Antibacterial and Biochemical Properties of Newly Isolated Lactic Acid Bacteria from Gastrointestinal Tract Microbiome of Armenian Honeybees

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher
AI-generated deep summary by claude@2026-07, 2026-07-04 · read from full text

The paper studied newly isolated lactic acid bacteria from the gastrointestinal tract microbiome of Armenian honeybees, using selective culture, a polyphasic identification approach that combined biochemical/physiological profiling with 16S rRNA gene sequencing, and in vitro testing for antibacterial activity against a broad panel of Gram-positive and Gram-negative bacteria. From approximately 50 mesophilic isolates, 17 strains showing antibacterial activity were selected and identified across multiple taxa including Bacillus, Staphylococcus, Streptococcus, Lactobacillus, and Enterococcus, with the strongest results reported for several specific Lactobacillus and Enterococcus isolates (e.g., L. kimblidii M9, E. durans M4, and L. delbrueckii subs. lactis/bulgaricus strains). The authors also characterized key growth and biochemical properties such as salt, pH, and temperature tolerances, acid production behavior, and additional enzymatic activities (e.g., gelatin proteolysis and amylolysis). A major caveat stated in the preprint is that it has not been peer reviewed. The paper does not explicitly discuss endometriosis or adenomyosis; it was included in the corpus via a keyword match in the upstream search index.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Full text 184,370 characters · extracted from preprint-html · click to expand
Antibacterial and Biochemical Properties of Newly Isolated Lactic Acid Bacteria from Gastrointestinal Tract Microbiome of Armenian Honeybees | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Antibacterial and Biochemical Properties of Newly Isolated Lactic Acid Bacteria from Gastrointestinal Tract Microbiome of Armenian Honeybees Inga Bazukyan, A. Sahakyan, A. Petrosyan, I. Semerjyan, L. Hakobyan, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4835721/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract During the last decade the health of honeybee is endangered because of many different pathogens, that is why the isolation of new lactic acid bacteria from honeybees' gut microbiotas, revealing of their strong antibacterial activity will help to create some products for protection of bees’ health. New Gram-positive mesophilic strains were isolated on selective media for lactic acid bacteria (LAB), followed by species identification by a polyphase approach, including biochemical and physiological characterization and molecular genetic identification based on the sequencing of the 16S rRNA genes. The newly isolated strains were tested for antibacterial activity against a broad range of Gram-positive and Gram-negative species. In total, seventeen new stains possessing antibacterial activity were isolated. They belonged to Bacillus, Staphylococcus, Streptococcus, Lactobacillus and Enterococcus different species . The most promising results comprising the antibacterial activity, and therefore possessing the potential to be used as probiotics, were obtained for the isolates L. kimbladii M9, E. durans M4, S. salivarius M12, L. delbrueckii subs. lactis A4, L. delbrueckii subs. lactis A5, and L. delbrueckii subs. bulgaricus B7. Taken together it can be suggested that strains Enterocccus ratti M2, E. durans M4, L. delbrueckii subs. lactis A4 and L. delbrueckii subs. bulgaricus B7 Mentioned above strains can be applied for protection of honeybees’ health. Biological sciences/Biochemistry Biological sciences/Biotechnology Biological sciences/Microbiology Apis mellifera gut microbiome lactic acid bacteria identification of LAB antagonistic activity Figures Figure 1 Figure 2 Figure 3 Figure 4 IMPORTANCE This investigation is very important to understand the immunity processes in organism of bees, and will help to create a medicinal preparation of probiotic bacteria which could be used as a feed for bees and will increase their immunity. INTRODUCTION Honeybees ( Apis mellifera ) are one of the most crucial pollinating insect species worldwide. Beekeepers collect honey, beeswax, propolis, pollen, and royal jelly from hives; bees are also kept for pollinating crops [ 1 ]. All components produced by honey bees have a beneficial effect on human health because of the antihypotensive activity, acidity, antiviral, antibacterial, antifungal, antioxidant, and anti-inflammatory compounds they contain. Some components have demonstrated antagonistic activity against over 250 strains of bacteria, including methicillin-resistant Staphylococcus aureus (MRSA) and vancomycin-resistant enterococci (VRE) [ 2 ]. The health status of honey bees has become an essential concern in many countries. For example, American foulbrood disease, caused by Paenibacillus larvae , is a common bacterial disease affecting apiculture worldwide [ 3 ]. Foulbrood is lethal for infected honey bee larvae, and in this way, it stops the reproduction of the infected colonies. According to the Trand Economy report for 2020 [ 4 ], the export of honey in Armenia is approximately 137 tons. This relatively low amount is specified not only by the small number of apiaries but also by the low immunity and high mortality of bees. Moreover, agricultural pressure decreased beneficial bee health genera when industrial treatments reduced the total number of bacteria [ 5 ]. The experiments conducted by scientists in different countries have shown the presence of core endosymbionts in the gut of healthy honeybees comprising nine bacterial phyla. Less than a decade ago, Olofsson and coauthors [ 6 ] discovered an unexplored bacterial microbiota in symbiosis with honeybees and located it in the honeybee's gastrointestinal tract (GIT). The representatives of two of their microbiota phyla (designated as "Firm-4" and "Firm-5") belonged to the genus Lactobacillus and another one, "Bifido", to the genus Bifidobacterium. The microbiota comprises approximately 40 lactic acid bacteria (LAB) strains with 13 taxonomically well-defined Lactobacillus and Bifidobacterium species. On the other side, not only lactobacilli are present in the honeybee gut, but also some representatives of Proteobacteria like Gilliamella apicola , Snodgrassella alvi , Frischella perrara , Bartonella apis, Parasaccharibacter apium , or Comensalibacter spp. , and Bacteroides such as Apibacter adventoris [ 7 ]. Kešnerová and co-authors [ 8 ] obtained remarkable results showing a difference between the gut microbiota of winter bees, foragers and nurses. It was shown that anthropogenic effects can lead to crucial changes in honeybee gut microbiota composition. LAB synthesize many compounds that possess both antibacterial activity (hydrogen peroxide, carbon dioxide, diacetyl, organic acids (lactic acid in particular), fatty acids (antifungal components, bacteriocins) and proteolytic activity (protease, peptidase) [ 9 ]. There are many reports on the production of antibacterial compounds by LAB [ 10 ], but there are comparatively few about the inhibitory activity of the microbiota of the bee gastrointestinal tract. Gyurova and co-authors [ 11 ] isolated E. durans EDD2 from the honey bee gut. This strain showed extremely high antagonistic activity against Paenibacillus larvae . In recent years, there have been reports on the antagonistic activity of LAB in the gut of honey bees against viral pathogens. The genome analysis indicated that this is probably due to a combination of several bacteriocins [ 11 ]. They found that honey bee survival was significantly increased in bees with a normal gut microbiota compared to bees with a perturbed (dysbiotic) gut microbiota [ 12 ]. It has been pointed out that LAB symbionts reacted in synergistic matter and defended themselves by secreting various active compounds that inhibited other microbial growth [ 13 ]. Just the presence of these bacteria and their metabolites, in combination with other compounds, can explain the medical effect of honey. It is widely accepted that the gut microbiota also contributes to the neurological processes of honey bee organisms and affects their behavior by affecting gene transcription in the brain and the circulating metabolism [ 7 ]. It is believed that the ecological conditions and geographic location of Armenia led to the development of unique associations—symbiosis—in the gastrointestinal tract of honey bees. Armenia is known as the cradle of Apis mellifera armeniaca , A. mellifera anatolica , and A. mellifera remipes [ 14 ]. In addition, Armenia is a habitat territory for wild types of stingless bees. Thus, the investigation of the bacterial composition of the microbiota in the gastrointestinal tract of different types of bees and the isolation of LAB with biological activity (antagonistic) are crucial for understanding the immunity processes in bee organisms and will help to create a medicinal preparation of probiotic bacteria that could be used as a feed for bees and will increase their immunity. The main goal of this research was to isolate new strains of bacteria from the honeybees' gut microbiotas, possessing strong antibacterial activity against potential pathogens with further usage for the protection of honeybees’ health. RESULTS Approximately 50 mesophilic isolates were isolated from all bee samples and primarily screened for antibacterial activity against E. coli ATCC 8739. Seventeen different isolates were chosen on their ability to ferment milk within 4 h to 7 days. All strains were named after the area where the bees had been collected and on the serial number of experiment (M1, M2, M4 strains were isolated from bees in the Metsavan village, B7 – the Berdashen village, M9, M10, M12 – the Movses village, A1, A2, A3, A4, A5 – the city of Artashat and K1, K2, K3, K4, K5 – the Karashamb village. The morphology and cultural properties of isolates All isolated strains were Gram-positive except for K4 and K5. Most isolates were non-sporulating cocci or bacilli, isolates A1 and A2 being the only spore-forming bacteria. The shape of the colony changed depending on the media composition, so for its investigation, the isolated strains were cultivated on MRS medium, which did not contain Tween 80 or other surface-active components. The growth graphs of strains A1, A2, A3, A4, A5, and K4 significantly differed during cultivation in MRS broth. They created the biofilm layer on the surface of MRS broth when all others grew on the bottom of tubes and showed approximately similar growth curves. The growth dynamic and the activity of acid synthesis are presented in Fig. 1 . More than ten important morphological, cultural and physiological properties of isolates were investigated for identification. Lactic acid cocci such as streptococci, leuconostocs, and pediococci have similar properties, for example, the absence of nitrate reduction, catalase, cytochromes, spores, etc. All of them synthesize the lactic acid during the fermentation of carbohydrates. So, the same approaches were used to identify cocci and bacilli. The physiological and biochemical properties of isolates The strains showed different sensitivity to the concentration of NaCl in media and different abilities to utilize carbohydrates and other carbon sources. They also had different optimums of temperature and pH for growth. The optimal temperature for the growth of most of the isolates was 37 0 C, but for A1, A2 and K3 isolates was 45 0 C. The isolates A1 and A2 were able to grow also at the temperature of 65 0 C. The strain K2 could grow at a very narrow pH range (7–8), while most strains grew in wide alkali pH ranges (K5, M1, M2 and M4 at pH 7–9, and A3 at pH 6–9). Remarkably, A1, A2, K3, K4, M9, M10, M12 and B7 strains demonstrated very few requirements for the pH value. They could grow at a wide range of pH 5–9; for A4, A5, and K1, these values were in the range of 4–9. A concentration of even 2% NaCl in media was lethal for K2 and K4 isolates. All other strains could grow in the presence of 7% of NaCl. The A3 strain showed the highest resistance to the high salt concentration and grew at 10% NaCl. All strains were chemoorganotrophs, homofermentative, and catalase-positive bacteria. They did not produce gas from glucose and could not reduce nitrates except for K3 and A3, which carried out nitrite reduction. The proteolysis of gelatin was detected for A1, A2, K3, K5, M9, M10 and M12 isolates. The strain A3 showed amylolytic activity. ADI activity was detected for A1, A2, A3, K1, K3 and K5 isolates. The lipolytic activity was revealed for A3, K3, K4 and K5 isolates. Remarkably, isolates K3 and K4 utilized Tween 40, while the other two strains cleaved Tween 80. The Voges-Proskauer reaction was positive in A1, A2, A3, K1, K4 and K5 isolates. Neither strain could synthesize indole from tryptophan, and neither has caseinolytic activity. They did not assimilate mannitol, dulcitol and melibiose, but the A2 isolate assimilated ribose. Even though the K4 strain did not use any of the tested carbohydrates, at the same time, it grew in MRS medium. The strains A4 and A5 used only arabinose as a carbon source, and the K1 strain used only fructose. The property to use only one carbon source (fructose) is a feature of strains isolated from bees' GUT. Molecular identification in phylogenetic study The 16s rRNA gene sequences were analyzed for more accurate identification of the isolated strains. The analysis revealed that strain A1 was identity to Bacillus pumilus (96%), A2 – B. pumilus (99%), A3 - Staphylococcus epidermidis (99%), A4 and A5 - Lactobacillus delbrueckii subs. lactis (99%). The other strains were identified as B7 – L. delbrueckii subs. bulgaricus (91%), M1 - Enterococcus lactis (99%), M 2 - E. ratti (97%), M4 - Enterococcus durans (99 %) , M9 - L. kimbladii , M10 - L. apis , M12 and K1 - Streptococcus salivarius (97 and 96% correspondingly). The phylogenetic tree, including isolates and control species, is presented in Figs. 2 and 3 . The strains A1 and A2 were identified as B. pumilus (with an identity of approximately 99%). Still, they were not included in the phylogenetic tree, as they are not representative of bee normal microbiota and are probably pathogenic for bees. Two separate phylogenetic trees were constructed for the coccus and rod morphological types. As can be seen in Fig. 3 , all species of both genera of lactic acid bacteria cocci (Enterococcus and Streptococcus) are divided into eleven clusters. Six of them are streptococci, and five are enterococci. The construction of the phylogenetic tree revealed that although the K1 strain has only 96% of identity to S. salivarius , it is in one cluster with the mentioned species so that it can be identified as S. salivarius . The other two cocci strains are included in enterococci clusters. It should be noticed that although the strain M4 was identical to E. durans by 99%, it composed a separate cluster with Enterococcus ratti by phylogenetic analyses. So, the M4 strain may have the same properties as these two mentioned strains. The investigation of the isoalte M1 showed 99% identity to E. lactis. But on the phylogenetic tree, the M1 strain is slightly far from the cluster in which Enterococcus faecium is also included. This allows speculating that the isolate M1 might be similar to these two strains with the properties. The analyses of 16S rDNA genes of Lactobacilli isolated within this research have shown fascinating results. All Lactobacilli species are divided into ten clusters. Remarkably, the last three clusters included representatives isolated from the gastrointestinal tract of honeybees. Two of our strains, A4 and A5, isolated from GUT of Armenian honeybees showed identity to L. delbrueckii subs. lactis , and one B7 - L. delbrueckii subs. bulgaricus . Bootstrap analyses did not reveal a significant distance between investigated and referent strains. Interestingly, they showed absolutely different morphological, culturing and biochemical properties. We can conclude that the symbiotic type of life dictates these specificities. According to El Kafsi and coauthors [ 15 ] L. delbrueckii subs. lactic is catalase-negative. It ferments glucose, fructose, mannose and maltose and hydrolyzes arginine. While the isolates A4 and A5 neutralized the H 2 O 2 , they did not assimilate any mentioned carbohydrates as the only carbon source and were ADI negative. These three strains (A4, A5 and B7) 16s rRNA gene sequences were deposited in the NCBI library with accession number OP 784418, OP 784423 and MK494928, respectively, and two of them, A4 and B7, were deposited in Microbial Depository Center of Armenia with accession number MDC 9679 and MDC 9680 respectively. Antibacterial activity of the isolated strains The antibacterial activity of isolates has been studied to estimate their biotechnological potential. Only four isolates from the gut of bees and three isolates from honey wax were found to be more active. Antibacterial activities of the studied isolates are presented in Table 2 . Maximum antibacterial activity after 10 h of cultivation was observed for the isolates M1, M2, and M4, while B7, M9 and M12 revealed this property at least after 27-hour cultivation. Table 1. Name and sequences of oligonucleotide primers used in PCR amplifications Primer name Sequence (5′ - 3′) Target ­ b Reference 16S F GAGTTTGATCCTTGGCTCAG Bacterial 16S rRNA, pos. 8-27 Universal Bacterial Identification by PCR and DNA Sequencing of 16S rRNA Gene; James, 2010 16S R GAAAGGAGGTGATCCAGCC 1492-1473 Table 2 The results of antibacterial activity analyses of isolates Strains number The zone of growth absence (Ø mm) S. Typhimurium St. aureus M. luteus B. subtilis B. mesentericus E. coli E. lactis M 1 11* 11* 18** 18** 14** 17** E. ratti M 2 12* 10* 19* 16*** 16*** 14** E. durans M 4 13* 14* 21* 14 17* 16** L. delbrueckii subs. bulgaricus B7 15** 18** 22* Static 15*** 10*** L. kimbladii M9 14* 13* 19* 16 15*** 12 L. apis M10 11* 16** 20* 17** 13* 15** S. salivarius M12 12* 14** 21* 20* 13* 13*** L. delbrueckii subs. lactis A4 15*** 0 ns 0 ns 0 ns 0 ns 13*** L. delbrueckii subs. lactis A5 16** 0 ns 0 ns 0 ns 0 ns 15*** *p < 0.05; * *p < 0.01; * **p < 0.001, ns - non significant. Based on the results, further investigation was done only after at least 10-hour cultivation for M1, M2, and M4 and 30-hour cultivation for B7, M9 and M12. Interestingly, B7, M9 and M12 were isolated from honey wax, and М1, М2, M4, A4 and A5 from the bees' gut. The most interesting is that the strains A4 and A5 showed antagonistic activity only against Gram-negative bacteria. That is why we didn't continue to work with these two strains. The correlation between antibacterial activity, the ability to produce an acid and intensity of aeration is shown in Table 3 . There is no correlation between antibacterial activity and the maximum value of the acidity, as well as between the aeration intensity and the number of cells in cultural liquid. The investigated strains inhibited the growth of a wide spectrum of Gram-positive and Gram-negative bacteria. The diameter of the inhibitory zones varied from 10 to 22 mm, while the measured activity AU ranged from 10 to 33.322. Generally, all investigated strains were characterized by low levels of acidification, and the aggregation of milk proteins takes place only after 48 h of cultivation. Maximum antibacterial activity for М1, М2 and M4 isolates was determined at good aeration conditions, while for isolate M10, the aeration did not play a decisive role (Fig. 4 ). Table 3 The growth kinetics of isolates and the correlation between synthesis of acid and cultivation conditions Strains The cultivation duration for maximum antibacterial activity (h) pH OD (600nm) Cultivation conditions Antibacterial activity Indicator microorganismes AU E. lactis M1 10 4.7 1.48 Without shaking St. aureus , S. Typhimurium, M. luteus, B. subtilis , E. coli, B. mesentericus 10–20 E. ratti M 2 10 4.72 1.4 With shaking (200 rpm) St. aureus , S. Typhimurium, M. luteus, B. subtilis , E. coli, B. mesentericus 10–25 E. durans M 4 10 4.5 1.38 With shaking (200 rpm) St. aureus , S. Typhimurium, M. luteus, B. subtilis , E. coli, B. mesentericus 15–33 L. kimbladii M9 30 4.5 0.9 Without shaking St. aureus , S. Typhimurium, M. luteus, B. subtilis , E. coli, B. mesentericus 15–30 L. apis M10 15 4.6 1.2 Independent St. aureus , S. Typhimurium, M. luteus, B. subtilis , E. coli, B. mesentericus 10–20 S. salivarius M12 24 4.7 0.84 With shaking (200 rpm) St. aureus , S. Typhimurium, M. luteus, B. subtilis , E. coli, B. mesentericus 15–33 L. delbrueckii subs. bulgaricus B7 27 4.5 1.35 With shaking (200 rpm) St. aureus , S. Typhimurium, M. luteus, E. coli, B. mesentericus 10–33 For the M4 strain, the aeration did not affect the synthesis of antibacterial components. This strain showed activity only in the case of cultivation in aerobic conditions only after the neutralization of the lactate by an adjustment of the pH to a value of pH 6.0. M9 isolate showed antibacterial activity at a pH 6.0 only when the strain was cultivated in strict anaerobic conditions. It means oxygen plays a crucial role in synthesizing pH-stable antibacterial component/s by the M9 isolate. This property must be further investigated. The media's nutrient composition effect on the isolated strains' antibacterial activity was also investigated. The results revealed that antibacterial component synthesis depends on the medium composition. This experiment used two media types: 10% skimmed milk and MRS. The data is presented in Table 4 . As shown in Table 4 , the antibacterial activity decreased crucially when the isolates were cultivated on MRS. Moreover, no activity was detected in investigated strains when the S. typhimurium MDC 1754 was used as a test organism (Table 4 ). Table 4 The effect of the nutrient composition of the medium on the antibacterial activity of isolates Strain Arbitrary Units B. subtilis St. aureus S. Typhimurium Milk MRS Milk MRS Milk MRS E. lactis M1 30 10 *** 10 0 *** 10 0 *** E. ratti M 2 25.85 0 *** 10 0 *** 15.85 0 *** E. durans M 4 20 10 *** 15.85 0 *** 20 0 *** L. kimbladii M9 25.85 15.85 *** 15.85 30 *** 25.85 0 *** L. apis M10 30 15.85 *** 20 25.85 ** 10 0 *** S. salivarius M12 33.22 0 *** 15.85 33.22 *** 15.85 0 *** L. delbrueckii subs. bulgaricus B7 10 10 ns 30 0 *** 20 0 *** *p < 0.05; * *p < 0.01; * **p < 0.001, ns - non significant. DISCUSSION Although Lactobacilli and Bifidobacteria are endosymbionts for Apis melifera , some extraordinary representatives of these two groups can be identified in the honeybee gut. Similarly, Evans and Armstrong [ 16 ] failed to isolate Lactobacillus sp. isolates from A. mellifera , suggesting that the gut's bacterial population is not constant in the same bee species. In the investigation of El-Sohaimy and co-authors [ 17 ], some LAB strains were reported that had not previously been detected in the genus Apis. The microbiome of honeybees can be different in different species. It can be changed during the year seasons, depending on flora diversity, geographic and ecological conditions, and usage of insecticides and antibiotics such as oxytetracycline hydrochloride and sulfathiazole, which are commonly used for controlling AFB and EFB worldwide. In this investigation, we observed an antibacterial activity of isolated strains against both Gram-positive and Gram-negative bacteria. This article's main goal was to investigate the Armenian honeybee gut microbiome by isolation of LAB and to reveal their potential to inhibit the growth of different possible pathogenic bacteria in honey. The microbiome of the Armenian honeybee is mainly composed of lactic acid bacteria, similar to the honeybee microbiomes investigated worldwide [ 2 ]. It was shown that LAB symbionts can protect honeybees by inhibiting the growth of different pathogens [1; 11]. Approximately 50 isolates were screened according to their ability to inhibit the E. coli ATCC 8739, and only for 17 an antagonistic activity was detected. The fact that all investigated strains kept antibacterial activity after pH adjustment to 6.5 underlined that the antagonistic activity is not related to organic acids. Some of LAB (M1, M2, M4) synthesized the antibacterial components after 10 h of cultivation, others after 24–30 h of cultivation (B7, M9, M12). Our previous data [ 18 ] shows that LAB isolated from different sources can synthesize the antibacterial component in different growth phases. We can speak about secondary metabolites mainly when they are synthesized after 24–30 h of growth in the late pre-stationer phase. The major part of LAB used as probiotics synthesize antibacterial components like bacteriocins, which can inhibit the growth of Gram-positive bacteria. At the same time, in the case of the A4 and A5 strains, the antagonistic activity was detected only against Gram-negatives indicators. The aeration can affect the synthesis of antibacterial components. In the case of some LAB strains, anaerobic conditions are more critical for synthesizing antagonists. As can be seen from Table 4 , there is no correlation between aeration and the synthesis of antibacterial components. Thus, the dependence of the synthesis of antibacterial components and acid on the aeration is only a strain-specific property. The most intriguing thing is that in the case of the M4 strain, the stable antibacterial components are synthesized in aeration conditions. Although LAB are characterized as aero-tolerant, many authors detected the presence of aerobic metabolism, even in the case of the Lactobacillaceae family. Zotta and co-authors [ 19 ] showed that lactobacilli can use oxygen as a respiration substrate because of the flavine oxidase synthesis. Aeration can affect the metabolism of carbohydrates and lead to the synthesis of different components, which can have antagonistic activity. On the other hand, the M9 strain showed the opposite picture. Its antibacterial components showed pH stability when the strains were cultivated in anaerobic conditions. This observation can be explained by oxygen's oxidative effect and components' destruction. Most likely, it can only be speculated that the M4 strain comes into the honeybee intestine originating from plants, where it adapted to the presence of oxygen. In contrast, the M9 strain is a typical representative of the intestinal microbiota growing under exclusively anaerobic conditions. The different components of nutrient media can also affect the synthesis of antagonistic components. Linares-Morales and co-authors [ 20 ] analyzed three different nutrient media composed of agro-industrial wastes. The comparison of LAB growth and their antagonistic activity revealed that this kind of culture media can improve not only the growth of cells but also the production of antibacterial components. The same results were obtained for LAB isolated from the Armenian gut microbiome. Milk usage improved the production and stability of antibacterial components, apparently due to the activation of proteolytic activity [ 21 ]. The components of the food, the gut, and the gut microbiome can be involved in the digestive process and result in different metabolic contractions [ 22 ]. The ability to degrade different carbohydrates revealed glycosidase activity typical for some representatives of honeybee gut like Giliamella sp. , which leads to the digestion of cellulose. Alfa-glycosidase is responsible for the digestion of glucose and maltose and also leads to the degradation of starch particles [ 23 ]. The presence of some carbohydrates in the honeybee gut can be very toxic for animals because they don't produce the necessary enzymes for their digestion [ 24 ]. Carbohydrates assimilation tests revealed the ability to utilize all investigated carbohydrates by LAB isolated from the Armenian honeybee gut. The most interesting thing is that some strains can utilize a single carbohydrate, like arabinose for strains A4 and A5, and fructose for K1. This finding is extraordinary because K1 was identified as S. epidermidis for which the utilization of carbohydrates should not be complicated and which can be explained only by speculation of symbiotic life. Pedrosa-Davilla and coauthors [ 25 ] state that S. epidermidis forms biofilms in low O 2 environments. Anaerobic conditions in these bacteria dictate the highest rate of fermentation. The growth rate decreased at low oxygen even though the ATP concentration was high and the bacteria formed biofilms under these conditions. From these 17 isolates, two were Gram-negative and two were spore-forming. According to some investigations, the microbiome of honeybee gut is composed of plant pollen and nectars microbiomes, where the dominant domain is Firmicutes (17.6%) followed by Proteobacteria (63.2%) and Actinobacteria (4.1%) [ 26 ]. Most of the detected Gram-negative bacteria are biofilm-forming Snodgrasella alvi , which did not ferment sugars and sugar-fermenting Gilliamella apicola [ 26 ]. Among Gram-positive bacteria, the core bacteria belong to phylum Firmicutes with representatives of Lactobacillus Firm-4, Lactobacillus Firm-5 and Bifidobacteria [ 26 ]. The most common bacteria isolated from floral pollen belong to the Bacillus genera. The representatives of this genus are essential for honeybees as the farms of different ferments play a role in digestion. Even more, the amylase detected in honey and which activity can be used as an indicator of honey freshness, produced mainly by representatives of bacilli which are present in the honeybee gut. In the case of our experiments, the amylase activity was detected for the A3 strain, which was identified as Staphylococcus epidermidis . According to classical microbiological identification features, Staphylococci should not show amylase activity [ 27 ]. However, several species of Staphylococci can produce α-amylase, which is observed to be the critical factor in the host-microbe interaction and to cause a higher infection rate. This increased monosaccharides production elevates the glucose levels phosphorylated by glkA in this pathogen and is primarily utilized in synthesizing adhesion polysaccharides, exo-polysaccharides and cell wall biosynthesis [ 28 ]. ADI pathway is common for many different genera and is very conservative. It can work as a possible way to synthesize energy or, like in the case of LAB, is responsible for the cells pH homeostasis, helps to survive in low pH conditions and is required for acid tolerance response, especially in LAB [ 29 ]. Lindgren and co-authors in 2014 showed that for some pathogenic bacteria like S. epidermidis or S. aureus , the ADI is crucial for resistance to acid conditions and even protects the cells from pH-induced oxidative stress [ 29 ]. This is a possible explanation of how the S. epidermidis A3 strain can survive in honeybee gut and also be a possible pathogen of honeybees, where, according to data, at least 50% of the microbiome is represented by LAB, producing a high amount of lactic acid. Moreover, our results revealed the catalase activity for all isolates, which can be very discussable because some of our isolates were typical LAB. Still, several data are accumulated in the literature [ 30 ] about hem-dependent and Mn-catalases of Lactobacilli, which protect them from the toxic effects of oxygen during the surface growth of the colony or in the case of symbiotic life. So, investigation of different representatives of honeybee gut, revealing their different activities, is very important not only for protecting honeybee health but also for understanding the host’s microbe interaction. During the last decade, articles approved the beneficial effect of LAB isolated from honeybee gut. Some strains can even inhibit the growth of typical honeybee pathogens like Ascosphaera apis , Nosema ceranae , Paenibacillus larvae [ 31 ]. These pathogens may cause extreme economic losses. Most of these strains belong to the genera Bacillus, Lactobacillus, Bifidus, and Brevibacillus [ 11 ]. Because the LAB strains isolated in the present work displayed defense activity against pathogens, a promising management strategy might be developed to prevent honeybee bacterial diseases and avoid antibiotic treatment. The microbiome of Armenian honeybees is an unexplored source of bacteria with different biological activities. After a detailed characterization of the isolated strains, it was concluded that they could be used as probiotics for the honeybees, and they also possess the potential to be used as starter cultures in the production of fermented foods. Some of the isolated strains had potent inhibitory activity against pathogens in the case of milk cultivation, indicating their beneficial effect on both animal and human health. The synthesis of antibacterial components by the strain can be detected both in the presence of oxygen and/or in anaerobic conditions. MATERIALS AND METHODS Samples The samples of bees were taken from apiaries in the villages: Metsavan (41°12'6˝ N, 44°13'44˝ E) in Lori province, Berdashen (41°3'13˝ N, 43°40'8˝ E) in Shirak province, Movses (40°54'23˝ N, 45°29'29˝ E) in Tavush province, Karashamb (40°24'18˝ N, 44°34'354˝ E) in Kotayk province, as well as in the city of Artashat (40°24'18˝ N, 44°34'35˝ E) in Ararat province. The sampling was made from May to June of 2016 and 2017, from only one hive in each province, which are characterized by diverse flora. The sampled bees (5 wokers) were placed in sterile containers with pieces of cotton saturated with a 15% sucrose solution. Each sample of bees was kept in chilled conditions at +4°C and investigated during the first 48 h. Before the isolation of bees’ gastrointestinal tract, the bee samples were washed with 70% ethanol, to avoid the external contamination, and the total gut was separated from bee with sterile lancet. Isolation of bacterial strains and cultivation conditions For the isolation of lactic acid bacteria, an enrichment of 10% skimmed milk was made for 24 h at 37 °C with total gut particles of bees. Then 0.5 ml of each serial dilution was cultivated in different media (MRS, M17, hydrolyzed milk, 10% skimmed milk "Himedia", India) for seven days at 37 °C. MRS media was used for cultivation of Lactobacilli , M17 as it was described with producer consisting of lactose and was used for isolation of Streptococci . Hydrolyzed and skimmed milk were used for isolation of different representatives of LAB like Enterococci , Apilactobacillus , Lactococcus , Fructilactobacillus, Latilactobacillus species and others. The hydrolyzed milk is important, especially for isolation of symbiotic bacteria. All these media were used for the isolation of LAB. The strains of LAB were obtained by picking up single colonies after cultivation on selective nutrient media under selective temperature conditions, and their purity was controlled by microscopic analysis of the obtained cultures (Motic M10LB, USA). Cultivation was made at batch cultures in tubes under aerobic conditions, without shaking. Only Gram-positive mesophylic (37 °C) bacteria were chosen. All studied isolates, except A1 and A2, formed small (usually point-shaped), round, ovoid or fusiform, lentil-like, rod-shape colonies with slight relief, white or cream colored, shiny or pale, with straight or indented edges and with diameter no more than 2 mm. A1 and A2 isolates were spread on the medium’s surface, creating colonies with dissected edges and high viscosity. All isolated strains were conserved at -20°C in the presence of 20% glycerol. LAB were maintained in a viable condition by subculturing once a month in enriched milk (10% skimmed milk, 0.1% peptone, 0.1% yeast extract, pH 6.9) or in MRS medium and saved at -20 °C (MRS media, 20% glycerol). Isolation of total DNA and 16s RNA gene amplification Extraction of genomic DNA was carried out according to "Bacterial genomic DNA isolation using CTAB" protocol [32]. The "universal" oligonucleotide primers (Table 1) were used for amplification of bacterial 16S rDNA gene (region 27-1492) [33]. Amplification was carried out at a final volume of 50 µl and contained 100 ng DNA, 1x Taq Buffer, 0.8 mM dNTP mix, 0.5 µM of each primer, 0.5 U DyNAzyme II DNA polymerase (Thermo Scientific, USA). Amplification was performed by an amplification protocol comprising initial denaturation at 95 ºC for 5 min followed by 30 cycles of denaturation at 95 ºC for 1 min, annealing at 54 ºC for 40 s, extension at 72 ºC for 1 min, and a final extension at 72 ºC for 10 min. The reactions were subsequently cooled to 4 ºC. The PCR product was analyzed on 1.0% agarose gel electrophoresis. Table 5. Utilization of different carbon sources by strains isolated from honeybee gut Carbohydrates A1 A2 A3 A4 A5 K1 K2 K3 K5 M1 M2 M4 M9 M10 M12 B7 Glucose + + + - - - - + + + + + + + + + Sucrose - - + - - - - - - + + + + + + + Fructose + + + - - + + + + + + + + + + + Arabinose + + + + + - + - + + + + + + + + Maltose + + + - - - - - + + + + + + + + Lactose + + + - - - - + + + + + + + + + Rafinose - - - - - - - + - + + + + + + + Ramnose - - - - - - - - - + + + + + + + Galactose - - + - - - - - - + + + + + + + Sorbitol - - - - - - - - - + + + + + + + Mannose + - + - - - - + - + + + + + + + Ribose - + - - - - - - - + + + + + + + Glycerol + + + - - - - - + + + + + + + + All LAB isolates amplification products were sequenced in Macrogen Inc. (South Korea). Sequence alignments were performed using the BLAST algorithm [34] at the NCBI (National Center for Biotechnology Information: http://www.ncbi.nlm.nih.gov/Blast). 100 value was used as the max target sequence. Automatically adjust parameters for short input sequences. 0.05 was used as the expect threshold. 0 as Max matches in a query range. 1, -2 used as Match/Mismatch Scores. Gap cost was linear. Low complexity regions were filtered. Removal of chimeric sequences was made with DECIPHER v2.0 [35]. The construction of phylogenetic trees was made by MEGA 11 Version 11.0.11. Morpho logical properties and staining Cell morphology and motility were determined by a light microscope (Olympus CH2). Gram staining was made by the standard method [36]. Physiology and biochemical properties The growth temperature range was determined after incubating the isolates at 5 to 80 °C with 5 °C intervals for 24 h in MRS media. The influence of the pH on the growth was tested in MRS media with adjusted pH at a range from pH 5 to pH 12 during seven days. In both cases, the measurement of optical density was at OD 595 nm. The influence of NaCl concentrations on growth was determined by adding from 0 to 10% NaCl to the incubation MRS medium with 1% steps, again during seven days. Catalase activity was determined by bubble formation in a 3% hydrogen peroxide solution. Arginine deiminase (ADI) activity was determined by adding Nessler's reagent to the cultural liquid according to [37]. The anaerobic growth of the isolates was tested by growth in solid anaerobic stab cultures covered with a paraffin layer. The casein and starch hydrolysis were tested by the streak plate method [38; 39]. The gelatin liquefaction was determined by inoculating the lactobacilli into gelatin nutrient medium (gelatin 10 g, distilled water 100 ml) technique and incubation at 37 °C for 24 h. The lipolytic activity was determined by technique involving the hydrolysis of Tween 20 (polyoxyethylene sorbitan monolaurate), Tween 40 (polyoxyethylene sorbitan monopalmitate), Tween 60 (polyoxyethylene sorbitan monostearate), Tween 80 (polyoxyethylene sorbitan monooleate). All mentioned experiments were carried out according to Benson [36]. For studying the reductive activity of strains and gas-formation (homo- or hetero-fermentation activity), all LAB isolates were grown on skimmed milk with 0.1% methylene blue and on MRS broth with inverted Durham tubes. The fermentation of different carbohydrates and several other biochemical properties were investigated by API 50CH test (BIOMERIEUX, France) to identify the isolated LAB. Study of antibacterial properties The antibacterial property of all isolated cultures was determined by a well-diffusion assay [9]. Different indicator strains ( Pseudomonas aeruginosa ATCC 9027, Escherichia coli VKPM-M17, Micrococcus luteus ATCC 15307, Staphylococcus aureus MDC-5233 (Microbial Depository Center, Armenia), Salmonella Typhimurium MDC 1754, Bacillus subtilis ATCC 6633, and B. licheniformis VKPM B-10956) were used as test organisms. Ordinary LAB grow in milk or MRS media and reach their stationary phase after maximum 48 h of cultivation in optimal conditions, although in case of symbiotic bacteria this frames can be changed. That is why, the isolated strains were cultivated in milk and MRS media at 37°C for 57 h. 0.1 ml of the fermented skimmed milk or cell free cultural liquid was added to the wells after each 3 h. For preparation of cell free cultural liquid samples each 3 hour approximately 5 ml of culture was centrifuged at 10000 rpm, during 5 min and passed throw the 0.22 μm bacteriological filter. Then, for the diffusion of antibacterial substances, Petri dishes were placed at room temperature for 30 min. After 24 h of incubation at the optimum temperature required for the test-culture growth, the diameters of the growth inhibition zones were measured. A clear inhibition zone of at least 2 mm diameter was recorded as positive. Antibacterial activity was measured after an adjustment of pH to 6. The investigation of the correlation between the synthesis of antibacterial components and the presence of oxygen in nutrient media was performed in several ways. The strains were cultivated without shaking in standard tubes half filled with the nutrient medium and the other half full of air. In the other case, the tubes with the same amount of nutrient media were actively shaken on the digital orbital shaker DaiHan SHO 2D (Korea) (180 r/min). Strong anaerobic conditions were created by filling the tubes with nutrient medium and topping them with sterile wax. Arbitrary units (AU) of antibacterial component activities were calculated using the spot-on-lawn method [9]. The resulting sample was two-fold serially diluted in a filter-sterilized phosphate buffer (20 mM, pH 6.5). 100 μL of each dilution was spotted on the plate. An AU of cell-free cultural liquidwas calculated according to the formula for 2n × 1,000/x, where n was the highest dilution that could significantly inhibit the indicator strain, and x was the amount of sample (μl) added to the well. Data processing Mean values and standart deviations were calculated from three independent repeated experiments with Statgraphics software (Statpoint Technologies, Inc; Warrenton, Virginia, USA). The statistical significance of received data was calculated with R Project for Statistical Computing version R 3.1.0 (The R foundation of statistical computing, Vienna, Austria); P<0.05 if not mentioned. Moreover all data were analised by a 2-way ANOVA Tukey’s statistical test using GraphPad Prism 8.0.2 program (GraphPad Software, USA). Declarations Author Contributions Inga Bazukyan: Supervision, Conceptualization, Investigation, Data curation, Writing- Original draft preparation. Anahit Sahakyan : Investigation. Anna Petrosyan: Investigation. Lusine Hakobyan: Formal analysis, Visualization. Inesa Semerjyan : Formal analysis, Validation. Lilit Nersisyan : Formal analysis, Software. Lusine Gasparyan: Investigation, Software. Karen Trchounian: Writing- Reviewing and Editing. Svetoslav Dimov: Investigation, Writing- Reviewing and Editing. Acknowledgments The authors thank all beekeepers for providing animals and keeping experimental conditions. Funding The work was supported by the Science Committee of RA, in the frames of the research project № 21T-2I019, by YSU in the frames of the inner research project of 2022, and by the Armenian National Science and Education Fund (ANSEF) based in New York, USA, to IB (NS Biotech-2203, 4431). Data availability All data generated or analyzed during this study are included in this published article. PRO-Seq data of 16srRNA were deposited into the Gene Expression Omnibus database under accession numbers MK494928, OP784418 and OP784423. The assembled contigs of the draft genome are available at the NCBI's GenBank under accession number JAQSVE000000000. The data are available at the following URL https://www.ncbi.nlm.nih.gov/nuccore/MK494928.1/, https://www.ncbi.nlm.nih.gov/nuccore/OP784418.1/, https://www.ncbi.nlm.nih.gov/nuccore/OP784423.1/. Ethics approval Experiences were fulfilled according to the "International Recommendations on carrying out biomedical research with the use of animals (CIOMS 1985), to the "Human Rights and Biomedicine, Oviedo Convention" (CE 1997), to the European Convention for the Protection of Vertebral Animals Used for Experimental and Other Scientific Purposes (CE 2005) and approved by the National Center of Bioethics (Armenia). Declaration of Competing Interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. References Vásquez, A. et al. Symbionts as major modulators of insect health: lactic acid bacteria and honeybees. PLoS One. 7(3), e33188; https://doi.org/10.1371/journal.pone.0033188 (2012). Olofsson, T.C. et al. Lactic acid bacterial symbionts in honeybees - an unknown key to honey's antimicrobial and therapeutic activities. Int. Wound. J. 13(5), 668-679. https://doi.org/10.1111/iwj.12345 (2016). Ellis, J.D. & Munn P.A. The worldwide health status of honey bees. Bee World. 86, 88-101. https://doi.org/10.1080/0005772x.2005.11417323 (2015). Annual International Trade Statistics by Country (HS02). https://trendeconomy.com/trade (2024). Dimov, S.G. Environmental and anthropogenic influence on the core beneficial honeybee gut microbiota. A Short Communication from Bulgaria. 1, 88-95. https://doi.org/10.3390/bacteria/1020008 (2022). Oloffson, T.C. & Vásquez, A. Detection and identification of a novel lactic acid bacterial flora within the honey stomach of the honeybees Apis mellifera . Curr. Microbiol. 57(4), 356-363. https://doi.org/10.1007/s00284-008-9202-0 (2008). Zheng, H., Steele, M.I., Leonard, S.P., Motta, E.V.S., Moran, N.A. Honey bees as models for gut microbiota research. Lab. Anim. (NY). 47(11), 317-325. https://doi.org/10.1038/s41684-018-0173-x (2018). Kešnerová, L. et al. Gut microbiota structure differs between honeybees in winter and summer. ISME J. 14, 801–814. https://doi.org/10.1038/s41396-019-0568-8 (2020). Lavermicocca, P. et al. Purification and characterization of novel antifungal compounds from the sourdough Lactobacillus plantarum strain 21B. Appl. Environ. Microbiol. 66, 4084-4090. https://doi.org/10.1128/aem.66.9.4084-4090.2000 (2000). Lahtinen, S., Ouwehand, A.C., Salminen, S., Von Wright, A. Lactic acid bacteria: microbiological and functional aspects. 4th Ed., CRC Press, Taylor and Francis Group. https://doi.org/10.1201/b11503 (2012). Gyurova, A. et al. Characterization of Enterococcus durans EDD2, a strain from beehives with inhibitory activity against Paenibacillus larvae . J. of Apicul. Res. 1-14. https://doi.org/10.1080/00218839.2021.1936915 (2021). Dosch, C. et al. The gut microbiota can provide viral tolerance in the honey bee. Microorg. 9(4). https://doi.org/10.3390/microorganisms/9040871 (2021). Audissio, M.C., Torres, M.J., Sabate, D.C., Ibarguren, C., Apella, M.C. Properties of different lactic acid bacteria isolated from Apis mellifer a L. bee-gut. Microbiol. Research.166, 1-13. https://doi:10.1016/j.micres.2010.01.003 (2011). Gupta, R.K. Taxonomy and distribution of different honeybee species. In: Gupta, R.K., Reybroeck, W., van Veen, J.W. and Gupta, A. (eds) Beekeeping for poverty alleviation and livelihood security. 18(2), 63-103. DOI: 10.1007/978-94-017-9199-1_2 (2014). El Kafsi, H. et al. Lactobacillus delbrueckii ssp. lactis and ssp. bulgaricus : a chronicle of evolution in action. BMC Genomics. 15(1), 407. https://doi:10.1186/1471-2164-15-407 (2014). Evans, J.D. & Armstrong, T.N. Antagonistic interactions between honey bee bacterial symbionts and implications for disease. BMC Ecol. 6:4. (2006) https://doi.org/10.1186/1472-6785-6-4 (2006). El-Sohaimy, A.A. et al. Isolation, identification and antimicrobial activity of unprecedented lactic acid bacterial isolates from honeybees. Pak. J. Biol. Sci. 23(4), 467-477. https://doi.org/10.3923/pjbs.2020.467.477 (2020). Bazukyan, I.L., Babayan, A.M. & Trchounian, A. Some properties of antibacterial component of lactic acid bacteria isolated from Armenian dairy products. NAS RA Electronic J. of Natural Science. 2(21), 39-43. (2013). Zotta, T., Parente, E. & Ricciardi, A. Aerobic metabolism in the genus Lactobacillus: impact on stress response and potential applications in the food industry. J. Appl. Microbiol. 122, 857-869. https://doi.org/10.1111/jam.13399 (2017). Linares-Morales, J.R. et al. Influence of culture media formulated with agroindustrial wastes on the antimicrobial activity of lactic acid bacteria. J. Microbiol. Biotechnol.: 32, 64-71. https://doi.org/10.4014/jmb.2107.07030 (2022). Keryan, A., Bazukyan, I., Trchounian, A. Lactobacilli isolated from the Armenian fermented milk product matsoun: Growth properties, antibacterial and proteolytic activity and their dependence on pH. Int. J. Dairy Technol. 70, 389-398. https://doi.org/10.1111/1471-0307.12353 (2017). Iorizzo, M. et al. Antimicrobial activity from putative probiotic lactic acid bacteria for the biological control of American and European foulbrood diseases. Vet Sc. 9(5), 236. https://doi.org/10.3390/vetsci9050236 (2022). Zheng, H. et al. Division of labor in honey bee gut microbiota for plant polysaccharide digestion. Proc. Natl. Acad. Sci., USA. 116(51), 25909-25916. https://doi.org/10.1073/pnas.1916224116 (2019). Lee, F.J., Rusch, D.B., Stewart, F.J., Mattila, H.R. & Newton, I.L.G. Fermentation by honey bee gut microbes. Environ. Microbiol. 17, 796-815. https://doi.org/10.1111/1462-2920.12526 (2015). Pedroza-Dávila, U.H. et al. Staphylococcus epidermidis metabolic adaptation and biofilm formation in response to varying oxygen. bioRxiv 665356. https://doi.org/10.1101/665356 (2019). Nowak, A., Szczuka, D., Górczyńska, A., Motyl, I. & Kręgiel, D. Characterization of Apis mellifera gastrointestinal microbiota and lactic acid bacteria for honeybee protection. A Review Cells. 10(3), 701. https://doi.org/10.3390/cells10030701 (2021). Bergey, D.H., Krieg, N.R. & Holt, J.G. Bergey's manual of systematic bacteriology. Baltimore MD: Williams & Wilkins. DOI: 10.1007/978-0-387-68572-4 (2001). Lakshmi, H.P. et al. Molecular characterization of α-amylase from Staphylococcus aureus. Bioinform. 9(6), 281-285. https://doi.org/10.6026/97320630009281 (2013). Lindgren, J.K. et al. Arginine deiminase in Staphylococcus epidermidis functions to augment biofilm maturation through pH homeostasis. J. Bacteriol. 196(12), 2277-89. https://doi.org/10.1128/JB.00051-14 (2014). Peacock, T. & Hassan, H.M. Role of the Mn-catalase in aerobic growth of Lactobacillus plantarum ATCC 14431. App. Microbiol. 1(3) 615-625. https://doi.org/10.3390/applmicrobiol1030040 (2021). Iorizzo, M. et al. Functional properties and antimicrobial activity from lactic acid bacteria as resources to improve the health and welfare of honey bees. Insects. 13(3), 308. https://doi.org/10.3390/insects13030308 (2022). William, S., Feil, H. & Copeland, A. Bacterial genomic DNA isolation using CTAB. Bacterial DNA Isolation CTAB Protocol, DOE Joint Genom Institute. https://jgi.doe.gov/wp-content/uploads/2014/02/JGI-Bacterial-DNA-isolation-CTAB-Protocol-2012.pdf (2012). James, G. Universal bacterial identification by PCR and DNA sequencing of 16S rRNA gene. In: Schuller, M., Sloots, P.T., James, S.G., Halliday, L.C. and Carter, W.J.I. (eds), PCR for clinical microbiology, Springer, Dordrecht, 209-214. https://doi.org/10.1007/978-90-481-9039-3_28 (2010). Wright, E.S., Yilmaz, L.S. & Noguera, D.R. DECIPHER, a search-based approach to chimera identification for 16S rRNA sequences. Appl. Environ. Microbiol. 78(3), 717-725. https://doi.org/10.1128/AEM.06516-11 (2012). Altschul, S.F., Gish, W., Miller, W., Myers, E.W., Lipman, D.J. Basic local alignment search tool. J. Mol. Biol. 215(3), 403-410. https://doi:10.1016/S0022-2836(05)80360-2 (1990). Benson, H. J. Benson's microbiological applications: laboratory manual in general microbiology, Thirteenth edition complete version ed. McGraw Hill Education. https://doi.org/10.1016/j.idairyj.2018.05.008 (2011). Wenzel, C. et al. The effect of starters with a functional arginine deiminase pathway on cheese ripening and quality. International Dairy Journal. V. 85, 91-200. https://doi.org/10.1016/j.idairyj.2018.05.008 (2018). Clinical Microbiology Procedures Handbook, Fourth Edition. In Clinical Microbiology Procedures Handbook, Fourth Edition. American Society of Microbiology. https://doi.org/10.1128/9781555818814 (2016). Tille, P.M. Bailey and Scott’s diagnostic microbiology. Thirteen edition. Mosby, Inc., an affiliate of Elsevier Inc. 3251 Riverport Lane. St. Louis. Missouri 63043. DOI:10.1309/LM5JC0PH0OGGBSZZ (2014). Additional Declarations No competing interests reported. Supplementary Files graficalabstract.tiff Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4835721","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":347595856,"identity":"62c168c3-0c60-4f66-becb-05d92e3d34cf","order_by":0,"name":"Inga Bazukyan","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAwElEQVRIiWNgGAWjYBACAyBmbAAS/KRrkWwgWYvBAWK1mLMffyY5s80uz/hG+jMJhppthLVY9iSkSW5sSy42u5FjJsFw7DYRDjuQcEzyYRtz4rYbOWwSDGzEaDn/sA2opT5x8wyQw/4Ro+VGMhvQYYcTN0gkmEkwthGhxXLGM2bLGeeOJ84488bYIrGPCC3m/OkPb/aUVSf2t6c/vPHhGxFawICRDUgIJDAwJBCpAQj+ADH/AeLVj4JRMApGwcgCAOjjPxqC5pNNAAAAAElFTkSuQmCC","orcid":"","institution":"Yerevan State University","correspondingAuthor":true,"prefix":"","firstName":"Inga","middleName":"","lastName":"Bazukyan","suffix":""},{"id":347595857,"identity":"0b02698b-4fc7-41f3-be38-cea180d60b5f","order_by":1,"name":"A. Sahakyan","email":"","orcid":"","institution":"Yerevan State University","correspondingAuthor":false,"prefix":"","firstName":"A.","middleName":"","lastName":"Sahakyan","suffix":""},{"id":347595858,"identity":"d5a584ab-353f-4b54-b19c-d465ad059827","order_by":2,"name":"A. Petrosyan","email":"","orcid":"","institution":"Yerevan State University","correspondingAuthor":false,"prefix":"","firstName":"A.","middleName":"","lastName":"Petrosyan","suffix":""},{"id":347595859,"identity":"acab361a-45cf-43fc-af6e-f92a6c777042","order_by":3,"name":"I. Semerjyan","email":"","orcid":"","institution":"Yerevan State University","correspondingAuthor":false,"prefix":"","firstName":"I.","middleName":"","lastName":"Semerjyan","suffix":""},{"id":347595860,"identity":"28eff178-15aa-4508-b5fe-c109b5a08ef9","order_by":4,"name":"L. Hakobyan","email":"","orcid":"","institution":"Yerevan State University","correspondingAuthor":false,"prefix":"","firstName":"L.","middleName":"","lastName":"Hakobyan","suffix":""},{"id":347595861,"identity":"79ca0af5-f2ad-4319-9ed7-f1e70c4e63b4","order_by":5,"name":"L. Nersisyan","email":"","orcid":"","institution":"Institute of Molecular Biology","correspondingAuthor":false,"prefix":"","firstName":"L.","middleName":"","lastName":"Nersisyan","suffix":""},{"id":347595862,"identity":"60de22f1-8dec-4210-8a63-206164f5b4d8","order_by":6,"name":"L. Gasparyan","email":"","orcid":"","institution":"Yerevan State University","correspondingAuthor":false,"prefix":"","firstName":"L.","middleName":"","lastName":"Gasparyan","suffix":""},{"id":347595863,"identity":"be863ada-dbc5-4ecd-a594-da92da3b33d1","order_by":7,"name":"K. Trchounian","email":"","orcid":"","institution":"Yerevan State University","correspondingAuthor":false,"prefix":"","firstName":"K.","middleName":"","lastName":"Trchounian","suffix":""},{"id":347595864,"identity":"47ab6b4a-d275-465e-a13f-eb0faab28300","order_by":8,"name":"S. Dimov","email":"","orcid":"","institution":"Sofia University St. Kliment Ohridski","correspondingAuthor":false,"prefix":"","firstName":"S.","middleName":"","lastName":"Dimov","suffix":""}],"badges":[],"createdAt":"2024-07-31 12:59:59","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4835721/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4835721/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":63959802,"identity":"ccd7c6c8-edfc-4114-b0cb-9bb620496c5a","added_by":"auto","created_at":"2024-09-04 08:36:34","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":666832,"visible":true,"origin":"","legend":"\u003cp\u003eThe growth dynamic and acid synthesis activity of the isolates (A1, A2, A3, A4, A5, K4)\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-4835721/v1/8a7ebffc23214644ebe44695.png"},{"id":63959126,"identity":"9534fd45-8f68-4366-9635-06646c274bc5","added_by":"auto","created_at":"2024-09-04 08:28:34","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1741500,"visible":true,"origin":"","legend":"\u003cp\u003ePhylogenetic tree of cocci isolates based on the comparison of their 16S rDNA\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-4835721/v1/89d6762b4eee7cd2135aec91.png"},{"id":63959125,"identity":"f3553171-d2ae-4d48-99bb-4f26f85c45a0","added_by":"auto","created_at":"2024-09-04 08:28:34","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1799273,"visible":true,"origin":"","legend":"\u003cp\u003ePhylogenetic tree of rod shape isolates based on the comparison of their 16S rDNA\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-4835721/v1/ad67c9ec57ef7336119794b6.png"},{"id":63959129,"identity":"255a8dbe-efb6-4217-bd82-e23612d35047","added_by":"auto","created_at":"2024-09-04 08:28:34","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":2064553,"visible":true,"origin":"","legend":"\u003cp\u003eThe effect of aeration intensity on the synthesis of antibacterial components\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eA.\u003c/strong\u003e The antibacterial activity of M4 isolates grown: 1) without shaking, 2) with shaking, 3) in strong anaerobic conditions, 4) without aeration with adjusted pH to a value of 6, 5) with aeration with adjusted pH to a value of 6, 6) in strong anaerobic conditions with adjusted pH to a value of 6.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eB. \u003c/strong\u003eThe antibacterial activity of B7 isolates grown: 7) without shaking, 8) with shaking, 9) in strong anaerobic conditions, 10) without aeration with adjusted pH to a value of 6, 11) with aeration with adjusted pH to a value of 6, 12) in strong anaerobic conditions with adjusted pH to a value of 6.\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-4835721/v1/c78b2201d756550c58f260e9.png"},{"id":64215462,"identity":"aed5bc27-b4d3-4201-92ea-b26cd5fa71b0","added_by":"auto","created_at":"2024-09-10 09:21:15","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":9493014,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4835721/v1/83dc4ce9-ce67-4af6-b3bd-61e3a74ea7c5.pdf"},{"id":63959803,"identity":"350a570c-8634-4484-a74c-3b50d1a87ea6","added_by":"auto","created_at":"2024-09-04 08:36:34","extension":"tiff","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":15205708,"visible":true,"origin":"","legend":"","description":"","filename":"graficalabstract.tiff","url":"https://assets-eu.researchsquare.com/files/rs-4835721/v1/77e93e7370d717d23be4e858.tiff"}],"financialInterests":"No competing interests reported.","formattedTitle":"Antibacterial and Biochemical Properties of Newly Isolated Lactic Acid Bacteria from Gastrointestinal Tract Microbiome of Armenian Honeybees","fulltext":[{"header":"IMPORTANCE ","content":"\u003cp\u003eThis investigation is very important to understand the immunity processes in organism of bees, and will help to create a medicinal preparation of probiotic bacteria which could be used as a feed for bees and will increase their immunity.\u003c/p\u003e"},{"header":"INTRODUCTION","content":"\u003cp\u003eHoneybees (\u003cem\u003eApis mellifera\u003c/em\u003e) are one of the most crucial pollinating insect species worldwide. Beekeepers collect honey, beeswax, propolis, pollen, and royal jelly from hives; bees are also kept for pollinating crops [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. All components produced by honey bees have a beneficial effect on human health because of the antihypotensive activity, acidity, antiviral, antibacterial, antifungal, antioxidant, and anti-inflammatory compounds they contain. Some components have demonstrated antagonistic activity against over 250 strains of bacteria, including methicillin-resistant \u003cem\u003eStaphylococcus aureus\u003c/em\u003e (MRSA) and vancomycin-resistant \u003cem\u003eenterococci\u003c/em\u003e (VRE) [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. The health status of honey bees has become an essential concern in many countries. For example, American foulbrood disease, caused by \u003cem\u003ePaenibacillus larvae\u003c/em\u003e, is a common bacterial disease affecting apiculture worldwide [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Foulbrood is lethal for infected honey bee larvae, and in this way, it stops the reproduction of the infected colonies.\u003c/p\u003e \u003cp\u003eAccording to the Trand Economy report for 2020 [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e], the export of honey in Armenia is approximately 137 tons. This relatively low amount is specified not only by the small number of apiaries but also by the low immunity and high mortality of bees. Moreover, agricultural pressure decreased beneficial bee health genera when industrial treatments reduced the total number of bacteria [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe experiments conducted by scientists in different countries have shown the presence of core endosymbionts in the gut of healthy honeybees comprising nine bacterial phyla. Less than a decade ago, Olofsson and coauthors [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e] discovered an unexplored bacterial microbiota in symbiosis with honeybees and located it in the honeybee's gastrointestinal tract (GIT). The representatives of two of their microbiota phyla (designated as \"Firm-4\" and \"Firm-5\") belonged to the genus Lactobacillus and another one, \"Bifido\", to the genus Bifidobacterium. The microbiota comprises approximately 40 lactic acid bacteria (LAB) strains with 13 taxonomically well-defined \u003cem\u003eLactobacillus\u003c/em\u003e and \u003cem\u003eBifidobacterium\u003c/em\u003e species. On the other side, not only lactobacilli are present in the honeybee gut, but also some representatives of Proteobacteria like \u003cem\u003eGilliamella apicola\u003c/em\u003e, \u003cem\u003eSnodgrassella alvi\u003c/em\u003e, \u003cem\u003eFrischella perrara\u003c/em\u003e, \u003cem\u003eBartonella apis, Parasaccharibacter apium\u003c/em\u003e, or \u003cem\u003eComensalibacter spp.\u003c/em\u003e, and Bacteroides such as \u003cem\u003eApibacter adventoris\u003c/em\u003e [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Kešnerov\u0026aacute; and co-authors [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e] obtained remarkable results showing a difference between the gut microbiota of winter bees, foragers and nurses. It was shown that anthropogenic effects can lead to crucial changes in honeybee gut microbiota composition.\u003c/p\u003e \u003cp\u003eLAB synthesize many compounds that possess both antibacterial activity (hydrogen peroxide, carbon dioxide, diacetyl, organic acids (lactic acid in particular), fatty acids (antifungal components, bacteriocins) and proteolytic activity (protease, peptidase) [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. There are many reports on the production of antibacterial compounds by LAB [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e], but there are comparatively few about the inhibitory activity of the microbiota of the bee gastrointestinal tract. Gyurova and co-authors [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e] isolated \u003cem\u003eE. durans\u003c/em\u003e EDD2 from the honey bee gut. This strain showed extremely high antagonistic activity against \u003cem\u003ePaenibacillus larvae\u003c/em\u003e. In recent years, there have been reports on the antagonistic activity of LAB in the gut of honey bees against viral pathogens. The genome analysis indicated that this is probably due to a combination of several bacteriocins [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. They found that honey bee survival was significantly increased in bees with a normal gut microbiota compared to bees with a perturbed (dysbiotic) gut microbiota [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. It has been pointed out that LAB symbionts reacted in synergistic matter and defended themselves by secreting various active compounds that inhibited other microbial growth [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Just the presence of these bacteria and their metabolites, in combination with other compounds, can explain the medical effect of honey. It is widely accepted that the gut microbiota also contributes to the neurological processes of honey bee organisms and affects their behavior by affecting gene transcription in the brain and the circulating metabolism [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIt is believed that the ecological conditions and geographic location of Armenia led to the development of unique associations\u0026mdash;symbiosis\u0026mdash;in the gastrointestinal tract of honey bees. Armenia is known as the cradle of \u003cem\u003eApis mellifera armeniaca\u003c/em\u003e, \u003cem\u003eA. mellifera anatolica\u003c/em\u003e, and \u003cem\u003eA. mellifera remipes\u003c/em\u003e [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. In addition, Armenia is a habitat territory for wild types of stingless bees. Thus, the investigation of the bacterial composition of the microbiota in the gastrointestinal tract of different types of bees and the isolation of LAB with biological activity (antagonistic) are crucial for understanding the immunity processes in bee organisms and will help to create a medicinal preparation of probiotic bacteria that could be used as a feed for bees and will increase their immunity.\u003c/p\u003e \u003cp\u003eThe main goal of this research was to isolate new strains of bacteria from the honeybees' gut microbiotas, possessing strong antibacterial activity against potential pathogens with further usage for the protection of honeybees\u0026rsquo; health.\u003c/p\u003e"},{"header":"RESULTS","content":"\u003cp\u003eApproximately 50 mesophilic isolates were isolated from all bee samples and primarily screened for antibacterial activity against \u003cem\u003eE. coli\u003c/em\u003e ATCC 8739. Seventeen different isolates were chosen on their ability to ferment milk within 4 h to 7 days.\u003c/p\u003e \u003cp\u003eAll strains were named after the area where the bees had been collected and on the serial number of experiment (M1, M2, M4 strains were isolated from bees in the Metsavan village, B7 \u0026ndash; the Berdashen village, M9, M10, M12 \u0026ndash; the Movses village, A1, A2, A3, A4, A5 \u0026ndash; the city of Artashat and K1, K2, K3, K4, K5 \u0026ndash; the Karashamb village.\u003c/p\u003e \u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eThe morphology and cultural properties of isolates\u003c/h2\u003e \u003cp\u003eAll isolated strains were Gram-positive except for K4 and K5. Most isolates were non-sporulating cocci or bacilli, isolates A1 and A2 being the only spore-forming bacteria. The shape of the colony changed depending on the media composition, so for its investigation, the isolated strains were cultivated on MRS medium, which did not contain Tween 80 or other surface-active components.\u003c/p\u003e \u003cp\u003eThe growth graphs of strains A1, A2, A3, A4, A5, and K4 significantly differed during cultivation in MRS broth. They created the biofilm layer on the surface of MRS broth when all others grew on the bottom of tubes and showed approximately similar growth curves. The growth dynamic and the activity of acid synthesis are presented in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eMore than ten important morphological, cultural and physiological properties of isolates were investigated for identification. Lactic acid cocci such as streptococci, leuconostocs, and pediococci have similar properties, for example, the absence of nitrate reduction, catalase, cytochromes, spores, etc. All of them synthesize the lactic acid during the fermentation of carbohydrates. So, the same approaches were used to identify cocci and bacilli.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eThe physiological and biochemical properties of isolates\u003c/h2\u003e \u003cp\u003eThe strains showed different sensitivity to the concentration of NaCl in media and different abilities to utilize carbohydrates and other carbon sources. They also had different optimums of temperature and pH for growth. The optimal temperature for the growth of most of the isolates was 37\u003csup\u003e0\u003c/sup\u003eC, but for A1, A2 and K3 isolates was 45\u003csup\u003e0\u003c/sup\u003eC. The isolates A1 and A2 were able to grow also at the temperature of 65\u003csup\u003e0\u003c/sup\u003eC.\u003c/p\u003e \u003cp\u003eThe strain K2 could grow at a very narrow pH range (7\u0026ndash;8), while most strains grew in wide alkali pH ranges (K5, M1, M2 and M4 at pH 7\u0026ndash;9, and A3 at pH 6\u0026ndash;9). Remarkably, A1, A2, K3, K4, M9, M10, M12 and B7 strains demonstrated very few requirements for the pH value. They could grow at a wide range of pH 5\u0026ndash;9; for A4, A5, and K1, these values were in the range of 4\u0026ndash;9.\u003c/p\u003e \u003cp\u003eA concentration of even 2% NaCl in media was lethal for K2 and K4 isolates. All other strains could grow in the presence of 7% of NaCl. The A3 strain showed the highest resistance to the high salt concentration and grew at 10% NaCl. All strains were chemoorganotrophs, homofermentative, and catalase-positive bacteria. They did not produce gas from glucose and could not reduce nitrates except for K3 and A3, which carried out nitrite reduction. The proteolysis of gelatin was detected for A1, A2, K3, K5, M9, M10 and M12 isolates. The strain A3 showed amylolytic activity.\u003c/p\u003e \u003cp\u003eADI activity was detected for A1, A2, A3, K1, K3 and K5 isolates. The lipolytic activity was revealed for A3, K3, K4 and K5 isolates. Remarkably, isolates K3 and K4 utilized Tween 40, while the other two strains cleaved Tween 80. The Voges-Proskauer reaction was positive in A1, A2, A3, K1, K4 and K5 isolates. Neither strain could synthesize indole from tryptophan, and neither has caseinolytic activity. They did not assimilate mannitol, dulcitol and melibiose, but the A2 isolate assimilated ribose. Even though the K4 strain did not use any of the tested carbohydrates, at the same time, it grew in MRS medium. The strains A4 and A5 used only arabinose as a carbon source, and the K1 strain used only fructose. The property to use only one carbon source (fructose) is a feature of strains isolated from bees' GUT.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eMolecular identification in phylogenetic study\u003c/h2\u003e \u003cp\u003eThe 16s rRNA gene sequences were analyzed for more accurate identification of the isolated strains. The analysis revealed that strain A1 was identity to \u003cem\u003eBacillus pumilus\u003c/em\u003e (96%), A2 \u0026ndash; \u003cem\u003eB. pumilus\u003c/em\u003e (99%), A3 - \u003cem\u003eStaphylococcus epidermidis\u003c/em\u003e (99%), A4 and A5 - \u003cem\u003eLactobacillus delbrueckii\u003c/em\u003e subs. \u003cem\u003elactis\u003c/em\u003e (99%). The other strains were identified as B7 \u0026ndash; \u003cem\u003eL. delbrueckii\u003c/em\u003e subs. \u003cem\u003ebulgaricus\u003c/em\u003e (91%), M1 - \u003cem\u003eEnterococcus lactis\u003c/em\u003e (99%), M 2 - \u003cem\u003eE. ratti\u003c/em\u003e (97%), M4 - \u003cem\u003eEnterococcus durans\u003c/em\u003e (99\u003cem\u003e%)\u003c/em\u003e, M9 \u003cem\u003e- L. kimbladii\u003c/em\u003e, M10 - \u003cem\u003eL. apis\u003c/em\u003e, M12 and K1 - \u003cem\u003eStreptococcus salivarius\u003c/em\u003e (97 and 96% correspondingly). The phylogenetic tree, including isolates and control species, is presented in Figs.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e and \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe strains A1 and A2 were identified as \u003cem\u003eB. pumilus\u003c/em\u003e (with an identity of approximately 99%). Still, they were not included in the phylogenetic tree, as they are not representative of bee normal microbiota and are probably pathogenic for bees.\u003c/p\u003e \u003cp\u003eTwo separate phylogenetic trees were constructed for the coccus and rod morphological types. As can be seen in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e, all species of both genera of lactic acid bacteria cocci (Enterococcus and Streptococcus) are divided into eleven clusters. Six of them are streptococci, and five are enterococci. The construction of the phylogenetic tree revealed that although the K1 strain has only 96% of identity to \u003cem\u003eS. salivarius\u003c/em\u003e, it is in one cluster with the mentioned species so that it can be identified as \u003cem\u003eS. salivarius\u003c/em\u003e. The other two cocci strains are included in enterococci clusters. It should be noticed that although the strain M4 was identical to \u003cem\u003eE. durans\u003c/em\u003e by 99%, it composed a separate cluster with \u003cem\u003eEnterococcus ratti\u003c/em\u003e by phylogenetic analyses. So, the M4 strain may have the same properties as these two mentioned strains. The investigation of the isoalte M1 showed 99% identity to \u003cem\u003eE. lactis.\u003c/em\u003e But on the phylogenetic tree, the M1 strain is slightly far from the cluster in which \u003cem\u003eEnterococcus faecium\u003c/em\u003e is also included. This allows speculating that the isolate M1 might be similar to these two strains with the properties.\u003c/p\u003e \u003cp\u003eThe analyses of 16S rDNA genes of Lactobacilli isolated within this research have shown fascinating results. All \u003cem\u003eLactobacilli\u003c/em\u003e species are divided into ten clusters. Remarkably, the last three clusters included representatives isolated from the gastrointestinal tract of honeybees. Two of our strains, A4 and A5, isolated from GUT of Armenian honeybees showed identity to \u003cem\u003eL. delbrueckii\u003c/em\u003e subs. \u003cem\u003elactis\u003c/em\u003e, and one B7 - \u003cem\u003eL. delbrueckii\u003c/em\u003e subs. \u003cem\u003ebulgaricus\u003c/em\u003e. Bootstrap analyses did not reveal a significant distance between investigated and referent strains. Interestingly, they showed absolutely different morphological, culturing and biochemical properties. We can conclude that the symbiotic type of life dictates these specificities. According to El Kafsi and coauthors [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e] \u003cem\u003eL. delbrueckii\u003c/em\u003e subs. \u003cem\u003elactic\u003c/em\u003e is catalase-negative. It ferments glucose, fructose, mannose and maltose and hydrolyzes arginine. While the isolates A4 and A5 neutralized the H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e, they did not assimilate any mentioned carbohydrates as the only carbon source and were ADI negative. These three strains (A4, A5 and B7) 16s rRNA gene sequences were deposited in the NCBI library with accession number OP 784418, OP 784423 and MK494928, respectively, and two of them, A4 and B7, were deposited in Microbial Depository Center of Armenia with accession number MDC 9679 and MDC 9680 respectively.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eAntibacterial activity of the isolated strains\u003c/h2\u003e \u003cp\u003eThe antibacterial activity of isolates has been studied to estimate their biotechnological potential. Only four isolates from the gut of bees and three isolates from honey wax were found to be more active. Antibacterial activities of the studied isolates are presented in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e2\u003c/span\u003e. Maximum antibacterial activity after 10 h of cultivation was observed for the isolates M1, M2, and M4, while B7, M9 and M12 revealed this property at least after 27-hour cultivation.\u003c/p\u003e \u003cp\u003e\u003cstrong\u003eTable 1.\u0026nbsp;\u003c/strong\u003eName and sequences of oligonucleotide primers used in PCR amplifications\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" width=\"631\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"12.361331220285262%\"\u003e\n \u003cp\u003ePrimer name\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"41.83835182250396%\"\u003e\n \u003cp\u003eSequence\u0026nbsp;(5\u0026prime; - 3\u0026prime;)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.968304278922346%\"\u003e\n \u003cp\u003eTarget\u003csub\u003e\u0026shy;\u003c/sub\u003e\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.832012678288432%\"\u003e\n \u003cp\u003eReference\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"12.361331220285262%\"\u003e\n \u003cp\u003e16S F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"41.83835182250396%\"\u003e\n \u003cp\u003eGAGTTTGATCCTTGGCTCAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.968304278922346%\" valign=\"top\"\u003e\n \u003cp\u003eBacterial 16S rRNA, pos. 8-27\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.832012678288432%\" rowspan=\"2\"\u003e\n \u003cp\u003eUniversal Bacterial Identification by PCR and DNA Sequencing of 16S rRNA Gene; James, 2010\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"16.666666666666668%\"\u003e\n \u003cp\u003e16S R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"56.41025641025641%\"\u003e\n \u003cp\u003eGAAAGGAGGTGATCCAGCC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"26.923076923076923%\" valign=\"top\"\u003e\n \u003cp\u003e1492-1473\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe results of antibacterial activity analyses of isolates\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"7\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eStrains number\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"6\" nameend=\"c7\" namest=\"c2\"\u003e \u003cp\u003eThe zone of growth absence (\u0026Oslash; mm)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eS.\u003c/em\u003e Typhimurium\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eSt. aureus\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003eM. luteus\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003eB. subtilis\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003eB.\u003c/em\u003e\u003c/p\u003e \u003cp\u003e\u003cem\u003emesentericus\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u003cem\u003eE. coli\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eE. lactis\u003c/em\u003e M 1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e11*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e11*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e18**\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e18**\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e14**\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e17**\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eE. ratti\u003c/em\u003e M 2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e12*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e10*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e19*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e16***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e16***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e14**\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eE. durans\u003c/em\u003e M 4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e13*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e14*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e21*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e17*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e16**\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eL. delbrueckii\u003c/em\u003e subs. \u003cem\u003ebulgaricus\u003c/em\u003e B7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e15**\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e18**\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e22*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eStatic\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e15***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e10***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eL. kimbladii\u003c/em\u003e M9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e14*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e13*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e19*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e15***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eL. apis\u003c/em\u003e M10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e11*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e16**\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e20*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e17**\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e13*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e15**\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eS. salivarius\u003c/em\u003e M12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e12*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e14**\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e21*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e20*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e13*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e13***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eL. delbrueckii\u003c/em\u003e subs. \u003cem\u003elactis\u003c/em\u003e A4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e15***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0\u003csup\u003ens\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0\u003csup\u003ens\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0\u003csup\u003ens\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0\u003csup\u003ens\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e13***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eL. delbrueckii\u003c/em\u003e subs. \u003cem\u003elactis\u003c/em\u003e A5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e16**\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0\u003csup\u003ens\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0\u003csup\u003ens\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0\u003csup\u003ens\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0\u003csup\u003ens\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e15***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e*p\u0026thinsp;\u0026lt;\u0026thinsp;0.05; * *p\u0026thinsp;\u0026lt;\u0026thinsp;0.01; * **p\u0026thinsp;\u0026lt;\u0026thinsp;0.001, ns - non significant.\u003c/p\u003e \u003cp\u003eBased on the results, further investigation was done only after at least 10-hour cultivation for M1, M2, and M4 and 30-hour cultivation for B7, M9 and M12. Interestingly, B7, M9 and M12 were isolated from honey wax, and М1, М2, M4, A4 and A5 from the bees' gut. The most interesting is that the strains A4 and A5 showed antagonistic activity only against Gram-negative bacteria. That is why we didn't continue to work with these two strains.\u003c/p\u003e \u003cp\u003eThe correlation between antibacterial activity, the ability to produce an acid and intensity of aeration is shown in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e3\u003c/span\u003e. There is no correlation between antibacterial activity and the maximum value of the acidity, as well as between the aeration intensity and the number of cells in cultural liquid. The investigated strains inhibited the growth of a wide spectrum of Gram-positive and Gram-negative bacteria. The diameter of the inhibitory zones varied from 10 to 22 mm, while the measured activity AU ranged from 10 to 33.322. Generally, all investigated strains were characterized by low levels of acidification, and the aggregation of milk proteins takes place only after 48 h of cultivation.\u003c/p\u003e \u003cp\u003eMaximum antibacterial activity for М1, М2 and M4 isolates was determined at good aeration conditions, while for isolate M10, the aeration did not play a decisive role (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe growth kinetics of isolates and the correlation between synthesis of acid and cultivation conditions\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"7\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eStrains\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eThe cultivation duration for maximum antibacterial activity (h)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003epH\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eOD\u003c/p\u003e \u003cp\u003e(600nm)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eCultivation conditions\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c7\" namest=\"c6\"\u003e \u003cp\u003eAntibacterial activity\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eIndicator microorganismes\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eAU\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eE. lactis\u003c/em\u003e M1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e4.7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1.48\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eWithout shaking\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003eSt. aureus\u003c/em\u003e, \u003cem\u003eS.\u003c/em\u003e Typhimurium, \u003cem\u003eM. luteus, B. subtilis\u003c/em\u003e, \u003cem\u003eE. coli, B. mesentericus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e10\u0026ndash;20\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eE. ratti\u003c/em\u003e M 2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e4.72\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1.4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eWith shaking\u003c/p\u003e \u003cp\u003e(200 rpm)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003eSt. aureus\u003c/em\u003e, \u003cem\u003eS.\u003c/em\u003e Typhimurium, \u003cem\u003eM. luteus, B. subtilis\u003c/em\u003e, \u003cem\u003eE. coli, B. mesentericus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e10\u0026ndash;25\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eE. durans\u003c/em\u003e M 4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e4.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1.38\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eWith shaking\u003c/p\u003e \u003cp\u003e(200 rpm)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003eSt. aureus\u003c/em\u003e, \u003cem\u003eS.\u003c/em\u003e Typhimurium, \u003cem\u003eM. luteus, B. subtilis\u003c/em\u003e, \u003cem\u003eE. coli, B. mesentericus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e15\u0026ndash;33\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eL. kimbladii\u003c/em\u003e M9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e4.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eWithout shaking\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003eSt. aureus\u003c/em\u003e, \u003cem\u003eS.\u003c/em\u003e Typhimurium, \u003cem\u003eM. luteus, B. subtilis\u003c/em\u003e, \u003cem\u003eE. coli, B. mesentericus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e15\u0026ndash;30\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eL. apis\u003c/em\u003e M10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e4.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eIndependent\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003eSt. aureus\u003c/em\u003e, \u003cem\u003eS.\u003c/em\u003e Typhimurium, \u003cem\u003eM. luteus, B. subtilis\u003c/em\u003e, \u003cem\u003eE. coli, B. mesentericus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e10\u0026ndash;20\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eS. salivarius\u003c/em\u003e M12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e4.7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.84\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eWith shaking\u003c/p\u003e \u003cp\u003e(200 rpm)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003eSt. aureus\u003c/em\u003e, \u003cem\u003eS.\u003c/em\u003e Typhimurium, \u003cem\u003eM. luteus, B. subtilis\u003c/em\u003e, \u003cem\u003eE. coli, B. mesentericus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e15\u0026ndash;33\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eL. delbrueckii\u003c/em\u003e subs. \u003cem\u003ebulgaricus\u003c/em\u003e B7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e27\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e4.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1.35\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eWith shaking\u003c/p\u003e \u003cp\u003e(200 rpm)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003eSt. aureus\u003c/em\u003e, \u003cem\u003eS.\u003c/em\u003e Typhimurium, \u003cem\u003eM. luteus, E. coli, B. mesentericus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e10\u0026ndash;33\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eFor the M4 strain, the aeration did not affect the synthesis of antibacterial components. This strain showed activity only in the case of cultivation in aerobic conditions only after the neutralization of the lactate by an adjustment of the pH to a value of pH 6.0. M9 isolate showed antibacterial activity at a pH 6.0 only when the strain was cultivated in strict anaerobic conditions. It means oxygen plays a crucial role in synthesizing pH-stable antibacterial component/s by the M9 isolate. This property must be further investigated.\u003c/p\u003e \u003cp\u003eThe media's nutrient composition effect on the isolated strains' antibacterial activity was also investigated. The results revealed that antibacterial component synthesis depends on the medium composition. This experiment used two media types: 10% skimmed milk and MRS. The data is presented in Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e4\u003c/span\u003e. As shown in Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e4\u003c/span\u003e, the antibacterial activity decreased crucially when the isolates were cultivated on MRS. Moreover, no activity was detected in investigated strains when the \u003cem\u003eS. typhimurium\u003c/em\u003e MDC 1754 was used as a test organism (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe effect of the nutrient composition of the medium on the antibacterial activity of isolates\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"7\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eStrain\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"6\" nameend=\"c7\" namest=\"c2\"\u003e \u003cp\u003eArbitrary Units\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003e\u003cem\u003eB. subtilis\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003e\u003cem\u003eSt. aureus\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c7\" namest=\"c6\"\u003e \u003cp\u003eS. Typhimurium\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMilk\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMRS\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eMilk\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eMRS\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMilk\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eMRS\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eE. lactis\u003c/em\u003e M1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e10\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eE. ratti\u003c/em\u003e M 2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e25.85\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e15.85\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eE. durans\u003c/em\u003e M 4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e10\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e15.85\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eL. kimbladii\u003c/em\u003e M9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e25.85\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e15.85\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e15.85\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e30\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e25.85\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eL. apis\u003c/em\u003e M10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e15.85\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e25.85\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eS. salivarius\u003c/em\u003e M12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e33.22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e15.85\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e33.22\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e15.85\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eL. delbrueckii\u003c/em\u003e subs. \u003cem\u003ebulgaricus\u003c/em\u003e B7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e10\u003csup\u003ens\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0\u003csup\u003e***\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e*p\u0026thinsp;\u0026lt;\u0026thinsp;0.05; * *p\u0026thinsp;\u0026lt;\u0026thinsp;0.01; * **p\u0026thinsp;\u0026lt;\u0026thinsp;0.001, ns - non significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"DISCUSSION","content":"\u003cp\u003eAlthough \u003cem\u003eLactobacilli\u003c/em\u003e and \u003cem\u003eBifidobacteria\u003c/em\u003e are endosymbionts for \u003cem\u003eApis melifera\u003c/em\u003e, some extraordinary representatives of these two groups can be identified in the honeybee gut. Similarly, Evans and Armstrong [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e] failed to isolate \u003cem\u003eLactobacillus sp.\u003c/em\u003e isolates from \u003cem\u003eA. mellifera\u003c/em\u003e, suggesting that the gut's bacterial population is not constant in the same bee species. In the investigation of El-Sohaimy and co-authors [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e], some LAB strains were reported that had not previously been detected in the genus Apis. The microbiome of honeybees can be different in different species. It can be changed during the year seasons, depending on flora diversity, geographic and ecological conditions, and usage of insecticides and antibiotics such as oxytetracycline hydrochloride and sulfathiazole, which are commonly used for controlling AFB and EFB worldwide.\u003c/p\u003e \u003cp\u003eIn this investigation, we observed an antibacterial activity of isolated strains against both Gram-positive and Gram-negative bacteria. This article's main goal was to investigate the Armenian honeybee gut microbiome by isolation of LAB and to reveal their potential to inhibit the growth of different possible pathogenic bacteria in honey. The microbiome of the Armenian honeybee is mainly composed of lactic acid bacteria, similar to the honeybee microbiomes investigated worldwide [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. It was shown that LAB symbionts can protect honeybees by inhibiting the growth of different pathogens [1; 11]. Approximately 50 isolates were screened according to their ability to inhibit the \u003cem\u003eE. coli\u003c/em\u003e ATCC 8739, and only for 17 an antagonistic activity was detected. The fact that all investigated strains kept antibacterial activity after pH adjustment to 6.5 underlined that the antagonistic activity is not related to organic acids. Some of LAB (M1, M2, M4) synthesized the antibacterial components after 10 h of cultivation, others after 24\u0026ndash;30 h of cultivation (B7, M9, M12). Our previous data [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e] shows that LAB isolated from different sources can synthesize the antibacterial component in different growth phases. We can speak about secondary metabolites mainly when they are synthesized after 24\u0026ndash;30 h of growth in the late pre-stationer phase. The major part of LAB used as probiotics synthesize antibacterial components like bacteriocins, which can inhibit the growth of Gram-positive bacteria. At the same time, in the case of the A4 and A5 strains, the antagonistic activity was detected only against Gram-negatives indicators.\u003c/p\u003e \u003cp\u003eThe aeration can affect the synthesis of antibacterial components. In the case of some LAB strains, anaerobic conditions are more critical for synthesizing antagonists. As can be seen from Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e4\u003c/span\u003e, there is no correlation between aeration and the synthesis of antibacterial components. Thus, the dependence of the synthesis of antibacterial components and acid on the aeration is only a strain-specific property. The most intriguing thing is that in the case of the M4 strain, the stable antibacterial components are synthesized in aeration conditions. Although LAB are characterized as aero-tolerant, many authors detected the presence of aerobic metabolism, even in the case of the Lactobacillaceae family. Zotta and co-authors [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e] showed that lactobacilli can use oxygen as a respiration substrate because of the flavine oxidase synthesis. Aeration can affect the metabolism of carbohydrates and lead to the synthesis of different components, which can have antagonistic activity.\u003c/p\u003e \u003cp\u003eOn the other hand, the M9 strain showed the opposite picture. Its antibacterial components showed pH stability when the strains were cultivated in anaerobic conditions. This observation can be explained by oxygen's oxidative effect and components' destruction. Most likely, it can only be speculated that the M4 strain comes into the honeybee intestine originating from plants, where it adapted to the presence of oxygen. In contrast, the M9 strain is a typical representative of the intestinal microbiota growing under exclusively anaerobic conditions. The different components of nutrient media can also affect the synthesis of antagonistic components. Linares-Morales and co-authors [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e] analyzed three different nutrient media composed of agro-industrial wastes. The comparison of LAB growth and their antagonistic activity revealed that this kind of culture media can improve not only the growth of cells but also the production of antibacterial components. The same results were obtained for LAB isolated from the Armenian gut microbiome. Milk usage improved the production and stability of antibacterial components, apparently due to the activation of proteolytic activity [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe components of the food, the gut, and the gut microbiome can be involved in the digestive process and result in different metabolic contractions [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. The ability to degrade different carbohydrates revealed glycosidase activity typical for some representatives of honeybee gut like \u003cem\u003eGiliamella sp.\u003c/em\u003e, which leads to the digestion of cellulose. Alfa-glycosidase is responsible for the digestion of glucose and maltose and also leads to the degradation of starch particles [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. The presence of some carbohydrates in the honeybee gut can be very toxic for animals because they don't produce the necessary enzymes for their digestion [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eCarbohydrates assimilation tests revealed the ability to utilize all investigated carbohydrates by LAB isolated from the Armenian honeybee gut. The most interesting thing is that some strains can utilize a single carbohydrate, like arabinose for strains A4 and A5, and fructose for K1. This finding is extraordinary because K1 was identified as \u003cem\u003eS. epidermidis\u003c/em\u003e for which the utilization of carbohydrates should not be complicated and which can be explained only by speculation of symbiotic life. Pedrosa-Davilla and coauthors [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e] state that \u003cem\u003eS. epidermidis\u003c/em\u003e forms biofilms in low O\u003csub\u003e2\u003c/sub\u003e environments. Anaerobic conditions in these bacteria dictate the highest rate of fermentation. The growth rate decreased at low oxygen even though the ATP concentration was high and the bacteria formed biofilms under these conditions.\u003c/p\u003e \u003cp\u003eFrom these 17 isolates, two were Gram-negative and two were spore-forming. According to some investigations, the microbiome of honeybee gut is composed of plant pollen and nectars microbiomes, where the dominant domain is Firmicutes (17.6%) followed by Proteobacteria (63.2%) and Actinobacteria (4.1%) [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Most of the detected Gram-negative bacteria are biofilm-forming \u003cem\u003eSnodgrasella alvi\u003c/em\u003e, which did not ferment sugars and sugar-fermenting \u003cem\u003eGilliamella apicola\u003c/em\u003e [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Among Gram-positive bacteria, the core bacteria belong to phylum Firmicutes with representatives of Lactobacillus Firm-4, Lactobacillus Firm-5 and Bifidobacteria [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. The most common bacteria isolated from floral pollen belong to the \u003cem\u003eBacillus\u003c/em\u003e genera. The representatives of this genus are essential for honeybees as the farms of different ferments play a role in digestion.\u003c/p\u003e \u003cp\u003eEven more, the amylase detected in honey and which activity can be used as an indicator of honey freshness, produced mainly by representatives of bacilli which are present in the honeybee gut. In the case of our experiments, the amylase activity was detected for the A3 strain, which was identified as \u003cem\u003eStaphylococcus epidermidis\u003c/em\u003e. According to classical microbiological identification features, Staphylococci should not show amylase activity [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. However, several species of \u003cem\u003eStaphylococci\u003c/em\u003e can produce α-amylase, which is observed to be the critical factor in the host-microbe interaction and to cause a higher infection rate. This increased monosaccharides production elevates the glucose levels phosphorylated by glkA in this pathogen and is primarily utilized in synthesizing adhesion polysaccharides, exo-polysaccharides and cell wall biosynthesis [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eADI pathway is common for many different genera and is very conservative. It can work as a possible way to synthesize energy or, like in the case of LAB, is responsible for the cells pH homeostasis, helps to survive in low pH conditions and is required for acid tolerance response, especially in LAB [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Lindgren and co-authors in 2014 showed that for some pathogenic bacteria like \u003cem\u003eS. epidermidis\u003c/em\u003e or \u003cem\u003eS. aureus\u003c/em\u003e, the ADI is crucial for resistance to acid conditions and even protects the cells from pH-induced oxidative stress [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. This is a possible explanation of how the \u003cem\u003eS. epidermidis\u003c/em\u003e A3 strain can survive in honeybee gut and also be a possible pathogen of honeybees, where, according to data, at least 50% of the microbiome is represented by LAB, producing a high amount of lactic acid. Moreover, our results revealed the catalase activity for all isolates, which can be very discussable because some of our isolates were typical LAB. Still, several data are accumulated in the literature [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e] about hem-dependent and Mn-catalases of Lactobacilli, which protect them from the toxic effects of oxygen during the surface growth of the colony or in the case of symbiotic life. So, investigation of different representatives of honeybee gut, revealing their different activities, is very important not only for protecting honeybee health but also for understanding the host\u0026rsquo;s microbe interaction.\u003c/p\u003e \u003cp\u003eDuring the last decade, articles approved the beneficial effect of LAB isolated from honeybee gut. Some strains can even inhibit the growth of typical honeybee pathogens like \u003cem\u003eAscosphaera apis\u003c/em\u003e, \u003cem\u003eNosema ceranae\u003c/em\u003e, \u003cem\u003ePaenibacillus larvae\u003c/em\u003e [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. These pathogens may cause extreme economic losses. Most of these strains belong to the genera Bacillus, Lactobacillus, Bifidus, and Brevibacillus [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eBecause the LAB strains isolated in the present work displayed defense activity against pathogens, a promising management strategy might be developed to prevent honeybee bacterial diseases and avoid antibiotic treatment.\u003c/p\u003e \u003cp\u003eThe microbiome of Armenian honeybees is an unexplored source of bacteria with different biological activities. After a detailed characterization of the isolated strains, it was concluded that they could be used as probiotics for the honeybees, and they also possess the potential to be used as starter cultures in the production of fermented foods. Some of the isolated strains had potent inhibitory activity against pathogens in the case of milk cultivation, indicating their beneficial effect on both animal and human health. The synthesis of antibacterial components by the strain can be detected both in the presence of oxygen and/or in anaerobic conditions.\u003c/p\u003e"},{"header":"MATERIALS AND METHODS","content":"\u003cp\u003e\u003cstrong\u003eSamples\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe samples of bees were taken from apiaries in the villages: Metsavan (41\u0026deg;12\u0026apos;6˝ N, 44\u0026deg;13\u0026apos;44˝ E) in Lori province, Berdashen (41\u0026deg;3\u0026apos;13˝ N, 43\u0026deg;40\u0026apos;8˝ E) in Shirak province, Movses (40\u0026deg;54\u0026apos;23˝ N, 45\u0026deg;29\u0026apos;29˝ E) in Tavush province, Karashamb (40\u0026deg;24\u0026apos;18˝ N, 44\u0026deg;34\u0026apos;354˝ E) in Kotayk province, as well as in the city of Artashat (40\u0026deg;24\u0026apos;18˝ N, 44\u0026deg;34\u0026apos;35˝ E) in Ararat province. The sampling was made from May to June of 2016 and 2017, from only one hive in each province, which are characterized by diverse flora. \u0026nbsp;The sampled bees (5 wokers) were placed in sterile containers with pieces of cotton saturated with a 15% sucrose solution. Each sample of bees was kept in chilled conditions at +4\u0026deg;C and investigated during the first 48 h. Before the isolation of bees\u0026rsquo; gastrointestinal tract, the bee samples were washed with 70% ethanol, to avoid the external contamination, and the total gut was separated from bee with sterile lancet. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eIsolation of bacterial strains and cultivation conditions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFor the isolation of lactic acid bacteria, an enrichment of 10% skimmed milk was made for 24 h at 37 \u0026deg;C with total gut particles of bees. Then 0.5 ml of each serial dilution was cultivated in different media (MRS, M17, hydrolyzed milk, 10% skimmed milk \u0026quot;Himedia\u0026quot;, India) for seven days at 37 \u0026deg;C. MRS media was used for cultivation of \u003cem\u003eLactobacilli\u003c/em\u003e, M17 as it was described with producer consisting of lactose and was used for isolation of \u003cem\u003eStreptococci\u003c/em\u003e. Hydrolyzed and skimmed milk were used for isolation of different representatives of LAB like \u003cem\u003eEnterococci\u003c/em\u003e, \u003cem\u003eApilactobacillus\u003c/em\u003e, \u003cem\u003eLactococcus\u003c/em\u003e, \u003cem\u003eFructilactobacillus, Latilactobacillus\u003c/em\u003e species and others. The hydrolyzed milk is important, especially for isolation of symbiotic bacteria. All these media were used for the isolation of LAB. The strains of LAB were obtained by picking up single colonies after cultivation on selective nutrient media under selective temperature conditions, and their purity was controlled by microscopic analysis of the obtained cultures (Motic M10LB, USA). Cultivation was made at batch cultures in tubes under aerobic conditions, without shaking. Only Gram-positive mesophylic (37 \u0026deg;C) bacteria were chosen. All studied isolates, except A1 and A2, formed small (usually point-shaped), round, ovoid or fusiform, lentil-like, rod-shape colonies with slight relief, white or cream colored, shiny or pale, with straight or indented edges and with diameter no more than 2 mm. A1 and A2 isolates were spread on the medium\u0026rsquo;s surface, creating colonies with dissected edges and high viscosity. All isolated strains were conserved at -20\u0026deg;C in the presence of 20% glycerol. LAB were maintained in a viable condition by subculturing once a month in enriched milk (10% skimmed milk, 0.1% peptone, 0.1% yeast extract, pH 6.9) or in MRS medium and saved at -20 \u0026deg;C (MRS media, 20% glycerol).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eIsolation of total DNA and 16s RNA gene amplification\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eExtraction of genomic DNA was carried out according to \u0026quot;Bacterial genomic DNA isolation using CTAB\u0026quot; protocol [32]. The \u0026quot;universal\u0026quot; oligonucleotide primers (Table 1) were used for amplification of bacterial 16S rDNA gene (region 27-1492) [33].\u003c/p\u003e\n\u003cp\u003eAmplification was carried out at a final volume of 50 \u0026micro;l and contained 100 ng DNA, 1x \u003cem\u003eTaq\u003c/em\u003e Buffer, 0.8 mM dNTP mix, 0.5 \u0026micro;M of each primer, 0.5 U DyNAzyme II DNA polymerase (Thermo Scientific, USA). Amplification was performed by an amplification protocol comprising initial denaturation at 95 \u0026ordm;C for 5 min followed by 30 cycles of denaturation at 95 \u0026ordm;C for 1 min, annealing at 54 \u0026ordm;C for 40 s, extension at 72 \u0026ordm;C for 1 min, and a final extension at 72 \u0026ordm;C for 10 min. The reactions were subsequently cooled to 4 \u0026ordm;C. The PCR product was analyzed on 1.0% agarose gel electrophoresis.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 5.\u0026nbsp;\u003c/strong\u003eUtilization of different carbon sources by strains isolated from honeybee gut\u003c/p\u003e\n \u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" width=\"647\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.184049079754601%\"\u003e\n \u003cp\u003eCarbohydrates\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.061349693251533%\"\u003e\n \u003cp\u003eA1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.368098159509202%\"\u003e\n \u003cp\u003eA2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003eA3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003eA4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003eA5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003eK1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003eK2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003eK3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003eK5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003eM1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003eM2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003eM4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003eM9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"6.134969325153374%\"\u003e\n \u003cp\u003eM10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"6.134969325153374%\"\u003e\n \u003cp\u003eM12\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"4.754601226993865%\"\u003e\n \u003cp\u003eB7\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.184049079754601%\"\u003e\n \u003cp\u003eGlucose\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.061349693251533%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.368098159509202%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"6.134969325153374%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"6.134969325153374%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"4.754601226993865%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.184049079754601%\"\u003e\n \u003cp\u003eSucrose\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.061349693251533%\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.368098159509202%\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"6.134969325153374%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"6.134969325153374%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"4.754601226993865%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.184049079754601%\"\u003e\n \u003cp\u003eFructose\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.061349693251533%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.368098159509202%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"6.134969325153374%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"6.134969325153374%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"4.754601226993865%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.184049079754601%\"\u003e\n \u003cp\u003eArabinose\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.061349693251533%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.368098159509202%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"6.134969325153374%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"6.134969325153374%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"4.754601226993865%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.184049079754601%\"\u003e\n \u003cp\u003eMaltose\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.061349693251533%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.368098159509202%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"6.134969325153374%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"6.134969325153374%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"4.754601226993865%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.184049079754601%\"\u003e\n \u003cp\u003eLactose\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.061349693251533%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.368098159509202%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"6.134969325153374%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"6.134969325153374%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"4.754601226993865%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.184049079754601%\"\u003e\n \u003cp\u003eRafinose\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.061349693251533%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.368098159509202%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"6.134969325153374%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"6.134969325153374%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"4.754601226993865%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.184049079754601%\"\u003e\n \u003cp\u003eRamnose\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.061349693251533%\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.368098159509202%\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"6.134969325153374%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"6.134969325153374%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"4.754601226993865%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.184049079754601%\"\u003e\n \u003cp\u003eGalactose\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.061349693251533%\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.368098159509202%\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"6.134969325153374%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"6.134969325153374%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"4.754601226993865%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.184049079754601%\"\u003e\n \u003cp\u003eSorbitol\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.061349693251533%\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.368098159509202%\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"6.134969325153374%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"6.134969325153374%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"4.754601226993865%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.184049079754601%\"\u003e\n \u003cp\u003eMannose\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.061349693251533%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.368098159509202%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"6.134969325153374%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"6.134969325153374%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"4.754601226993865%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.184049079754601%\"\u003e\n \u003cp\u003eRibose\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.061349693251533%\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.368098159509202%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"6.134969325153374%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"6.134969325153374%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"4.754601226993865%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.184049079754601%\"\u003e\n \u003cp\u003eGlycerol\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.061349693251533%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.368098159509202%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.214723926380368%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"6.134969325153374%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"6.134969325153374%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"4.754601226993865%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003eAll LAB isolates amplification products were sequenced in Macrogen Inc. (South Korea).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eSequence alignments were performed using the BLAST algorithm [34] at the NCBI (National Center for Biotechnology Information: http://www.ncbi.nlm.nih.gov/Blast). 100 value was used as the max target sequence. Automatically adjust parameters for short input sequences. 0.05 was used as the expect threshold. 0 as Max matches in a query range. 1, -2 used as Match/Mismatch Scores. Gap cost was linear. Low complexity regions were filtered. Removal of chimeric sequences was made with DECIPHER v2.0 [35].\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe construction of phylogenetic trees was made by MEGA 11 Version 11.0.11.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMorpho\u003c/strong\u003e\u003cstrong\u003elogical properties and staining\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCell morphology and motility were determined by a light microscope (Olympus CH2). Gram staining was made by the standard method [36].\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePhysiology and biochemical properties\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe growth temperature range was determined after incubating the isolates at 5 to 80 \u0026deg;C with 5 \u0026deg;C intervals for 24 h in MRS media. The influence of the pH on the growth was tested in MRS media with adjusted pH at a range from pH 5 to pH 12 during seven days. In both cases, the\u0026nbsp;measurement of optical density was at OD\u003csub\u003e595\u003c/sub\u003e nm. The influence of NaCl concentrations on growth was determined by adding from 0 to 10% NaCl to the incubation MRS medium with 1% steps, again during seven days. Catalase activity was determined by bubble formation in a 3% hydrogen peroxide solution. Arginine deiminase (ADI) activity was determined by adding Nessler\u0026apos;s reagent to the cultural liquid according to [37].\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe anaerobic growth of the isolates was tested by growth in solid anaerobic stab cultures covered with a paraffin layer. The casein and starch hydrolysis were tested by the streak plate method [38; 39]. The gelatin liquefaction was determined by inoculating the lactobacilli into gelatin nutrient medium (gelatin 10 g, distilled water 100 ml) technique and incubation at 37 \u0026deg;C for 24 h. The lipolytic activity was determined by technique involving the hydrolysis of Tween 20 (polyoxyethylene sorbitan monolaurate), Tween 40 (polyoxyethylene sorbitan monopalmitate), Tween 60 (polyoxyethylene sorbitan monostearate), Tween 80 (polyoxyethylene sorbitan monooleate). All mentioned experiments were carried out according to Benson [36].\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eFor studying the reductive activity of strains and gas-formation (homo- or hetero-fermentation activity), all LAB isolates were grown on skimmed milk with 0.1% methylene blue and on MRS broth with inverted Durham tubes. The fermentation of different carbohydrates and several other biochemical properties were investigated by API 50CH test (BIOMERIEUX, France) to identify the isolated LAB.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStudy of antibacterial properties\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe antibacterial property of all isolated cultures was determined by a well-diffusion assay [9]. Different indicator strains (\u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e ATCC 9027, \u003cem\u003eEscherichia coli\u0026nbsp;\u003c/em\u003eVKPM-M17, \u003cem\u003eMicrococcus luteus\u003c/em\u003e ATCC 15307, \u003cem\u003eStaphylococcus aureus\u003c/em\u003e MDC-5233 (Microbial Depository Center, Armenia), \u003cem\u003eSalmonella\u0026nbsp;\u003c/em\u003eTyphimurium MDC 1754, \u003cem\u003eBacillus subtilis\u0026nbsp;\u003c/em\u003eATCC 6633, and \u003cem\u003eB. licheniformis\u0026nbsp;\u003c/em\u003eVKPM B-10956) were used as test organisms. Ordinary LAB grow in milk or MRS media and reach their stationary phase after maximum 48 h of cultivation in optimal conditions, although in case of symbiotic bacteria this frames can be changed. That is why, the isolated strains were cultivated in milk and MRS media at 37\u0026deg;C for 57 h. 0.1 ml of the fermented skimmed milk or cell free cultural liquid was added to the wells after each 3 h. For preparation of cell free cultural liquid samples each 3 hour approximately 5 ml of culture was centrifuged at 10000 rpm, during 5 min and passed throw the 0.22 \u0026mu;m bacteriological filter. Then, for the diffusion of antibacterial substances, Petri dishes were placed at room temperature for 30 min. After 24 h of incubation at the optimum temperature required for the test-culture growth, the diameters of the growth inhibition zones were measured. A clear inhibition zone of at least 2 mm diameter was recorded as positive. Antibacterial activity was measured after an adjustment of pH to 6.\u003c/p\u003e\n\u003cp\u003eThe investigation of the correlation between the synthesis of antibacterial components and the presence of oxygen in nutrient media was performed in several ways. The strains were cultivated without shaking in standard tubes half filled with the nutrient medium and the other half full of air. In the other case, the tubes with the same amount of nutrient media were actively shaken on the digital orbital shaker DaiHan SHO 2D (Korea) (180 r/min). Strong anaerobic conditions were created by filling the tubes with nutrient medium and topping them with sterile wax.\u003c/p\u003e\n\u003cp\u003eArbitrary units (AU) of antibacterial component activities were calculated using the spot-on-lawn method [9]. The resulting sample was two-fold serially diluted in a filter-sterilized phosphate buffer (20 mM, pH 6.5). 100 \u0026mu;L of each dilution was spotted on the plate. An AU of cell-free cultural liquidwas calculated according to the formula for 2n \u0026times; 1,000/x, where n was the highest dilution that could significantly inhibit the indicator strain, and x was the amount of sample (\u0026mu;l) added to the well.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData processing\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMean values and standart deviations were calculated from three independent repeated experiments with Statgraphics software (Statpoint Technologies, Inc; Warrenton, Virginia, USA). The statistical significance of received data was calculated with R Project for Statistical Computing version R 3.1.0 (The R foundation of statistical computing, Vienna, Austria); P\u0026lt;0.05 if not mentioned. Moreover all data were analised by a 2-way ANOVA Tukey\u0026rsquo;s statistical test using GraphPad Prism 8.0.2 program (GraphPad Software, USA).\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eInga Bazukyan:\u003c/strong\u003e Supervision,\u0026nbsp;Conceptualization, Investigation,\u0026nbsp;Data curation, Writing- Original draft preparation.\u0026nbsp;\u003cstrong\u003eAnahit Sahakyan\u003c/strong\u003e:\u0026nbsp;Investigation.\u0026nbsp;\u003cstrong\u003eAnna Petrosyan:\u003c/strong\u003e Investigation.\u0026nbsp;\u003cstrong\u003eLusine Hakobyan:\u003c/strong\u003e Formal analysis, Visualization.\u0026nbsp;\u003cstrong\u003eInesa Semerjyan\u003c/strong\u003e:\u0026nbsp;Formal analysis, Validation.\u0026nbsp;\u003cstrong\u003eLilit Nersisyan\u003c/strong\u003e\u003cstrong\u003e:\u003c/strong\u003e Formal analysis, Software.\u0026nbsp;\u003cstrong\u003eLusine Gasparyan:\u003c/strong\u003e Investigation, Software.\u0026nbsp;\u003cstrong\u003eKaren Trchounian:\u003c/strong\u003e Writing- Reviewing and Editing.\u0026nbsp;\u003cstrong\u003eSvetoslav Dimov:\u003c/strong\u003e Investigation,\u0026nbsp;Writing- Reviewing and Editing.\u0026nbsp;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors thank all beekeepers for providing animals and keeping experimental conditions.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe work was supported by the Science Committee of RA, in the frames of the research project № 21T-2I019, by YSU in the frames of the inner research project of 2022, and by the Armenian National Science and Education Fund (ANSEF) based in New York, USA, to IB (NS Biotech-2203, 4431).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data generated or analyzed during this study are included in this published article.\u003c/p\u003e\n\u003cp\u003ePRO-Seq data of 16srRNA were deposited into the Gene Expression Omnibus database under accession numbers MK494928, OP784418 and OP784423. The assembled contigs of the draft genome are available at the NCBI\u0026apos;s GenBank under accession number JAQSVE000000000. The data are available at the following URL https://www.ncbi.nlm.nih.gov/nuccore/MK494928.1/, https://www.ncbi.nlm.nih.gov/nuccore/OP784418.1/, https://www.ncbi.nlm.nih.gov/nuccore/OP784423.1/.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eExperiences were fulfilled according to the \u0026quot;International Recommendations on carrying out biomedical research with the use of animals (CIOMS 1985), to the \u0026quot;Human Rights and Biomedicine, Oviedo Convention\u0026quot; (CE 1997), to the European Convention for the Protection of Vertebral Animals Used for Experimental and Other Scientific Purposes (CE 2005) and approved by the National Center of Bioethics (Armenia).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDeclaration of Competing Interest\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eV\u0026aacute;squez, A. et al. Symbionts as major modulators of insect health: lactic acid bacteria and honeybees. PLoS One. 7(3), e33188; https://doi.org/10.1371/journal.pone.0033188 (2012).\u003c/li\u003e\n\u003cli\u003eOlofsson, T.C. et al. Lactic acid bacterial symbionts in honeybees - an unknown key to honey\u0026apos;s antimicrobial and therapeutic activities. Int. Wound. J. 13(5), 668-679. https://doi.org/10.1111/iwj.12345 (2016).\u003c/li\u003e\n\u003cli\u003eEllis, J.D. \u0026amp; Munn P.A. The worldwide health status of honey bees. Bee World. 86, 88-101. https://doi.org/10.1080/0005772x.2005.11417323 (2015).\u003c/li\u003e\n\u003cli\u003eAnnual International Trade Statistics by Country (HS02). https://trendeconomy.com/trade (2024).\u003c/li\u003e\n\u003cli\u003eDimov, S.G. Environmental and anthropogenic influence on the core beneficial honeybee gut microbiota. A Short Communication from Bulgaria. 1, 88-95. https://doi.org/10.3390/bacteria/1020008 (2022).\u003c/li\u003e\n\u003cli\u003eOloffson, T.C. \u0026amp; V\u0026aacute;squez, A. Detection and identification of a novel lactic acid bacterial flora within the honey stomach of the honeybees \u003cem\u003eApis mellifera\u003c/em\u003e. Curr. Microbiol. 57(4), 356-363. https://doi.org/10.1007/s00284-008-9202-0 (2008).\u003c/li\u003e\n\u003cli\u003eZheng, H., Steele, M.I., Leonard, S.P., Motta, E.V.S., Moran, N.A. Honey bees as models for gut microbiota research. Lab. Anim. (NY). 47(11), 317-325. https://doi.org/10.1038/s41684-018-0173-x (2018).\u003c/li\u003e\n\u003cli\u003eKe\u0026scaron;nerov\u0026aacute;, L. et al. Gut microbiota structure differs between honeybees in winter and summer. ISME J. 14, 801\u0026ndash;814. https://doi.org/10.1038/s41396-019-0568-8 (2020).\u003c/li\u003e\n\u003cli\u003eLavermicocca, P. et al. Purification and characterization of novel antifungal compounds from the sourdough \u003cem\u003eLactobacillus plantarum \u003c/em\u003estrain 21B. Appl. Environ. Microbiol. 66, 4084-4090. https://doi.org/10.1128/aem.66.9.4084-4090.2000 (2000).\u003c/li\u003e\n\u003cli\u003eLahtinen, S., Ouwehand, A.C., Salminen, S., Von Wright, A. Lactic acid bacteria: microbiological and functional aspects. 4th Ed., CRC Press, Taylor and Francis Group. https://doi.org/10.1201/b11503 (2012).\u003c/li\u003e\n\u003cli\u003eGyurova, A. et al. Characterization of \u003cem\u003eEnterococcus durans \u003c/em\u003eEDD2, a strain from beehives with inhibitory activity against \u003cem\u003ePaenibacillus larvae\u003c/em\u003e. J. of Apicul. Res. 1-14. https://doi.org/10.1080/00218839.2021.1936915 (2021).\u003c/li\u003e\n\u003cli\u003eDosch, C. et al. The gut microbiota can provide viral tolerance in the honey bee. Microorg. 9(4). https://doi.org/10.3390/microorganisms/9040871 (2021).\u003c/li\u003e\n\u003cli\u003eAudissio, M.C., Torres, M.J., Sabate, D.C., Ibarguren, C., Apella, M.C. Properties of different lactic acid bacteria isolated from \u003cem\u003eApis mellifer\u003c/em\u003ea L. bee-gut. Microbiol. Research.166, 1-13. https://doi:10.1016/j.micres.2010.01.003 (2011).\u003c/li\u003e\n\u003cli\u003eGupta, R.K. Taxonomy and distribution of different honeybee species. In: Gupta, R.K., Reybroeck, W., van Veen, J.W. and Gupta, A. (eds) Beekeeping for poverty alleviation and livelihood security. 18(2), 63-103. DOI: 10.1007/978-94-017-9199-1_2 (2014).\u003c/li\u003e\n\u003cli\u003eEl Kafsi, H. et al. \u003cem\u003eLactobacillus delbrueckii \u003c/em\u003essp. \u003cem\u003elactis \u003c/em\u003eand ssp. \u003cem\u003ebulgaricus\u003c/em\u003e: a chronicle of evolution in action. BMC Genomics. 15(1), 407. https://doi:10.1186/1471-2164-15-407 (2014).\u003c/li\u003e\n\u003cli\u003eEvans, J.D. \u0026amp; Armstrong, T.N. Antagonistic interactions between honey bee bacterial symbionts and implications for disease. BMC Ecol. 6:4. (2006) https://doi.org/10.1186/1472-6785-6-4 (2006).\u003c/li\u003e\n\u003cli\u003eEl-Sohaimy, A.A. et al. Isolation, identification and antimicrobial activity of unprecedented lactic acid bacterial isolates from honeybees. Pak. J. Biol. Sci. 23(4), 467-477. https://doi.org/10.3923/pjbs.2020.467.477 (2020).\u003c/li\u003e\n\u003cli\u003eBazukyan, I.L., Babayan, A.M. \u0026amp; Trchounian, A. Some properties of antibacterial component of lactic acid bacteria isolated from Armenian dairy products. NAS RA Electronic J. of Natural Science. 2(21), 39-43. (2013).\u003c/li\u003e\n\u003cli\u003eZotta, T., Parente, E. \u0026amp; Ricciardi, A. Aerobic metabolism in the genus Lactobacillus: impact on stress response and potential applications in the food industry. J. Appl. Microbiol. 122, 857-869. https://doi.org/10.1111/jam.13399 (2017).\u003c/li\u003e\n\u003cli\u003eLinares-Morales, J.R. et al. Influence of culture media formulated with agroindustrial wastes on the antimicrobial activity of lactic acid bacteria. J. Microbiol. Biotechnol.: 32, 64-71. https://doi.org/10.4014/jmb.2107.07030 (2022).\u003c/li\u003e\n\u003cli\u003eKeryan, A., Bazukyan, I., Trchounian, A. Lactobacilli isolated from the Armenian fermented milk product matsoun: Growth properties, antibacterial and proteolytic activity and their dependence on pH. Int. J. Dairy Technol. 70, 389-398. https://doi.org/10.1111/1471-0307.12353 (2017).\u003c/li\u003e\n\u003cli\u003eIorizzo, M. et al. Antimicrobial activity from putative probiotic lactic acid bacteria for the biological control of American and European foulbrood diseases. Vet Sc. 9(5), 236. https://doi.org/10.3390/vetsci9050236 (2022).\u003c/li\u003e\n\u003cli\u003eZheng, H. et al. Division of labor in honey bee gut microbiota for plant polysaccharide digestion. Proc. Natl. Acad. Sci., USA. 116(51), 25909-25916. https://doi.org/10.1073/pnas.1916224116 (2019).\u003c/li\u003e\n\u003cli\u003eLee, F.J., Rusch, D.B., Stewart, F.J., Mattila, H.R. \u0026amp; Newton, I.L.G. Fermentation by honey bee gut microbes. Environ. Microbiol. 17, 796-815. https://doi.org/10.1111/1462-2920.12526 (2015).\u003c/li\u003e\n\u003cli\u003ePedroza-D\u0026aacute;vila, U.H. et al. \u003cem\u003eStaphylococcus epidermidis\u003c/em\u003e metabolic adaptation and biofilm formation in response to varying oxygen. bioRxiv 665356. https://doi.org/10.1101/665356 (2019).\u003c/li\u003e\n\u003cli\u003eNowak, A., Szczuka, D., G\u0026oacute;rczyńska, A., Motyl, I. \u0026amp; Kręgiel, D. Characterization of \u003cem\u003eApis mellifera\u003c/em\u003e gastrointestinal microbiota and lactic acid bacteria for honeybee protection. A Review Cells. 10(3), 701. https://doi.org/10.3390/cells10030701 (2021).\u003c/li\u003e\n\u003cli\u003eBergey, D.H., Krieg, N.R. \u0026amp; Holt, J.G. Bergey\u0026apos;s manual of systematic bacteriology. Baltimore MD: Williams \u0026amp; Wilkins. DOI: 10.1007/978-0-387-68572-4 (2001).\u003c/li\u003e\n\u003cli\u003eLakshmi, H.P. et al. Molecular characterization of \u0026alpha;-amylase from Staphylococcus aureus. Bioinform. 9(6), 281-285. https://doi.org/10.6026/97320630009281 (2013).\u003c/li\u003e\n\u003cli\u003eLindgren, J.K. et al. Arginine deiminase in \u003cem\u003eStaphylococcus epidermidis\u003c/em\u003e functions to augment biofilm maturation through pH homeostasis. J. Bacteriol. 196(12), 2277-89. https://doi.org/10.1128/JB.00051-14 (2014).\u003c/li\u003e\n\u003cli\u003ePeacock, T. \u0026amp; Hassan, H.M. Role of the Mn-catalase in aerobic growth of \u003cem\u003eLactobacillus plantarum\u003c/em\u003e ATCC 14431. App. Microbiol. 1(3) 615-625. https://doi.org/10.3390/applmicrobiol1030040 (2021).\u003c/li\u003e\n\u003cli\u003eIorizzo, M. et al. Functional properties and antimicrobial activity from lactic acid bacteria as resources to improve the health and welfare of honey bees. Insects. 13(3), 308. https://doi.org/10.3390/insects13030308 (2022).\u003c/li\u003e\n\u003cli\u003eWilliam, S., Feil, H. \u0026amp; Copeland, A. Bacterial genomic DNA isolation using CTAB. Bacterial DNA Isolation CTAB Protocol, DOE Joint Genom Institute. https://jgi.doe.gov/wp-content/uploads/2014/02/JGI-Bacterial-DNA-isolation-CTAB-Protocol-2012.pdf (2012).\u003c/li\u003e\n\u003cli\u003eJames, G. Universal bacterial identification by PCR and DNA sequencing of 16S rRNA gene. In: Schuller, M., Sloots, P.T., James, S.G., Halliday, L.C. and Carter, W.J.I. (eds), PCR for clinical microbiology, Springer, Dordrecht, 209-214. https://doi.org/10.1007/978-90-481-9039-3_28 (2010).\u003c/li\u003e\n\u003cli\u003eWright, E.S., Yilmaz, L.S. \u0026amp; Noguera, D.R. DECIPHER, a search-based approach to chimera identification for 16S rRNA sequences. Appl. Environ. Microbiol. 78(3), 717-725. https://doi.org/10.1128/AEM.06516-11 (2012).\u003c/li\u003e\n\u003cli\u003eAltschul, S.F., Gish, W., Miller, W., Myers, E.W., Lipman, D.J. Basic local alignment search tool. J. Mol. Biol. 215(3), 403-410. https://doi:10.1016/S0022-2836(05)80360-2 (1990).\u003c/li\u003e\n\u003cli\u003eBenson, H. J. Benson\u0026apos;s microbiological applications:\u003cem\u003e \u003c/em\u003elaboratory manual in general microbiology, Thirteenth edition complete version ed. McGraw Hill Education. https://doi.org/10.1016/j.idairyj.2018.05.008 (2011).\u003c/li\u003e\n\u003cli\u003eWenzel, C. et al. The effect of starters with a functional arginine deiminase pathway on cheese ripening and quality. International Dairy Journal. V. 85, 91-200. https://doi.org/10.1016/j.idairyj.2018.05.008 (2018).\u003c/li\u003e\n\u003cli\u003eClinical Microbiology Procedures Handbook, Fourth Edition. In Clinical Microbiology Procedures Handbook, Fourth Edition. American Society of Microbiology. https://doi.org/10.1128/9781555818814 (2016).\u003c/li\u003e\n\u003cli\u003eTille, P.M. Bailey and Scott\u0026rsquo;s diagnostic microbiology. Thirteen edition. Mosby, Inc., an affiliate of Elsevier Inc. 3251 Riverport Lane. St. Louis. Missouri 63043. DOI:10.1309/LM5JC0PH0OGGBSZZ (2014).\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Apis mellifera gut microbiome, lactic acid bacteria, identification of LAB, antagonistic activity","lastPublishedDoi":"10.21203/rs.3.rs-4835721/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4835721/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eDuring the last decade the health of honeybee is endangered because of many different pathogens, that is why the isolation of new lactic acid bacteria from honeybees' gut microbiotas, revealing of their \u0026nbsp;strong \u0026nbsp;antibacterial activity \u0026nbsp;will help to create some products for protection of bees’ health.\u003c/p\u003e\n\u003cp\u003eNew Gram-positive mesophilic strains were isolated on selective media for lactic acid bacteria (LAB), followed by species identification by a polyphase approach, including biochemical and physiological characterization and molecular genetic identification based on the sequencing of the 16S rRNA genes. The newly isolated strains were tested for antibacterial activity against a broad range of Gram-positive and Gram-negative species. In total, seventeen new stains possessing antibacterial activity were isolated. They belonged to \u003cem\u003eBacillus, Staphylococcus, Streptococcus, Lactobacillus \u003c/em\u003eand \u003cem\u003eEnterococcus \u003c/em\u003edifferent species\u003cem\u003e.\u003c/em\u003e The most promising results comprising the antibacterial activity, and therefore possessing the potential to be used as probiotics, were obtained for the isolates \u003cem\u003eL. kimbladii \u003c/em\u003eM9, \u003cem\u003eE. durans\u003c/em\u003e M4, \u003cem\u003eS. salivarius\u003c/em\u003e M12, \u003cem\u003eL. delbrueckii \u003c/em\u003esubs. \u003cem\u003elactis \u003c/em\u003eA4, \u003cem\u003eL. delbrueckii \u003c/em\u003esubs. \u003cem\u003elactis\u003c/em\u003e A5, and \u003cem\u003eL. delbrueckii \u003c/em\u003esubs. \u003cem\u003ebulgaricus \u003c/em\u003eB7. Taken together it can be suggested that strains \u003cem\u003eEnterocccus ratti\u003c/em\u003e M2, \u003cem\u003eE. durans \u003c/em\u003eM4, \u003cem\u003eL. delbrueckii \u003c/em\u003esubs. \u003cem\u003elactis \u003c/em\u003eA4 and \u003cem\u003eL. delbrueckii \u003c/em\u003esubs. \u003cem\u003ebulgaricus \u003c/em\u003eB7\u003c/p\u003e\n\u003cp\u003eMentioned above strains can be applied for protection of honeybees’ health.\u003c/p\u003e","manuscriptTitle":"Antibacterial and Biochemical Properties of Newly Isolated Lactic Acid Bacteria from Gastrointestinal Tract Microbiome of Armenian Honeybees","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-09-04 08:28:25","doi":"10.21203/rs.3.rs-4835721/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"e76c1ccf-ce5c-4f95-a31a-2ca56259b12c","owner":[],"postedDate":"September 4th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":36879569,"name":"Biological sciences/Biochemistry"},{"id":36879570,"name":"Biological sciences/Biotechnology"},{"id":36879571,"name":"Biological sciences/Microbiology"}],"tags":[],"updatedAt":"2024-09-10T09:13:02+00:00","versionOfRecord":[],"versionCreatedAt":"2024-09-04 08:28:25","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4835721","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4835721","identity":"rs-4835721","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00
unpaywall
last seen: 2026-05-26T02:00:01.498150+00:00
License: CC-BY-4.0