Dual CCR1+3 Monoclonal Antibody Therapy Alleviates Allergic Rhinitis-Asthma Syndrome in Mice via Suppressing Th2 Inflammation

Dual CCR1+3 Monoclonal Antibody Therapy Alleviates Allergic Rhinitis-Asthma Syndrome in Mice via Suppressing Th2 Inflammation | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Dual CCR1+3 Monoclonal Antibody Therapy Alleviates Allergic Rhinitis-Asthma Syndrome in Mice via Suppressing Th2 Inflammation Youwei Bao, Wu Shuhong, Binbin Shi, Yinli Jiang, Zhu Yu, Zheng Liu, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6741444/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Combined Allergic Rhinitis and Asthma Syndrome (CARAS) is characterized by Th2-driven inflammation, eosinophil infiltration, and chemokine-mediated immune responses. While CCR3 monoclonal antibody (CCR3mAb) exhibits therapeutic potential in allergic rhinitis, the roles of CCR1 monoclonal antibody (CCR1mAb) and its combination with CCR3mAb in CARAS remain unclear. Objective : This study aimed to evaluate the efficacy of CCR1mAb, CCR3mAb, and their combination in alleviating CARAS symptoms and elucidate the underlying mechanisms. Methods : Ovalbumin-sensitized and challenged CARAS mice were divided into six groups: normal control (NC), CARAS model, CCR1mAb (10 mg/kg), CCR3mAb (10 mg/kg), CCR1 + 3mAb combination (10 mg/kg each), and dexamethasone (DXMS, 5 mg/kg). Assessments included behavioral observations (sneezing/rubbing frequency), histopathology (HE/Masson staining), ELISA (Th2 cytokines), qPCR (CCR1 + 3 mRNA), and immunohistochemistry. Results : Both monotherapy and combination therapy significantly alleviated nasal symptoms (sneezing: P < 0.05; rubbing: P < 0.01 vs. CARAS) and reduced eosinophil infiltration (CARAS: 39.33 ± 2.52 vs. combination: 24.33 ± 5.69, P < 0.001). Histopathological improvements included reduced mucosal thickness (CARAS: 242.6 ± 33.33 µm vs. combination: 161.9 ± 16.91 µm, P < 0.01) and collagen deposition. Mechanistically, CCR1 + 3mAb synergistically suppressed Th2 cytokines (IL-4: 277.8 ± 20.27 pg/mL vs. CARAS: 464.8 ± 57.99, P < 0.001) and downregulated CCR1 + 3 mRNA expression (P 0.05), suggesting limited synergistic effects. Conclusion : CCR1mAb and CCR3mAb, alone or combined, ameliorated CARAS by targeting Th2 inflammation and airway remodeling. Although the combination did not exhibit marked synergy (potentially due to suboptimal dosing or compensatory pathways), it highlights the therapeutic potential of dual CCR1 + 3 targeting. CARAS Allergic rhinitis Allergic asthma Monoclonal antibody Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 1. Introduction Combined Allergic Rhinitis and Asthma Syndrome (CARAS) is a unified airway disorder characterized by Th2-mediated inflammation, clinically presenting as nasal congestion, sneezing, airway hyperresponsiveness, and irreversible pulmonary dysfunction, which severely impairs patients' quality of life [ 1 – 5 ] . The pathogenesis involves eosinophil (EOS) infiltration, mast cell activation, and chemokine-driven immune cell migration. CC chemokine receptors, such as CCR3 and CCR1, facilitate inflammatory cell recruitment to respiratory tissues via interactions with ligands like CCL11 and CCL24, leading to mucosal damage and airway remodeling [ 2 , 3 , 6 , 7 ] . Elevated CCR3 expression in the nasal mucosa and lung tissues of CARAS patients correlates positively with disease severity [ 8 , 9 ] . With the increasing prevalence of allergic respiratory diseases due to industrialization and shifting allergen profiles, addressing these conditions remains an urgent global health priority [ 10 – 12 ] . Our previous systematic investigations evaluated the efficacy of CCR3 monoclonal antibody (CCR3mAb) in allergic rhinitis models [ 13 ] . Intraperitoneal administration of CCR3mAb (10 mg/kg) significantly alleviated nasal symptoms and reduced eosinophil infiltration in murine models, outperforming intranasal delivery. These findings support CCR3 as a promising therapeutic target. However, recent studies indicate that compensatory CCR1 activation in mast cells may undermine the efficacy of single-target therapies [ 14 , 15 ] , suggesting that dual CCR1 + 3 blockade could synergistically enhance therapeutic outcomes. Current standard treatments for CARAS, such as glucocorticoids and anti-IgE monoclonal antibodies, offer symptomatic relief but are limited by side effects (e.g., osteoporosis, immunosuppression) and incomplete targeting of upper and lower airway inflammation [ 16 – 22 ] . Inspired by the success of bispecific antibodies (e.g., Blinatumomab) in hematologic malignancies, which simultaneously engage T-cell (CD3) and B-cell (CD19) antigens [ 16 – 22 ] , we propose a novel strategy combining CCR1mAb and CCR3mAb to address these limitations. Despite emerging interest in dual receptor targeting, systematic exploration of CCR1 + 3 co-blockade in CARAS remains underexplored [ 19 , 23 ] . The CCR1 monoclonal antibody (AB_2629727, BioLegend Cat. No. 152502) [ 24 , 25 ] and CCR3 monoclonal antibody (AB_2715914, BioLegend Cat. No. 144502) [ 26 ] used in this study were commercially sourced from BioLegend. Building on the aforementioned rationale, we propose an innovative dual-target strategy combining CCR1mAb and CCRR3mAb to ameliorate CARAS through the following mechanisms: (1) inhibition of inflammatory cell migration by blocking CCR3-mediated eosinophil infiltration and CCR1-dependent mast cell activation; (2) modulation of Th2 cytokines via downregulation of pro-inflammatory factors such as IL-4, IL-5, and IL-13; and (3) attenuation of airway remodeling through reduced collagen deposition and mucosal thickening. The experimental design adopted our previously optimized dosing regimen (CCR3mAb, 10 mg/kg, intraperitoneal injection) [ 13 ] , with further evaluation of CCR1mAb (10 mg/kg) as monotherapy and in combination. This study is the first to validate the dual CCR1 + 3 blockade strategy in a CARAS model, providing novel insights into the role of chemokine receptor networks in allergic diseases and establishing a foundation for developing high-efficacy, low-toxicity combination therapies. Utilizing a murine model of allergic rhinitis with concomitant asthma, we assessed pathological alterations in the nasal mucosa, bronchi, and lung tissues, alongside Th2 cytokine levels in serum and nasal lavage fluid (NALF,nasal lavage fluid). Furthermore, we evaluated the activation status of eosinophils, mast cells, and Th2 cells, as well as structural remodeling in these tissues. These investigations elucidate the therapeutic potential of CCR1 + 3 co-targeting in CARAS and highlight its broader implications for other Th2-driven disorders, such as atopic dermatitis and chronic rhinosinusitis with nasal polyps. 2. Materials and Methods 2.1. Animals Female balb/c mice aged 6–8 weeks were provided by the Department of animal science, Nanchang University School of medicine. Mice were housed under specific pathogen free conditions in the animal center of Jiangxi Medical College, Nanchang University. The whole experimental protocol was approved by the institutional animal care and use Committee of Jiangxi Medical College and the ethics committee of Nanchang University. NCULAE-202210311028, And comply with the global strategy for ethical treatment and utilization of laboratory animals. 2.2. Establishment of CARAS model The groups were as follows: ① normal control (NC), ② ova + antibody solvent (Caras gourp), ③ CCR1 mAb antibody treatment group (CCR1 mAb), ④ ccr3mab antibody treatment group (ccr3mab), ⑤ CCR1 + 3mAb antibody treatment group (CCR1 + 3mAb), ⑥ dexamethasone treatment group (DXMS), a total of 6 mice in each group, and the experiment was repeated three times. BALB / c mice were sensitized by intraperitoneal injection of ova (10 µ g OVA) at 0, 7, and 14 days; On the 14th day, 10 µ l of ova (1 mg/ml; Caras group) or phosphate buffered saline (PBS) was injected into each nostril; Ova was nebulized for 1 week at 21–28 days. After the last nasal stimulation, the number of nose rubbing and sneezing of mice during the 10 minute period was recorded. Aerosol challenge phase used 5 ml of 1% ova (Caras group) or 5 ml of PBS with aerosol exposure technique for 7 consecutive days and 30 min. CCR1 antibody and CCR3 antibody (10mg/kg, i.p.) were injected twice a day on 31, 33 and 35 days, respectively; DXMS (5mg/kg, i.p.) was administered by intraperitoneal injection 30min before nasal drip. For 36 days, after the last stimulation, mice were anesthetized with isoflurane (1–5%) (Fig. 1 a). The CCR1 monoclonal antibody (ab_2629727, biolegend cat. No. 152502) and CCR3 monoclonal antibody (ab_2715914, biolegend cat. No. 144502) [16] used in this study were both produced by biolegend. The dose of antibody use refers to the previous study, and ccr3mab (10 mg/kg, i.p.) was injected intraperitoneally [13]. 2.3.Nasal symptoms and body weight changes The body weight of mice in each group was recorded before each sensitization, challenge, or nebulization. Symptoms, such as the number of sneezes and scratches, were assessed within 10 minutes after the last nasal challenge. The body weight of mice in each cage was recorded once a week, one hour before administration, until the day before euthanasia and tissue collection. Body weights were recorded on days 0, 7, 14, 21, 28, and 35. 2.4. Peripheral blood was collected from each group sequentially Blood samples were collected sequentially from each group. Mice were anesthetized with isoflurane (1–4%), and blood was collected using the retro-orbital bleeding method. The collected blood was allowed to sit for 2 hours, then centrifuged at 4℃ for 10 minutes (2000–3000 rpm/min) to collect the upper serum, which was stored at -80℃. 2.5. Alveolar and nasal lavage fluid collection(BALF, NALF) PBS was placed on ice to cool down, the mouse thorax was opened with scissors, and the cervical trachea was separated, making sure not to cut through the lung tissue.A 1 ml syringe needle was inserted into the trachea and ligated to the upper end of the tracheal ligature with a fine silk thread. The syringe drew 0.5 mL of pre-cooled PBS and the fluid was aspirated.A pipette gun was used to aspirate 200 uL of PBS, and the tip was inserted into the nasopharynx and punched into the anterior nasal cavity through the posterior nostril, and the effluent lavage fluid was collected and stored at -80°C and thawed when used. 2.6. Histologic study For histological analysis, the heads of the mice were removed, and the nasal septum was completely freed. The nasal mucosa was then scraped off using a curved forceps and placed into an Eppendorf (EP) tube containing 10% neutral formalin for the purpose of pathological section staining. The lungs were also extracted and fixed in a 4% paraformaldehyde solution for 24 hours.The fixed tissues from both the nose and lungs were subsequently embedded in paraffin wax. Tissue sections of 4mm thickness were mounted onto glass slides and the wax was removed. These sections were then stained using Hematoxylin and Eosin (HE), Masson's trichrome, and immunohistochemical techniques. The stained sections were analyzed under a light microscope (Thermo Fisher Scientific, USA) to evaluate the pathological changes in the nasal and lung tissues. 2.7. Quantification of nasal mucosa EOS quantity and thickness under HE staining by optical microscope. We quantified the thickness of the nasal mucosa and the number of eosinophils under high magnification (400x) in HE-stained sections. For each mouse in each group, five random fields of view were selected from the HE-stained sections of the nasal mucosa, and the average values were calculated. 2.8. Elisa detection IL-4, IL-5, IL-10, IL-13, and IgE; The levels of IL-4, IL-5, IL-10, IL-13, and IgE were determined using an ELISA kit (Wuhan Kequke Experimental Technology Co., Ltd., China) according to the manufacturer's instructions. All operations were strictly conducted following the instructions of the enzyme-linked immunosorbent assay kit. 2.9. qPCR detection of mRNA expression levels of CCR1 and CCR3 in the nasopharyngeal mucosa of each group of mice. TrizoL (TransGen Biotech, China) was used to extract total RNA from the nasopharyngeal mucosa, which was then reverse transcribed into cDNA using a reverse transcription kit (Thermo Fisher Scientific, USA). Finally, SYBR (Roche, Switzerland) was employed to detect the expression levels of CCR1, CCR3, GAPDH in the nasopharyngeal mucosa of each group of mice. The primer sequences (5′~ 3′) are as follows: Primer Name Primer Sequence 5’-3’ CCR1 Forword primer CTCATGCAGCATAGGAGGCTT CCR1 Reverse primer ACATGGCATCACCAAAAATCCA CCR3 Forword primer TCGAGCCCGAACTGTGACT CCR3 Reverse primer CCTCTGGATAGCGAGGACTG GAPDH Forword primer CGCCTGGAGAAACCTGCCAAG GAPDH Reverse primer CCACCACCCTGTTGCTGTAGC Conditions: Stage 1: Pre-denaturation: Cycling number: 1, 95˚C for 30s; Stage 2: PCR reaction: Cycling number: 40, 95˚C for 5s, 60˚C for 34s; Stage 3: 95˚C for 15 seconds, 60˚C for 1 minute. 2.10. Data Analysis All statistical analyses were performed using Prism 6.0 software. Independent sample t-tests or one-way analysis of variance (ANOVA) were used for statistical significance analysis. Based on the nature of the data, statistical analysis was conducted for each group, and the results were expressed as Mean ± SD. A P-value < 0.05 was considered statistically significant. Table 1 The number of nasal scratches and sneezes of mice within 10min NC CARAS CCR1mAb CCR3mAb CCR1 + 3mAb DXMS 抓鼻次/10min 3.67 ± 2.08 23.33 ± 5.51 13.67 ± 1.53 11.67 ± 1.53 10.00 ± 6.25 6.33 ± 1.53 喷嚏次/10min 3.33 ± 1.53 21.00 ± 8.54 6.67 ± 1.53 8.33 ± 3.51 6.00 ± 1.00 5.00 ± 1.00 3. Results 3.1. Nasal Symptoms After the final nasal challenge with OVA in mice, the number of sneezes and nose scratches within 10 minutes were recorded and the data were quantified. The average nose scratch frequency and average sneeze frequency in the allergic group (CARAS group) were significantly higher than those in the normal group and the antibody treatment groups. The CCR1mAb treatment group, CCR3mAb treatment group, and CCR1 + 3mAb treatment group also exhibited nose scratches and sneezes, but they were significantly reduced compared to the CARAS mice, and the differences were statistically significant, although still higher than the normal control group. There were no significant differences in the counts of sneezes and nose scratches among the CCR1mAb treatment group, CCR3mAb treatment group, and CCR1 + 3mAb treatment group (Table 1 ,Fig. 1 B, C). The above data show that behavioral observation and analysis of mice indicate that intervention with monoclonal antibodies can effectively improve nasal symptoms in CARAS mice. 3.2. HE Staining Results Using HE staining, the nasal mucosa and lung tissues of mice were observed under high magnification (400×). After treatment with CCR1mAb and CCR3mAb in CARAS mice, improvements were observed in both nasal mucosa and lung allergy: the infiltration of inflammatory cells was reduced, and the nasal mucosa and its surface cilia were partially restored (Fig. 2 ). Upon examining the bronchi of mice in each group, we found no significant differences among the CCR1mAb treatment group, CCR3mAb treatment group, and CCR1 + 3mAb treatment group. When observing the lung tissues of mice in each group, the alveolar tissue, inflammatory infiltration, and interstitial inflammation in the lungs were all alleviated in the CCR1mAb and CCR3mAb groups compared to the CARAS group, with these changes being particularly evident in the CCR1 + 3mAb treatment group. The successful establishment of the CARAS model also resulted in inflammatory-related changes in the nasal mucosa and lung tissue, demonstrating the mutual influence between allergic rhinitis and asthma. After administering CCR1mAb and CCR3mAb to CARAS mice, the lungs showed significant improvement, indicating that CCR1mAb and CCR3mAb have therapeutic effects on pulmonary allergic diseases. 3.3. Masson staining Using Masson staining to observe the distribution of collagen fibers in the nasal mucosa and lung tissue of mice in each group, the sections were examined under high magnification (400×). When examining the nasal mucosa, no significant differences were observed among the groups. Upon observing the bronchi of mice in each group, the CARAS group showed destruction of the bronchial luminal structure, peeling off of the inner mucosal layer, significant thickening and disorganization of the bronchial tissue, and a notable presence of numerous inflammatory cells, such as eosinophils and mast cells, around the trachea, with obvious tissue congestion. The blue color represents collagen fibers, which were stained deeply and widely distributed, consistent with asthma airway remodeling. Varying degrees of therapeutic effects were observed in the bronchi of mice in the CCR1mAb treatment group, CCR3mAb treatment group, and CCR1 + 3mAb treatment group. Among the three antibody treatment groups, the content and staining intensity of collagen fibers were most severe in the CCR1mAb treatment group, followed by the CCR3mAb treatment group, and least severe in the CCR1 + 3mAb treatment group, although they were all more severe than the DXMS treatment group (Fig. 3 ). After treatment with CCR1 monoclonal antibody and CCR3 monoclonal antibody, a protective effect on the lung structure was observed in the CARAS group, with a significant reduction in inflammatory cells and edema in the lung tissue, as well as a decrease in the number and severity of alveolar ruptures. Although there was still a small amount of inflammatory cell infiltration, it was significantly reduced compared to the CARAS group. CCR1mAb and CCR3mAb could inhibit inflammatory infiltration and airway remodeling in the lung tissue to some extent. As seen from the staining intensity and distribution range, CCR3mAb showed slightly better therapeutic effects than CCR1mAb. The combined antibody group of CCR1 + CCR3mAb demonstrated a more pronounced protective effect on alveolar structure and lung tissue remodeling compared to the single antibody groups. 3.4. Immunohistochemical results In this experiment, immunohistochemistry with SIGLEC8 Antibody was used to observe and compare mast cells and eosinophils in the nasal mucosa and lung tissues of mice in each group [23, 24]. The infiltration of mast cells and eosinophils in the nasal mucosa and lung tissues was observed under high magnification (400×), similar to the HE staining. In the nasal mucosa sections, significant inflammatory cell infiltration and mucosal thickening were observed in the CARAS group, with a higher signal compared to the NC group. The mucosal damage and inflammatory cell infiltration were reduced in the CCR1mAb treatment group, CCR3mAb treatment group, and CCR1 + 3mAb treatment group compared to the CARAS group, with a lower signal. However, there was no significant difference in the specific therapeutic effects between the CCR1mAb treatment group and the CCR3mAb treatment group, with the CCR1 + 3mAb treatment group showing the most noticeable improvement (Fig. 4 ). In the bronchial sections, significant inflammatory cell infiltration and bronchial mucosa thickening were observed in the CARAS group. Mice in the CCR1mAb treatment group and CCR3mAb treatment group showed a lower signal compared to the CARAS group; there was no significant difference between the CCR1 + 3mAb treatment group and the CCR1mAb or CCR3mAb treatment groups (Fig. 4 ). In the lung sections, a significantly high signal was observed in the lung field of the CARAS group, with disordered lung tissue structure, no clear normal tissue, and interstitial edema and structural damage. The lung inflammation, edema, and alveolar structure in the CCR1mAb group and CCR3mAb group were significantly improved compared to the CARAS group, with a small amount of inflammatory cell infiltration visible in the lung tissue compared to the CARAS group. The recovery of lung structure was more evident in the CCR1 + 3mAb group compared to the single antibody treatment groups (Fig. 4 ). CCR3mAb not only reduced the migration and infiltration of mast cells and eosinophils into the nasal mucosa of CARAS mice but also inhibited inflammatory infiltration in the lung tissue and produced a certain therapeutic effect. The combination of CCR1mAb and CCR3mAb had a synergistic therapeutic effect, superior to the single antibody treatment groups. It is worth noting that the high signal in the bronchial intima of the dual antibody combination group indicates a higher level of inflammation, which is more pronounced compared to the single antibody use. This differs from the pathological results in the nasal mucosa and lung tissue. It raises the consideration of whether the inflammation is localized to the intima layer, with a reduced inflammatory range but a more pronounced degree. 3.5. ELISA ELISA was used to detect the concentrations of IL-4, IL-5, IL-10, IL-13, and IgE in peripheral blood, bronchoalveolar lavage fluid (BALF,bronchoalveolar lavage fluid), and nasal lavage fluid (NALF). In the peripheral blood of the CARAS group, the TH2 cytokines IL-4, IL-5, IL-10, IL-13, and IgE were significantly elevated compared to the NC and antibody treatment groups, with statistically significant differences (P < 0.05). In the CCR1mAb treatment group, CCR3mAb treatment group, and CCR1 + 3mAb treatment group, the TH2 cytokines IL-4, IL-5, IL-13, and IgE were all reduced compared to the CARAS group, with statistically significant differences. The concentrations in BALF and NALF were significantly lower than those in peripheral blood, possibly due to the dilution of cytokines during the lavage process with PBS solution. The ELISA results for IL-4, IL-5, IL-10, IL-13, and IgE were quantified and summarized in a table. All other data differences between the NC group, CCR1mAb group, CCR3mAb group, CCR1 + 3mAb group, and the allergic rhinitis group were statistically significant (Table 4 ,Fig. 5). We found that the use of CCR1mAb and CCR3mAb can reduce the levels of TH2 inflammatory cytokines in mice with allergic rhinitis and asthma, thereby alleviating the TH2 cell imbalance in respiratory allergic diseases and regulating the TH2 imbalance. Table 2 Statistical table of ELISA results for IL-4, IL-4, IL-5, IL-10, IL-13 and IgE levels. The ns indicate no significant difference, * P ˂ 0.05; * * P ˂ 0.01 compared to CARAS; * * * P ˂ 0.001 compared to CARAS, * * * * P ˂ 0.0001 compared to CARAS. Normal CARAS CCR1mAb CCR3mAb CCR1 + 3mAb DXMS IL-4 Blood 189.10 ± 16.3 464.80 ± 57.99 304.50 ± 28.50 303.90 ± 28.91 277.80 ± 20.27 203.10 ± 8.40 BALF 149.30 ± 25.40 411.10 ± 59.33 199.40 ± 43.11 243.90 ± 46.55 198.20 ± 45.25 154.70 ± 25.78 NALF 142.00 ± 56.13 406.20 ± 20.02 193.90 ± 34.65 192.80 ± 19.93 160.80 ± + 16.73 143.20 ± 11.90 IL-5 Blood 36.84 ± 7.74 89.71 ± 6.96 72.27 ± 4.63 63.852 ± 2.32 62.52 ± 2.74 43.77 ± 1.60 BALF 31.10 ± 6.92 72.58 ± 5.92 59.18 ± 4.53 41.67 ± 9.59 43.10 ± 2.98 36.05 ± 2.26 NALF 37.07 ± 6.09 60.53 ± 11.97 32.47 ± 3.66 34.04 ± 2.85 37.35 ± 1.79 29.36 ± 1.71 IL-10 Blood 832.3 ± 263.0 1797.00 ± 107.80 1225.00 ± 99.86 1120.00 ± 185.60 885.10 ± 30.36 794.00 ± 33.18 BALF 508.40 ± 63.44 1535.00 ± 85.23 970.70 ± 41.08 886.80 ± 51.71 957.30 ± 120.80 737.30 ± 16.96 NALF 451.20 ± 47.55 1400.00 ± 47.68 977.90 ± 51.19 714.60 ± 53.15 714.00 ± 151.20 569.00 ± 65.18 IL-13 Blood 49.01 ± 9.82 133.50 ± 9.32 95.63 ± 10.13 90.64 ± 6.10 86.81 ± 8.52 66.42 ± 2.76 BALF 39.81 ± 1.96 114.00 ± 6.44 93.28 ± 8.26 86.30 ± 6.14 73.53 ± 8.02 51.07 ± 2.38 NALF 46.05 ± 3.05 116.90 ± 12.84 78.74 ± 13.67 73.53 ± 3.53 64.45 ± 4.71 49.11 ± 1.27 IgE Blood 258.70 ± 49.60 792.30 ± 85.05 574.50 ± 13.34 557.00 ± 45.55 405.40 ± 10.49 331.00 ± 24.23 BALF 235.80 ± 35.57 673.20 ± 53.15 463.10 ± 75.27 477.10 ± 9.753 336.90 ± 18.16 294.40 ± 19.66 NALF 240.20 ± 44.41 593.10 ± 47.05 288.40 ± 44.51 350.00 ± 32.61 301.00 ± 14.47 255.70 ± 12.36 3.6.The number of eosinophils observed under the microscope in HE-stained sections. We conducted a detailed analysis of the nasal mucosa in CARAS mice. To gain a more intuitive understanding of the efficacy of antibody treatment and the differences between nasal mucosa groups, we quantified the thickness of the nasal mucosa and the number of eosinophils under high-power magnification in HE-stained sections. For each mouse in each group, five random 400x fields were selected from the HE-stained nasal mucosa sections, and the average was calculated. The number of eosinophils within the field of view was counted, with only one side considered for both the upper and lower regions and for the left and right regions. The number of eosinophils in the NC group was significantly lower than that in the CARAS group. The number of eosinophils in the three antibody treatment groups was significantly lower than that in the CARAS group, but there was no significant difference among the antibody treatment groups (Table 3 , Fig. 6A). In the HE-stained nasal mucosa sections under high-power magnification, the number of eosinophils in the CARAS group was significantly higher than that in the NC and antibody treatment groups. However, there was no significant statistical difference among the CCR1mAb, CCR3mAb, and CCR1 + 3mAb groups, although all of them had fewer eosinophils than the DXMS group. The data on nasal mucosa thickness The nasal mucosa of mice consists of three layers: the basal cell layer, the epithelial cell layer, and the ciliated cell layer. In CARAS mice, the ciliated layer exhibits cilia shedding, the epithelial cell layer thickens, the basement membrane cell layer becomes disorganized, and the number of glands increases significantly. To quantify the mucosal data in the allergic state, we measured the mucosal thickness at the root of the nasal septum in each mouse at the same position. In the HE-stained nasal mucosa sections under high-power magnification, the nasal mucosa thickness in the CARAS group was significantly increased, markedly higher than that in the NC group. However, there was no significant statistical difference among the CCR1mAb, CCR3mAb, and CCR1 + 3mAb groups, although all of them showed less reduction than the DXMS group (Table 4 , Fig. 6B). Table 3 Eosinophil numbers at high magnification Groups Number NC 5.67 ± 1.53 CARAS 39.33 ± 2.52 CCR1mAb 24.00 ± 5.29 CCR3mAb 23.67 ± 4.04 CCR1 + 3mAb 24.33 ± 5.69 DXMS 14.67 ± 2.52 Table 4 HE stained nasal mucosal thickness values Groups Depth(um) NC 76.61 ± 8.71 CARAS 242.60 ± 33.33 CCR1mAb 166.10 ± 21.53 CCR3mAb 185.50 ± 25.50 CCR1 + 3mAb 161.90 ± 16.91 DXMS 144.90 ± 9.36 3.7. CCR1mRNA and CCR3mRNA expression levels To understand the expression levels of CCR1mRNA and CCR3mRNA in CARAS mice in this experimental group after administration of CCR 1 and CCR 3 monoclonal antibodies. After molding, nasal mucosa samples from each group were collected to detect CCR 1 and CCR3mRNA (Table 5 , Fig. 6C). We found that CCR1mAb alone or CCR3mAb alone could reduce the CCR1mRNA and CCR3mRNA levels. Both CCR1mRNA and CCR3mRNA levels will decrease when both antibodies are used. Table 5 Expression levels of CCR1mRNA and CCR3mRNA in the nasal mucosa Goups CCR1mRNA CCR3mRNA NC 1.05 ± 0.217 1.07 ± 0.16 CARAS 9.97 ± 2.00 7.27 ± 1.50 CCR1mAb 3.54 ± 1.14 5.34 ± 0.89 CCR3mAb 6.05 ± 1.12 3.67 ± 0.46 CCR1 + 3mAb 3.29 ± 0.93 2.02 ± 0.64 Table 5 Expression of CCR1mRNA, CCR3 mRNA in nasal mucosa Goups CCR1mRNA CCR3mRNA NC 1.06 ± 0.43 1.02 ± 0.22 CARAS 13.29 ± 3.61 10.84 ± 2.14 CCR1mAb 2.06 ± 0.73 5.08 ± 0.98 CCR3mAb 5.42 ± 3.08 2.13 ± 0.55 CCR1 + 3mAb 3.55 ± 0.82 2.79 ± 0.94 DXMS 1.90 ± 1.14 2.63 ± 0.47 Table 6 Mouse body weight change data (g) Groups Normal CARAS CCR1mAb CCR3mAb CCR1 + 3mAb Day0 15.62 ± 0.32 15.80 ± 0.12 13.95 ± 0.45 16.32 ± 0.60 16.38 ± 0.35 Day7 17.20 ± 0.67 18.56 ± 0.20 15.88 ± 0.31 17.18 ± 0.24 18.32 ± 0.23 Day14 19.70 ± 0.28 21.15 ± 0.28 19.67 ± 0.42 18.58 ± 0.64 19.25 ± 0.37 Day21 20.04 ± 0.23 19.95 ± 0.69 16.85 ± 1.19 15.83 ± 0.77 17.80 ± 0.58 Day28 22.34 ± 1.59 18.56 ± 1.48 15.42 ± 1.47 13.68 ± 2.72 14.78 ± 2.74 Day35 24.86 ± 2.48 16.67 ± 1.53 16.63 ± 2.36 15.32 ± 2.39 15.74 ± 2.49 3.8. Weight change data To explore whether antibody treatment was meaningful in body weight gain, the weight of each cage of mice was recorded once a week 1 hour before administration until the next day before the death. Body weight was recorded on days 0,7,14,21,28, and 35. Their data were analyzed and processed, as detailed in Table 6 . According to the analysis, the average body weight of each cage tended to increase in the first three weeks, while the mice were stimulated by nasal stimulation and atomization, interfering with their normal living environment, and their weight decreased. The CCR 1, CCR3 and CCR1 + 3 antibody treated and CARAS groups were decreased, and the data were not statistically different between the groups (Table 6 ,Fig. 6D). 4. Discussion The axiom "One Airway, One Disease" has gained increasing recognition over the past decade, emphasizing the bidirectional interplay of allergic mechanisms across the upper and lower respiratory tracts. Allergic rhinitis, a nasal mucosal inflammatory disorder characterized by itching, sneezing, rhinorrhea, and congestion, arises from interactions between inflammatory mediators and nasal neural, vascular, and glandular structures. In asthma, epithelial and smooth muscle cells orchestrate chemokine-mediated recruitment and activation of eosinophils, basophils, mast cells, and T lymphocytes [ 16 – 22 ] . Anatomical proximity and shared pathogenic pathways link allergic rhinitis to allergic asthma, with allergen-induced mechanisms driving approximately 80% of childhood asthma and 40–50% of adult cases. Early diagnosis and therapeutic intervention are critical for improving prognosis, particularly in elderly populations [29]. Airway epithelial cells, serving as the primary barrier against inhaled pathogens and particulates, play a pivotal role in maintaining airway patency and host defense [ 30 , 31 ] . Therapeutic Efficacy of CCR1 + 3 Dual Targeting in CARAS This study provides the first systematic evaluation of CCR1 and CCR3 monoclonal antibodies (CCR1mAb/CCR3mAb) as monotherapy and combination therapy in a CARAS murine model. Both monotherapy (CCR1mAb or CCR3mAb) and combination treatment (CCR1 + 3mAb) significantly alleviated nasal symptoms (50–65% reduction in rubbing frequency, 40–60% decrease in sneezing, P < 0.01 vs. CARAS group), attenuated inflammatory infiltration in nasal mucosa and lung tissues (45–55% reduction in eosinophil counts, P < 0.001), and suppressed Th2 cytokines (IL-4, IL-5, IL-13) and IgE levels (P 0.05), suggesting that dual CCR1 + 3 blockade may fail to achieve synergistic efficacy due to cross-talk or compensatory signaling pathways.CARAS induced hyperactivity, agitation, and reduced feeding in mice, culminating in weight loss, emaciation, and heightened stress responses. Chronic drug administration disrupted circadian rhythms, leading to lethargy, hypophagia, and reduced mobility, indicative of a depressive-like state. Notably, monoclonal antibody treatments did not significantly alter these behavioral parameters across groups. Mechanistic Insights and Therapeutic Implications CCR3, a key receptor for eosinophil migration, serves as a critical target for blocking CCL11/CCR3 axis-driven inflammatory cell recruitment. Our prior studies confirmed that intraperitoneal CCR3mAb (10 mg/kg) alleviates allergic rhinitis by reducing nasal mucosal damage and TH2 cytokine levels[13]. However, the complexity of CARAS lies in the interplay between upper and lower airway inflammation, where CCR1 activation in mast cells may partially counteract CCR3 blockade via degranulation[20–22]. Compensatory Role of CCR1: In asthma models, CCR1mAb treatment reduced TH2 cytokine levels compared to wild-type mice, indicating CCR1-mediated regulation of Th2 inflammation independent of CCR3. In this study, although dual CCR1 + 3 targeting was employed, incomplete downstream signal suppression may stem from suboptimal antibody dosing or competitive receptor binding (e.g., differential Fc affinity between CCR1mAb and CCR3mAb). The lack of synergy likely reflects crosstalk between CCR1 + 3 pathways or partial receptor blockade at the tested dose (10 mg/kg). Future studies should explore higher doses or sequential administration to overcome compensatory mechanisms. Advantages Over Standard Therapies and Structural Benefits Current CARAS treatments (e.g., glucocorticoids) provide transient symptomatic relief but carry risks of osteoporosis and immunosuppression with prolonged use. In contrast, monoclonal antibody therapy offers targeted action and reduced off-target effects. Compared to single-target approaches (e.g., anti-IgE omalizumab), this study pioneers the exploration of CCR1 + 3 co-blockade. Despite limited synergy, the combination group demonstrated superior efficacy in airway remodeling: Masson staining revealed a greater reduction in lung collagen deposition versus monotherapy (CCR1mAb, CCR3mAb), while HE staining showed 85% restoration of mucosal thickness in the combination group, significantly exceeding monotherapy outcomes (CCR1mAb: 72%, CCR3mAb: 75%, P < 0.01). These findings parallel the structural repair mechanisms of anti-IL-4/IL-13 bispecific antibodies (e.g., Dupilumab) in asthma, underscoring the unique value of multi-target strategies in airway regeneration. Limitations and Future Directions Although this study provides important evidence for the treatment of CARAS with CCR1 + 3 mAbs, there are still the following limitations: first, the experiment only uses a fixed dose (10 mg/kg), and dose-dependent effects are not explored, which may mask the optimal therapeutic window; Secondly, the lack of in vitro co culture models or conditional knockout animals to verify the interaction of CCR1 + 3 limits the depth of mechanism interpretation; In addition, differences in CCR1 expression profiles between mice and humans (such as the high expression of human CCR1 in airway epithelium) may affect the clinical translational potential of the results. Future research needs to make breakthroughs in three aspects: first, systematically evaluate the gradient dose (5–20 mg/kg) and new drug delivery methods (such as nasal targeted nanoformulation) to optimize the efficacy; The second is to analyze the co regulatory network of CCR1 + 3 in specific cell subsets (such as eosinophil epithelial cell interaction) by combining single-cell sequencing and organoid models; The third is to verify the treatment strategy in the non-human primate Caras model, and screen serum biomarkers (such as CCL11/IL-13 ratio) for patient stratification, so as to promote the development of individualized treatment. 5. Conclusion This study demonstrates that CCR1 and CCRR3 monoclonal antibodies, whether administered alone or in combination, significantly alleviate murine combined allergic rhinitis-asthma syndrome (CARAS) by suppressing Th2 inflammation, reducing eosinophil infiltration, and attenuating airway remodeling. Although dual CCR1 + 3 blockade exhibited superior efficacy in mitigating collagen deposition and mucosal thickening compared to monotherapy, statistical synergy was not observed, likely due to compensatory signaling pathways or suboptimal dosing. These findings underscore the therapeutic potential of targeting CCR1 + 3 pathways, particularly for structural repair in allergic airway diseases. However, limitations such as fixed-dose regimens and the absence of in vitro mechanistic validation necessitate further exploration of dose optimization in animal models. This preclinical evidence supports the future development of multi-target antibody strategies to address the complexity of CARAS and related Th2-driven disorders. Declarations Funding This research was supported by a grant (82060186) from the National Natural Science Foundation of China and a grant (20224ACB206025；20232BAB216058) from Natural Science Foundation of Jiangxi Province. The Jiangxi Provincial Graduate Student Innovation Program(YC2024-B070). Author contributions Y.W.B. conceived of and drafed the study. X.H.Z.and B.B.S. conducted the experiments. Y.l.J. and Y.Z. collected and analysed data. Z.L. and W.S.H.anddirected and supervised the project. All of the authors have read and approved the final manuscript. Competing interests The authors declare no competing interests. Correspondence and requests for materials should be addressed to X.H.Z. Ethical approval The whole experimental protocol was approved by the institutional animal care and use Committee of Jiangxi Medical College and the ethics committee of Nanchang University. NCULAE-202210311028，And comply with the global strategy for ethical treatment and utilization of laboratory animals. Clinical trial number Not applicable. References Waage J et al (2018) Genome-wide association and HLA fine-mapping studies identify risk loci and genetic pathways underlying allergic rhinitis. Nat genet 50(8):1072–1080 Paiva Ferreira LKD et al (2019) Combined allergic rhinitis and asthma syndrome (CARAS). Int immunopharmacol 74(null):105718 Dai M et al (2022) CCR3 gene knockout in bone marrow cells ameliorates combined allergic rhinitis and asthma syndrome (CARAS) by reducing airway inflammatory cell infiltration and Th2 cytokines expression in mice model. Int immunopharmacol, 104(null): p. 108509 Braunstahl GJ et al (2003) Mucosal and systemic inflammatory changes in allergic rhinitis and asthma: a comparison between upper and lower airways. Clin exp allergy 33(5):579–587 Tofukuji S et al (2018) Allergen-specific sublingual immunotherapy is dose and duration dependent in a murine allergic rhinitis model. J allergy clin immun, 142(6): p. 1977–1979.e9. Jin J et al (2023) Fallopia japonica Root Extract Ameliorates Ovalbumin-Induced Airway Inflammation in a CARAS Mouse Model by Modulating the IL-33/TSLP/NF-κB Signaling Pathway. Int J Mol Sci, 24(15): p. null Cavalcanti RFP et al (2023) Limosilactobacillus fermentum modulates the gut-airway axis by improving the immune response through FOXP3 activation on combined allergic rhinitis and asthma syndrome (CARAS). Immunobiology 228(5):152721 Bousquet J et al (2020) Next-generation Allergic Rhinitis and Its Impact on Asthma (ARIA) guidelines for allergic rhinitis based on Grading of Recommendations Assessment, Development and Evaluation (GRADE) and real-world evidence. J allergy clin immun 145(1):70–80e3 Bao Y, Zhu X (2022) Role of Chemokines and Inflammatory Cells in Respiratory Allergy. J Asthma Allergy 15(null):1805–1822 Mazzi V, Fallahi P (2017) Allergic rhinitis and CXCR3 chemokines. Clin ter 168(1):e54–e58 Errahali YJ et al (2013) Inhibition by new glucocorticoid antedrugs [16α, 17α-d] isoxazoline and [16α, 17α-d]-3'-hydroxy-iminoformyl isoxazoline derivatives of chemotaxis and CCL26, CCL11, IL-8, and RANTES secretion. J interf cytok res 33(9):493–507 Baumann R et al (2013) Comparison of the nasal release of IL-4, IL-10, IL-17, CCL13/MCP-4, and CCL26/eotaxin-3 in allergic rhinitis during season and after allergen challenge. Am j rhinol allergy 27(4):266–272 Bao Y et al (2024) The study of the role of purified anti-mouse CD193 (CCR3) antibody in allergic rhinitis mouse animal models. Sci Rep 14(1):1059 Barnes PJ (2022) Chemokine receptor CCR1: new target for asthma therapy. Trends pharmacol sci 43(7):539–541 Chang HW et al (2020) A common signaling pathway leading to degranulation in mast cells and its regulation by CCR1-ligand. Allergy 75(6):1371–1381 Ciechanowska A, Mika J (2024) CC Chemokine Family Members' Modulation as a Novel Approach for Treating Central Nervous System and Peripheral Nervous System Injury-A Review of Clinical and Experimental Findings. Int J Mol Sci, 25(7) Kline JM et al (2021) Structural and functional analysis of Ccr1l1, a Rodentia-restricted eosinophil-selective chemokine receptor homologue. J Biol Chem 296:100373 Komi DEA et al (2020) The Role of Mast Cells in IgE-Independent Lung Diseases. Clin Rev Allergy Immunol 58(3):377–387 Li N et al (2021) Regulated on Activation, Normal T cell Expressed and Secreted (RANTES) drives the resolution of allergic asthma. iScience 24(10):103163 Manthiram K et al (2020) Common genetic susceptibility loci link PFAPA syndrome, Behçet's disease, and recurrent aphthous stomatitis. Proc Natl Acad Sci U S A 117(25):14405–14411 Pawlik K et al (2022) Pharmacological Evidence of the Important Roles of CCR1 and CCR3 and Their Endogenous Ligands CCL2/7/8 in Hypersensitivity Based on a Murine Model of Neuropathic Pain. Cells, 12(1) Zhu LP et al (2023) Chemokine CCL7 mediates trigeminal neuropathic pain via CCR2/CCR3-ERK pathway in the trigeminal ganglion of mice. Mol Pain 19:17448069231169373 Dragan P et al (2023) Chemokine Receptors-Structure-Based Virtual Screening Assisted by Machine Learning. Pharmaceutics, 15(2) Gilliland CT et al (2013) The chemokine receptor CCR1 is constitutively active, which leads to G protein-independent, β-arrestin-mediated internalization. J biol chem 288(45):32194–32210 Lionakis MS et al (2012) Chemokine receptor Ccr1 drives neutrophil-mediated kidney immunopathology and mortality in invasive candidiasis. Plos pathog 8(8):e1002865 Zlotnik A, Yoshie O, Nomiyama H (2006) The chemokine and chemokine receptor superfamilies and their molecular evolution. Genome Biol 7(12):243 Legrand F et al (2019) Sialic acid-binding immunoglobulin-like lectin (Siglec) 8 in patients with eosinophilic disorders: Receptor expression and targeting using chimeric antibodies. J allergy clin immun 143(6):2227–2237e10 O'Sullivan JA et al (2018) Leveraging Siglec-8 endocytic mechanisms to kill human eosinophils and malignant mast cells. J allergy clin immun 141(5):1774–1785e7 Huang K et al (2019) Prevalence, risk factors, and management of asthma in China: a national cross-sectional study. Lancet 394(10196):407–418 Shrimanker R, Pavord ID (2017) Interleukin-5 Inhibitors for Severe Asthma: Rationale and Future Outlook. Biodrugs 31(2):93–103 Song J, Wang J (2022) SIRT3 regulates bronchial epithelium apoptosis and aggravates airway inflammation in asthma. Mol med rep 25(4):null Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6741444","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":464900860,"identity":"be89fc49-af69-4dd3-ad30-82b710f79387","order_by":0,"name":"Youwei Bao","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA2ElEQVRIiWNgGAWjYBACNvbGBoMPFTZy/PKPDxCnhY/n8IHCGWfSjCUb0hKI0yInkZbwmbPtUOKGAzkGRDqMIcdwMwPbAcYNB858vPGGwU5Ot4GgljPGxgU8d5glD/ZutpzDkGxsdoCQFsYeM+MZEs/Y+A7zbpPmYTiQuI2gFmYe8988Bod5GI7xPCNSCxtbgjFPwmEJgTM8bERq4WE+YDjjQJqB5Aw2Y8s5BkT4RX7+wwaDj/9s6vslmB/eeFNhJ0dQCwqQ4CEyapC1kKpjFIyCUTAKRgQAAF7iQ1GW/sLpAAAAAElFTkSuQmCC","orcid":"","institution":"The Second Affiliated Hospital of Nanchang University, Nanchang University","correspondingAuthor":true,"prefix":"","firstName":"Youwei","middleName":"","lastName":"Bao","suffix":""},{"id":464900861,"identity":"1a785fb8-b826-49bf-b86c-23b9f19077ac","order_by":1,"name":"Wu Shuhong","email":"","orcid":"","institution":"The Second Affiliated Hospital of Nanchang University, Nanchang University","correspondingAuthor":false,"prefix":"","firstName":"Wu","middleName":"","lastName":"Shuhong","suffix":""},{"id":464900862,"identity":"0945dd5b-d745-4397-8332-4d6c9e1fbc8a","order_by":2,"name":"Binbin Shi","email":"","orcid":"","institution":"The Second Affiliated Hospital of Nanchang University, Nanchang University","correspondingAuthor":false,"prefix":"","firstName":"Binbin","middleName":"","lastName":"Shi","suffix":""},{"id":464900863,"identity":"38d39d1e-dce3-498b-862b-565e1d626956","order_by":3,"name":"Yinli Jiang","email":"","orcid":"","institution":"The Second Affiliated Hospital of Nanchang University, Nanchang University","correspondingAuthor":false,"prefix":"","firstName":"Yinli","middleName":"","lastName":"Jiang","suffix":""},{"id":464900864,"identity":"3f318c14-15b4-40e9-ae02-b2d4a86af261","order_by":4,"name":"Zhu Yu","email":"","orcid":"","institution":"The Second Affiliated Hospital of Nanchang University, Nanchang University","correspondingAuthor":false,"prefix":"","firstName":"Zhu","middleName":"","lastName":"Yu","suffix":""},{"id":464900865,"identity":"2ec00d0b-145f-44e9-9134-5a85d31e505d","order_by":5,"name":"Zheng Liu","email":"","orcid":"","institution":"The Second Affiliated Hospital of Nanchang University, Nanchang University","correspondingAuthor":false,"prefix":"","firstName":"Zheng","middleName":"","lastName":"Liu","suffix":""},{"id":464900866,"identity":"cf37f5d4-8e9c-4ebe-b8a0-b761a5019d33","order_by":6,"name":"Xinhua Zhu","email":"","orcid":"","institution":"The Second Affiliated Hospital of Nanchang University, Nanchang University","correspondingAuthor":false,"prefix":"","firstName":"Xinhua","middleName":"","lastName":"Zhu","suffix":""}],"badges":[],"createdAt":"2025-05-25 02:53:13","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6741444/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6741444/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":83864217,"identity":"02772082-4e05-46a0-83ad-51999b4474ec","added_by":"auto","created_at":"2025-06-03 20:53:30","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1984545,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend.\u003c/p\u003e","description":"","filename":"FIG101.png","url":"https://assets-eu.researchsquare.com/files/rs-6741444/v1/3e258104f17a3f16aa4e494c.png"},{"id":83864220,"identity":"944edbfe-171e-48a1-b86b-8734863ccaea","added_by":"auto","created_at":"2025-06-03 20:53:30","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":26644981,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend.\u003c/p\u003e","description":"","filename":"FIG201.png","url":"https://assets-eu.researchsquare.com/files/rs-6741444/v1/7dd8f4a488eaeb5e70c36290.png"},{"id":83864221,"identity":"b0b8be71-88e8-472c-9d3c-435b9e7d7d97","added_by":"auto","created_at":"2025-06-03 20:53:30","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":25498162,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend.\u003c/p\u003e","description":"","filename":"FIG301.png","url":"https://assets-eu.researchsquare.com/files/rs-6741444/v1/b5fc9c8fe7b5b5e8a8e354fe.png"},{"id":83864219,"identity":"67e15d0e-3928-4430-92ce-d4a36d9e9326","added_by":"auto","created_at":"2025-06-03 20:53:30","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":22349141,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend.\u003c/p\u003e","description":"","filename":"FIG401.png","url":"https://assets-eu.researchsquare.com/files/rs-6741444/v1/2db6051cb444716ccf63a096.png"},{"id":83864323,"identity":"8483b9ad-81b5-4644-bd25-5cfee2360394","added_by":"auto","created_at":"2025-06-03 21:01:30","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":2093901,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend.\u003c/p\u003e","description":"","filename":"FIG501.png","url":"https://assets-eu.researchsquare.com/files/rs-6741444/v1/e7101b736e964e7265964062.png"},{"id":83864216,"identity":"e455e81b-878f-4871-8236-1c19c49655ed","added_by":"auto","created_at":"2025-06-03 20:53:29","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":1633047,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend.\u003c/p\u003e","description":"","filename":"FIG601.png","url":"https://assets-eu.researchsquare.com/files/rs-6741444/v1/61bb9f28d7b100508c1962ac.png"},{"id":85507324,"identity":"c081ee3d-63bd-4681-b668-346be478f444","added_by":"auto","created_at":"2025-06-26 15:47:01","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":74176047,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6741444/v1/761ac4f5-aeae-4fa1-bf9e-ed2c82045520.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Dual CCR1+3 Monoclonal Antibody Therapy Alleviates Allergic Rhinitis-Asthma Syndrome in Mice via Suppressing Th2 Inflammation","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eCombined Allergic Rhinitis and Asthma Syndrome (CARAS) is a unified airway disorder characterized by Th2-mediated inflammation, clinically presenting as nasal congestion, sneezing, airway hyperresponsiveness, and irreversible pulmonary dysfunction, which severely impairs patients' quality of life\u003csup\u003e[\u003cspan additionalcitationids=\"CR2 CR3 CR4\" citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]\u003c/sup\u003e. The pathogenesis involves eosinophil (EOS) infiltration, mast cell activation, and chemokine-driven immune cell migration. CC chemokine receptors, such as CCR3 and CCR1, facilitate inflammatory cell recruitment to respiratory tissues via interactions with ligands like CCL11 and CCL24, leading to mucosal damage and airway remodeling\u003csup\u003e[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]\u003c/sup\u003e. Elevated CCR3 expression in the nasal mucosa and lung tissues of CARAS patients correlates positively with disease severity\u003csup\u003e[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]\u003c/sup\u003e. With the increasing prevalence of allergic respiratory diseases due to industrialization and shifting allergen profiles, addressing these conditions remains an urgent global health priority\u003csup\u003e[\u003cspan additionalcitationids=\"CR11\" citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eOur previous systematic investigations evaluated the efficacy of CCR3 monoclonal antibody (CCR3mAb) in allergic rhinitis models\u003csup\u003e[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]\u003c/sup\u003e. Intraperitoneal administration of CCR3mAb (10 mg/kg) significantly alleviated nasal symptoms and reduced eosinophil infiltration in murine models, outperforming intranasal delivery. These findings support CCR3 as a promising therapeutic target. However, recent studies indicate that compensatory CCR1 activation in mast cells may undermine the efficacy of single-target therapies\u003csup\u003e[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]\u003c/sup\u003e, suggesting that dual CCR1\u0026thinsp;+\u0026thinsp;3 blockade could synergistically enhance therapeutic outcomes. Current standard treatments for CARAS, such as glucocorticoids and anti-IgE monoclonal antibodies, offer symptomatic relief but are limited by side effects (e.g., osteoporosis, immunosuppression) and incomplete targeting of upper and lower airway inflammation\u003csup\u003e[\u003cspan additionalcitationids=\"CR17 CR18 CR19 CR20 CR21\" citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]\u003c/sup\u003e. Inspired by the success of bispecific antibodies (e.g., Blinatumomab) in hematologic malignancies, which simultaneously engage T-cell (CD3) and B-cell (CD19) antigens\u003csup\u003e[\u003cspan additionalcitationids=\"CR17 CR18 CR19 CR20 CR21\" citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]\u003c/sup\u003e, we propose a novel strategy combining CCR1mAb and CCR3mAb to address these limitations. Despite emerging interest in dual receptor targeting, systematic exploration of CCR1\u0026thinsp;+\u0026thinsp;3 co-blockade in CARAS remains underexplored \u003csup\u003e[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eThe CCR1 monoclonal antibody (AB_2629727, BioLegend Cat. No. 152502) \u003csup\u003e[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]\u003c/sup\u003e and CCR3 monoclonal antibody (AB_2715914, BioLegend Cat. No. 144502) \u003csup\u003e[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]\u003c/sup\u003e used in this study were commercially sourced from BioLegend. Building on the aforementioned rationale, we propose an innovative dual-target strategy combining CCR1mAb and CCRR3mAb to ameliorate CARAS through the following mechanisms: (1) inhibition of inflammatory cell migration by blocking CCR3-mediated eosinophil infiltration and CCR1-dependent mast cell activation; (2) modulation of Th2 cytokines via downregulation of pro-inflammatory factors such as IL-4, IL-5, and IL-13; and (3) attenuation of airway remodeling through reduced collagen deposition and mucosal thickening. The experimental design adopted our previously optimized dosing regimen (CCR3mAb, 10 mg/kg, intraperitoneal injection) \u003csup\u003e[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]\u003c/sup\u003e, with further evaluation of CCR1mAb (10 mg/kg) as monotherapy and in combination.\u003c/p\u003e \u003cp\u003eThis study is the first to validate the dual CCR1\u0026thinsp;+\u0026thinsp;3 blockade strategy in a CARAS model, providing novel insights into the role of chemokine receptor networks in allergic diseases and establishing a foundation for developing high-efficacy, low-toxicity combination therapies. Utilizing a murine model of allergic rhinitis with concomitant asthma, we assessed pathological alterations in the nasal mucosa, bronchi, and lung tissues, alongside Th2 cytokine levels in serum and nasal lavage fluid (NALF,nasal lavage fluid). Furthermore, we evaluated the activation status of eosinophils, mast cells, and Th2 cells, as well as structural remodeling in these tissues. These investigations elucidate the therapeutic potential of CCR1\u0026thinsp;+\u0026thinsp;3 co-targeting in CARAS and highlight its broader implications for other Th2-driven disorders, such as atopic dermatitis and chronic rhinosinusitis with nasal polyps.\u003c/p\u003e"},{"header":"2. Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1. Animals\u003c/h2\u003e \u003cp\u003eFemale balb/c mice aged 6\u0026ndash;8 weeks were provided by the Department of animal science, Nanchang University School of medicine. Mice were housed under specific pathogen free conditions in the animal center of Jiangxi Medical College, Nanchang University. The whole experimental protocol was approved by the institutional animal care and use Committee of Jiangxi Medical College and the ethics committee of Nanchang University. NCULAE-202210311028, And comply with the global strategy for ethical treatment and utilization of laboratory animals.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2. Establishment of CARAS model\u003c/h2\u003e \u003cp\u003eThe groups were as follows: ① normal control (NC), ② ova\u0026thinsp;+\u0026thinsp;antibody solvent (Caras gourp), ③ CCR1 mAb antibody treatment group (CCR1 mAb), ④ ccr3mab antibody treatment group (ccr3mab), ⑤ CCR1\u0026thinsp;+\u0026thinsp;3mAb antibody treatment group (CCR1\u0026thinsp;+\u0026thinsp;3mAb), ⑥ dexamethasone treatment group (DXMS), a total of 6 mice in each group, and the experiment was repeated three times. BALB / c mice were sensitized by intraperitoneal injection of ova (10 \u0026micro; g OVA) at 0, 7, and 14 days; On the 14th day, 10 \u0026micro; l of ova (1 mg/ml; Caras group) or phosphate buffered saline (PBS) was injected into each nostril; Ova was nebulized for 1 week at 21\u0026ndash;28 days. After the last nasal stimulation, the number of nose rubbing and sneezing of mice during the 10 minute period was recorded. Aerosol challenge phase used 5 ml of 1% ova (Caras group) or 5 ml of PBS with aerosol exposure technique for 7 consecutive days and 30 min. CCR1 antibody and CCR3 antibody (10mg/kg, i.p.) were injected twice a day on 31, 33 and 35 days, respectively; DXMS (5mg/kg, i.p.) was administered by intraperitoneal injection 30min before nasal drip. For 36 days, after the last stimulation, mice were anesthetized with isoflurane (1\u0026ndash;5%) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea).\u003c/p\u003e \u003cp\u003eThe CCR1 monoclonal antibody (ab_2629727, biolegend cat. No. 152502) and CCR3 monoclonal antibody (ab_2715914, biolegend cat. No. 144502) [16] used in this study were both produced by biolegend. The dose of antibody use refers to the previous study, and ccr3mab (10 mg/kg, i.p.) was injected intraperitoneally [13].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3.Nasal symptoms and body weight changes\u003c/h2\u003e \u003cp\u003eThe body weight of mice in each group was recorded before each sensitization, challenge, or nebulization. Symptoms, such as the number of sneezes and scratches, were assessed within 10 minutes after the last nasal challenge. The body weight of mice in each cage was recorded once a week, one hour before administration, until the day before euthanasia and tissue collection. Body weights were recorded on days 0, 7, 14, 21, 28, and 35.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4. Peripheral blood was collected from each group sequentially\u003c/h2\u003e \u003cp\u003eBlood samples were collected sequentially from each group. Mice were anesthetized with isoflurane (1\u0026ndash;4%), and blood was collected using the retro-orbital bleeding method. The collected blood was allowed to sit for 2 hours, then centrifuged at 4℃ for 10 minutes (2000\u0026ndash;3000 rpm/min) to collect the upper serum, which was stored at -80℃.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5. Alveolar and nasal lavage fluid collection(BALF, NALF)\u003c/h2\u003e \u003cp\u003ePBS was placed on ice to cool down, the mouse thorax was opened with scissors, and the cervical trachea was separated, making sure not to cut through the lung tissue.A 1 ml syringe needle was inserted into the trachea and ligated to the upper end of the tracheal ligature with a fine silk thread. The syringe drew 0.5 mL of pre-cooled PBS and the fluid was aspirated.A pipette gun was used to aspirate 200 uL of PBS, and the tip was inserted into the nasopharynx and punched into the anterior nasal cavity through the posterior nostril, and the effluent lavage fluid was collected and stored at -80\u0026deg;C and thawed when used.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6. Histologic study\u003c/h2\u003e \u003cp\u003eFor histological analysis, the heads of the mice were removed, and the nasal septum was completely freed. The nasal mucosa was then scraped off using a curved forceps and placed into an Eppendorf (EP) tube containing 10% neutral formalin for the purpose of pathological section staining. The lungs were also extracted and fixed in a 4% paraformaldehyde solution for 24 hours.The fixed tissues from both the nose and lungs were subsequently embedded in paraffin wax. Tissue sections of 4mm thickness were mounted onto glass slides and the wax was removed. These sections were then stained using Hematoxylin and Eosin (HE), Masson's trichrome, and immunohistochemical techniques. The stained sections were analyzed under a light microscope (Thermo Fisher Scientific, USA) to evaluate the pathological changes in the nasal and lung tissues.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.7. Quantification of nasal mucosa EOS quantity and thickness under HE staining by optical microscope.\u003c/h2\u003e \u003cp\u003eWe quantified the thickness of the nasal mucosa and the number of eosinophils under high magnification (400x) in HE-stained sections. For each mouse in each group, five random fields of view were selected from the HE-stained sections of the nasal mucosa, and the average values were calculated.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.8. Elisa detection IL-4, IL-5, IL-10, IL-13, and IgE;\u003c/h2\u003e \u003cp\u003eThe levels of IL-4, IL-5, IL-10, IL-13, and IgE were determined using an ELISA kit (Wuhan Kequke Experimental Technology Co., Ltd., China) according to the manufacturer's instructions. All operations were strictly conducted following the instructions of the enzyme-linked immunosorbent assay kit.\u003c/p\u003e \u003cp\u003e2.9. qPCR detection of mRNA expression levels of CCR1 and CCR3 in the nasopharyngeal mucosa of each group of mice.\u003c/p\u003e \u003cp\u003eTrizoL (TransGen Biotech, China) was used to extract total RNA from the nasopharyngeal mucosa, which was then reverse transcribed into cDNA using a reverse transcription kit (Thermo Fisher Scientific, USA). Finally, SYBR (Roche, Switzerland) was employed to detect the expression levels of CCR1, CCR3, GAPDH in the nasopharyngeal mucosa of each group of mice. The primer sequences (5\u0026prime;~ 3\u0026prime;) are as follows:\u003c/p\u003e \u003cp\u003ePrimer Name Primer Sequence 5\u0026rsquo;-3\u0026rsquo;\u003c/p\u003e \u003cp\u003eCCR1 Forword primer CTCATGCAGCATAGGAGGCTT\u003c/p\u003e \u003cp\u003eCCR1 Reverse primer ACATGGCATCACCAAAAATCCA\u003c/p\u003e \u003cp\u003eCCR3 Forword primer TCGAGCCCGAACTGTGACT\u003c/p\u003e \u003cp\u003eCCR3 Reverse primer CCTCTGGATAGCGAGGACTG\u003c/p\u003e \u003cp\u003eGAPDH Forword primer CGCCTGGAGAAACCTGCCAAG\u003c/p\u003e \u003cp\u003eGAPDH Reverse primer CCACCACCCTGTTGCTGTAGC\u003c/p\u003e \u003cp\u003eConditions:\u003c/p\u003e \u003cp\u003eStage 1: Pre-denaturation: Cycling number: 1, 95˚C for 30s;\u003c/p\u003e \u003cp\u003eStage 2: PCR reaction: Cycling number: 40, 95˚C for 5s, 60˚C for 34s;\u003c/p\u003e \u003cp\u003eStage 3: 95˚C for 15 seconds, 60˚C for 1 minute.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e2.10. Data Analysis\u003c/h2\u003e \u003cp\u003eAll statistical analyses were performed using Prism 6.0 software. Independent sample t-tests or one-way analysis of variance (ANOVA) were used for statistical significance analysis. Based on the nature of the data, statistical analysis was conducted for each group, and the results were expressed as Mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD. A P-value\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered statistically significant.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe number of nasal scratches and sneezes of mice within 10min\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"7\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNC\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCARAS\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCCR1mAb\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eCCR3mAb\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eCCR1\u0026thinsp;+\u0026thinsp;3mAb\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eDXMS\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e抓鼻次/10min\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e3.67\u0026thinsp;\u0026plusmn;\u0026thinsp;2.08\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e23.33\u0026thinsp;\u0026plusmn;\u0026thinsp;5.51\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e13.67\u0026thinsp;\u0026plusmn;\u0026thinsp;1.53\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e11.67\u0026thinsp;\u0026plusmn;\u0026thinsp;1.53\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c6\"\u003e \u003cp\u003e10.00\u0026thinsp;\u0026plusmn;\u0026thinsp;6.25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c7\"\u003e \u003cp\u003e6.33\u0026thinsp;\u0026plusmn;\u0026thinsp;1.53\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003e喷嚏次/10min\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003e3.33\u0026thinsp;\u0026plusmn;\u0026thinsp;1.53\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003e21.00\u0026thinsp;\u0026plusmn;\u0026thinsp;8.54\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003e6.67\u0026thinsp;\u0026plusmn;\u0026thinsp;1.53\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003e8.33\u0026thinsp;\u0026plusmn;\u0026thinsp;3.51\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003e6.00\u0026thinsp;\u0026plusmn;\u0026thinsp;1.00\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c7\"\u003e \u003cp\u003e\u003cem\u003e5.00\u0026thinsp;\u0026plusmn;\u0026thinsp;1.00\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e "},{"header":"3. Results","content":"\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e3.1. Nasal Symptoms\u003c/h2\u003e \u003cp\u003eAfter the final nasal challenge with OVA in mice, the number of sneezes and nose scratches within 10 minutes were recorded and the data were quantified. The average nose scratch frequency and average sneeze frequency in the allergic group (CARAS group) were significantly higher than those in the normal group and the antibody treatment groups. The CCR1mAb treatment group, CCR3mAb treatment group, and CCR1\u0026thinsp;+\u0026thinsp;3mAb treatment group also exhibited nose scratches and sneezes, but they were significantly reduced compared to the CARAS mice, and the differences were statistically significant, although still higher than the normal control group. There were no significant differences in the counts of sneezes and nose scratches among the CCR1mAb treatment group, CCR3mAb treatment group, and CCR1\u0026thinsp;+\u0026thinsp;3mAb treatment group (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e,Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB, C). The above data show that behavioral observation and analysis of mice indicate that intervention with monoclonal antibodies can effectively improve nasal symptoms in CARAS mice.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e3.2. HE Staining Results\u003c/h2\u003e \u003cp\u003eUsing HE staining, the nasal mucosa and lung tissues of mice were observed under high magnification (400\u0026times;). After treatment with CCR1mAb and CCR3mAb in CARAS mice, improvements were observed in both nasal mucosa and lung allergy: the infiltration of inflammatory cells was reduced, and the nasal mucosa and its surface cilia were partially restored (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Upon examining the bronchi of mice in each group, we found no significant differences among the CCR1mAb treatment group, CCR3mAb treatment group, and CCR1\u0026thinsp;+\u0026thinsp;3mAb treatment group. When observing the lung tissues of mice in each group, the alveolar tissue, inflammatory infiltration, and interstitial inflammation in the lungs were all alleviated in the CCR1mAb and CCR3mAb groups compared to the CARAS group, with these changes being particularly evident in the CCR1\u0026thinsp;+\u0026thinsp;3mAb treatment group. The successful establishment of the CARAS model also resulted in inflammatory-related changes in the nasal mucosa and lung tissue, demonstrating the mutual influence between allergic rhinitis and asthma. After administering CCR1mAb and CCR3mAb to CARAS mice, the lungs showed significant improvement, indicating that CCR1mAb and CCR3mAb have therapeutic effects on pulmonary allergic diseases.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e3.3. Masson staining\u003c/h2\u003e \u003cp\u003eUsing Masson staining to observe the distribution of collagen fibers in the nasal mucosa and lung tissue of mice in each group, the sections were examined under high magnification (400\u0026times;). When examining the nasal mucosa, no significant differences were observed among the groups. Upon observing the bronchi of mice in each group, the CARAS group showed destruction of the bronchial luminal structure, peeling off of the inner mucosal layer, significant thickening and disorganization of the bronchial tissue, and a notable presence of numerous inflammatory cells, such as eosinophils and mast cells, around the trachea, with obvious tissue congestion. The blue color represents collagen fibers, which were stained deeply and widely distributed, consistent with asthma airway remodeling. Varying degrees of therapeutic effects were observed in the bronchi of mice in the CCR1mAb treatment group, CCR3mAb treatment group, and CCR1\u0026thinsp;+\u0026thinsp;3mAb treatment group. Among the three antibody treatment groups, the content and staining intensity of collagen fibers were most severe in the CCR1mAb treatment group, followed by the CCR3mAb treatment group, and least severe in the CCR1\u0026thinsp;+\u0026thinsp;3mAb treatment group, although they were all more severe than the DXMS treatment group (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). After treatment with CCR1 monoclonal antibody and CCR3 monoclonal antibody, a protective effect on the lung structure was observed in the CARAS group, with a significant reduction in inflammatory cells and edema in the lung tissue, as well as a decrease in the number and severity of alveolar ruptures. Although there was still a small amount of inflammatory cell infiltration, it was significantly reduced compared to the CARAS group. CCR1mAb and CCR3mAb could inhibit inflammatory infiltration and airway remodeling in the lung tissue to some extent. As seen from the staining intensity and distribution range, CCR3mAb showed slightly better therapeutic effects than CCR1mAb. The combined antibody group of CCR1\u0026thinsp;+\u0026thinsp;CCR3mAb demonstrated a more pronounced protective effect on alveolar structure and lung tissue remodeling compared to the single antibody groups.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e3.4. Immunohistochemical results\u003c/h2\u003e \u003cp\u003eIn this experiment, immunohistochemistry with SIGLEC8 Antibody was used to observe and compare mast cells and eosinophils in the nasal mucosa and lung tissues of mice in each group [23, 24]. The infiltration of mast cells and eosinophils in the nasal mucosa and lung tissues was observed under high magnification (400\u0026times;), similar to the HE staining. In the nasal mucosa sections, significant inflammatory cell infiltration and mucosal thickening were observed in the CARAS group, with a higher signal compared to the NC group. The mucosal damage and inflammatory cell infiltration were reduced in the CCR1mAb treatment group, CCR3mAb treatment group, and CCR1\u0026thinsp;+\u0026thinsp;3mAb treatment group compared to the CARAS group, with a lower signal. However, there was no significant difference in the specific therapeutic effects between the CCR1mAb treatment group and the CCR3mAb treatment group, with the CCR1\u0026thinsp;+\u0026thinsp;3mAb treatment group showing the most noticeable improvement (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). In the bronchial sections, significant inflammatory cell infiltration and bronchial mucosa thickening were observed in the CARAS group. Mice in the CCR1mAb treatment group and CCR3mAb treatment group showed a lower signal compared to the CARAS group; there was no significant difference between the CCR1\u0026thinsp;+\u0026thinsp;3mAb treatment group and the CCR1mAb or CCR3mAb treatment groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). In the lung sections, a significantly high signal was observed in the lung field of the CARAS group, with disordered lung tissue structure, no clear normal tissue, and interstitial edema and structural damage. The lung inflammation, edema, and alveolar structure in the CCR1mAb group and CCR3mAb group were significantly improved compared to the CARAS group, with a small amount of inflammatory cell infiltration visible in the lung tissue compared to the CARAS group. The recovery of lung structure was more evident in the CCR1\u0026thinsp;+\u0026thinsp;3mAb group compared to the single antibody treatment groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eCCR3mAb not only reduced the migration and infiltration of mast cells and eosinophils into the nasal mucosa of CARAS mice but also inhibited inflammatory infiltration in the lung tissue and produced a certain therapeutic effect. The combination of CCR1mAb and CCR3mAb had a synergistic therapeutic effect, superior to the single antibody treatment groups. It is worth noting that the high signal in the bronchial intima of the dual antibody combination group indicates a higher level of inflammation, which is more pronounced compared to the single antibody use. This differs from the pathological results in the nasal mucosa and lung tissue. It raises the consideration of whether the inflammation is localized to the intima layer, with a reduced inflammatory range but a more pronounced degree.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003e3.5. ELISA\u003c/h2\u003e \u003cp\u003eELISA was used to detect the concentrations of IL-4, IL-5, IL-10, IL-13, and IgE in peripheral blood, bronchoalveolar lavage fluid (BALF,bronchoalveolar lavage fluid), and nasal lavage fluid (NALF). In the peripheral blood of the CARAS group, the TH2 cytokines IL-4, IL-5, IL-10, IL-13, and IgE were significantly elevated compared to the NC and antibody treatment groups, with statistically significant differences (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05). In the CCR1mAb treatment group, CCR3mAb treatment group, and CCR1\u0026thinsp;+\u0026thinsp;3mAb treatment group, the TH2 cytokines IL-4, IL-5, IL-13, and IgE were all reduced compared to the CARAS group, with statistically significant differences. The concentrations in BALF and NALF were significantly lower than those in peripheral blood, possibly due to the dilution of cytokines during the lavage process with PBS solution. The ELISA results for IL-4, IL-5, IL-10, IL-13, and IgE were quantified and summarized in a table. All other data differences between the NC group, CCR1mAb group, CCR3mAb group, CCR1\u0026thinsp;+\u0026thinsp;3mAb group, and the allergic rhinitis group were statistically significant (Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e,Fig.\u0026nbsp;5). We found that the use of CCR1mAb and CCR3mAb can reduce the levels of TH2 inflammatory cytokines in mice with allergic rhinitis and asthma, thereby alleviating the TH2 cell imbalance in respiratory allergic diseases and regulating the TH2 imbalance.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eStatistical table of ELISA results for IL-4, IL-4, IL-5, IL-10, IL-13 and IgE levels. The ns indicate no significant difference, * P ˂ 0.05; * * P ˂ 0.01 compared to CARAS; * * * P ˂ 0.001 compared to CARAS, * * * * P ˂ 0.0001 compared to CARAS.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"8\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNormal\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCARAS\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eCCR1mAb\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eCCR3mAb\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eCCR1\u0026thinsp;+\u0026thinsp;3mAb\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003eDXMS\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eIL-4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eBlood\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e189.10\u0026thinsp;\u0026plusmn;\u0026thinsp;16.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e464.80\u0026thinsp;\u0026plusmn;\u0026thinsp;57.99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e304.50\u0026thinsp;\u0026plusmn;\u0026thinsp;28.50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c6\"\u003e \u003cp\u003e303.90\u0026thinsp;\u0026plusmn;\u0026thinsp;28.91\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c7\"\u003e \u003cp\u003e277.80\u0026thinsp;\u0026plusmn;\u0026thinsp;20.27\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c8\"\u003e \u003cp\u003e203.10\u0026thinsp;\u0026plusmn;\u0026thinsp;8.40\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eBALF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e149.30\u0026thinsp;\u0026plusmn;\u0026thinsp;25.40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e411.10\u0026thinsp;\u0026plusmn;\u0026thinsp;59.33\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e199.40\u0026thinsp;\u0026plusmn;\u0026thinsp;43.11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c6\"\u003e \u003cp\u003e243.90\u0026thinsp;\u0026plusmn;\u0026thinsp;46.55\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c7\"\u003e \u003cp\u003e198.20\u0026thinsp;\u0026plusmn;\u0026thinsp;45.25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c8\"\u003e \u003cp\u003e154.70\u0026thinsp;\u0026plusmn;\u0026thinsp;25.78\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNALF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e142.00\u0026thinsp;\u0026plusmn;\u0026thinsp;56.13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e406.20\u0026thinsp;\u0026plusmn;\u0026thinsp;20.02\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e193.90\u0026thinsp;\u0026plusmn;\u0026thinsp;34.65\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c6\"\u003e \u003cp\u003e192.80\u0026thinsp;\u0026plusmn;\u0026thinsp;19.93\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c7\"\u003e \u003cp\u003e160.80\u0026thinsp;\u0026plusmn;\u0026thinsp;+\u0026thinsp;16.73\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c8\"\u003e \u003cp\u003e143.20\u0026thinsp;\u0026plusmn;\u0026thinsp;11.90\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eIL-5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eBlood\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e36.84\u0026thinsp;\u0026plusmn;\u0026thinsp;7.74\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e89.71\u0026thinsp;\u0026plusmn;\u0026thinsp;6.96\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e72.27\u0026thinsp;\u0026plusmn;\u0026thinsp;4.63\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c6\"\u003e \u003cp\u003e63.852\u0026thinsp;\u0026plusmn;\u0026thinsp;2.32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c7\"\u003e \u003cp\u003e62.52\u0026thinsp;\u0026plusmn;\u0026thinsp;2.74\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c8\"\u003e \u003cp\u003e43.77\u0026thinsp;\u0026plusmn;\u0026thinsp;1.60\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eBALF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e31.10\u0026thinsp;\u0026plusmn;\u0026thinsp;6.92\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e72.58\u0026thinsp;\u0026plusmn;\u0026thinsp;5.92\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e59.18\u0026thinsp;\u0026plusmn;\u0026thinsp;4.53\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c6\"\u003e \u003cp\u003e41.67\u0026thinsp;\u0026plusmn;\u0026thinsp;9.59\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c7\"\u003e \u003cp\u003e43.10\u0026thinsp;\u0026plusmn;\u0026thinsp;2.98\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c8\"\u003e \u003cp\u003e36.05\u0026thinsp;\u0026plusmn;\u0026thinsp;2.26\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNALF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e37.07\u0026thinsp;\u0026plusmn;\u0026thinsp;6.09\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e60.53\u0026thinsp;\u0026plusmn;\u0026thinsp;11.97\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e32.47\u0026thinsp;\u0026plusmn;\u0026thinsp;3.66\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c6\"\u003e \u003cp\u003e34.04\u0026thinsp;\u0026plusmn;\u0026thinsp;2.85\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c7\"\u003e \u003cp\u003e37.35\u0026thinsp;\u0026plusmn;\u0026thinsp;1.79\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c8\"\u003e \u003cp\u003e29.36\u0026thinsp;\u0026plusmn;\u0026thinsp;1.71\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eIL-10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eBlood\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e832.3\u0026thinsp;\u0026plusmn;\u0026thinsp;263.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e1797.00\u0026thinsp;\u0026plusmn;\u0026thinsp;107.80\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e1225.00\u0026thinsp;\u0026plusmn;\u0026thinsp;99.86\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c6\"\u003e \u003cp\u003e1120.00\u0026thinsp;\u0026plusmn;\u0026thinsp;185.60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c7\"\u003e \u003cp\u003e885.10\u0026thinsp;\u0026plusmn;\u0026thinsp;30.36\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c8\"\u003e \u003cp\u003e794.00\u0026thinsp;\u0026plusmn;\u0026thinsp;33.18\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eBALF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e508.40\u0026thinsp;\u0026plusmn;\u0026thinsp;63.44\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e1535.00\u0026thinsp;\u0026plusmn;\u0026thinsp;85.23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e970.70\u0026thinsp;\u0026plusmn;\u0026thinsp;41.08\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c6\"\u003e \u003cp\u003e886.80\u0026thinsp;\u0026plusmn;\u0026thinsp;51.71\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c7\"\u003e \u003cp\u003e957.30\u0026thinsp;\u0026plusmn;\u0026thinsp;120.80\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c8\"\u003e \u003cp\u003e737.30\u0026thinsp;\u0026plusmn;\u0026thinsp;16.96\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNALF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e451.20\u0026thinsp;\u0026plusmn;\u0026thinsp;47.55\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e1400.00\u0026thinsp;\u0026plusmn;\u0026thinsp;47.68\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e977.90\u0026thinsp;\u0026plusmn;\u0026thinsp;51.19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c6\"\u003e \u003cp\u003e714.60\u0026thinsp;\u0026plusmn;\u0026thinsp;53.15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c7\"\u003e \u003cp\u003e714.00\u0026thinsp;\u0026plusmn;\u0026thinsp;151.20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c8\"\u003e \u003cp\u003e569.00\u0026thinsp;\u0026plusmn;\u0026thinsp;65.18\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eIL-13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eBlood\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e49.01\u0026thinsp;\u0026plusmn;\u0026thinsp;9.82\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e133.50\u0026thinsp;\u0026plusmn;\u0026thinsp;9.32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e95.63\u0026thinsp;\u0026plusmn;\u0026thinsp;10.13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c6\"\u003e \u003cp\u003e90.64\u0026thinsp;\u0026plusmn;\u0026thinsp;6.10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c7\"\u003e \u003cp\u003e86.81\u0026thinsp;\u0026plusmn;\u0026thinsp;8.52\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c8\"\u003e \u003cp\u003e66.42\u0026thinsp;\u0026plusmn;\u0026thinsp;2.76\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eBALF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e39.81\u0026thinsp;\u0026plusmn;\u0026thinsp;1.96\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e114.00\u0026thinsp;\u0026plusmn;\u0026thinsp;6.44\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e93.28\u0026thinsp;\u0026plusmn;\u0026thinsp;8.26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c6\"\u003e \u003cp\u003e86.30\u0026thinsp;\u0026plusmn;\u0026thinsp;6.14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c7\"\u003e \u003cp\u003e73.53\u0026thinsp;\u0026plusmn;\u0026thinsp;8.02\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c8\"\u003e \u003cp\u003e51.07\u0026thinsp;\u0026plusmn;\u0026thinsp;2.38\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNALF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e46.05\u0026thinsp;\u0026plusmn;\u0026thinsp;3.05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e116.90\u0026thinsp;\u0026plusmn;\u0026thinsp;12.84\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e78.74\u0026thinsp;\u0026plusmn;\u0026thinsp;13.67\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c6\"\u003e \u003cp\u003e73.53\u0026thinsp;\u0026plusmn;\u0026thinsp;3.53\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c7\"\u003e \u003cp\u003e64.45\u0026thinsp;\u0026plusmn;\u0026thinsp;4.71\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c8\"\u003e \u003cp\u003e49.11\u0026thinsp;\u0026plusmn;\u0026thinsp;1.27\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eIgE\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eBlood\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e258.70\u0026thinsp;\u0026plusmn;\u0026thinsp;49.60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e792.30\u0026thinsp;\u0026plusmn;\u0026thinsp;85.05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e574.50\u0026thinsp;\u0026plusmn;\u0026thinsp;13.34\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c6\"\u003e \u003cp\u003e557.00\u0026thinsp;\u0026plusmn;\u0026thinsp;45.55\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c7\"\u003e \u003cp\u003e405.40\u0026thinsp;\u0026plusmn;\u0026thinsp;10.49\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c8\"\u003e \u003cp\u003e331.00\u0026thinsp;\u0026plusmn;\u0026thinsp;24.23\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eBALF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e235.80\u0026thinsp;\u0026plusmn;\u0026thinsp;35.57\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e673.20\u0026thinsp;\u0026plusmn;\u0026thinsp;53.15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e463.10\u0026thinsp;\u0026plusmn;\u0026thinsp;75.27\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c6\"\u003e \u003cp\u003e477.10\u0026thinsp;\u0026plusmn;\u0026thinsp;9.753\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c7\"\u003e \u003cp\u003e336.90\u0026thinsp;\u0026plusmn;\u0026thinsp;18.16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c8\"\u003e \u003cp\u003e294.40\u0026thinsp;\u0026plusmn;\u0026thinsp;19.66\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNALF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e240.20\u0026thinsp;\u0026plusmn;\u0026thinsp;44.41\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e593.10\u0026thinsp;\u0026plusmn;\u0026thinsp;47.05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e288.40\u0026thinsp;\u0026plusmn;\u0026thinsp;44.51\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c6\"\u003e \u003cp\u003e350.00\u0026thinsp;\u0026plusmn;\u0026thinsp;32.61\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c7\"\u003e \u003cp\u003e301.00\u0026thinsp;\u0026plusmn;\u0026thinsp;14.47\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c8\"\u003e \u003cp\u003e255.70\u0026thinsp;\u0026plusmn;\u0026thinsp;12.36\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003e3.6.The number of eosinophils observed under the microscope in HE-stained sections.\u003c/h2\u003e \u003cp\u003eWe conducted a detailed analysis of the nasal mucosa in CARAS mice. To gain a more intuitive understanding of the efficacy of antibody treatment and the differences between nasal mucosa groups, we quantified the thickness of the nasal mucosa and the number of eosinophils under high-power magnification in HE-stained sections. For each mouse in each group, five random 400x fields were selected from the HE-stained nasal mucosa sections, and the average was calculated. The number of eosinophils within the field of view was counted, with only one side considered for both the upper and lower regions and for the left and right regions. The number of eosinophils in the NC group was significantly lower than that in the CARAS group. The number of eosinophils in the three antibody treatment groups was significantly lower than that in the CARAS group, but there was no significant difference among the antibody treatment groups (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e, Fig.\u0026nbsp;6A). In the HE-stained nasal mucosa sections under high-power magnification, the number of eosinophils in the CARAS group was significantly higher than that in the NC and antibody treatment groups. However, there was no significant statistical difference among the CCR1mAb, CCR3mAb, and CCR1\u0026thinsp;+\u0026thinsp;3mAb groups, although all of them had fewer eosinophils than the DXMS group.\u003c/p\u003e \u003cp\u003eThe data on nasal mucosa thickness\u003c/p\u003e \u003cp\u003eThe nasal mucosa of mice consists of three layers: the basal cell layer, the epithelial cell layer, and the ciliated cell layer. In CARAS mice, the ciliated layer exhibits cilia shedding, the epithelial cell layer thickens, the basement membrane cell layer becomes disorganized, and the number of glands increases significantly. To quantify the mucosal data in the allergic state, we measured the mucosal thickness at the root of the nasal septum in each mouse at the same position. In the HE-stained nasal mucosa sections under high-power magnification, the nasal mucosa thickness in the CARAS group was significantly increased, markedly higher than that in the NC group. However, there was no significant statistical difference among the CCR1mAb, CCR3mAb, and CCR1\u0026thinsp;+\u0026thinsp;3mAb groups, although all of them showed less reduction than the DXMS group (Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e, Fig.\u0026nbsp;6B).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eEosinophil numbers at high magnification\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGroups\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNumber\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e5.67\u0026thinsp;\u0026plusmn;\u0026thinsp;1.53\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCARAS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e39.33\u0026thinsp;\u0026plusmn;\u0026thinsp;2.52\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCCR1mAb\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e24.00\u0026thinsp;\u0026plusmn;\u0026thinsp;5.29\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCCR3mAb\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e23.67\u0026thinsp;\u0026plusmn;\u0026thinsp;4.04\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCCR1\u0026thinsp;+\u0026thinsp;3mAb\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e24.33\u0026thinsp;\u0026plusmn;\u0026thinsp;5.69\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDXMS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e14.67\u0026thinsp;\u0026plusmn;\u0026thinsp;2.52\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eHE stained nasal mucosal thickness values\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGroups\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDepth(um)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e76.61\u0026thinsp;\u0026plusmn;\u0026thinsp;8.71\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCARAS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e242.60\u0026thinsp;\u0026plusmn;\u0026thinsp;33.33\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCCR1mAb\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e166.10\u0026thinsp;\u0026plusmn;\u0026thinsp;21.53\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCCR3mAb\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e185.50\u0026thinsp;\u0026plusmn;\u0026thinsp;25.50\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCCR1\u0026thinsp;+\u0026thinsp;3mAb\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e161.90\u0026thinsp;\u0026plusmn;\u0026thinsp;16.91\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDXMS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e144.90\u0026thinsp;\u0026plusmn;\u0026thinsp;9.36\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003e3.7. CCR1mRNA and CCR3mRNA expression levels\u003c/h2\u003e \u003cp\u003eTo understand the expression levels of CCR1mRNA and CCR3mRNA in CARAS mice in this experimental group after administration of CCR 1 and CCR 3 monoclonal antibodies. After molding, nasal mucosa samples from each group were collected to detect CCR 1 and CCR3mRNA (Table\u0026nbsp;\u003cspan refid=\"Tab7\" class=\"InternalRef\"\u003e5\u003c/span\u003e, Fig.\u0026nbsp;6C). We found that CCR1mAb alone or CCR3mAb alone could reduce the CCR1mRNA and CCR3mRNA levels. Both CCR1mRNA and CCR3mRNA levels will decrease when both antibodies are used.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab5\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 5\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eExpression levels of CCR1mRNA and CCR3mRNA in the nasal mucosa\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGoups\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCR1mRNA\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCR3mRNA\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e1.05\u0026thinsp;\u0026plusmn;\u0026thinsp;0.217\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e1.07\u0026thinsp;\u0026plusmn;\u0026thinsp;0.16\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCARAS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e9.97\u0026thinsp;\u0026plusmn;\u0026thinsp;2.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e7.27\u0026thinsp;\u0026plusmn;\u0026thinsp;1.50\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCCR1mAb\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e3.54\u0026thinsp;\u0026plusmn;\u0026thinsp;1.14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e5.34\u0026thinsp;\u0026plusmn;\u0026thinsp;0.89\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCCR3mAb\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e6.05\u0026thinsp;\u0026plusmn;\u0026thinsp;1.12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e3.67\u0026thinsp;\u0026plusmn;\u0026thinsp;0.46\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCCR1\u0026thinsp;+\u0026thinsp;3mAb\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e3.29\u0026thinsp;\u0026plusmn;\u0026thinsp;0.93\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e2.02\u0026thinsp;\u0026plusmn;\u0026thinsp;0.64\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab6\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 5\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eExpression of CCR1mRNA, CCR3 mRNA in nasal mucosa\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGoups\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCR1mRNA\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCR3mRNA\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e1.06\u0026thinsp;\u0026plusmn;\u0026thinsp;0.43\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e1.02\u0026thinsp;\u0026plusmn;\u0026thinsp;0.22\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCARAS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e13.29\u0026thinsp;\u0026plusmn;\u0026thinsp;3.61\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e10.84\u0026thinsp;\u0026plusmn;\u0026thinsp;2.14\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCCR1mAb\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e2.06\u0026thinsp;\u0026plusmn;\u0026thinsp;0.73\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e5.08\u0026thinsp;\u0026plusmn;\u0026thinsp;0.98\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCCR3mAb\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e5.42\u0026thinsp;\u0026plusmn;\u0026thinsp;3.08\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e2.13\u0026thinsp;\u0026plusmn;\u0026thinsp;0.55\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCCR1\u0026thinsp;+\u0026thinsp;3mAb\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e3.55\u0026thinsp;\u0026plusmn;\u0026thinsp;0.82\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e2.79\u0026thinsp;\u0026plusmn;\u0026thinsp;0.94\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDXMS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e1.90\u0026thinsp;\u0026plusmn;\u0026thinsp;1.14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e2.63\u0026thinsp;\u0026plusmn;\u0026thinsp;0.47\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab7\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 6\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eMouse body weight change data (g)\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGroups\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNormal\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCARAS\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCCR1mAb\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eCCR3mAb\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eCCR1\u0026thinsp;+\u0026thinsp;3mAb\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDay0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e15.62\u0026thinsp;\u0026plusmn;\u0026thinsp;0.32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e15.80\u0026thinsp;\u0026plusmn;\u0026thinsp;0.12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e13.95\u0026thinsp;\u0026plusmn;\u0026thinsp;0.45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e16.32\u0026thinsp;\u0026plusmn;\u0026thinsp;0.60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c6\"\u003e \u003cp\u003e16.38\u0026thinsp;\u0026plusmn;\u0026thinsp;0.35\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDay7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e17.20\u0026thinsp;\u0026plusmn;\u0026thinsp;0.67\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e18.56\u0026thinsp;\u0026plusmn;\u0026thinsp;0.20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e15.88\u0026thinsp;\u0026plusmn;\u0026thinsp;0.31\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e17.18\u0026thinsp;\u0026plusmn;\u0026thinsp;0.24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c6\"\u003e \u003cp\u003e18.32\u0026thinsp;\u0026plusmn;\u0026thinsp;0.23\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDay14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e19.70\u0026thinsp;\u0026plusmn;\u0026thinsp;0.28\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e21.15\u0026thinsp;\u0026plusmn;\u0026thinsp;0.28\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e19.67\u0026thinsp;\u0026plusmn;\u0026thinsp;0.42\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e18.58\u0026thinsp;\u0026plusmn;\u0026thinsp;0.64\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c6\"\u003e \u003cp\u003e19.25\u0026thinsp;\u0026plusmn;\u0026thinsp;0.37\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDay21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e20.04\u0026thinsp;\u0026plusmn;\u0026thinsp;0.23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e19.95\u0026thinsp;\u0026plusmn;\u0026thinsp;0.69\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e16.85\u0026thinsp;\u0026plusmn;\u0026thinsp;1.19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e15.83\u0026thinsp;\u0026plusmn;\u0026thinsp;0.77\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c6\"\u003e \u003cp\u003e17.80\u0026thinsp;\u0026plusmn;\u0026thinsp;0.58\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDay28\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e22.34\u0026thinsp;\u0026plusmn;\u0026thinsp;1.59\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e18.56\u0026thinsp;\u0026plusmn;\u0026thinsp;1.48\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e15.42\u0026thinsp;\u0026plusmn;\u0026thinsp;1.47\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e13.68\u0026thinsp;\u0026plusmn;\u0026thinsp;2.72\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c6\"\u003e \u003cp\u003e14.78\u0026thinsp;\u0026plusmn;\u0026thinsp;2.74\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDay35\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e24.86\u0026thinsp;\u0026plusmn;\u0026thinsp;2.48\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e16.67\u0026thinsp;\u0026plusmn;\u0026thinsp;1.53\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e16.63\u0026thinsp;\u0026plusmn;\u0026thinsp;2.36\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e15.32\u0026thinsp;\u0026plusmn;\u0026thinsp;2.39\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c6\"\u003e \u003cp\u003e15.74\u0026thinsp;\u0026plusmn;\u0026thinsp;2.49\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003e3.8. Weight change data\u003c/h2\u003e \u003cp\u003eTo explore whether antibody treatment was meaningful in body weight gain, the weight of each cage of mice was recorded once a week 1 hour before administration until the next day before the death. Body weight was recorded on days 0,7,14,21,28, and 35. Their data were analyzed and processed, as detailed in Table\u0026nbsp;\u003cspan refid=\"Tab6\" class=\"InternalRef\"\u003e6\u003c/span\u003e. According to the analysis, the average body weight of each cage tended to increase in the first three weeks, while the mice were stimulated by nasal stimulation and atomization, interfering with their normal living environment, and their weight decreased. The CCR 1, CCR3 and CCR1\u0026thinsp;+\u0026thinsp;3 antibody treated and CARAS groups were decreased, and the data were not statistically different between the groups (Table\u0026nbsp;\u003cspan refid=\"Tab6\" class=\"InternalRef\"\u003e6\u003c/span\u003e,Fig.\u0026nbsp;6D).\u003c/p\u003e \u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eThe axiom \"One Airway, One Disease\" has gained increasing recognition over the past decade, emphasizing the bidirectional interplay of allergic mechanisms across the upper and lower respiratory tracts. Allergic rhinitis, a nasal mucosal inflammatory disorder characterized by itching, sneezing, rhinorrhea, and congestion, arises from interactions between inflammatory mediators and nasal neural, vascular, and glandular structures. In asthma, epithelial and smooth muscle cells orchestrate chemokine-mediated recruitment and activation of eosinophils, basophils, mast cells, and T lymphocytes\u003csup\u003e[\u003cspan additionalcitationids=\"CR17 CR18 CR19 CR20 CR21\" citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]\u003c/sup\u003e. Anatomical proximity and shared pathogenic pathways link allergic rhinitis to allergic asthma, with allergen-induced mechanisms driving approximately 80% of childhood asthma and 40\u0026ndash;50% of adult cases. Early diagnosis and therapeutic intervention are critical for improving prognosis, particularly in elderly populations [29]. Airway epithelial cells, serving as the primary barrier against inhaled pathogens and particulates, play a pivotal role in maintaining airway patency and host defense \u003csup\u003e[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003e \u003cb\u003eTherapeutic Efficacy of CCR1\u0026thinsp;+\u0026thinsp;3 Dual Targeting in CARAS\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThis study provides the first systematic evaluation of CCR1 and CCR3 monoclonal antibodies (CCR1mAb/CCR3mAb) as monotherapy and combination therapy in a CARAS murine model. Both monotherapy (CCR1mAb or CCR3mAb) and combination treatment (CCR1\u0026thinsp;+\u0026thinsp;3mAb) significantly alleviated nasal symptoms (50\u0026ndash;65% reduction in rubbing frequency, 40\u0026ndash;60% decrease in sneezing, P\u0026thinsp;\u0026lt;\u0026thinsp;0.01 vs. CARAS group), attenuated inflammatory infiltration in nasal mucosa and lung tissues (45\u0026ndash;55% reduction in eosinophil counts, P\u0026thinsp;\u0026lt;\u0026thinsp;0.001), and suppressed Th2 cytokines (IL-4, IL-5, IL-13) and IgE levels (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05). However, no statistically significant difference was observed between combination and monotherapy groups (P\u0026thinsp;\u0026gt;\u0026thinsp;0.05), suggesting that dual CCR1\u0026thinsp;+\u0026thinsp;3 blockade may fail to achieve synergistic efficacy due to cross-talk or compensatory signaling pathways.CARAS induced hyperactivity, agitation, and reduced feeding in mice, culminating in weight loss, emaciation, and heightened stress responses. Chronic drug administration disrupted circadian rhythms, leading to lethargy, hypophagia, and reduced mobility, indicative of a depressive-like state. Notably, monoclonal antibody treatments did not significantly alter these behavioral parameters across groups.\u003c/p\u003e \u003cp\u003e \u003cb\u003eMechanistic Insights and Therapeutic Implications\u003c/b\u003e \u003c/p\u003e \u003cp\u003eCCR3, a key receptor for eosinophil migration, serves as a critical target for blocking CCL11/CCR3 axis-driven inflammatory cell recruitment. Our prior studies confirmed that intraperitoneal CCR3mAb (10 mg/kg) alleviates allergic rhinitis by reducing nasal mucosal damage and TH2 cytokine levels[13]. However, the complexity of CARAS lies in the interplay between upper and lower airway inflammation, where CCR1 activation in mast cells may partially counteract CCR3 blockade via degranulation[20\u0026ndash;22]. Compensatory Role of CCR1: In asthma models, CCR1mAb treatment reduced TH2 cytokine levels compared to wild-type mice, indicating CCR1-mediated regulation of Th2 inflammation independent of CCR3. In this study, although dual CCR1\u0026thinsp;+\u0026thinsp;3 targeting was employed, incomplete downstream signal suppression may stem from suboptimal antibody dosing or competitive receptor binding (e.g., differential Fc affinity between CCR1mAb and CCR3mAb). The lack of synergy likely reflects crosstalk between CCR1\u0026thinsp;+\u0026thinsp;3 pathways or partial receptor blockade at the tested dose (10 mg/kg). Future studies should explore higher doses or sequential administration to overcome compensatory mechanisms.\u003c/p\u003e \u003cp\u003e \u003cb\u003eAdvantages Over Standard Therapies and Structural Benefits\u003c/b\u003e \u003c/p\u003e \u003cp\u003eCurrent CARAS treatments (e.g., glucocorticoids) provide transient symptomatic relief but carry risks of osteoporosis and immunosuppression with prolonged use. In contrast, monoclonal antibody therapy offers targeted action and reduced off-target effects. Compared to single-target approaches (e.g., anti-IgE omalizumab), this study pioneers the exploration of CCR1\u0026thinsp;+\u0026thinsp;3 co-blockade. Despite limited synergy, the combination group demonstrated superior efficacy in airway remodeling: Masson staining revealed a greater reduction in lung collagen deposition versus monotherapy (CCR1mAb, CCR3mAb), while HE staining showed 85% restoration of mucosal thickness in the combination group, significantly exceeding monotherapy outcomes (CCR1mAb: 72%, CCR3mAb: 75%, P\u0026thinsp;\u0026lt;\u0026thinsp;0.01). These findings parallel the structural repair mechanisms of anti-IL-4/IL-13 bispecific antibodies (e.g., Dupilumab) in asthma, underscoring the unique value of multi-target strategies in airway regeneration.\u003c/p\u003e \u003cp\u003e \u003cb\u003eLimitations and Future Directions\u003c/b\u003e \u003c/p\u003e \u003cp\u003eAlthough this study provides important evidence for the treatment of CARAS with CCR1\u0026thinsp;+\u0026thinsp;3 mAbs, there are still the following limitations: first, the experiment only uses a fixed dose (10 mg/kg), and dose-dependent effects are not explored, which may mask the optimal therapeutic window; Secondly, the lack of in vitro co culture models or conditional knockout animals to verify the interaction of CCR1\u0026thinsp;+\u0026thinsp;3 limits the depth of mechanism interpretation; In addition, differences in CCR1 expression profiles between mice and humans (such as the high expression of human CCR1 in airway epithelium) may affect the clinical translational potential of the results. Future research needs to make breakthroughs in three aspects: first, systematically evaluate the gradient dose (5\u0026ndash;20 mg/kg) and new drug delivery methods (such as nasal targeted nanoformulation) to optimize the efficacy; The second is to analyze the co regulatory network of CCR1\u0026thinsp;+\u0026thinsp;3 in specific cell subsets (such as eosinophil epithelial cell interaction) by combining single-cell sequencing and organoid models; The third is to verify the treatment strategy in the non-human primate Caras model, and screen serum biomarkers (such as CCL11/IL-13 ratio) for patient stratification, so as to promote the development of individualized treatment.\u003c/p\u003e"},{"header":"5. Conclusion","content":"\u003cp\u003eThis study demonstrates that CCR1 and CCRR3 monoclonal antibodies, whether administered alone or in combination, significantly alleviate murine combined allergic rhinitis-asthma syndrome (CARAS) by suppressing Th2 inflammation, reducing eosinophil infiltration, and attenuating airway remodeling. Although dual CCR1\u0026thinsp;+\u0026thinsp;3 blockade exhibited superior efficacy in mitigating collagen deposition and mucosal thickening compared to monotherapy, statistical synergy was not observed, likely due to compensatory signaling pathways or suboptimal dosing. These findings underscore the therapeutic potential of targeting CCR1\u0026thinsp;+\u0026thinsp;3 pathways, particularly for structural repair in allergic airway diseases. However, limitations such as fixed-dose regimens and the absence of in vitro mechanistic validation necessitate further exploration of dose optimization in animal models. This preclinical evidence supports the future development of multi-target antibody strategies to address the complexity of CARAS and related Th2-driven disorders.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003eFunding\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThis research was supported by a grant (82060186) from the National Natural Science Foundation of China and a grant (20224ACB206025；20232BAB216058) from Natural Science Foundation of Jiangxi Province. The Jiangxi Provincial Graduate Student Innovation Program(YC2024-B070).\u003c/p\u003e\n\u003cp\u003eAuthor contributions\u003c/p\u003e\n\u003cp\u003eY.W.B. conceived of and drafed the study.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eX.H.Z.and B.B.S. conducted the experiments.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eY.l.J. and Y.Z. collected and analysed data.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eZ.L. and W.S.H.anddirected and supervised the project.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAll of the authors have read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003eCompeting interests\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e\n\u003cp\u003eCorrespondence and requests for materials should be addressed to X.H.Z.\u003c/p\u003e\n\u003cp\u003eEthical approval\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe whole experimental protocol was approved by the institutional animal care and use Committee of Jiangxi Medical College and the ethics committee of Nanchang University. NCULAE-202210311028，And comply with the global strategy for ethical treatment and utilization of laboratory animals.\u003c/p\u003e\n\u003cp\u003eClinical trial number\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eWaage J et al (2018) Genome-wide association and HLA fine-mapping studies identify risk loci and genetic pathways underlying allergic rhinitis. Nat genet 50(8):1072\u0026ndash;1080\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePaiva Ferreira LKD et al (2019) Combined allergic rhinitis and asthma syndrome (CARAS). Int immunopharmacol 74(null):105718\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDai M et al (2022) \u003cem\u003eCCR3 gene knockout in bone marrow cells ameliorates combined allergic rhinitis and asthma syndrome (CARAS) by reducing airway inflammatory cell infiltration and Th2 cytokines expression in mice model.\u003c/em\u003e Int immunopharmacol, 104(null): p. 108509\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBraunstahl GJ et al (2003) Mucosal and systemic inflammatory changes in allergic rhinitis and asthma: a comparison between upper and lower airways. Clin exp allergy 33(5):579\u0026ndash;587\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTofukuji S et al (2018) Allergen-specific sublingual immunotherapy is dose and duration dependent in a murine allergic rhinitis model. J allergy clin immun, 142(6): p. 1977\u0026ndash;1979.e9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJin J et al (2023) \u003cem\u003eFallopia japonica Root Extract Ameliorates Ovalbumin-Induced Airway Inflammation in a CARAS Mouse Model by Modulating the IL-33/TSLP/NF-κB Signaling Pathway.\u003c/em\u003e Int J Mol Sci, 24(15): p. null\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCavalcanti RFP et al (2023) Limosilactobacillus fermentum modulates the gut-airway axis by improving the immune response through FOXP3 activation on combined allergic rhinitis and asthma syndrome (CARAS). Immunobiology 228(5):152721\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBousquet J et al (2020) Next-generation Allergic Rhinitis and Its Impact on Asthma (ARIA) guidelines for allergic rhinitis based on Grading of Recommendations Assessment, Development and Evaluation (GRADE) and real-world evidence. J allergy clin immun 145(1):70\u0026ndash;80e3\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBao Y, Zhu X (2022) Role of Chemokines and Inflammatory Cells in Respiratory Allergy. J Asthma Allergy 15(null):1805\u0026ndash;1822\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMazzi V, Fallahi P (2017) Allergic rhinitis and CXCR3 chemokines. Clin ter 168(1):e54\u0026ndash;e58\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eErrahali YJ et al (2013) Inhibition by new glucocorticoid antedrugs [16α, 17α-d] isoxazoline and [16α, 17α-d]-3'-hydroxy-iminoformyl isoxazoline derivatives of chemotaxis and CCL26, CCL11, IL-8, and RANTES secretion. J interf cytok res 33(9):493\u0026ndash;507\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBaumann R et al (2013) Comparison of the nasal release of IL-4, IL-10, IL-17, CCL13/MCP-4, and CCL26/eotaxin-3 in allergic rhinitis during season and after allergen challenge. Am j rhinol allergy 27(4):266\u0026ndash;272\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBao Y et al (2024) The study of the role of purified anti-mouse CD193 (CCR3) antibody in allergic rhinitis mouse animal models. Sci Rep 14(1):1059\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBarnes PJ (2022) Chemokine receptor CCR1: new target for asthma therapy. Trends pharmacol sci 43(7):539\u0026ndash;541\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChang HW et al (2020) A common signaling pathway leading to degranulation in mast cells and its regulation by CCR1-ligand. Allergy 75(6):1371\u0026ndash;1381\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCiechanowska A, Mika J (2024) CC Chemokine Family Members' Modulation as a Novel Approach for Treating Central Nervous System and Peripheral Nervous System Injury-A Review of Clinical and Experimental Findings. Int J Mol Sci, 25(7)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKline JM et al (2021) Structural and functional analysis of Ccr1l1, a Rodentia-restricted eosinophil-selective chemokine receptor homologue. J Biol Chem 296:100373\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKomi DEA et al (2020) The Role of Mast Cells in IgE-Independent Lung Diseases. Clin Rev Allergy Immunol 58(3):377\u0026ndash;387\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi N et al (2021) Regulated on Activation, Normal T cell Expressed and Secreted (RANTES) drives the resolution of allergic asthma. iScience 24(10):103163\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eManthiram K et al (2020) Common genetic susceptibility loci link PFAPA syndrome, Beh\u0026ccedil;et's disease, and recurrent aphthous stomatitis. Proc Natl Acad Sci U S A 117(25):14405\u0026ndash;14411\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePawlik K et al (2022) Pharmacological Evidence of the Important Roles of CCR1 and CCR3 and Their Endogenous Ligands CCL2/7/8 in Hypersensitivity Based on a Murine Model of Neuropathic Pain. Cells, 12(1)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhu LP et al (2023) Chemokine CCL7 mediates trigeminal neuropathic pain via CCR2/CCR3-ERK pathway in the trigeminal ganglion of mice. Mol Pain 19:17448069231169373\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDragan P et al (2023) Chemokine Receptors-Structure-Based Virtual Screening Assisted by Machine Learning. Pharmaceutics, 15(2)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGilliland CT et al (2013) The chemokine receptor CCR1 is constitutively active, which leads to G protein-independent, β-arrestin-mediated internalization. J biol chem 288(45):32194\u0026ndash;32210\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLionakis MS et al (2012) Chemokine receptor Ccr1 drives neutrophil-mediated kidney immunopathology and mortality in invasive candidiasis. Plos pathog 8(8):e1002865\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZlotnik A, Yoshie O, Nomiyama H (2006) The chemokine and chemokine receptor superfamilies and their molecular evolution. Genome Biol 7(12):243\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLegrand F et al (2019) Sialic acid-binding immunoglobulin-like lectin (Siglec) 8 in patients with eosinophilic disorders: Receptor expression and targeting using chimeric antibodies. J allergy clin immun 143(6):2227\u0026ndash;2237e10\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eO'Sullivan JA et al (2018) Leveraging Siglec-8 endocytic mechanisms to kill human eosinophils and malignant mast cells. J allergy clin immun 141(5):1774\u0026ndash;1785e7\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang K et al (2019) Prevalence, risk factors, and management of asthma in China: a national cross-sectional study. Lancet 394(10196):407\u0026ndash;418\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShrimanker R, Pavord ID (2017) Interleukin-5 Inhibitors for Severe Asthma: Rationale and Future Outlook. Biodrugs 31(2):93\u0026ndash;103\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSong J, Wang J (2022) SIRT3 regulates bronchial epithelium apoptosis and aggravates airway inflammation in asthma. Mol med rep 25(4):null\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"CARAS, Allergic rhinitis, Allergic asthma, Monoclonal antibody","lastPublishedDoi":"10.21203/rs.3.rs-6741444/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6741444/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eCombined Allergic Rhinitis and Asthma Syndrome (CARAS) is characterized by Th2-driven inflammation, eosinophil infiltration, and chemokine-mediated immune responses. While CCR3 monoclonal antibody (CCR3mAb) exhibits therapeutic potential in allergic rhinitis, the roles of CCR1 monoclonal antibody (CCR1mAb) and its combination with CCR3mAb in CARAS remain unclear.\u003c/p\u003e \u003cp\u003e \u003cb\u003eObjective\u003c/b\u003e: This study aimed to evaluate the efficacy of CCR1mAb, CCR3mAb, and their combination in alleviating CARAS symptoms and elucidate the underlying mechanisms.\u003c/p\u003e \u003cp\u003e \u003cb\u003eMethods\u003c/b\u003e: Ovalbumin-sensitized and challenged CARAS mice were divided into six groups: normal control (NC), CARAS model, CCR1mAb (10 mg/kg), CCR3mAb (10 mg/kg), CCR1\u0026thinsp;+\u0026thinsp;3mAb combination (10 mg/kg each), and dexamethasone (DXMS, 5 mg/kg). Assessments included behavioral observations (sneezing/rubbing frequency), histopathology (HE/Masson staining), ELISA (Th2 cytokines), qPCR (CCR1\u0026thinsp;+\u0026thinsp;3 mRNA), and immunohistochemistry.\u003c/p\u003e \u003cp\u003e \u003cb\u003eResults\u003c/b\u003e: Both monotherapy and combination therapy significantly alleviated nasal symptoms (sneezing: P\u0026thinsp;\u0026lt;\u0026thinsp;0.05; rubbing: P\u0026thinsp;\u0026lt;\u0026thinsp;0.01 vs. CARAS) and reduced eosinophil infiltration (CARAS: 39.33\u0026thinsp;\u0026plusmn;\u0026thinsp;2.52 vs. combination: 24.33\u0026thinsp;\u0026plusmn;\u0026thinsp;5.69, P\u0026thinsp;\u0026lt;\u0026thinsp;0.001). Histopathological improvements included reduced mucosal thickness (CARAS: 242.6\u0026thinsp;\u0026plusmn;\u0026thinsp;33.33 \u0026micro;m vs. combination: 161.9\u0026thinsp;\u0026plusmn;\u0026thinsp;16.91 \u0026micro;m, P\u0026thinsp;\u0026lt;\u0026thinsp;0.01) and collagen deposition. Mechanistically, CCR1\u0026thinsp;+\u0026thinsp;3mAb synergistically suppressed Th2 cytokines (IL-4: 277.8\u0026thinsp;\u0026plusmn;\u0026thinsp;20.27 pg/mL vs. CARAS: 464.8\u0026thinsp;\u0026plusmn;\u0026thinsp;57.99, P\u0026thinsp;\u0026lt;\u0026thinsp;0.001) and downregulated CCR1\u0026thinsp;+\u0026thinsp;3 mRNA expression (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01 vs. CARAS). However, no significant difference was observed between monotherapy and combination groups (P\u0026thinsp;\u0026gt;\u0026thinsp;0.05), suggesting limited synergistic effects.\u003c/p\u003e \u003cp\u003e \u003cb\u003eConclusion\u003c/b\u003e: CCR1mAb and CCR3mAb, alone or combined, ameliorated CARAS by targeting Th2 inflammation and airway remodeling. Although the combination did not exhibit marked synergy (potentially due to suboptimal dosing or compensatory pathways), it highlights the therapeutic potential of dual CCR1\u0026thinsp;+\u0026thinsp;3 targeting.\u003c/p\u003e","manuscriptTitle":"Dual CCR1+3 Monoclonal Antibody Therapy Alleviates Allergic Rhinitis-Asthma Syndrome in Mice via Suppressing Th2 Inflammation","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-06-03 20:53:25","doi":"10.21203/rs.3.rs-6741444/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"7381aae5-d22d-41c9-967e-ecfc71b30db7","owner":[],"postedDate":"June 3rd, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-06-26T15:38:12+00:00","versionOfRecord":[],"versionCreatedAt":"2025-06-03 20:53:25","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-6741444","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6741444","identity":"rs-6741444","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}