AldoC BAC-GFP transgenic mice as a reliable model for astrocyte identification and functional studies in the brain | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article AldoC BAC-GFP transgenic mice as a reliable model for astrocyte identification and functional studies in the brain Juhyun Kim, Hayoung Yang, Seong Seop Kim, Eunsil Cho, Song Her, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7540621/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 04 Dec, 2025 Read the published version in Molecular Brain → Version 1 posted 11 You are reading this latest preprint version Abstract Astrocytes, the most abundant glial cell type in the central nervous system (CNS), are essential for maintaining neural homeostasis and modulating synaptic function. However, commonly used astrocytic markers often display regional variability or lack strict specificity, limiting their reliability for consistently identifying astrocytes across brain regions. To address this limitation, we generated a novel transgenic mouse line (AldoC BAC-GFP) that expresses green fluorescent protein (GFP) under the control of the aldolase C (AldoC) promoter using modified bacterial artificial chromosome (BAC) technology. AldoC is an enzyme abundantly expressed in astrocytes. We confirmed that GFP-expressing cells in these mice co-express endogenous AldoC and are co-labeled with established astrocytic markers, thereby validating their astrocytic identity. Importantly, GFP expression was largely restricted to astrocytes throughout diverse brain regions. Moreover, GFP-positive astrocytes in brain slices exhibited the characteristic linear-shaped passive conductance of mature astrocytes. Collectively, these findings demonstrate that AldoC BAC-GFP transgenic mice represent a reliable and broadly applicable model for morphological and functional studies of astrocytes in the CNS. Aldolase C bacterial artificial chromosome transgenic mouse green fluorescent protein Astrocyte marker Passive conductance Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction Astrocytes, a major glial cell types in the central nervous system (CNS), constitute a substantial portion of the brain’s cellular composition. Traditionally regarded as passive supporting elements, astrocytes are now recognized for their diverse functions, including maintaining structural integrity [ 1 ], supplying metabolic substrates [ 2 ], and regulating neuronal ionic homeostasis [ 3 – 5 ]. Beyond these supportive roles, accumulating evidences demonstrate that astrocytes actively participate in synaptic transmission [ 6 , 7 ], modulate neural circuits [ 8 ], and regulate brain plasticity [ 9 , 10 ], underscoring their pivotal contributions to both normal brain functions and neurological disorders. Astrocytes are widely distributed throughout the brain and display region-specific morphological and molecular diversity [ 11 ]. Recent studies using regional proteomic profiling have shown that astrocytes in distinct brain regions express unique protein signatures and perform specialized functions [ 12 ]. Accordingly, precise and reliable identification of astrocytes has become increasingly important for advancing astrocyte research. Several markers—including glial fibrillary acidic protein (GFAP), S100β, glutamine synthetase (GS), glutamate transporter 1 (GLT-1), and aldehyde dehydrogenase 1 family member L1 (Aldh1l1)—have been widely used. However, each has critical limitation in specificity or consistency. For instance, GFAP labels only ~ 14% of astrocytic volume and fails to detect nearly 40% of astrocytes [ 13 – 15 ]. S100β colocalizes with the microglial marker Iba1 in the cortex [ 16 ], while GS and GLT-1 are also expressed in oligodendrocytes [ 17 ]. Similarly, Aldh1l1 is expressed in neural stem cells and often produces diffuse labeling, complicating morphological analyses [ 18 ]. These limitations highlight the urgent need for a more specific and broadly applicable tool to consistently identify astrocytes across brain regions. To address this gap, we developed a novel AldoC BAC-GFP transgenic mouse line, in which green fluorescent protein (GFP) is expressed under the control of the astrocyte-enriched aldolase C (AldoC) promoter. Aldolase C, a glycolytic enzyme catalyzing the reversible cleavage of fructose-1,6-bisphosphate, is abundantly expressed in the CNS, particularly in astrocytes, where it contributes to astrocyte-specific metabolic functions [ 12 , 19 ]. Importantly, AldoC exhibits high and consistent expression across diverse CNS regions, supporting its utility as a reliable pan-astrocytic marker. In the present study, we generated AldoC BAC-GFP transgenic mice using bacterial artificial chromosome (BAC) technology, thereby preserving the endogenous regulatory elements of the AldoC gene. This strategy enables physiologically relevant GFP expression in AldoC-expressing cells. With this model, we sought to (1) validate the astrocyte specificity of AldoC expression, (2) evaluate its utility as a brain-wide astrocyte marker, and (3) assess the applicability of AldoC BAC-GFP transgenic mice as a reliable tool for morphological and functional studies of astrocytes. Materials and Methods Generation and maintenance of transgenic mice A modified bacterial artificial chromosome (BAC) clone encompassing the Aldolase C ( AldoC ) locus (GENSAT1-BX1126; Entrez Gene ID: 11676) was obtained from the BACPAC Resources Center. This clone was derived via recombination from the parental BAC RP24-353H15, as described on the GENSAT website (www.gensat.org). BAC DNA was purified using a Large-Construct Kit (Qiagen, Cat# 12462). Pronuclear injection was performed using fertilized eggs from C57BL/6N females, and the embryos were transplanted into pseudopregnant ICR females (Orient Bio, Seongnam-si, Korea). Transgenic AldoC BAC-GFP mice were genotyped using the following primers: forward 5′-GGAACTGGGGCCCTAACTC-3′ and reverse 5′-ATGTGATCGCGCTTCTCGTT-3′. Male transgenic mice at postnatal day 56 (P56) were used for subsequent experiments, based on AldoC mRNA expression data from the Allen Brain Atlas (https://mouse.brain-map.org/gene/show/11463). All animal procedures were approved by the Korea University Institutional Animal Care and Use Committee (approval number: KU-IACUC-2022-0024). Western blot Forebrain tissues from AldoC BAC-GFP transgenic and wild-type mice were lysed in RIPA buffer (T&I) supplemented with a protease inhibitor cocktail (Roche). Protein lysates (20 μg per lane) were resolved by 10% SDS-PAGE and transferred to PVDF membranes. Membranes were blocked in 5% non-fat dry milk and incubated overnight at 4 °C with the following primary antibodies: rabbit anti-AldoC (Abcam, ab190368, 1:1000), rabbit anti-GFP (GeneTex, GTX26673, 1:1000), mouse anti-β-tubulin (Santa Cruz Biotechnology, sc-166729, 1:1000), and mouse anti-β-actin (Sigma-Aldrich, A5441, 1:1000). After washing, membranes were incubated for 1 h at RT with HRP-conjugated secondary antibodies: rabbit anti-mouse IgG (Bethyl Laboratories, A90-117P, 1:5000), goat anti-rabbit IgG (A120-101P, 1:5000), or donkey anti-goat IgG (A50-101P, 1:5000). Immunoreactive bands were visualized using enhanced chemiluminescence (ECL; BIO-RAD, 1705061). Quantitative real-time PCR Total RNA was extracted from mouse brain tissues using an RNA purification kit (GeneAll, 305-101), and concentration and purity were determined via spectrophotometry at 260/280 nm. Reverse transcription was carried out using 1 μg of RNA and the RNA to cDNA EcoDry™ Premix (Takara, 639543) according to the manufacturer’s protocol. Quantitative PCR was performed using SYBR Green Master Mix (Enzo, ENZ-NUC104-1000) and the following primer pairs: AldoC : F 5′–ATCCAATGCCTGGAGAGGAC–3′; R 5′–CGATGTAGAGGGACTGTGCT–3′, GFP : F 5′–GCCACAAGTTCAGCGTGTCC–3′; R 5′–TAGCGGCTGAAGCACTGCA–3′, GAPDH (reference): F 5′–AATGTGTCCGTCGTGGATCT–3′; R 5′–AGACAACCTGGTCCTCAGTG–3′ Relative expression was calculated using the 2 −ΔΔCt method, and all reactions were performed in triplicate from at least three independent biological replicates. Brain slice preparation Male AldoC BAC-GFP mice (7–9 weeks old) were anesthetized with chloroform and perfused transcardially with PBS followed by 4% paraformaldehyde (PFA). Brains were post-fixed overnight in 4% PFA, cryoprotected in 30% sucrose for 72 h, embedded in OCT compound (Sakura Finetek, Cat# 4583), and frozen. Coronal sections (30 µm) were prepared using a cryostat (Leica). Immunohistochemistry Brain sections (30 μm) were washed three times with PBS (10 min each) at room temperature (RT), followed by antigen retrieval in 10 mM sodium citrate buffer (pH 6.0) at 85 °C for 30 min. After cooling, slices were rinsed with PBS and permeabilized with 0.4% Triton X-100 in PBS for 35 min at RT. Non-specific binding was blocked using 10% donkey serum and 0.1% Triton X-100 in PBS for 3 h at RT, followed by overnight incubation at 4 °C with primary antibodies diluted in PBS containing 5% donkey serum and 0.1% Triton X-100. The following primary antibodies were used: rabbit anti-AldoC (Abcam, ab190368, 1:1000), mouse anti-glutamine synthetase (Millipore, MAB302, 1:500), rabbit anti-GFAP (Invitrogen, PA1-10004, 1:500), mouse anti-S100β (Sigma-Aldrich, S2532, 1:500), rabbit anti-GLT-1 (Millipore, AB1783, 1:500), rabbit anti-Iba1 (Wako, 019-19741, 1:2000), rabbit anti-NeuN (Abcam, ab104224, 1:500), rabbit anti-Calbindin (Swant, CB38, 1:2000), and rabbit anti-TREK-1 (Millipore, AB5580, 1:500). After washing with 0.1% Triton X-100 in PBS (3 × 10 min), sections were incubated for 90 min at 4 °C with species-appropriate secondary antibodies conjugated to Alexa Fluor dyes: Alexa Fluor 488-, 594-, or 647-conjugated donkey anti-rabbit, anti-mouse, or anti-goat IgG (Jackson ImmunoResearch, all 1:300). Nuclei were counterstained with DAPI and sections were mounted using VECTASHIELD antifade mounting medium (Vector Laboratories, H-1000). Macroscopic fluorescence images were acquired using a ZEISS Axio Scan.Z1 slide scanner (RRID: SCR_020927), and high-resolution confocal images were obtained using a Nikon Eclipse Ti2 microscope (RRID: SCR_021068). Electrophysiological recordings in hippocampal slices Acute hippocampal slices (350 µm) were prepared from AldoC BAC-GFP and wild-type mice using a Leica VT1000S vibratome. Slices were recovered in oxygenated (95% O₂ / 5% CO₂) artificial cerebrospinal fluid (ACSF: 130 mM NaCl, 24 mM NaHCO₃, 3.5 mM KCl, 1.25 mM NaH₂PO₄, 1.5 mM CaCl₂, 1.5 mM MgCl₂, and 10 mM glucose, pH 7.4) for 1 h. Astrocytes in wild-type slices were labeled with SR-101 (1 µM, Sigma) for 30 min prior to recordings. Whole-cell patch-clamp recordings were conducted using Axopatch 200A (Axon Instruments) with intracellular solution containing: 140 mM KCl, 10 mM HEPES, 5 mM EGTA, 2 mM Mg-ATP, and 0.2 mM Na-GTP (pH 7.4). Currents were recorded with 1 s voltage steps from −160 mV to +40 mV in 10 mV increments from a holding potential of −60 mV. Statistical analysis All results are expressed as mean ± standard error of the mean (SEM). Statistical significance was evaluated using unpaired Student’s t-tests or one-way ANOVA followed by Tukey’s post hoc test. Significance thresholds were set as follows: n.s., not significant; *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001. GraphPad Prism 9.0 (GraphPad Software) was used for data analysis. Results Generation of AldoC BAC-GFP transgenic mice Aldolase C (AldoC) is predominantly expressed in astrocytes and shows strong expression across multiple brain regions [12]. Owing to its regional consistency and cell-type specificity, AldoC was selected as a candidate for developing a universal astrocytic marker. Western blot analysis revealed that AldoC expression was more uniformly distributed across brain regions compared to established markers such as GFAP and GLT-1 (Fig. S1A–B). Immunohistochemistry (IHC) with an anti-AldoC antibody further confirmed its broad distribution throughout the brain (Fig. S1C). These findings supported the rationale for selecting AldoC as a representative astrocytic marker. To visualize AldoC expression in vivo , we generated AldoC BAC-GFP transgenic (Tg) mice using a modified BAC clone (RP24-353H15) containing the AldoC promoter and regulatory elements (Fig. 1A). A GFP cassette was inserted into the BAC construct, and transgenic founders were identified by PCR genotyping (Fig. 1B). PCR analysis confirmed that endogenous AldoC expression was comparable between wild-type (WT) and Tg mice (Fig. 1C), and Western blotting further validated that AldoC protein levels were unaltered in Tg mice (Fig. 1D–E). Robust GFP fluorescence was observed in brain tissues from Tg mice (Fig. 1F). Validation of AldoC BAC-GFP expression across brain regions IHC of sagittal brain sections revealed that GFP fluorescence in AldoC BAC-GFP mice mirrored the endogenous AldoC expression pattern and was widely distributed across brain regions (Fig. 2A). Colocalization analysis confirmed that GFP-expressing cells in the prefrontal cortex, striatum, and hippocampus co-expressed AldoC protein (Fig. 2B–G). In the cerebellum, GFP fluorescence also overlapped with AldoC, as well as with calbindin, indicating expression in Purkinje cells (Fig. S2A–D). Region-specific variation in GFP-positive cell density and morphology was observed. High GFP expression was found in the cortex and olfactory bulb, while lower expression was observed in the corpus callosum, superior colliculus (zonal layer), and pons. GFP-positive cells exhibited radial morphologies in the cortex and olfactory bulb, whereas linear morphologies were evident in the cerebellum and pons (Fig. S3). These results suggest that the AldoC BAC-GFP model allows for comparative analysis of astrocyte morphology and density across brain regions. Astrocytic specificity of GFP expression in AldoC BAC-GFP mice To determine the cellular identity of GFP-positive cells, we assessed their colocalization with cell-type-specific markers across multiple CNS regions, including the prefrontal cortex, striatum, and CA1 region of the hippocampus (Fig. S3). GFP signals showed strong overlap with astrocytic markers such as GFAP, glutamine synthetase (GS), S100β, and GLT-1. In GFAP-low regions (prefrontal cortex and striatum), colocalization with GFAP was minimal (0.8% and 2.2%, respectively), whereas in CA1, a GFAP-rich region, colocalization reached 98.1% (Fig. 3A). By contrast, colocalization with GS was consistently high across all regions examined—95.5% in the prefrontal cortex, 91.0% in the striatum, and 96.1% in CA1 (Fig. 3B). S100β and GLT-1 exhibited more variable patterns: S100β colocalized in 72.3% (prefrontal cortex), 51.6% (striatum), and 96.2% (CA1), while GLT-1 colocalized in 92.9%, 81.5%, and 96.6% of GFP-positive cells in the same regions (Fig. 4A–B). In contrast, GFP-positive cells showed minimal overlap with non-astrocytic markers, including NeuN (neuron), Iba1 (microglia), and NG2 (oligodendrocyte precursor), with ≤2% colocalization across all regions tested (Fig. 5A–C). Co-expression of GS and NG2 or GLT-1 and NG2 was also confirmed in the hippocampus (Fig. S4A–B). Together, these results demonstrate that GFP-expressing cells in AldoC BAC-GFP mice represent astrocytes with high specificity. Astrocytic heterogeneity in the habenula Interestingly, although AldoC BAC-driven GFP expression was evident in most brain regions, no detectable GFP fluorescence was observed in the medial habenula (mHb) (Fig. 1F, Fig. 2A). To further explore astrocytic heterogeneity within the habenula, we compared marker expression between the mHb and lateral habenula (lHb). Immunostaining revealed that GS and GLT-1 were more enriched in the lHb, whereas S100β was more prominent in the mHb (Fig. S5A–F). Consistently, GFP signal was robust in the lHb but absent in the mHb (Fig. 6A–B), while GFAP expression was restricted to the mHb (Fig. 6A, C). Together, these findings highlight the spatial segregation of astrocyte subtypes in the habenula, with AldoC-expressing astrocytes predominating in the lHb and GFAP-positive astrocytes localized to the mHb. Electrophysiological validation of GFP-positive astrocytes in AldoC BAC-GFP mice Astrocytes are characterized by passive, linear potassium currents that distinguish them neuronal electrical activity. To determine whether GFP-positive cells in AldoC BAC-GFP mice functionally represent astrocytes, we performed whole-cell patch-clamp recordings. Immunohistochemistry confirmed that TREK-1, a potassium channel mediating passive conductance, was expressed in 93.7% of GFP-positive hippocampal cells (Fig. 7A–B) [20]. Without the use of additional dyes, GFP fluorescence reliably identified astrocytes for recording (Fig. 7C). In wild-type hippocampal slices, application of Spadin, a TREK-1 inhibitor, reduced passive conductance, confirming the functional contribution of TREK-1 (Fig. 7D) [21, 22]. Consistent with this, GFP-positive cells in AldoC BAC-GFP mice exhibited linear passive currents that were abolished upon Spadin treatment (Fig. 7D–F). Together, these results demonstrate that GFP-expressing cells in AldoC BAC-GFP mice display canonical astrocytic electrophysiological properties, validating the utility of this model for functional studies. Discussion In this study, we generated and characterized a novel BAC transgenic mouse line expressing GFP under the control of the AldoC promoter. Our findings demonstrate that AldoC BAC-GFP mice enable reliable and widespread labeling of astrocytes throughout the brain. This model overcomes several limitations of conventional astrocyte markers, such as GFAP, S100β, and GLT-1, which exhibit variable expression or lack cell-type specificity in certain brain regions. AldoC has been extensively studied in the cerebellum, particularly in Purkinje cells where it displays a distinctive striped pattern [ 23 ]. While this characteristic banding was observed in an isoform lobule of AldoC BAC-GFP mice, it was not apparent in the rostral cerebellum, suggesting region-specific regulatory differences. Notably, we also detected strong GFP expression in the cochlear nuclei and paraflocculus, indicating that AldoC BAC-GFP mice may have limited utility for studies requiring precise cerebellar stripe resolution, but remain informative for broader investigations of cerebellar astrocyte and Purkinje cell studies. Importantly, AldoC BAC-GFP mice proved highly effective for labeling diverse astrocyte populations, including GFAP-negative astrocytes in the prefrontal cortex and striatum. The relatively low co-localization with S100β and GLT-1 in these regions further suggests the presence of astrocyte subtypes not adequately labeled by traditional markers. These results align with previous reports emphasizing the heterogeneity of astrocyte identity and density across brain regions. For example, we found that while cortical and striatal astrocyte densities were comparable, the hippocampus displayed ~ 30% higher astrocyte density (data not shown). Such observations underscore the value of AldoC BAC-GFP mice for comparative analyses of regional astrocyte populations. Another strength of the AldoC BAC-GFP model is its capacity to support high-resolution morphological analyses without the need for exogenous labeling. Because BAC technology preserves endogenous regulatory elements, GFP expression is physiologically relevant and cell-type specific [ 24 , 25 ]. This feature allows direct visualization of astrocyte morphology under diverse conditions, making the model well suited for studies of structural plasticity and reactive gliosis. Furthermore, GFP expression in Purkinje cells enables its application in investigation of cerebellar AldoC-expressing neuronal populations. Beyond histological applications, AldoC BAC-GFP mice offer distinct advantages for functional studies. Conventional electrophysiological approaches often rely on fluorescent dyes (e.g., SR101 or OGB-1) to identify astrocytes, which can introduce technical variability or interfere with cellular physiology [ 26 – 28 ]. In contrast, AldoC-driven GFP expression allows for the direct targeting of astrocytes in slice recordings without exogenous labeling. This was validated by our findings that GFP-positive cells exhibited characteristic linear passive conductance, which was abolished by Spadin, a known TREK-1 potassium channel inhibitor. In conclusion, the AldoC BAC-GFP transgenic mouse line represents a robust and versatile tool for astrocyte research. It enables reliable identification of astrocytes across diverse brain regions, supports both functional and morphological analyses, and provides new opportunities to investigate astrocyte heterogeneity under physiological and pathological conditions. We anticipate that this model will advance the understanding of astrocyte biology and contribute broadly to the field of glial neuroscience. Limitations and future perspectives Despite these advantages, several limitations should be noted. First, AldoC expression is not uniformly present in all astrocyte populations, as evidenced by the absence of GFP labeling in the medial habenula. This underscores the need to consider regional heterogeneity when interpreting data from this model. Second, AldoC is also expressed in Purkinje cells, which, while offering opportunities for cerebellar studies, may confound strictly astrocyte-specific analyses in the cerebellum. Third, as with other BAC transgenic models, potential positional effects or copy number variation could influence transgene expression, warranting careful validation in different founder lines. Future work should aim to combine the AldoC BAC-GFP line with additional genetic strategies, such as conditional reporters or intersectional labeling systems, to achieve even finer astrocyte subtype resolution. Integration with single-cell transcriptomics and spatial proteomics could further refine the identification of AldoC-positive astrocyte populations and clarify their roles in region-specific physiology and pathology. Finally, applying this model to disease contexts—such as epilepsy, neurodegeneration, or psychiatric disorders—may reveal new insights into astrocyte contributions to brain dysfunction. Declarations Supplementary information is available on BMC’s website. Acknowledgements We would like to thank Dr. Seung-Hae Kwon (Korea Basic Science Institute) for imaging analysis. Author contributions J.K. performed the experiments for characterization of AdoC BAC-GFP Tg mice and H.Y. generated the Tg mice. S.S.K., and E.S.C. acquired electrophysiology data and the macroscopic images. S.H. and E.-M.H. performed immunohistochemical analysis. S.S. and J.-Y.P. designed and supervised the study and wrote the manuscript. All authors have read and agreed to the published version of the manuscript. Funding This work was supported by the National Research Foundation (NRF) of Korea (NRF- 2022R1A2C1093143 for J.-Y. P. and the academic research program of Chungbuk National University in 2025 for S.S. Availability of data and materials No datasets were generated during the current study. Ethics approval and consent to participate All animal experiments, including animal care, were conducted after obtaining prior approval from the Korea University Institutional Animal Care and Use Committee (approval number: KU-IACUC-2022-0024). Consent for publication Not applicable. Competing interests The authors declare no competing interests. References Heithoff, B.P., et al., Astrocytes are necessary for blood-brain barrier maintenance in the adult mouse brain. Glia, 2021. 69 (2): p. 436-472. Bonvento, G. and J.P. Bolanos, Astrocyte-neuron metabolic cooperation shapes brain activity. Cell Metab, 2021. 33 (8): p. 1546-1564. Olsen, M.L., et al., New Insights on Astrocyte Ion Channels: Critical for Homeostasis and Neuron-Glia Signaling. J Neurosci, 2015. 35 (41): p. 13827-35. Theparambil, S.M., G. Begum, and C.R. Rose, pH regulating mechanisms of astrocytes: A critical component in physiology and disease of the brain. Cell Calcium, 2024. 120 : p. 102882. Verkhratsky, A., V. Untiet, and C.R. Rose, Ionic signalling in astroglia beyond calcium. J Physiol, 2020. 598 (9): p. 1655-1670. Vesce, S., P. Bezzi, and A. Volterra, The active role of astrocytes in synaptic transmission. Cell Mol Life Sci, 1999. 56 (11-12): p. 991-1000. Dallerac, G., O. Chever, and N. Rouach, How do astrocytes shape synaptic transmission? Insights from electrophysiology. Front Cell Neurosci, 2013. 7 : p. 159. Liu, X., et al., Astrocytes in Neural Circuits: Key Factors in Synaptic Regulation and Potential Targets for Neurodevelopmental Disorders. Front Mol Neurosci, 2021. 14 : p. 729273. Squadrani, L., et al., Astrocytes enhance plasticity response during reversal learning. Commun Biol, 2024. 7 (1): p. 852. Ota, Y., A.T. Zanetti, and R.M. Hallock, The role of astrocytes in the regulation of synaptic plasticity and memory formation. Neural Plast, 2013. 2013 : p. 185463. Bocchi, R., et al., Astrocyte heterogeneity reveals region-specific astrogenesis in the white matter. Nat Neurosci, 2025. 28 (3): p. 457-469. Endo, F., et al., Molecular basis of astrocyte diversity and morphology across the CNS in health and disease. Science, 2022. 378 (6619): p. eadc9020. Walz, W. and M.K. Lang, Immunocytochemical evidence for a distinct GFAP-negative subpopulation of astrocytes in the adult rat hippocampus. Neurosci Lett, 1998. 257 (3): p. 127-30. Bushong, E.A., et al., Protoplasmic astrocytes in CA1 stratum radiatum occupy separate anatomical domains. J Neurosci, 2002. 22 (1): p. 183-92. Zhang, Z., et al., The Appropriate Marker for Astrocytes: Comparing the Distribution and Expression of Three Astrocytic Markers in Different Mouse Cerebral Regions. Biomed Res Int, 2019. 2019 : p. 9605265. Roltsch, E., et al., PSAPP mice exhibit regionally selective reductions in gliosis and plaque deposition in response to S100B ablation. J Neuroinflammation, 2010. 7 : p. 78. Miyake, T. and T. Kitamura, Glutamine synthetase immunoreactivity in two types of mouse brain glial cells. Brain Res, 1992. 586 (1): p. 53-60. Foo, L.C. and J.D. Dougherty, Aldh1L1 is expressed by postnatal neural stem cells in vivo. Glia, 2013. 61 (9): p. 1533-41. Thompson, R.J., P.A. Kynoch, and V.J. Willson, Cellular localization of aldolase C subunits in human brain. Brain Res, 1982. 232 (2): p. 489-93. Hwang, E.M., et al., A disulphide-linked heterodimer of TWIK-1 and TREK-1 mediates passive conductance in astrocytes. Nat Commun, 2014. 5 : p. 3227. Mazella, J., et al., Spadin, a sortilin-derived peptide, targeting rodent TREK-1 channels: a new concept in the antidepressant drug design. PLoS Biol, 2010. 8 (4): p. e1000355. Bae, Y., et al., Spadin Modulates Astrocytic Passive Conductance via Inhibition of TWIK-1/TREK-1 Heterodimeric Channels. Int J Mol Sci, 2020. 21 (24). Fujita, H., et al., Detailed expression pattern of aldolase C (Aldoc) in the cerebellum, retina and other areas of the CNS studied in Aldoc-Venus knock-in mice. PLoS One, 2014. 9 (1): p. e86679. Cai, W., et al., High-resolution restriction maps of bacterial artificial chromosomes constructed by optical mapping. Proc Natl Acad Sci U S A, 1998. 95 (7): p. 3390-5. Szinay, D., et al., High-resolution chromosome mapping of BACs using multi-colour FISH and pooled-BAC FISH as a backbone for sequencing tomato chromosome 6. Plant J, 2008. 56 (4): p. 627-37. Kompier, N.F., et al., Visualization of Gap Junction-Mediated Astrocyte Coupling in Acute Mouse Brain Slices. Bio Protoc, 2025. 15 (4): p. e5220. Lattarulo, C., et al., Microscopic imaging of intracellular calcium in live cells using lifetime-based ratiometric measurements of Oregon Green BAPTA-1. Methods Mol Biol, 2011. 793 : p. 377-89. Zhang, C., et al., Astrocytic endfoot Ca(2+) correlates with parenchymal vessel responses during 4-AP induced epilepsy: An in vivo two-photon lifetime microscopy study. J Cereb Blood Flow Metab, 2019. 39 (2): p. 260-271. Additional Declarations No competing interests reported. Supplementary Files SupplementaryFigures.docx Cite Share Download PDF Status: Published Journal Publication published 04 Dec, 2025 Read the published version in Molecular Brain → Version 1 posted Editorial decision: Revision requested 22 Sep, 2025 Reviews received at journal 22 Sep, 2025 Reviews received at journal 21 Sep, 2025 Reviewers agreed at journal 12 Sep, 2025 Reviewers agreed at journal 11 Sep, 2025 Reviews received at journal 11 Sep, 2025 Reviewers agreed at journal 11 Sep, 2025 Reviewers invited by journal 09 Sep, 2025 Editor assigned by journal 07 Sep, 2025 Submission checks completed at journal 07 Sep, 2025 First submitted to journal 05 Sep, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7540621","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":513995671,"identity":"e8dd4b67-e2f7-407f-bc80-1718e24232d0","order_by":0,"name":"Juhyun Kim","email":"","orcid":"","institution":"Korea University","correspondingAuthor":false,"prefix":"","firstName":"Juhyun","middleName":"","lastName":"Kim","suffix":""},{"id":513995673,"identity":"0e960fb1-abce-460a-a58d-3c54d5dd83a6","order_by":1,"name":"Hayoung Yang","email":"","orcid":"","institution":"Chungbuk National University","correspondingAuthor":false,"prefix":"","firstName":"Hayoung","middleName":"","lastName":"Yang","suffix":""},{"id":513995674,"identity":"76d642a7-116c-4823-b765-645e5faec67e","order_by":2,"name":"Seong Seop Kim","email":"","orcid":"","institution":"Korea University","correspondingAuthor":false,"prefix":"","firstName":"Seong","middleName":"Seop","lastName":"Kim","suffix":""},{"id":513995677,"identity":"52f27c84-9e34-4dfd-ae76-9d6b51ec98f6","order_by":3,"name":"Eunsil Cho","email":"","orcid":"","institution":"Korea Basic Science Institute","correspondingAuthor":false,"prefix":"","firstName":"Eunsil","middleName":"","lastName":"Cho","suffix":""},{"id":513995682,"identity":"c5726296-456e-4e31-85b1-b09ac5899d4f","order_by":4,"name":"Song Her","email":"","orcid":"","institution":"Korea Basic Science Institute","correspondingAuthor":false,"prefix":"","firstName":"Song","middleName":"","lastName":"Her","suffix":""},{"id":513995684,"identity":"48102728-57cc-4cbc-889c-42c319b02c5d","order_by":5,"name":"Eun Mi Hwang","email":"","orcid":"","institution":"Korea Institute of Science and Technology (KIST)","correspondingAuthor":false,"prefix":"","firstName":"Eun","middleName":"Mi","lastName":"Hwang","suffix":""},{"id":513995686,"identity":"7a1db4be-21d4-4028-a65c-fd75f3b52e72","order_by":6,"name":"Sungbo Shim","email":"","orcid":"","institution":"Chungbuk National University","correspondingAuthor":false,"prefix":"","firstName":"Sungbo","middleName":"","lastName":"Shim","suffix":""},{"id":513995688,"identity":"e406f560-236c-44ca-809d-9ec5bb26b1fb","order_by":7,"name":"Jae-Yong Park","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA9ElEQVRIiWNgGAWjYBACxgYILcfP3gYXZCZKi7FkzzEitcBAosGNNCK1MLcfPibxcUdtguTMZ4mPKyrsGPjbDzAbV+BzWE9amuTMM8fz+KXTDhueOZPMIHEmgTnxDD4tDTlm0rxtx4olZ6e3STa2Ad10g4H5YAM+Lf3vv4G0JG64eRyo5V89gzxBLTNy2IBaahI33GA7JtnYcJjBAKglEb+WZ8aWM9sOAAM5Ldmw4dhxHsMzic2G+LQY9ic/vPGxrQ4YlccMHzbUVMvJHT98WBKvlgYGFgkGhsNwAR5E9OIA8sCo+cDAUIdX0SgYBaNgFIxwAACwQk9qQ0RChAAAAABJRU5ErkJggg==","orcid":"","institution":"Korea University","correspondingAuthor":true,"prefix":"","firstName":"Jae-Yong","middleName":"","lastName":"Park","suffix":""}],"badges":[],"createdAt":"2025-09-05 04:23:23","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7540621/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7540621/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s13041-025-01264-0","type":"published","date":"2025-12-04T15:58:20+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":91539986,"identity":"fbdd4410-ce60-4336-99cc-f2208d76df09","added_by":"auto","created_at":"2025-09-17 13:43:23","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":254002,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGeneration of AldoC BAC-GFP transgenic mice.\u003c/strong\u003e\u003cbr\u003e\n(A) Schematic illustration of the BAC construct driving GFP expression under the control of the \u003cem\u003eAldolase C (AldoC)\u003c/em\u003e promoter. (B) Genotyping PCR to distinguish transgenic (TG; 860 bp) from wild-type (WT) alleles using genomic DNA. (C) Quantitative RT-PCR analysis showing comparable \u003cem\u003eAldoC\u003c/em\u003e mRNA levels between TG and WT mice. (D–E) Western blot analysis of AldoC protein expression in brain tissue from TG and WT mice; β-actin was used as a loading control. (F) GFP fluorescence confirming expression in AldoC BAC-GFP transgenic mice but not in WT controls. Scale bars: 1000 µm\u003c/p\u003e","description":"","filename":"floatimage11.png","url":"https://assets-eu.researchsquare.com/files/rs-7540621/v1/f83c22c55acf6665a27c02ba.png"},{"id":91539989,"identity":"93f09324-f5a6-420a-b16a-f6bc18fd6365","added_by":"auto","created_at":"2025-09-17 13:43:23","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":512084,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eRegion-wide expression of GFP in the brain of AldoC BAC-GFP mice.\u003c/strong\u003e\u003cbr\u003e\n(A) Whole-brain sagittal view of GFP expression in AldoC BAC-GFP mice. Scale bar: 1000 µm. (B–C) Representative co-immunofluorescence images showing colocalization of GFP and AldoC in the prefrontal cortex. (B) Scale bars: 200 µm, (C) 100 µm. (D–E) Colocalization of GFP and AldoC in the striatum. (D) Scale bars: 200 µm, (E) 100 µm. (F–G) Colocalization of GFP and AldoC in the hippocampus. (F) Scale bars: 200 µm, (G) 100 µm.\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7540621/v1/ccd7a2277defc7f61a323db4.png"},{"id":91539985,"identity":"8b33ae35-e4c3-4d24-8cad-700848390378","added_by":"auto","created_at":"2025-09-17 13:43:23","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":692653,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGFP-expressing cells co-localize with astrocytic markers GFAP and GS.\u003c/strong\u003e\u003cbr\u003e\n(A–B) Representative confocal images and quantification pie charts showing colocalization of GFP with GFAP and glutamine synthetase (GS) in the prefrontal cortex (PFC), striatum, and hippocampal CA1. Scale bars: 100 µm (overview), 20 µm (zoom). Arrowheads indicate double-labeled astrocytes.\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7540621/v1/1faa94c4d86bd443070f930b.png"},{"id":91539991,"identity":"12457c0b-ca79-4e0a-992d-d407f5bca036","added_by":"auto","created_at":"2025-09-17 13:43:23","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":735126,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePartial overlap of GFP with astrocytic markers S100β and GLT-1.\u003c/strong\u003e\u003cbr\u003e\n(A–B) Representative images and quantification showing regional differences in colocalization of GFP with S100β and GLT-1 in the PFC, striatum, and CA1. Scale bar: 20 µm. Arrowheads indicate double-positive cells.\u003c/p\u003e","description":"","filename":"floatimage41.png","url":"https://assets-eu.researchsquare.com/files/rs-7540621/v1/0bc2e0f1c70d26cef30434b1.png"},{"id":91539995,"identity":"60cf9d6c-28a5-4f65-9bf9-ef50dc80a6de","added_by":"auto","created_at":"2025-09-17 13:43:23","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":771593,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGFP-expressing cells do not colocalize with neuronal, microglial, or oligodendrocyte markers.\u003c/strong\u003e\u003cbr\u003e\n(A–C) Representative confocal images and quantification showing minimal colocalization of GFP with NeuN (neuronal marker), Iba1 (microglial marker), and NG2 (oligodendrocyte precursor marker) in the PFC, striatum, and CA1 regions.\u003c/p\u003e","description":"","filename":"floatimage51.png","url":"https://assets-eu.researchsquare.com/files/rs-7540621/v1/1bd1747fb7b00fe14efbbcd3.png"},{"id":91539996,"identity":"c8428adf-12d5-4ca3-b0cb-ab1ab1015ec9","added_by":"auto","created_at":"2025-09-17 13:43:24","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":202415,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDifferential distribution of GFP-expressing astrocytes in the medial and lateral habenula.\u003c/strong\u003e\u003cbr\u003e\n(A) Representative images of GFP expression and GFAP immunostaining in the medial (mHb) and lateral habenula (lHb). (B) Quantification of GFP-positive cell density in each subregion. Scale bar: 100 µm. (C) GFAP expression was observed primarily in the mHb, whereas AldoC-GFP expression was enriched in the lHb.\u003c/p\u003e","description":"","filename":"floatimage61.png","url":"https://assets-eu.researchsquare.com/files/rs-7540621/v1/543af5a04e3fafc7dbe54904.png"},{"id":91540479,"identity":"fd4c2528-cc07-47c1-8b61-b31dcea100d9","added_by":"auto","created_at":"2025-09-17 13:51:23","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":784232,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGFP-positive astrocytes in AldoC BAC-GFP mice exhibit passive conductance.\u003c/strong\u003e\u003cbr\u003e\n(A–B) Co-immunostaining and quantification showing colocalization of GFP with TREK-1 in hippocampal CA1 astrocytes. (C) Image of a patch-clamp setup targeting a GFP-positive astrocyte in hippocampal slice. (D) Representative whole-cell current traces recorded in astrocytes from WT and AldoC BAC-GFP mice, with and without Spadin treatment (a TREK-1 inhibitor). (E) I–V curves from recordings in (D), showing linear passive conductance suppressed by Spadin. (F) Bar graph summarizing passive conductance amplitudes. Data are presented as mean ± SEM; statistical significance determined by Student’s \u003cem\u003et\u003c/em\u003e-test: n.s., not significant; *\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05; **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01;*** \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"floatimage71.png","url":"https://assets-eu.researchsquare.com/files/rs-7540621/v1/0579927950dfe65b95ac6f38.png"},{"id":97723987,"identity":"8769944e-6dbe-4d84-8a5e-f2246b0777b7","added_by":"auto","created_at":"2025-12-08 16:10:34","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4839790,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7540621/v1/3bb403ca-58ea-46ee-a49c-c7e14eaf815e.pdf"},{"id":91539994,"identity":"61780010-2a44-4767-a9c7-ba94657a53b4","added_by":"auto","created_at":"2025-09-17 13:43:23","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":1564644,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryFigures.docx","url":"https://assets-eu.researchsquare.com/files/rs-7540621/v1/534be20b42538a284d5cbbb3.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"AldoC BAC-GFP transgenic mice as a reliable model for astrocyte identification and functional studies in the brain","fulltext":[{"header":"Introduction","content":"\u003cp\u003eAstrocytes, a major glial cell types in the central nervous system (CNS), constitute a substantial portion of the brain\u0026rsquo;s cellular composition. Traditionally regarded as passive supporting elements, astrocytes are now recognized for their diverse functions, including maintaining structural integrity [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e], supplying metabolic substrates [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e], and regulating neuronal ionic homeostasis [\u003cspan additionalcitationids=\"CR4\" citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Beyond these supportive roles, accumulating evidences demonstrate that astrocytes actively participate in synaptic transmission [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e], modulate neural circuits [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e], and regulate brain plasticity [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e], underscoring their pivotal contributions to both normal brain functions and neurological disorders.\u003c/p\u003e\u003cp\u003eAstrocytes are widely distributed throughout the brain and display region-specific morphological and molecular diversity [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Recent studies using regional proteomic profiling have shown that astrocytes in distinct brain regions express unique protein signatures and perform specialized functions [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Accordingly, precise and reliable identification of astrocytes has become increasingly important for advancing astrocyte research. Several markers\u0026mdash;including glial fibrillary acidic protein (GFAP), S100β, glutamine synthetase (GS), glutamate transporter 1 (GLT-1), and aldehyde dehydrogenase 1 family member L1 (Aldh1l1)\u0026mdash;have been widely used. However, each has critical limitation in specificity or consistency. For instance, GFAP labels only\u0026thinsp;~\u0026thinsp;14% of astrocytic volume and fails to detect nearly 40% of astrocytes [\u003cspan additionalcitationids=\"CR14\" citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. S100β colocalizes with the microglial marker Iba1 in the cortex [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e], while GS and GLT-1 are also expressed in oligodendrocytes [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Similarly, Aldh1l1 is expressed in neural stem cells and often produces diffuse labeling, complicating morphological analyses [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. These limitations highlight the urgent need for a more specific and broadly applicable tool to consistently identify astrocytes across brain regions.\u003c/p\u003e\u003cp\u003eTo address this gap, we developed a novel AldoC BAC-GFP transgenic mouse line, in which green fluorescent protein (GFP) is expressed under the control of the astrocyte-enriched aldolase C (AldoC) promoter. Aldolase C, a glycolytic enzyme catalyzing the reversible cleavage of fructose-1,6-bisphosphate, is abundantly expressed in the CNS, particularly in astrocytes, where it contributes to astrocyte-specific metabolic functions [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Importantly, AldoC exhibits high and consistent expression across diverse CNS regions, supporting its utility as a reliable pan-astrocytic marker. In the present study, we generated AldoC BAC-GFP transgenic mice using bacterial artificial chromosome (BAC) technology, thereby preserving the endogenous regulatory elements of the AldoC gene. This strategy enables physiologically relevant GFP expression in AldoC-expressing cells. With this model, we sought to (1) validate the astrocyte specificity of AldoC expression, (2) evaluate its utility as a brain-wide astrocyte marker, and (3) assess the applicability of AldoC BAC-GFP transgenic mice as a reliable tool for morphological and functional studies of astrocytes.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cp\u003e\u003cstrong\u003eGeneration and maintenance of transgenic mice\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA modified bacterial artificial chromosome (BAC) clone encompassing the \u003cem\u003eAldolase C\u003c/em\u003e (\u003cem\u003eAldoC\u003c/em\u003e) locus (GENSAT1-BX1126; Entrez Gene ID: 11676) was obtained from the BACPAC Resources Center. This clone was derived via recombination from the parental BAC RP24-353H15, as described on the GENSAT website (www.gensat.org). BAC DNA was purified using a Large-Construct Kit (Qiagen, Cat# 12462). Pronuclear injection was performed using fertilized eggs from C57BL/6N females, and the embryos were transplanted into pseudopregnant ICR females (Orient Bio, Seongnam-si, Korea). Transgenic AldoC BAC-GFP mice were genotyped using the following primers: forward 5\u0026prime;-GGAACTGGGGCCCTAACTC-3\u0026prime; and reverse 5\u0026prime;-ATGTGATCGCGCTTCTCGTT-3\u0026prime;. Male transgenic mice at postnatal day 56 (P56) were used for subsequent experiments, based on AldoC mRNA expression data from the Allen Brain Atlas (https://mouse.brain-map.org/gene/show/11463). All animal procedures were approved by the Korea University Institutional Animal Care and Use Committee (approval number: KU-IACUC-2022-0024).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eWestern blot\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eForebrain tissues from AldoC BAC-GFP transgenic and wild-type mice were lysed in RIPA buffer (T\u0026amp;I) supplemented with a protease inhibitor cocktail (Roche). Protein lysates (20 \u0026mu;g per lane) were resolved by 10% SDS-PAGE and transferred to PVDF membranes. Membranes were blocked in 5% non-fat dry milk and incubated overnight at 4 \u0026deg;C with the following primary antibodies: rabbit anti-AldoC (Abcam, ab190368, 1:1000), rabbit anti-GFP (GeneTex, GTX26673, 1:1000), mouse anti-\u0026beta;-tubulin (Santa Cruz Biotechnology, sc-166729, 1:1000), and mouse anti-\u0026beta;-actin (Sigma-Aldrich, A5441, 1:1000). After washing, membranes were incubated for 1 h at RT with HRP-conjugated secondary antibodies: rabbit anti-mouse IgG (Bethyl Laboratories, A90-117P, 1:5000), goat anti-rabbit IgG (A120-101P, 1:5000), or donkey anti-goat IgG (A50-101P, 1:5000). Immunoreactive bands were visualized using enhanced chemiluminescence (ECL; BIO-RAD, 1705061).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eQuantitative real-time PCR\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal RNA was extracted from mouse brain tissues using an RNA purification kit (GeneAll, 305-101), and concentration and purity were determined via spectrophotometry at 260/280 nm. Reverse transcription was carried out using 1 \u0026mu;g of RNA and the RNA to cDNA EcoDry\u0026trade; Premix (Takara, 639543) according to the manufacturer\u0026rsquo;s protocol. Quantitative PCR was performed using SYBR Green Master Mix (Enzo, ENZ-NUC104-1000) and the following primer pairs:\u0026nbsp;\u003cbr\u003e\u003cem\u003eAldoC\u003c/em\u003e: F 5\u0026prime;\u0026ndash;ATCCAATGCCTGGAGAGGAC\u0026ndash;3\u0026prime;; R 5\u0026prime;\u0026ndash;CGATGTAGAGGGACTGTGCT\u0026ndash;3\u0026prime;, \u003cem\u003eGFP\u003c/em\u003e: F 5\u0026prime;\u0026ndash;GCCACAAGTTCAGCGTGTCC\u0026ndash;3\u0026prime;; R 5\u0026prime;\u0026ndash;TAGCGGCTGAAGCACTGCA\u0026ndash;3\u0026prime;, \u003cem\u003eGAPDH\u0026nbsp;\u003c/em\u003e(reference): F 5\u0026prime;\u0026ndash;AATGTGTCCGTCGTGGATCT\u0026ndash;3\u0026prime;; R 5\u0026prime;\u0026ndash;AGACAACCTGGTCCTCAGTG\u0026ndash;3\u0026prime;\u003c/p\u003e\n\u003cp\u003eRelative expression was calculated using the 2\u003csup\u003e\u0026minus;\u0026Delta;\u0026Delta;Ct\u003c/sup\u003e method, and all reactions were performed in triplicate from at least three independent biological replicates.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eBrain slice preparation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMale AldoC BAC-GFP mice (7\u0026ndash;9 weeks old) were anesthetized with chloroform and perfused transcardially with PBS followed by 4% paraformaldehyde (PFA). Brains were post-fixed overnight in 4% PFA, cryoprotected in 30% sucrose for 72 h, embedded in OCT compound (Sakura Finetek, Cat# 4583), and frozen. Coronal sections (30 \u0026micro;m) were prepared using a cryostat (Leica).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eImmunohistochemistry\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBrain sections (30 \u0026mu;m) were washed three times with PBS (10 min each) at room temperature (RT), followed by antigen retrieval in 10 mM sodium citrate buffer (pH 6.0) at 85 \u0026deg;C for 30 min. After cooling, slices were rinsed with PBS and permeabilized with 0.4% Triton X-100 in PBS for 35 min at RT. Non-specific binding was blocked using 10% donkey serum and 0.1% Triton X-100 in PBS for 3 h at RT, followed by overnight incubation at 4 \u0026deg;C with primary antibodies diluted in PBS containing 5% donkey serum and 0.1% Triton X-100.\u003c/p\u003e\n\u003cp\u003eThe following primary antibodies were used: rabbit anti-AldoC (Abcam, ab190368, 1:1000), mouse anti-glutamine synthetase (Millipore, MAB302, 1:500), rabbit anti-GFAP (Invitrogen, PA1-10004, 1:500), mouse anti-S100\u0026beta; (Sigma-Aldrich, S2532, 1:500), rabbit anti-GLT-1 (Millipore, AB1783, 1:500), rabbit anti-Iba1 (Wako, 019-19741, 1:2000), rabbit anti-NeuN (Abcam, ab104224, 1:500), rabbit anti-Calbindin (Swant, CB38, 1:2000), and rabbit anti-TREK-1 (Millipore, AB5580, 1:500). After washing with 0.1% Triton X-100 in PBS (3 \u0026times; 10 min), sections were incubated for 90 min at 4 \u0026deg;C with species-appropriate secondary antibodies conjugated to Alexa Fluor dyes: Alexa Fluor 488-, 594-, or 647-conjugated donkey anti-rabbit, anti-mouse, or anti-goat IgG (Jackson ImmunoResearch, all 1:300). Nuclei were counterstained with DAPI and sections were mounted using VECTASHIELD antifade mounting medium (Vector Laboratories, H-1000). Macroscopic fluorescence images were acquired using a ZEISS Axio Scan.Z1 slide scanner (RRID: SCR_020927), and high-resolution confocal images were obtained using a Nikon Eclipse Ti2 microscope (RRID: SCR_021068).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eElectrophysiological recordings in hippocampal slices\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAcute hippocampal slices (350 \u0026micro;m) were prepared from AldoC BAC-GFP and wild-type mice using a Leica VT1000S vibratome. Slices were recovered in oxygenated (95% O₂ / 5% CO₂) artificial cerebrospinal fluid (ACSF: 130 mM NaCl, 24 mM NaHCO₃, 3.5 mM KCl, 1.25 mM NaH₂PO₄, 1.5 mM CaCl₂, 1.5 mM MgCl₂, and 10 mM glucose, pH 7.4) for 1 h. Astrocytes in wild-type slices were labeled with SR-101 (1 \u0026micro;M, Sigma) for 30 min prior to recordings. Whole-cell patch-clamp recordings were conducted using Axopatch 200A (Axon Instruments) with intracellular solution containing: 140 mM KCl, 10 mM HEPES, 5 mM EGTA, 2 mM Mg-ATP, and 0.2 mM Na-GTP (pH 7.4). Currents were recorded with 1 s voltage steps from \u0026minus;160 mV to +40 mV in 10 mV increments from a holding potential of \u0026minus;60 mV.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll results are expressed as mean \u0026plusmn; standard error of the mean (SEM). Statistical significance was evaluated using unpaired Student\u0026rsquo;s t-tests or one-way ANOVA followed by Tukey\u0026rsquo;s post hoc test. Significance thresholds were set as follows: n.s., not significant; *p \u0026lt; 0.05; **p \u0026lt; 0.01; ***p \u0026lt; 0.001; ****p \u0026lt; 0.0001. GraphPad Prism 9.0 (GraphPad Software) was used for data analysis.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eGeneration of AldoC BAC-GFP transgenic mice\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAldolase C (AldoC) is predominantly expressed in astrocytes and shows strong expression across multiple brain regions [12]. Owing to its regional consistency and cell-type specificity, AldoC was selected as a candidate for developing a universal astrocytic marker. Western blot analysis revealed that AldoC expression was more uniformly distributed across brain regions compared to established markers such as GFAP and GLT-1 (Fig. S1A\u0026ndash;B). Immunohistochemistry (IHC) with an anti-AldoC antibody further confirmed its broad distribution throughout the brain (Fig. S1C). These findings supported the rationale for selecting AldoC as a representative astrocytic marker.\u003c/p\u003e\n\u003cp\u003eTo visualize AldoC expression \u003cem\u003ein vivo\u003c/em\u003e, we generated AldoC BAC-GFP transgenic (Tg) mice using a modified BAC clone (RP24-353H15) containing the AldoC promoter and regulatory elements (Fig. 1A). A GFP cassette was inserted into the BAC construct, and transgenic founders were identified by PCR genotyping (Fig. 1B). PCR analysis confirmed that endogenous AldoC expression was comparable between wild-type (WT) and Tg mice (Fig. 1C), and Western blotting further validated that AldoC protein levels were unaltered in Tg mice (Fig. 1D\u0026ndash;E). Robust GFP fluorescence was observed in brain tissues from Tg mice (Fig. 1F).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eValidation of AldoC BAC-GFP expression across brain regions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIHC of sagittal brain sections revealed that GFP fluorescence in AldoC BAC-GFP mice mirrored the endogenous AldoC expression pattern and was widely distributed across brain regions (Fig. 2A). Colocalization analysis confirmed that GFP-expressing cells in the prefrontal cortex, striatum, and hippocampus co-expressed AldoC protein (Fig. 2B\u0026ndash;G). In the cerebellum, GFP fluorescence also overlapped with AldoC, as well as with calbindin, indicating expression in Purkinje cells (Fig. S2A\u0026ndash;D). Region-specific variation in GFP-positive cell density and morphology was observed. High GFP expression was found in the cortex and olfactory bulb, while lower expression was observed in the corpus callosum, superior colliculus (zonal layer), and pons. GFP-positive cells exhibited radial morphologies in the cortex and olfactory bulb, whereas linear morphologies were evident in the cerebellum and pons (Fig. S3). These results suggest that the AldoC BAC-GFP model allows for comparative analysis of astrocyte morphology and density across brain regions.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAstrocytic specificity of GFP expression in AldoC BAC-GFP mice\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo determine the cellular identity of GFP-positive cells, we assessed their colocalization with cell-type-specific markers across multiple CNS regions, including the prefrontal cortex, striatum, and CA1 region of the hippocampus (Fig. S3). GFP signals showed strong overlap with astrocytic markers such as GFAP, glutamine synthetase (GS), S100\u0026beta;, and GLT-1. In GFAP-low regions (prefrontal cortex and striatum), colocalization with GFAP was minimal (0.8% and 2.2%, respectively), whereas in CA1, a GFAP-rich region, colocalization reached 98.1% (Fig. 3A). By contrast, colocalization with GS was consistently high across all regions examined\u0026mdash;95.5% in the prefrontal cortex, 91.0% in the striatum, and 96.1% in CA1 (Fig. 3B). S100\u0026beta; and GLT-1 exhibited more variable patterns: S100\u0026beta; colocalized in 72.3% (prefrontal cortex), 51.6% (striatum), and 96.2% (CA1), while GLT-1 colocalized in 92.9%, 81.5%, and 96.6% of GFP-positive cells in the same regions (Fig. 4A\u0026ndash;B).\u003c/p\u003e\n\u003cp\u003eIn contrast, GFP-positive cells showed minimal overlap with non-astrocytic markers, including NeuN (neuron), Iba1 (microglia), and NG2 (oligodendrocyte precursor), with \u0026le;2% colocalization across all regions tested (Fig. 5A\u0026ndash;C). Co-expression of GS and NG2 or GLT-1 and NG2 was also confirmed in the hippocampus (Fig. S4A\u0026ndash;B). Together, these results demonstrate that GFP-expressing cells in AldoC BAC-GFP mice represent astrocytes with high specificity.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAstrocytic heterogeneity in the habenula\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eInterestingly, although AldoC BAC-driven GFP expression was evident in most brain regions, no detectable GFP fluorescence was observed in the medial habenula (mHb) (Fig. 1F, Fig. 2A). To further explore astrocytic heterogeneity within the habenula, we compared marker expression between the mHb and lateral habenula (lHb). Immunostaining revealed that GS and GLT-1 were more enriched in the lHb, whereas S100\u0026beta; was more prominent in the mHb (Fig. S5A\u0026ndash;F). Consistently, GFP signal was robust in the lHb but absent in the mHb (Fig. 6A\u0026ndash;B), while GFAP expression was restricted to the mHb (Fig. 6A, C). Together, these findings highlight the spatial segregation of astrocyte subtypes in the habenula, with AldoC-expressing astrocytes predominating in the lHb and GFAP-positive astrocytes localized to the mHb.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eElectrophysiological validation of GFP-positive astrocytes in AldoC BAC-GFP mice\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAstrocytes are characterized by passive, linear potassium currents that distinguish them neuronal electrical activity. To determine whether GFP-positive cells in AldoC BAC-GFP mice functionally represent astrocytes, we performed whole-cell patch-clamp recordings. Immunohistochemistry confirmed that TREK-1, a potassium channel mediating passive conductance, was expressed in 93.7% of GFP-positive hippocampal cells (Fig. 7A\u0026ndash;B) [20]. Without the use of additional dyes, GFP fluorescence reliably identified astrocytes for recording (Fig. 7C). In wild-type hippocampal slices, application of Spadin, a TREK-1 inhibitor, reduced passive conductance, confirming the functional contribution of TREK-1 (Fig. 7D) [21, 22]. Consistent with this, GFP-positive cells in AldoC BAC-GFP mice exhibited linear passive currents that were abolished upon Spadin treatment (Fig. 7D\u0026ndash;F). Together, these results demonstrate that GFP-expressing cells in AldoC BAC-GFP mice display canonical astrocytic electrophysiological properties, validating the utility of this model for functional studies.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn this study, we generated and characterized a novel BAC transgenic mouse line expressing GFP under the control of the AldoC promoter. Our findings demonstrate that AldoC BAC-GFP mice enable reliable and widespread labeling of astrocytes throughout the brain. This model overcomes several limitations of conventional astrocyte markers, such as GFAP, S100β, and GLT-1, which exhibit variable expression or lack cell-type specificity in certain brain regions.\u003c/p\u003e\u003cp\u003eAldoC has been extensively studied in the cerebellum, particularly in Purkinje cells where it displays a distinctive striped pattern [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. While this characteristic banding was observed in an isoform lobule of AldoC BAC-GFP mice, it was not apparent in the rostral cerebellum, suggesting region-specific regulatory differences. Notably, we also detected strong GFP expression in the cochlear nuclei and paraflocculus, indicating that AldoC BAC-GFP mice may have limited utility for studies requiring precise cerebellar stripe resolution, but remain informative for broader investigations of cerebellar astrocyte and Purkinje cell studies.\u003c/p\u003e\u003cp\u003eImportantly, AldoC BAC-GFP mice proved highly effective for labeling diverse astrocyte populations, including GFAP-negative astrocytes in the prefrontal cortex and striatum. The relatively low co-localization with S100β and GLT-1 in these regions further suggests the presence of astrocyte subtypes not adequately labeled by traditional markers. These results align with previous reports emphasizing the heterogeneity of astrocyte identity and density across brain regions. For example, we found that while cortical and striatal astrocyte densities were comparable, the hippocampus displayed\u0026thinsp;~\u0026thinsp;30% higher astrocyte density (data not shown). Such observations underscore the value of AldoC BAC-GFP mice for comparative analyses of regional astrocyte populations.\u003c/p\u003e\u003cp\u003eAnother strength of the AldoC BAC-GFP model is its capacity to support high-resolution morphological analyses without the need for exogenous labeling. Because BAC technology preserves endogenous regulatory elements, GFP expression is physiologically relevant and cell-type specific [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. This feature allows direct visualization of astrocyte morphology under diverse conditions, making the model well suited for studies of structural plasticity and reactive gliosis. Furthermore, GFP expression in Purkinje cells enables its application in investigation of cerebellar AldoC-expressing neuronal populations.\u003c/p\u003e\u003cp\u003eBeyond histological applications, AldoC BAC-GFP mice offer distinct advantages for functional studies. Conventional electrophysiological approaches often rely on fluorescent dyes (e.g., SR101 or OGB-1) to identify astrocytes, which can introduce technical variability or interfere with cellular physiology [\u003cspan additionalcitationids=\"CR27\" citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. In contrast, AldoC-driven GFP expression allows for the direct targeting of astrocytes in slice recordings without exogenous labeling. This was validated by our findings that GFP-positive cells exhibited characteristic linear passive conductance, which was abolished by Spadin, a known TREK-1 potassium channel inhibitor.\u003c/p\u003e\u003cp\u003eIn conclusion, the AldoC BAC-GFP transgenic mouse line represents a robust and versatile tool for astrocyte research. It enables reliable identification of astrocytes across diverse brain regions, supports both functional and morphological analyses, and provides new opportunities to investigate astrocyte heterogeneity under physiological and pathological conditions. We anticipate that this model will advance the understanding of astrocyte biology and contribute broadly to the field of glial neuroscience.\u003c/p\u003e\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\u003ch2\u003eLimitations and future perspectives\u003c/h2\u003e\u003cp\u003eDespite these advantages, several limitations should be noted. First, AldoC expression is not uniformly present in all astrocyte populations, as evidenced by the absence of GFP labeling in the medial habenula. This underscores the need to consider regional heterogeneity when interpreting data from this model. Second, AldoC is also expressed in Purkinje cells, which, while offering opportunities for cerebellar studies, may confound strictly astrocyte-specific analyses in the cerebellum. Third, as with other BAC transgenic models, potential positional effects or copy number variation could influence transgene expression, warranting careful validation in different founder lines.\u003c/p\u003e\u003cp\u003eFuture work should aim to combine the AldoC BAC-GFP line with additional genetic strategies, such as conditional reporters or intersectional labeling systems, to achieve even finer astrocyte subtype resolution. Integration with single-cell transcriptomics and spatial proteomics could further refine the identification of AldoC-positive astrocyte populations and clarify their roles in region-specific physiology and pathology. Finally, applying this model to disease contexts\u0026mdash;such as epilepsy, neurodegeneration, or psychiatric disorders\u0026mdash;may reveal new insights into astrocyte contributions to brain dysfunction.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eSupplementary information is available on BMC\u0026rsquo;s website.\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eWe would like to thank Dr. Seung-Hae Kwon (Korea Basic Science Institute) for imaging analysis. \u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eJ.K. performed the experiments for characterization of AdoC BAC-GFP Tg mice and H.Y. generated the Tg mice. S.S.K., and E.S.C. acquired electrophysiology data and the macroscopic images. S.H. and E.-M.H. performed immunohistochemical analysis. S.S. and J.-Y.P. designed and supervised the study and wrote the manuscript. All authors have read and agreed to the published version of the manuscript.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThis work was supported by the National Research Foundation (NRF) of Korea (NRF- 2022R1A2C1093143 for J.-Y. P. and the academic research program of Chungbuk National University in 2025 for S.S. \u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNo datasets were generated during the current study. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll animal experiments, including animal care, were conducted after obtaining prior approval from the Korea University Institutional Animal Care and Use Committee (approval number: KU-IACUC-2022-0024).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cbr\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eHeithoff, B.P., et al., \u003cem\u003eAstrocytes are necessary for blood-brain barrier maintenance in the adult mouse brain.\u003c/em\u003e Glia, 2021. \u003cstrong\u003e69\u003c/strong\u003e(2): p. 436-472.\u003c/li\u003e\n\u003cli\u003eBonvento, G. and J.P. Bolanos, \u003cem\u003eAstrocyte-neuron metabolic cooperation shapes brain activity.\u003c/em\u003e Cell Metab, 2021. \u003cstrong\u003e33\u003c/strong\u003e(8): p. 1546-1564.\u003c/li\u003e\n\u003cli\u003eOlsen, M.L., et al., \u003cem\u003eNew Insights on Astrocyte Ion Channels: Critical for Homeostasis and Neuron-Glia Signaling.\u003c/em\u003e J Neurosci, 2015. \u003cstrong\u003e35\u003c/strong\u003e(41): p. 13827-35.\u003c/li\u003e\n\u003cli\u003eTheparambil, S.M., G. Begum, and C.R. Rose, \u003cem\u003epH regulating mechanisms of astrocytes: A critical component in physiology and disease of the brain.\u003c/em\u003e Cell Calcium, 2024. \u003cstrong\u003e120\u003c/strong\u003e: p. 102882.\u003c/li\u003e\n\u003cli\u003eVerkhratsky, A., V. Untiet, and C.R. Rose, \u003cem\u003eIonic signalling in astroglia beyond calcium.\u003c/em\u003e J Physiol, 2020. \u003cstrong\u003e598\u003c/strong\u003e(9): p. 1655-1670.\u003c/li\u003e\n\u003cli\u003eVesce, S., P. Bezzi, and A. Volterra, \u003cem\u003eThe active role of astrocytes in synaptic transmission.\u003c/em\u003e Cell Mol Life Sci, 1999. \u003cstrong\u003e56\u003c/strong\u003e(11-12): p. 991-1000.\u003c/li\u003e\n\u003cli\u003eDallerac, G., O. Chever, and N. Rouach, \u003cem\u003eHow do astrocytes shape synaptic transmission? Insights from electrophysiology.\u003c/em\u003e Front Cell Neurosci, 2013. \u003cstrong\u003e7\u003c/strong\u003e: p. 159.\u003c/li\u003e\n\u003cli\u003eLiu, X., et al., \u003cem\u003eAstrocytes in Neural Circuits: Key Factors in Synaptic Regulation and Potential Targets for Neurodevelopmental Disorders.\u003c/em\u003e Front Mol Neurosci, 2021. \u003cstrong\u003e14\u003c/strong\u003e: p. 729273.\u003c/li\u003e\n\u003cli\u003eSquadrani, L., et al., \u003cem\u003eAstrocytes enhance plasticity response during reversal learning.\u003c/em\u003e Commun Biol, 2024. \u003cstrong\u003e7\u003c/strong\u003e(1): p. 852.\u003c/li\u003e\n\u003cli\u003eOta, Y., A.T. Zanetti, and R.M. Hallock, \u003cem\u003eThe role of astrocytes in the regulation of synaptic plasticity and memory formation.\u003c/em\u003e Neural Plast, 2013. \u003cstrong\u003e2013\u003c/strong\u003e: p. 185463.\u003c/li\u003e\n\u003cli\u003eBocchi, R., et al., \u003cem\u003eAstrocyte heterogeneity reveals region-specific astrogenesis in the white matter.\u003c/em\u003e Nat Neurosci, 2025. \u003cstrong\u003e28\u003c/strong\u003e(3): p. 457-469.\u003c/li\u003e\n\u003cli\u003eEndo, F., et al., \u003cem\u003eMolecular basis of astrocyte diversity and morphology across the CNS in health and disease.\u003c/em\u003e Science, 2022. \u003cstrong\u003e378\u003c/strong\u003e(6619): p. eadc9020.\u003c/li\u003e\n\u003cli\u003eWalz, W. and M.K. Lang, \u003cem\u003eImmunocytochemical evidence for a distinct GFAP-negative subpopulation of astrocytes in the adult rat hippocampus.\u003c/em\u003e Neurosci Lett, 1998. \u003cstrong\u003e257\u003c/strong\u003e(3): p. 127-30.\u003c/li\u003e\n\u003cli\u003eBushong, E.A., et al., \u003cem\u003eProtoplasmic astrocytes in CA1 stratum radiatum occupy separate anatomical domains.\u003c/em\u003e J Neurosci, 2002. \u003cstrong\u003e22\u003c/strong\u003e(1): p. 183-92.\u003c/li\u003e\n\u003cli\u003eZhang, Z., et al., \u003cem\u003eThe Appropriate Marker for Astrocytes: Comparing the Distribution and Expression of Three Astrocytic Markers in Different Mouse Cerebral Regions.\u003c/em\u003e Biomed Res Int, 2019. \u003cstrong\u003e2019\u003c/strong\u003e: p. 9605265.\u003c/li\u003e\n\u003cli\u003eRoltsch, E., et al., \u003cem\u003ePSAPP mice exhibit regionally selective reductions in gliosis and plaque deposition in response to S100B ablation.\u003c/em\u003e J Neuroinflammation, 2010. \u003cstrong\u003e7\u003c/strong\u003e: p. 78.\u003c/li\u003e\n\u003cli\u003eMiyake, T. and T. Kitamura, \u003cem\u003eGlutamine synthetase immunoreactivity in two types of mouse brain glial cells.\u003c/em\u003e Brain Res, 1992. \u003cstrong\u003e586\u003c/strong\u003e(1): p. 53-60.\u003c/li\u003e\n\u003cli\u003eFoo, L.C. and J.D. Dougherty, \u003cem\u003eAldh1L1 is expressed by postnatal neural stem cells in vivo.\u003c/em\u003e Glia, 2013. \u003cstrong\u003e61\u003c/strong\u003e(9): p. 1533-41.\u003c/li\u003e\n\u003cli\u003eThompson, R.J., P.A. Kynoch, and V.J. Willson, \u003cem\u003eCellular localization of aldolase C subunits in human brain.\u003c/em\u003e Brain Res, 1982. \u003cstrong\u003e232\u003c/strong\u003e(2): p. 489-93.\u003c/li\u003e\n\u003cli\u003eHwang, E.M., et al., \u003cem\u003eA disulphide-linked heterodimer of TWIK-1 and TREK-1 mediates passive conductance in astrocytes.\u003c/em\u003e Nat Commun, 2014. \u003cstrong\u003e5\u003c/strong\u003e: p. 3227.\u003c/li\u003e\n\u003cli\u003eMazella, J., et al., \u003cem\u003eSpadin, a sortilin-derived peptide, targeting rodent TREK-1 channels: a new concept in the antidepressant drug design.\u003c/em\u003e PLoS Biol, 2010. \u003cstrong\u003e8\u003c/strong\u003e(4): p. e1000355.\u003c/li\u003e\n\u003cli\u003eBae, Y., et al., \u003cem\u003eSpadin Modulates Astrocytic Passive Conductance via Inhibition of TWIK-1/TREK-1 Heterodimeric Channels.\u003c/em\u003e Int J Mol Sci, 2020. \u003cstrong\u003e21\u003c/strong\u003e(24).\u003c/li\u003e\n\u003cli\u003eFujita, H., et al., \u003cem\u003eDetailed expression pattern of aldolase C (Aldoc) in the cerebellum, retina and other areas of the CNS studied in Aldoc-Venus knock-in mice.\u003c/em\u003e PLoS One, 2014. \u003cstrong\u003e9\u003c/strong\u003e(1): p. e86679.\u003c/li\u003e\n\u003cli\u003eCai, W., et al., \u003cem\u003eHigh-resolution restriction maps of bacterial artificial chromosomes constructed by optical mapping.\u003c/em\u003e Proc Natl Acad Sci U S A, 1998. \u003cstrong\u003e95\u003c/strong\u003e(7): p. 3390-5.\u003c/li\u003e\n\u003cli\u003eSzinay, D., et al., \u003cem\u003eHigh-resolution chromosome mapping of BACs using multi-colour FISH and pooled-BAC FISH as a backbone for sequencing tomato chromosome 6.\u003c/em\u003e Plant J, 2008. \u003cstrong\u003e56\u003c/strong\u003e(4): p. 627-37.\u003c/li\u003e\n\u003cli\u003eKompier, N.F., et al., \u003cem\u003eVisualization of Gap Junction-Mediated Astrocyte Coupling in Acute Mouse Brain Slices.\u003c/em\u003e Bio Protoc, 2025. \u003cstrong\u003e15\u003c/strong\u003e(4): p. e5220.\u003c/li\u003e\n\u003cli\u003eLattarulo, C., et al., \u003cem\u003eMicroscopic imaging of intracellular calcium in live cells using lifetime-based ratiometric measurements of Oregon Green BAPTA-1.\u003c/em\u003e Methods Mol Biol, 2011. \u003cstrong\u003e793\u003c/strong\u003e: p. 377-89.\u003c/li\u003e\n\u003cli\u003eZhang, C., et al., \u003cem\u003eAstrocytic endfoot Ca(2+) correlates with parenchymal vessel responses during 4-AP induced epilepsy: An in vivo two-photon lifetime microscopy study.\u003c/em\u003e J Cereb Blood Flow Metab, 2019. \u003cstrong\u003e39\u003c/strong\u003e(2): p. 260-271.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"molecular-brain","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mbrj","sideBox":"Learn more about [Molecular Brain](http://molecularbrain.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/mbrj/default.aspx","title":"Molecular Brain","twitterHandle":"@molecularbrain","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Aldolase C, bacterial artificial chromosome transgenic mouse, green fluorescent protein, Astrocyte marker, Passive conductance","lastPublishedDoi":"10.21203/rs.3.rs-7540621/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7540621/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eAstrocytes, the most abundant glial cell type in the central nervous system (CNS), are essential for maintaining neural homeostasis and modulating synaptic function. However, commonly used astrocytic markers often display regional variability or lack strict specificity, limiting their reliability for consistently identifying astrocytes across brain regions. To address this limitation, we generated a novel transgenic mouse line (AldoC BAC-GFP) that expresses green fluorescent protein (GFP) under the control of the aldolase C (AldoC) promoter using modified bacterial artificial chromosome (BAC) technology. AldoC is an enzyme abundantly expressed in astrocytes. We confirmed that GFP-expressing cells in these mice co-express endogenous AldoC and are co-labeled with established astrocytic markers, thereby validating their astrocytic identity. Importantly, GFP expression was largely restricted to astrocytes throughout diverse brain regions. Moreover, GFP-positive astrocytes in brain slices exhibited the characteristic linear-shaped passive conductance of mature astrocytes. Collectively, these findings demonstrate that AldoC BAC-GFP transgenic mice represent a reliable and broadly applicable model for morphological and functional studies of astrocytes in the CNS.\u003c/p\u003e","manuscriptTitle":"AldoC BAC-GFP transgenic mice as a reliable model for astrocyte identification and functional studies in the brain","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-09-17 13:43:19","doi":"10.21203/rs.3.rs-7540621/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-09-23T02:25:55+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-09-22T13:19:40+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-09-21T14:19:48+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"324406051752429424803569490555184578221","date":"2025-09-12T05:57:49+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"133807571594785691381922757671344401969","date":"2025-09-11T08:28:15+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-09-11T05:20:20+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"244545539418769430995887433299447620162","date":"2025-09-11T05:11:22+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-09-10T02:19:22+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-09-08T03:02:11+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-09-08T03:01:14+00:00","index":"","fulltext":""},{"type":"submitted","content":"Molecular Brain","date":"2025-09-05T04:18:43+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"molecular-brain","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mbrj","sideBox":"Learn more about [Molecular Brain](http://molecularbrain.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/mbrj/default.aspx","title":"Molecular Brain","twitterHandle":"@molecularbrain","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"eb6c0afb-33d0-4ed3-9379-3797d665614a","owner":[],"postedDate":"September 17th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-12-08T16:04:13+00:00","versionOfRecord":{"articleIdentity":"rs-7540621","link":"https://doi.org/10.1186/s13041-025-01264-0","journal":{"identity":"molecular-brain","isVorOnly":false,"title":"Molecular Brain"},"publishedOn":"2025-12-04 15:58:20","publishedOnDateReadable":"December 4th, 2025"},"versionCreatedAt":"2025-09-17 13:43:19","video":"","vorDoi":"10.1186/s13041-025-01264-0","vorDoiUrl":"https://doi.org/10.1186/s13041-025-01264-0","workflowStages":[]},"version":"v1","identity":"rs-7540621","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7540621","identity":"rs-7540621","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.