Targeting BRD4 Ameliorates Experimental Emphysema by Disrupting Super-Enhancer in Polarized Alveolar Macrophage     

Targeting BRD4 Ameliorates Experimental Emphysema by Disrupting Super-Enhancer in Polarized Alveolar Macrophage | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Targeting BRD4 Ameliorates Experimental Emphysema by Disrupting Super-Enhancer in Polarized Alveolar Macrophage Difei Li, Xing Shi, Yuqiong Yang, Yao Deng, Dandan Chen, Shuyu Chen, and 15 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3788052/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Chronic obstructive pulmonary disease (COPD) is a progressive chronic lung disease characterized by chronic airway inflammation and emphysema. Macrophage polarization plays an important role in COPD pathogenesis by secreting inflammatory mediators. Bromodomain-containing protein 4 (BRD4), an epigenetic reader that specifically binds to histones, plays a crucial role in inflammatory diseases by regulating macrophage polarization. Herein, we attempted to examine the hypothesis that modulating alveolar macrophage polarization via BRD4 inhibitors might has a potential for COPD treatment. Methods We firstly investigated the BRD4 expression and its association with clinical parameters and macrophage polarization markers by reanalyzing the clinical cohort of sputum transcriptomes from 94 patients with COPD and 36 healthy individuals in China. In vivo , we further verified its expression in the lipopolysaccharides (LPS)/elastase-induced emphysema model. Subsequently, BRD4 inhibitor JQ1 and degrader ARV-825 were intraperitoneally administrated into emphysema mice in order to investigate their effects on lung emphysema and inflammation. In vitro , RNA-seq and CUT&Tag assay of BRD4 and acetylated histone 3 lysine 27 (H3K27ac), were applied for elucidating the underlying molecular mechanism of how BRD4 regulates macrophage polarization. Results We found an increased expression of BRD4 in the induced sputum from patients with COPD and unveiled a strong correlation between BRD4 expression and clinical parameters as well as macrophage polarization. Subsequently, the upregulation of BRD4 in macrophage was verified in the experimental emphysema model. BRD4 inhibitor JQ1 and degrader ARV-825 significantly mitigated emphysema and airway inflammation along with better protection of lung function in mice. BRD4 inhibition also suppressed both M1 and M2 alveolar macrophage polarization. The CUT&Tag assay of BRD4 and H3K27ac, revealed that BRD4 inhibition disrupted the super-enhancers (SEs) of IRF4 (a crucial transcription factor for M2 macrophage), and subsequently affected the expression of matrix metalloproteinase 12 (MMP12) which is vital for emphysema development. Conclusion This study suggested that downregulation of BRD4 might suppress airway inflammation and emphysema through disrupting the SEs of IRF4 and alveolar macrophages polarization, which might be a potential target of therapeutic intervention in COPD. chronic obstructive pulmonary disease (COPD) bromodomain-containing protein 4 (BRD4) alveolar macrophage polarization super-enhancers ARV-825 Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 1 Introduction Chronic obstructive pulmonary disease (COPD) is a progressive and lethal chronic lung disease characterized by chronic airway inflammation and emphysema [1]. An aberrant inflammatory response that involves both innate and adaptive immunity is critical to the development of COPD. A variety of immune cells, including macrophages, neutrophils, and T lymphocytes, are involved in the pathogenesis of COPD [2]. Among all, alveolar macrophages (AMs) are abundantly found in patients with COPD and play essential roles in the inflammation and airway remodeling of this disease [3]. Macrophages are the most plastic immune cells present in all tissues and can be commonly polarized into classically activated (also called M1) macrophages and alternatively activated (also called M2) macrophages [4]. M1 polarized macrophages are stimulated by interferon-γ (IFN-γ) and toll-like receptor (TLR) ligands, which are recognized for their ability to elicit the production of cytokines such as IL-6, IL-1β, and TNF-α, and play an essential role in Th1-type immune responses. M2 macrophages are generated by the stimulation of T-helper 2 (Th2) cytokine IL-4 or IL-13, and secrete anti‐inflammatory cytokines (e.g., IL-10, TGF-β) and chemokines (e.g., CCL17, CCL22) to participate in Th2-type immune responses [5]. In the context of COPD, AMs are cells of the innate immune system and represent a vital component of the first-line body defense against pathogens and inhaled particles[6]. On one hand, AMs exposed to cigarette smoke or microbes can polarize into M1 subtype and secrete the pro-inflammatory cytokines and chemokines, thereby play a crucial role in initiating the pro-inflammatory response[7; 8]. On the other hand, AMs adapt to M2 states to release active mediators likewise matrix metalloproteinases 12 (MMP12) which have been recognized as a key factor in causing emphysema [9; 10; 11]. Therefore, both types of macrophages are vital to the pathogenesis of COPD [12]. As such, it was widely believed that regulating the AMs polarization holds significant promise for advancing COPD therapy. Notably, clinical cohort studies offer a powerful tool for discovering potential therapeutic targets. In China, a cohort of sputum transcriptomes was previously created, consisting of 94 patients diagnosed with COPD and 36 persons who were deemed healthy[13] and found that the transcriptional level of bromodomain containing protein 4 (BRD4) is significantly associated with clinical parameters and macrophage polarization. Hence, this observation suggests that it possesses the potential to serve as a therapeutic target for COPD. Numerous human diseases have been closely linked to aberrant epigenetic regulation [14]. BRD4 is the best-characterized member of the bromodomain and extra-terminal (BET) protein family and is an epigenetic reader of acetylated lysine residues to regulate the transcription of genes and chromatin landscape. It usually acts as a scaffold for transcription factors and localizes at gene promoters and enhancers [15]. In addition, BRD4 plays a crucial role in the organization of super-enhancers (SEs), which are critical in driving the high-level transcription of specific genes and are typically identified based on strong enrichment of H3K27ac [16]. Due to the vital role of BRD4 in various disease progression, including carcinomas, inflammatory diseases, fibrosis, and vascular diseases, several BRD4 inhibitors, such as JQ1, have been developed for disease intervention [17; 18; 19; 20]. In recent years, BRD4 degraders like ARV-825 were also developed based on the proteolytic targeting chimera (PROTAC) technology and were tested for many disease treatments [21; 22]. Although BRD4 plays a critical role in regulating both M1 and M2 macrophage polarization, they have been reported to be effective in the treatment of tumors by modulating the function of tumor-associated macrophage [23; 24; 25]. However, little is known whether targeting BRD4 affects the AMs polarization and the therapeutic consequence for COPD. As such, we hypothesized that modulating macrophage polarization via BRD4 inhibitors is a potential therapeutic approach for COPD. 2 Material and Methods 2.1 Patient cohorts and samples This study utilizes human airway transcriptomic data from two separate cohorts of individuals with COPD in different cities in China. Specifically, the discovery cohort consisted of 70 patients with stable COPD and 18 healthy controls, from whom induced sputum samples were collected at the First Affiliated Hospital of Guangzhou Medical University in Guangzhou. The validation cohort included 24 patients with stable COPD and 18 healthy controls, from whom induced sputum samples were obtained at Shenzhen People's Hospital in Shenzhen. The inclusion and exclusion criteria were described in previous study[13]. The study was approved by the ethics committee of two centers (reference no. 2017-22 and KY-LL-2020294-01). The inclusion criteria for patients with COPD consisted of being over the age of 40 and having a confirmed diagnosis of COPD based on the GOLD guideline. Specifically, a post-bronchodilator forced expiratory volume in 1 s (FEV1)/forced vital capacity ratio < 0.7. The exclusion criteria were: (1) a diagnosis of known respiratory disorders other than COPD; (2) COPD exacerbation within 4 weeks of enrolment; (3) history of lung surgery and tuberculosis; (4) diagnosis of cancer; (5) blood transfusion within 4 weeks of enrolment; (6) diagnosis of autoimmune diseases; (7) enrolment in a blinded drug trial; and (8) antibiotic usage within 4 weeks of enrolment. All participants provided written informed consent. The chest CT data in Guangzhou cohort and Shenzhen cohort were imported separately into workstations of the VIDA software (version 2.2, Apollo; VIDA Diagnostics, Coralville, IA, USA) and NeuLungCare-QA (version 1.0, Neusoft Medical Systems Co., Ltd. Shenyang, Liaoning, China) to automatically analyze the extent of emphysema (LAA950%). 2.2 Murine model To establish an emphysema model, male Bagg Albino (BALB/c) mice, aged 6 weeks and weighing 25–30 g, were procured from Gem Phamatech Co., Ltd., located in Guangdong, China. C57 black 6 (C57BL/6) mice weighing between 25-30g were procured from Gem Phamatech Co., Ltd., Guangdong, China, for the purpose of conducting cellular analysis. In order to mitigate agonistic behavior and prevent the occurrence of diseases, appropriate measures were implemented for the care of animals. Specifically, all mice were accommodated in a pathogen-free animal facility, where they were housed in isolated cages that provided sufficient ventilation. Additionally, a 12-hour light/dark cycle was maintained, and the mice were given unrestricted access to food and water. It is important to note that all experiments conducted in this study were approved by the Animal Subjects Committee of Shenzhen People's Hospital (AUP-220714-CRC-0599-01). 2.3 Establishment of a model with emphysema The BALB/c mice were administered intratracheal instillation of a mixture containing 7 ug LPS purified from Escherichia coli O26:B6 (Sigma-Aldrich, St. Gallen, Switzerland) and 1.8 U of porcine pancreatic elastase (Elastin Products Company, Owensville, MO) in 50-µL PBS for a total of four times. Following each exposure to LPS/elastase, subgroups of mice were intraperitoneally injected with either the BRD4 inhibitor JQ1 (50 mg/kg), the BRD4 degrader ARV-825 (10 and 20 mg/kg), or a control Vehicle on days 14, 17, 21, 24, 28, and 31 [26]. 2.4 Lung histopathology The left lungs of all mice were aseptically collected and subsequently fixed in 4% paraformaldehyde overnight. The following day, the lung tissues were embedded in paraffin and sectioned into 4-um thickness. These lung sections were then stained with H&E to facilitate the observation of histological changes. The degree of peri-bronchial inflammation was assessed using a scoring standard ranging from 0 to 4, as previously described [27]. In this scoring system, a score of 0 indicates the absence of inflammatory cells, while scores of 1, 2, 3, and 4 represent the presence of occasional, one layer, two layers, and more than two layers of inflammatory cells around the bronchi, respectively. 2.5 Lung function analysis in the emphysema model mice The Forced Pulmonary Maneuver System (Buxco Research Systems, Wilmington, North Carolina, USA) was employed in accordance with the manufacturer's guidelines to assess fluctuations in lung function. The respiratory rate of anesthetized mice was standardized to an average of 150 breaths per minute. The study involved the execution of three semiautomatic maneuvers: (a) Boyle's law functional residual capacity (FRC), (b) quasi-static pressure volume (PV), and (c) fast flow volume (FV). The quasi-static PV maneuver was conducted to assess total lung capacity (TLC) and chord compliance (Cchord). Additionally, the fast FV maneuver was employed to measure forced expiration volumes (FEV50, FEV100, FEV200, and FEV300) in milliseconds, as well as forced vital capacity (FVC). 2.6 Bronchoalveolar lavage fluid (BALF) analysis Following the extraction of blood, the trachea and right lung were subjected to in-situ lavage using a prewarmed sterile solution of 0.9% NaCl saline, with a volume of 0.5 mL. The fluid obtained from this procedure was then examined to determine the total cell count in the bronchoalveolar lavage fluid (BALF) and utilized for the preparation of cyto-spin samples. The enumeration of total inflammatory cells, macrophages, neutrophils, and lymphocytes in the BALF was conducted using a hemacytometer. 2.7 Protein extraction from lung tissues and western blotting Total protein was extracted from lung homogenates and the protein concentration was determined using a BCA Protein Assay kit (Thermofisher, USA). Cell lysis was performed at a temperature of 100°C for a duration of 10 minutes, followed by the loading of 20-µg of protein into a 10% SDS-PAGE gel. Subsequently, the protein was transferred onto a PVDF membrane (Merck Millipore, Bedford, MA, USA) and incubated overnight at 4°C with antibodies against BRD4 (1:1000; A301985A100, Thermo-fisher, USA) and β-actin (1:3000; AB2001, AB Ways). The next day, following three rounds of washing with PBST, the samples underwent incubation with anti-rabbit-IgG horseradish peroxidase-conjugated secondary antibodies (CST, USA). Subsequently, the signals were detected through enhanced chemiluminescence (Merck Millipore, Bedford, MA, USA) and recorded using a Chemi Doc™ MP Imager (Bio-Rad, USA). The Image J program was utilized to measure the integral optical density of each sample. 2.8 Immunofluorescence staining The lung sections were subjected to overnight incubation at 4°C with antibodies against CD68 (GB113109, Servicebio) and BRD4 (AB 128874, Abcam). Subsequently, the lung sections were exposed to a fluorescein isothiocyanate-labeled secondary antibody (GB22303, Servicebio) at room temperature for a duration of 1 hour. Furthermore, DAPI (G1012, Servicebio) was employed for nuclear staining, and anti-fluorescence quenching sealer (G1401, Servicebio) was administered. The visualization of staining was carried out using an inverted fluorescence microscope (Servicebio). 2.9 Isolation and culturing of alveolar macrophages The mice underwent tracheal lavage with 1 ml of PBS seven times to obtain BALF. BALF cells were isolated by centrifugation at 1500 rpm for 10 minutes and subsequently washed with PBS. To promote cell adherence, 12-well plates were utilized, with each well containing 3×10 5 cells, and were incubated for 12 hours. Following incubation, the plates were washed twice with PBS to eliminate non-adherent cells. The adhered cells were cultured overnight in a solution containing 20 ng/mL IFN-γ (C746, Novo protein) and 1 mg/mL LPS (Sigma-Aldrich, St. Louis, MO, USA) to induce M1 polarization. Additionally, 20 ng/mL interleukin-4 (CK15, Novo protein) was used to induce M2 polarization. The M1 and M2 macrophages were subsequently harvested for quantitative PCR analysis, while the supernatant was collected for ELISA. 2.10 RNA extraction for qPCR analysis and RNA-Seq followed analysis Induced sputum samples were collected and preformed with good quality control as previously described[13]. Transcriptomic data from sputum cells for RNA-sequencing were obtained by using the Illumina NovaSeq platform. The normalized gene count matrix was used to next transcriptomic analysis as described[13]. For a full set of transcriptomic data see the previous report[13]. Differentially expressed genes (DEGs) data from sputum cells analysis was performed using limma in R vegan package, among genes in BET protein family, MMP12 and IRF4 . Genes in BET protein family consists of BRD1 , BRD2 , BRD3 , BRD4 , BRD7 , BRD8 , BRD9 . Sets of M1 and M2 genes were based on selected classic genes in human expression publications. M1 markers includes 18 genes ( NOS2 , IL1A , IL1B , IL6 , IL12B , TNF , CXCL1 , IL1F9 , CXCL2 , CXCL9 , CXCL10 , CCL2 , IRF5 , IRF7 , IRF9 , STAT1 , P65 , SPI1 ). M2 markers includes 12 genes ( ARG1 , MRC1 , STAT6 , IRF4 , MMP12 , ADAM8 , ADAM9 , IL10 , CCL17 , CCL22 , TGFB1 , TFRC ). Gene Set Variation Analysis (GSVA) was used to calculate the enrichment score (ES) for each patient and for gene signatures of macrophages and neutrophils. ES values range from − 1 to 1. A linear model for transcriptomic data with Benjamini-Hochberg false discovery rate (FDR) correction was used in the analysis of the DEGs and for GSVA. Spearman Correlation between genes and genes, genes and clinical parameters, genes and ES were calculated. In order to perform cells and animal model qPCR analysis, total RNA was extracted from AMs using a UNIQ-10 Column Total RNA extraction Kit (IA24KA6842, Sangon Biotech, China). RNA isolation from lung homogenates of LPS/elastase-induced COPD model was performed using the Spin Column Animal Total RNA Purification Kit (HA14KA1972, Sangon Biotech, China). gDNA was removed, and total RNA was reverse transcribed into cDNA using PrimeScript™ RT reagent Kit supplemented with gDNA Eraser (RR047A, TAKARA, China). qPCR was performed using TB Green® Premix Ex Taq™ II (Tli RNase H Plus) (RR820A, TAKAR, China) on a CFX Connect™ Real-Time PCR system (BIO-RAD, USA). The sequences of primers used were shown in (Table 1 ). Table 1 Primers used in the studies Mouse primers Primer sequence 5’-3’ mouse Actb F GGGCACGAAGGCTCATCATT mouse Actb R AGCGAGCATCCCCCAAAGTT mouse Nos2 F CCTGTGAGACCTTTGATG mouse Nos2 R CCTATATTGCTGTGGCTC mouse Tnf F CACCACGCTCTTCTGTCT mouse Tnf R GGCTACAGGCTTGTCACTC mouse Il1b F CAACCAACAAGTGATATTCTCCATG mouse Il1b R GATCCACACTCTCCAGCTGCA mouse Arg1 F GGAACCCAGAGAGAGCATGA mouse Arg1 R TTTTTCCAGCAGACCAGCTT mouse Ccl17 F TTGTGTTCGCCTGTAGTGCATA mouse Ccl17 R CAGGAAGTTGGTGAGCTGGTATA mouse Tfrc F ATGCCGACAATAACATGAAGGC mouse Tfrc R ACACGCTTACAATAGCCCAGG mouse Irf4 F AAAGGCAAGTTCCGAGAAGGG mouse Irf4 R CTCGACCAATTCCTCAAAGTCA mouse Mmp12 F CGGAGGGAACAGGTTGATGA mouse Mmp12 R TCTGCTGGGAACCTTCAGC Total amounts and integrity of RNA from cells were assessed using the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA). The RNA-Seq library was prepared using NEBNext Ultra RNA Library Prep Kit for Illumina (NEB, USA). After the construction of the library, 150bp×2 paired-end sequences were generated using the Illumina NovaSeq 6000 system at Novogene, Shenzhen. For the RNA-seq analysis, raw reads were removed with the help of Trimmomatic v0.39 [28], and aligned to the mm10 mouse genome by Bowtie2 v2.2.5 [29]. Duplicate sequences were removed using MarkDuplicates v3.0.0 from Picard software ( http://broadinstitute.github.io/picard/ ). Gene expression level was quantified by Salmon v0.12[30] followed by normalization using trimmed mean of M-values (TMM) method in edgeR v3.32.1[31]. DEGs analysis among all groups was performed using edgeR's glmQLFTest. Significant DEGs were identified using a fold change > 1.5 and FDR < 0.05. Further, Gene Ontology and gene set enrichment analyses were performed using clusterProfiler v3.18.15[32] and GSEApy v0.10.46 [33], respectively, to investigate the biological functions of DEGs. Heatmaps were generated with the help of ComplexHeatmap v2.6.27 to visualize the expression level of DEGs. 2.11 Cleavage Under Target & Tagmentation (CUT & Tag)-seq assay CUT & Tag-seq assay were performed by using NovoNGS® CUT&Tag® 4.0 High-Sensitivity Kit (for Illumina®) (N259-YH01-01B, Suzhou, China). Alveolar macrophages were bound by ConA-magnetic beads and were resuspended in primary antibody buffer (containing protease inhibitor cocktail, 5% digitonin and primary antibody BRD4 (1:100; A301985A100, Thermo-fisher, USA) overnight at 4°C. After washing, alveolar macrophages were incubated with a secondary antibody (1:200) at room temperature for 1 hour. After washing again, alveolar macrophages were incubated with transposome buffer at room temperature for 1 hour and tagmentation buffer at 37°C for 1 hour respectively. And termination of tagmentation was performed by adding stop buffer at 50°C for 10 minutes. Finally, DNA fragments were extracted by adding Tagment DNA extract beads. Amplified and cleaned DNA fragments were used for sequencing at the Illumina platform. 2.12 CUT&Tag Sequencing data analysis Raw reads were trimmed and aligned to mm10 mouse genome as aforementioned mentioned. SEACR peak caller v1.3 with default parameters was employed to identify the binding peaks of BRD4 and H3K27ac [34]. Differential peaks between groups were caculated using DiffBind v3.8.4 [35], and the genomic region and genes around peaks were annotated by ChIPseeker v1.34.1[36]. The coverage of reads for each genome bin of 50 bp was quantified and standardized to counts per million (CPM) using bamCoverage function of deepTools v3.5.1 [37]. Further, R v4.1.0 was employed to construct heatmaps enriched around transcription start sites (TSS), and visualized using EnrichedHeatmap v1.28.1[38]. A binding density plot of gene body and enhancer regions was generated using ngsplot v2.61[39]. The identification of super-enhancers (SEs) was carried out by initially combining H3K27ac and BRD4 binding peaks with the help of mergeBed [40]. Following this, the ROSE algorithm was employed to compute enriched H3K27ac signals within 12.5 kb windows surrounding the merged binding sites. By ranking these stitched enhancer regions based on the H3K27ac signal, SEs were identified, and associated target genes were annotated[41]. Genomic signal tracks of desired genes were visualized in IGV browser v2.15.4[42]. 2.13 Overexpression experiment Primary AMs were isolated from mice. The cells were cultured in antibiotic-free growth medium supplemented with 10% fetal bovine serum (FBS) (BioWest). All cells were cultured in a humidified incubator containing 5% CO2 at 37°C. For gene overexpression, the full-length mouse Irf4 sequence was cloned into a pReceiver-M02 Expression Clone (GeneCopoeia) which were transfected into cells using Lipofectamine 3000 reagents and Opti-MEM (Thermofisher) reagents. 2.14 Statistical Analysis Data were tested for normal distribution and homogeneity of variance. Differences were assessed with t test between 2 groups, and one-way analysis of variance (ANOVA) accompanied by Bonferroni’s difference post hoc test for ≥ 3 groups. Data are presented as mean ± SEM. p < 0.05 was regarded as statistically significant. 3 Results 3.1 BRD4 was associated with key clinical events during COPD progression To identify the clinically relevant genes and pathways involved in COPD development, induced sputum was collected from 94 patients with COPD and 36 healthy controls for mRNA sequencing characterization [13]. Notably, BET family proteins mediated epigenetic regulation were known for their critical role in the pathogenesis of various inflammatory diseases [19; 43] and the differential expression of BRD1 , BRD2 , BRD3 , BRD4 , BRD7 , BRD8 , BRD9 in patients with COPD and healthy controls were analyzed. In this study, it was shown that the expression levels of BRD4 were significantly increased in the sputum samples obtained from patients with COPD compared to the healthy control group in the Guangzhou cohort. These findings were subsequently confirmed in the Shenzhen cohort as well (Fig. 1 A). We demonstrated that BRD4 exhibited stronger correlations with clinical indicators in comparison other genes within the same family (Fig. 1 B). Specifically, an upregulation of BRD4 was associated with poorer lung function (negative correlation with post-bronchodilator forced expiratory volume in one second (FEV1) (% reference), r=-0.49%, p < 0.001), more severe dyspnea symptoms (positive correlation with modified Medical Research Council (mMRC), r = 0.31, p < 0.05), a higher degree of pulmonary emphysema (positive correlation with LAA950%, r = 0.39, p < 0.005) in Guangzhou cohort and validated in Shenzhen cohort (Fig. 1 C). Meanwhile BRD4 displayed a negative correlation with Body Mass Index (BMI) and positive correlations with acute exacerbation frequency in the past one year, and these trends were subsequently validated in the Shenzhen cohort (Fig. 1 B). Collectively, BRD4 exhibited stronger associations with clinical parameters. Of note, COPD is a chronic inflammatory lung disease that involves a variety of immune cells, including macrophages, neutrophils, and lymphocytes.[2] It has been previously found that induced sputum comprises a great amount of innate immune cells like macrophages and neutrophils with few parenchymal pulmonary cells. GSVA was used to calculate the ES of macrophage and neutrophil for each patient based on the specific gene expression. We observed that BRD4 expression significantly positively correlated with macrophage ES and neutrophil ES both in Guangzhou cohort and Shenzhen cohort (Fig. 1 D, Figure S1 A, Figure S1 B). In order to further validate the result in vivo, we established the elastase dosage dependent mouse model of emphysema using 0.7 ug LPS and 0 U, 0.6 U, 1.2 U, 1.8 U, 2.4 U, 3.0 U elastase intratracheal treatment for 4 weeks. Terminal readout was carried out one week after the last challenge. Using pulmonary function tests, initially, it was observed that 1.8 U elastase significantly change FEV100/FVC (%) in mice with LPS + elastase-induced emphysema (Figure S2 A), whereas 1.2 U elastase induced significantly change on functional residual capacity (FRC) (Figure S2 A). The number of inflammatory cells in BALF are upregulated even treatment with 0.6 U elastase (Figure S2 B). Hemotoxylin and eosin (H&E) staining showed that 0.6 U elastase markedly increased lung inflammation in the vicinity of small airways and alveoli calculated according to inflammation score, and 1.2 U elastase treatment significantly expanded alveolar spaces in emphysema mice, which were validated by the statistical analysis of histological slides by calculating mean linear intercept (MLI) (Figure S2 C, Figure S2 D). In summary, we select 1.8 U elastase as the best amount to induce emphysema animal model. Subsequentially, the upregulation of BRD4 protein expression in lipopolysaccharide (LPS) + elastase-induced experimental emphysema model was verified (Fig. 1 E, 1 F). The immunofluorescence staining assay showed that BRD4 co-localized with macrophage-specific marker CD68 in lung tissues and displayed increased expression in emphysema mice compared with control mice (Fig. 1 G). Collectively, these clinical results suggested a potential role of BRD4 in COPD development by regulating macrophage function. 3.2 BRD4 targeting alleviated experimental emphysema To evaluate the potential of BRD4 as a therapeutic target for COPD, the BRD4 inhibitor JQ1 (at a dosage of 50 mg/kg) and the degrader ARV-825 (at dosages of 10 and 20 mg/kg) were intraperitoneally administered into mice with induced emphysema. This administration occurred twice a week for four consecutive weeks, commencing one week after the initiation of LPS + elastase treatment. Using pulmonary function tests, initially, it was observed that ARV-825 significantly improved FEV100/FVC (%) and suppressed FRC in mice with LPS + elastase-induced emphysema (Fig. 2 A), whereas no effect was observed on TLC. To investigate the impact of BRD4 inhibition on immune responses relevant to emphysema, the number of inflammatory cells in BALF was counted. It was found that treatment of JQ1 and ARV-825 significantly inhibited the infiltration of macrophages, neutrophils, and lymphocytes in BALF (Fig. 2 B). Subsequently, H&E staining demonstrated that targeting BRD4 markedly alleviated lung inflammation in the vicinity of small airways and alveoli, and accompanied with reduction of the expanded alveolar spaces in emphysema mice, which were further validated by the statistical analysis of histological slides (Fig. 2 C). It has been shown that the parameters of inflammation score and MLI were reduced by treatment of JQ1 and ARV-825 in emphysema mice (Fig. 2 D, 2 E). In summary, these results strongly indicate that targeting BRD4 holds significant therapeutic potential for emphysema treatment. 3.3 BRD4 inhibition suppress both M1 and M2 alveolar macrophage polarization As shown above, both the COPD cohort and experimental model showed that BRD4 expression displayed a significant association with macrophages during COPD development. Notably, both M1 and M2 macrophage polarization have been reported to be important to COPD development at different stages [44; 45]. As such, the effect of BRD4 targeting on macrophage polarization was further investigated, we found that BRD4 expression were significantly positively correlated with M1 polarization markers ( IL1A , IL1B , IL6 , TNF , IL12B , IL36G , CXCL1 , CXCL2 , RELA , SPI1 , IRF7 , and IRF9 ) in Guangzhou cohort, and these trends were partially validated in the Shenzhen cohort (Fig. 3 A). Subsequently, it was shown that the targeting BRD4 with JQ1 and ARV-825 resulted in a significant decrease in the mRNA expression of Tnf and Il1b in lung tissue, as well as a reduction in the release of IL-6 in BALF in the emphysema mice model (Fig. 3 B). To further investigate if BRD4 inhibition can block the M1 AMs polarization, the primary AMs were isolated for M1 polarization in vitro by stimulating with LPS/IFN-γ for 24h while pretreatment was done with JQ1, ZL0420, and ARV-825 2h in advance for BRD4 inhibition. The application of RNA-seq analysis revealed that the inhibition of BRD4 using all three drugs resulted in significant suppression of genes associated with M1 polarization, as demonstrated by the heatmap representation (Fig. 3 C) of gene expression levels, including Il1a , Il1b , Il6 , Tnf , nitric oxide synthase 2 ( Nos2 ), and prostaglandin-endoperoxide synthase 2 ( PtgS2 ) (Table S1 ). Venn diagram analysis revealed that 55.68% (1108/1990) of M1 macrophage-specific genes were downregulated under the effect of three different drugs (Fig. 3 D). In particular, 657 genes were down-regulated by all three drugs (Fig. 3 D). Further, GSEA revealed a significant enrichment of M1 macrophage-specific genes among those that ARV-825 downregulated (normalized enrichment score (NES) = -1.554, p < 0.001) (Fig. 3 E). The results of the Gene Ontology (GO) enrichment analysis indicated that the downregulation of M1 macrophage-specific genes caused by ARV-825 primarily affects processes related to the positive regulation of cytokine production, cytokine-mediated signaling pathway, regulation of immune effector process, leukocyte migration, responses to LPS, and regulation of inflammatory response, among others (Fig. 3 F). Heatmap analysis displayed a group of downregulated genes mediated by all three drugs, which mainly enriched in pathways of positive regulation of cytokine production, specifically IL-6 production (Fig. 3 G). Finally, the verification of BRD4 inhibition-induced suppression of M1 macrophage-specific markers, including Tnf , Il1b , and Nos2 , was conducted using quantitative polymerase chain reaction (qPCR) analysis (Fig. 3 H). Next, the functional role of BRD4 during the M2 macrophage polarization was analyzed in COPD patients. As shown in the heatmap, BRD4 expressions were positively correlated with M2 markers in the Guangzhou cohort ( ADAM8 , STAT6 , TGFB , ARG1 , and IL10 ) and the Shenzhen cohort ( CCL22 , ARG1 , IL10 , ADAM8 , STAT6 , IRF4 and TGFB ) (Fig. 4 A). Subsequently, it was observed that BRD4 targeting with JQ1 and ARV-825 markedly decreased the mRNA expression of Arg1 , Ccl17 and Tfrc in lung tissue from the emphysema mouse (Fig. 4 B). Further, we investigated the effect of inhibition of BRD4 targeting on transcriptional changes in IL-4 induced M2 AMs using JQ1, ARV-825, and ZL0420. In total, 595 genes were upregulated in M2 macrophages, and the majority of these genes were suppressed by all three drugs (Table S2 ). Among these upregulated genes, marker genes of M2 macrophage, including Arg1 , Il1r1 , Ccr5 , Sema4b , Ccl17 , and Cish were all included (Fig. 4 C). Venn diagram analysis revealed that 75.75% (421/595) of M2 macrophage-specific genes were downregulated under the effect of three different drugs (Fig. 4 D). In particular, 281 genes were down-regulated by all three drugs (Fig. 4 D). Further, GSEA revealed that M2 macrophage-specific genes were significantly enriched among those downregulated by ARV-825 (NES = -1.418, p < 0.001; Fig. 4 E). The GO enrichment analysis revealed that the genes particular to M2 macrophages, which were downregulated by the influence of ARV-825, had a strong enrichment in immunological functions and remodeling processes. These processes encompassed myeloid leukocyte differentiation, leukocyte chemotaxis, and extracellular matrix organization (Fig. 4 F, 4 G). Lastly, all three anti-BRD4 drugs induced downregulation of M2 macrophage-specific markers such as Arg1 and Ccl17 were significantly downregulated by all three anti-BRD4 drugs (Fig. 4 H). These results collectively indicated that BRD4 expression was strongly associated with both M1 and M2 macrophage polarization in clinical cohort and experimental COPD animal model, and its inhibition is potent enough to suppress both M1 and M2 AMs polarization in vitro . 3.4 BRD4 regulates chromatin expression of M2 polarization-related genes by binding at promoter regions Previous studies have already figured out that BRD4 promotes M1 macrophage polarization-related inflammatory response by facilitating the NF-κB pathway[46; 47]. However, there has been limited research on the role of BRD4 in promoting M2 AMs polarization. Therefore, the subsequent inquiry aimed to clarify the molecular mechanism by which BRD4 influences the polarization of M2 AMs, which contributing to the development of COPD. The interaction between BRD4 and H3K27ac occurs through competitive binding mechanisms, enabling BRD4 to act as a scaffold for transcription factors (TFs) at both promoters and enhancers, therefore modulating the levels of gene expression [48]. A comprehensive analysis was conducted to examine the occupancy of BRD4/H3K27ac throughout the whole genome in M2 macrophages. The study conducted CUT&Tag analysis on IL-4-driven M2 AMs that were treated with or without ARV-825 in vitro . This analysis involved the use of BRD4 and H3K27ac antibodies. In total, 38,800 peaks of BRD4 and 38,610 peaks of H3K27ac were obtained in M2 macrophages; among those, 96.4% of peaks were overlapped, which was slightly higher as in M0 (Fig. 5 A). Peaks were widely distributed across the genome, including promoter, introns, and distal intergenic regions. Originally, around 25% of BRD4 and H3K27ac peaks were specifically located in the promoter region (≤ 1kb), which were decreased to < 20% upon treatment with ARV-825 (Fig. 5 B). Notably, a significant decrease in BRD4 and H3k27ac binding was observed in the nearby transcription start site (TSS) (Fig. 5 C, D). In conclusion, the degradation of BRD4 resulted in the downregulation of genes involved in M2 macrophage polarizations by diminishing the co-binding of BRD4 and H3K27ac to the promoter. 3.5 BRD4 inhibition changes the dynamic enhancer epigenome in M2 macrophage To further investigate the regulatory mechanisms underlying the effect of BRD4 inhibition over dynamic enhancer epigenome in M2 macrophages, genome-wide binding dynamics of BRD4 and H3K27ac were explored. In total, 24071 BRD4-associated genes and 20587 H3K27ac-associated genes were annotated. Among all, 86.89% (517/595) M2-specific genes were co-occupied with BRD4 and H3K27ac and only 5.04% (30/595) M2-specific genes were not associated with BRD4 and H3K27ac (Fig. 6 A). Moreover, genes exhibiting reduced BRD4 binding demonstrated a significantly greater fold change decrease compared to other genes after ARV-825 treatment (Fig. 6 B). This suggests that genes directly regulated by BRD4 experience the most potent regulatory effect. GSEA was conducted to examine the downregulated genes affected by ARV-825, which indicated significant enrichment of genes associated with the lower peaks of BRD4 and H3K27ac (Fig. 6 C). BRD4 and H3K27ac-associated ARV-825 downregulated genes were primarily enriched in pathways related to immune response activation, regulation of immune response through cell surface receptors, signaling pathways mediated by cell surface receptors, leukocyte migration, positive regulation of innate immune response, regulation of DNA-binding transcription factor activity, myeloid leukocyte migration, and innate immune response activation pathways, etc. (Fig. 6 D). In M2 AMs treated with ARV-825, CUT&Tag and RNA-seq analysis revealed genomic binding events of BRD4 and H3K27ac, and quantified gene expression levels in the whole genome. The data presented pertains to the gene loci associated with marker genes for M2 macrophage polarization, including Arg1 , Ccl22 , Ccr5 , and Ccl17 (Fig. 6 E). These results suggest that BRD4 degraders might disrupt the enhancers of specific genes to regulate the polarization of macrophages. 3.6 BRD4 inhibition disrupted IRF4 super-enhancer formation in M2 alveolar macrophages SEs, which regulate gene expression involved in multiple cellular processes including macrophage-associated immune responses, have broadly been identified as genomic regions with top-ranked enrichment(s) of H3K27ac and BRD4 [49]. To elucidate whether SEs are critical to the M2 AMs polarization, SEs were identified in M0, M2, and M2 macrophages treated with ARV-825 by analyzing BRD4 and H3K27ac CUT&Tag data with the help of the ROSE algorithm (Fig. 7 A). The 952 M2 and 829 M2/ARV-825 associated SEs were identified. The findings of this study demonstrate considerable modifications in H3K27ac and BRD4 binding patterns at many SEs during polarization of M2 cells. These alterations are significantly reversed by the administration of ARV-825, particularly at the SEs associated with Irf4 enhancer sites (Fig. 7 B). This data uncovered a mechanism where the expression of Irf4 is increased in M2 due to the combined binding of BRD4 and H3K27ac to its SE site, while also being suppressed by ARV-825 interventions (Fig. 7 C, D; Figure S3A). The binding sites of IRF4 were significantly overlapped with those of BRD4 and H3K27ac, and the binding capacity of IRF4 to BRD4 and H3K27ac peaks was significantly decreased following drug intervention (Fig. 7 E, F; Figure S4A). As a result, the ability to bind to key downstream targets is diminished, leading to a significant decrease in Mmp12 which is linked with emphysema during COPD (Fig. 7 G) [50]. The further functional rescue experiment showed that over-expression of Irf4 in the ARV-825-treated M2 AMs can partially recover the BRD4 inhibition mediated suppression of Mmp12 (Fig. 7 H). In addition, it was observed that BRD4 targeting with JQ1 and ARV-825 markedly decreased both the mRNA expression of Irf4 and Mmp12 in lung tissue in the emphysema mouse (Fig. 7 I). Moreover, the clinical cohort analysis from both Guangzhou and Shenzhen showed that the expression of both IRF4 and MMP12 was elevated in COPD patients compared to healthy control, and the expression of IRF4 was significantly positively correlated with MMP12 in both cohorts (Fig. 7 J, Fig. 7 K). These results suggest that disruption of SE by BRD4 degraders inhibits key gene expression involved in M2 polarization and emphysema. 4 Discussion The present study delves into the pivotal role of BRD4 within the immune system, elucidating their vital contribution to the pathogenesis of chronic airway inflammatory diseases, particularly in the context of emphysema. A significant increase in the expression of BRD4 has been seen in the produced sputum of patients with COPD, as well as in the macrophages of mice in the experimental model of emphysema. Additionally, through analysis of RNA-seq data from two separate clinical cohorts in China, it was found that the expression of BRD4 was strongly correlated with both clinical parameters and the expression of macrophage polarization markers. Crucially, the present findings provided compelling evidence that targeting BRD4 using JQ1 and ARV-825 yields substantial therapeutic benefits, including improved lung function, alleviation of lung inflammatory responses, reduction of air space enlargement in the experimental emphysema model, achieved through the inhibition of both M1 and M2 alveolar polarization. In particular, the current research elucidated the regulatory mechanism of BRD4 inhibition mediated suppression of M2 AMs polarization, which at least partially involved the disruption of the SEs of Irf4 , and thereby further impacted the expression of Mmp12 , a vital pathogenic gene of emphysema. The aforementioned findings indicate that the epigenetic machinery of BETs in AMs has promise as a viable target for therapeutic interventions in COPD. Initially, the BET family proteins were analyzed in clinical cohort RNA-seq data, the present study revealed a notable upregulation of BRD4 in the Guangzhou cohort, which also exhibited a statistically significant rise in the Shenzhen cohort. Further analysis revealed that BRD4 had a strong correlation with clinical index mMRC and post FEV1 (% reference), which are the key parameters for evaluating COPD severity. In particular, it was interesting to observe that LAA-950, a parameter to test the extent of emphysema generated by CT scanning, was significantly positively correlated to BRD4 expression. Moreover, the results exhibited a significant correlation between BRD4 expression and macrophage with the help of GSEV analysis, which was verified in the experimental emphysema mouse model. The present outcomes were also supported by a study from Duan et al. (2023) [51], which reported that BRD4 expression was strongly associated with COPD viral exacerbation and also demonstrated that BRD4 expression both in the blood and in the sputum were significantly correlated with FEV1% predicted in stable COPD patients. Tang et al. (2019) [52] reported a correlation between BRD4 expression and lung function by analyzing COPD lung tissue samples and detected an increased expression of BRD4 in the nuclei of bronchial epithelial cells by immuno-histofluorescence. In this study, the BET family proteins were analyzed in the sputum from two independent COPD cohorts. The proposal suggests that further investigation is needed to validate the functional significance of BRD4 in macrophages during the development of COPD, given that macrophages are a prominent immune cell type in sputum samples. Before conducting the functional analysis of BRD4 targeting in the disease model, a precise intratracheal instillation approach was constructed to directly administer LPS/elastase into the lungs. This technique was used to produce COPD in a mouse model, following a procedure developed by Yadava et al. (2016) [26]. Furthermore, it has been determined that an elastase concentration of 1.8 U is suitable for conducting intervention studies (Figure S2 ). Previous research has been conducted to investigate the impact of BRD4 inhibition in cigarette-induced COPD animal models [53]. Insufficient research has been conducted to establish the therapeutic efficacy of targeting BRD4 in the treatment of emphysema. To bridge this knowledge gap, the current study was conducted to examine the effects of BRD4 targeting through the use of JQ1 and ARV-825 in a mouse model of emphysema. The findings revealed that BRD4 inhibition significantly reduced the lung inflammatory response in emphysema mice, improved lung function, and air space enlargement as well. Panagis Filippakopoulos et al. (2010) published a seminal study introducing JQ1, a small chemical compound with the ability to permeate cell membranes. JQ1 was found to competitively bind to acetyl-lysine recognition motifs, specifically targeting bromodomains. This compound was quickly acknowledged as a pioneering selective inhibitor of BRD4, making it a valuable tool for cancer biology research [54]. The first confidential evidence demonstrating that BRD4 inhibition with JQ1 was a potential therapeutic approach for inflammatory diseases involving macrophage-mediated immune responses was provided by the Gerald V. Denis laboratory in 2013. They showed that BRD2 and BRD4 physically regulated the activity at the promoters of inflammatory genes in macrophages, which were inhibited by the treatment with JQ1, and consequently protected mice from an LPS-induced cytokine storm and death [55]. Owing to the crucial role of BRD4 in various disease pathogenesis, a diverse type of BRD4 modulators have been designed for a variety of disease interventions including autoimmune diseases, organ fibrosis, vascular diseases, and inflammatory lung diseases. Within the field of COPD, Liu et al. (2021) conducted a study investigating the potential protective effects of JQ1 against COPD produced by cigarette smoke (CS) in mice[53]. In a similar vein, Zakarya and colleagues determined that JQ1 can suppress small airway fibrosis associated with COPD [19]. In 2015, Craig M Crews and his research group utilized PROTAC technology to develop ARV-825. This compound functions by recruiting BRD4 to the E3 ubiquitin ligase cereblon, leading to the rapid, efficient, and sustained degradation of BRD4 through the proteasome pathway. Notably, ARV-825 demonstrates superior efficacy in inhibiting c-MYC expression and suppressing cancer cell growth compared to other BRD4 inhibitors, such as JQ1 and OTX015 [56]. This study is the first to explore the therapeutic potential of inflammatory diseases. As anticipated, it was observed that the 20 mg/kg of ARV-825 exhibited a similar ability to 50 mg/kg of JQ1 in ameliorating the experimental emphysema. Additionally, a concentration of 0.2 µmol of ARV-825 was more effective than 1 µmol of JQ1 and 80 µmol of Zl0420 to suppress M2 AMs polarization in vitro . Hence, the findings indicate that the utilization of small compounds based on PROTAC exhibits significant potential for therapeutic intervention in chronic inflammatory lung diseases. This study aimed to investigate the inhibitory effect of targeting BRD4 on the inflammatory response generated by LPS/elastase. This choice was supported by recent reports indicating that BRD4 has the potential to influence the activation of inflammatory cells by disrupting the Janus kinase/signal transducers and activators of transcription (JAK/STAT) and nuclear factor kappa B (NF-κB) signaling pathways [57; 58]. Similarly, it was shown that BRD4 inhibition significantly blocked the M1 AMs polarization, however, it was more attractive to see the improvement of air space enlargement. It was speculated that BRD4 inhibition caused the suppression of M2 AMs, suggesting its significance in this particular process. Moreover, in this study, the underlying mechanism of how BRD4 regulated the M2 AMs polarization was also elucidated and thereby contributed to the development of COPD in the part of the mechanistic study. Young et al. (2013), first proposed SEs, a large cluster of transcriptional enhancers comprising a complex array of sequence elements that drive the expression of specific genes. SEs are much more likely to work as modulators of the vital processes in normal cells and pathological processes compared to conventional enhancers [59]. Recently, there has been a growing body of researches that have been dedicated to investigating the impact of SEs on the development of abnormal transcriptional programs in immune cell dysfunction. Several studies have examined the functional involvement of BRD4 in the process of M2 macrophage polarization. However, one study conducted by Das et al. (2021) has reported on the promotion of M2 polarization during Leishmania donovani parasite infection through the transcription of miR146a-5p, which is controlled by SE [49]. Therefore, the role of SEs in M2 polarization is still largely unknown. The present study observed a high enrichment of SEs in M2 macrophages in relation to H3K27ac/BRD4 co-occupied areas. Specifically, there were 952 instances of enrichment. However, when ARV-825 therapy was administered, the number of enriched SEs decreased to 829. This finding aligns with a previous investigation in 2023 conducted by Carelock et al. [60]. Through the examination of RNA-seq data from M2 AMs subjected to treatment with BRD4 inhibitors and degraders, it was shown that IRF4, a crucial transcription factor necessary for M2 polarization, is the sole gene that experiences suppression by all three anti-BRD4 drugs. As expected, the administration of ARV-825 exhibited a notable reduction of SEs in the gene regulatory regions involving the transcription factor Irf4 , as well as inhibition of BRD4. These combined effects had a discernible impact on the expression of downstream markers associated with M2 polarization, such as MMP12. MMP12 plays a key role in regulating emphysema in individuals suffering from COPD [50]. Subsequently, the data demonstrated that ARV-825 treatment reduced the binding sites of IRF4 on Mmp12 , and similar results were presented in 2021 by Fu et al. [61]. This work offers valuable insights into the impact of anti-BRD4 medicines and their associated side effects, as well as the regulatory role of IRF4 in M2 AMs among patients with COPD. Furthermore, it identifies possible therapeutic targets for future studies. In addition, relationship between IRF4 and MMP12 were verified in the clinical cohort by a functional rescue experiment involving over expression of IRF4. It is worth mentioning that chromatin immunoprecipitation sequencing (CHIP-seq) is a well-documented epigenetic technique utilized for the identification of SEs through the profiling of H3K27ac and BRD4. Nevertheless, the current approaches frequently encounter difficulties related to the requirement for greater cell inputs, as well as the time-consuming and intricate nature of the operation. In the present work the CUT & Tag technique was applied to replace CHIP-seq as it is much faster than CHIP-seq and reduced sequencing depths. Specifically, this technique allows for the utilization of smaller cell inputs, which are very appropriate for the study of primary AMs separated by BALF. To the best of our knowledge, this research is the pioneering work which applied this technology for the analysis of AMs. Conclusion In conclusion, this study's clinical cohort revealed a stronger correlation between BRD4 and COPD evaluating parameters. The in vivo experiments demonstrated that BRD4 inhibition effectively mitigated mouse emphysema by suppressing both M1 and M2 AMs polarization. Lastly, a novel mechanism by which BRD4 regulates the M2 AMs polarization by disrupting the formation of IRF4 SEs was uncovered by using the novel CUT& Tag assay. Taken together, the current study strongly suggests that targeting BRD4 in macrophages holds potential as a therapeutic approach for COPD. Abbreviations AMs Alveolar macrophages BET Bromodomain and extra-terminal BRD4 Bromodomain-containing protein 4 BALF Bronchoalveolar lavage fluid BMI Body mass index COPD Chronic obstructive pulmonary disease Cchord Chord compliance CPM Counts per million ES Enrichment score FDR False discovery rate FV Fast flow volume FVC Forced vital capacity FEV1 Forced expiratory volume in 1 s FRC Functional residual capacity GSVA Gene set variation analysis H3K27ac Histone H3 on lysine 27 acetylation LPS Lipopolysaccharides; SEs:super-enhancers MMP12 Matrix metalloproteinase 12 mMRC Modified medical research council MLI Mean linear intercept Nos2 Nitric oxide synthase 2 PROTAC Proteolytic targeting chimera PV Quasi-static pressure volume PtgS2 Prostaglandin-endoperoxide synthase 2 TLC Total lung capacity TMM Trimmed mean of m-values TSS Transcription start site Declarations Author Contributions D.L., X.S., Y.Y., and Y.D. contributed equally to this work and should be considered co-first authors. D.L., and S.C. contributed to concept and design. D.L., X.S., Y.Y., and Y.D. performed acquisition, analysis, and interpretation of data. D.L., and S.C. drafted the manuscript. D.L., X.S., Y.Y., performed statistical analysis. Q.M., D.C., S.C., J.W., G.W., Z.L., F.W., J.G., Y.L., D.W., J.H., R.L., H.X., and L.R., provided administrative, technical, or material support. L.R., S.C., L.W., and R.C. performed supervision. All authors reviewed the manuscript. Availability of data and materials The raw transcriptomic data and Cut&tag data for this study have been deposited in the Gene Expression Omnibus (GEO, https://db.cngb.org/cnsa/) under GSE number (GSE248961, GSE248962, GSE250232). The authors declare that all data supporting the results in this study are available in the paper and Supplementary Materials. Source data are available from the corresponding authors upon reasonable request. Funding This work was supported by the National Key R&D Program of China (2022YFF0710800 and 2022YFF0710802); the National Natural Science Foundation of China (82170042, 82222035, 32100914, and 32100734); Natural Science Foundation of Guangdong province, China (2021A1515010478 and 2214050008970); Guangzhou Science and Technology Plans (202201020513); Shenzhen Science Technology and Innovative Commission (SZSTI) (JCYJ20210324114400002, KCXFZ202002011008256, and JCYJ20220530152800001). Acknowledgements Not applicable. Consent for publication All authors have seen the manuscript and approved the submission. Competing interests The authors declare that they have no competing interests. References A. Agusti, B.R. Celli, G.J. Criner, D. Halpin, A. Anzueto, P. Barnes, et al., Global Initiative for Chronic Obstructive Lung Disease 2023 Report: GOLD Executive Summary. Eur Respir J. 2023; 61. P.J. Barnes, Immunology of asthma and chronic obstructive pulmonary disease. Nat Rev Immunol. 2008; 8: 183-92. S. Arora, K. Dev, B. Agarwal, P. Das, and M.A. Syed, Macrophages: Their role, activation and polarization in pulmonary diseases. Immunobiology. 2018; 223: 383-396. T.A. Wynn, A. Chawla, and J.W. Pollard, Macrophage biology in development, homeostasis and disease. Nature. 2013; 496: 445-55. T. McLaughlin, S.E. Ackerman, L. Shen, and E. Engleman, Role of innate and adaptive immunity in obesity-associated metabolic disease. J Clin Invest. 2017; 127: 5-13. Y.D. Woo, D. Jeong, and D.H. Chung, Development and Functions of Alveolar Macrophages. Mol Cells. 2021; 44: 292-300. D. Mei, W. Liao, P. Gan, Q. Tran, C. Chan, C. Heng, et al., Angiotensin II type-2 receptor activation in alveolar macrophages mediates protection against cigarette smoke-induced chronic obstructive pulmonary disease. 2022; 184: 106469. R. Vlahos, and S.J.F.i.i. Bozinovski, Role of alveolar macrophages in chronic obstructive pulmonary disease. 2014; 5: 435. B. Spix, E.S. Butz, C.-C. Chen, A.S. Rosato, R. Tang, A. Jeridi, et al., Lung emphysema and impaired macrophage elastase clearance in mucolipin 3 deficient mice. Nature Communications. 2022; 13: 318. J.B. Trojanek, A. Cobos-Correa, S. Diemer, M. Kormann, S.C. Schubert, Z. Zhou-Suckow, et al., Airway mucus obstruction triggers macrophage activation and matrix metalloproteinase 12-dependent emphysema. Am J Respir Cell Mol Biol. 2014; 51: 709-20. K.J. Warren, X. Fang, N.M. Gowda, J.J. Thompson, and N.M. Heller, The TORC1-activated Proteins, p70S6K and GRB10, Regulate IL-4 Signaling and M2 Macrophage Polarization by Modulating Phosphorylation of Insulin Receptor Substrate-2. J Biol Chem. 2016; 291: 24922-24930. J.W. Lee, W. Chun, H.J. Lee, J.H. Min, S.M. Kim, J.Y. Seo, et al., The Role of Macrophages in the Development of Acute and Chronic Inflammatory Lung Diseases. Cells. 2021; 10. Z. Yan, B. Chen, Y. Yang, X. Yi, M. Wei, G. Ecklu-Mensah, et al., Multi-omics analyses of airway host-microbe interactions in chronic obstructive pulmonary disease identify potential therapeutic interventions. Nat Microbiol. 2022; 7: 1361-1375. G. Benincasa, D.L. DeMeo, K. Glass, E.K. Silverman, and C. Napoli, Epigenetics and pulmonary diseases in the horizon of precision medicine: a review. Eur Respir J. 2021; 57. J.E. Lee, Y.K. Park, S. Park, Y. Jang, N. Waring, A. Dey, et al., Brd4 binds to active enhancers to control cell identity gene induction in adipogenesis and myogenesis. Nat Commun. 2017; 8: 2217. J. Wilflingseder, M. Willi, H.K. Lee, H. Olauson, J. Jankowski, T. Ichimura, et al., Enhancer and super-enhancer dynamics in repair after ischemic acute kidney injury. Nat Commun. 2020; 11: 3383. T. Hua, H. Wang, X. Fan, N. An, J. Li, H. Song, et al., BRD4 Inhibition Attenuates Inflammatory Pain by Ameliorating NLRP3 Inflammasome-Induced Pyroptosis. Front Immunol. 2022; 13: 837977. M.S. Stratton, R.A. Bagchi, M.B. Felisbino, R.A. Hirsch, H.E. Smith, A.S. Riching, et al., Dynamic Chromatin Targeting of BRD4 Stimulates Cardiac Fibroblast Activation. Circ Res. 2019; 125: 662-677. R. Zakarya, Y.L. Chan, S. Rutting, K. Reddy, J. Bozier, R.R. Woldhuis, et al., BET proteins are associated with the induction of small airway fibrosis in COPD. Thorax. 2021; 76: 647-655. S. Sui, J. Zhang, S. Xu, Q. Wang, P. Wang, and D. Pang, Ferritinophagy is required for the induction of ferroptosis by the bromodomain protein BRD4 inhibitor (+)-JQ1 in cancer cells. Cell Death Dis. 2019; 10: 331. S.L. Kim, H.S. Choi, and D.S. Lee, BRD4/nuclear PD-L1/RelB circuit is involved in the stemness of breast cancer cells. Cell Commun Signal. 2023; 21: 315. Y. Chen, L. Xu, A. Mayakonda, M.L. Huang, D. Kanojia, T.Z. Tan, et al., Bromodomain and extraterminal proteins foster the core transcriptional regulatory programs and confer vulnerability in liposarcoma. Nat Commun. 2019; 10: 1353. N. Modi, Y. Chen, X. Dong, X. Hu, G.W. Lau, K.T. Wilson, et al., BRD4 Regulates Glycolysis-Dependent Nos2 Expression in Macrophages Upon H pylori Infection. Cell Mol Gastroenterol Hepatol. 2023. X. He, L. Jiang, L. Hu, P. Du, M. Zhu, H. Wu, et al., Mivebresib alleviates systemic lupus erythematosus-associated diffuse alveolar hemorrhage via inhibiting infiltration of monocytes and M1 polarization of macrophages. Int Immunopharmacol. 2023; 120: 110305. T. Yang, Y. Hu, J. Miao, J. Chen, J. Liu, Y. Cheng, et al., A BRD4 PROTAC nanodrug for glioma therapy via the intervention of tumor cells proliferation, apoptosis and M2 macrophages polarization. Acta Pharm Sin B. 2022; 12: 2658-2671. K. Yadava, C. Pattaroni, A.K. Sichelstiel, A. Trompette, E.S. Gollwitzer, O. Salami, et al., Microbiota Promotes Chronic Pulmonary Inflammation by Enhancing IL-17A and Autoantibodies. Am J Respir Crit Care Med. 2016; 193: 975-87. R. Chen, Q. Zhang, S. Chen, H. Tang, P. Huang, S. Wei, et al., IL-17F, rather than IL-17A, underlies airway inflammation in a steroid-insensitive toluene diisocyanate-induced asthma model. Eur Respir J. 2019; 53. A.M. Bolger, M. Lohse, and B. Usadel, Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics. 2014; 30: 2114-20. B. Langmead, and S.L. Salzberg, Fast gapped-read alignment with Bowtie 2. Nat Methods. 2012; 9: 357-9. R. Patro, G. Duggal, M.I. Love, R.A. Irizarry, and C. Kingsford, Salmon provides fast and bias-aware quantification of transcript expression. Nat Methods. 2017; 14: 417-419. M.D. Robinson, D.J. McCarthy, and G.K. Smyth, edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics. 2010; 26: 139-40. G. Yu, L.G. Wang, Y. Han, and Q.Y. He, clusterProfiler: an R package for comparing biological themes among gene clusters. OMICS. 2012; 16: 284-7. Z. Fang, X. Liu, and G. Peltz, GSEApy: a comprehensive package for performing gene set enrichment analysis in Python. Bioinformatics. 2023; 39. M.P. Meers, D. Tenenbaum, and S. Henikoff, Peak calling by Sparse Enrichment Analysis for CUT&RUN chromatin profiling. Epigenetics Chromatin. 2019; 12: 42. R.S. ∗, and G.B. †, DiffBind: Differential binding analysis of ChIP- Seq peak data. Q. Wang, M. Li, T. Wu, L. Zhan, L. Li, M. Chen, et al., Exploring Epigenomic Datasets by ChIPseeker. Curr Protoc. 2022; 2: e585. F. Ramirez, D.P. Ryan, B. Gruning, V. Bhardwaj, F. Kilpert, A.S. Richter, et al., deepTools2: a next generation web server for deep-sequencing data analysis. Nucleic Acids Res. 2016; 44: W160-5. Z. Gu, R. Eils, M. Schlesner, and N. Ishaque, EnrichedHeatmap: an R/Bioconductor package for comprehensive visualization of genomic signal associations. BMC Genomics. 2018; 19: 234. L. Shen, N. Shao, X. Liu, and E. Nestler, ngs.plot: Quick mining and visualization of next-generation sequencing data by integrating genomic databases. BMC Genomics. 2014; 15: 284. A.R. Quinlan, and I.M. Hall, BEDTools: a flexible suite of utilities for comparing genomic features. Bioinformatics. 2010; 26: 841-2. J. Loven, H.A. Hoke, C.Y. Lin, A. Lau, D.A. Orlando, C.R. Vakoc, et al., Selective inhibition of tumor oncogenes by disruption of super-enhancers. Cell. 2013; 153: 320-34. H. Thorvaldsdottir, J.T. Robinson, and J.P. Mesirov, Integrative Genomics Viewer (IGV): high-performance genomics data visualization and exploration. Brief Bioinform. 2013; 14: 178-92. A. Dey, W. Yang, A. Gegonne, A. Nishiyama, R. Pan, R. Yagi, et al., BRD4 directs hematopoietic stem cell development and modulates macrophage inflammatory responses. EMBO J. 2019; 38. M.S. Eapen, P.M. Hansbro, K. McAlinden, R.Y. Kim, C. Ward, T.L. Hackett, et al., Abnormal M1/M2 macrophage phenotype profiles in the small airway wall and lumen in smokers and chronic obstructive pulmonary disease (COPD). Sci Rep. 2017; 7: 13392. P.S. Hiemstra, Altered macrophage function in chronic obstructive pulmonary disease. Ann Am Thorac Soc. 2013; 10 Suppl: S180-5. K. Hao, W. Jiang, M. Zhou, H. Li, Y. Chen, F. Jiang, et al., Targeting BRD4 prevents acute gouty arthritis by regulating pyroptosis. Int J Biol Sci. 2020; 16: 3163-3173. Y. Bao, X. Wu, J. Chen, X. Hu, F. Zeng, J. Cheng, et al., Brd4 modulates the innate immune response through Mnk2-eIF4E pathway-dependent translational control of IκBα. 2017; 114: E3993-E4001. D. Sengupta, A. Kannan, M. Kern, M.A. Moreno, E. Vural, B. Stack, Jr., et al., Disruption of BRD4 at H3K27Ac-enriched enhancer region correlates with decreased c-Myc expression in Merkel cell carcinoma. Epigenetics. 2015; 10: 460-6. S. Das, S. Mukherjee, and N. Ali, Super enhancer-mediated transcription of miR146a-5p drives M2 polarization during Leishmania donovani infection. PLoS Pathog. 2021; 17: e1009343. S. Shibata, K. Miyake, T. Tateishi, S. Yoshikawa, Y. Yamanishi, Y. Miyazaki, et al., Basophils trigger emphysema development in a murine model of COPD through IL-4-mediated generation of MMP-12-producing macrophages. Proc Natl Acad Sci U S A. 2018; 115: 13057-13062. Y. Duan, S. Zhou, and J. Wang, BRD4 is involved in viral exacerbation of chronic obstructive pulmonary disease. Respir Res. 2023; 24: 37. K. Tang, J. Zhao, J. Xie, and J. Wang, Decreased miR-29b expression is associated with airway inflammation in chronic obstructive pulmonary disease. Am J Physiol Lung Cell Mol Physiol. 2019; 316: L621-L629. Y. Liu, Z.Z. Huang, L. Min, Z.F. Li, and K. Chen, The BRD4 inhibitor JQ1 protects against chronic obstructive pulmonary disease in mice by suppressing NF-kappaB activation. Histol Histopathol. 2021; 36: 101-112. P. Filippakopoulos, J. Qi, S. Picaud, Y. Shen, W.B. Smith, O. Fedorov, et al., Selective inhibition of BET bromodomains. Nature. 2010; 468: 1067-73. A.C. Belkina, B.S. Nikolajczyk, and G.V. Denis, BET protein function is required for inflammation: Brd2 genetic disruption and BET inhibitor JQ1 impair mouse macrophage inflammatory responses. J Immunol. 2013; 190: 3670-8. J. Lu, Y. Qian, M. Altieri, H. Dong, J. Wang, K. Raina, et al., Hijacking the E3 Ubiquitin Ligase Cereblon to Efficiently Target BRD4. Chem Biol. 2015; 22: 755-63. G. Deng, F. Zeng, J. Su, S. Zhao, R. Hu, W. Zhu, et al., BET inhibitor suppresses melanoma progression via the noncanonical NF-kappaB/SPP1 pathway. Theranostics. 2020; 10: 11428-11443. L. Xu, J. Jiao, M. Liu, Y. Qin, M. Zhang, D. Yan, et al., A Combination of CPI-0610 and SAHA Induces Apoptosis through STAT3 and p38 Signalling Pathways in Diffuse Large B-cell Lymphoma Cells. Curr Med Chem. 2023. W.A. Whyte, D.A. Orlando, D. Hnisz, B.J. Abraham, C.Y. Lin, M.H. Kagey, et al., Master transcription factors and mediator establish super-enhancers at key cell identity genes. Cell. 2013; 153: 307-19. M.E. Carelock, R.P. Master, M.-C. Kim, Z. Jin, L. Wang, C.K. Maharjan, et al., Targeting intracellular proteins with cell type-specific functions for cancer immunotherapy. Life Medicine. 2023; 2: lnad019. Y. Fu, A. Saraswat, Z. Wei, M.Y. Agrawal, V.V. Dukhande, S.E. Reznik, et al., Development of Dual ARV-825 and Nintedanib-Loaded PEGylated Nano-Liposomes for Synergistic Efficacy in Vemurafnib-Resistant Melanoma. Pharmaceutics. 2021; 13. Additional Declarations No competing interests reported. Supplementary Files Supplementaryfigure.zip Supplementarytable.zip GraphicalAbstract.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3788052","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":263349298,"identity":"cf70d9af-4467-44df-9776-8d1fad7239ba","order_by":0,"name":"Difei Li","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA3klEQVRIiWNgGAWjYBACNvbmg49/GNjI8bM3Nj5I+GFDWAsfz7FkY4aCNGPJnsOHDR72pBHWIieRYybN8OFQ4oYbaWmSD9gOE+EwnmMJ0gUGB4wlZ+SYVSTwHGbgb+9OIOSXA8YzDO7I8fO8MbuRYJHOIHHm7AaCtiTwGDwzlmzPAWrhsWYwkMgloEUix+AAj8HhxA0HcswKEtiYidJi2AzWciItjSGBzZkILcBAZpxhAAlkicSeNB6CfpFvbz7+48MfSFR+/PEDyGjvxa8FA/CQpnwUjIJRMApGAVYAALUDTlTXZQmFAAAAAElFTkSuQmCC","orcid":"","institution":"Southern University of Science and Technology","correspondingAuthor":true,"prefix":"","firstName":"Difei","middleName":"","lastName":"Li","suffix":""},{"id":263349301,"identity":"ece62f10-b4b2-4c53-aa87-cff7ea4d00d6","order_by":1,"name":"Xing Shi","email":"","orcid":"","institution":"ShenZhen People’s Hospital","correspondingAuthor":false,"prefix":"","firstName":"Xing","middleName":"","lastName":"Shi","suffix":""},{"id":263349302,"identity":"c86476aa-4858-49ef-8908-195e88faa505","order_by":2,"name":"Yuqiong Yang","email":"","orcid":"","institution":"First Affiliated Hospital of Guangzhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"Yuqiong","middleName":"","lastName":"Yang","suffix":""},{"id":263349303,"identity":"b469aa7f-e514-4286-8ca0-6728e19d5725","order_by":3,"name":"Yao Deng","email":"","orcid":"","institution":"Southern University of Science and Technology","correspondingAuthor":false,"prefix":"","firstName":"Yao","middleName":"","lastName":"Deng","suffix":""},{"id":263349306,"identity":"291b79ed-908d-4d36-a8a7-f921928ef412","order_by":4,"name":"Dandan Chen","email":"","orcid":"","institution":"ShenZhen People’s Hospital","correspondingAuthor":false,"prefix":"","firstName":"Dandan","middleName":"","lastName":"Chen","suffix":""},{"id":263349310,"identity":"c22e621e-96d4-448f-9f58-8f6119ca25aa","order_by":5,"name":"Shuyu Chen","email":"","orcid":"","institution":"ShenZhen People’s Hospital","correspondingAuthor":false,"prefix":"","firstName":"Shuyu","middleName":"","lastName":"Chen","suffix":""},{"id":263349312,"identity":"f69d4967-f57d-4245-8ecf-f9c4f76645b3","order_by":6,"name":"Qianfang Meng","email":"","orcid":"","institution":"Shenzhen Bay Laboratory","correspondingAuthor":false,"prefix":"","firstName":"Qianfang","middleName":"","lastName":"Meng","suffix":""},{"id":263349313,"identity":"63c7cd43-8e2f-4758-a1b9-e5c58477db06","order_by":7,"name":"Jinyong Wang","email":"","orcid":"","institution":"ShenZhen People’s Hospital","correspondingAuthor":false,"prefix":"","firstName":"Jinyong","middleName":"","lastName":"Wang","suffix":""},{"id":263349314,"identity":"828fb982-d391-4092-962b-a6e96a3b873f","order_by":8,"name":"Guanxi Wen","email":"","orcid":"","institution":"ShenZhen People’s Hospital","correspondingAuthor":false,"prefix":"","firstName":"Guanxi","middleName":"","lastName":"Wen","suffix":""},{"id":263349315,"identity":"cae101c8-6a1c-4015-a6d1-bdf7fad8e3ca","order_by":9,"name":"Zhenyu Liang","email":"","orcid":"","institution":"First Affiliated Hospital of Guangzhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"Zhenyu","middleName":"","lastName":"Liang","suffix":""},{"id":263349316,"identity":"de36e149-8c55-417c-9bea-4c73da5ed933","order_by":10,"name":"Fengyan Wang","email":"","orcid":"","institution":"First Affiliated Hospital of Guangzhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"Fengyan","middleName":"","lastName":"Wang","suffix":""},{"id":263349317,"identity":"2de5a830-89a5-4c25-afd7-4e0828c30049","order_by":11,"name":"Jiaqi Gao","email":"","orcid":"","institution":"South China Normal University","correspondingAuthor":false,"prefix":"","firstName":"Jiaqi","middleName":"","lastName":"Gao","suffix":""},{"id":263349318,"identity":"8669a399-4194-4adb-81df-37fd7c0359a8","order_by":12,"name":"Yuanyuan Liu","email":"","orcid":"","institution":"ShenZhen People’s Hospital","correspondingAuthor":false,"prefix":"","firstName":"Yuanyuan","middleName":"","lastName":"Liu","suffix":""},{"id":263349319,"identity":"6aae9ad2-d89d-4226-bdb3-7a872935e94b","order_by":13,"name":"Danna Wang","email":"","orcid":"","institution":"ShenZhen People’s Hospital","correspondingAuthor":false,"prefix":"","firstName":"Danna","middleName":"","lastName":"Wang","suffix":""},{"id":263349320,"identity":"1b679068-a29c-4d33-80d9-346b3a5914ba","order_by":14,"name":"Jieying Hu","email":"","orcid":"","institution":"First Affiliated Hospital of Guangzhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"Jieying","middleName":"","lastName":"Hu","suffix":""},{"id":263349321,"identity":"581ca1ae-7f6d-4ee2-ad8e-c82215300df9","order_by":15,"name":"Ruifang Liang","email":"","orcid":"","institution":"Southern University of Science and Technology","correspondingAuthor":false,"prefix":"","firstName":"Ruifang","middleName":"","lastName":"Liang","suffix":""},{"id":263349322,"identity":"76fbe1dd-4813-46a9-8f78-8243cc5c4218","order_by":16,"name":"Haizhao Xu","email":"","orcid":"","institution":"Southern University of Science and Technology","correspondingAuthor":false,"prefix":"","firstName":"Haizhao","middleName":"","lastName":"Xu","suffix":""},{"id":263349323,"identity":"b667b0bd-7e77-4367-97b7-34bd3315df1b","order_by":17,"name":"Lang Rao","email":"","orcid":"","institution":"Shenzhen Bay Laboratory","correspondingAuthor":false,"prefix":"","firstName":"Lang","middleName":"","lastName":"Rao","suffix":""},{"id":263349324,"identity":"7cd8a111-9ccf-47d7-9657-9c5ebbdc6e90","order_by":18,"name":"Lingwei Wang","email":"","orcid":"","institution":"ShenZhen People’s Hospital","correspondingAuthor":false,"prefix":"","firstName":"Lingwei","middleName":"","lastName":"Wang","suffix":""},{"id":263349325,"identity":"89786719-7b45-4d8e-a5f4-51aa18ff3286","order_by":19,"name":"Rongchang Chen","email":"","orcid":"","institution":"ShenZhen People’s Hospital","correspondingAuthor":false,"prefix":"","firstName":"Rongchang","middleName":"","lastName":"Chen","suffix":""},{"id":263349326,"identity":"6dff6fcf-5d3c-471f-978a-839c55c6836f","order_by":20,"name":"Shanze Chen","email":"","orcid":"","institution":"ShenZhen People’s Hospital","correspondingAuthor":false,"prefix":"","firstName":"Shanze","middleName":"","lastName":"Chen","suffix":""}],"badges":[],"createdAt":"2023-12-21 16:59:17","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3788052/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3788052/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":49078422,"identity":"b23fdfc3-e7a8-426a-a918-28893339add8","added_by":"auto","created_at":"2024-01-02 19:16:16","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1141854,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003e­BRD4 was associated with key clinical events during COPD progression\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A）Box plots show the abundance of \u003cem\u003eBRD1\u003c/em\u003e, \u003cem\u003eBRD2\u003c/em\u003e, \u003cem\u003eBRD3\u003c/em\u003e, \u003cem\u003eBRD4\u003c/em\u003e, \u003cem\u003eBRD7\u003c/em\u003e, \u003cem\u003eBRD8\u003c/em\u003e, \u003cem\u003eBRD9\u003c/em\u003e in COPD (n = 94) and controls (n = 36). Significance was determined using a two-sided Wilcoxon rank-sum test. NS: Not significant; (B) Pairwise correlations between \u003cem\u003eBRD1\u003c/em\u003e, \u003cem\u003eBRD2\u003c/em\u003e, \u003cem\u003eBRD3\u003c/em\u003e, \u003cem\u003eBRD4\u003c/em\u003e, \u003cem\u003eBRD7\u003c/em\u003e, \u003cem\u003eBRD8\u003c/em\u003e, \u003cem\u003eBRD9\u003c/em\u003e and clinical parameters of COPD patients. Significant \u003cem\u003ep\u003c/em\u003e-values are shown by color, and Spearman's correlation analysis is used to estimatesignificant correlations. Clinical parameters included: BMI: body mass index; postFEV1pct: post FEV1 (% reference); pack year: cigarette consumption per year; CAT: COPD Assessment Test; mMRC: modified Medical Research Council; AE_year_0: acute exacerbation times per year; (C) Correlations of the expression of BRD4 between FEV1% predicted, mMRC and LAA_950 in Guangzhou and Shenzhen COPD cohorts. (D) Correlations of the expression of between BRD4 and Macrophage ES or Neutrophil ES in the Guangzhou cohort. (E) BRD4 expression levels in lung tissue were detected by western blotting in control and model mice(n = 3). (F) Semiquantitative analysis of western blotting results of BRD4 expression levels in the lung. (G) Immunofluorescence staining of CD68 and BRD4 in lung tissue of control and model mice. Original magnifications 200 × (left) and 630 × (right) (n = 5). * \u003cem\u003ep\u003c/em\u003e \u0026lt;0.05, ** \u003cem\u003ep\u003c/em\u003e \u0026lt;0.01, *** \u003cem\u003ep\u003c/em\u003e \u0026lt;0.001, **** \u003cem\u003ep\u003c/em\u003e \u0026lt;0.0001.\u003c/p\u003e","description":"","filename":"image2.png","url":"https://assets-eu.researchsquare.com/files/rs-3788052/v1/b8d04e93bd0f25fd8e4ed806.png"},{"id":49078683,"identity":"80258f2e-93a3-4e63-8091-845c3c44ea5e","added_by":"auto","created_at":"2024-01-02 19:24:16","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1203580,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePharmacological targeting of BRD4 ameliorates LPS/elastase-induced airway inflammation and emphysema\u003c/strong\u003e. (A) Measurement of obstructive airflow limitation with FEV100/FVC (%), FRC, and TLC (B) Measurement of inflammatory cells, macrophage, neutrophils, and lymphocytes in BALF. (C) Representative H\u0026amp;E-stained pulmonary sections were isolated from different groups. Original magnifications 400×. (D) Semiquantitative analysis of airway inflammation. (E) Semiquantitative analysis of mean linear intercept (MLI), n = 5–10 mice per group. * \u003cem\u003ep\u003c/em\u003e \u0026lt;0.05, ** \u003cem\u003ep\u003c/em\u003e \u0026lt;0.01, *** \u003cem\u003ep\u003c/em\u003e \u0026lt;0.001, **** \u003cem\u003ep\u003c/em\u003e \u0026lt;0.0001.\u003c/p\u003e","description":"","filename":"image3.png","url":"https://assets-eu.researchsquare.com/files/rs-3788052/v1/559daa9a0bdf1bc7fb69bec1.png"},{"id":49077613,"identity":"fb3d9ef5-ca01-4c18-873b-9f6247723e22","added_by":"auto","created_at":"2024-01-02 19:08:16","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":269695,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTranscriptome characterization of BRD4 inhibition in M1 AMs. \u003c/strong\u003e(A) Pairwise correlations between \u003cem\u003eBRD1\u003c/em\u003e, \u003cem\u003eBRD2\u003c/em\u003e, \u003cem\u003eBRD3\u003c/em\u003e, \u003cem\u003eBRD4\u003c/em\u003e, \u003cem\u003eBRD7\u003c/em\u003e, \u003cem\u003eBRD8\u003c/em\u003e, \u003cem\u003eBRD9\u003c/em\u003e, and M1 macrophage marker genes expression. (B) Barplot shows the expression of \u003cem\u003eTnf\u003c/em\u003e, \u003cem\u003eIl1b\u003c/em\u003e and IL-6 (n = 5) in the lung of emphysema mice treated with or without DMSO, ARV825 (10 mg/kg), ARV825 (20 mg/kg), JQ1 (50 mg/kg). (C) Heatmap analysis of RNA-seq data change of M1 macrophage when using 3 different BRD4 inhibition drugs. (D) Venn diagrams showing overlapped genes between M1-specific genes and genes regulated by 3 different BRD4 inhibition drugs. (E) GSEA enrichment analysis of ARV-825 regulated genes against M1-specific genes in M1 AMs. (F) GO analysis of ARV825 downregulated genes in M1 AMs. G) Heatmap of gene expression in the pathway of leukocyte migration, cytokine production, and IL-6 production of M1 macrophage. (H) Barplot shows expression of \u003cem\u003eTnf, Il1b, and Nos2\u003c/em\u003e (n = 3) in the AMs stimulated with LPS/IFN-γ treated with or without DMSO, ARV825 (0.2 µmol),JQ1 (1 µmol), and ZL0420 (80 µmol). * \u003cem\u003ep\u003c/em\u003e \u0026lt;0.05, ** \u003cem\u003ep\u003c/em\u003e \u0026lt;0.01, *** \u003cem\u003ep\u003c/em\u003e \u0026lt;0.001, **** \u003cem\u003ep\u003c/em\u003e \u0026lt;0.0001.\u003c/p\u003e","description":"","filename":"image4.png","url":"https://assets-eu.researchsquare.com/files/rs-3788052/v1/5d6f8b8be7342a08ccb4fe91.png"},{"id":49077615,"identity":"e6caacc1-df7b-4ab9-85c6-3cfac91b33ed","added_by":"auto","created_at":"2024-01-02 19:08:16","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":323582,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTranscriptome characterization of BRD4 inhibition in M2 AMs. \u003c/strong\u003e(A) Pairwise correlations between \u003cem\u003eBRD1\u003c/em\u003e, \u003cem\u003eBRD2\u003c/em\u003e, \u003cem\u003eBRD3\u003c/em\u003e, \u003cem\u003eBRD4\u003c/em\u003e, \u003cem\u003eBRD7\u003c/em\u003e, \u003cem\u003eBRD8\u003c/em\u003e, \u003cem\u003eBRD9\u003c/em\u003e, and M2 macrophage expression in Guangzhou and Shenzhen clinical cohorts. (B) Barplot shows expression of \u003cem\u003eArg1\u003c/em\u003e, \u003cem\u003eCcl17\u003c/em\u003e, and \u003cem\u003eTfrc\u003c/em\u003e (n = 5) in the lung of emphysema mice treated with or without DMSO, ARV825 (10 mg/kg), ARV825 (20 mg/kg), and JQ1 (50 mg/kg).\u003cstrong\u003e \u003c/strong\u003e(C) Heatmap of RNA-seq data of M2 macrophage when using 3 different BRD4 inhibition drugs. (D) Venn diagrams showing overlapped genes between M2-specific genes and genes downregulated using 3 different BRD4 inhibition drugs. (E) GSEA enrichment analysis of ARV825 regulated genes against M2-specific gene list. (F) GO analysis of the differentially expressed mRNAs in BRD4 inhibition drugs of ARV825 downregulated genes. (G) Heatmap analysis of gene expression change in myeloid leukocyte differentiation, leukocyte chemotaxis, and extracellular matrix organization of M2 macrophage when using 3 different BRD4 inhibition drugs. (H) Barplot shows expression of \u003cem\u003eArg1\u003c/em\u003e, \u003cem\u003eCcl17\u003c/em\u003e (n = 3) in the AMs stimulated with IL-4 in the treatment with or without DMSO, ARV825 (0.2 µmol),JQ1 (1 µmol), and ZL0420 (80 µmol). * \u003cem\u003ep\u003c/em\u003e \u0026lt;0.05, ** \u003cem\u003ep\u003c/em\u003e \u0026lt;0.01, *** \u003cem\u003ep\u003c/em\u003e \u0026lt;0.001, **** \u003cem\u003ep\u003c/em\u003e \u0026lt;0.0001.\u003c/p\u003e","description":"","filename":"image5.png","url":"https://assets-eu.researchsquare.com/files/rs-3788052/v1/aa5f3ace16158619e47cfa22.png"},{"id":49078450,"identity":"c848a7d7-6c7c-447b-8713-38b79126f71f","added_by":"auto","created_at":"2024-01-02 19:16:16","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":858932,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eBRD4 inhibition decreases BRD4 and H3K27ac occupancy on promoter regions in vitro\u003c/strong\u003e. (A) Venn diagram showing BRD4 and H3K27ac overlapped binding peaks in M0 and M2 AMs. (B) Genome-wide distribution of BRD4 and H3k27ac in AMs from M0 group, M2 group, ARV-825+M2 group. (C) Heatmaps of BRD4 and H3k27ac occupancy on the promoter region (TSS±5 kb), aligned by the degree of BRD4 and H3k27ac signal intensity in AMs from M0 group, M2 group, ARV-825+M2 group. (D) Binding intensity of BRD4 and H3k27ac across the gene body of the whole genome in AMs from M0 group, M2 group, ARV-825+M2 group.\u003c/p\u003e","description":"","filename":"image6.png","url":"https://assets-eu.researchsquare.com/files/rs-3788052/v1/8e1bb5e989b03b9074210b69.png"},{"id":49078449,"identity":"f31194f5-2e48-4660-9d54-c4cc2a1c3d7d","added_by":"auto","created_at":"2024-01-02 19:16:16","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":268603,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eBRD4 inhibition changes the dynamic enhancer epigenome in M2 AMs.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) The left Venn diagram shows enriched genes annotated to BRD4 peaks, H3K27ac peaks in M2 AMs, and their overlapped genes with upregulated genes in M2 macrophage; the right Venn diagram shows overlapped genes between genes associated with ARV825 downregulated BRD4 peaks, genes associated with ARV825 downregulated H3K27ac peaks, and ARV825 downregulated genes in M2 AMs. (B) The boxplot shows significantly differential gene expression fold changes between genes associated with and not with downregulated BRD4 peaks and H3K27ac peaks in M2 AMs with ARV-825. (C) GSEA plots indicate genes associated with downregulated BRD4 and H3k27ac peaks are significantly downregulated by ARV-825 in M2 macrophage. (D) GO analysis of the ARV-825 downregulated genes associated with BRD4 and H3k27ac downregulated peaks in M2 macrophage. (E) Gene tracks show strong downregulated signals of the M2 marker genes\u003cem\u003e Arg1\u003c/em\u003e, \u003cem\u003eCcl17\u003c/em\u003e, \u003cem\u003eCcr5\u003c/em\u003e, and \u003cem\u003eCcl22\u003c/em\u003e after ARV-825 treatment. * \u003cem\u003ep\u003c/em\u003e \u0026lt;0.05, ** \u003cem\u003ep\u003c/em\u003e \u0026lt;0.01, *** \u003cem\u003ep\u003c/em\u003e \u0026lt;0.001, **** \u003cem\u003ep\u003c/em\u003e \u0026lt;0.0001.\u003c/p\u003e","description":"","filename":"image7.png","url":"https://assets-eu.researchsquare.com/files/rs-3788052/v1/3bb985e83ffa2cf0f5082add.png"},{"id":49078432,"identity":"e38d4cd0-629b-4c0a-9d70-9da0d8200319","added_by":"auto","created_at":"2024-01-02 19:16:16","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":364436,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eBRD4 inhibition disrupts IRF4 SE formation in M2 AMs\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Super enhancers of M0, M2, and ARV825-M2 macrophage, which are ranked by their H3K27ac signaling using ROSE. (B) Venn diagram shows the overlap of genes associated with SEs sites, M2-specific genes, and ARV825 downregulated genes in M2. (C) Gene tracks of \u003cem\u003eIrf4\u003c/em\u003e associated SE in M2 AMs. The adjacent genes IRF4 showed strong SE peaks and RNA-seq signals in M2 AMs and intensively reduced when using ARV-825. (D) Volcano plot depicting significant downregulation of \u003cem\u003eIrf4\u003c/em\u003e in M2 macrophage by BRD4 inhibition drug ARV825. (E) Venn diagram shows overlapped peaks of BRD4, H3K27ac, and IRF4 in M2 AMs. \u0026nbsp;(F) Binding intensity of IRF4 across the BRD4 binding sites of the whole genome in AMs from the M0 group, M2 group, and ARV-825 + M2 group. (G) Gene tracks of \u003cem\u003eMmp12\u003c/em\u003e in the M2 AMs. The adjacent gene \u003cem\u003eMmp12\u003c/em\u003e showed strong IRF4 peaks and RNA-seq signals in the M2 AMs. (H) Barplot shows expression of \u003cem\u003eIrf4\u003c/em\u003e, \u003cem\u003eMmp12\u003c/em\u003e, and \u003cem\u003eTfrc\u003c/em\u003e in response to IRF4 transfection in M2 macrophage with or without treatment with ARV825 (n = 5). (I) Transcription level of \u003cem\u003eIrf4, Mmp12\u003c/em\u003e is significantly downregulated by BRD4 inhibition drugs in pulmonary sections from LPS/elastase-induced COPD mice. The values were detected by quantitative PCR (n = 5). (J) Box plots show the abundance of \u003cem\u003eIRF4\u003c/em\u003e (Guangzhou \u003cem\u003ep\u003c/em\u003e =0.006; Shenzhen \u003cem\u003ep\u003c/em\u003e =0.0012), and \u003cem\u003eMMP12\u003c/em\u003e (Guangzhou \u003cem\u003ep\u003c/em\u003e =0.00056; Shenzhen \u003cem\u003ep\u003c/em\u003e =0.00022) in COPD and healthy control. (K) The gene expression of \u003cem\u003eIRF4 \u003c/em\u003eand \u003cem\u003eMMP12 \u003c/em\u003eare significantly correlated in Guangzhou and Shenzhen COPD patients. * \u003cem\u003ep\u003c/em\u003e \u0026lt;0.05, ** \u003cem\u003ep\u003c/em\u003e \u0026lt;0.01, *** \u003cem\u003ep\u003c/em\u003e \u0026lt;0.001, **** \u003cem\u003ep\u003c/em\u003e \u0026lt;0.0001.\u003c/p\u003e","description":"","filename":"image8.png","url":"https://assets-eu.researchsquare.com/files/rs-3788052/v1/019c2cd7d5aaeddb13268326.png"},{"id":50232013,"identity":"5ad17b2d-b6d3-4146-a31e-8b3626fd87bc","added_by":"auto","created_at":"2024-01-26 21:55:04","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4723712,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3788052/v1/aa65e557-3a4b-4821-99b7-076843066987.pdf"},{"id":49077621,"identity":"0b222004-4175-45e8-9fa8-6eb7464811ac","added_by":"auto","created_at":"2024-01-02 19:08:16","extension":"zip","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":4823994,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementaryfigure.zip","url":"https://assets-eu.researchsquare.com/files/rs-3788052/v1/12584915bb2ef10ca741dfee.zip"},{"id":49077618,"identity":"fb73fd36-e8ff-40b0-8d31-d287e80741ad","added_by":"auto","created_at":"2024-01-02 19:08:16","extension":"zip","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":512104,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementarytable.zip","url":"https://assets-eu.researchsquare.com/files/rs-3788052/v1/a2e64bd0ae7d6859e8e749fb.zip"},{"id":49078447,"identity":"5e33eaec-56e2-4143-9929-86838f0e669f","added_by":"auto","created_at":"2024-01-02 19:16:16","extension":"docx","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":143381,"visible":true,"origin":"","legend":"","description":"","filename":"GraphicalAbstract.docx","url":"https://assets-eu.researchsquare.com/files/rs-3788052/v1/ccf11e1561f0afcfefa75ff2.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Targeting BRD4 Ameliorates Experimental Emphysema by Disrupting Super-Enhancer in Polarized Alveolar Macrophage ","fulltext":[{"header":"1 Introduction","content":"\u003cp\u003eChronic obstructive pulmonary disease (COPD) is a progressive and lethal chronic lung disease characterized by chronic airway inflammation and emphysema [1].\u0026ensp;An aberrant inflammatory response that involves both innate and adaptive immunity is critical to the development of COPD. A variety of immune cells, including macrophages, neutrophils, and T lymphocytes, are involved in the pathogenesis of COPD [2]. Among all, alveolar macrophages (AMs) are abundantly found in patients with COPD and play essential roles in the inflammation and airway remodeling of this disease [3]. Macrophages are the most plastic immune cells present in all tissues and can be commonly polarized into classically activated (also called M1) macrophages and alternatively activated (also called M2) macrophages [4]. M1 polarized macrophages are stimulated by interferon-γ (IFN-γ) and toll-like receptor (TLR) ligands, which are recognized for their ability to elicit the production of cytokines such as IL-6, IL-1β, and TNF-α, and play an essential role in Th1-type immune responses. M2 macrophages are generated by the stimulation of T-helper 2 (Th2) cytokine IL-4 or IL-13, and secrete anti‐inflammatory cytokines (e.g., IL-10, TGF-β) and chemokines (e.g., CCL17, CCL22) to participate in Th2-type immune responses [5].\u003c/p\u003e \u003cp\u003eIn the context of COPD, AMs are cells of the innate immune system and represent a vital component of the first-line body defense against pathogens and inhaled particles[6]. On one hand, AMs exposed to cigarette smoke or microbes can polarize into M1 subtype and secrete the pro-inflammatory cytokines and chemokines, thereby play a crucial role in initiating the pro-inflammatory response[7; 8]. On the other hand, AMs adapt to M2 states to release active mediators likewise matrix metalloproteinases 12 (MMP12) which have been recognized as a key factor in causing emphysema [9; 10; 11]. Therefore, both types of macrophages are vital to the pathogenesis of COPD [12]. As such, it was widely believed that regulating the AMs polarization holds significant promise for advancing COPD therapy.\u003c/p\u003e \u003cp\u003eNotably, clinical cohort studies offer a powerful tool for discovering potential therapeutic targets. In China, a cohort of sputum transcriptomes was previously created, consisting of 94 patients diagnosed with COPD and 36 persons who were deemed healthy[13] and found that the transcriptional level of bromodomain containing protein 4 (BRD4) is significantly associated with clinical parameters and macrophage polarization. Hence, this observation suggests that it possesses the potential to serve as a therapeutic target for COPD. Numerous human diseases have been closely linked to aberrant epigenetic regulation [14]. BRD4 is the best-characterized member of the bromodomain and extra-terminal (BET) protein family and is an epigenetic reader of acetylated lysine residues to regulate the transcription of genes and chromatin landscape. It usually acts as a scaffold for transcription factors and localizes at gene promoters and enhancers [15].\u003c/p\u003e \u003cp\u003eIn addition, BRD4 plays a crucial role in the organization of super-enhancers (SEs), which are critical in driving the high-level transcription of specific genes and are typically identified based on strong enrichment of H3K27ac [16]. Due to the vital role of BRD4 in various disease progression, including carcinomas, inflammatory diseases, fibrosis, and vascular diseases, several BRD4 inhibitors, such as JQ1, have been developed for disease intervention [17; 18; 19; 20]. In recent years, BRD4 degraders like ARV-825 were also developed based on the proteolytic targeting chimera (PROTAC) technology and were tested for many disease treatments [21; 22]. Although BRD4 plays a critical role in regulating both M1 and M2 macrophage polarization, they have been reported to be effective in the treatment of tumors by modulating the function of tumor-associated macrophage [23; 24; 25]. However, little is known whether targeting BRD4 affects the AMs polarization and the therapeutic consequence for COPD. As such, we hypothesized that modulating macrophage polarization via BRD4 inhibitors is a potential therapeutic approach for COPD.\u003c/p\u003e"},{"header":"2 Material and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1 Patient cohorts and samples\u003c/h2\u003e \u003cp\u003eThis study utilizes human airway transcriptomic data from two separate cohorts of individuals with COPD in different cities in China. Specifically, the discovery cohort consisted of 70 patients with stable COPD and 18 healthy controls, from whom induced sputum samples were collected at the First Affiliated Hospital of Guangzhou Medical University in Guangzhou. The validation cohort included 24 patients with stable COPD and 18 healthy controls, from whom induced sputum samples were obtained at Shenzhen People's Hospital in Shenzhen. The inclusion and exclusion criteria were described in previous study[13]. The study was approved by the ethics committee of two centers (reference no. 2017-22 and KY-LL-2020294-01). The inclusion criteria for patients with COPD consisted of being over the age of 40 and having a confirmed diagnosis of COPD based on the GOLD guideline. Specifically, a post-bronchodilator forced expiratory volume in 1 s (FEV1)/forced vital capacity ratio\u0026thinsp;\u0026lt;\u0026thinsp;0.7. The exclusion criteria were: (1) a diagnosis of known respiratory disorders other than COPD; (2) COPD exacerbation within 4 weeks of enrolment; (3) history of lung surgery and tuberculosis; (4) diagnosis of cancer; (5) blood transfusion within 4 weeks of enrolment; (6) diagnosis of autoimmune diseases; (7) enrolment in a blinded drug trial; and (8) antibiotic usage within 4 weeks of enrolment. All participants provided written informed consent.\u003c/p\u003e \u003cp\u003eThe chest CT data in Guangzhou cohort and Shenzhen cohort were imported separately into workstations of the VIDA software (version 2.2, Apollo; VIDA Diagnostics, Coralville, IA, USA) and NeuLungCare-QA (version 1.0, Neusoft Medical Systems Co., Ltd. Shenyang, Liaoning, China) to automatically analyze the extent of emphysema (LAA950%).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2 Murine model\u003c/h2\u003e \u003cp\u003eTo establish an emphysema model, male Bagg Albino (BALB/c) mice, aged 6 weeks and weighing 25\u0026ndash;30 g, were procured from Gem Phamatech Co., Ltd., located in Guangdong, China. C57 black 6 (C57BL/6) mice weighing between 25-30g were procured from Gem Phamatech Co., Ltd., Guangdong, China, for the purpose of conducting cellular analysis. In order to mitigate agonistic behavior and prevent the occurrence of diseases, appropriate measures were implemented for the care of animals. Specifically, all mice were accommodated in a pathogen-free animal facility, where they were housed in isolated cages that provided sufficient ventilation. Additionally, a 12-hour light/dark cycle was maintained, and the mice were given unrestricted access to food and water. It is important to note that all experiments conducted in this study were approved by the Animal Subjects Committee of Shenzhen People's Hospital (AUP-220714-CRC-0599-01).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3 Establishment of a model with emphysema\u003c/h2\u003e \u003cp\u003eThe BALB/c mice were administered intratracheal instillation of a mixture containing 7 ug LPS purified from Escherichia coli O26:B6 (Sigma-Aldrich, St. Gallen, Switzerland) and 1.8 U of porcine pancreatic elastase (Elastin Products Company, Owensville, MO) in 50-\u0026micro;L PBS for a total of four times. Following each exposure to LPS/elastase, subgroups of mice were intraperitoneally injected with either the BRD4 inhibitor JQ1 (50 mg/kg), the BRD4 degrader ARV-825 (10 and 20 mg/kg), or a control Vehicle on days 14, 17, 21, 24, 28, and 31 [26].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4 Lung histopathology\u003c/h2\u003e \u003cp\u003eThe left lungs of all mice were aseptically collected and subsequently fixed in 4% paraformaldehyde overnight. The following day, the lung tissues were embedded in paraffin and sectioned into 4-um thickness. These lung sections were then stained with H\u0026amp;E to facilitate the observation of histological changes. The degree of peri-bronchial inflammation was assessed using a scoring standard ranging from 0 to 4, as previously described [27]. In this scoring system, a score of 0 indicates the absence of inflammatory cells, while scores of 1, 2, 3, and 4 represent the presence of occasional, one layer, two layers, and more than two layers of inflammatory cells around the bronchi, respectively.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5 Lung function analysis in the emphysema model mice\u003c/h2\u003e \u003cp\u003eThe Forced Pulmonary Maneuver System (Buxco Research Systems, Wilmington, North Carolina, USA) was employed in accordance with the manufacturer's guidelines to assess fluctuations in lung function. The respiratory rate of anesthetized mice was standardized to an average of 150 breaths per minute. The study involved the execution of three semiautomatic maneuvers: (a) Boyle's law functional residual capacity (FRC), (b) quasi-static pressure volume (PV), and (c) fast flow volume (FV). The quasi-static PV maneuver was conducted to assess total lung capacity (TLC) and chord compliance (Cchord). Additionally, the fast FV maneuver was employed to measure forced expiration volumes (FEV50, FEV100, FEV200, and FEV300) in milliseconds, as well as forced vital capacity (FVC).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6 Bronchoalveolar lavage fluid (BALF) analysis\u003c/h2\u003e \u003cp\u003eFollowing the extraction of blood, the trachea and right lung were subjected to in-situ lavage using a prewarmed sterile solution of 0.9% NaCl saline, with a volume of 0.5 mL. The fluid obtained from this procedure was then examined to determine the total cell count in the bronchoalveolar lavage fluid (BALF) and utilized for the preparation of cyto-spin samples. The enumeration of total inflammatory cells, macrophages, neutrophils, and lymphocytes in the BALF was conducted using a hemacytometer.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.7 Protein extraction from lung tissues and western blotting\u003c/h2\u003e \u003cp\u003eTotal protein was extracted from lung homogenates and the protein concentration was determined using a BCA Protein Assay kit (Thermofisher, USA). Cell lysis was performed at a temperature of 100\u0026deg;C for a duration of 10 minutes, followed by the loading of 20-\u0026micro;g of protein into a 10% SDS-PAGE gel. Subsequently, the protein was transferred onto a PVDF membrane (Merck Millipore, Bedford, MA, USA) and incubated overnight at 4\u0026deg;C with antibodies against BRD4 (1:1000; A301985A100, Thermo-fisher, USA) and β-actin (1:3000; AB2001, AB Ways). The next day, following three rounds of washing with PBST, the samples underwent incubation with anti-rabbit-IgG horseradish peroxidase-conjugated secondary antibodies (CST, USA). Subsequently, the signals were detected through enhanced chemiluminescence (Merck Millipore, Bedford, MA, USA) and recorded using a Chemi Doc\u0026trade; MP Imager (Bio-Rad, USA). The Image J program was utilized to measure the integral optical density of each sample.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.8 Immunofluorescence staining\u003c/h2\u003e \u003cp\u003eThe lung sections were subjected to overnight incubation at 4\u0026deg;C with antibodies against CD68 (GB113109, Servicebio) and BRD4 (AB 128874, Abcam). Subsequently, the lung sections were exposed to a fluorescein isothiocyanate-labeled secondary antibody (GB22303, Servicebio) at room temperature for a duration of 1 hour. Furthermore, DAPI (G1012, Servicebio) was employed for nuclear staining, and anti-fluorescence quenching sealer (G1401, Servicebio) was administered. The visualization of staining was carried out using an inverted fluorescence microscope (Servicebio).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e2.9 Isolation and culturing of alveolar macrophages\u003c/h2\u003e \u003cp\u003eThe mice underwent tracheal lavage with 1 ml of PBS seven times to obtain BALF. BALF cells were isolated by centrifugation at 1500 rpm for 10 minutes and subsequently washed with PBS. To promote cell adherence, 12-well plates were utilized, with each well containing 3\u0026times;10\u003csup\u003e5\u003c/sup\u003e cells, and were incubated for 12 hours. Following incubation, the plates were washed twice with PBS to eliminate non-adherent cells. The adhered cells were cultured overnight in a solution containing 20 ng/mL IFN-γ (C746, Novo protein) and 1 mg/mL LPS (Sigma-Aldrich, St. Louis, MO, USA) to induce M1 polarization. Additionally, 20 ng/mL interleukin-4 (CK15, Novo protein) was used to induce M2 polarization. The M1 and M2 macrophages were subsequently harvested for quantitative PCR analysis, while the supernatant was collected for ELISA.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e2.10 RNA extraction for qPCR analysis and RNA-Seq followed analysis\u003c/h2\u003e \u003cp\u003eInduced sputum samples were collected and preformed with good quality control as previously described[13]. Transcriptomic data from sputum cells for RNA-sequencing were obtained by using the Illumina NovaSeq platform. The normalized gene count matrix was used to next transcriptomic analysis as described[13]. For a full set of transcriptomic data see the previous report[13]. Differentially expressed genes (DEGs) data from sputum cells analysis was performed using limma in R vegan package, among genes in BET protein family, \u003cem\u003eMMP12\u003c/em\u003e and \u003cem\u003eIRF4\u003c/em\u003e. Genes in BET protein family consists of \u003cem\u003eBRD1\u003c/em\u003e, \u003cem\u003eBRD2\u003c/em\u003e, \u003cem\u003eBRD3\u003c/em\u003e, \u003cem\u003eBRD4\u003c/em\u003e, \u003cem\u003eBRD7\u003c/em\u003e, \u003cem\u003eBRD8\u003c/em\u003e, \u003cem\u003eBRD9\u003c/em\u003e. Sets of M1 and M2 genes were based on selected classic genes in human expression publications. M1 markers includes 18 genes (\u003cem\u003eNOS2\u003c/em\u003e, \u003cem\u003eIL1A\u003c/em\u003e, \u003cem\u003eIL1B\u003c/em\u003e, \u003cem\u003eIL6\u003c/em\u003e, \u003cem\u003eIL12B\u003c/em\u003e, \u003cem\u003eTNF\u003c/em\u003e, \u003cem\u003eCXCL1\u003c/em\u003e, \u003cem\u003eIL1F9\u003c/em\u003e, \u003cem\u003eCXCL2\u003c/em\u003e, \u003cem\u003eCXCL9\u003c/em\u003e, \u003cem\u003eCXCL10\u003c/em\u003e, \u003cem\u003eCCL2\u003c/em\u003e, \u003cem\u003eIRF5\u003c/em\u003e, \u003cem\u003eIRF7\u003c/em\u003e, \u003cem\u003eIRF9\u003c/em\u003e, \u003cem\u003eSTAT1\u003c/em\u003e, \u003cem\u003eP65\u003c/em\u003e, \u003cem\u003eSPI1\u003c/em\u003e). M2 markers includes 12 genes (\u003cem\u003eARG1\u003c/em\u003e, \u003cem\u003eMRC1\u003c/em\u003e, \u003cem\u003eSTAT6\u003c/em\u003e, \u003cem\u003eIRF4\u003c/em\u003e, \u003cem\u003eMMP12\u003c/em\u003e, \u003cem\u003eADAM8\u003c/em\u003e, \u003cem\u003eADAM9\u003c/em\u003e, \u003cem\u003eIL10\u003c/em\u003e, \u003cem\u003eCCL17\u003c/em\u003e, \u003cem\u003eCCL22\u003c/em\u003e, \u003cem\u003eTGFB1\u003c/em\u003e, \u003cem\u003eTFRC\u003c/em\u003e). Gene Set Variation Analysis (GSVA) was used to calculate the enrichment score (ES) for each patient and for gene signatures of macrophages and neutrophils. ES values range from \u0026minus;\u0026thinsp;1 to 1. A linear model for transcriptomic data with Benjamini-Hochberg false discovery rate (FDR) correction was used in the analysis of the DEGs and for GSVA. Spearman Correlation between genes and genes, genes and clinical parameters, genes and ES were calculated.\u003c/p\u003e \u003cp\u003eIn order to perform cells and animal model qPCR analysis, total RNA was extracted from AMs using a UNIQ-10 Column Total RNA extraction Kit (IA24KA6842, Sangon Biotech, China). RNA isolation from lung homogenates of LPS/elastase-induced COPD model was performed using the Spin Column Animal Total RNA Purification Kit (HA14KA1972, Sangon Biotech, China). gDNA was removed, and total RNA was reverse transcribed into cDNA using PrimeScript\u0026trade; RT reagent Kit supplemented with gDNA Eraser (RR047A, TAKARA, China). qPCR was performed using TB Green\u0026reg; Premix Ex Taq\u0026trade; II (Tli RNase H Plus) (RR820A, TAKAR, China) on a CFX Connect\u0026trade; Real-Time PCR system (BIO-RAD, USA). The sequences of primers used were shown in (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimers used in the studies\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMouse primers\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer sequence 5\u0026rsquo;-3\u0026rsquo;\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003emouse \u003cem\u003eActb F\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGGCACGAAGGCTCATCATT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003emouse \u003cem\u003eActb\u003c/em\u003e R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGCGAGCATCCCCCAAAGTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003emouse \u003cem\u003eNos2\u003c/em\u003e F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCTGTGAGACCTTTGATG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003emouse \u003cem\u003eNos2\u003c/em\u003e R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCTATATTGCTGTGGCTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003emouse \u003cem\u003eTnf\u003c/em\u003e F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCACCACGCTCTTCTGTCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003emouse \u003cem\u003eTnf\u003c/em\u003e R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGCTACAGGCTTGTCACTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003emouse \u003cem\u003eIl1b\u003c/em\u003e F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAACCAACAAGTGATATTCTCCATG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003emouse \u003cem\u003eIl1b\u003c/em\u003e R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGATCCACACTCTCCAGCTGCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003emouse \u003cem\u003eArg1\u003c/em\u003e F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGAACCCAGAGAGAGCATGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003emouse \u003cem\u003eArg1\u003c/em\u003e R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTTTTCCAGCAGACCAGCTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003emouse \u003cem\u003eCcl17\u003c/em\u003e F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTGTGTTCGCCTGTAGTGCATA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003emouse \u003cem\u003eCcl17\u003c/em\u003e R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAGGAAGTTGGTGAGCTGGTATA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003emouse \u003cem\u003eTfrc\u003c/em\u003e F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATGCCGACAATAACATGAAGGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003emouse \u003cem\u003eTfrc\u003c/em\u003e R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACACGCTTACAATAGCCCAGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003emouse \u003cem\u003eIrf4\u003c/em\u003e F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAAAGGCAAGTTCCGAGAAGGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003emouse \u003cem\u003eIrf4\u003c/em\u003e R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTCGACCAATTCCTCAAAGTCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003emouse \u003cem\u003eMmp12\u003c/em\u003e F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCGGAGGGAACAGGTTGATGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003emouse \u003cem\u003eMmp12\u003c/em\u003e R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCTGCTGGGAACCTTCAGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eTotal amounts and integrity of RNA from cells were assessed using the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA). The RNA-Seq library was prepared using NEBNext Ultra RNA Library Prep Kit for Illumina (NEB, USA). After the construction of the library, 150bp\u0026times;2 paired-end sequences were generated using the Illumina NovaSeq 6000 system at Novogene, Shenzhen.\u003c/p\u003e \u003cp\u003eFor the RNA-seq analysis, raw reads were removed with the help of Trimmomatic v0.39 [28], and aligned to the mm10 mouse genome by Bowtie2 v2.2.5 [29]. Duplicate sequences were removed using MarkDuplicates v3.0.0 from Picard software (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://broadinstitute.github.io/picard/\u003c/span\u003e\u003cspan address=\"http://broadinstitute.github.io/picard/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). Gene expression level was quantified by Salmon v0.12[30] followed by normalization using trimmed mean of M-values (TMM) method in edgeR v3.32.1[31]. DEGs analysis among all groups was performed using edgeR's glmQLFTest. Significant DEGs were identified using a fold change\u0026thinsp;\u0026gt;\u0026thinsp;1.5 and FDR\u0026thinsp;\u0026lt;\u0026thinsp;0.05. Further, Gene Ontology and gene set enrichment analyses were performed using clusterProfiler v3.18.15[32] and GSEApy v0.10.46 [33], respectively, to investigate the biological functions of DEGs. Heatmaps were generated with the help of ComplexHeatmap v2.6.27 to visualize the expression level of DEGs.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e2.11 Cleavage Under Target \u0026amp; Tagmentation (CUT \u0026amp; Tag)-seq assay\u003c/h2\u003e \u003cp\u003eCUT \u0026amp; Tag-seq assay were performed by using NovoNGS\u0026reg; CUT\u0026amp;Tag\u0026reg; 4.0 High-Sensitivity Kit (for Illumina\u0026reg;) (N259-YH01-01B, Suzhou, China). Alveolar macrophages were bound by ConA-magnetic beads and were resuspended in primary antibody buffer (containing protease inhibitor cocktail, 5% digitonin and primary antibody BRD4 (1:100; A301985A100, Thermo-fisher, USA) overnight at 4\u0026deg;C. After washing, alveolar macrophages were incubated with a secondary antibody (1:200) at room temperature for 1 hour. After washing again, alveolar macrophages were incubated with transposome buffer at room temperature for 1 hour and tagmentation buffer at 37\u0026deg;C for 1 hour respectively. And termination of tagmentation was performed by adding stop buffer at 50\u0026deg;C for 10 minutes. Finally, DNA fragments were extracted by adding Tagment DNA extract beads. Amplified and cleaned DNA fragments were used for sequencing at the Illumina platform.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e2.12 CUT\u0026amp;Tag Sequencing data analysis\u003c/h2\u003e \u003cp\u003eRaw reads were trimmed and aligned to mm10 mouse genome as aforementioned mentioned. SEACR peak caller v1.3 with default parameters was employed to identify the binding peaks of BRD4 and H3K27ac [34]. Differential peaks between groups were caculated using DiffBind v3.8.4 [35], and the genomic region and genes around peaks were annotated by ChIPseeker v1.34.1[36]. The coverage of reads for each genome bin of 50 bp was quantified and standardized to counts per million (CPM) using bamCoverage function of deepTools v3.5.1 [37]. Further, R v4.1.0 was employed to construct heatmaps enriched around transcription start sites (TSS), and visualized using EnrichedHeatmap v1.28.1[38]. A binding density plot of gene body and enhancer regions was generated using ngsplot v2.61[39]. The identification of super-enhancers (SEs) was carried out by initially combining H3K27ac and BRD4 binding peaks with the help of mergeBed [40]. Following this, the ROSE algorithm was employed to compute enriched H3K27ac signals within 12.5 kb windows surrounding the merged binding sites. By ranking these stitched enhancer regions based on the H3K27ac signal, SEs were identified, and associated target genes were annotated[41]. Genomic signal tracks of desired genes were visualized in IGV browser v2.15.4[42].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e2.13 Overexpression experiment\u003c/h2\u003e \u003cp\u003ePrimary AMs were isolated from mice. The cells were cultured in antibiotic-free growth medium supplemented with 10% fetal bovine serum (FBS) (BioWest). All cells were cultured in a humidified incubator containing 5% CO2 at 37\u0026deg;C. For gene overexpression, the full-length mouse \u003cem\u003eIrf4\u003c/em\u003e sequence was cloned into a pReceiver-M02 Expression Clone (GeneCopoeia) which were transfected into cells using Lipofectamine 3000 reagents and Opti-MEM (Thermofisher) reagents.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e2.14 Statistical Analysis\u003c/h2\u003e \u003cp\u003eData were tested for normal distribution and homogeneity of variance. Differences were assessed with \u003cem\u003et\u003c/em\u003e test between 2 groups, and one-way analysis of variance (ANOVA) accompanied by Bonferroni\u0026rsquo;s difference post hoc test for \u0026ge;\u0026thinsp;3 groups. Data are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM. \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was regarded as statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"3 Results","content":"\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003e3.1 BRD4 was associated with key clinical events during COPD progression\u003c/h2\u003e \u003cp\u003eTo identify the clinically relevant genes and pathways involved in COPD development, induced sputum was collected from 94 patients with COPD and 36 healthy controls for mRNA sequencing characterization [13]. Notably, BET family proteins mediated epigenetic regulation were known for their critical role in the pathogenesis of various inflammatory diseases [19; 43] and the differential expression of \u003cem\u003eBRD1\u003c/em\u003e, \u003cem\u003eBRD2\u003c/em\u003e, \u003cem\u003eBRD3\u003c/em\u003e, \u003cem\u003eBRD4\u003c/em\u003e, \u003cem\u003eBRD7\u003c/em\u003e, \u003cem\u003eBRD8\u003c/em\u003e, \u003cem\u003eBRD9\u003c/em\u003e in patients with COPD and healthy controls were analyzed. In this study, it was shown that the expression levels of BRD4 were significantly increased in the sputum samples obtained from patients with COPD compared to the healthy control group in the Guangzhou cohort. These findings were subsequently confirmed in the Shenzhen cohort as well (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). We demonstrated that BRD4 exhibited stronger correlations with clinical indicators in comparison other genes within the same family (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). Specifically, an upregulation of BRD4 was associated with poorer lung function (negative correlation with post-bronchodilator forced expiratory volume in one second (FEV1) (% reference), r=-0.49%, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001), more severe dyspnea symptoms (positive correlation with modified Medical Research Council (mMRC), r\u0026thinsp;=\u0026thinsp;0.31, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), a higher degree of pulmonary emphysema (positive correlation with LAA950%, r\u0026thinsp;=\u0026thinsp;0.39, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.005) in Guangzhou cohort and validated in Shenzhen cohort (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). Meanwhile BRD4 displayed a negative correlation with Body Mass Index (BMI) and positive correlations with acute exacerbation frequency in the past one year, and these trends were subsequently validated in the Shenzhen cohort (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). Collectively, BRD4 exhibited stronger associations with clinical parameters.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eOf note, COPD is a chronic inflammatory lung disease that involves a variety of immune cells, including macrophages, neutrophils, and lymphocytes.[2] It has been previously found that induced sputum comprises a great amount of innate immune cells like macrophages and neutrophils with few parenchymal pulmonary cells. GSVA was used to calculate the ES of macrophage and neutrophil for each patient based on the specific gene expression. We observed that BRD4 expression significantly positively correlated with macrophage ES and neutrophil ES both in Guangzhou cohort and Shenzhen cohort (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD, Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eA, Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003eIn order to further validate the result in vivo, we established the elastase dosage dependent mouse model of emphysema using 0.7 ug LPS and 0 U, 0.6 U, 1.2 U, 1.8 U, 2.4 U, 3.0 U elastase intratracheal treatment for 4 weeks. Terminal readout was carried out one week after the last challenge. Using pulmonary function tests, initially, it was observed that 1.8 U elastase significantly change FEV100/FVC (%) in mice with LPS\u0026thinsp;+\u0026thinsp;elastase-induced emphysema (Figure \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003eA), whereas 1.2 U elastase induced significantly change on functional residual capacity (FRC) (Figure \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003eA). The number of inflammatory cells in BALF are upregulated even treatment with 0.6 U elastase (Figure \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003eB). Hemotoxylin and eosin (H\u0026amp;E) staining showed that 0.6 U elastase markedly increased lung inflammation in the vicinity of small airways and alveoli calculated according to inflammation score, and 1.2 U elastase treatment significantly expanded alveolar spaces in emphysema mice, which were validated by the statistical analysis of histological slides by calculating mean linear intercept (MLI) (Figure \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003eC, Figure \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003eD). In summary, we select 1.8 U elastase as the best amount to induce emphysema animal model. Subsequentially, the upregulation of BRD4 protein expression in lipopolysaccharide (LPS)\u0026thinsp;+\u0026thinsp;elastase-induced experimental emphysema model was verified (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE, \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eF). The immunofluorescence staining assay showed that BRD4 co-localized with macrophage-specific marker CD68 in lung tissues and displayed increased expression in emphysema mice compared with control mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eG). Collectively, these clinical results suggested a potential role of BRD4 in COPD development by regulating macrophage function.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003e3.2 BRD4 targeting alleviated experimental emphysema\u003c/h2\u003e \u003cp\u003eTo evaluate the potential of BRD4 as a therapeutic target for COPD, the BRD4 inhibitor JQ1 (at a dosage of 50 mg/kg) and the degrader ARV-825 (at dosages of 10 and 20 mg/kg) were intraperitoneally administered into mice with induced emphysema. This administration occurred twice a week for four consecutive weeks, commencing one week after the initiation of LPS\u0026thinsp;+\u0026thinsp;elastase treatment. Using pulmonary function tests, initially, it was observed that ARV-825 significantly improved FEV100/FVC (%) and suppressed FRC in mice with LPS\u0026thinsp;+\u0026thinsp;elastase-induced emphysema (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA), whereas no effect was observed on TLC. To investigate the impact of BRD4 inhibition on immune responses relevant to emphysema, the number of inflammatory cells in BALF was counted. It was found that treatment of JQ1 and ARV-825 significantly inhibited the infiltration of macrophages, neutrophils, and lymphocytes in BALF (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). Subsequently, H\u0026amp;E staining demonstrated that targeting BRD4 markedly alleviated lung inflammation in the vicinity of small airways and alveoli, and accompanied with reduction of the expanded alveolar spaces in emphysema mice, which were further validated by the statistical analysis of histological slides (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). It has been shown that the parameters of inflammation score and MLI were reduced by treatment of JQ1 and ARV-825 in emphysema mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD, \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE). In summary, these results strongly indicate that targeting BRD4 holds significant therapeutic potential for emphysema treatment.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003e3.3 BRD4 inhibition suppress both M1 and M2 alveolar macrophage polarization\u003c/h2\u003e \u003cp\u003eAs shown above, both the COPD cohort and experimental model showed that BRD4 expression displayed a significant association with macrophages during COPD development. Notably, both M1 and M2 macrophage polarization have been reported to be important to COPD development at different stages [44; 45]. As such, the effect of BRD4 targeting on macrophage polarization was further investigated, we found that BRD4 expression were significantly positively correlated with M1 polarization markers (\u003cem\u003eIL1A\u003c/em\u003e, \u003cem\u003eIL1B\u003c/em\u003e, \u003cem\u003eIL6\u003c/em\u003e, \u003cem\u003eTNF\u003c/em\u003e, \u003cem\u003eIL12B\u003c/em\u003e, \u003cem\u003eIL36G\u003c/em\u003e, \u003cem\u003eCXCL1\u003c/em\u003e, \u003cem\u003eCXCL2\u003c/em\u003e, \u003cem\u003eRELA\u003c/em\u003e, \u003cem\u003eSPI1\u003c/em\u003e, \u003cem\u003eIRF7\u003c/em\u003e, and \u003cem\u003eIRF9\u003c/em\u003e) in Guangzhou cohort, and these trends were partially validated in the Shenzhen cohort (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). Subsequently, it was shown that the targeting BRD4 with JQ1 and ARV-825 resulted in a significant decrease in the mRNA expression of \u003cem\u003eTnf\u003c/em\u003e and \u003cem\u003eIl1b\u003c/em\u003e in lung tissue, as well as a reduction in the release of IL-6 in BALF in the emphysema mice model (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo further investigate if BRD4 inhibition can block the M1 AMs polarization, the primary AMs were isolated for M1 polarization \u003cem\u003ein vitro\u003c/em\u003e by stimulating with LPS/IFN-γ for 24h while pretreatment was done with JQ1, ZL0420, and ARV-825 2h in advance for BRD4 inhibition. The application of RNA-seq analysis revealed that the inhibition of BRD4 using all three drugs resulted in significant suppression of genes associated with M1 polarization, as demonstrated by the heatmap representation (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC) of gene expression levels, including \u003cem\u003eIl1a\u003c/em\u003e, \u003cem\u003eIl1b\u003c/em\u003e, \u003cem\u003eIl6\u003c/em\u003e, \u003cem\u003eTnf\u003c/em\u003e, nitric oxide synthase 2 (\u003cem\u003eNos2\u003c/em\u003e), and prostaglandin-endoperoxide synthase 2 (\u003cem\u003ePtgS2\u003c/em\u003e) (Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). Venn diagram analysis revealed that 55.68% (1108/1990) of M1 macrophage-specific genes were downregulated under the effect of three different drugs (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD). In particular, 657 genes were down-regulated by all three drugs (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD). Further, GSEA revealed a significant enrichment of M1 macrophage-specific genes among those that ARV-825 downregulated (normalized enrichment score (NES) = -1.554, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE). The results of the Gene Ontology (GO) enrichment analysis indicated that the downregulation of M1 macrophage-specific genes caused by ARV-825 primarily affects processes related to the positive regulation of cytokine production, cytokine-mediated signaling pathway, regulation of immune effector process, leukocyte migration, responses to LPS, and regulation of inflammatory response, among others (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF). Heatmap analysis displayed a group of downregulated genes mediated by all three drugs, which mainly enriched in pathways of positive regulation of cytokine production, specifically IL-6 production (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eG). Finally, the verification of BRD4 inhibition-induced suppression of M1 macrophage-specific markers, including \u003cem\u003eTnf\u003c/em\u003e, \u003cem\u003eIl1b\u003c/em\u003e, and \u003cem\u003eNos2\u003c/em\u003e, was conducted using quantitative polymerase chain reaction (qPCR) analysis (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eH).\u003c/p\u003e \u003cp\u003eNext, the functional role of BRD4 during the M2 macrophage polarization was analyzed in COPD patients. As shown in the heatmap, BRD4 expressions were positively correlated with M2 markers in the Guangzhou cohort (\u003cem\u003eADAM8\u003c/em\u003e, \u003cem\u003eSTAT6\u003c/em\u003e, \u003cem\u003eTGFB\u003c/em\u003e, \u003cem\u003eARG1\u003c/em\u003e, and \u003cem\u003eIL10\u003c/em\u003e) and the Shenzhen cohort (\u003cem\u003eCCL22\u003c/em\u003e, \u003cem\u003eARG1\u003c/em\u003e, \u003cem\u003eIL10\u003c/em\u003e, \u003cem\u003eADAM8\u003c/em\u003e, \u003cem\u003eSTAT6\u003c/em\u003e, \u003cem\u003eIRF4\u003c/em\u003e and \u003cem\u003eTGFB\u003c/em\u003e) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). Subsequently, it was observed that BRD4 targeting with JQ1 and ARV-825 markedly decreased the mRNA expression of \u003cem\u003eArg1\u003c/em\u003e, \u003cem\u003eCcl17\u003c/em\u003e and \u003cem\u003eTfrc\u003c/em\u003e in lung tissue from the emphysema mouse (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eFurther, we investigated the effect of inhibition of BRD4 targeting on transcriptional changes in IL-4 induced M2 AMs using JQ1, ARV-825, and ZL0420. In total, 595 genes were upregulated in M2 macrophages, and the majority of these genes were suppressed by all three drugs (Table \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e). Among these upregulated genes, marker genes of M2 macrophage, including \u003cem\u003eArg1\u003c/em\u003e, \u003cem\u003eIl1r1\u003c/em\u003e, \u003cem\u003eCcr5\u003c/em\u003e, \u003cem\u003eSema4b\u003c/em\u003e, \u003cem\u003eCcl17\u003c/em\u003e, and \u003cem\u003eCish\u003c/em\u003e were all included (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). Venn diagram analysis revealed that 75.75% (421/595) of M2 macrophage-specific genes were downregulated under the effect of three different drugs (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). In particular, 281 genes were down-regulated by all three drugs (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). Further, GSEA revealed that M2 macrophage-specific genes were significantly enriched among those downregulated by ARV-825 (NES = -1.418, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001; Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE). The GO enrichment analysis revealed that the genes particular to M2 macrophages, which were downregulated by the influence of ARV-825, had a strong enrichment in immunological functions and remodeling processes. These processes encompassed myeloid leukocyte differentiation, leukocyte chemotaxis, and extracellular matrix organization (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF, \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eG). Lastly, all three anti-BRD4 drugs induced downregulation of M2 macrophage-specific markers such as \u003cem\u003eArg1\u003c/em\u003e and \u003cem\u003eCcl17\u003c/em\u003e were significantly downregulated by all three anti-BRD4 drugs (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eH). These results collectively indicated that BRD4 expression was strongly associated with both M1 and M2 macrophage polarization in clinical cohort and experimental COPD animal model, and its inhibition is potent enough to suppress both M1 and M2 AMs polarization \u003cem\u003ein vitro\u003c/em\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003e3.4 BRD4 regulates chromatin expression of M2 polarization-related genes by binding at promoter regions\u003c/h2\u003e \u003cp\u003ePrevious studies have already figured out that BRD4 promotes M1 macrophage polarization-related inflammatory response by facilitating the NF-κB pathway[46; 47]. However, there has been limited research on the role of BRD4 in promoting M2 AMs\u003c/p\u003e \u003cp\u003epolarization. Therefore, the subsequent inquiry aimed to clarify the molecular mechanism by which BRD4 influences the polarization of M2 AMs, which contributing to the development of COPD. The interaction between BRD4 and H3K27ac occurs through competitive binding mechanisms, enabling BRD4 to act as a scaffold for transcription factors (TFs) at both promoters and enhancers, therefore modulating the levels of gene expression [48]. A comprehensive analysis was conducted to examine the occupancy of BRD4/H3K27ac throughout the whole genome in M2 macrophages. The study conducted CUT\u0026amp;Tag analysis on IL-4-driven M2 AMs that were treated with or without ARV-825 \u003cem\u003ein vitro\u003c/em\u003e. This analysis involved the use of BRD4 and H3K27ac antibodies. In total, 38,800 peaks of BRD4 and 38,610 peaks of H3K27ac were obtained in M2 macrophages; among those, 96.4% of peaks were overlapped, which was slightly higher as in M0 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). Peaks were widely distributed across the genome, including promoter, introns, and distal intergenic regions. Originally, around 25% of BRD4 and H3K27ac peaks were specifically located in the promoter region (\u0026le;\u0026thinsp;1kb), which were decreased to \u0026lt;\u0026thinsp;20% upon treatment with ARV-825 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). Notably, a significant decrease in BRD4 and H3k27ac binding was observed in the nearby transcription start site (TSS) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC, D). In conclusion, the degradation of BRD4 resulted in the downregulation of genes involved in M2 macrophage polarizations by diminishing the co-binding of BRD4 and H3K27ac to the promoter.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003e3.5 BRD4 inhibition changes the dynamic enhancer epigenome in M2 macrophage\u003c/h2\u003e \u003cp\u003eTo further investigate the regulatory mechanisms underlying the effect of BRD4 inhibition over dynamic enhancer epigenome in M2 macrophages, genome-wide binding dynamics of BRD4 and H3K27ac were explored. In total, 24071 BRD4-associated genes and 20587 H3K27ac-associated genes were annotated. Among all, 86.89% (517/595) M2-specific genes were co-occupied with BRD4 and H3K27ac and only 5.04% (30/595) M2-specific genes were not associated with BRD4 and H3K27ac (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA). Moreover, genes exhibiting reduced BRD4 binding demonstrated a significantly greater fold change decrease compared to other genes after ARV-825 treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB). This suggests that genes directly regulated by BRD4 experience the most potent regulatory effect. GSEA was conducted to examine the downregulated genes affected by ARV-825, which indicated significant enrichment of genes associated with the lower peaks of BRD4 and H3K27ac (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC). BRD4 and H3K27ac-associated ARV-825 downregulated genes were primarily enriched in pathways related to immune response activation, regulation of immune response through cell surface receptors, signaling pathways mediated by cell surface receptors, leukocyte migration, positive regulation of innate immune response, regulation of DNA-binding transcription factor activity, myeloid leukocyte migration, and innate immune response activation pathways, etc. (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eD). In M2 AMs treated with ARV-825, CUT\u0026amp;Tag and RNA-seq analysis revealed genomic binding events of BRD4 and H3K27ac, and quantified gene expression levels in the whole genome. The data presented pertains to the gene loci associated with marker genes for M2 macrophage polarization, including \u003cem\u003eArg1\u003c/em\u003e, \u003cem\u003eCcl22\u003c/em\u003e, \u003cem\u003eCcr5\u003c/em\u003e, and \u003cem\u003eCcl17\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eE). These results suggest that BRD4 degraders might disrupt the enhancers of specific genes to regulate the polarization of macrophages.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec23\" class=\"Section2\"\u003e \u003ch2\u003e3.6 BRD4 inhibition disrupted IRF4 super-enhancer formation in M2 alveolar macrophages\u003c/h2\u003e \u003cp\u003eSEs, which regulate gene expression involved in multiple cellular processes including macrophage-associated immune responses, have broadly been identified as genomic regions with top-ranked enrichment(s) of H3K27ac and BRD4 [49]. To elucidate whether SEs are critical to the M2 AMs polarization, SEs were identified in M0, M2, and M2 macrophages treated with ARV-825 by analyzing BRD4 and H3K27ac CUT\u0026amp;Tag data with the help of the ROSE algorithm (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA). The 952 M2 and 829 M2/ARV-825 associated SEs were identified. The findings of this study demonstrate considerable modifications in H3K27ac and BRD4 binding patterns at many SEs during polarization of M2 cells. These alterations are significantly reversed by the administration of ARV-825, particularly at the SEs associated with \u003cem\u003eIrf4\u003c/em\u003e enhancer sites (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eB). This data uncovered a mechanism where the expression of \u003cem\u003eIrf4\u003c/em\u003e is increased in M2 due to the combined binding of BRD4 and H3K27ac to its SE site, while also being suppressed by ARV-825 interventions (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eC, D; Figure S3A). The binding sites of IRF4 were significantly overlapped with those of BRD4 and H3K27ac, and the binding capacity of IRF4 to BRD4 and H3K27ac peaks was significantly decreased following drug intervention (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eE, F; Figure S4A). As a result, the ability to bind to key downstream targets is diminished, leading to a significant decrease in \u003cem\u003eMmp12\u003c/em\u003e which is linked with emphysema during COPD (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eG) [50]. The further functional rescue experiment showed that over-expression of \u003cem\u003eIrf4\u003c/em\u003e in the ARV-825-treated M2 AMs can partially recover the BRD4 inhibition mediated suppression of \u003cem\u003eMmp12\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eH). In addition, it was observed that BRD4 targeting with JQ1 and ARV-825 markedly decreased both the mRNA expression of \u003cem\u003eIrf4\u003c/em\u003e and \u003cem\u003eMmp12\u003c/em\u003e in lung tissue in the emphysema mouse (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eI). Moreover, the clinical cohort analysis from both Guangzhou and Shenzhen showed that the expression of both \u003cem\u003eIRF4\u003c/em\u003e and \u003cem\u003eMMP12\u003c/em\u003e was elevated in COPD patients compared to healthy control, and the expression of \u003cem\u003eIRF4\u003c/em\u003e was significantly positively correlated with \u003cem\u003eMMP12\u003c/em\u003e in both cohorts (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eJ, Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eK). These results suggest that disruption of SE by BRD4 degraders inhibits key gene expression involved in M2 polarization and emphysema.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"4 Discussion","content":"\u003cp\u003eThe present study delves into the pivotal role of BRD4 within the immune system, elucidating their vital contribution to the pathogenesis of chronic airway inflammatory diseases, particularly in the context of emphysema. A significant increase in the expression of BRD4 has been seen in the produced sputum of patients with COPD, as well as in the macrophages of mice in the experimental model of emphysema. Additionally, through analysis of RNA-seq data from two separate clinical cohorts in China, it was found that the expression of BRD4 was strongly correlated with both clinical parameters and the expression of macrophage polarization markers. Crucially, the present findings provided compelling evidence that targeting BRD4 using JQ1 and ARV-825 yields substantial therapeutic benefits, including improved lung function, alleviation of lung inflammatory responses, reduction of air space enlargement in the experimental emphysema model, achieved through the inhibition of both M1 and M2 alveolar polarization. In particular, the current research elucidated the regulatory mechanism of BRD4 inhibition mediated suppression of M2 AMs polarization, which at least partially involved the disruption of the SEs of \u003cem\u003eIrf4\u003c/em\u003e, and thereby further impacted the expression of \u003cem\u003eMmp12\u003c/em\u003e, a vital pathogenic gene of emphysema. The aforementioned findings indicate that the epigenetic machinery of BETs in AMs has promise as a viable target for therapeutic interventions in COPD.\u003c/p\u003e \u003cp\u003eInitially, the BET family proteins were analyzed in clinical cohort RNA-seq data, the present study revealed a notable upregulation of BRD4 in the Guangzhou cohort, which also exhibited a statistically significant rise in the Shenzhen cohort. Further analysis revealed that BRD4 had a strong correlation with clinical index mMRC and post FEV1 (% reference), which are the key parameters for evaluating COPD severity. In particular, it was interesting to observe that LAA-950, a parameter to test the extent of emphysema generated by CT scanning, was significantly positively correlated to BRD4 expression. Moreover, the results exhibited a significant correlation between BRD4 expression and macrophage with the help of GSEV analysis, which was verified in the experimental emphysema mouse model. The present outcomes were also supported by a study from Duan et al. (2023) [51], which reported that BRD4 expression was strongly associated with COPD viral exacerbation and also demonstrated that BRD4 expression both in the blood and in the sputum were significantly correlated with FEV1% predicted in stable COPD patients. Tang et al. (2019) [52] reported a correlation between BRD4 expression and lung function by analyzing COPD lung tissue samples and detected an increased expression of BRD4 in the nuclei of bronchial epithelial cells by immuno-histofluorescence. In this study, the BET family proteins were analyzed in the sputum from two independent COPD cohorts. The proposal suggests that further investigation is needed to validate the functional significance of BRD4 in macrophages during the development of COPD, given that macrophages are a prominent immune cell type in sputum samples.\u003c/p\u003e \u003cp\u003eBefore conducting the functional analysis of BRD4 targeting in the disease model, a precise intratracheal instillation approach was constructed to directly administer LPS/elastase into the lungs. This technique was used to produce COPD in a mouse model, following a procedure developed by Yadava et al. (2016) [26]. Furthermore, it has been determined that an elastase concentration of 1.8 U is suitable for conducting intervention studies (Figure \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e). Previous research has been conducted to investigate the impact of BRD4 inhibition in cigarette-induced COPD animal models [53]. Insufficient research has been conducted to establish the therapeutic efficacy of targeting BRD4 in the treatment of emphysema. To bridge this knowledge gap, the current study was conducted to examine the effects of BRD4 targeting through the use of JQ1 and ARV-825 in a mouse model of emphysema. The findings revealed that BRD4 inhibition significantly reduced the lung inflammatory response in emphysema mice, improved lung function, and air space enlargement as well. Panagis Filippakopoulos et al. (2010) published a seminal study introducing JQ1, a small chemical compound with the ability to permeate cell membranes. JQ1 was found to competitively bind to acetyl-lysine recognition motifs, specifically targeting bromodomains. This compound was quickly acknowledged as a pioneering selective inhibitor of BRD4, making it a valuable tool for cancer biology research [54]. The first confidential evidence demonstrating that BRD4 inhibition with JQ1 was a potential therapeutic approach for inflammatory diseases involving macrophage-mediated immune responses was provided by the Gerald V. Denis laboratory in 2013. They showed that BRD2 and BRD4 physically regulated the activity at the promoters of inflammatory genes in macrophages, which were inhibited by the treatment with JQ1, and consequently protected mice from an LPS-induced cytokine storm and death [55]. Owing to the crucial role of BRD4 in various disease pathogenesis, a diverse type of BRD4 modulators have been designed for a variety of disease interventions including autoimmune diseases, organ fibrosis, vascular diseases, and inflammatory lung diseases. Within the field of COPD, Liu et al. (2021) conducted a study investigating the potential protective effects of JQ1 against COPD produced by cigarette smoke (CS) in mice[53]. In a similar vein, Zakarya and colleagues determined that JQ1 can suppress small airway fibrosis associated with COPD [19]. In 2015, Craig M Crews and his research group utilized PROTAC technology to develop ARV-825. This compound functions by recruiting BRD4 to the E3 ubiquitin ligase cereblon, leading to the rapid, efficient, and sustained degradation of BRD4 through the proteasome pathway. Notably, ARV-825 demonstrates superior efficacy in inhibiting c-MYC expression and suppressing cancer cell growth compared to other BRD4 inhibitors, such as JQ1 and OTX015 [56]. This study is the first to explore the therapeutic potential of inflammatory diseases. As anticipated, it was observed that the 20 mg/kg of ARV-825 exhibited a similar ability to 50 mg/kg of JQ1 in ameliorating the experimental emphysema. Additionally, a concentration of 0.2 \u0026micro;mol of ARV-825 was more effective than 1 \u0026micro;mol of JQ1 and 80 \u0026micro;mol of Zl0420 to suppress M2 AMs polarization \u003cem\u003ein vitro\u003c/em\u003e. Hence, the findings indicate that the utilization of small compounds based on PROTAC exhibits significant potential for therapeutic intervention in chronic inflammatory lung diseases.\u003c/p\u003e \u003cp\u003eThis study aimed to investigate the inhibitory effect of targeting BRD4 on the inflammatory response generated by LPS/elastase. This choice was supported by recent reports indicating that BRD4 has the potential to influence the activation of inflammatory cells by disrupting the Janus kinase/signal transducers and activators of transcription (JAK/STAT) and nuclear factor kappa B (NF-κB) signaling pathways [57; 58]. Similarly, it was shown that BRD4 inhibition significantly blocked the M1 AMs polarization, however, it was more attractive to see the improvement of air space enlargement. It was speculated that BRD4 inhibition caused the suppression of M2 AMs, suggesting its significance in this particular process. Moreover, in this study, the underlying mechanism of how BRD4 regulated the M2 AMs polarization was also elucidated and thereby contributed to the development of COPD in the part of the mechanistic study.\u003c/p\u003e \u003cp\u003eYoung et al. (2013), first proposed SEs, a large cluster of transcriptional enhancers comprising a complex array of sequence elements that drive the expression of specific genes. SEs are much more likely to work as modulators of the vital processes in normal cells and pathological processes compared to conventional enhancers [59]. Recently, there has been a growing body of researches that have been dedicated to investigating the impact of SEs on the development of abnormal transcriptional programs in immune cell dysfunction. Several studies have examined the functional involvement of BRD4 in the process of M2 macrophage polarization. However, one study conducted by Das et al. (2021) has reported on the promotion of M2 polarization during \u003cem\u003eLeishmania donovani\u003c/em\u003e parasite infection through the transcription of miR146a-5p, which is controlled by SE [49]. Therefore, the role of SEs in M2 polarization is still largely unknown. The present study observed a high enrichment of SEs in M2 macrophages in relation to H3K27ac/BRD4 co-occupied areas. Specifically, there were 952 instances of enrichment. However, when ARV-825 therapy was administered, the number of enriched SEs decreased to 829. This finding aligns with a previous investigation in 2023 conducted by Carelock \u003cem\u003eet al.\u003c/em\u003e [60]. Through the examination of RNA-seq data from M2 AMs subjected to treatment with BRD4 inhibitors and degraders, it was shown that IRF4, a crucial transcription factor necessary for M2 polarization, is the sole gene that experiences suppression by all three anti-BRD4 drugs. As expected, the administration of ARV-825 exhibited a notable reduction of SEs in the gene regulatory regions involving the transcription factor \u003cem\u003eIrf4\u003c/em\u003e, as well as inhibition of BRD4. These combined effects had a discernible impact on the expression of downstream markers associated with M2 polarization, such as MMP12. MMP12 plays a key role in regulating emphysema in individuals suffering from COPD [50]. Subsequently, the data demonstrated that ARV-825 treatment reduced the binding sites of IRF4 on \u003cem\u003eMmp12\u003c/em\u003e, and similar results were presented in 2021 by Fu \u003cem\u003eet al.\u003c/em\u003e [61]. This work offers valuable insights into the impact of anti-BRD4 medicines and their associated side effects, as well as the regulatory role of IRF4 in M2 AMs among patients with COPD. Furthermore, it identifies possible therapeutic targets for future studies. In addition, relationship between IRF4 and MMP12 were verified in the clinical cohort by a functional rescue experiment involving over expression of IRF4. It is worth mentioning that chromatin immunoprecipitation sequencing (CHIP-seq) is a well-documented epigenetic technique utilized for the identification of SEs through the profiling of H3K27ac and BRD4. Nevertheless, the current approaches frequently encounter difficulties related to the requirement for greater cell inputs, as well as the time-consuming and intricate nature of the operation. In the present work the CUT \u0026amp; Tag technique was applied to replace CHIP-seq as it is much faster than CHIP-seq and reduced sequencing depths. Specifically, this technique allows for the utilization of smaller cell inputs, which are very appropriate for the study of primary AMs separated by BALF. To the best of our knowledge, this research is the pioneering work which applied this technology for the analysis of AMs.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn conclusion, this study's clinical cohort revealed a stronger correlation between BRD4 and COPD evaluating parameters. The \u003cem\u003ein vivo\u003c/em\u003e experiments demonstrated that BRD4 inhibition effectively mitigated mouse emphysema by suppressing both M1 and M2 AMs polarization. Lastly, a novel mechanism by which BRD4 regulates the M2 AMs polarization by disrupting the formation of IRF4 SEs was uncovered by using the novel CUT\u0026amp; Tag assay. Taken together, the current study strongly suggests that targeting BRD4 in macrophages holds potential as a therapeutic approach for COPD.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cdiv class=\"DefinitionList\"\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eAMs\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eAlveolar macrophages\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eBET\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eBromodomain and extra-terminal\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eBRD4\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eBromodomain-containing protein 4\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eBALF\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eBronchoalveolar lavage fluid\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eBMI\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eBody mass index\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eCOPD\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eChronic obstructive pulmonary disease\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eCchord\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eChord compliance\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eCPM\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eCounts per million\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eES\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eEnrichment score\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eFDR\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eFalse discovery rate\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eFV\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eFast flow volume\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eFVC\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eForced vital capacity\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eFEV1\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eForced expiratory volume in 1 s\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eFRC\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eFunctional residual capacity\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eGSVA\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eGene set variation analysis\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eH3K27ac\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eHistone H3 on lysine 27 acetylation\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eLPS\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eLipopolysaccharides; SEs:super-enhancers\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eMMP12\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eMatrix metalloproteinase 12\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003emMRC\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eModified medical research council\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eMLI\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eMean linear intercept\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eNos2\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eNitric oxide synthase 2\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003ePROTAC\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eProteolytic targeting chimera\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003ePV\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eQuasi-static pressure volume\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003ePtgS2\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eProstaglandin-endoperoxide synthase 2\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eTLC\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eTotal lung capacity\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eTMM\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eTrimmed mean of m-values\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eTSS\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eTranscription start site\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eD.L., X.S., Y.Y., and Y.D. contributed equally to this work and should be considered co-first authors. D.L., and S.C. contributed to concept and design. D.L., X.S., Y.Y., and Y.D. performed acquisition, analysis, and interpretation of data. D.L., and S.C. drafted the manuscript. D.L., X.S., Y.Y., performed statistical analysis. Q.M., D.C., S.C., J.W., G.W., Z.L., F.W., J.G., Y.L., D.W., J.H., R.L., H.X., and L.R., provided administrative, technical, or material support. L.R., S.C., L.W., and R.C. performed supervision. All authors reviewed the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe raw transcriptomic data and Cut\u0026amp;tag data for this study have been deposited in the Gene Expression Omnibus (GEO, https://db.cngb.org/cnsa/) under GSE number (GSE248961, GSE248962, GSE250232). The authors declare that all data supporting the results in this study are available in the paper and Supplementary Materials. Source data are available from the corresponding authors upon reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the National Key R\u0026amp;D Program of China (2022YFF0710800 and 2022YFF0710802); the National Natural Science Foundation of China (82170042, 82222035, 32100914, and 32100734); Natural Science Foundation of Guangdong province, China (2021A1515010478 and 2214050008970); Guangzhou Science and Technology Plans (202201020513); Shenzhen Science Technology and Innovative Commission (SZSTI) (JCYJ20210324114400002, KCXFZ202002011008256, and JCYJ20220530152800001).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors have seen the manuscript and approved the submission.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eA. Agusti, B.R. Celli, G.J. Criner, D. Halpin, A. Anzueto, P. Barnes, et al., Global Initiative for Chronic Obstructive Lung Disease 2023 Report: GOLD Executive Summary. Eur Respir J. 2023; 61.\u003c/li\u003e\n\u003cli\u003eP.J. Barnes, Immunology of asthma and chronic obstructive pulmonary disease. Nat Rev Immunol. 2008; 8: 183-92.\u003c/li\u003e\n\u003cli\u003eS. Arora, K. Dev, B. Agarwal, P. Das, and M.A. Syed, Macrophages: Their role, activation and polarization in pulmonary diseases. Immunobiology. 2018; 223: 383-396.\u003c/li\u003e\n\u003cli\u003eT.A. Wynn, A. Chawla, and J.W. Pollard, Macrophage biology in development, homeostasis and disease. Nature. 2013; 496: 445-55.\u003c/li\u003e\n\u003cli\u003eT. McLaughlin, S.E. Ackerman, L. Shen, and E. Engleman, Role of innate and adaptive immunity in obesity-associated metabolic disease. J Clin Invest. 2017; 127: 5-13.\u003c/li\u003e\n\u003cli\u003eY.D. Woo, D. Jeong, and D.H. Chung, Development and Functions of Alveolar Macrophages. Mol Cells. 2021; 44: 292-300.\u003c/li\u003e\n\u003cli\u003eD. Mei, W. Liao, P. Gan, Q. Tran, C. Chan, C. Heng, et al., Angiotensin II type-2 receptor activation in alveolar macrophages mediates protection against cigarette smoke-induced chronic obstructive pulmonary disease. 2022; 184: 106469.\u003c/li\u003e\n\u003cli\u003eR. Vlahos, and S.J.F.i.i. Bozinovski, Role of alveolar macrophages in chronic obstructive pulmonary disease. 2014; 5: 435.\u003c/li\u003e\n\u003cli\u003eB. Spix, E.S. Butz, C.-C. Chen, A.S. Rosato, R. Tang, A. Jeridi, et al., Lung emphysema and impaired macrophage elastase clearance in mucolipin 3 deficient mice. Nature Communications. 2022; 13: 318.\u003c/li\u003e\n\u003cli\u003eJ.B. Trojanek, A. Cobos-Correa, S. Diemer, M. Kormann, S.C. Schubert, Z. Zhou-Suckow, et al., Airway mucus obstruction triggers macrophage activation and matrix metalloproteinase 12-dependent emphysema. Am J Respir Cell Mol Biol. 2014; 51: 709-20.\u003c/li\u003e\n\u003cli\u003eK.J. Warren, X. Fang, N.M. Gowda, J.J. Thompson, and N.M. Heller, The TORC1-activated Proteins, p70S6K and GRB10, Regulate IL-4 Signaling and M2 Macrophage Polarization by Modulating Phosphorylation of Insulin Receptor Substrate-2. J Biol Chem. 2016; 291: 24922-24930.\u003c/li\u003e\n\u003cli\u003eJ.W. Lee, W. Chun, H.J. Lee, J.H. Min, S.M. Kim, J.Y. Seo, et al., The Role of Macrophages in the Development of Acute and Chronic Inflammatory Lung Diseases. Cells. 2021; 10.\u003c/li\u003e\n\u003cli\u003eZ. Yan, B. Chen, Y. Yang, X. Yi, M. Wei, G. Ecklu-Mensah, et al., Multi-omics analyses of airway host-microbe interactions in chronic obstructive pulmonary disease identify potential therapeutic interventions. Nat Microbiol. 2022; 7: 1361-1375.\u003c/li\u003e\n\u003cli\u003eG. Benincasa, D.L. DeMeo, K. Glass, E.K. Silverman, and C. Napoli, Epigenetics and pulmonary diseases in the horizon of precision medicine: a review. Eur Respir J. 2021; 57.\u003c/li\u003e\n\u003cli\u003eJ.E. Lee, Y.K. Park, S. Park, Y. Jang, N. Waring, A. Dey, et al., Brd4 binds to active enhancers to control cell identity gene induction in adipogenesis and myogenesis. Nat Commun. 2017; 8: 2217.\u003c/li\u003e\n\u003cli\u003eJ. Wilflingseder, M. Willi, H.K. Lee, H. Olauson, J. Jankowski, T. Ichimura, et al., Enhancer and super-enhancer dynamics in repair after ischemic acute kidney injury. Nat Commun. 2020; 11: 3383.\u003c/li\u003e\n\u003cli\u003eT. Hua, H. Wang, X. Fan, N. An, J. Li, H. Song, et al., BRD4 Inhibition Attenuates Inflammatory Pain by Ameliorating NLRP3 Inflammasome-Induced Pyroptosis. Front Immunol. 2022; 13: 837977.\u003c/li\u003e\n\u003cli\u003eM.S. Stratton, R.A. Bagchi, M.B. Felisbino, R.A. Hirsch, H.E. Smith, A.S. Riching, et al., Dynamic Chromatin Targeting of BRD4 Stimulates Cardiac Fibroblast Activation. Circ Res. 2019; 125: 662-677.\u003c/li\u003e\n\u003cli\u003eR. Zakarya, Y.L. Chan, S. Rutting, K. Reddy, J. Bozier, R.R. Woldhuis, et al., BET proteins are associated with the induction of small airway fibrosis in COPD. Thorax. 2021; 76: 647-655.\u003c/li\u003e\n\u003cli\u003eS. Sui, J. Zhang, S. Xu, Q. Wang, P. Wang, and D. Pang, Ferritinophagy is required for the induction of ferroptosis by the bromodomain protein BRD4 inhibitor (+)-JQ1 in cancer cells. Cell Death Dis. 2019; 10: 331.\u003c/li\u003e\n\u003cli\u003eS.L. Kim, H.S. Choi, and D.S. Lee, BRD4/nuclear PD-L1/RelB circuit is involved in the stemness of breast cancer cells. Cell Commun Signal. 2023; 21: 315.\u003c/li\u003e\n\u003cli\u003eY. Chen, L. Xu, A. Mayakonda, M.L. Huang, D. Kanojia, T.Z. Tan, et al., Bromodomain and extraterminal proteins foster the core transcriptional regulatory programs and confer vulnerability in liposarcoma. Nat Commun. 2019; 10: 1353.\u003c/li\u003e\n\u003cli\u003eN. Modi, Y. Chen, X. Dong, X. Hu, G.W. Lau, K.T. Wilson, et al., BRD4 Regulates Glycolysis-Dependent Nos2 Expression in Macrophages Upon H pylori Infection. Cell Mol Gastroenterol Hepatol. 2023.\u003c/li\u003e\n\u003cli\u003eX. He, L. Jiang, L. Hu, P. Du, M. Zhu, H. Wu, et al., Mivebresib alleviates systemic lupus erythematosus-associated diffuse alveolar hemorrhage via inhibiting infiltration of monocytes and M1 polarization of macrophages. Int Immunopharmacol. 2023; 120: 110305.\u003c/li\u003e\n\u003cli\u003eT. Yang, Y. Hu, J. Miao, J. Chen, J. Liu, Y. Cheng, et al., A BRD4 PROTAC nanodrug for glioma therapy via the intervention of tumor cells proliferation, apoptosis and M2 macrophages polarization. Acta Pharm Sin B. 2022; 12: 2658-2671.\u003c/li\u003e\n\u003cli\u003eK. Yadava, C. Pattaroni, A.K. Sichelstiel, A. Trompette, E.S. Gollwitzer, O. Salami, et al., Microbiota Promotes Chronic Pulmonary Inflammation by Enhancing IL-17A and Autoantibodies. Am J Respir Crit Care Med. 2016; 193: 975-87.\u003c/li\u003e\n\u003cli\u003eR. Chen, Q. Zhang, S. Chen, H. Tang, P. Huang, S. Wei, et al., IL-17F, rather than IL-17A, underlies airway inflammation in a steroid-insensitive toluene diisocyanate-induced asthma model. Eur Respir J. 2019; 53.\u003c/li\u003e\n\u003cli\u003eA.M. Bolger, M. Lohse, and B. Usadel, Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics. 2014; 30: 2114-20.\u003c/li\u003e\n\u003cli\u003eB. Langmead, and S.L. Salzberg, Fast gapped-read alignment with Bowtie 2. Nat Methods. 2012; 9: 357-9.\u003c/li\u003e\n\u003cli\u003eR. Patro, G. Duggal, M.I. Love, R.A. Irizarry, and C. Kingsford, Salmon provides fast and bias-aware quantification of transcript expression. Nat Methods. 2017; 14: 417-419.\u003c/li\u003e\n\u003cli\u003eM.D. Robinson, D.J. McCarthy, and G.K. Smyth, edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics. 2010; 26: 139-40.\u003c/li\u003e\n\u003cli\u003eG. Yu, L.G. Wang, Y. Han, and Q.Y. He, clusterProfiler: an R package for comparing biological themes among gene clusters. OMICS. 2012; 16: 284-7.\u003c/li\u003e\n\u003cli\u003eZ. Fang, X. Liu, and G. Peltz, GSEApy: a comprehensive package for performing gene set enrichment analysis in Python. Bioinformatics. 2023; 39.\u003c/li\u003e\n\u003cli\u003eM.P. Meers, D. Tenenbaum, and S. Henikoff, Peak calling by Sparse Enrichment Analysis for CUT\u0026amp;RUN chromatin profiling. Epigenetics Chromatin. 2019; 12: 42.\u003c/li\u003e\n\u003cli\u003eR.S. \u0026lowast;, and G.B. \u0026dagger;, DiffBind: Differential binding analysis of ChIP- Seq peak data.\u003c/li\u003e\n\u003cli\u003eQ. Wang, M. Li, T. Wu, L. Zhan, L. Li, M. Chen, et al., Exploring Epigenomic Datasets by ChIPseeker. Curr Protoc. 2022; 2: e585.\u003c/li\u003e\n\u003cli\u003eF. Ramirez, D.P. Ryan, B. Gruning, V. Bhardwaj, F. Kilpert, A.S. Richter, et al., deepTools2: a next generation web server for deep-sequencing data analysis. Nucleic Acids Res. 2016; 44: W160-5.\u003c/li\u003e\n\u003cli\u003eZ. Gu, R. Eils, M. Schlesner, and N. Ishaque, EnrichedHeatmap: an R/Bioconductor package for comprehensive visualization of genomic signal associations. BMC Genomics. 2018; 19: 234.\u003c/li\u003e\n\u003cli\u003eL. Shen, N. Shao, X. Liu, and E. Nestler, ngs.plot: Quick mining and visualization of next-generation sequencing data by integrating genomic databases. BMC Genomics. 2014; 15: 284.\u003c/li\u003e\n\u003cli\u003eA.R. Quinlan, and I.M. Hall, BEDTools: a flexible suite of utilities for comparing genomic features. Bioinformatics. 2010; 26: 841-2.\u003c/li\u003e\n\u003cli\u003eJ. Loven, H.A. Hoke, C.Y. Lin, A. Lau, D.A. Orlando, C.R. Vakoc, et al., Selective inhibition of tumor oncogenes by disruption of super-enhancers. Cell. 2013; 153: 320-34.\u003c/li\u003e\n\u003cli\u003eH. Thorvaldsdottir, J.T. Robinson, and J.P. Mesirov, Integrative Genomics Viewer (IGV): high-performance genomics data visualization and exploration. Brief Bioinform. 2013; 14: 178-92.\u003c/li\u003e\n\u003cli\u003eA. Dey, W. Yang, A. Gegonne, A. Nishiyama, R. Pan, R. Yagi, et al., BRD4 directs hematopoietic stem cell development and modulates macrophage inflammatory responses. EMBO J. 2019; 38.\u003c/li\u003e\n\u003cli\u003eM.S. Eapen, P.M. Hansbro, K. McAlinden, R.Y. Kim, C. Ward, T.L. Hackett, et al., Abnormal M1/M2 macrophage phenotype profiles in the small airway wall and lumen in smokers and chronic obstructive pulmonary disease (COPD). Sci Rep. 2017; 7: 13392.\u003c/li\u003e\n\u003cli\u003eP.S. Hiemstra, Altered macrophage function in chronic obstructive pulmonary disease. Ann Am Thorac Soc. 2013; 10 Suppl: S180-5.\u003c/li\u003e\n\u003cli\u003eK. Hao, W. Jiang, M. Zhou, H. Li, Y. Chen, F. Jiang, et al., Targeting BRD4 prevents acute gouty arthritis by regulating pyroptosis. Int J Biol Sci. 2020; 16: 3163-3173.\u003c/li\u003e\n\u003cli\u003eY. Bao, X. Wu, J. Chen, X. Hu, F. Zeng, J. Cheng, et al., Brd4 modulates the innate immune response through Mnk2-eIF4E pathway-dependent translational control of I\u0026kappa;B\u0026alpha;. 2017; 114: E3993-E4001.\u003c/li\u003e\n\u003cli\u003eD. Sengupta, A. Kannan, M. Kern, M.A. Moreno, E. Vural, B. Stack, Jr., et al., Disruption of BRD4 at H3K27Ac-enriched enhancer region correlates with decreased c-Myc expression in Merkel cell carcinoma. Epigenetics. 2015; 10: 460-6.\u003c/li\u003e\n\u003cli\u003eS. Das, S. Mukherjee, and N. Ali, Super enhancer-mediated transcription of miR146a-5p drives M2 polarization during Leishmania donovani infection. PLoS Pathog. 2021; 17: e1009343.\u003c/li\u003e\n\u003cli\u003eS. Shibata, K. Miyake, T. Tateishi, S. Yoshikawa, Y. Yamanishi, Y. Miyazaki, et al., Basophils trigger emphysema development in a murine model of COPD through IL-4-mediated generation of MMP-12-producing macrophages. Proc Natl Acad Sci U S A. 2018; 115: 13057-13062.\u003c/li\u003e\n\u003cli\u003eY. Duan, S. Zhou, and J. Wang, BRD4 is involved in viral exacerbation of chronic obstructive pulmonary disease. Respir Res. 2023; 24: 37.\u003c/li\u003e\n\u003cli\u003eK. Tang, J. Zhao, J. Xie, and J. Wang, Decreased miR-29b expression is associated with airway inflammation in chronic obstructive pulmonary disease. Am J Physiol Lung Cell Mol Physiol. 2019; 316: L621-L629.\u003c/li\u003e\n\u003cli\u003eY. Liu, Z.Z. Huang, L. Min, Z.F. Li, and K. Chen, The BRD4 inhibitor JQ1 protects against chronic obstructive pulmonary disease in mice by suppressing NF-kappaB activation. Histol Histopathol. 2021; 36: 101-112.\u003c/li\u003e\n\u003cli\u003eP. Filippakopoulos, J. Qi, S. Picaud, Y. Shen, W.B. Smith, O. Fedorov, et al., Selective inhibition of BET bromodomains. Nature. 2010; 468: 1067-73.\u003c/li\u003e\n\u003cli\u003eA.C. Belkina, B.S. Nikolajczyk, and G.V. Denis, BET protein function is required for inflammation: Brd2 genetic disruption and BET inhibitor JQ1 impair mouse macrophage inflammatory responses. J Immunol. 2013; 190: 3670-8.\u003c/li\u003e\n\u003cli\u003eJ. Lu, Y. Qian, M. Altieri, H. Dong, J. Wang, K. Raina, et al., Hijacking the E3 Ubiquitin Ligase Cereblon to Efficiently Target BRD4. Chem Biol. 2015; 22: 755-63.\u003c/li\u003e\n\u003cli\u003eG. Deng, F. Zeng, J. Su, S. Zhao, R. Hu, W. Zhu, et al., BET inhibitor suppresses melanoma progression via the noncanonical NF-kappaB/SPP1 pathway. Theranostics. 2020; 10: 11428-11443.\u003c/li\u003e\n\u003cli\u003eL. Xu, J. Jiao, M. Liu, Y. Qin, M. Zhang, D. Yan, et al., A Combination of CPI-0610 and SAHA Induces Apoptosis through STAT3 and p38 Signalling Pathways in Diffuse Large B-cell Lymphoma Cells. Curr Med Chem. 2023.\u003c/li\u003e\n\u003cli\u003eW.A. Whyte, D.A. Orlando, D. Hnisz, B.J. Abraham, C.Y. Lin, M.H. Kagey, et al., Master transcription factors and mediator establish super-enhancers at key cell identity genes. Cell. 2013; 153: 307-19.\u003c/li\u003e\n\u003cli\u003eM.E. Carelock, R.P. Master, M.-C. Kim, Z. Jin, L. Wang, C.K. Maharjan, et al., Targeting intracellular proteins with cell type-specific functions for cancer immunotherapy. Life Medicine. 2023; 2: lnad019.\u003c/li\u003e\n\u003cli\u003eY. Fu, A. Saraswat, Z. Wei, M.Y. Agrawal, V.V. Dukhande, S.E. Reznik, et al., Development of Dual ARV-825 and Nintedanib-Loaded PEGylated Nano-Liposomes for Synergistic Efficacy in Vemurafnib-Resistant Melanoma. Pharmaceutics. 2021; 13.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"chronic obstructive pulmonary disease (COPD), bromodomain-containing protein 4 (BRD4), alveolar macrophage polarization, super-enhancers, ARV-825","lastPublishedDoi":"10.21203/rs.3.rs-3788052/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3788052/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eChronic obstructive pulmonary disease (COPD) is a progressive chronic lung disease characterized by chronic airway inflammation and emphysema. Macrophage polarization plays an important role in COPD pathogenesis by secreting inflammatory mediators. Bromodomain-containing protein 4 (BRD4), an epigenetic reader that specifically binds to histones, plays a crucial role in inflammatory diseases by regulating macrophage polarization. Herein, we attempted to examine the hypothesis that modulating alveolar macrophage polarization via BRD4 inhibitors might has a potential for COPD treatment.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethods\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe firstly investigated the BRD4 expression and its association with clinical parameters and macrophage polarization markers by reanalyzing the clinical cohort of sputum transcriptomes from 94 patients with COPD and 36 healthy individuals in China. \u003cem\u003eIn vivo\u003c/em\u003e, we further verified its expression in the lipopolysaccharides (LPS)/elastase-induced emphysema model. Subsequently, BRD4 inhibitor JQ1 and degrader ARV-825 were intraperitoneally administrated into emphysema mice in order to investigate their effects on lung emphysema and inflammation. \u003cem\u003eIn vitro\u003c/em\u003e, RNA-seq and CUT\u0026amp;Tag assay of BRD4 and acetylated histone 3 lysine 27 (H3K27ac), were applied for elucidating the underlying molecular mechanism of how BRD4 regulates macrophage polarization.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe found an increased expression of BRD4 in the induced sputum from patients with COPD and unveiled a strong correlation between BRD4 expression and clinical parameters as well as macrophage polarization. Subsequently, the upregulation of BRD4 in macrophage was verified in the experimental emphysema model. BRD4 inhibitor JQ1 and degrader ARV-825 significantly mitigated emphysema and airway inflammation along with better protection of lung function in mice. BRD4 inhibition also suppressed both M1 and M2 alveolar macrophage polarization. The CUT\u0026amp;Tag assay of BRD4 and H3K27ac, revealed that BRD4 inhibition disrupted the super-enhancers (SEs) of IRF4 (a crucial transcription factor for M2 macrophage), and subsequently affected the expression of matrix metalloproteinase 12 (MMP12) which is vital for emphysema development.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusion\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study suggested that downregulation of BRD4 might suppress airway inflammation and emphysema through disrupting the SEs of IRF4 and alveolar macrophages polarization, which might be a potential target of therapeutic intervention in COPD.\u003c/p\u003e","manuscriptTitle":"Targeting BRD4 Ameliorates Experimental Emphysema by Disrupting Super-Enhancer in Polarized Alveolar Macrophage ","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-01-02 19:08:11","doi":"10.21203/rs.3.rs-3788052/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"ae7e5cdd-e59e-4cfa-bc95-eaae68a20687","owner":[],"postedDate":"January 2nd, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-01-26T21:46:56+00:00","versionOfRecord":[],"versionCreatedAt":"2024-01-02 19:08:11","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3788052","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3788052","identity":"rs-3788052","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}