Closantel, an FDA-approved veterinary drug, suppresses PEDV replication via targeting Main Protease

Closantel, an FDA-approved veterinary drug, suppresses PEDV replication via targeting Main Protease | Authorea try { document.documentElement.classList.add('js'); } catch (e) { } var _gaq = _gaq || []; _gaq.push(['_setAccount', 'G-8VDV14Y67G']); _gaq.push(['_trackPageview']); (function() { var ga = document.createElement('script'); ga.type = 'text/javascript'; ga.async = true; ga.src = ('https:' == document.location.protocol ? 'https://ssl' : 'http://www') + '.google-analytics.com/ga.js'; var s = document.getElementsByTagName('script')[0]; s.parentNode.insertBefore(ga, s); })(); Skip to main content Preprints Collections Wiley Open Research IET Open Research Ecological Society of Japan All Collections About About Authorea FAQs Contact Us Quick Search anywhere Search for preprint articles, keywords, etc. Search Search ADVANCED SEARCH SCROLL This is a preprint and has not been peer reviewed. Data may be preliminary. 10 February 2026 V1 Latest version Share on Closantel, an FDA-approved veterinary drug, suppresses PEDV replication via targeting Main Protease Authors : Lei Zhang , Zhuoya Wang , Feng Xu , Yuanyuan Zhao , Chenxia Gao , Yue Xu , Ruyue Zhang , Yingze Shu , Pan Xing , and Yuxi Lin 0000-0001-9284-2659 [email protected] Authors Info & Affiliations https://doi.org/10.22541/au.177068718.86713753/v1 Published Virology Version of record Peer review timeline 175 views 73 downloads Contents Abstract Information & Authors Metrics & Citations View Options References Figures Tables Media Share Abstract Porcine epidemic diarrhea virus (PEDV) continues to pose a global threat to the swine industry, causing fatal neonatal diarrhea with a mortality rate approaching 100%. Currently, no effective targeted drugs have been approved. The coronavirus main protease (M pro ), a conserved enzyme essential for viral replication, represents a promising target for antiviral development. Here, we demonstrate that Closantel, an FDA-approved veterinary drug, acts as a potent pan-coronavirus M pro inhibitor via enzymatic inhibition assays. Moreover, Closantel potently suppresses PEDV replication in Vero-E6 and IPEC-J2 cells, with EC 50 values of 1.49 ± 0.38 μM and 4.32 ± 0.53 μM, respectively, and exhibits minimal cytotoxicity. Remarkably, Closantel triggers interferon secretion and activates JAK-STAT signaling pathways via phosphorylation of STAT1 and STAT2, establishing a dual antiviral mechanism. In summary, Closantel holds promise as a potential lead compound for developing targeted therapies against PEDV infection. Closantel, an FDA-approved veterinary drug, suppresses PEDV replication via targeting Main Protease Lei Zhang 1, # , Zhuoya Wang 2, # , Feng Xu 3, # , Yuanyuan Zhao 4 , Chenxia Gao 4 , Yue Xu 4 , Ruyue Zhang 4 , Yingze Shu 4 , Pan Xing 4 , Yuxi Lin 4, * 1. Research Center of Traditional Chinese Medicine and Clinical Pharmacy, Shandong Provincial Maternal and Child Health Care Hospital Affiliated to Qingdao University, Jinan 250014, China. 2. GOSCI Technology Group, Qingdao 266237 Shandong, PR China. 3. The Affiliated Hospital of Qingdao University, Qingdao, 266000. 4. State Key Laboratory of Microbial Technology, Shandong University, Qingdao, 266237, Shandong, PR China # These authors contributed equally to this work * Correspondence: [email protected] Abstract Porcine epidemic diarrhea virus (PEDV) continues to pose a global threat to the swine industry, causing fatal neonatal diarrhea with a mortality rate approaching 100%. Currently, no effective targeted drugs have been approved. The coronavirus main protease (M pro ), a conserved enzyme essential for viral replication, represents a promising target for antiviral development. Here, we demonstrate that Closantel, an FDA-approved veterinary drug, acts as a potent pan-coronavirus M pro inhibitor via enzymatic inhibition assays. Moreover, Closantel potently suppresses PEDV replication in Vero-E6 and IPEC-J2 cells, with EC 50 values of 1.49 ± 0.38 μM and 4.32 ± 0.53 μM, respectively, and exhibits minimal cytotoxicity. Remarkably, Closantel triggers interferon secretion and activates JAK-STAT signaling pathways via phosphorylation of STAT1 and STAT2, establishing a dual antiviral mechanism. In summary, Closantel holds promise as a potential lead compound for developing targeted therapies against PEDV infection. Keywords: Closantel, Coronavirus, PEDV, Main Protease, Interferon 1. Induction Coronaviruses comprise a family of positive‑sense, single‑stranded RNA viruses that infect a broad range of hosts, from mammals to birds [1,2]. In recent decades, several members of this family have emerged as serious threats to global health [3-6]. The COVID-19 pandemic caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) has highlighted the urgent need for effective antiviral strategies [7-9]. Beyond human health, coronaviruses also impose substantial burdens on livestock industries [10-12]. Porcine epidemic diarrhea virus (PEDV), a member of the Alphacoronavirus genus, is one of the most significant pathogens affecting the global swine industry [13]. Since its first identification in the 1970s, PEDV has caused periodic outbreaks in swine herds worldwide, leading to devastating economic losses. The virus primarily affects neonatal pigs, causing acute diarrhea, vomiting, and dehydration, with mortality rates approaching 100% in susceptible populations [14]. Although vaccines have been deployed, the high genetic variability and mutation rate of PEDV have frequently compromised their protective efficacy [15]. Currently, there are no specific antiviral drugs approved for the prevention or treatment of PEDV infection, creating an urgent need for novel therapeutics. The coronavirus main protease (M pro , also known as 3CLpro) is a cysteine protease that plays an indispensable role in the viral life cycle by processing viral polyproteins, making it a compelling target for antiviral drug development [16-18]. Protease inhibitors have already proven successful as clinical antiviral agents, exemplified by Boceprevir for HCV [19] and Darunavir for HIV [20]. Given that coronaviral M pro is highly conserved and distinct from human proteases, compounds capable of inhibiting activity hold significant potential as pan-coronavirus inhibitors with a high safety profile and minimal off-target effects [21]. To date, several SARS-CoV-2 M pro -targeting drugs have been approved, while effective therapeutics targeting PEDV remain elusive. Drug repurposing is an effective strategy in drug discovery, capable of significantly accelerating the translation of therapeutics to the market. For rapidly spreading infectious diseases such as COVID-19 and PED, screening FDA-approved drugs offers an effective strategy to rapidly contain a pandemic. In this study, through enzymatic screening of 121 FDA-approved drugs, we identified that Closantel significantly inhibits the M pro activity of both SARS-CoV-2 and PEDV, with IC 50 values of 1.23 ± 0.01 μM and 1.24 ± 0.02 μM, respectively. Results from molecular docking and molecular dynamics simulations indicated that Closantel occupies the catalytic pockets of various M pro with a stable conformation, exhibiting excellent potential for broad-spectrum inhibition. Crucially, closantel inhibits PEDV replication in Vero-E6 and IPEC-J2 cells, with EC 50 values of 1.49 ± 0.38 μM and 4.32 ± 0.53 μM, and exhibits minimal cytotoxicity. Finally, closantel treatment induces the expression of IFN and the activation of downstream STAT1 and STAT2, thereby further enhancing the antiviral immune response. Taken together, Closantel holds promise as a potential lead compound targeting PEDV. 2. Results 2.1 Identification of Closantel as a potent M pro Inhibitor To screen M pro inhibitors, recombinant GST-tagged SARS-CoV-2 and PEDV M pro were expressed in the E. coli BL21/DE3. Following purification, the N-terminal tag was removed by cleavage with Factor Xa. The purity and the Michaelis constant (Km) of the proteases were then measured as described [22]. Next, 121 compounds from libraries consisting of approved drugs and drug candidates in clinical trials were screened against SARS-CoV-2 M pro to identify new inhibitors. Primary hits included 30 compounds that showed more than 50% inhibition against M pro at a concentration of 50 μM (Fig. 1A). Surprisingly, Closantel and MG132 almost abolished the enzyme activities of M pro at the final concentration of 10 µM (Fig. 1B). Closantel exhibited dose-dependent inhibition of M pro hydrolase activity in vitro at low concentrations, with a half-maximal inhibitory concentration (IC₅₀) of 1.23 ± 0.11 µM against SARS‑CoV‑2 M pro (Fig. 1C and D). As noted in our previous reports, the IC₅₀ of enzyme inhibitors can vary with assay conditions. To further characterize the inhibitory potency of Closantel, we determined its inhibition constant (Ki), which was 1.19 ± 0.03 µM (Fig. 1E). These results demonstrate that Closantel effectively suppresses SARS‑CoV‑2 M pro enzymatic activity in vitro . To further characterize the binding mode of Closantel with M pro , molecular docking was performed. As shown in Figure 1F, Closantel docks into the catalytic pocket of M pro , and the nitrogen atom forms critical hydrogen-bonding interactions with key catalytic residues Cys145 and Ser144 of M pro , which are essential for the inhibitory activity. In addition, the two terminal benzene rings establish Pi-sulfur interactions with Cys145 and Met165, respectively, while the central benzene ring engages in a Pi-alkyl interaction with Cys145, collectively anchoring the compound within the active pocket of M pro . Furthermore, methyl groups participate in alkyl interactions with His41 and Met165, and the iodine atom forms an alkyl interaction with Leu167, further enhancing the binding affinity between Closantel and M pro . In summary, Closantel, identified through screening, exhibits a promising binding profile as a potential SARS‑CoV‑2 M pro inhibitor. Given the evolutionary conservation of M pro among coronaviruses and the structural similarity of its catalytic pocket (Fig. S1), we further investigated whether Closantel could also inhibit the enzymatic activity of PEDV M pro . The results demonstrated that Closantel inhibited PEDV M pro hydrolase activity in a dose-dependent manner, with an IC₅₀ value of 1.24 ± 0.24 µM (Fig. 2A). Moreover, Closantel exhibited high affinity toward PEDV M pro , displaying a Ki value of 0.42 ± 0.01 µM (Fig. 2B). Molecular docking further confirmed that Closantel binds to the catalytic pocket of PEDV M pro , forming critical interactions with key residues such as His162, Glu165, His41, and Cys144 (Fig. 2C). Additionally, 100 ns molecular dynamics simulations revealed that Closantel maintained a stable binding conformation within the PEDV M pro pocket (Fig. 2D). Subsequent molecular docking revealed that Closantel binds to the M pro active sites of multiple coronaviruses, including SARS-CoV, MERS, TGEV, and PDCoV, via hydrogen bonding and additional non-covalent interactions (Fig. S2). Collectively, these results support Closantel as a potential broad-spectrum inhibitor of coronavirus M pro . 2.2 Closantel restricts PEDV replication in the cell-based assay Many compounds exhibit high binding affinity in vitro , but demonstrate limited cellular activity due to unfavorable pharmacokinetic properties such as poor solubility, permeability, or metabolic instability. Therefore, we next evaluated whether Closantel could inhibit coronavirus replication at the cellular level. As shown in Figure 2E, Closantel significantly restricts the PEDV N gene amplification in a dose dependent manner, with EC 50 value of 1.49 ± 0.38 µM. Similarly to the qRT-PCR result, immunofluorescence assays further confirmed that Closantel treatment significantly suppressed PEDV replication in Vero-E6 cells (Fig. 2F and G). This suggests that inhibition of PEDV M pro by Closantel impedes viral replication, thereby attenuating the ongoing viral RNA synthesis. PEDV can infect porcine intestinal epithelial cells. To further verify whether Closantel could inhibit PEDV replication in porcine cells, we established an infection model in IPEC-J2 cells. The results demonstrated that Closantel significantly suppressed PEDV N gene amplification and viral replication in IPEC-J2 cells (Fig. 3A and B), with EC 50 value of 4.32 ± 0.53 µM, and negligible cytotoxicity (Table 1). Collectively, our findings demonstrate that Closantel restricts PEDV replication in cells via inhibiting the coronavirus M pro . 2.3 Closantel upregulates the antiviral response mediated by interferon Interferons (IFNs) serve as the first line of innate immune defense in mammals against viruses and pathogenic microbes, playing a crucial role in the effective elimination of invading pathogens [23,24]. Interferons such as IFN-alpha and IFN-beta inhibit viral replication through multiple mechanisms at various stages of the viral life cycle by regulating the transcription of downstream interferon-stimulated genes (ISGs) [25]. Subsequently, we investigated whether Closantel could alleviate the cellular antiviral innate immunity by inhibiting PEDV replication. Interestingly, although Closantel effectively inhibited PEDV replication, the expression levels of cytokines, such as ISGs ( IFIT1 , IFITM1 , ISG15 ), IFN-α , IFN-β , and IFN-γ , increased in a concentration-dependent manner (Fig. 3C). This suggests that Closantel may positively regulate the IFN-mediated antiviral immune response. Pattern recognition receptors (PRRs) detect intracellular pathogen-associated molecular patterns (PAMPs), such as viral proteins or nucleic acids, triggering IRF3 or IRF7 activation to induce the transcription of interferons (IFNs) and other antiviral or proinflammatory genes [26]. To investigate this mechanism, we treated HEK-293T cells with indicated concentrations of Closantel for 24 h and assessed the phosphorylation status of key IFN signaling components by Western blot. As shown in Figure 4A, Closantel enhanced the phosphorylation of the upstream molecules STING and IRF3 in a concentration-dependent manner, while simultaneously activating the downstream transcription factors STAT1 and STAT2. Furthermore, Closantel induced the expression of ISGs, IFN-α , and IFN-β in 293T cells without affecting the expression of IL-6 and TNF-α (Fig. 4B and C). These findings suggest that Closantel effectively inhibits PEDV replication not only by targeting the coronavirus main protease (M pro ) but also by upregulating the host antiviral IFN innate immune response. 3. Discussion Drug repurposing represents a highly effective strategy for identifying new therapeutic indications, particularly for approved agents with established bioactivity, safety, and bioavailability profiles. In the face of widespread diseases such as COVID-19 or PEDV, high-throughput screening of approved drugs based on enzymatic activity offers an efficient means to discover potential therapeutics. Here, we report that the FDA-approved antihelminthic drug Closantel exhibits potent anti-coronavirus potential by targeting the main protease (M pro ). Furthermore, Closantel augments its antiviral activity by upregulating the classical antiviral innate immune IFN pathway. Closantel is a halogenated salicylanilide anthelmintic widely used to control Fasciola and Haemonchus species in livestock [27-30]. Research indicates that the lipophilic properties of Closantel enable it to bind to the inner mitochondrial membrane of parasites, disrupting mitochondrial ion transport and leading to the uncoupling of oxidative phosphorylation. This results in reduced ATP synthesis and confers antiparasitic activity [31,32]. Notably, ATP, which serves as the ”energy currency” present at high concentrations (2–12 mM) in all living cells but is absent in viruses themselves, is indispensable for the completion of the coronavirus life cycle [33-36]. Surprisingly, recent studies have revealed that ATP can specifically bind to the pocket within the N-terminal domain of the SARS-CoV-2 nucleocapsid (N) protein [37]. Further research has demonstrated that the dimeric C-terminal domain (CTD) also contains two ATP-binding sites [38]. ATP can bidirectionally regulate the liquid-liquid phase separation (LLPS) of SARS-CoV-2 N protein in the absence of nucleic acids through a bivalent binding mode [39-41]. We hypothesize that Closantel may potentially disrupt coronavirus N protein-mediated LLPS by downregulating ATP production, thereby inhibiting coronavirus replication. PEDV is capable of infecting porcine intestinal epithelial cells in piglets. The lipophilic nature of Closantel may enhance the drug concentration in the intestinal tract, potentially leading to effective inhibition of PEDV replication in vivo . It is worth noting that Closantel treatment can upregulate the phosphorylation of STING. Aberrant release of mitochondrial DNA (mtDNA) can activate the cGAS-STING pathway [42-44]. Closantel might, by compromising mitochondrial integrity, increase the cytosolic content of mtDNA, thereby activating the downstream classical antiviral innate immune response mediated by STING-IRF3-IFNs-STATs. Furthermore, studies have shown that Closantel can target filarial chitinase, thereby exerting antifilarial activity [45]. Our screening revealed that Closantel significantly inhibits the hydrolytic enzyme activity of the cysteine protease M pro with considerable affinity. Additionally, the three-dimensional spatial conformation of Closantel fits well into the catalytic pocket of another coronavirus protease, PL pro (Fig. S3). However, whether it possesses inhibitory activity against PL pro remains to be elucidated. In summary, Closantel, a broad-spectrum antiparasitic drug widely used in veterinary medicine, has been identified herein as a broad-spectrum coronavirus M pro inhibitor, demonstrating favorable anti-PEDV activity at the cellular level. Given the current lack of targeted therapeutics for epidemics caused by PEDV infection, the discovery of Closantel, an FDA-approved drug, provides a new perspective for the treatment of PED. 4. Materials and Methods 4.1. Cell Culture and Reagents Vero-E6 (CL0632), IPEC-J2 (CL0176) and HEK-293T (CL0005) cell lines were purchased from Fenghui Biotechnology Co., Ltd. (Hunan, China), and cultured in DMEM-High glucose medium (Gibco). All cells need the medium containing 10% fetal bovine serum (Vazyme, China), 100 U/mL penicillin, and 100 μg/mL streptomycin. The cells were cultured at 37℃ with 5% CO 2 . Candidate compounds were obtained from a chemical bank in the lab, which was originally purchased from TargetMol (Shanghai, China). Escherichia coli DH5α (#C502-02) and BL21 (DE3) (#C504-02) were purchased from Vazyme Biotech Co., Ltd. (Nanjing, China). The STAT1 (#9172), p-STAT1 (Y701) (#9167), STAT2 (#72604), p-STAT2 (Y690) (#88410), STING (#13647), p-STING (#50907), IRF3 (#4302) and p-IRF3 (#29047) antibodies were obtained from Cell Signaling Technology (Danvers, MA, United States). The PEDV N antibody was purchased from Immunology Consultants Laboratory, Inc (#MPEDV-5A-2F7). The Alexa Fluor® 488 (ab150077) antibody was obtained from Abcam (Cambridge, MA, USA). 4.2. Protein Expression, Purification, and Enzymatic Assay Protein expression and enzymatical assays were performed as previously described, with minor modifications. SARS-CoV-2 and PEDV M pro were generated as described previously [22]. Protein purity was identified by Coomassie Brilliant Blue staining. The enzymatic activity of M pro was measured by continuous kinetic assays using an identical fluorogenic substrate, MCA-AVLQ/SGFR-Lys(DNP)-Lys-NH2 (Apetide Co., Ltd., Shanghai, China), as previously described [22]. The fluorescence intensities were monitored by a microplate reader (TECAN Spark). Experiments were performed in 100 µL buffer (50 mM Tris-HCl, 1 mM EDTA, pH 7.3) containing 100 nM M pro , 2 µM substrate, and 1 µL of the desired concentration of drugs. The compounds and the M pro were incubated at RT for 15 min. The reaction velocities, EC 50 , IC 50 and Ki were calculated by GraphPad Prism. 4.3. Drug Treatment and Viral Infection Closantel (#S4106) was purchased from Selleck (Shanghai, China). For cytotoxicity analysis, Vero-E6 cells (3000 cells/well) and IPEC-J2 cells (5000 cells/well) were seeded into 96-well plates. After 12 h, the cells were treated with the indicated concentration of closantel. At 48-h post-treatment, 10 µL of CCK-8 (#CA1210, Solarbio) was added to each well and incubated for 1 h. The absorbance at a wavelength of 450 nm were measured using the microplate reader (Berthold Technologies, Germany). For viral infection assay, Vero-E6 and IPEC-J2 cells were seeded into 48-well plates. After reaching 80% confluency, cells were pretreated with indicated concentration of closantel for 2 h, then, the culture medium was removed, and cells were wash three times with PBS, followed by infection with PEDV at multiplicities of infection (MOI) of 0.01 or 0.1, respectively. 2-hour post-infection, the medium was discarded, and the cells were incubated with compounds for an additional 48 h. Quantitative reverse transcription polymerase chain reaction (qRT-PCR) was employed to quantify the PEDV N mRNA. 4.4. Molecular Docking The protein structure of M pro (SARS-CoV-2: 6LU7, SARS-CoV: 7RC1, PEDV: 6W81, MERS-CoV: 9Y8W, TGEV: 2AMP) was obtained from the Protein Data Bank (PDB). The target protein and ligand were processed using AutoDockTools software (including hydrogen addition, charge calculation, setting atom types, determining the ligand root, and setting rotatable bonds), followed by molecular docking using the AutoDock vina. PyMOL and Discovery Studio 2019 software were used to visualize and analyze the docking results obtained from AutoDock vina. 4.5. RNA isolation and qRT-PCR assay RNA isolation and qRT-PCR assay were performed as previously described [46]. In brief, RNA was extracted using the RNAiso Plus reagent (Takara, #9109), cDNA was synthesized from total RNA using HiScript III RT SuperMix for qPCR (+gDNA wiper) (Vazyme, Nanjing, China, R323-01) according to the manufacturer’s protocol. Real-time PCR was performed with ChamQ Universal SYBR qPCR Master Mix (Vazyme, Nanjing, China, Q711-03) in a LightCycler 480 (Roche). 18s rRNA expression served as the internal control for normalization. All forward and reverse primers are listed in Table S1. 4.6. Immunofluorescence assay Vero-E6 and IPEC-J2 cells were treated as indicated and fixed with 4% paraformaldehyde in phosphate buffered saline (PBS) for 15 min and washed three times with PBS. Cells were permeabilized with 0.2% Triton X-100 for 15 min, blocked with 3% BSA for 1 h at room temperature (RT), and stained with the PEDV N antibody (MPEDV-5A-2F7, 1:500) at 4℃ overnight. Coverslips were washed three times with PBS and incubated with the Alexa Fluor® 488 antibody (ab150077, 1:1000) for 1 h at room temperature in the dark. The slides were mounted with DAPI (4’,6’-diamidino-2-phenylindole) and imaged with a fluorescence microscope (Nikon, Japan). Images were quantified by ImageJ software. 4.7. Western blot assay HEK-293T cells were treated with indicated concentration of Closantel for 24 h. The cell lysate containing protease and phosphatase inhibitors (Roche) was kept on ice for 30 minutes. Cellular lysates were centrifuged at 13,000 g for 10 min at 4 ℃ and supernatant was collected. Protein concentration was measured by BCA protein assay kit (Beyotime Biotechnology, Nanjing, China) following the manufacturer’s instructions. Approximately 30 μg of proteins were separated by SDS-PAGE and transferred to the NC membranes (Pall, USA). Proteins were detected using the indicated primary antibodies, followed by HRP-conjugated secondary antibody and visualized by using ECL (Thermo Scientific, Waltham, MA, USA) in the ChemiDoc MP system (Bio-Rad, USA). The intensity of protein bands was quantified using ImageJ software. 4.8. Molecular dynamics simulation The AMBER 20 software package was used for performing MD simulation. The protein structure was prepared by adding hydrogen atoms and assigning the ff14SB force field. Ligand parameters were generated using the GAFF2 force field, and atomic charges were calculated using the AM1-BCC method. The protein–ligand complex was solvated in a TIP3P water box with a 10 Å buffer distance, and the system was neutralized by adding Na + or Cl − ions. Energy minimization was conducted with backbone restraints to eliminate steric clashes. The system was further equilibrated for 10 ns without restraints. Finally, a 100 ns production MD simulation was carried out with a 2fs time step under periodic boundary conditions. The CPPTRAJ module was employed to analyze root mean square deviation (RMSD), Solvent accessible surface area (SASA) and Radius of gyration (Rg) properties 4.9. Statistical analysis Data were analyzed by Student’s t -test or two-way ANOVA. p values of ≤ 0.05 are considered statistically significant. *P ≤ 0.05, **P ≤ 0.01, ***P ≤ 0.001, non-significant (ns), P > 0.05. Author Contributions L.Z. and Y.L. designed, supervised the study, and wrote the manuscript; Y.L. performed data analysis with significant contributions from Y.L., L.Z., and Z.W. All the authors have read the manuscript and provided useful comments. Funding We cordially acknowledge the special scientific research fund for COVID-19 from the Pilot National Laboratory for Marine Science and Technology (Qingdao) (QNLM202001), Medical and Health Technology Project of Shandong Province (Grant No. 2024020410491), Youth Science and Technology Innovation Project of Shandong Provincial Maternal and Child Health Care (SFYZXJJ-2024026), and National Science Foundation of China (82341096). Institutional Review Board Statement : Not applicable. Informed Consent Statement : Not applicable. Data Availability Statement : All other data can be provided upon request. Acknowledgments : We acknowledge Dayong Shi for providing the expression vector. Furthermore, the authors give thanks for the support from Chinese Academy of Agricultural Sciences and Lead High Technology (QingDao) Co., Ltd. Conflicts of Interest ：The authors declare no conflict of interest. Figure legends Fig. 1 Closantel inhibits hydrolase activity of SARS-CoV-2 M pro in a dose-dependent manner . (A) Relative enzyme activities of SARS-CoV-2 M pro in the presence of 50 μM compounds. MG132 was used as positive control. (B) The kinetic curves in the presence of Closantel, MG132, and the solvent DMSO. Closantel and MG132 were added to the final concentration of 10 μM. (C) Closantel inhibited M pro dose-dependently. (D) The IC 50 value of Closantel. (E) The Ki value of Closantel on SARS-CoV-2 M pro . (F) The binding model of Closantel with SARS-CoV-2 M pro (6LU7). Data were shown as means ± SEM from three independent experiments. Fig. 2 Closantel inhibits PEDV replication via targeting M pro . The IC 50 value (A) and Ki value (B) of Closantel on PEDV M pro . (C) The binding model of Closantel with PEDV M pro (6W81). (D) The RMSD, RG, SASA and RMSF plots of PEDV M pro (blue) and Closantel-PEDV M pro (purple). (E) The EC 50 value of Closantel. Vero-E6 cells were pre-treated with the compounds and then infected with PEDV (MOI = 0.01) for 2 h. The inoculum was then removed and replaced with fresh medium containing indicated concentration of Closantel. After 48 h of incubation, the expression level of the PEDV N gene was quantified by qRT-PCR. (F) Immunofluorescence (IF) analysis of the inhibitory effect of Closantel on PEDV N protein expression. Vero-E6 cells were pre-treated and infected as described in (E). The expression of the PEDV N protein was then analyzed by IF. (G) The mean fluorescence intensity of PEDV N in indicated group. The data are shown as the means ± SD of three independent experiments. **P < 0.01, *** P <0.001, ****P < 0.0001. Fig. 3 Closantel inhibits PEDV replication in IPEC-J2 cells . (A) The EC 50 value of Closantel on IPEC-J2 cells. IPEC-J2 cells were infected with PEDV at MOI = 0.1 for 2 h. The expression level of the PEDV N gene was quantified by qRT-PCR. (B) Immunofluorescence (IF) analysis of the expression of PEDV N protein following Closantel treatment. (C) The relative expression levels of classical ISGs and IFNs. IPEC-J2 cells were infected with PEDV (MOI = 0.1) for 2 h. The inoculum was then removed and replaced with fresh medium containing indicated concentration of Closantel. After 48 h of incubation, the expression level of the ISGs and IFNs were quantified by qRT-PCR. The data are shown as the means ± SD of three independent experiments. *P <0.05, **P < 0.01, ***P Fig. 4 Closantel induces the expression of IFNs and ISGs . (A) The expression levels of protein. HEK-293T cells were treated with Closantel for 24 h. Whole-cell extracts were prepared using RIPA, and analyzed by western blot. (B and C) The relative expression levels of indicated genes. HEK-293T cells were treated with Closantel for 24 h, the gene expression was quantified by qRT-PCR. The data are shown as the means ± SD of three independent experiments. *P < 0.0001. Table. 1 The EC 50 and CC 50 values of Closantel in Vero-E6 and IPEC-J2 cells. Fig. S1 The amino acid sequences and 3D structures of the M pro catalytic domains for different coronaviruses . (A) Alignment of amino acid sequences. (B) The three-dimensional structures of M pro are highly conserved. Fig. S2 The interaction patterns between Closantel and indicated M pro . The Fig. S3 The binding model of Closantel and PEDV PL pro . Table. S1 The synthesized primers . Fig. 1 Fig. 2 Fig. 3 Fig. 4 Fig. S1 Fig. S2 Fig. S3 Table. 1 Vero-E6 36.88 ± 4.50 1.49 ± 0.38 24.75 IPEC-J2 19.93 ± 3.95 4.32 ± 0.53 4.61 Table. S1 PEDV N PEDV N-F TAGGACTCGTACTGAGGGTGTTTTC PEDV N-R CGTGAATTTGCACGTGAAGTAGG Ifit1 IFIT1-F ACATGGGAGTTGGTCATTCAAGA IFIT1-R CCAGGTAACCAGCCTTCTCA Ifitm1 IFITM1-F TGCCTCCACCGCCAAGT IFITM1-R GTGGCTCCGATGGTCAGAAT Isg15 ISG15-F AGCATGGTCCTGTTGATGGTG ISG15-R CAGAAATGGTCAGCTTGCACG Ifn-α IFN- α -F CCTGGCACAAATGAGGAGAA IFN- α -R GCCTTCTGGACCTGGTTG Ifn-β IFN-β-F GGAGCAGCAATTTGGCATGT IFN-β-R TGACGGTTTCATTCCAGCCA Ifn-γ IFN- γ -F TCAGCTTTGCGTGACTTTGTG IFN- γ -R GGTCCACCATTAGGTACATCTGA Tnf-α Tnf - α -F CTGTGCCTCAGCCTCTTCTC Tnf - α -R GAGGGTTGATGCTCAAGGGG IL-6 IL6-F GGTGATGCCACCTCAGACAA IL6-R GCCAGTACCTCCTTGCTGTT 18S rRNA 18S-F ATTGACGGAAGGGCACCACCAG 18S-R CAAATCGCTCCACCAACTAAGAACG References 1. Jie, C.; Fang, L.; Zheng-Li, S. Origin and evolution of pathogenic coronaviruses. Nat Rev Microbiol , 2018 , 17(3):181-192 , doi:10.1038/s41579-018-0118-9. 2. Arinjay, B.; Kirsten, K.; Vikram, M.; Matthew, F.; Karen, M. Bats and Coronaviruses. Viruses, 2019 , 11(1):41 , doi:10.3390/v11010041. 3. Nikhil, K.; Shiv, B.; Sang Gu, K. From SARS to SARS-CoV-2, insights on structure, pathogenicity and immunity aspects of pandemic human coronaviruses. Infect Genet Evol , 2020 , 85:104502 , doi:10.1016/j.meegid.2020.104502. 4. Zhiqi, S.; Yanfeng, X.; Linlin, B.; Ling, Z.; Pin, Y.; Yajin, Q.; Hua, Z.; Wenjie, Z.; Yunlin, H.; Chuan, Q. From SARS to MERS, Thrusting Coronaviruses into the Spotlight. Viruses , 2019 , 11(1):59 , doi:10.3390/v11010059. 5. W, W.; Syriam, S.N.A.; Gadissa B, H.; Bart L, H. Host Determinants of MERS-CoV Transmission and Pathogenesis. Viruses , 2019 , 11(3):280 , doi:10.3390/v11030280. 6. Feng, L.; Huanyu, Z.; Linquan, L.; Yang, Y.; Xiaodong, Z.; Jiahuan, C.; Xiaochun, T. PEDV: Insights and Advances into Types, Function, Structure, and Receptor Recognition. Viruses , 2022 , 14(8):1744 , doi:10.3390/v14081744. 7. Eric J, C.; Timothy M, U.; Helen Y, C. The effects of the COVID-19 pandemic on community respiratory virus activity. Nat Rev Microbiol , 2022 , 21(3):195-210 , doi:10.1038/s41579-022-00807-9. 8. W Joost, W.; Andrew, R.; Allen C, C.; Sharon J, P.; Hallie C, P. Pathophysiology, Transmission, Diagnosis, and Treatment of Coronavirus Disease 2019 (COVID-19): A Review. JAMA , 2020 , 324(8):782-793 , doi:10.1001/jama.2020.12839. 9. Eric J, R.; Lindsey R, B.; Stephen, M. Audio Interview: A Look at Covid-19 Prevention and Care in 2020. N Engl J Med , 2021 , 383(27):e147 , doi:10.1056/NEJMe2036225. 10. Silviu O, P.; David C, A.; Harriet, B.; Andrew J, B.; Hollie, B.; Steven, B.; Donald M, B.; Neil D, B.; Sarah, C.; Andrew A, C.; et al. Post COVID-19: a solution scan of options for preventing future zoonotic epidemics. Biol Rev Camb Philos Soc , 2021 , 96(6):2694-2715 , doi:10.1111/brv.12774. 11. Shuiyun, C.; Huiying, Z.; Mingfeng, C.; Wei, C.; Junjun, Z.; Honghai, W.; Xuelong, C.; Yanping, Q. Prevalence of transmissible gastroenteritis among swine populations in China during 1983-2022: A systematic review and meta-analysis. Microb Pathog , 2023 , 183:106320 , doi:10.1016/j.micpath.2023.106320. 12. Qiang, L.; Huai-Yu, W. Porcine enteric coronaviruses: an updated overview of the pathogenesis, prevalence, and diagnosis. Vet Res Commun , 2021 , 45(2-3):75-86 , doi:10.1007/s11259-021-09808-0. 13. Hao, Z.; Chuangchao, Z.; Ouyang, P.; Usama, A.; Qiuping, X.; Lang, G.; Baochao, F.; Yun, Z.; Zhichao, X.; Chunyi, X.; et al. Global Dynamics of Porcine Enteric Coronavirus PEDV Epidemiology, Evolution, and Transmission. Mol Biol Evol , 2023 , 40(3):msad052 , doi:10.1093/molbev/msad052. 14. Anastasia N, V.; Douglas, M.; Qiuhong, W.; Marie R, C.; Kurt D, R.; Albert, R.; James, C.; Linda J, S. Distinct characteristics and complex evolution of PEDV strains, North America, May 2013-February 2014. Emerg Infect Dis , 2014 , 20(10):1620-8 , doi:10.3201/eid2010.140491. 15. Kuldeep S, C.; James A, R.; Linda J, S. Strategies for design and application of enteric viral vaccines. Annu Rev Anim Biosci , 2014 , 3:375-95 , doi:10.1146/annurev-animal-022114-111038. 16. Guangdi, L.; Rolf, H.; Richard, W.; Erik, D.C. Therapeutic strategies for COVID-19: progress and lessons learned. Nat Rev Drug Discov , 2023 , 22(6):449-475 , doi:10.1038/s41573-023-00672-y. 17. Lu, L.; Shan, S.; Haitao, Y.; Shibo, J. Antivirals with common targets against highly pathogenic viruses. Cell , 2021 , 184(6):1604-1620 , doi:10.1016/j.cell.2021.02.013. 18. Letian, S.; Shenghua, G.; Bing, Y.; Mianling, Y.; Yusen, C.; Dongwei, K.; Fan, Y.; Jin-Peng, S.; Luis, M.-A.; Johan, N.; et al. Medicinal chemistry strategies towards the development of non-covalent SARS-CoV-2 M pro inhibitors. Acta Pharm Sin B , 2024 , 14(1):87-109 , doi:10.1016/j.apsb.2023.08.004. 19. John M, V.; Stefan, Z.; Fred, P.; Jean-Pierre, B.; Michael P, M.; Bruce R, B.; Rafael, E.; Steven L, F.; Paul Y, K.; Lisa D, P.; et al. Safety and efficacy of boceprevir/peginterferon/ribavirin for HCV G1 compensated cirrhotics: meta-analysis of 5 trials. J Hepatol , 2014 , 61(2):200-9 , doi:10.1016/j.jhep.2014.03.022. 20. Emma D, D.J.D. Cobicistat: a review of its use as a pharmacokinetic enhancer of atazanavir and darunavir in patients with HIV-1 infection. Drugs , 2013 , 74(2):195-206 , doi:10.1007/s40265-013-0160-x. 21. Zhenming, J.; Xiaoyu, D.; Yechun, X.; Yongqiang, D.; Meiqin, L.; Yao, Z.; Bing, Z.; Xiaofeng, L.; Leike, Z.; Chao, P.; et al. Structure of M(pro) from SARS-CoV-2 and discovery of its inhibitors. Nature , 2020 , 582(7811):289-293 , doi:10.1038/s41586-020-2223-y. 22. Yuxi, L.; Ruochen, Z.; Yanlong, M.; Zhuoya, W.; Li, L.; Siyuan, D.; Rong, Z.; Zhiqiang, W.; Jinbo, Y.; Xin, W. Xanthohumol Is a Potent Pan-Inhibitor of Coronaviruses Targeting Main Protease. Int J Mol Sci , 2021 , 22(22):12134 , doi:10.3390/ijms222212134. 23. Finlay, M.; Katrin, M.-B.; Alan, S.; Andreas, W.; Anne, O.G. Type I interferons in infectious disease. Nat Rev Immunol , 2015 , 15(2):87-103 , doi:10.1038/nri3787. 24. Rachael L, P.; Yuxin, W.; HyeonJoo, C.; Yuka, K.; Massimo, G.; Vittorio, S.; Curt M, H.; James E Jr, D.; George R, S.; John J, O.S. The JAK-STAT pathway at 30: Much learned, much more to do. Cell , 2022 , 185(21):3857-3876 , doi:10.1016/j.cell.2022.09.023. 25. George R, S.; HyeonJoo, C.; Yuxin, W. Responses to Cytokines and Interferons that Depend upon JAKs and STATs. Cold Spring Harb Perspect Biol , 2017 , 10(1):a028555 , doi:10.1101/cshperspect.a028555. 26. Delphine, G.; Safia, D.; Caetano, R.e.S. Cytosolic sensing of viruses. Immunity , 2013 , 38(5):855-69 , doi:10.1016/j.immuni.2013.05.007. 27. Basma, S.; Lu, L.; Xing, C.; Jianli, L.; Shuanghui, J.; Rong, L.; Limin, H. Determination of closantel enantiomers in black goat plasma and their pharmacokinetic characteristics. J Chromatogr B Analyt Technol Biomed Life Sci , 2022 , 1210:123414. , doi:10.1016/j.jchromb.2022.123414. 28. Wu, P.; Wu, Y.; Wu, R.; Wan, X.; Yang, Q.; She, P. Antibacterial and Antibiofilm Activity of Closantel Against Staphylococcus epidermidis. Microbiologyopen , 2025 , 14(5):e70062 , doi:10.1002/mbo3.70062. 29. Hongzhuan, Z.; Xia, S.; Lulu, L.; Jin, Z.; Qi, Q.; Fangfang, G.; Fuzhou, X.; Bing, Y. Inhibitory Effects of Antiviral Drug Candidates on Canine Parvovirus in F81 cells. Viruses , 2019 , 11(8):742 , doi:10.3390/v11080742. 30. Nagendran, T.; Jenna, P.; Dawilmer, C.; Eleftherios, M. Repurposing the anthelmintic drug niclosamide to combat Helicobacter pylori. Sci Rep , 2018 , 8(1):3701 , doi:10.1038/s41598-018-22037-x. 31. P J, S.; I, F. The effect of the hydrogen ionophore closantel upon the pharmacology and ultrastructure of the adult liver fluke Fasciola hepatica. Parasitol Res , 1990 , 76(3):241-50 , doi:10.1007/bf00930821. 32. Yujian, Z.; Defeng, T.; Hironori, M.; Takashi, H.; Takayuki, S.; Naohiro, T.; Derek J, H.; Michael A, W.; Gunda I, G.; Jon E, H. Human Adenine Nucleotide Translocase (ANT) Modulators Identified by High-Throughput Screening of Transgenic Yeast. J Biomol Screen , 2016 , 21(4):381-90 , doi:10.1177/1087057115624637. 33. Avinash, P.; Liliana, M.; Shambaditya, S.; Jie, W.; Simon, A.; Yamuna, K.; Anthony A, H. ATP as a biological hydrotrope. Science , 2017 , 356(6339):753-756 , doi:10.1126/science.aaf6846. 34. Jian, K.; Liangzhong, L.; Yimei, L.; Jianxing, S. A unified mechanism for LLPS of ALS/FTLD-causing FUS as well as its modulation by ATP and oligonucleic acids. PLoS Biol , 2019 , 17(6):e3000327 , doi:10.1371/journal.pbio.3000327. 35. Jian, K.; Liangzhong, L.; Jianxing, S. ATP binds and inhibits the neurodegeneration-associated fibrillization of the FUS RRM domain. Commun Biol , 2019 , 2:223 , doi:10.1038/s42003-019-0463-x. 36. Mei, D.; Jianxing, S. A review of the effects of ATP and hydroxychloroquine on the phase separation of the SARS-CoV-2 nucleocapsid protein. Biophys Rev , 2022 , 14(3):709-715 , doi:10.1007/s12551-022-00957-3. 37. Dhurvas Chandrasekaran, D.; Dominika, C.; Jan, S.; Eliska, K.; Radim, N.; Vaclav, V.; Evzen, B. Structural basis of RNA recognition by the SARS-CoV-2 nucleocapsid phosphoprotein. PLoS Pathog , 2020 , 16(12):e1009100 , doi:10.1371/journal.ppat.1009100. 38. Mei, D.; Jianxing, S. CTD of SARS-CoV-2 N protein is a cryptic domain for binding ATP and nucleic acid that interplay in modulating phase separation. Protein Sci , 2021 , 31(2):345-356 , doi:10.1002/pro.4221. 39. Mei, D.; Yifan, L.; Jianxing, S. ATP biphasically modulates LLPS of SARS-CoV-2 nucleocapsid protein and specifically binds its RNA-binding domain. Biochem Biophys Res Commun , 2021 , 541:50-55. , doi:10.1016/j.bbrc.2021.01.018. 40. Mei, D.; Yifan, L.; Jianxing, S. Tethering-induced destabilization and ATP-binding for tandem RRM domains of ALS-causing TDP-43 and hnRNPA1. Sci Rep , 2021 , 11(1):1034 , doi:10.1038/s41598-020-80524-6. 41. Mei, D.; Jianxing, S. Structural basis of anti-SARS-CoV-2 activity of HCQ: specific binding to N protein to disrupt its interaction with nucleic acids and LLPS. QRB Discov , 2021 , 2:e13 , doi:10.1017/qrd.2021.12. 42. Ping, L.; Lei, L.; Nicolò, B.; Martina, T.; Bianca, C.; Yuxin, L.; Jingjing, C.; Prafull Kumar, S.; Rydell Alvarez, A.; Giuseppe, A.; et al. Mitochondrial DNA released by senescent tumor cells enhances PMN-MDSC-driven immunosuppression through the cGAS-STING pathway. Immunity , 2025 , 58(4):811-825.e7 , doi:10.1016/j.immuni.2025.03.005. 43. Yujia, L.; Hui, C.; Qi, Y.; Lixin, W.; Jing, Z.; Yuanyuan, W.; Jiaxin, W.; Yating, Y.; Menglan, N.; Hongliang, L.; et al. Increased Drp1 promotes autophagy and ESCC progression by mtDNA stress mediated cGAS-STING pathway. J Exp Clin Cancer Res , 2022 , 41(1):76 , doi:10.1186/s13046-022-02262-z. 44. Juan Ignacio, J.-L.; Beatriz, V.-Z.; Álvaro, V.-P.; Juan, Z.-M.; Rocío, B.-F.; María Dolores, F.-L.; Francisco A, T.-B.; Juan Carlos, E.; Estela, A.-G.; Aurora, G.-D.; et al. Mitophagy curtails cytosolic mtDNA-dependent activation of cGAS/STING inflammation during aging. Nat Commun , 2024 , 15(1):830 , doi:10.1038/s41467-024-45044-1. 45. Christian, G.; Amanda L, G.; Fana, M.; Yelena, O.; Nancy, T.; Lisa M, E.; Sara, L.; Gunnar F, K.; Kim D, J. Repositioning of an existing drug for the neglected tropical disease Onchocerciasis. Proc Natl Acad Sci U S A , 2010 , 107(8):3424-9 , doi:10.1073/pnas.0915125107. 46. Yuxi, L.; Xiaoyi, B.; Shuo, L.; Hao, S.; Yiting, Z.; Chenxia, G.; Jiashu, C.; Yuanyuan, Z.; Yue, X.; Yanan, G.; et al. Discovery of a small-molecule inhibitor of eIF4E suppressing tumor proliferation via lipid metabolic reprogramming. J Adv Res , 2025 , S2090-1232(25)01041-0 , doi:10.1016/j.jare.2025.12.050. Information & Authors Information Version history V1 Version 1 10 February 2026 Peer review timeline Published Virology Version of Record 1 May 2026 Published Copyright This work is licensed under a Non Exclusive No Reuse License. Keywords antiviral agents coronavirus disease control interferons virus classification Authors Affiliations Lei Zhang Shandong Province Maternal and Child Health Care Hospital View all articles by this author Zhuoya Wang GOSCI Technology Group View all articles by this author Feng Xu The Affiliated Hospital of Qingdao University View all articles by this author Yuanyuan Zhao Shandong University - Qingdao Campus View all articles by this author Chenxia Gao Shandong University - Qingdao Campus View all articles by this author Yue Xu Shandong University - Qingdao Campus View all articles by this author Ruyue Zhang Shandong University - Qingdao Campus View all articles by this author Yingze Shu Shandong University - Qingdao Campus View all articles by this author Pan Xing Shandong University - Qingdao Campus View all articles by this author Yuxi Lin 0000-0001-9284-2659 [email protected] Shandong University - Qingdao Campus View all articles by this author Metrics & Citations Metrics Article Usage 175 views 73 downloads .FvxKWukQNSOunydq8rnd { width: 100px; } Citations Download citation Lei Zhang, Zhuoya Wang, Feng Xu, et al. Closantel, an FDA-approved veterinary drug, suppresses PEDV replication via targeting Main Protease. Authorea . 10 February 2026. DOI: https://doi.org/10.22541/au.177068718.86713753/v1 If you have the appropriate software installed, you can download article citation data to the citation manager of your choice. Simply select your manager software from the list below and click Download. For more information or tips please see 'Downloading to a citation manager' in the Help menu . Format Please select one from the list RIS (ProCite, Reference Manager) EndNote BibTex Medlars RefWorks Direct import Tips for downloading citations document.getElementById('citMgrHelpLink').addEventListener('click', function() { popupHelp(this.href); return false; }); $(".js__slcInclude").on("change", function(e){ if ($(this).val() == 'refworks') $('#direct').prop("checked", false); $('#direct').prop("disabled", ($(this).val() == 'refworks')); }); View Options View options PDF View PDF Figures Tables Media Share Share Share article link Copy Link Copied! Copying failed. Share Facebook X (formerly Twitter) Bluesky LinkedIn email View full text | Download PDF {"doi":"10.22541/au.177068718.86713753/v1","type":"Article"} Now Reading: Share Figures Tables Close figure viewer Back to article Figure title goes here Change zoom level Go to figure location within the article Download figure Toggle share panel Toggle share panel Share Toggle information panel Toggle information panel Go to previous graphic Go to next graphic Go to previous table Go to next table All figures All tables View all material View all material xrefBack.goTo xrefBack.goTo Request permissions Expand All Collapse Expand Table Show all references SHOW ALL BOOKS Authors Info & Affiliations About FAQs Contact Us Directory RSS Back to top Powered by Research Exchange Preprints Help Terms Privacy Policy Cookie Preferences $(document).ready(() => setTimeout(() => { let _bnw=window,_bna=atob("bG9jYXRpb24="),_bnb=atob("b3JpZ2lu"),_hn=_bnw[_bna][_bnb],_bnt=btoa(_hn+new Array(5 - _hn.length % 4).join(" ")); $.get("/resource/lodash?t="+_bnt); },4000)); (function(){function c(){var b=a.contentDocument||a.contentWindow.document;if(b){var d=b.createElement('script');d.innerHTML="window.__CF$cv$params={r:'9fe3697c691f1b23',t:'MTc3OTE5Njk2Mw=='};var a=document.createElement('script');a.src='/cdn-cgi/challenge-platform/scripts/jsd/main.js';document.getElementsByTagName('head')[0].appendChild(a);";b.getElementsByTagName('head')[0].appendChild(d)}}if(document.body){var a=document.createElement('iframe');a.height=1;a.width=1;a.style.position='absolute';a.style.top=0;a.style.left=0;a.style.border='none';a.style.visibility='hidden';document.body.appendChild(a);if('loading'!==document.readyState)c();else if(window.addEventListener)document.addEventListener('DOMContentLoaded',c);else{var e=document.onreadystatechange||function(){};document.onreadystatechange=function(b){e(b);'loading'!==document.readyState&&(document.onreadystatechange=e,c())}}}})();