Genetic lineage tracing identifies intermediate mesoderm as a novel contributor to mammalian kidney lymphatics

Genetic lineage tracing identifies intermediate mesoderm as a novel contributor to mammalian kidney lymphatics | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results Genetic lineage tracing identifies intermediate mesoderm as a novel contributor to mammalian kidney lymphatics Daniyal J Jafree , Lauren G Russell , Athanasia Stathopoulou , Christopher J Rowan , Andrew T White , Charlotte O’Riordan , Maria Kolatsi-Joannou , Karen L Price , Sarah Ivins , Liam A Ridge , Catherine Roberts , Jennie C Chandler , Laura Wilson , Dale Moulding , Julie Siegenthaler , Adrian S Woolf , Paul R Riley , Christiana Ruhrberg , Peter J Scambler , Norman D Rosenblum , View ORCID Profile David A Long doi: https://doi.org/10.1101/2025.07.18.665353 Daniyal J Jafree 1 Developmental Biology & Cancer Research & Teaching Department, UCL Great Ormond Street Institute of Child Health, University College London , London, UK 2 UCL Centre for Kidney and Bladder Health, University College London , London, UK 3 Wellcome Trust Sanger Institute , Hinxton, UK Find this author on Google Scholar Find this author on PubMed Search for this author on this site Lauren G Russell 1 Developmental Biology & Cancer Research & Teaching Department, UCL Great Ormond Street Institute of Child Health, University College London , London, UK 2 UCL Centre for Kidney and Bladder Health, University College London , London, UK Find this author on Google Scholar Find this author on PubMed Search for this author on this site Athanasia Stathopoulou 1 Developmental Biology & Cancer Research & Teaching Department, UCL Great Ormond Street Institute of Child Health, University College London , London, UK 4 Institute of Developmental and Regenerative Medicine, University of Oxford , Oxford, UK Find this author on Google Scholar Find this author on PubMed Search for this author on this site Christopher J Rowan 5 Program in Developmental and Stem Cell Biology, The Hospital for Sick Children , Toronto, Ontario, Canada Find this author on Google Scholar Find this author on PubMed Search for this author on this site Andrew T White 1 Developmental Biology & Cancer Research & Teaching Department, UCL Great Ormond Street Institute of Child Health, University College London , London, UK 2 UCL Centre for Kidney and Bladder Health, University College London , London, UK Find this author on Google Scholar Find this author on PubMed Search for this author on this site Charlotte O’Riordan 1 Developmental Biology & Cancer Research & Teaching Department, UCL Great Ormond Street Institute of Child Health, University College London , London, UK 2 UCL Centre for Kidney and Bladder Health, University College London , London, UK Find this author on Google Scholar Find this author on PubMed Search for this author on this site Maria Kolatsi-Joannou 1 Developmental Biology & Cancer Research & Teaching Department, UCL Great Ormond Street Institute of Child Health, University College London , London, UK 2 UCL Centre for Kidney and Bladder Health, University College London , London, UK Find this author on Google Scholar Find this author on PubMed Search for this author on this site Karen L Price 1 Developmental Biology & Cancer Research & Teaching Department, UCL Great Ormond Street Institute of Child Health, University College London , London, UK 2 UCL Centre for Kidney and Bladder Health, University College London , London, UK Find this author on Google Scholar Find this author on PubMed Search for this author on this site Sarah Ivins 1 Developmental Biology & Cancer Research & Teaching Department, UCL Great Ormond Street Institute of Child Health, University College London , London, UK Find this author on Google Scholar Find this author on PubMed Search for this author on this site Liam A Ridge 1 Developmental Biology & Cancer Research & Teaching Department, UCL Great Ormond Street Institute of Child Health, University College London , London, UK 6 Department of Life Sciences, Manchester Metropolitan University , Manchester, UK Find this author on Google Scholar Find this author on PubMed Search for this author on this site Catherine Roberts 1 Developmental Biology & Cancer Research & Teaching Department, UCL Great Ormond Street Institute of Child Health, University College London , London, UK 7 Institute of Medical and Biomedical Education, St George’s University of London , London UK Find this author on Google Scholar Find this author on PubMed Search for this author on this site Jennie C Chandler 1 Developmental Biology & Cancer Research & Teaching Department, UCL Great Ormond Street Institute of Child Health, University College London , London, UK 2 UCL Centre for Kidney and Bladder Health, University College London , London, UK Find this author on Google Scholar Find this author on PubMed Search for this author on this site Laura Wilson 1 Developmental Biology & Cancer Research & Teaching Department, UCL Great Ormond Street Institute of Child Health, University College London , London, UK 2 UCL Centre for Kidney and Bladder Health, University College London , London, UK Find this author on Google Scholar Find this author on PubMed Search for this author on this site Dale Moulding 1 Developmental Biology & Cancer Research & Teaching Department, UCL Great Ormond Street Institute of Child Health, University College London , London, UK 2 UCL Centre for Kidney and Bladder Health, University College London , London, UK Find this author on Google Scholar Find this author on PubMed Search for this author on this site Julie Siegenthaler 8 University of Colorado Anschutz Medical Campus, Department of Pediatrics, Section of Developmental Biology , Aurora, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Adrian S Woolf 9 School of Biological Sciences, Faculty of Biology Medicine and Health, University of Manchester , Manchester, UK Find this author on Google Scholar Find this author on PubMed Search for this author on this site Paul R Riley 4 Institute of Developmental and Regenerative Medicine, University of Oxford , Oxford, UK Find this author on Google Scholar Find this author on PubMed Search for this author on this site Christiana Ruhrberg 10 UCL Institute of Ophthalmology, University College London , London, UK Find this author on Google Scholar Find this author on PubMed Search for this author on this site Peter J Scambler 1 Developmental Biology & Cancer Research & Teaching Department, UCL Great Ormond Street Institute of Child Health, University College London , London, UK Find this author on Google Scholar Find this author on PubMed Search for this author on this site Norman D Rosenblum 5 Program in Developmental and Stem Cell Biology, The Hospital for Sick Children , Toronto, Ontario, Canada Find this author on Google Scholar Find this author on PubMed Search for this author on this site David A Long 1 Developmental Biology & Cancer Research & Teaching Department, UCL Great Ormond Street Institute of Child Health, University College London , London, UK 2 UCL Centre for Kidney and Bladder Health, University College London , London, UK Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for David A Long For correspondence: d.long{at}ucl.ac.uk Abstract Full Text Info/History Metrics Preview PDF ABSTRACT The lymphatic vasculature is essential for fluid homeostasis, immune regulation and possesses diverse organ-specific functions. During development, lymphatic endothelial cells (LEC) arise from multiple progenitor sources that form organ-specific lymphatic networks. While the origins of LECs in the heart, skin, and mesentery have been studied, those in the kidney remain unresolved. Here, we combined genetic lineage tracing in mouse embryos with optical clearing and high-resolution three-dimensional imaging to identify two distinct progenitor sources of kidney lymphatics. The majority of kidney LECs originate from a Tie2⁺ endothelial lineage previously linked to venous or capillary vessels. Approximately 15% derive from Osr1⁺ intermediate mesoderm, a lineage that generates kidney nephrons and stroma. Osr1⁺- derived LECs were absent from the heart, mesentery, and skin, indicating a kidney-specific contribution, and arose independently of nephron and stromal lineages. Both Tie2⁺ and Osr1⁺ lineages contributed to vessel sprouting and de novo formation of lymphatic clusters. Revealing a novel cellular origin of LECs and identifying a dual origin for kidney lymphatics, we demonstrate that de novo lymphatic formation can occur from both shared and organ-specific progenitors. This work advances our understanding of how lymphatics assemble during development and provides a framework for targeting kidney lymphatics in disease. INTRODUCTION Lymphatic vessels are present in nearly all mammalian organs, where they maintain tissue fluid balance, transport macromolecules and regulate immune responses. During disease, lymphatics expand to facilitate the resolution of inflammation and tissue repair. Beyond these conserved roles, lymphatics exert organ-specific functions 1 – 3 , such as cerebrospinal fluid drainage from the central nervous system and nasopharynx 4 – 6 , maintenance of stem cells niches in the heart, skin and intestines 7 – 10 and thermoregulation in adipose tissue 11 , 12 . However, it remains unclear how functional heterogeneity is established during development. One emerging hypothesis is that the developmental origin of lymphatic endothelial cells (LEC), which line lymphatic vessels, underpins their organ-specific characteristics 13 , 14 . The differentiation of LECs from venous endothelium, followed by their proliferation and sprouting into lymphatic vessels, termed lymphangiogenesis, was long thought to be the primary mechanism of lymphatic development 15 – 20 . However, additional progenitor sources that give rise to LECs de novo have been identified 21 , 22 . A second model, termed lymphvasculogenesis, has been proposed, based on the presence of lymphatic clusters anatomically distinct from sprouting lymphatics within the developing meninges 23 , heart 24 , 25 , skin 26 , 27 , mesentery 28 and kidney 29 . Demonstrated by live imaging studies in zebrafish embryos 30 – 32 , lymphangiogenesis and lymphvasculogenesis cooperate to generate organ-specific lymphatic networks. Genetic lineage tracing studies in mice have begun to unravel the diversity of progenitors giving rise to LECs, with origins traced to the second heart field 25 , 33 , hemogenic endothelium 28 , 34 and tissue-resident blood capillaries 27 . Moreover, it was shown that paraxial mesoderm gives rise to lymphatic vessels and isolated clusters in several different organs 35 , 36 . Despite these advances, lineage tracing studies have not yet established the developmental origins of kidney lymphatics. This gap is notable, given the kidney’s central role in physiological homeostasis, the expansion of lymphatics in kidney diseases, and the therapeutic interest in targeting lymphatics in conditions such as chronic kidney disease 37 – 40 , polycystic kidney disease 29 , 41 , 42 and transplant rejection 43 – 45 . We previously showed that kidney lymphatic development involves both lymphangiogenesis and lymphvasculogenesis 29 , but the identity of the contributing progenitors remained undefined. Within the mouse metanephros, the direct precursor to the adult kidney, intermediate mesoderm gives rise to epithelial, stromal and blood vasculature 46 , and is therefore a plausible source of kidney lymphatics. However, whether LECs within the kidney arise from this lineage, or instead share progenitors with lymphatics in other organs, has not been established. To address this, we combined genetic lineage tracing, optical clearing, and three-dimensional (3D) imaging 45 , 47 in mouse embryos to quantitatively map the origins of kidney LECs. We show that the majority of kidney lymphatics arise from Tie2⁺ progenitors, an origin shared by lymphatics in other organs 20 , 36 . Conversely, 15% of LECs arise from Osr1⁺ intermediate mesoderm, distinct from the lineage composition of lymphatics in other organs. These findings reveal that kidney lymphatics originate from complementary, developmentally distinct sources, refining our understanding of organ-specific lymphatic development and the broader lineage architecture of the kidney. RESULTS The majority of kidney lymphatics originate from endothelial progenitors independent of hemogenic or capillary sources To identify the cellular origins that generate kidney lymphatics, we performed genetic lineage tracing using a panel of endothelial-targeted Cre drivers, combined with wholemount immunolabelling for tdTomato and molecular markers of lymphatics. Solvent-based optical clearing and 3D confocal microscopy 48 were used to visualise lineage contributions at embryonic day (E)15.5, when kidney lymphatic expansion during development is most rapid 29 . We first employed a constitutive Tie2-Cre line 49 , which marks venous and capillary endothelium and their progeny. Prior lineage tracing studies demonstrate that Tie2-Cre labels LECs in multiple organs 20 , 33 , 34 , 36 , capturing both venous contributions 20 and an angioblast population that gives rise to systemic LECs 36 . However, Tie2 + lineage labelling of kidney lymphatics has not been explored. In E15.5 Tie2-Cre ; Rosa26 tdTomato/+ embryos, tdTomato labelled blood vasculature in the metanephric kidney, the direct precursor to the adult organ ( Figure S1a,b ). By co-labelling E15.5 Tie2-Cre ; Rosa26 tdTomato/+ kidneys with PROX1, PDPN and tdTomato and applying 3D imaging, we manually quantified Tie2 + progenitor contributions from confocal image stacks of embryonic kidney ( Figure 1a,b ). From 761 LECs examined within five kidneys across two embryonic litters, 643 (86.7 ± 1.8%) kidney LECs were tdTomato⁺, whereas 118 (13.3 ± 1.8%) LECs remained unlabelled. Download figure Open in new tab Figure S1. Validation of Tie2 + progenitor lineage labelling in the kidney and yolk sac ( a ) Representative images from two Tie2-Cre;Rosa26 tdTomato/+ kidneys (left, n = 4 fields) and one Cre-negative littermate control (right), immunolabelled for tdTomato. Widespread tdTomato expression is observed in kidney vasculature, with no signal in controls. Scale bar: 100 μm. ( b ) High-resolution z-sections of E15.5 Tie2-Cre;Rosa26 tdTomato/+ kidneys ( n = 2), immunolabelled for PECAM1 and tdTomato. tdTomato⁺ signal is seen throughout PECAM1⁺ vasculature in the cortex (arrowheads). Scale bar: 30 μm. ( c ) Left: z-projection of E11.5 yolk sacs from Tie2-Cre;Rosa26 tdTomato/+ embryos ( n = 3), labelled for EMCN, LYVE1 and tdTomato. Scale: 200 μm. Right: High-magnification view of boxed region, showing tdTomato⁺ LYVE1⁺ EMCN⁺ cells (arrowheads) in yolk sac vasculature, indicating labelling of hemogenic endothelium by Tie2-Cre . Scale bar: 30 μm. Download figure Open in new tab Figure 1. Endothelial progenitor contributions to developing kidney lymphatics ( a ) Left: Low magnification 3D reconstruction of E15.5 Tie2-Cre;Rosa26 tdTomato/+ kidneys ( n = 3, two litters), immunolabelled for PROX1, PECAM1 and tdTomato. tdTomato⁺ labelling is observed in the glomerulus, peritubular capillaries (PTC) and lymphatic vessels (LV). Scale bar: 30 μm. Right: Magnified view of dashed box showing tdTomato⁺ LECs (arrowhead) and unlabelled LECs (asterisk). Scale bar: 10 μm. ( b ) Confocal z-section from E15.5 Tie2-Cre;Rosa26 tdTomato/+ kidneys ( n = 2), labelled for PROX1, PDPN and tdTomato. Some LECs are tdTomato⁺ (arrowhead), but others are unlabelled (asterisk). Scale bar: 20 μm. ( c ) z-projection of E15.5 Kit CreERT2/+ ; Rosa26 tdTomato/+ kidneys ( n = 5, two litters), labelled for PROX1, EMCN and tdTomato following E10.5 tamoxifen. No tdTomato⁺ LECs detected in the cortex. Scale: 50 μm. ( d ) z-projection of E15.5 Apln CreERT2/+ ; Rosa26 tdTomato/+ kidneys ( n = 4), labelled for PROX1, PDPN and tdTomato after E11.5 4-OHT. Robust labelling of blood vessels (BV) observed, but PROX1⁺ LECs remain unlabelled. Scale bar: 50 μm. Tie2-Cre labels multiple vascular beds with potential for lymphatic differentiation. For example, the yolk sac contains hemogenic endothelium with competency for LEC differentiation 34 . Using LYVE1 to demarcate hemogenic endothelial cells 50 , we found LYVE1 + EMCN + endothelia were labelled in E11.5 Tie2-Cre ; Rosa26 tdTomato/+ yolk sac ( Figure S1c ). We therefore used a tamoxifen inducible CreERT2 driver targeting specific endothelial lineages previously shown to contribute to lymphatics. To capture hemogenic endothelium-derived LECs, we used Kit CreERT2/+ which, when activated at E10.5, labels LECs within the mouse mesentery 28 , 51 . Using this approach, rare tdTomato⁺ EMCN⁺ blood endothelial cells were observed in the E15.5 kidney ( Figure S2a,b ) 52 . However, LECs were not tdTomato + ( Figure 1c , n = 3 kidneys from across 2 litters). Tissue-resident blood capillary endothelium has been shown to contribute to lymphatics in the dermis 27 , and we used Apln CreERT2 to label this potential source 24 , 53 . 4-hydroxytamoxifen (4-OHT) was administered to Apln CreERT2/+ ; Rosa26 tdTomato/+ mice at E11.5, a timepoint that labels the kidney vasculature upon its entry into the metanephric mesenchyme 54 but precedes the arrival of the lymphatic plexus 29 . Although this approach led to robust labelling of the EMCN⁺ vasculature ( Figure S3a,b ), kidney LECs did not express tdTomato ( Figure 1d , n = 4 kidneys from across 2 litters). Download figure Open in new tab Figure S2. Kit + progenitor lineage tracing within in the kidney ( a ) Representative images of E15.5 Kit CreERT2/+ ; Rosa26 tdTomato/+ kidneys ( n = 2) and a Cre-negative control, immunolabelled for tdTomato. Tamoxifen was administered at E10.5. tdTomato⁺ cells are broadly visible in a vascular pattern; no signal is observed in controls. Scale bar: 100 μm. ( b ) High-resolution confocal z-section from Kit CreERT2/+ ; Rosa26 tdTomato/+ kidneys ( n = 4) immunolabelled for EMCN, PROX1 and tdTomato. tdTomato⁺ cells are occasionally observed within EMCN⁺ blood vessels (arrowheads), but not within PROX1⁺ lymphatics. Scale bar: 50 μm. Download figure Open in new tab Figure S3. Apln + progenitor lineage tracing within in the kidney ( a ) tdTomato immunolabelling in E15.5 Apln CreERT2/+ ; Rosa26 tdTomato/+ kidneys ( n = 2), following 4-OHT injection at E11.5. Strong vascular tdTomato expression is seen, absent in Cre-negative controls. Scale bar: 100 μm. ( b ) High-resolution z-projection from Apln CreERT2/+ ; Rosa26 tdTomato/+ kidneys ( n = 3), labelled for EMCN and tdTomato. tdTomato⁺ signal colocalises with EMCN⁺ endothelial cells (arrowheads) in cortical vasculature. Scale bar: 30 μm. Together, these findings demonstrate that the majority of kidney lymphatics arise from a Tie2 + endothelial progenitor lineage that is independent of hemogenic endothelium or kidney blood capillaries. Osr1 + progenitors account for the remaining proportion of kidney lymphatics and are distinct from other putative lymphatic origins The mouse metanephric kidney forms around E10.5 and is composed of posterior intermediate mesoderm-derived metanephric mesenchyme and anterior intermediate mesoderm-derived ureteric bud. The posterior intermediate mesoderm gives rise to specialised kidney epithelia, stroma, perivascular cells and blood endothelium 46 , but its putative contribution to LECs has not been explored. We first ascertained if LEC progenitors exist within intermediate mesoderm. To do this, we interrogated a published single-nucleus RNA-sequencing atlas of mouse embryogenic development 55 , analysing a 95,226 cell subset of the atlas containing intermediate mesoderm and its derivatives from E8.0 until birth ( Figure S4a,b ). The transcription factor Osr1 , an established marker of intermediate mesoderm essential for kidney development 56 – 58 , was enriched within cells annotated as posterior intermediate mesoderm or metanephric mesenchyme ( Figure S4c ). Within this population, we identified cells co-expressing Prox1 and Vegfr3 ( Figure S4d,e ), two early regulators of LEC identity that are expressed by the first lymphatic-fated cells emerging from the cardinal vein in mouse embryos 19 , 59 . Download figure Open in new tab Figure S4. Analysis of single-nucleus RNA-sequencing data from mouse embryos supports lymphatic progenitors within Osr1 + intermediate mesoderm ( a-b ) A previously published single-nucleus RNA-sequencing (snRNA-seq) atlas of mouse embryonic development, spanning embryos from E8.0 until the postnatal stage, was interrogated using the online browser: https://omg.gs.washington.edu . 3D uniform manifold approximation and projection (UMAP) of the ‘kidney development’ module within the atlas, coloured by cell type ( a ) and by timepoint ( b ). ( c-e ) Feature plots showing expression of selected transcripts within the dataset. Osr1 is expressed within posterior intermediate mesoderm and metanephric mesenchyme ( c ), with Prox1 ( d ) and Vegfr3 ( e ) expressed in cells within these domains. We then tested whether kidney LECs originate from the intermediate mesoderm by performing genetic lineage tracing, utilising mice harbouring a tamoxifen-dependent CreERT2 allele that is knocked-in to the endogenous Osr1 locus 46 . Importantly, OSR1 is not expressed by LECs during embryonic development 60 , avoiding unexpected labelling of LECs. Tamoxifen administration of Osr1 eGFP-CreERT2/+ ; Rosa26 tdTomato/+ at E9.5 ( Figure S5a ) resulted in widespread tdTomato expression in the metanephric kidney, including PDPN⁺ glomerular podocytes ( Figure S5b ) and PBX1⁺ stromal cells ( Figure S5c ), confirming broad labelling of Osr1⁺ posterior intermediate mesoderm 46 . No recombination occurred in Cre-negative controls, although scarce tdTomato⁺ cells were observed following vehicle-only injection ( Figure S5a ), demonstrating the importance of including both controls in lineage labelling studies. Following induction at E8.5 or E9.5 to label posterior intermediate mesoderm-derived cells, we consistently detected tdTomato⁺ traced cells co-expressing the LEC markers PROX1 and PDPN in the kidney lymphatic plexus at E15.5 ( Figure 2a,b ; staining present in 5/5 kidneys examined from three independent litters). No co-labelled cells were detected after tamoxifen injection at E10.5 ( Figure 2b , findings from 3/3 kidneys from two litters for both E9.5 and E10.5). Quantification demonstrated a temporal restriction of tdTomato⁺ labelled-LECs by Osr1⁺ progenitors. Following E8.5 tamoxifen induction, 162 out of 1,007 (15.6 ± 2.6%) were tdTomato⁺, dropping to 77 out of 1,432 (5.4 ± 0.7%) of tdTomato⁺ after E9.5 induction (mean difference = 10.1%, 95% CI = 6.2-14.1, p = 0.0002; Figure 2c ). The contribution after tamoxifen induction at E8.5 closely matched the proportion of LECs unlabelled by Tie2 ⁺ endothelial progenitors ( Figure 2d ). No tdTomato⁺ labelled-LECs were detected in the kidney after tamoxifen induction at E7.5, capturing anterior intermediate mesoderm-derived cells (data not shown). Download figure Open in new tab Figure S5. Validation of Osr1 + progenitor lineage labelling in the kidney ( a ) Left: representative images of E15.5 Osr1 eGFP-CreERT2/+ ; Rosa26 tdTomato/+ kidneys ( n = 4) immunolabelled for tdTomato after tamoxifen induction at E9.5, showing widespread labelling alongside control kidneys ( Osr1 +/+ ; Rosa26 tdTomato/+ ) lack tdTomato expression. Right: E15.5 kidneys from Osr1 eGFP-CreERT2/+ ; Rosa26 tdTomato/+ embryos ( n = 2) injected with oil vehicle at E9.5 exhibit minimal tdTomato expression. Rare tdTomato⁺ cells (arrowheads) indicate low background leakiness of the CreERT2 allele. Magnified view of boxed region is shown. Scale bars: 100 μm. ( b ) High-resolution z-section showing tdTomato⁺ labelling in PROX1⁺ PDPN⁺ epithelia of Osr1 eGFP-CreERT2/+ ; Rosa26 tdTomato/+ kidneys at E15.5 ( n = 2), following E9.5 tamoxifen. Signal is seen in glomerular (G) podocytes and the nephrogenic zone (Nz), alongside tdTomato⁺ LECs in lymphatic vessels (LV). Images representative of three fields per kidney. Scale bar: 50 μm. ( c ) High-resolution z-section of E15.5 Osr1 eGFP-CreERT2/+ ; Rosa26 tdTomato/+ kidneys ( n = 2), immunolabelled for PBX1 and tdTomato after E9.5 tamoxifen, showing tdTomato⁺ PBX1⁺ nuclei (arrowheads) in renal stroma. Scale bar: 50 μm. ( d ) Left: Yolk sac from E11.5 Osr1 eGFP-CreERT2/+ ; Rosa26 tdTomato/+ embryos labelled for EMCN, LYVE1 and tdTomato following E8.5 induction. Scale: 200 μm. Right: Higher magnification of boxed region shows LYVE1⁺ EMCN⁺ vessels (asterisks) lacking tdTomato labelling. Scale bar: 30 μm. Download figure Open in new tab Figure 2. Osr1 + progenitors contribute to the developing kidney lymphatic plexus ( a ) Left: Low magnification 3D reconstruction of E15.5 Osr1 eGFP-CreERT2/+ ; Rosa26 tdTomato/+ kidneys (n = 5, two litters), immunolabelled for PROX1, PDPN and tdTomato after tamoxifen induction at E8.5. Lymphatic vessels (LV) are visible in the hilum and cortex (C). Scale bar: 50 μm. Right: High-resolution reconstruction of boxed region showing tdTomato⁺ and tdTomato⁻ LECs within the PDPN + network (arrowhead and asterisk, respectively). Scale bar: 20 μm. ( b ) Representative z-sections of kidneys following tamoxifen at E8.5, E9.5, or E10.5. Arrowheads indicate tdTomato⁺ LECs. No labelling was seen after E10.5. n ≥ 3 kidneys per timepoint from ≥2 litters. Scale bars: 30 μm. ( c ) Quantification of tdTomato⁺ LECs shows a significant decline in lineage contribution over time (ANOVA F = 68.7, p < 0.0001). E8.5 vs E9.5: mean difference = 10.1%, p = 0.0002. Each point represents one kidney from a separate embryo. * p < 0.0332, ** p < 0.0021, *** p < 0.0002, **** p < 0.0001. ( d ) Comparison of proportions of lineage labelled and unlabelled kidney LECs within Osr1 eGFP- CreERT2/+ ; Rosa26 tdTomato/+ kidneys (labelled: 15.6 ± 2.6% LECs, unlabelled: 84.4 ± 2.6% LECs) compared with Tie2-Cre;Rosa26 tdTomato/+ kidneys (labelled: 86.7 ± 1.8% LECs, unlabelled: 13.3 ± 1.8% LECs). Each data point represents an individual kidney from a separate embryo. ( e ) Wholemount HCR showing Osr1 and Pax3 expression at E8.5 (top) and E9.5 (bottom). Osr1 ⁺ intermediate mesoderm (arrowheads) and Pax3 ⁺ somites (asterisks) are spatially distinct. Scale bars: 200 μm. We next determined whether Osr1⁺ progenitor-derived kidney LEC originate from non-intermediate mesoderm sources that are known to contribute to lymphatics in other organs. First, we asked whether Osr1 is expressed in paraxial mesoderm, a major source of systemic LECs 35 , 36 . Wholemount in situ hybridisation chain reaction (HCR) of wildtype embryos for Pax3 , a marker of paraxial mesoderm, and Osr1 at E8.5 and E9.5 ( n = 5 embryos per timepoint obtained from two litters) revealed spatially distinct expression domains. Between E8.5 and 9.5, Pax3 expression was detected, as expected, in paraxial mesoderm-derived somites ( Figure 2e ), adjacent to but not overlapping with Osr1 + cells, especially in the posterior part of the embryo where the Osr1 + intermediate mesoderm is located. Given the hemogenic endothelial origin of LECs in the heart 34 and mesentery 28 , we also examined yolk sacs from Osr1 eGFP-CreERT2/+ ; Rosa26 tdTomato/+ embryos after tamoxifen induction E8.5. The E11.5 yolk sac LYVE1 + haemogenic endothelium, did not contain tdTomato⁺ cells ( Figure S5d ). These results demonstrate that Osr1⁺ progenitor cells contribute to kidney LECs within a defined developmental window. This lineage reflects a putative intermediate mesoderm origin and accounts for the proportion of LECs unlabelled by the Tie2 + endothelial lineage. The Osr1 + lineage does not contribute to lymphatic endothelial cells in the mesentery, heart or dermis To assess whether Osr1⁺ progenitors contribute to organ LECs beyond the kidney, we examined organs within which novel LEC progenitors have been identified, namely the heart 24 , 25 , 33 , 34 , dermis 26 , 27 , 61 and mesentery 28 . We profiled organs from the same four E15.5 Osr1 eGFP-CreERT2/+ ; Rosa26 tdTomato/+ embryos in which we had observed tdTomato⁺ LECs in the kidney. Wholemount immunolabelling and optical clearing confirmed the presence of PROX1⁺ PDPN⁺ lymphatic networks in each organ. In the heart, PROX1⁺ lymphatics were evident proximal to the atria and extending into the ventricles ( Figure 3a ) 51 , but no tdTomato⁺ LECs were detected in any of the four hearts examined. In the dorsal skin, tdTomato⁺ perivascular cells were found adjacent to dermal lymphatics, as expected 46 , but PROX1⁺ PDPN⁺ LECs lacked tdTomato expression ( Figure 3b ). In the mesentery and adjacent intestinal tracts, PROX1⁺ lymphatic vessels extended into the parenchyma, but no Osr1 + lineage labelled LECs were detected, although rare tdTomato⁺ cells lacking lymphatic markers were seen near vessels ( Figure 3c ). Download figure Open in new tab Figure 3. The Osr1 + lineage does not contribute to lymphatics in the heart, skin or mesentery ( a ) Left: low magnification z-projection of E15.5 Osr1 eGFP-CreERT2/+ ; Rosa26 tdTomato/+ heart, pooled from two litters and immunolabelled for PROX1, PDPN and tdTomato. Lymphatic vessels (LV) extend from the atria to ventricles, with PROX1⁺ valve cells visible. Scale bar: 200 μm. Right: high magnification of boxed region from (a), showing absence of tdTomato labelling in a cardiac lymphatic vessel (asterisk). Scale bar: 30 μm. ( b ) Left: Low magnification z-projection of dorsal skin from E15.5 embryos, showing dermal lymphatics (LV) labelled for PROX1, PDPN and tdTomato. Scale bar: 200 μm. Right: high magnification of boxed region from (c), confirming no tdTomato⁺ LECs (asterisk). Scale bar: 30 μm. ( c ) Left: low magnification z-projection of E15.5 mesentery and adjacent intestine (Int), showing lymphatic vessels extending from mesentery (M). Scale bar: 200 μm. Right: high magnification of boxed region from (e), showing absence of tdTomato expression in PROX1⁺ PDPN⁺ lymphatic vessels (asterisk). Scale bar: 30 μm. Tamoxifen was administered at E9.5. For each tissue, a minimum of two samples from independent litters were analysed, with all imaging representative of at least three fields of view per sample. These results demonstrate that the Osr1⁺ lineage does not contribute to LECs in the heart, skin, or mesentery, in contrast with its specific contribution to the kidney. This organ-restricted pattern supports the idea that Osr1⁺ lineage LECs arise from intermediate mesoderm rather than a shared or systemic progenitor source. Osr1 + lineage lymphatics arise independently of stromal or nephron lineages within the kidney During kidney development, the Osr1 + posterior intermediate mesoderm segregates into epithelial and stromal compartments. Of these two lineages, stromal progenitors expressing FOXD1 62 – 64 generate vascular smooth muscle, pericytes and interstitial stromal cells, with a subset of progenitors expressing TBX18 65 , 66 forming differentiated stromal cell types within the kidney hilum. We therefore examined whether, downstream of posterior intermediate mesoderm, kidney lymphatics derive from the Foxd1⁺ lineage of stromal progenitors. Using a constitutive Foxd1 eGFP-Cre/+ line, we found tdTomato⁺ labelling of PBX1⁺ stromal cells in Foxd1 eGFP-Cre/+ ; Rosa26 tdTomato/+ kidneys at E15.5 ( Figure S6a,b ). We also found that a subset of kidney LECs ( Figure 4a ) were tdTomato + at this timepoint. Download figure Open in new tab Figure S6. Validation of Foxd1 + progenitor lineage labelling in the kidney ( a ) Representative images of E15.5 Foxd1 eGFP-Cre/+ ; Rosa26 tdTomato/+ kidneys ( n = 2), immunolabelled for tdTomato (left) and compared with Cre-negative littermates (right). tdTomato expression is seen in a stromal pattern. Scale bar: 100 μm. ( b ) High-resolution confocal z-projection of Foxd1 eGFP-Cre/+ ; Rosa26 tdTomato/+ kidneys immunolabelled for PBX1 and tdTomato. In the cortex, tdTomato⁺ signal colocalises with PBX1⁺ stromal nuclei (arrowheads). Scale bar: 50 μm. Download figure Open in new tab Figure 4. Examining nephron and stromal lineage contributions to kidney lymphatics ( a ) Left: low magnification z-section of E15.5 Foxd1 eGFP-Cre/+ ; Rosa26 tdTomato/+ kidneys (n = 5; two litters) immunolabelled for PROX1, PDPN and tdTomato. Lymphatics (LV) were seen en route to the cortex. Scale bar: 100 μm. Right: high-resolution image of boxed region reveals tdTomato⁺ PROX1⁺ PDPN⁺ LECs (arrowheads), interspersed with unlabelled cells (asterisks), indicating Foxd1 + lineage contribution. Scale bar: 30 μm. ( b ) Left: representative low-resolution z-projection of E15.5 Foxd1 eGFP-CreERT2/+ ; Rosa26 tdTomato/+ kidneys ( n = 4), immunolabelled for PROX1, PDPN and tdTomato. Lymphatic vessels (LV) are shown in the hilum adjacent to the pelvis. Scale bar: 100 μm. Right: magnified dashed box region from left panel, showing no overlap between tdTomato, PROX1 and PDPN in lymphatic vessels (asterisk). Scale bar: 30 μm. ( c-e ) High magnification z-projections of E15.5 Foxd1 eGFP-Cre/+ ; Rosa26 tdTomato/+ tissues: heart ( c ), skin ( d ) and mesentery ( e ), pooled from two litters ( n = 2 organs per group), immunolabelled for PROX1, PDPN and tdTomato. tdTomato⁺ LECs (arrowheads) were observed in each organ, coexisting with non-lineage-labelled LECs (asterisks), reflecting Foxd1 ⁺ lineage contribution beyond the kidney. Scale bar: 30 μm. ( f ) Left: low magnification z-section of E15.5 Six2-eGFP-Cre;Rosa26 tdTomato/+ kidneys ( n = 4; two litters), immunolabelled for PROX1, PDPN and tdTomato. Lymphatic vessels (LV) were visible extending into the cortex. Scale bar: 100 μm. Right: high-resolution image of boxed region, showing no tdTomato expression in PROX1⁺ PDPN⁺ LECs (asterisk), indicating absence of contribution from the Six2 ⁺ nephron progenitor lineage. Scale bar: 30 μm. To ascertain whether these Foxd1⁺ lineage lymphatics represented a kidney stromal progenitor contribution, we sought to replicate our findings using inducible Foxd1 eGFP-CreERT2 mice. This CreERT2, when labelled with tamoxifen at E10.5, captures both cortical and medullary kidney stromal progenitors 63 . In contrast to our observations with the constitutive Cre line, PROX1⁺ PDPN⁺ LECs were not labelled with the inducible approach ( Figure 4b , three kidneys from two litters). We then utilised the inducible Tbx18 CreERT2/+ line 67 that, upon tamoxifen induction, marks FOXD1⁺ stromal progenitors in the kidney hilum 65 , 66 , an early site of lymphatic colonisation 29 . Induction at E10.5 caused tdTomato⁺ labelling of perivascular stroma and smooth muscle at the kidney hilum ( Figure S7a ), but tdTomato⁺ LECs were not detected ( Figure S7b , 3/3 kidneys), excluding stromal lineage contributions to kidney LECs. Download figure Open in new tab Figure S7. Tbx18 + progenitor lineage labelling in the kidney shows no contribution to lymphatics ( a ) Left: Representative low-resolution z-projection of E15.5 Tbx18 CreERT2/+ ; Rosa26 tdTomato/+ kidneys ( n = 3), immunolabelled for tdTomato and the smooth muscle, ACTA2. Tamoxifen induction was performed at E10.5. The ureter, medulla and cortex are demarcated. Scale bar: 100 μm. Right: magnified dashed box region from left panel, showing co-expression of tdTomato and ACTA2 within ureteric smooth muscle and vascular smooth muscle (asterisk). Scale bar: 30 μm. ( b ) High-resolution confocal z-projection of the kidney hilum from Tbx18 CreERT2/+ ; Rosa26 tdTomato/+ kidneys, immunolabelled for PROX1 and tdTomato. In the kidney hilum, no co-expression of PROX1 and tdTomato is observed. Scale bar: 30 μm. The absence of kidney lymphatic labelling using these approaches led us to hypothesise that Foxd1⁺ lineage LECs arise from a cellular source that is distinct from Osr1 + intermediate mesoderm. Evidence for Foxd1 expression in the paraxial mesoderm in non-mammalian species 68 , 69 prompted us to explore its expression in mouse embryos. Wholemount HCR of wildtype embryos showed that Foxd1 was expressed from E8.0-8.5 (not shown) and at E9.5 within paraxial mesoderm-derived somites and was spatially segregated from the Osr1 + intermediate mesoderm field ( Figure S8, n = 3 embryos from two litters). In line these findings, across three Foxd1 eGFP-Cre/+ ; Rosa26 tdTomato/+ embryos, we consistently detected tdTomato⁺ LECs in the heart ( Figure 4c ), dermis ( Figure 4d ) and mesentery ( Figure 4e ), organs in which paraxial mesoderm is known to contribute to lymphatics 35 , 36 and differing from our experiments demonstrating a kidney-restricted contribution of the Osr1 + lineage. Thus, Foxd1⁺ lineage LECs are most likely to arise from paraxial mesoderm, rather than kidney stroma downstream of the Osr1 + lineage. The second major lineage within the Osr1 + posterior intermediate mesoderm is demarcated by SIX2 expression, serving as a progenitor source for nephron epithelia and glomerular podocytes 70 . To determine whether the nephron lineage contributes to kidney lymphatics, we utilised a constitutively active Six2-eGFP-Cre . In Six2-eGFP-Cre ; Rosa26 tdTomato/+ embryos at E15.5, tdTomato robustly labelled ECAD⁺ kidney epithelia ( Figure S9a,b ), but not PROX1⁺ PDPN⁺ LECs ( Figure 4f ) across four kidneys examined from two litters. Download figure Open in new tab Figure S8. Early expression of Foxd1 + within somites Left: Wholemount HCR showing Osr1 and Foxd1 expression at E9.5, representative of three embryos pooled across two litters. The head, tail and somites are demarcated. Right: High magnification of boxed region from left panel. Osr1 ⁺ intermediate mesoderm (arrowheads) is distinct from Foxd1 ⁺ cells (asterisks), the latter being expressed within somites. Scale bars: 200 μm. Download figure Open in new tab Figure S9. Validation of Six2 + progenitor lineage labelling in the kidney ( a ) Representative images of E15.5 Six2-eGFP-Cre;Rosa26 tdTomato/+ kidneys ( n = 2), immunolabelled for tdTomato (left), compared with littermate controls lacking Cre (right). tdTomato expression is observed in an epithelial pattern. Scale bar: 100 μm. ( b ) High-resolution confocal z-projection of Six2-eGFP-Cre;Rosa26 tdTomato/+ kidneys immunolabelled for ECAD and tdTomato. Strong tdTomato signal is detected in the nephrogenic zone, ECAD⁺ comma-shaped bodies, and cap mesenchyme (arrowhead). Scale bar: 50 μm. Taken together, these findings indicate that, akin to the blood vasculature within the kidney 46 , the small proportion of kidney lymphatics that derive from the Osr1 + progenitor pool do so directly, independent of Foxd1 + stromal or Six2 + nephron lineages. Kidney lymphvasculogenesis involves contributions from both Tie2⁺ and Osr1⁺ progenitor lineages Previously, we identified anatomically distinct clusters of LECs in the mouse and human developing kidney, suggestive of de novo formation of lymphatics via lymphvasculogenesis 14 , 22 . To investigate the lineage composition of these clusters, we first assessed the contribution of the Tie2⁺ endothelial lineage, given its broad contribution to kidney LECs. From nine non-overlapping 3D imaging volumes of Tie2-Cre ; Rosa26 tdTomato/+ kidneys at E15.5, 24 out of 37 (64.0 ± 9.1%) PROX1⁺ PDPN⁺ LECs across thirteen lymphatic clusters (from three embryos) were tdTomato⁺ ( Figure 5a ), indicating that the Tie2⁺ endothelial lineage contributes substantially to de novo lymphatic formation. Download figure Open in new tab Figure 5. Osr1 + and Tie2 + progenitors contribute to kidney lymphvasculogenesis ( a ) 3D reconstruction of 13 lymphatic clusters from Tie2-Cre;Rosa26 tdTomato/+ kidneys (E15.5), pooled from two litters and labelled for PROX1, PDPN and tdTomato. tdTomato⁺ cluster LECs (arrowheads) co-express PROX1 and PDPN, whereas others remained unlabelled by tdTomato (asterisks). Representative of nine non-overlapping 3D imaging volumes. Scale bar: 10 μm. ( b ) Representative 3D reconstruction of 16 lymphatic clusters from Osr1 eGFP-CreERT2/+ ; Rosa26 tdTomato/+ kidneys (E15.5), pooled from two litters and immunolabelled for PROX1, PDPN and tdTomato. Tamoxifen was administered at E8.5. tdTomato⁺ LECs (arrowheads) are intermixed with non-labelled LECs (asterisks) within clusters. Representative of eight non-overlapping 3D imaging volumes. Scale bar: 10 μm. ( c ) Quantification of lineage-labelled or unlabelled LECs within lymphatic clusters at E15.5. In Osr1 eGFP-CreERT2/+ ; Rosa26 tdTomato/+ kidneys, 36.2 ± 10.4% of cluster LECs were lineage labelled and 63.8 ± 10.4% were unlabelled. Each data point represents an individual field of view in which clusters were assessed. We next examined the contribution of Osr1⁺ intermediate mesoderm to lymphvasculogenesis in the kidney. Using Osr1 eGFP-CreERT2/+ ; Rosa26 tdTomato/+ kidneys after tamoxifen induction at E8.5, and from eight non-overlapping imaging volumes, we found that 24 out of 59 (36.2 ± 10.4%) PROX1⁺ PDPN⁺ LECs within sixteen clusters (from three embryos) were tdTomato⁺ ( Figure 5b ). Additionally, two of the sixteen clusters were exclusively comprised of Osr1 ⁺ lineage-derived cells. Quantification revealed that the proportion of LECs within kidney lymphatic clusters that were labelled by the Osr1 ⁺ lineage was complementary to Tie2⁺ lineage-negative LECs within these clusters ( Figure 5a ). These findings suggest that de novo LEC formation in the kidney, via lymphvasculogenesis, involves contributions from both Tie2⁺ endothelial and Osr1 ⁺ intermediate mesodermal progenitors. DISCUSSION Our understanding of lymphatic origins has expanded considerably over the past decade. Classical studies using Tie2-Cre mice implicated a predominantly venous origin for LECs 20 , consistent with earlier dye injection experiments in mammalian embryos 15 , 16 . However, subsequent lineage tracing has revealed surprising diversity in the cellular origins of LECs, with sources including the second heart field 25 , 33 , hemogenic endothelium 28 , 34 , tissue-resident blood capillaries 27 and paraxial mesoderm 35 , 36 . Here, we expand this framework by identifying two distinct and complementary progenitor sources for kidney lymphatics: a Tie2⁺ endothelial lineage, which contributes the majority of LECs and is shared by other organs, and an Osr1⁺ intermediate mesoderm lineage, representing a previously unrecognised, kidney-specific LEC source. Unlike other organs profiled to date, the kidney contains LECs from a progenitor pool not shared with systemic lymphatic beds. Our study places lymphatic development within the broader framework of lineage hierarchies within the kidney. Using snRNA-seq, we identified Prox1 and Vegfr3 expression within subsets of Osr1⁺ intermediate mesoderm, supporting early lymphatic fate specification within this population. Subsequently, our genetic lineage tracing studies reveal that, in addition to giving rise to nephron epithelium, stroma, and blood vasculature 46 , the posterior intermediate mesoderm also gives rise to ∼15% of kidney LECs. This contribution was found to arise after tamoxifen administration at E8.5. This timing precedes the emergence of the definitive metanephric rudiment at E10.5, the direct precursor to the adult kidney. However, at E10.5, no lineage labelling was identified, in line with the known temporal lineage restriction of Osr1⁺ cells as kidney development progresses 46 . Importantly, the Osr1⁺ lineage contribution was exclusive to the kidney. Osr1⁺- derived LECs were not detected in the heart, mesentery, or dermis, organs in which alternative mesodermal progenitors such as the second heart field and paraxial mesoderm contribute to lymphatics 25 , 33 , 35 , 36 . As Osr1 is expressed in non-kidney progenitors, including posterior second heart field 71 and fibroblast precursors 60 , 72 , the detection of Osr1⁺ progenitor-derived lymphatics in the kidney, as opposed to other organs examined, suggests that Osr1⁺- derived LECs are unique to the kidney and arise from intermediate mesoderm, rather than shared progenitor populations To determine whether kidney LECs emerge downstream of known lineages within the intermediate mesoderm, we performed lineage tracing of Foxd1⁺ stromal and Six2⁺ nephron progenitor populations. While constitutive Foxd1 eGFP-Cre labelled some kidney LECs, this labelling was absent in the inducible Foxd1 eGFP-CreERT2 line. Instead, Foxd1 expression was enriched within Pax3 + paraxial mesoderm–derived somites at early timepoints, and Foxd1 ⁺ LECs were detected in organs within which paraxial mesoderm is known to contribute to lymphatics 35 , 36 . These data suggest that Foxd1 eGFP-Cre captures paraxial mesoderm derivatives rather than kidney-specific stroma per se . Additionally, Six2⁺ nephron progenitors did not contribute to kidney LECs. Taken together, our results suggest that Osr1⁺ lineage LECs arise independently of canonical stromal or epithelial compartments within the kidney. This mirrors the developmental pattern of renal blood vasculature, which also arises from the Osr1⁺ 46 , but not Foxd1⁺ or Six2⁺ lineages 64 , 70 . Our data may also clarify discrepancies in earlier lineage tracing studies of the kidney. While one study report found that Foxd1 eGFP-Cre labelled CD31⁺ endothelial cells in the kidney 62 , another found no Foxd1⁺ lineage contribution to renal blood vessels 64 . Given that LECs can express CD31, albeit at lower levels than blood endothelial cells 29 , it is plausible that some of the previously identified CD31⁺ cells were LECs. These findings underscore the importance of temporally controlled lineage tracing to avoid misattributing cellular origins. A key finding is that both Tie2⁺ and Osr1⁺ lineages contribute to lymphatic clusters within the developing kidney, with complementary proportions of lineage labelling. Anatomically discrete clusters of LECs have previously been observed in the developing meninges 23 , heart 24 , 25 , skin 26 , 27 , mesentry 28 and kidney 29 . Inspired by live imaging studies within zebrafish 30 – 32 , these clusters have been proposed to arise via lymphvasculogenesis; de novo LEC differentiation from tissue-resident progenitors. An analogous mechanism has been proposed for the blood vasculature of the kidney, which forms both by sprouting 54 , 73 and de novo differentiation of kidney endothelial cells in situ 74 – 78 . Although once thought to reflect non-venous origins, recent evidence shows that paraxial mesoderm–derived progenitors can contribute both to lymphatic sprouting and to cluster formation 35 , 36 . Our data extend this concept by showing that the kidney hosts lymphatic clusters composed of both a systemic Tie2⁺ lineage and a local, kidney-specific Osr1⁺ lineage. Thus, cluster formation via lymphvasculogenesis appears not to depend on a singular lineage identity, but rather represents a shared cellular mechanism across progenitor types. There are limitations to our study. As with all Cre-based lineage tracing, conclusions are dependent on the specificity and efficiency of the Cre drivers. We attempted to mitigate this using a range of constitutive and inducible lines, but definitive resolution of lineage relationships may require intersectional genetics 79 or single-cell barcoding approaches 80 , 81 . Additionally, our analysis is limited to embryonic development. How these lineages persist or remodel in postnatal or diseased kidneys remains unexplored. Finally, the molecular cues that instruct lymphatic fate within the intermediate mesoderm remain to be elucidated. In conclusion, we demonstrate that kidney lymphatics arise from dual progenitor sources: a broadly conserved Tie2⁺ endothelial lineage and a kidney-restricted Osr1⁺ intermediate mesoderm lineage. Our findings support an emerging model in which lymphatic development is governed by organ-specific lineage hierarchies, akin to those shaping blood vasculature. As with blood endothelial cells, LECs may retain developmental memory that influences their specialised functions in health and disease. Understanding how distinct progenitors establish lymphatic identity may ultimately inform strategies for selectively targeting or regenerating kidney lymphatics, which undergo expansion in response to injury and inflammation 37 – 40 but are perturbed in contexts such as chronic transplant rejection 45 , 82 . Our study provides a foundation for investigating how lymphatic identity is encoded during kidney development and how it might be leveraged in regeneration and repair. METHODS Mouse husbandry Mouse experiments were approved across four university sites. Experiments at UK sites (UCL Great Ormond Street Institute of Child Health and UCL Institute of Ophthalmology) were UK Home Office approved and performed in accordance with the Animals (Scientific Procedures) Act 1986. Experiments at SickKids Hospital Research Facility were approved by the Animal Ethics Committee and were carried out in accordance with the regulations of the Canadian Council on Animal Care. Experiments at the University of Colorado were approved by AALAC and procedures were performed in accordance with animal protocols approved by the IACUC at the Anschutz Medical Campus. Mice were kept in specific pathogen-free conditions with unrestricted access to standard chow and water. Ear biopsies were collected at 2–3 weeks of age and stored at –20°C for genotyping. All mice were maintained on a C57Bl/6 background. The following strains were used: Osr1 eGFP-CreERT2 , (MGI:3827104, maintained at UCL Great Ormond Street Institute of Child Health), Six2-eGFP-Cre (MGI:3848345, maintained at the SickKids Hospital Research Facility), Foxd1 eGFP-Cre (MGI:4359653, maintained at SickKids Hospital Research Facility), Foxd1 eGFP-CreERT2 (MGI:J:158051, maintained at UCL Great Ormond Street Institute of Child Health), Tbx18 CreERT2 (MGI:J:253913, maintained at the University of Colorado), Tie2-Cre (MGI:2450311, maintained at UCL Great Ormond Street Institute of Child Health), Kit CreERT2 (MGI:5543260, maintained at UCL Institute of Ophthalmology) , Apln CreERT2 (MGI:5637737, maintained at UCL Great Ormond Street Institute of Child Health) and R26 tdTomato (MGI:J:155793, maintained at each of the research sites). To obtain embryos, females were time-mated, with the morning of plug detection designated as E0.5. Males carrying Cre or CreERT2 (heterozygous) were crossed with R26 tdTomato/tdTomato females, except for Apln CreERT2 crosses, in which CreERT2 was inherited maternally. Activation of CreERT2 Pregnant dams carrying CreERT2-expressing embryos were injected intraperitoneally with either tamoxifen (≥99% purity, T5648, Sigma-Aldrich) or 4-hydroxytamoxifen (≥70% Z-isomer, H6278, Sigma-Aldrich). Compounds were dissolved in ethanol and diluted to 10 mg/ml in peanut oil (P2144, Sigma-Aldrich), with the exception of Tbx18 CreERT2 crosses, in which case tamoxifen was dissolved in corn oil (C8267, Sigma-Aldrich) at a concentration of 20mg/ml. Injections were performed at midday using 27G hypodermic needles (Becton Dickinson). Genotyping Cre genotyping was performed using the following primers: Forward: TGGAAAATGCTTCTGTCCGTTTGC; Reverse: AACGAACCTGGTCGAAATCAGTG. PCR was performed using the KAPA2G Fast HotStart genotyping mix (Merck), with a touchdown protocol. Products were resolved via 2% agarose gel electrophoresis. Hybridisation chain reaction Wild-type embryos at various stages were collected from at least three independent litters, fixed overnight in 4% paraformaldehyde (PFA), and processed for whole-mount HCR. Samples were dehydrated in graded methanol (MeOH)/PBS-Tween (0.1%) series. HCR was performed as previously described 83 . DNA probe sets targeting Osr1, Pax3 , and Foxd1 transcripts, along with staining reagents and hairpin amplifiers, were supplied by Molecular Instruments. Embryos were stained with DAPI and mounted in CitiFluor AF1 on custom chamber slides. Wholemount immunofluorescence and optical clearing Unless otherwise stated, all reagents were from Sigma Aldrich. Embryonic kidneys and other tissues were dissected in PBS, fixed in 4% PFA overnight at 4°C, washed and stored in PBS with 0.02% sodium azide. Kidneys were sectioned into 250-300 μm-thick slices using a VT1200S Automated Vibrating Microtome (Leica Microsystems). Samples were cleared and stained using a modified iDISCO+ protocol 84 , as previously described 29 , 48 . Primary antibodies used were: rat anti-EMCN monoclonal (1:50, clone: V.5C7, sc-53941, Santa Cruz), goat anti-PROX1 polyclonal (1:200, AF2727, R&D Systems), rabbit anti-PROX1 polyclonal (1:200, ABN278, Merck), hamster anti-PDPN monoclonal (1:100, clone 8.1.1, 14-5381-82, ThermoFisher Scientific), rat anti-PECAM1 monoclonal (1:50, clone: MEC 13.3, 550274, BD Biosciences) rabbit anti-ACTA2 polyclonal (1:50, ab5694, Abcam), rabbit anti-RFP polyclonal (1:100, 600-401-379, Rockland), goat anti-RFP polyclonal (1:100, AB1140, SicGen), rabbit anti-PBX1 polyclonal (1:100, 4342S, Cell Signalling Technology), goat anti-LYVE1 polyclonal (1:100, AF2089 Abcam), rabbit anti-ECAD monoclonal (1:50, clone: #3195, 24E10, Cell Signalling Technology). Secondary antibodies were all AlexaFluor fluorescent-conjugated, used at 1:200 with excitations at 488 nm, 546 nm, 633 nm or 647 nm. Optical clearing was performed by dehydrating in a methanol series and incubation in benzyl alcohol:benzyl benzoate (BABB) in a 1:2 ratio. Cleared tissues were mounted in BABB on glass FluoroDishes (VWI International) and inverted immediately prior to imaging. Confocal microscopy Images were acquired on an LSM880 upright confocal microscope (Carl Zeiss) using 5×/NA 0.16 EC Plan-Neofluar and 10×/NA 0.5 W-Plan Apochromat water-dipping objectives. Detection was via multi-alkali and GaAsP PMTs or Airyscan Fast (4Y). Laser lines included 488, 561, and 633 nm. Imaging for Six2-eGFP-Cre or Foxd1 eGFP-Cre lines was performed at the SickKids Imaging Facility using a Leica SP8 Lightning confocal microscope with a 20×/0.75 objective and 4× HyD detectors with resonant scanning. Image processing For 3D imaging data, donfocal z-stacks were imported into Imaris (v8, Bitplane) for 3D reconstruction and isosurface rendering of tdTomato fluorescence. For HCR datasets, FIJI was used for image processing and maximum intensity projection was performed of representative embryo halves. Quantification of lymphatic labelling Quantification of LECs was performed manually in FIJI. For each kidney, ≥3 randomly selected, non-overlapping volumes were analysed from 300 µm slices. PROX1⁺ nuclei were manually counted and assessed for tdTomato co-labelling using the Multi-point tool. Data were pooled by kidney and mean labelling percentages calculated. Analysis of single-nucleus RNA sequencing data scRNAseq data were previously published 55 . Gene expression plots were generated from the interactive browser https://omg.gs.washington.edu/ using the ‘kidney development’ module, and relevant images exported. Reproducibility, statistics and data presentation All experiments included at least two kidneys from different embryos per litter and were replicated across two or more independent litters. Exact n values are provided in the manuscript and corresponding figure legends. Samples were pooled and analysed randomly by litter. To compare lineage-labelling proportions, data distributions were assessed for normality and variance equality; all groups passed these criteria, allowing for parametric testing. Two-group comparisons were made using unpaired two-tailed Student’s t -tests; comparisons across multiple groups used one-way ANOVA with Tukey’s post hoc test. Data are presented as mean ± standard error of the mean (SEM), with error bars indicating SEM. A p value ≤ 0.05 was considered statistically significant. Data availability All imaging files are available by contacting the lead author upon reasonable request. snRNA-seq data is available via the original publication 55 . Author contributions DJJ, PS, PR, NDR and DAL conceived the study design with support from ASW and CR. DJJ, LGR, AS designed experiments, which were performed and analysed together with CR, MKJ, SI, LAR, CR, JCC and JS. DM assisted with confocal microscopy and 3D imaging protocols. DJJ and DAL wrote the first draft of the manuscript, which was subsequently revised by all others, who approved the final version. DJJ, LGR and AS contributed equally to this work. DAL is the corresponding author. Competing interests All authors declare no conflicts of interest. Materials & Correspondence Correspondence and materials request should be addressed to DJJ ( daniyal.jafree{at}ucl.ac.uk ) or DAL ( d.long{at}ucl.ac.uk ). Acknowledgements The authors acknowledge Dr Peter Baluk (University of California San Francisco), Professor Juan Pedro Martinez-Barbera (University College London), Dr Robert D’Cruz and Dr Kimberley Lau (SickKids Hospital) for valuable discussions and technical expertise. This work was supported by a Wellcome Trust Investigator Award (220895/Z/20/Z) to DAL, alongside grants from Kidney Research UK (IN_012_20190306), a Rosetrees Trust PhD Plus Award (PhD2020\100012), a Foulkes Foundation Fellowship, and a Wellcome Trust Accelerator Award (314710/Z/24/Z) to DJJ. DJJ is also supported by the Specialised Foundation Programme at the East of England NHS Deanery. ASW acknowledges grant support from the Medical Research Council (MRC)-National Institute for Health and Care Research (NIHR) Rare Disease Research Platform MR/Y008340/1 and MRC Project Grant APP14742. DAL’s laboratory is supported by the NIHR Biomedical Research Centre at Great Ormond Street Hospital for Children NHS Foundation Trust and University College London. Funder Information Declared Wellcome Trust, https://ror.org/029chgv08 , 220895/Z/20/Z , 314710/Z/24/Z Kidney Research UK, https://ror.org/02kx7se86 , IN_012_20190306 Rosetrees Trust, https://ror.org/04e3zg361 , PhD2020\100012 Foulkes Foundation, https://ror.org/03hvqcb43 Medical Research Council, https://ror.org/03x94j517 , MR/Y008340/1 , APP14742 NIHR Great Ormond Street Hospital Biomedical Research Centre REFERENCES 1. ↵ Oliver , G. , Kipnis , J. , Randolph , G. J. & Harvey , N. L . The lymphatic vasculature in the 21st century: novel functional roles in homeostasis and disease . Cell 182 , 270 – 296 ( 2020 ). OpenUrl CrossRef PubMed 2. Petrova , T. V. & Koh , G. Y . Biological functions of lymphatic vessels . Science 369 , ( 2020 ). 3. ↵ Stritt , S. , Koltowska , K. & Mäkinen , T . Homeostatic maintenance of the lymphatic vasculature . Trends Mol. Med . 27 , 955 – 970 ( 2021 ). OpenUrl CrossRef PubMed 4. ↵ Yoon , J.-H. et al. Nasopharyngeal lymphatic plexus is a hub for cerebrospinal fluid drainage . Nature 625 , 768 – 777 ( 2024 ). OpenUrl CrossRef PubMed 5. Louveau , A. et al. CNS lymphatic drainage and neuroinflammation are regulated by meningeal lymphatic vasculature . Nat. Neurosci . 21 , 1380 – 1391 ( 2018 ). OpenUrl CrossRef PubMed 6. ↵ Antila , S. et al. Sustained meningeal lymphatic vessel atrophy or expansion does not alter Alzheimer’s disease-related amyloid pathology. Nat . Cardiovasc. Res . 3 , 474 – 491 ( 2024 ). OpenUrl CrossRef 7. ↵ Gur-Cohen , S. et al. Stem cell-driven lymphatic remodeling coordinates tissue regeneration . Science 366 , 1218 – 1225 ( 2019 ). OpenUrl Abstract / FREE Full Text 8. Niec , R. E. et al. Lymphatics act as a signaling hub to regulate intestinal stem cell activity . Cell Stem Cell 29 , 1067 – 1082 .e18 ( 2022 ). OpenUrl CrossRef PubMed 9. Liu , X. et al. Lymphoangiocrine signals promote cardiac growth and repair . Nature 588 , 705 – 711 ( 2020 ). OpenUrl CrossRef PubMed 10. ↵ Peña-Jimenez , D. et al. Lymphatic vessels interact dynamically with the hair follicle stem cell niche during skin regeneration in vivo . EMBO J . 38 , e101688 ( 2019 ). OpenUrl CrossRef PubMed 11. ↵ Li , J. et al. Neurotensin is an anti-thermogenic peptide produced by lymphatic endothelial cells . Cell Metab . 33 , 1449 – 1465 .e6 ( 2021 ). OpenUrl CrossRef PubMed 12. ↵ Phan , T. T. et al. Increased adipose tissue lymphatic vessel density inhibits thermogenesis through elevated neurotensin levels . Front. Cell Dev. Biol . 11 , 1100788 ( 2023 ). OpenUrl PubMed 13. ↵ Stone , O. A. , Zhou , B. , Red-Horse , K. & Stainier , D. Y. R . Endothelial ontogeny and the establishment of vascular heterogeneity . Bioessays 43 , e2100036 ( 2021 ). OpenUrl CrossRef PubMed 14. ↵ Jafree , D. J. , Long , D. A. , Scambler , P. J. & Ruhrberg , C . Mechanisms and cell lineages in lymphatic vascular development . Angiogenesis 24 , 271 – 288 ( 2021 ). OpenUrl PubMed 15. ↵ Sabin , F. R . On the origin of the lymphatic system from the veins and the development of the lymph hearts and thoracic duct in the pig . Am. J. Anat . 1 , 367 – 389 ( 1902 ). OpenUrl CrossRef Web of Science 16. ↵ Sabin , F. R . On the development of the superficial lymphatics in the skin of the pig . Am. J. Anat . 3 , 183 – 195 ( 1904 ). OpenUrl CrossRef Web of Science 17. Wigle , J. T. & Oliver , G . Prox1 function is required for the development of the murine lymphatic system . Cell 98 , 769 – 778 ( 1999 ). OpenUrl CrossRef PubMed Web of Science 18. Wigle , J. T. et al. An essential role for Prox1 in the induction of the lymphatic endothelial cell phenotype . EMBO J . 21 , 1505 – 1513 ( 2002 ). OpenUrl Abstract / FREE Full Text 19. ↵ Hägerling , R. et al. A novel multistep mechanism for initial lymphangiogenesis in mouse embryos based on ultramicroscopy . EMBO J . 32 , 629 – 644 ( 2013 ). OpenUrl Abstract / FREE Full Text 20. ↵ Srinivasan , R. S. et al. Lineage tracing demonstrates the venous origin of the mammalian lymphatic vasculature . Genes Dev . 21 , 2422 – 2432 ( 2007 ). OpenUrl Abstract / FREE Full Text 21. ↵ Huntington , G. S. & McClure , C. F. W . The anatomy and development of the jugular lymph sacs in the domestic cat (Felis domestica) . Am. J. Anat . 10 , 177 – 312 ( 1910 ). OpenUrl CrossRef 22. ↵ Ulvmar , M. H. & Mäkinen , T . Heterogeneity in the lymphatic vascular system and its origin . Cardiovasc. Res . 111 , 310 – 321 ( 2016 ). OpenUrl CrossRef PubMed 23. ↵ Antila , S. et al. Development and plasticity of meningeal lymphatic vessels . J. Exp. Med . 214 , 3645 – 3667 ( 2017 ). OpenUrl Abstract / FREE Full Text 24. ↵ Gancz , D. et al. Distinct origins and molecular mechanisms contribute to lymphatic formation during cardiac growth and regeneration . Elife 8 , ( 2019 ). 25. ↵ Lioux , G. et al. A Second Heart Field-Derived Vasculogenic Niche Contributes to Cardiac Lymphatics . Dev. Cell 52 , 350 – 363 .e6 ( 2020 ). OpenUrl CrossRef PubMed 26. ↵ Martinez-Corral , I. et al. Nonvenous origin of dermal lymphatic vasculature . Circ. Res . 116 , 1649 – 1654 ( 2015 ). OpenUrl Abstract / FREE Full Text 27. ↵ Pichol-Thievend , C. et al. A blood capillary plexus-derived population of progenitor cells contributes to genesis of the dermal lymphatic vasculature during embryonic development . Development 145 , ( 2018 ). 28. ↵ Stanczuk , L. et al. cKit Lineage Hemogenic Endothelium-Derived Cells Contribute to Mesenteric Lymphatic Vessels . Cell Rep . 10 , 1708 – 1721 ( 2015 ). OpenUrl CrossRef PubMed 29. ↵ Jafree , D. J. et al. Spatiotemporal dynamics and heterogeneity of renal lymphatics in mammalian development and cystic kidney disease . Elife 8 , ( 2019 ). 30. ↵ Yaniv , K. et al. Live imaging of lymphatic development in the zebrafish . Nat. Med . 12 , 711 – 716 ( 2006 ). OpenUrl CrossRef PubMed Web of Science 31. Okuda , K. S. et al. lyve1 expression reveals novel lymphatic vessels and new mechanisms for lymphatic vessel development in zebrafish . Development 139 , 2381 – 2391 ( 2012 ). OpenUrl Abstract / FREE Full Text 32. ↵ Eng , T. C. et al. Zebrafish facial lymphatics develop through sequential addition of venous and non-venous progenitors . EMBO Rep . 20 , ( 2019 ). 33. ↵ Maruyama , K. , Miyagawa-Tomita , S. , Mizukami , K. , Matsuzaki , F. & Kurihara , H . Isl1-expressing non-venous cell lineage contributes to cardiac lymphatic vessel development . Dev. Biol . 452 , 134 – 143 ( 2019 ). OpenUrl CrossRef PubMed 34. ↵ Klotz , L. et al. Cardiac lymphatics are heterogeneous in origin and respond to injury . Nature 522 , 62 – 67 ( 2015 ). OpenUrl CrossRef PubMed 35. ↵ Stone , O. A. & Stainier , D. Y. R . Paraxial mesoderm is the major source of lymphatic endothelium . Dev. Cell 50 , 247 – 255 .e3 ( 2019 ). OpenUrl CrossRef PubMed 36. ↵ Lupu , I.-E. et al. Direct specification of lymphatic endothelium from mesenchymal progenitors. Nat . Cardiovasc. Res . 4 , 45 – 63 ( 2025 ). OpenUrl 37. ↵ Russell , P. S. , Itkin , M. , Windsor , J. A. & Phillips , A. R. J. Kidney Lymphatics . Compr. Physiol . 13 , 4945 – 4984 ( 2023 ). OpenUrl PubMed 38. Baker , M. L. & Cantley , L. G . The lymphatic system in kidney disease . Kidney360 4 , e841 – e850 ( 2023 ). OpenUrl 39. Jafree , D. J. & Long , D. A . Beyond a passive conduit: implications of lymphatic biology for kidney diseases . J. Am. Soc. Nephrol . 31 , 1178 – 1190 ( 2020 ). OpenUrl Abstract / FREE Full Text 40. ↵ Donnan , M. D. , Kenig-Kozlovsky , Y. & Quaggin , S. E . The lymphatics in kidney health and disease . Nat. Rev. Nephrol . 17 , 655 – 675 ( 2021 ). OpenUrl CrossRef PubMed 41. ↵ Huang , J. L. et al. Vascular endothelial growth factor C for polycystic kidney diseases . J. Am. Soc. Nephrol . 27 , 69 – 77 ( 2016 ). OpenUrl Abstract / FREE Full Text 42. ↵ Jafree , D. J. et al. Microvascular aberrations found in human polycystic kidneys are an early feature in a Pkd1 mutant mouse model . Dis. Model. Mech . 18 , ( 2025 ). 43. ↵ Stuht , S. et al. Lymphatic neoangiogenesis in human renal allografts: results from sequential protocol biopsies . Am. J. Transplant . 7 , 377 – 384 ( 2007 ). OpenUrl CrossRef PubMed Web of Science 44. Pedersen , M. S. et al. Lymphangiogenesis in a mouse model of renal transplant rejection extends life span of the recipients . Kidney Int . 97 , 89 – 94 ( 2020 ). OpenUrl CrossRef PubMed 45. ↵ Jafree , D. J. et al. Organ-specific features of human kidney lymphatics are disrupted in chronic transplant rejection . J. Clin. Invest . ( 2025 ). doi: 10.1172/JCI168962 OpenUrl CrossRef 46. ↵ Mugford , J. W. , Sipilä , P. , McMahon , J. A. & McMahon , A. P . Osr1 expression demarcates a multi-potent population of intermediate mesoderm that undergoes progressive restriction to an Osr1-dependent nephron progenitor compartment within the mammalian kidney . Dev. Biol . 324 , 88 – 98 ( 2008 ). OpenUrl CrossRef PubMed Web of Science 47. ↵ Liu , H. et al. Heterozygous Mutation of Vegfr3 Reduces Renal Lymphatics without Renal Dysfunction . J. Am. Soc. Nephrol . 32 , 3099 – 3113 ( 2021 ). OpenUrl Abstract / FREE Full Text 48. ↵ Jafree , D. J. , Long , D. A. , Scambler , P. J. & Moulding , D . Tissue Clearing and Deep Imaging of the Kidney Using Confocal and Two-Photon Microscopy . Methods Mol. Biol . 2067 , 103 – 126 ( 2020 ). OpenUrl PubMed 49. ↵ Kisanuki , Y. Y. et al. Tie2-Cre transgenic mice: a new model for endothelial cell-lineage analysis in vivo . Dev. Biol . 230 , 230 – 242 ( 2001 ). OpenUrl CrossRef PubMed Web of Science 50. ↵ Lee , L. K. et al. LYVE1 Marks the Divergence of Yolk Sac Definitive Hemogenic Endothelium from the Primitive Erythroid Lineage . Cell Rep . 17 , 2286 – 2298 ( 2016 ). OpenUrl CrossRef PubMed 51. ↵ Marcelo , K. L. et al. Hemogenic endothelial cell specification requires c-Kit, Notch signaling, and p27-mediated cell-cycle control . Dev. Cell 27 , 504 – 515 ( 2013 ). OpenUrl CrossRef PubMed 52. ↵ Hu , Y. , Li , M. , Göthert , J. R. , Gomez , R. A. & Sequeira-Lopez , M. L. S . Hemovascular Progenitors in the Kidney Require Sphingosine-1-Phosphate Receptor 1 for Vascular Development . J. Am. Soc. Nephrol . 27 , 1984 – 1995 ( 2016 ). OpenUrl Abstract / FREE Full Text 53. ↵ Liu , Q. et al. Genetic targeting of sprouting angiogenesis using Apln-CreER . Nat. Commun . 6 , 6020 ( 2015 ). OpenUrl CrossRef PubMed 54. ↵ Munro , D. A. D. , Hohenstein , P. & Davies , J. A . Cycles of vascular plexus formation within the nephrogenic zone of the developing mouse kidney . Sci. Rep . 7 , 3273 ( 2017 ). OpenUrl CrossRef PubMed 55. ↵ Qiu , C. et al. A single-cell time-lapse of mouse prenatal development from gastrula to birth . Nature 626 , 1084 – 1093 ( 2024 ). OpenUrl CrossRef PubMed 56. ↵ Lan , Y. , Liu , H. , Ovitt , C. E. & Jiang , R . Generation of Osr1 conditional mutant mice . Genesis 49 , 419 – 422 ( 2011 ). OpenUrl CrossRef PubMed Web of Science 57. Xu , J. , Liu , H. , Chai , O. H. , Lan , Y. & Jiang , R . Osr1 Interacts Synergistically with Wt1 to Regulate Kidney Organogenesis . PLoS One 11 , e0159597 ( 2016 ). OpenUrl PubMed 58. ↵ Xu , J. , Liu , H. , Park , J.-S. , Lan , Y. & Jiang , R . Osr1 acts downstream of and interacts synergistically with Six2 to maintain nephron progenitor cells during kidney organogenesis . Development 141 , 1442 – 1452 ( 2014 ). OpenUrl Abstract / FREE Full Text 59. ↵ Srinivasan , R. S. et al. The Prox1-Vegfr3 feedback loop maintains the identity and the number of lymphatic endothelial cell progenitors . Genes Dev . 28 , 2175 – 2187 ( 2014 ). OpenUrl Abstract / FREE Full Text 60. ↵ Vallecillo-García , P. et al. Mesenchymal Osr1+ cells regulate embryonic lymphatic vessel formation . Development 151 , ( 2024 ). 61. ↵ Ulvmar , M. H. , Martinez-Corral , I. , Stanczuk , L. & Mäkinen , T . Pdgfrb-Cre targets lymphatic endothelial cells of both venous and non-venous origins . Genesis 54 , 350 – 358 ( 2016 ). OpenUrl CrossRef PubMed 62. ↵ Sims-Lucas , S. et al. Endothelial Progenitors Exist within the Kidney and Lung Mesenchyme . PLoS One 8 , e65993 ( 2013 ). OpenUrl CrossRef PubMed 63. ↵ Kobayashi , A. et al. Identification of a multipotent self-renewing stromal progenitor population during mammalian kidney organogenesis . Stem Cell Rep . 3 , 650 – 662 ( 2014 ). OpenUrl CrossRef 64. ↵ Sequeira-Lopez , M. L. S. et al. The earliest metanephric arteriolar progenitors and their role in kidney vascular development . Am. J. Physiol. Regul. Integr. Comp. Physiol . 308 , R138 – 49 ( 2015 ). OpenUrl CrossRef PubMed 65. ↵ Bohnenpoll , T. et al. Tbx18 expression demarcates multipotent precursor populations in the developing urogenital system but is exclusively required within the ureteric mesenchymal lineage to suppress a renal stromal fate . Dev. Biol . 380 , 25 – 36 ( 2013 ). OpenUrl CrossRef PubMed 66. ↵ Xu , J. , Nie , X. , Cai , X. , Cai , C.-L. & Xu , P.-X . Tbx18 is essential for normal development of vasculature network and glomerular mesangium in the mammalian kidney . Dev. Biol . 391 , 17 – 31 ( 2014 ). OpenUrl CrossRef PubMed 67. ↵ Guimarães-Camboa , N. et al. Pericytes of multiple organs do not behave as mesenchymal stem cells in vivo . Cell Stem Cell 20 , 345 – 359 .e5 ( 2017 ). OpenUrl CrossRef PubMed 68. ↵ Mok , G. F. et al. Single cell RNA-sequencing and RNA-tomography of the avian embryo extending body axis . Front. Cell Dev. Biol . 12 , 1382960 ( 2024 ). OpenUrl PubMed 69. ↵ Zhang , Y. , Tan , X. , Sun , W. & Zhang , P.-J . Flounder (Paralichthys olivaceus) FoxD1 and its regulation on the expression of myogenic regulatory factor , MyoD. Biologia (Bratisl .) 67 , ( 2012 ). 70. ↵ Kobayashi , A. et al. Six2 defines and regulates a multipotent self-renewing nephron progenitor population throughout mammalian kidney development . Cell Stem Cell 3 , 169 – 181 ( 2008 ). OpenUrl CrossRef PubMed Web of Science 71. ↵ Zhou , L. et al. Tbx5 and Osr1 interact to regulate posterior second heart field cell cycle progression for cardiac septation . J. Mol. Cell Cardiol . 85 , 1 – 12 ( 2015 ). OpenUrl CrossRef PubMed 72. ↵ Vallecillo-García , P. et al. Odd skipped-related 1 identifies a population of embryonic fibro-adipogenic progenitors regulating myogenesis during limb development . Nat. Commun . 8 , 1218 ( 2017 ). OpenUrl CrossRef PubMed 73. ↵ Daniel , E. et al. Spatiotemporal heterogeneity and patterning of developing renal blood vessels . Angiogenesis 21 , 617 – 634 ( 2018 ). OpenUrl CrossRef PubMed 74. ↵ Loughna , S. , Yuan , H. T. & Woolf , A. S . Effects of oxygen on vascular patterning in Tie1/LacZ metanephric kidneys in vitro . Biochem. Biophys. Res. Commun . 247 , 361 – 366 ( 1998 ). OpenUrl CrossRef PubMed Web of Science 75. Koning , M. et al. Vasculogenesis in kidney organoids upon transplantation. npj Regen . Med . 7 , 40 ( 2022 ). 76. Robert , B. , St John , P. L. , Hyink , D. P. & Abrahamson , D. R . Evidence that embryonic kidney cells expressing flk-1 are intrinsic, vasculogenic angioblasts . Am. J. Physiol . 271 , F744 – 53 ( 1996 ). OpenUrl PubMed 77. Robert , B. , St John , P. L. & Abrahamson , D. R . Direct visualization of renal vascular morphogenesis in Flk1 heterozygous mutant mice . Am. J. Physiol . 275 , F164 – 72 ( 1998 ). OpenUrl CrossRef 78. ↵ Loughna , S. et al. A molecular and genetic analysis of renalglomerular capillary development . Angiogenesis 1 , 84 – 101 ( 1997 ). OpenUrl CrossRef PubMed 79. ↵ Pu , W. et al. Genetic Targeting of Organ-Specific Blood Vessels . Circ. Res . 123 , 86 – 99 ( 2018 ). OpenUrl Abstract / FREE Full Text 80. ↵ Yoon , B. , Kim , H. , Jung , S. W. & Park , J . Single-cell lineage tracing approaches to track kidney cell development and maintenance . Kidney Int . 105 , 1186 – 1199 ( 2024 ). OpenUrl CrossRef PubMed 81. ↵ Jakab , M. & Augustin , H. G . Understanding angiodiversity: insights from single cell biology . Development 147 , ( 2020 ). 82. ↵ Thaunat , O. , Kerjaschki , D. & Nicoletti , A . Is defective lymphatic drainage a trigger for lymphoid neogenesis? Trends Immunol . 27 , 441 – 445 ( 2006 ). OpenUrl CrossRef PubMed Web of Science 83. ↵ Choi , H. M. T. et al. Third-generation in situ hybridization chain reaction: multiplexed, quantitative, sensitive, versatile, robust . Development 145 , ( 2018 ). 84. ↵ Renier , N. et al. iDISCO: a simple, rapid method to immunolabel large tissue samples for volume imaging . Cell 159 , 896 – 910 ( 2014 ). OpenUrl CrossRef PubMed Web of Science View the discussion thread. Back to top Previous Next Posted July 22, 2025. Download PDF Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following Genetic lineage tracing identifies intermediate mesoderm as a novel contributor to mammalian kidney lymphatics Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share Genetic lineage tracing identifies intermediate mesoderm as a novel contributor to mammalian kidney lymphatics Daniyal J Jafree , Lauren G Russell , Athanasia Stathopoulou , Christopher J Rowan , Andrew T White , Charlotte O’Riordan , Maria Kolatsi-Joannou , Karen L Price , Sarah Ivins , Liam A Ridge , Catherine Roberts , Jennie C Chandler , Laura Wilson , Dale Moulding , Julie Siegenthaler , Adrian S Woolf , Paul R Riley , Christiana Ruhrberg , Peter J Scambler , Norman D Rosenblum , David A Long bioRxiv 2025.07.18.665353; doi: https://doi.org/10.1101/2025.07.18.665353 Share This Article: Copy Citation Tools Genetic lineage tracing identifies intermediate mesoderm as a novel contributor to mammalian kidney lymphatics Daniyal J Jafree , Lauren G Russell , Athanasia Stathopoulou , Christopher J Rowan , Andrew T White , Charlotte O’Riordan , Maria Kolatsi-Joannou , Karen L Price , Sarah Ivins , Liam A Ridge , Catherine Roberts , Jennie C Chandler , Laura Wilson , Dale Moulding , Julie Siegenthaler , Adrian S Woolf , Paul R Riley , Christiana Ruhrberg , Peter J Scambler , Norman D Rosenblum , David A Long bioRxiv 2025.07.18.665353; doi: https://doi.org/10.1101/2025.07.18.665353 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Developmental Biology Subject Areas All Articles Animal Behavior and Cognition (7635) Biochemistry (17697) Bioengineering (13895) Bioinformatics (41951) Biophysics (21456) Cancer Biology (18594) Cell Biology (25520) Clinical Trials (138) Developmental Biology (13381) Ecology (19903) Epidemiology (2067) Evolutionary Biology (24323) Genetics (15612) Genomics (22510) Immunology (17738) Microbiology (40401) Molecular Biology (17184) Neuroscience (88622) Paleontology (667) Pathology (2833) Pharmacology and Toxicology (4825) Physiology (7644) Plant Biology (15158) Scientific Communication and Education (2046) Synthetic Biology (4296) Systems Biology (9825) Zoology (2271)