\u003e\n \u003cp\u003e0-14\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"26.768377253814148%\" valign=\"top\"\u003e\n \u003cp\u003e41\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"34.8127600554785%\"\u003e\n \u003cp\u003e\u0026nbsp;14.2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"38.41886269070735%\" valign=\"top\"\u003e\n \u003cp\u003e15-29\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"26.768377253814148%\" valign=\"top\"\u003e\n \u003cp\u003e58\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"34.8127600554785%\"\u003e\n \u003cp\u003e20.0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"38.41886269070735%\" valign=\"top\"\u003e\n \u003cp\u003e30-44\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"26.768377253814148%\" valign=\"top\"\u003e\n \u003cp\u003e106\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"34.8127600554785%\"\u003e\n \u003cp\u003e36.7\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"38.41886269070735%\" valign=\"top\"\u003e\n \u003cp\u003e45-59\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"26.768377253814148%\" valign=\"top\"\u003e\n \u003cp\u003e54\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"34.8127600554785%\"\u003e\n \u003cp\u003e18.7\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"38.41886269070735%\" valign=\"top\"\u003e\n \u003cp\u003eAbove 60\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"26.768377253814148%\" valign=\"top\"\u003e\n \u003cp\u003e30\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"34.8127600554785%\"\u003e\n \u003cp\u003e10.4\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"38.41886269070735%\"\u003e\n \u003cp\u003e\u003cstrong\u003eEducational level\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"26.768377253814148%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"34.8127600554785%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"38.41886269070735%\"\u003e\n \u003cp\u003eNo formal education\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"26.768377253814148%\"\u003e\n \u003cp\u003e96\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"34.8127600554785%\"\u003e\n \u003cp\u003e33.2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"38.41886269070735%\"\u003e\n \u003cp\u003ePrimary\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"26.768377253814148%\"\u003e\n \u003cp\u003e105\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"34.8127600554785%\"\u003e\n \u003cp\u003e36.3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"38.41886269070735%\"\u003e\n \u003cp\u003eSecondary\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"26.768377253814148%\"\u003e\n \u003cp\u003e58\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"34.8127600554785%\"\u003e\n \u003cp\u003e20.0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"38.41886269070735%\"\u003e\n \u003cp\u003eTertiary\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"26.768377253814148%\"\u003e\n \u003cp\u003e30\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"34.8127600554785%\"\u003e\n \u003cp\u003e10.4\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"38.41886269070735%\"\u003e\n \u003cp\u003e\u003cstrong\u003eProfession/Employment status\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"26.768377253814148%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"34.8127600554785%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"38.41886269070735%\"\u003e\n \u003cp\u003eCivil servant\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"26.768377253814148%\"\u003e\n \u003cp\u003e45\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"34.8127600554785%\"\u003e\n \u003cp\u003e17.0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"38.41886269070735%\"\u003e\n \u003cp\u003eFarming\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"26.768377253814148%\"\u003e\n \u003cp\u003e59\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"34.8127600554785%\"\u003e\n \u003cp\u003e20.4\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"38.41886269070735%\"\u003e\n \u003cp\u003eCattle Breeders\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"26.768377253814148%\"\u003e\n \u003cp\u003e80\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"34.8127600554785%\"\u003e\n \u003cp\u003e27.7\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"38.41886269070735%\"\u003e\n \u003cp\u003eSelf-employed\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"26.768377253814148%\"\u003e\n \u003cp\u003e47\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"34.8127600554785%\"\u003e\n \u003cp\u003e16.3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"38.41886269070735%\"\u003e\n \u003cp\u003eTrading\u003c/p\u003e\n \u003cp\u003eUnemployed\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"26.768377253814148%\"\u003e\n \u003cp\u003e28\u003c/p\u003e\n \u003cp\u003e10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"34.8127600554785%\"\u003e\n \u003cp\u003e9.7\u003c/p\u003e\n \u003cp\u003e3.5\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"38.41886269070735%\"\u003e\n \u003cp\u003eStudents\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"26.768377253814148%\"\u003e\n \u003cp\u003e22\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"34.8127600554785%\"\u003e\n \u003cp\u003e7.6\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMolecular Results of Human and Mosquitoes Samples\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eRT-qPCR analysis of the RNA extracted from all human blood samples collected from our study participants and mosquitoes\u0026rsquo; samples were negative for DENV RNA.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSerological Results\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe overall seroprevalence of DENV in Oyo state was 128/289 (44.3%) consisting of 19/289 (6.6%) and 109/289 (37.7%) IgM and IgG positive , 8/289 (2.8%) of the participants were simultaneously positive for IgM and IgG specific DENV (Figure 1).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe distribution of DENV positive IgM patients by LGAs (Figure 2) showed five (26.3%) patients from Iwajowa LGA, four (21.1%) from Ibadan Southeast and Oluyole LGAs, two (10.5%) from Ido and Akinyele LGAs, with one person (5.3%) in both Kajola and Oyo East LGAs were identified Females 11/19(57.9%) and the age group 30-44 years were the most affected (Figure 3). A Patient was positive for both LASV IgM and DENV IgM. In this study, DENV positive cases were reported almost all year round with more cases reported in the months of the rainy season July to October (Figure 4). Also, there exists a trend in the abundance of \u003cem\u003eAedes\u003c/em\u003e mosquitoes recovered with increase in humidity and rainfall (Figure 5).\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eLarval Survey and Adult Aedes Species Composition\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA total of 776 containers/tires were inspected from houses in 10 different communities in 10 LGAs of Oyo state, of these numbers, 254/500 (50.8%) of the houses had positive Aedes larvae/pupae and 361/776 (46.5%) of water retaining containers/tires had various positive immature stages of Aedes species (Table 2)\u003cem\u003e.\u0026nbsp;\u003c/em\u003eAdult Aedes mosquito was collected using BG trap, a total of 414 were recovered. The BG trap mimics convection currents created by a human body, it employs attractive visual cues, releases artificial emanations through a large surface area. It has a BG lure, a dispenser which releases a combination of non-toxic substances that are also found on human skin (ammonia, lactic acid and caproic acid)\u003cem\u003e.\u003c/em\u003e \u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThere was a high abundance of \u003cem\u003eAedes aegypti\u003c/em\u003e in all the locations surveyed with fewer quantity of \u003cem\u003eAedes albopictus\u003c/em\u003e detected in Ido LGA and Ibadan South-east LGA while \u003cem\u003eAedes simpsoni\u0026nbsp;\u003c/em\u003ewas found at Iwajowa LGA\u003cem\u003e\u0026nbsp;(Table 3).\u0026nbsp;\u003c/em\u003eThe total Aedes species collected during the study period was 1015, consisting of \u003cem\u003eAedes aegypti\u0026nbsp;\u003c/em\u003e798/1015(78.6%)\u003cem\u003e, Aedes albopictus\u0026nbsp;\u003c/em\u003e95/1015(12.3)\u003cem\u003e\u0026nbsp;and Aedes simpsoni\u0026nbsp;\u003c/em\u003e62/1012(9.1%) (Table 4).\u003cem\u003e\u0026nbsp;\u003c/em\u003eAnopheles and other species were also recovered from the 10 different communities in abundance.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe number of mosquitoes recovered all over the study location during dry season was in the same range, there was however an appreciable increase all over the LGAs with Ido and Iwajowa having the highest Aedes mosquito abundance in rainy season followed by Ibadan South-East as seen in figure 6.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eCorrelation coefficient r =\u003cem\u003e\u0026nbsp;\u003c/em\u003e0.419166\u003cem\u003e,\u0026nbsp;\u003c/em\u003er = 0.568597, r = 0.601639 as seen in Table 5 all indicates a positive association between Dengue Fever vs No of Aedes Mosquito, Humidity and Rainfall respectively while r= -0.46593 shows a negative association between Dengue Fever vs temperature\u003cstrong\u003e.\u0026nbsp;\u003c/strong\u003eThe larval indices were high in all the communities sampled as seen in Table 6\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 2: Household and Container Productivity of Aedes Species Per Community \u003cem\u003ein Oyo State from April 2022 to April 2023\u003c/em\u003e\u003c/strong\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" width=\"761\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"5.519053876478318%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eS/N\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.300919842312746%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eLGA\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.140604467805518%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eLocation /\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eCommunity\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.614980289093298%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eNumber of Houses Surveyed\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.922470433639948%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eNumber of Houses with Positive Aedes Pupae/Larvae\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.16294349540079%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eNumber of Containers/Tires\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eSurveyed\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"22.339027595269382%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eNumber of Containers with Positive \u003cem\u003eAedes\u0026nbsp;\u003c/em\u003eLarvae/Pupae\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"5.519053876478318%\" valign=\"top\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.300919842312746%\" valign=\"top\"\u003e\n \u003cp\u003eIdo\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.140604467805518%\" valign=\"top\"\u003e\n \u003cp\u003eLeo\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.614980289093298%\" valign=\"top\"\u003e\n \u003cp\u003e50\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.922470433639948%\" valign=\"top\"\u003e\n \u003cp\u003e23\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.16294349540079%\" valign=\"top\"\u003e\n \u003cp\u003e94\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"22.339027595269382%\" valign=\"top\"\u003e\n \u003cp\u003e41\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"5.519053876478318%\" valign=\"top\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.300919842312746%\" valign=\"top\"\u003e\n \u003cp\u003eOyo East\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.140604467805518%\" valign=\"top\"\u003e\n \u003cp\u003eAraromi\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.614980289093298%\" valign=\"top\"\u003e\n \u003cp\u003e50\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.922470433639948%\" valign=\"top\"\u003e\n \u003cp\u003e34\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.16294349540079%\" valign=\"top\"\u003e\n \u003cp\u003e75\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"22.339027595269382%\" valign=\"top\"\u003e\n \u003cp\u003e32\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"5.519053876478318%\" valign=\"top\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.300919842312746%\" valign=\"top\"\u003e\n \u003cp\u003eOrelope\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.140604467805518%\" valign=\"top\"\u003e\n \u003cp\u003eIgboho\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.614980289093298%\" valign=\"top\"\u003e\n \u003cp\u003e50\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.922470433639948%\" valign=\"top\"\u003e\n \u003cp\u003e15\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.16294349540079%\" valign=\"top\"\u003e\n \u003cp\u003e50\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"22.339027595269382%\" valign=\"top\"\u003e\n \u003cp\u003e14\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"5.519053876478318%\" valign=\"top\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.300919842312746%\" valign=\"top\"\u003e\n \u003cp\u003eOna Ara\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.140604467805518%\" valign=\"top\"\u003e\n \u003cp\u003eKajola\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.614980289093298%\" valign=\"top\"\u003e\n \u003cp\u003e50\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.922470433639948%\" valign=\"top\"\u003e\n \u003cp\u003e16\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.16294349540079%\" valign=\"top\"\u003e\n \u003cp\u003e92\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"22.339027595269382%\" valign=\"top\"\u003e\n \u003cp\u003e18\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"5.519053876478318%\" valign=\"top\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.300919842312746%\" valign=\"top\"\u003e\n \u003cp\u003eAkinyele\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.140604467805518%\" valign=\"top\"\u003e\n \u003cp\u003eFalade- Olorisaoko\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.614980289093298%\" valign=\"top\"\u003e\n \u003cp\u003e50\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.922470433639948%\" valign=\"top\"\u003e\n \u003cp\u003e32\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.16294349540079%\" valign=\"top\"\u003e\n \u003cp\u003e76\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"22.339027595269382%\" valign=\"top\"\u003e\n \u003cp\u003e48\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"5.519053876478318%\" valign=\"top\"\u003e\n \u003cp\u003e6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.300919842312746%\" valign=\"top\"\u003e\n \u003cp\u003eOluyole\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.140604467805518%\" valign=\"top\"\u003e\n \u003cp\u003eIre-Akari\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.614980289093298%\" valign=\"top\"\u003e\n \u003cp\u003e50\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.922470433639948%\" valign=\"top\"\u003e\n \u003cp\u003e28\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.16294349540079%\" valign=\"top\"\u003e\n \u003cp\u003e71\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"22.339027595269382%\" valign=\"top\"\u003e\n \u003cp\u003e45\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"5.519053876478318%\" valign=\"top\"\u003e\n \u003cp\u003e7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.300919842312746%\" valign=\"top\"\u003e\n \u003cp\u003eIwajowa\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.140604467805518%\" valign=\"top\"\u003e\n \u003cp\u003eAgbaruru\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.614980289093298%\" valign=\"top\"\u003e\n \u003cp\u003e50\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.922470433639948%\" valign=\"top\"\u003e\n \u003cp\u003e35\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.16294349540079%\" valign=\"top\"\u003e\n \u003cp\u003e80\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"22.339027595269382%\" valign=\"top\"\u003e\n \u003cp\u003e40\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"5.519053876478318%\" valign=\"top\"\u003e\n \u003cp\u003e8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.300919842312746%\" valign=\"top\"\u003e\n \u003cp\u003eOgbomoso South\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.140604467805518%\" valign=\"top\"\u003e\n \u003cp\u003eArowomole\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.614980289093298%\" valign=\"top\"\u003e\n \u003cp\u003e50\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.922470433639948%\" valign=\"top\"\u003e\n \u003cp\u003e25\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.16294349540079%\" valign=\"top\"\u003e\n \u003cp\u003e49\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"22.339027595269382%\" valign=\"top\"\u003e\n \u003cp\u003e28\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"5.519053876478318%\" valign=\"top\"\u003e\n \u003cp\u003e9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.300919842312746%\" valign=\"top\"\u003e\n \u003cp\u003eIbarapa Central\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.140604467805518%\" valign=\"top\"\u003e\n \u003cp\u003eIgboora\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.614980289093298%\" valign=\"top\"\u003e\n \u003cp\u003e50\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.922470433639948%\" valign=\"top\"\u003e\n \u003cp\u003e21\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.16294349540079%\" valign=\"top\"\u003e\n \u003cp\u003e67\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"22.339027595269382%\" valign=\"top\"\u003e\n \u003cp\u003e37\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"5.519053876478318%\" valign=\"top\"\u003e\n \u003cp\u003e10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.300919842312746%\" valign=\"top\"\u003e\n \u003cp\u003eIbadan south east\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.140604467805518%\" valign=\"top\"\u003e\n \u003cp\u003eOranyan\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.614980289093298%\" valign=\"top\"\u003e\n \u003cp\u003e50\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.922470433639948%\" valign=\"top\"\u003e\n \u003cp\u003e25\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.16294349540079%\" valign=\"top\"\u003e\n \u003cp\u003e122\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"22.339027595269382%\" valign=\"top\"\u003e\n \u003cp\u003e48\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"5.519053876478318%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.300919842312746%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e10 LGAs\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.140604467805518%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eTotal\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.614980289093298%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e500\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.922470433639948%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e254 (50.8%)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.16294349540079%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e776\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"22.339027595269382%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e361 (46.5%)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 3: Aedes(larval) Species Composition \u003cem\u003ein Oyo State from Jan 2022 to April 2023\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"710\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"6.197183098591549%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eS/N\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.887323943661972%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eLGA\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.422535211267604%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eCommunity\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.760563380281692%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eAedes spp\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.507042253521126%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eNumber\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.112676056338028%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eTotal No\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.112676056338028%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"6.197183098591549%\" valign=\"top\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.887323943661972%\" valign=\"top\"\u003e\n \u003cp\u003eIdo\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.422535211267604%\" valign=\"top\"\u003e\n \u003cp\u003eLeo\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.760563380281692%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eAe. aegypti\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eAe. albopictus\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.507042253521126%\" valign=\"top\"\u003e\n \u003cp\u003e89\u003c/p\u003e\n \u003cp\u003e33\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.112676056338028%\" valign=\"top\"\u003e\n \u003cp\u003e122\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.112676056338028%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"6.197183098591549%\" valign=\"top\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.887323943661972%\" valign=\"top\"\u003e\n \u003cp\u003eOyo East\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.422535211267604%\" valign=\"top\"\u003e\n \u003cp\u003eAraromi\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.760563380281692%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eAe. aegypti\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.507042253521126%\" valign=\"top\"\u003e\n \u003cp\u003e54\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.112676056338028%\" valign=\"top\"\u003e\n \u003cp\u003e54\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.112676056338028%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"6.197183098591549%\" valign=\"top\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.887323943661972%\" valign=\"top\"\u003e\n \u003cp\u003eOrelope\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.422535211267604%\" valign=\"top\"\u003e\n \u003cp\u003eIgboho\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.760563380281692%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eAe. aegypti\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.507042253521126%\" valign=\"top\"\u003e\n \u003cp\u003e69\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.112676056338028%\" valign=\"top\"\u003e\n \u003cp\u003e69\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.112676056338028%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"6.197183098591549%\" valign=\"top\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.887323943661972%\" valign=\"top\"\u003e\n \u003cp\u003eOna Ara\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.422535211267604%\" valign=\"top\"\u003e\n \u003cp\u003eKajola\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.760563380281692%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eAe. aegypti\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.507042253521126%\" valign=\"top\"\u003e\n \u003cp\u003e40\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.112676056338028%\" valign=\"top\"\u003e\n \u003cp\u003e40\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.112676056338028%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"6.197183098591549%\" valign=\"top\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.887323943661972%\" valign=\"top\"\u003e\n \u003cp\u003eAkinyele\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.422535211267604%\" valign=\"top\"\u003e\n \u003cp\u003eFalade- Olorisaoko\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.760563380281692%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eAe. aegypti\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.507042253521126%\" valign=\"top\"\u003e\n \u003cp\u003e39\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.112676056338028%\" valign=\"top\"\u003e\n \u003cp\u003e39\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.112676056338028%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"6.197183098591549%\" valign=\"top\"\u003e\n \u003cp\u003e6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.887323943661972%\" valign=\"top\"\u003e\n \u003cp\u003eOluyole\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.422535211267604%\" valign=\"top\"\u003e\n \u003cp\u003eIre-Akari\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.760563380281692%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eAe. aegypti\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.507042253521126%\" valign=\"top\"\u003e\n \u003cp\u003e47\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.112676056338028%\" valign=\"top\"\u003e\n \u003cp\u003e47\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.112676056338028%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"6.197183098591549%\" valign=\"top\"\u003e\n \u003cp\u003e7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.887323943661972%\" valign=\"top\"\u003e\n \u003cp\u003eIwajowa\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.422535211267604%\" valign=\"top\"\u003e\n \u003cp\u003eAgbaruru\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.760563380281692%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eAe. aegypti\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eAe. simpsoni\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.507042253521126%\" valign=\"top\"\u003e\n \u003cp\u003e82\u003c/p\u003e\n \u003cp\u003e25\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.112676056338028%\" valign=\"top\"\u003e\n \u003cp\u003e107\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.112676056338028%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"6.197183098591549%\" valign=\"top\"\u003e\n \u003cp\u003e8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.887323943661972%\" valign=\"top\"\u003e\n \u003cp\u003eOgbomoso South\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.422535211267604%\" valign=\"top\"\u003e\n \u003cp\u003eArowomole\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.760563380281692%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eAe. aegypti\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.507042253521126%\" valign=\"top\"\u003e\n \u003cp\u003e21\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.112676056338028%\" valign=\"top\"\u003e\n \u003cp\u003e21\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.112676056338028%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"6.197183098591549%\" valign=\"top\"\u003e\n \u003cp\u003e9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.887323943661972%\" valign=\"top\"\u003e\n \u003cp\u003eIbarapa Central\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.422535211267604%\" valign=\"top\"\u003e\n \u003cp\u003eIgboora\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.760563380281692%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eAe. aegypti\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.507042253521126%\" valign=\"top\"\u003e\n \u003cp\u003e19\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.112676056338028%\" valign=\"top\"\u003e\n \u003cp\u003e19\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.112676056338028%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"6.197183098591549%\" valign=\"top\"\u003e\n \u003cp\u003e10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.887323943661972%\" valign=\"top\"\u003e\n \u003cp\u003eIbadan Southeast\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.422535211267604%\" valign=\"top\"\u003e\n \u003cp\u003eOranyan\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.760563380281692%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eAe. aegypti\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eAe. albopictus\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.507042253521126%\" valign=\"top\"\u003e\n \u003cp\u003e71\u003c/p\u003e\n \u003cp\u003e12\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.112676056338028%\" valign=\"top\"\u003e\n \u003cp\u003e83\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.112676056338028%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"6.197183098591549%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.887323943661972%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.422535211267604%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.760563380281692%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eTotal\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.507042253521126%\" valign=\"top\"\u003e\n \u003cp\u003e601\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.112676056338028%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.112676056338028%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 4: Relative Abundance of all Aedes (Adult and Larval) Collected in Oyo State, Nigeria from April 2022 to April 2023\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"650\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"14.90015360983103%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eS/N\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"33.333333333333336%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eAedes Species\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"24.88479262672811%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eNumber\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"26.881720430107528%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eProportion\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"14.90015360983103%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e1\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"33.333333333333336%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eAedes aegypti\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"24.88479262672811%\" valign=\"top\"\u003e\n \u003cp\u003e798\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"26.881720430107528%\" valign=\"top\"\u003e\n \u003cp\u003e78.6\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"14.90015360983103%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e2\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e3\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"33.333333333333336%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eAedes albopictus\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eAedes simpsoni\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"24.88479262672811%\" valign=\"top\"\u003e\n \u003cp\u003e125\u003c/p\u003e\n \u003cp\u003e92\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"26.881720430107528%\" valign=\"top\"\u003e\n \u003cp\u003e12.3\u003c/p\u003e\n \u003cp\u003e9.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"14.90015360983103%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"33.333333333333336%\" valign=\"top\"\u003e\n \u003cp\u003eTotal\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"24.88479262672811%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e1015\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"26.881720430107528%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e100\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eTable 5:\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003eCorrelation between DENV, Mosquitoes and environmental factors (Rainfall, Humidity and Temperature)Oyo State, Nigeria from January 2022 to April 2023\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"623\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"16.506410256410255%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.666666666666668%\" valign=\"bottom\"\u003e\n \u003cp\u003e\u003cstrong\u003eDengue\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.666666666666668%\" valign=\"bottom\"\u003e\n \u003cp\u003e\u003cstrong\u003eNo of Aedes Mosquito\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.826923076923077%\" valign=\"bottom\"\u003e\n \u003cp\u003e\u003cstrong\u003eTemperature\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.666666666666668%\" valign=\"bottom\"\u003e\n \u003cp\u003e\u003cstrong\u003eHumidity\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.666666666666668%\" valign=\"bottom\"\u003e\n \u003cp\u003e\u003cstrong\u003eRainfall\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"16.506410256410255%\" valign=\"bottom\"\u003e\n \u003cp\u003eDengue\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.666666666666668%\" valign=\"bottom\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.666666666666668%\" valign=\"bottom\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.826923076923077%\" valign=\"bottom\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.666666666666668%\" valign=\"bottom\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.666666666666668%\" valign=\"bottom\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"16.506410256410255%\" valign=\"bottom\"\u003e\n \u003cp\u003eNo of Aedes Mosquito\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.666666666666668%\" valign=\"bottom\"\u003e\n \u003cp\u003e0.419166*\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.666666666666668%\" valign=\"bottom\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.826923076923077%\" valign=\"bottom\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.666666666666668%\" valign=\"bottom\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.666666666666668%\" valign=\"bottom\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"16.506410256410255%\" valign=\"bottom\"\u003e\n \u003cp\u003eTemperature\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.666666666666668%\" valign=\"bottom\"\u003e\n \u003cp\u003e-0.46593\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.666666666666668%\" valign=\"bottom\"\u003e\n \u003cp\u003e-0.74949\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.826923076923077%\" valign=\"bottom\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.666666666666668%\" valign=\"bottom\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.666666666666668%\" valign=\"bottom\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"16.506410256410255%\" valign=\"bottom\"\u003e\n \u003cp\u003eHumidity\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.666666666666668%\" valign=\"bottom\"\u003e\n \u003cp\u003e0.568597*\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.666666666666668%\" valign=\"bottom\"\u003e\n \u003cp\u003e0.827154\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.826923076923077%\" valign=\"bottom\"\u003e\n \u003cp\u003e-0.73563\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.666666666666668%\" valign=\"bottom\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.666666666666668%\" valign=\"bottom\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"16.506410256410255%\" valign=\"bottom\"\u003e\n \u003cp\u003eRainfall\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.666666666666668%\" valign=\"bottom\"\u003e\n \u003cp\u003e0.601639\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.666666666666668%\" valign=\"bottom\"\u003e\n \u003cp\u003e0.90958\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.826923076923077%\" valign=\"bottom\"\u003e\n \u003cp\u003e-0.77836\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.666666666666668%\" valign=\"bottom\"\u003e\n \u003cp\u003e0.923878\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.666666666666668%\" valign=\"bottom\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003eInterpretation:\u003c/strong\u003e correlation coefficient r =\u003cem\u003e\u0026nbsp;\u003c/em\u003e0.419166\u003cem\u003e,\u0026nbsp;\u003c/em\u003er = 0.568597, r = 0.601639 all indicates a positive and strong association between Dengue Fever vs No of Aedes Mosquito, Humidity and Rainfall respectively while r= -0.46593 shows a negative and weak association between Dengue Fever vs temperature\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 6 Larval Indices Aedes Collected in Oyo State from April 2022 to April 2023\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"684\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"7.017543859649122%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eS/N\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.292397660818715%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eLocal Government\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.444444444444443%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eHouse index (%)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"27.19298245614035%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eContainer index (%)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.05263157894737%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eBreteau Index (%)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"7.017543859649122%\" valign=\"top\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.292397660818715%\" valign=\"top\"\u003e\n \u003cp\u003eIdo\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.444444444444443%\" valign=\"top\"\u003e\n \u003cp\u003e46\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"27.19298245614035%\" valign=\"top\"\u003e\n \u003cp\u003e43.6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.05263157894737%\" valign=\"top\"\u003e\n \u003cp\u003e82\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"7.017543859649122%\" valign=\"top\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.292397660818715%\" valign=\"top\"\u003e\n \u003cp\u003eOyo East\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.444444444444443%\" valign=\"top\"\u003e\n \u003cp\u003e68\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"27.19298245614035%\" valign=\"top\"\u003e\n \u003cp\u003e42.7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.05263157894737%\" valign=\"top\"\u003e\n \u003cp\u003e64\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"7.017543859649122%\" valign=\"top\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.292397660818715%\" valign=\"top\"\u003e\n \u003cp\u003eOrelope\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.444444444444443%\" valign=\"top\"\u003e\n \u003cp\u003e30\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"27.19298245614035%\" valign=\"top\"\u003e\n \u003cp\u003e28\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.05263157894737%\" valign=\"top\"\u003e\n \u003cp\u003e28\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"7.017543859649122%\" valign=\"top\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.292397660818715%\" valign=\"top\"\u003e\n \u003cp\u003eOna Ara\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.444444444444443%\" valign=\"top\"\u003e\n \u003cp\u003e32\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"27.19298245614035%\" valign=\"top\"\u003e\n \u003cp\u003e19.6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.05263157894737%\" valign=\"top\"\u003e\n \u003cp\u003e36\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"7.017543859649122%\" valign=\"top\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.292397660818715%\" valign=\"top\"\u003e\n \u003cp\u003eAkinyele\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.444444444444443%\" valign=\"top\"\u003e\n \u003cp\u003e64\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"27.19298245614035%\" valign=\"top\"\u003e\n \u003cp\u003e63.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.05263157894737%\" valign=\"top\"\u003e\n \u003cp\u003e96\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"7.017543859649122%\" valign=\"top\"\u003e\n \u003cp\u003e6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.292397660818715%\" valign=\"top\"\u003e\n \u003cp\u003eOluyole\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.444444444444443%\" valign=\"top\"\u003e\n \u003cp\u003e56\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"27.19298245614035%\" valign=\"top\"\u003e\n \u003cp\u003e63.4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.05263157894737%\" valign=\"top\"\u003e\n \u003cp\u003e90\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"7.017543859649122%\" valign=\"top\"\u003e\n \u003cp\u003e7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.292397660818715%\" valign=\"top\"\u003e\n \u003cp\u003eIwajowa\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.444444444444443%\" valign=\"top\"\u003e\n \u003cp\u003e70\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"27.19298245614035%\" valign=\"top\"\u003e\n \u003cp\u003e50\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.05263157894737%\" valign=\"top\"\u003e\n \u003cp\u003e80\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"7.017543859649122%\" valign=\"top\"\u003e\n \u003cp\u003e8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.292397660818715%\" valign=\"top\"\u003e\n \u003cp\u003eOgbomoso South\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.444444444444443%\" valign=\"top\"\u003e\n \u003cp\u003e50\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"27.19298245614035%\" valign=\"top\"\u003e\n \u003cp\u003e57.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.05263157894737%\" valign=\"top\"\u003e\n \u003cp\u003e56\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"7.017543859649122%\" valign=\"top\"\u003e\n \u003cp\u003e9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.292397660818715%\" valign=\"top\"\u003e\n \u003cp\u003eIbarapa Central\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.444444444444443%\" valign=\"top\"\u003e\n \u003cp\u003e42\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"27.19298245614035%\" valign=\"top\"\u003e\n \u003cp\u003e55.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.05263157894737%\" valign=\"top\"\u003e\n \u003cp\u003e74\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"7.017543859649122%\" valign=\"top\"\u003e\n \u003cp\u003e10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.292397660818715%\" valign=\"top\"\u003e\n \u003cp\u003eIbadan Southeast\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.444444444444443%\" valign=\"top\"\u003e\n \u003cp\u003e50\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"27.19298245614035%\" valign=\"top\"\u003e\n \u003cp\u003e39.3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.05263157894737%\" valign=\"top\"\u003e\n \u003cp\u003e96\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eGenerally, according to WHO guidelines larval index is considered low when House Index ˂ 5% and Breteau Index ˂ 4. It is high when House Index \u0026ge;5% and/or Breteau Index \u0026ge;4\u003csup\u003e3\u003c/sup\u003e.\u0026nbsp;\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003e One Health is defined as the collaborative effort of multiple disciplines working locally, nationally and globally to attain optimal health for people, animals and the environment. The One Health paradigm emerged from the recognition that the wellbeing of humans, animals and ecosystems are interrelated and interdependent, and there is need for more systematic and cross-sectoral approaches to identifying and responding to global public health emergencies and other health threats arising at the human-animal ecosystem interface\u003csup\u003e10,11\u003c/sup\u003e. The One Health concept is, therefore, a worldwide strategy for expanding interdisciplinary collaborations and communications in all aspects of health care for humans, animals and the environment1\u003csup\u003e10,11\u003c/sup\u003e. Thus, this study adopted the one health approach in achieving the objectives of determining the sero-molecular prevalence of DENV, to assess the Aedes mosquito abundance and its arboviral carriage rate, as well as, to determine the influence of climatic and meteorological parameters on Aedes mosquito vector abundance in Oyo State, Nigeria.\u003c/p\u003e \u003cp\u003eIn Nigeria, there is growing evidence consequent upon lessons learned from response to previous outbreaks that no single sector/agency can sufficiently manage the challenges of myriads of public health threat battling the nation\u003csup\u003e10\u003c/sup\u003e. Experiences from the Lassa fever, COVID-19 outbreaks\u0026rdquo; responses and ongoing activities in combatting antimicrobial resistance have demonstrated the effectiveness of multi-sectoral, multi-agency approaches in dealing with public health issues.\u003c/p\u003e \u003cp\u003eConsequently, the One Health approach has been advocated as the global framework for strengthening collaboration and capacities of the sectors and actors involved in health service delivery\u003csup\u003e10\u003c/sup\u003e.\u003c/p\u003e \u003cdiv id=\"Sec24\" class=\"Section2\"\u003e \u003ch2\u003eDengue Fever Sero-Molecular Detection\u003c/h2\u003e \u003cp\u003ePrior to this study, the magnitude of DF in Oyo state and indeed in Nigeria remained unclear, as cases were underdiagnosed or misdiagnosed as malaria or referred to as pyrexia of unknown origin (PUO) if they fail to respond to antimalarial drugs \u003csup\u003e6,12\u003c/sup\u003e. The high detection rate (44.3%) of DENV among participants in this study, DF may arguably be responsible for some unclassified febrile illnesses; misdiagnosed as Malaria or as PUO. This is particularly so, because DF is usually not a differential diagnosis of acute febrile illness hence, testing is not usually requested. There is currently no ongoing surveillance activity dedicated to DF in Oyo state and the surveillance activity for DF in the NCDC needs to be strengthened. What exists are sero-prevalence and molecular studies carried out by individual researchers in various parts of the country which have confirmed high prevalence and transmission of DF in Nigeria \u003csup\u003e5,6,12\u003c/sup\u003e. Though DF has been declared a priority epidemic-prone disease, the reciprocal surveillance activity including testing of suspected cases or inclusion as differential testing for other VHF is missing.\u003c/p\u003e \u003cp\u003eThere are no sufficient morbidity and mortality data available on DF at the moment in Oyo state and Nigeria at large. In this study, DENV IgG was used to assess past exposure to infection, while DENV IgM to assess active or acute infection. The seroprevalence of 37.7% for DENV IgG was reported in this study which is in close range with the overall pooled DENV IgG prevalence of 32.8% reported by a systematic review and lower than a IgG seroprevalence of 77.0% previously reported by a study conducted in Osun State\u003csup\u003e4,12\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eThe DENV IgM seroprevalence of 6.6% reported in this study is lower than the IgM pooled seroprevalence of 16.8% reported by the same systematic review study and another study conducted previously conducted in Oyo State which reports IgM seroprevalence of 17.2%\u003csup\u003e12, 13\u003c/sup\u003e. The DENV positive IgM patients were seen mostly from Iwajowa LGA followed by Ibadan Southeast, Oluyole, Ido, Akinyele and Kajola LGAs, of the state. The relatively high prevalence of DENV in some of these LGAs could be due to the proximity of the localities to the dense rainforest which provide enabling breed sites for DENV vectors. This study also confirmed a high abundance of Aedes mosquitoes in the localities. More so, the primary host of the DENV, which is the non-human primates (NHP), is abundantly found in the forests\u003csup\u003e14\u003c/sup\u003e. From the aforementioned, it shows that this disease affects many people in Oyo state and is most likely responsible for a great proportion of febrile illnesses often misdiagnosed as malaria\u003c/p\u003e \u003cp\u003eThis study shows that the state is a high burden state for DENV and there is an urgent need to include DENV for routine diagnosis.\u003c/p\u003e \u003cp\u003eThe DENV RT-PCR for all samples tested were negative, this may be because DENV RNA is usually detectable in infected individuals a few days after infection till the sixth-day post-onset of clinical symptoms such as fever and headache \u003csup\u003e5\u003c/sup\u003e. In Nigeria where health-seeking behavior is poor and individuals tend to consult traditional, patent medicine vendors ahead of presenting at health care facilities and even when such patients come to the health facility, there is usually no routine laboratory testing capacity to screen for DENV, in such occasion DENV is usually missed out hence, it is possible that the samples were not obtained during the high infectious period \u003csup\u003e21,22\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eDENV IgM is measurable from the third-day post symptom onset till the third month, while IgG is detectable from day 10 post-onset of symptoms and can remain detectable for months and years\u003csup\u003e16\u003c/sup\u003e. Hence, the serology test is more suitable for diagnosis, however, cross-reaction with other arbovirus and other limitations should be noted. In this study, some demographic and ecologic factors in the study location facilitated the spread of the DENV. The increase in DENV antibodies with age from adulthood suggests that infection occurs from middle to older age having an age range 15\u0026ndash;29 followed by 30\u0026ndash;44 with the highest proportion of DENV. Although seropositivity was higher in female participants, these results were not significant, suggesting that both sexes are equally infected in this region. More so, high level of IgG with low level of IgM, suggests infection in the past, thereby confirming the endemicity of DENV infection in the state.\u003c/p\u003e \u003cp\u003eThe high seroprevalence of DENV observed in this study may indicate poor level of public health interventions aimed at effectively controlling the vector transmission as well as interruption of the disease process. There is also the possibility of poor awareness of the presence of this disease in Oyo state and in Nigeria as a whole, hence, the reason for the absence of surveillance and routine testing. The high rate of urbanization in Oyo state equally explains the high prevalence of DENV especially in urban LGAs within Ibadan metropolis as the burden of DENV infection has been reported to be associated with the rising rate of urbanization, coupled with poor infrastructure in tropical and subtropical areas\u003csup\u003e10\u003c/sup\u003e. The mechanism behind the association between the high prevalence in DENV infection could be due to the high vector population and breeding sites because of urbanization and deforestation as reported in this study.\u003c/p\u003e \u003cp\u003eThe high number of these breeding sites is favoured by climatic as well as environmental patterns of Nigeria that encourage the development of mosquitoes hence, favouring enhanced DENV transmission\u003csup\u003e9,10\u003c/sup\u003e. Indeed, Aedes aegypti thrive better in warm and humid climatic conditions which typically exist in the study area\u003csup\u003e7\u003c/sup\u003e. This favours the survival of the mosquito eggs compared to the cold and temperate climatic regions which encourage hibernation while suppressing conservation and development\u003csup\u003e17,19\u003c/sup\u003e. In this study, cases of DENV were reported almost all year round with more cases reported in the rainy season of July to October. There also exists a positive and strong correlation between DF, humidity, and rainfall, this further demonstrates the high prevalence of arboviral disease in the rainy season. It will be of interest to conduct a similar study in the northern part of the country with lower rainfall and humidity and higher temperature.\u003c/p\u003e \u003cdiv id=\"Sec25\" class=\"Section3\"\u003e \u003ch2\u003eEntomological Findings and Detection of DENV in Aedes Mosquito\u003c/h2\u003e \u003cp\u003eEntomological findings from this study revealed a high abundance of \u003cem\u003eAedes aegypti\u003c/em\u003e in all the locations surveyed with few numbers of \u003cem\u003eAedes albopictus\u003c/em\u003e and \u003cem\u003eAedes simpsoni\u003c/em\u003e detected at Ido, Ibadan Southeast and Iwajowa LGAs respectively. This was observed all year round with month-by-month variation in mosquito abundance, mainly caused by rainfall as established by this study. A similar study conducted in Ekiti reported high recovery of Aedes aegypti which was attributed rainfall\u003csup\u003e7\u003c/sup\u003e. The all-year-round presence of Aedes species may be because their larvae can colonize and survive in almost all habitats such as barrels, drainages, tyres, pots, discarded plastics and bottles, and tanks from which they were trapped \u003csup\u003e7,8,9\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eThis study also revealed high larval indices as deduced from all the locations surveyed\u003csup\u003e3\u003c/sup\u003e. This is a surrogate marker and clear indication that those communities are at high risk of massive DF outbreaks and other arboviral diseases, in the presence of susceptible human population and competent disease vector\u003csup\u003e20\u003c/sup\u003e. In order to mitigate this, herd immunity to the prevalent arboviral disease through reactive mass vaccination for the vaccine preventable arboviral disease is advocated as well as massive, targeted vector control. In view of these, Oyo state is at risk of DF and other arboviral transmission, therefore multifaceted response actions are advocated. In essence many Aedes mosquito species collected in this study are known to be important vectors of arboviruses of public health importance. Furthermore, in this study high Aedes species abundance was found in months with high rainfall quantities with the peak in the months of July and August while the lowest number was in the month of February when there was little or no rains which agrees with a previous study done in Ibadan\u003csup\u003e16\u003c/sup\u003e. Mosquito populations varied during the study period in response to prevailing weather conditions. This research clearly demonstrates that changes in rainfall and relative humidity due to imminent climate changes and seasonal pattern variations modify the behavior and geographical distribution and abundance of Aedes mosquito vectors. Rainfall increases the opportunity for egg-laying by increasing the number of potential breeding sites for Aedes mosquitoes to lay eggs, which can reach adulthood within nine to twelve days, necessary for the mosquito life cycle. Rainfall is one of the climatic variables that aid in the multiplication of mosquito breeding places while humidity improves mosquito survival rates. The rainy season is a fertile period for breeding sites, which were numerous. Meteorological parameters are therefore good predictors of abundance of Aedes mosquitoes and their associated disease risks \u003csup\u003e8,12\u003c/sup\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec26\" class=\"Section3\"\u003e \u003ch2\u003eCoinfection of LASV and DENV\u003c/h2\u003e \u003cp\u003eSo far, co-infection of DENV and LASV has not been well documented in Nigeria. In this study, both LASV and DENV were simultaneously laboratory confirmed in a 45year old male from Iwajowa LGA. The patient was positive for both LASV IgM and DENV IgM, this is similar to finding reported in Brazil which demonstrates co-infection of SARS-COV-2 and DENV\u003csup\u003e18\u003c/sup\u003e. This was the first case of human co-infection of DENV and LASV reported in Oyo State, Nigeria. This underscores the importance of an accurate and timely diagnosis for targeted and effective intervention. In conclusion, DF high seroprevalence rate documented in this study further underscores the need for heightened surveillance for this virus in Oyo State. Overall, these findings confirm ongoing transmission and exposure to DENV in Oyo State.\u003c/p\u003e \u003cp\u003eOyo State is therefore at significant risk of DENV and other arboviral outbreaks considering the high abundance of competent arboviral vectors, therefore multifaceted response actions are advocated. Findings from this study necessitate the need for the adoption of the One Health strategic approach to halt the spread of arboviral diseases.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec27\" class=\"Section3\"\u003e \u003ch2\u003eContributions to Knowledge\u003c/h2\u003e \u003cp\u003eThis study has provided useful information on the serostatus and ongoing transmission of DF in Oyo State and suggests the potential for a massive outbreak if the trends continue. Also, the Aedes specie vector abundance in Oyo State has been established.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthical Considerations\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eEthical approval was obtained from the Institutional Review Board (IRB) of the Nigerian Institute of Medical Research (NIMR) IRB-19-006. Further permission was obtained from the Oyo State Ministry of Health Department of Public Health (SMOH/EPID/016/005) and the various officer-in-charge in the healthcare facilities before the commencement of the study. Informed consent was obtained from study participants. \u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for Publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable \u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets used and or analyzed during this current study are available from the corresponding author on reasonable request. Relevant data generated and analyzed during this study are included in the published article.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll Authors declare that we do not have any competing interests.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was funded by Nigerian Institute of Medical Research (grant number 2NIMRGA-0026-21-0).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; Contribution\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAOS and RAA conceptualized, designed the study, and embarked on fieldwork. JOS, OPA and BKA carried out the laboratory analysis.\u0026nbsp;AOD provided expert guidance to the authors in performing the entomological surveillance.\u0026nbsp;AOA, OTO, and IAO\u0026nbsp;analyzed and interpreted the data. All authors were fully involved in every aspect of the work and contributed significantly, and all performed literature search, drafted the manuscript, and reviewed it for intellectual content. All authors approved the final manuscript before submission.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe authors acknowledge the valuable support provided by staff of the Centre for Human Genomics NIMR, especially Miss Fatimah Awonju, Miss Blessing Agada, and Mr. David Ojo regarding laboratory analysis part of this study. The Oyo State Ministry of Health Emergency Operations Centre staff led by the State Epidemiologist Dr Iyabo Kareem and the State Disease Surveillance and Notification Officer Mrs. Titilope Akinleye, State Laboratory Focal Person Mr Adigun Adeadayo for their support during the sample collection, active case search and entomological surveillance. We also appreciate the Entomology Team at the University of Ibadan led by Dr Ibrahim and Mr. Philips of the National Arbovirus and Vectors Research Centre for their support regarding the entomological surveillance aspect of this work. The teaching and non-teaching staff of the Department of Biological Sciences Lead City University led by the Head of Department Dr Felicia Adesina all well appreciated.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eKatzelnick LC, Fonville JM, Gromowski GD, Bustos Arriaga J, Green A, James SL, Lau L, Montoya M, Wang C, VanBlargan LA, Russell CA, Thu HM, Pierson TC, Buchy P, Aaskov JG, Mu\u0026ntilde;oz-Jord\u0026aacute;n JL, Vasilakis N, Gibbons RV, Tesh RB, Osterhaus AD, Fouchier RA, Durbin A, Simmons CP, Holmes EC, Harris E, Whitehead SS, Smith DJ. Dengue viruses cluster antigenically but not as discrete serotypes.\u003cstrong\u003e\u0026nbsp;Science\u003c/strong\u003e 2015;349:1338-43.\u003c/li\u003e\n \u003cli\u003eReich NG, Shrestha S, King AA, Rohani P, Lessler J, Kalayanarooj S, Yoon IK, Gibbons RV, Burke DS, Cummings DA. Interactions between serotypes of dengue highlight epidemiological impact of crossimmunity. \u003cstrong\u003eJ R Soc Interface\u003c/strong\u003e 2013;10:2013041\u003c/li\u003e\n \u003cli\u003eWorld Health Organisation. Guidelines for dengue surveillance and mosquito control.Western pacific Education in Action Series No 8. Geneva:WHO ;1995.\u003c/li\u003e\n \u003cli\u003eM.A. Adeleke, M.A. Muhibi, E.I.O. Ajayi0, O.A. Idowu, M.T. Famodimu, \u0026amp; S.O.Olaniyan, Dengue virus specific immunoglobulin g antibodies among patients with febrile conditions in Osogbo, Southwestern Nigeria. \u003cstrong\u003eTrop Biomed.\u003c/strong\u003e 33(1), 2016, 1\u0026ndash;7.\u003c/li\u003e\n \u003cli\u003eI.A. Nasir, O.O. Agbede, A. Dangana, M. Baba, A.S. Haruna, Dengue virus non-structural Protein-1 expression and associated risk factors among febrile Patients attending University of Abuja Teaching Hospital, Nigeria. \u003cstrong\u003eVirus Res\u003c/strong\u003e, 2017;230:7-12.\u003c/li\u003e\n \u003cli\u003eO.A. Adesina, \u0026amp; J.A. Adeniji, Incidence of Dengue virus infections in febrile episodes in Ile-Ife, Nigeria. \u003cstrong\u003eAfr J Infect Dis\u0026nbsp;\u003c/strong\u003e2016; 10:21-4.\u003c/li\u003e\n \u003cli\u003eI.A. Simon-oke, \u0026amp; L.K Olofintoye., The Effect of Climatic Factors on the Distribution and Abundance of Mosquito Vectors in Ekiti State \u003cstrong\u003eJournal of Biology, Agriculture and Healthcare\u0026nbsp;\u003c/strong\u003ewww.iiste.org ISSN 2224-3208 (Paper) ISSN 2225-093X (Online) Vol.5, No.9, 2015.\u003c/li\u003e\n \u003cli\u003eA.V. Opayele, J.A. Adeniji, K.T. Ibrahim, \u0026amp; O.D. Olaleye, Influence of Meteorological Variables on Diversity and Abundance of Mosquito Vectors in Two Livestock Farms in Ibadan, Nigeria: \u003cstrong\u003ePublic Health Implications J Mosq Res,\u0026nbsp;\u003c/strong\u003e7(9), 2017, 70\u0026ndash;78. doi:10.5376/jmr.2017.07.0009.\u003c/li\u003e\n \u003cli\u003eLeopoldo M. Rueda Pictorial keys for the identification of mosquitoes (Diptera: Culicidae) associated with Dengue Virus Transmission (Zootaxa 589) 60 pp.; 30 cm. 3 2004 ISBN 1-877354-46-5 (Paperback) ISBN 1-877354-47-3 (Online edition)\u003c/li\u003e\n \u003cli\u003eShen, Kow-Ton \u003cem\u003eEmerging Infectious Diseases and One Health: Implication for Public Health; \u003cstrong\u003eInternational Journal of Environmental Research and Public Health\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e\u0026nbsp;,\u003c/strong\u003e19(15) 9081. 2022 https://doi.org/10.3390/ijerph19159081\u003c/li\u003e\n \u003cli\u003eAl Awaidy ST, Khamis F. Dengue fever: an emerging disease in Oman requiring urgent public health interventions. \u003cstrong\u003eOman Med J.\u003c/strong\u003e 2019;34(2):91\u0026ndash;93. doi: 10.5001/omj.201\u003c/li\u003e\n \u003cli\u003eA.U. Emeribe, I.N. Abdullahi, I.K. Isong, A.O. Emeribe, J.O. Nwofe, \u0026amp; B.I. Shuaib, Dengue virus is hyperendemic in Nigeria from 2009 to 2020: \u003cstrong\u003eA contemporary systematic review. Infect Chemother,\u003c/strong\u003e53(2), 2021, 284\u0026ndash;99.\u003c/li\u003e\n \u003cli\u003eOladipo E.K., C. Amanetu, T.A Gbadero , J.K. Oloke Detectable Anti-dengue Virus IgM Antibodies among Healthy Individuals In Ogbomoso, Oyo State, Nigeria American Journal of Infectious Diseases 10(2): 64-67,2014\u003c/li\u003e\n \u003cli\u003eBack, A.T. \u0026amp; Lundkvist, A. Dengue Viruses - An Overview. \u003cstrong\u003eInfection Ecology \u0026amp; Epidemiology,\u003c/strong\u003e 3(9), 2013, 11-16.\u003c/li\u003e\n \u003cli\u003eFagbami, A.H., Monath, T.P. \u0026amp; Fabiyi, A. Dengue virus infections in Nigeria: a survey for antibodies in monkeys and humans. \u003cstrong\u003eTransactions of the Royal Society of Tropical Medicine and Hygiene,\u003c/strong\u003e 71, 1977, 60\u0026ndash;65.\u003c/li\u003e\n \u003cli\u003eOderinde BS, Mora-C\u0026aacute;rdenas E, Carletti T, Baba MM, Marcello A. Prevalence of locally undetected acute infections of Flaviviruses in North-Eastern Nigeria. Virus Res 2020;286:198060.\u003c/li\u003e\n \u003cli\u003eBaba, M.M. \u0026amp; Talle, M. The Effect of Climate on Dengue Virus Infections in Nigeria.\u003cstrong\u003e\u0026nbsp;New York Science Journal,\u003c/strong\u003e 4(1), 2011, 28-33.\u003c/li\u003e\n \u003cli\u003eNaira Bicudo,Eliana Bicudo,Julia Duarte Costa Co-infection of SARS-CoV-2 and Dengue virus: a clinical challenge \u003cstrong\u003eBraz J infect Dis\u003c/strong\u003e 24(5) 2020 452-454\u003c/li\u003e\n \u003cli\u003eBhatt, S., Gething, P.W., Brady, O.J., Messina, J.P., Farlow, A.W. \u0026amp; Moyes, C.L, The global Distribution and Burden of Dengue. \u003cstrong\u003eNature,\u003c/strong\u003e 496, 2011, 504-507.\u003c/li\u003e\n \u003cli\u003eFaneye, A., Idika, N., Motayo, B.O., Adesanmi, A. \u0026amp; Afocha, E. Serological evidence of recent dengue virus infection among febrile children in a semi-arid zone. \u003cstrong\u003eAmerican Journal of Infectious Diseases,\u003c/strong\u003e 9, 2013, 7-10.\u003c/li\u003e\n \u003cli\u003eOlasehinde N.(2018). Healthcare Seeking Behaviour In Nigeria \u003cstrong\u003e.Journal Of Population And Social Studies\u003c/strong\u003e, 26(3),207-218\u003c/li\u003e\n \u003cli\u003eAyukekbong J.A .,2014 Dengue Virus in Nigeria: Current Status and Future Perspective .\u003cstrong\u003eBritish Journal of Virology\u003c/strong\u003e ,1(3) :106-111.\u003c/li\u003e\n \u003cli\u003eB. Bassey, E. Braka, F. Onyibe, Rosemary 2022, \u003cem\u003eChanging Epidemiology of Yellow Fever Virus in Oyo State, Nigeria. \u003cstrong\u003eBMC Public Health\u003c/strong\u003e 22:467\u003c/em\u003e\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":true,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"one-health-outlook","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"oneh","sideBox":"Learn more about [One Health Outlook](https://onehealthoutlook.biomedcentral.com)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/oneh/default.aspx","title":"One Health Outlook","twitterHandle":"@BioMedCentral","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Dengue Fever, Aedes mosquito, Surveillance, Diagnosis","lastPublishedDoi":"10.21203/rs.3.rs-4476878/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4476878/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eThe threat from Dengue Fever (DF) is fast becoming a global menace. The burden of DF in Oyo State and indeed in Nigeria remains unclear, as cases go underdiagnosed or misdiagnosed as malaria. This is attributable to poor health-seeking behavior of the population, weak surveillance systems, and poor health infrastructure. Consistent surveillance of this pathogen using a one-health approach is necessary to assess the public health impact, meteorological influence, vectoral abundance, high-risk groups, and locations associated with Dengue Virus (DENV) infections.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eA cross-sectional study was conducted from Jan 2022 to April 2023. It involved screening DENV in 289 human blood samples and 1,015 \u003cem\u003eAedes species\u003c/em\u003e mosquitoes. Viral RNA was extracted and purified using Jena Bioscience Viral DNA\u0026thinsp;+\u0026thinsp;RNA purification kit. These were analyzed using the One-Step PrimeScript III RT-qPCR mix. Serological detection of DENV-specific antibodies IgM and IgG in humans was analyzed using a one-step lateral flow immunoassay cassette test kit. Patients who were DENV IgM positive were screened for Lassa Virus (LASV) to rule out coinfection. Adult \u003cem\u003eAedes\u003c/em\u003e mosquitoes were trapped using Biogents Sentinel Trap. Mosquitoes recovered were morphologically identified and classified using appropriate taxonomical keys. Meteorological data was obtained from NIMET. Data was abridged as proportions; correlation analysis was done to determine associations.\u003c/p\u003e\u003ch2\u003eResult\u003c/h2\u003e \u003cp\u003eThe overall seroprevalence of DENV was 128/289 (44.2%) with 19/289 (6.6%) and 109/289 (37.7%) being IgM and IgG positive. DENV was detected all year round with more cases in the rainy season. LASV and DENV coinfection was detected in a participant. DENV RT-qPCR analysis in febrile patients and mosquitoes was negative. There was a high abundance of \u003cem\u003eAedes aegypti (79.5%)\u003c/em\u003e in all the locations surveyed with \u003cem\u003eAedes albopictus (12.3%)\u003c/em\u003e detected in Ido LGA and Ibadan South-East LGA while \u003cem\u003eAedes simpsoni (9.1%)\u003c/em\u003e was found at Iwajowa LGA. Mosquito populations varied during the study period in response to prevailing weather conditions.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e \u003cp\u003eThe high seroprevalence in this study demonstrates an ongoing transmission and exposure to DENV in Oyo State, this further underscores the need to include DF as a differential diagnosis for febrile illnesses. Surveillance system strengthening, as well as timely, accessible, and sensitive laboratory diagnosis for DF, is advocated.\u003c/p\u003e","manuscriptTitle":"Enhancing Surveillance for Dengue Fever in Oyo State, Nigeria – a One Health Approach","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-07-18 16:00:33","doi":"10.21203/rs.3.rs-4476878/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Major revision","date":"2024-07-11T05:29:25+00:00","index":"","fulltext":""},{"type":"reviewerAgreed","content":"","date":"2024-07-09T14:28:42+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-06-19T13:57:41+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-05-27T01:14:40+00:00","index":"","fulltext":""},{"type":"submitted","content":"One Health Outlook","date":"2024-05-25T09:03:38+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"one-health-outlook","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"oneh","sideBox":"Learn more about [One Health Outlook](https://onehealthoutlook.biomedcentral.com)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/oneh/default.aspx","title":"One Health Outlook","twitterHandle":"@BioMedCentral","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"68b72cb0-2ed5-4c2c-996b-c49a510e2de7","owner":[],"postedDate":"July 18th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-02-03T16:03:10+00:00","versionOfRecord":{"articleIdentity":"rs-4476878","link":"https://doi.org/10.1186/s42522-024-00121-9","journal":{"identity":"one-health-outlook","isVorOnly":false,"title":"One Health Outlook"},"publishedOn":"2025-01-29 15:57:52","publishedOnDateReadable":"January 29th, 2025"},"versionCreatedAt":"2024-07-18 16:00:33","video":"","vorDoi":"10.1186/s42522-024-00121-9","vorDoiUrl":"https://doi.org/10.1186/s42522-024-00121-9","workflowStages":[]},"version":"v1","identity":"rs-4476878","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4476878","identity":"rs-4476878","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00
unpaywall
last seen: 2026-05-26T02:00:01.498150+00:00
License: CC-BY-4.0