The transsulfuration pathway suppresses the embryonic lethal phenotype of glutathione reductase mutants in Caenorhabditis elegans

The transsulfuration pathway suppresses the embryonic lethal phenotype of glutathione reductase mutants in Caenorhabditis elegans | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results The transsulfuration pathway suppresses the embryonic lethal phenotype of glutathione reductase mutants in Caenorhabditis elegans Marina Valenzuela-Villatoro , David Guerrero-Gómez , Eva Gómez-Orte , Qing Cheng , Angelina Zheleva , José Antonio Mora-Lorca , Dunja Petrovic , Nigel J. O’Neil , Julián Cerón , Akiko Hatakeyama , Shuichi Onami , Milos Filipovic , Elias S.J. Arnér , Juan Cabello , Antonio Miranda-Vizuete doi: https://doi.org/10.1101/2025.01.09.632117 Marina Valenzuela-Villatoro 1 Redox Homeostasis Group, Instituto de Biomedicina de Sevilla (IBIS), Hospital Universitario Virgen del Rocío/CSIC/Universidad de Sevilla , Seville, Spain Find this author on Google Scholar Find this author on PubMed Search for this author on this site David Guerrero-Gómez 1 Redox Homeostasis Group, Instituto de Biomedicina de Sevilla (IBIS), Hospital Universitario Virgen del Rocío/CSIC/Universidad de Sevilla , Seville, Spain Find this author on Google Scholar Find this author on PubMed Search for this author on this site Eva Gómez-Orte 2 Centro para la Investigación Biomédica de la Rioja (CIBIR) , Logroño, Spain Find this author on Google Scholar Find this author on PubMed Search for this author on this site Qing Cheng 3 Division of Biochemistry, Department of Medical Biochemistry and Biophysics, Karolinska Institutet , Stockholm, Sweden Find this author on Google Scholar Find this author on PubMed Search for this author on this site Angelina Zheleva 2 Centro para la Investigación Biomédica de la Rioja (CIBIR) , Logroño, Spain Find this author on Google Scholar Find this author on PubMed Search for this author on this site José Antonio Mora-Lorca 1 Redox Homeostasis Group, Instituto de Biomedicina de Sevilla (IBIS), Hospital Universitario Virgen del Rocío/CSIC/Universidad de Sevilla , Seville, Spain Find this author on Google Scholar Find this author on PubMed Search for this author on this site Dunja Petrovic 4 Leibniz Institute for Analytical Sciences, ISAS e.V. , Dortmund, Germany Find this author on Google Scholar Find this author on PubMed Search for this author on this site Nigel J. O’Neil 5 Michael Smith Laboratories, University of British Columbia , Vancouver, Canada Find this author on Google Scholar Find this author on PubMed Search for this author on this site Julián Cerón 6 Modeling Human Diseases in C. elegans Group; Genes, Diseases, and Therapies Program, Institut d’Investigació Biomèdica de Bellvitge - IDIBELL, L’Hospitalet de Llobregat , Barcelona, Spain Find this author on Google Scholar Find this author on PubMed Search for this author on this site Akiko Hatakeyama 7 Laboratory for Developmental Dynamics, RIKEN Center for Biosystems Dynamics Research , Kobe, Japan Find this author on Google Scholar Find this author on PubMed Search for this author on this site Shuichi Onami 7 Laboratory for Developmental Dynamics, RIKEN Center for Biosystems Dynamics Research , Kobe, Japan Find this author on Google Scholar Find this author on PubMed Search for this author on this site Milos Filipovic 4 Leibniz Institute for Analytical Sciences, ISAS e.V. , Dortmund, Germany Find this author on Google Scholar Find this author on PubMed Search for this author on this site Elias S.J. Arnér 3 Division of Biochemistry, Department of Medical Biochemistry and Biophysics, Karolinska Institutet , Stockholm, Sweden 8 Department of Selenoprotein Research, National Institute of Oncology , Budapest, Hungary Find this author on Google Scholar Find this author on PubMed Search for this author on this site Juan Cabello 2 Centro para la Investigación Biomédica de la Rioja (CIBIR) , Logroño, Spain Find this author on Google Scholar Find this author on PubMed Search for this author on this site For correspondence: amiranda-ibis{at}us.es juan.cabello{at}riojasalud.es Antonio Miranda-Vizuete 1 Redox Homeostasis Group, Instituto de Biomedicina de Sevilla (IBIS), Hospital Universitario Virgen del Rocío/CSIC/Universidad de Sevilla , Seville, Spain Find this author on Google Scholar Find this author on PubMed Search for this author on this site For correspondence: amiranda-ibis{at}us.es juan.cabello{at}riojasalud.es Abstract Full Text Info/History Metrics Supplementary material Preview PDF Abstract The gsr-1 gene encodes the only glutathione reductase in Caenorhabditis elegans and gsr-1 loss of function alleles have a fully penetrant embryonic lethal phenotype. Therefore, maintenance of glutathione redox homeostasis is essential for nematode survival. We report here that impairment of the nonsense-mediated mRNA decay (NMD) pathway suppresses the embryonic lethality of gsr-1 mutants, allowing their normal development and growth. This NMD pathway dependent suppression requires cth-1 and cth-2 that encode, respectively, two isoforms of cystathionine-γ-lyase that catalyze the conversion of cystathionine to cysteine through the transsulfuration pathway. Interestingly, the thioredoxin system that can also provide cysteine through the cystine reduction pathway is not required for the suppression of the lethal phenotype of gsr-1 embryos when the NMD pathway is inactivated. Together, our data indicate that increasing the activity of the reverse transsulfuration pathway can compensate the detrimental effect of the gsr-1 mutation, raising the interesting question of why C. elegans has not preserved such compensatory mechanism to avoid the embryonic lethality of these mutants. Highlights A novel cryptic deletion in the smg-3 gene suppresses the embryonic lethality of C. elegans gsr-1 mutants. Inactivation of the nonsense-mediated mRNA decay (NMD) pathway allows survival of gsr-1 mutant worms. Genetic impairment of the transsulfuration pathway restores the embryonic lethal phenotype in gsr-1; smg-3 mutants. Introduction The tripeptide glutathione (GSH: L-γ-glutamyl-L-cysteinyl-glycine) is the most abundant low molecular weight thiol in the vast majority of organisms and it plays key roles in many cellular processes including cell signaling, DNA synthesis and repair, regulation of protein function, detoxification or antioxidant defense. GSH performs its diverse functions either directly through non-enzymatic reactions or as cosubstrate in enzyme-catalyzed reactions ( 1 ). Glutathione is synthesized in the cytoplasm of eukaryotic cells by the sequential action of two ATP requiring enzymes: gamma-glutamylcysteine synthetase that catalyzes the condensation of glutamate and cysteine, the rate limiting reaction of GSH biosynthesis, and glutathione synthetase which catalyzes the conjugation of gamma-glutamylcysteine with glycine ( 2 ). The relevance of GSH as an essential metabolite is illustrated by the fact that mutations that impair γ-glutamylcysteine synthetase function cause lethality in all organisms studied from yeast to mammals ( 3 – 7 ). Similarly, genetic inactivation of glutathione synthetase is also lethal in Caenorhabditis elegans and mice ( 8 , 9 ). On the other hand, no overt phenotype in yeast under normal growth conditions is observed, probably due to the increased levels of gamma-glutamylcysteine that may partially compensate the GSH requirement for growth ( 10 ). In humans, the very few cases of patients with glutathione synthetase deficiency have been found to have increased levels of γ-glutamylcysteine, supporting this compensatory role on GSH requirement ( 11 , 12 ). Once GSH serves as an electron donor it becomes oxidized (GSSG) and is then recycled to its reduced form by the flavoenzyme glutathione reductase, which is not needed for yeast, zebrafish or mice survival ( 13 – 15 ). The dispensability of glutathione reductase in these organisms has been explained by the thioredoxin system working as an alternative pathway to regenerate reduced glutathione ( 13 , 16 , 17 ), although the exact mechanism needs yet to be fully elucidated. In contrast to yeast, zebrafish and mice, glutathione reductase is essential for Caenorhabditis elegans development: homozygous gsr-1 animals segregating from heterozygous parents (hereafter referred as gsr-1(m+,z-) ; m , maternal and z , zygotic) have a normal embryonic and postembryonic development and reach adulthood indistinguishably of wild type controls thanks to the maternally contributed gsr-1 mRNA and/or GSR-1 protein. In turn, the gsr-1(m-,z-) embryos generated by these gsr-1(m+,z-) adults arrest at the pregastrula stage due to lack of maternal contribution ( 8 ). This embryonic lethal phenotype is intriguing as it has been shown that cytoplasmic thioredoxin reductase TRXR-1 and glutathione reductase GSR-1 have redundant functions in the nematode molting cycle, probably by TRXR-1 mediating a thioredoxin-dependent reduction of GSSG in the hypodermis in the absence of GSR-1 ( 18 ). Why TRXR-1 can functionally substitute GSR-1 to allow molting of gsr-1(m+,z-) larvae but not to allow gsr-1(m-,z-) embryos development is currently unknown. When GSSG reduction is compromised in mammalian cells by simultaneous blockage of glutathione reductase and cytoplasmic thioredoxin reductase 1, cells rely on de novo glutathione synthesis for survival using the reverse transsulfuration pathway to provide cysteine as a GSH precursor ( 19 ). This pathway employs homocysteine (generated from methionine by the S-adenosylmethionine cycle) to synthesize cysteine in two sequential enzymatic steps catalyzed by cystathionine β-synthase and cystathionine γ-lyase, respectively ( 20 ). Although mammals have a second independent pathway able to supply cysteine from extracellular cystine (oxidized form of cysteine) in a reaction catalyzed by the cystine reductase TRP14 ( 21 ), this pathway is not operative in TRXR1 knockout cells, because TRP14 is a member of the thioredoxin family that requires TRXR1 and NADPH to be maintained in its reduced active conformation ( 22 ). Of note, while the transsulfuration and cystine reduction pathways have been relatively well characterized in mammals ( 20 , 23 ), very little is known on their functional roles in other model organisms like Drosophila melanogaster or Caenorhabditis elegans . The nonsense-mediated mRNA decay pathway (NMD) is a surveillance mRNA system that was initially discovered as a mechanism to degrade transcripts that contained premature stop codons but was later found to eliminate aberrant mRNAs that cannot be translated by other different reasons, like unproductively spliced mRNAs or mRNAs with very long 3’-untranslated regions (reviewed in ( 24 )). Importantly, whole transcriptomic analyses have widened this view by showing that NMD regulates the dynamics and stability of a large proportion of the eukaryotic transcriptome in all organisms ( 25 – 28 ). The core components of the NMD pathway were first identified in yeast and named UPFs (up frameshift proteins) ( 29 ), but have been shown to be conserved across metazoan evolution: UPF1 is an ATP-dependent RNA helicase; UPF2 acts as a molecular bridge between UPF1 and UPF3, promoting UPF1 RNA unwinding and helicase activity while UPF3 binds to exon junction complexes ( 30 , 31 ). In C. elegans , the molecular constituents of the NMD pathway were originally discovered as a class of extragenic suppressor genes that, when mutated, share a common phenotype of abnormal morphogenesis of the male bursa and the hermaphrodite vulva, thus named smg ( s uppressor with m orphogenetic effect on g enitalia) genes ( 32 ). This gene class was later found to encode the orthologues of yeast UPF genes: SMG-2/UPF1, SMG-3/UPF2 and SMG-4/UPF3 ( 33 – 36 ). In addition to these core components, there are other proteins that assist for the correct function and regulation of the NMD pathway in all organisms ( 31 , 37 , 38 ). In this work, we report that impairment of the NMD pathway suppresses the embryonic lethal phenotype of C. elegans gsr-1 loss of function mutants and that this suppression requires the two cystathionine γ-lyase orthologues CTH-1 and CTH-2. Results Inactivation of the NMD pathway suppresses the embryonic lethality of C. elegans gsr-1 mutants The C. elegans gsr-1(tm3574) deletion allele encodes truncated versions of mitochondrial (GSR-1a) and cytosolic glutathione reductase (GSR-1b) isoforms that lack part of their respective NADPH and FAD binding domains ( Figure 1a,b ) and gsr-1(tm3574) mutants exhibit a fully penetrant embryonic lethal phenotype ( Figure 1c ) ( 8 ). When generating a strain combining the gsr-1(tm3574) allele with the integrated transgene gnaIs2 [Pmyo-2::yfp; Punc-119::Aβ1-42] (that expresses human Aβ peptide in all worm neurons along with YFP in pharynx as fluorescence co-injection marker) ( 39 ), we were able to isolate double gsr-1(tm3574); gnaIs2 homozygous animals that were viable and grossly wild type ( Figure 1c ). As the gnaIs2 transgene in heterozygosis failed to rescue the gsr-1 embryonic lethal phenotype ( Figure 1c ), we concluded that the causative suppressor mutation is recessive. The rescue of the gsr-1(tm3574) embryonic lethal phenotype by the gnaIs2 transgene is not due to YFP or Aβ as the control transgenes gnaIs1 [Pmyo-2::yfp], expressing YFP in pharynx, or dvIs50 [Psnb-1:: Aβ1-42], expressing Aβ in neurons, were unable to restore viability of gsr-1(tm3574) mutants ( Figure 1c ). Ten times outcrossing of the gnaIs2 transgene with the wild type strain maintained the viability of gsr-1(tm3574 ) mutants, suggesting that the transgene insertion locus or a closely linked mutation was responsible for the suppression of the embryonic lethal phenotype. Download figure Open in new tab Figure 1. mRNA and protein domain organization of wild type and mutant gsr-1 and identification of the molecular lesion segregating with the gnaIs2 transgene. a) Schematic representation of the two gsr-1 mRNA variants. Boxes represent exons and lines show spliced introns. White boxes indicate 5’-UTR and 3’-UTR, respectively, and grey boxes indicate the ORF. Boundaries of gsr-1(tm3574) and gsr-1(syb2343) deletions are shown as black lines. b) Schematic representation of GSR-1 proteins . Protein domain organization of GSR-1a and GSR-1b isoforms as well as those of the shorter proteins resulting from translation of the gsr-1(tm3574) and gsr-1(syb2343) deletion alleles . c) The gnaIs2 transgene suppresses gsr-1 mutants embryonic lethality. gsr-1(tm3574) embryos carrying the gnaIs2 transgene (expressing YFP in pharynx and Aβ in neurons) in homozygosis develop normally. The gnaIs2 transgene in heterozygosis and control transgenes gnaIs1 (expressing YFP in pharynx) and dvIs50 (expressing Aβ in neurons) do not suppress gsr-1 mutants embryonic lethality. Data are the mean +/− SEM of three independent experiments (three biological replicates) with at least 100 embryos laid per plate. Strains with the wild type gsr-1 allele are depicted in blue and strains with the gsr-1 mutant allele are depicted in red. d) Diagram of the deletion boundaries at 6.36 MB position of LG IV identified in the strain harboring the gnaIs2 integrated transgene. Genes within this region are represented in boxes where ORF exons are in blue and 3’-UTR exons are in grey, connected by lines representing the introns. Next, to identify the suppressor locus, we performed whole genome sequencing using a single-nucleotide polymorphism (WGS-SNP) mapping strategy ( 40 ). Briefly, the gnaIs2 harbouring strain was crossed with the highly polymorphic Hawaiian C. elegans strain CB4856 and the resulting F2 progeny carrying the gnaIs2 transgene in homozygosis was pooled for WGS-SNP analysis. The loss of Hawaiian SNPs identified the chromosomal interval containing the suppressor locus within a wide region of LG IV (Supplemental Figure 1). A detailed inspection of this interval identified a 4.5 kb deletion, centered at 6,364 MB position of LG IV ( Figure 1d ), which harbors three genes: Y73B6BL.47 and Y73B6BL.270 of unknown function and smg-3 that encodes the C. elegans orthologue of human UPF2, a core regulator of the non-sense mRNA mediated decay (NMD) pathway ( 34 ). C. elegans hermaphrodites with mutations in smg genes display a p rotruding vu lva (Pvu) phenotype ( 32 ). Interestingly, the original strain carrying the gnaIs2 transgene as well as the viable gsr-1(tm3574); gnaIs2 animals exhibit this Pvu phenotype, similar to that of smg-3(ma117) mutants used as control ( Figure 2a ), suggesting that animals bearing the gnaIs2 transgene may have impaired smg-3 function. To determine whether defective SMG-3 function allows gsr-1 embryos development, we generated double mutants of the gsr-1(tm3574) deletion with three independent smg-3 alleles: ma117 whose molecular lesion is unknown and the deletions tm5719 and tm5906 . We found that all smg-3 alleles rescued the gsr-1 embryonic lethal phenotype ( Figure 2b ). Download figure Open in new tab Figure 2. Impairment of the NMD pathway suppresses the embryonic lethal phenotype of gsr-1 mutants a) Representative micrographs of first day adult gsr-1(tm3574), gnaIs2 or smg-3(ma117) mutants. All mutants develop similar to wild type control, except that those carrying the gnaIs2 transgene or smg-3 mutation have a protruding vulva phenotype (Pvu). Insets show the magnification of the vulva area . b,c,d) smg-1(e1228) , smg-2(e2008) and smg-3(ma117) mutations allow normal embryonic development of gsr-1(tm3574) and gsr-1(syb2363) animals. The variable number of arrested embryos in the strains carrying the smg-1 , smg-2 and smg-3 alleles is due to the him-2(e1065) or him-5(e1490) (high incidence of males) mutations present in their respective backgrounds ( 41 ) (See Supplemental Table 1 for complete genotype). In all cases, the number of arrested embryos substantially decreased upon crossing with the gsr-1 mutation, including the smg-1(e1228) allele that is linked to the him-2(e1065) mutation at LG I. Data are the mean +/− SEM of three independent experiments (three biological replicates) with at least 100 embryos laid per plate. Strains with the wild type gsr-1 allele are depicted in blue and strains with the gsr-1 mutant allele are depicted in red. To confirm that impairment of NMD pathway activity is the underlying cause of the gsr-1 embryonic lethal phenotype suppression, we combined the gsr-1(tm3574) deletion with mutations in smg-1 and smg-2 genes, that encode other components of the NMD pathway acting upstream smg-3 ( 34 – 36 ). As shown in Figure 2c , both smg-1(e1228) and smg-2(e2008) mutants also restored the viability of gsr-1 mutants. As described above, the gsr-1(tm3574) deletion allele encodes shorter GSR-1 isoforms (both cytoplasmic and mitochondrial) that lack part of the NADPH and FAD binding domains ( Figure 1a,b ) and we have shown that this shorter isoforms are devoid of glutathione reductase enzymatic activity in vitro ( 8 ). Although the smg genes were initially defined as a class of extragenic suppressors ( 32 ), given the role of NMD in the regulation of the dynamics and stability of many transcripts ( 25 – 28 ), we first set to rule out that the suppression phenotype would arise from a cryptic expression of the gsr-1(tm3574) transcript, producing a shorter GSR-1 protein with residual enzymatic activity in vivo . For this purpose, we generated by CRISPR-Cas9 a new deletion allele, gsr-1(syb2363) that almost completely eliminates the gsr-1 ORF, thus being a putative null allele ( Figure 1a,b ), Similar to gsr-1(tm3574) allele, homozygous gsr-1(syb2363) animals also display a fully penetrant embryonic lethal phenotype which is suppressed by mutations in the genes encoding the different components of C. elegans NMD pathway ( Figure 2d ), indicating that the suppressor phenotype is extragenic to gsr-1 . Collectively, these data demonstrate that impairment of the NMD pathway function suppresses gsr-1 mutants embryonic lethality. This is most likely achieved by allowing the translation of one or more mRNAs (normally degraded by a functional NMD pathway) encoding components of an alternative system capable of generating enough GSH to sustain gsr-1 embryos development. The inactivation of the NMD pathway does not suppress the synthetic molting phenotype of gsr-1(m+,z-); trxr-1 double mutants Aiming to identify the alternative system that allows the development of gsr-1 embryos in an smg-3 (NMD deficient) background, we first focused on the cytoplasmic thioredoxin reductase TRXR-1, that we have previously shown to function redundantly with GSR-1 in the worm molting cycle ( 18 ). For this purpose, we used three different trxr-1 alleles: trxr-1(sv47) is a deletion that removes most of trxr-1 ORF and is probably a null allele, whereas trxr-1(cer34[Sec666Cys]) and trxr-1(cer55[Sec666*]) are two different point mutation alleles that eliminate the selenocysteine residue of TRXR-1, required for its enzymatic activity ( 18 , 42 ). Because smg-3 maps at LG IV, same as trxr-1 , we decided to investigate the role of trxr-1 in gsr-1 mutants development when the NMD pathway is impaired using instead the smg-2(e2008) allele, which is equally functional in inactivating the pathway ( Figure 2c ). In all cases, the smg-2 mutation did not suppress the synthetic molting defect of gsr-1(m+,z-); trxr-1 double mutants ( Figure 3 ). Importantly, the very few gsr-1(m+,z-); trxr-1; smg-2 survivors that managed to overcome the four larval molts became adults with a severe sick appearance that laid very few embryos which invariably arrested at the pregastrula stage, like gsr-1(m-,z-) mutant embryos (data not shown) ( 8 ). Thus, these data suggest that the functional redundancy between GSR-1 and TRXR-1 in the worm molting cycle is independent of the NMD pathway. Download figure Open in new tab Figure 3. The smg-2(e2008) mutation fails to suppress the molting phenotype of gsr-1; trxr-1 double mutants. All triple mutants gsr-1; smg-2; trxr-1 display a highly penetrant molting larval arrest phenotype, similar to that of the control strain gsr-1; trxr-1 . Data are the mean +/− SEM of three independent experiments (three biological replicates) with at least 100 embryos laid per plate. Strains with the wild type gsr-1 allele are depicted in blue and strains with the gsr-1 mutant allele are depicted in red. The thioredoxin system is dispensable for the growth of gsr-1; smg-3 embryos As mentioned above, the gsr-1(m+,z-); trxr-1; smg-2 triple mutants that make it through the four molting steps are sick and the very few gsr-1(m-,z-); trxr-1; smg-2 embryos they produce do not develop. To elucidate whether the embryonic arrest of this triple mutant is due to a direct need of the thioredoxin system in reducing GSSG in the absence of GSR-1 or, instead, it is due to other requirements of the worm thioredoxin system during embryogenesis, not directly related to glutathione metabolism, we first aimed to determine whether C. elegans TRXR-1 exhibits glutathione reductase enzymatic activity in vitro . Despite metazoan thioredoxin reductases and glutathione reductases share domain organization and functional groups, apart from the additional C-terminal active site motif in thioredoxin reductases mentioned above ( 43 ), no metazoan thioredoxin reductase has been shown to reduce GSSG in vitro . Consistently, this is also the case for C. elegans TRXR-1, which we found unable to reduce GSSG in the presence of NADPH ( Figure 4a and Supplemental Figure 2). Having ruled out direct GSSG reduction by TRXR-1, we next addressed whether TRXR-1 role in allowing gsr-1; smg-3 embryos development could be mediated through reduction of one of the nematode thioredoxin family members that have previously been shown to interact with the glutathione system in other organisms. We first focused on the thioredoxin member DPY-11 because is expressed in the hypodermis (where GSR-1 and TRXR-1 display redundant functions in the molting cycle) ( 44 ) and its mammalian orthologue TMX1 has been reported to use glutathione for its catalytic activity ( 45 ). However, two different putative dpy-11 null alleles (e207 and sy748) ( 44 , 46 ) and a newly generated CRISPR-Cas9 allele (syb4162[C51S;C54S]) that encodes a redox-dead DPY-11 variant, all failed to restore embryonic lethality in gsr-1; smg-3 mutants ( Figure 4b ). To our surprise, the redox-dead allele dpy-11(syb4162) does not cause any dumpy phenotype (Supplemental Figure 3), indicating that DPY-11 enzymatic redox activity is dispensable for its biological function in maintaining body morphology, in contrast to what has been previously proposed ( 44 ). Like dpy-11 mutants, null or loss of function alleles of trx-1 , txdc-17 and txl-1 genes, whose mammalian orthologs encode the thioredoxin proteins with GSSG reducing activity in vitro TRX-1 ( 47 ), TRP14/TXNDC17 ( 21 ) and TXNL1/TRP32 ( 48 ) had not effect on the development of gsr-1; smg-3 mutants ( Figure 4c ). Together, these data suggest that the thioredoxin system is not directly involved in the mechanism by which impairment of the NMD pathway suppresses the embryonic lethality of gsr-1 mutants. However, given the high number of thioredoxin family members in C. elegans ( 49 ) and their possible functional redundancy in redox mediated reactions, our data cannot completely rule out that one or more yet unidentified TRXR-1 dependent thioredoxins may play a role in the viability of gsr-1; smg-3 animals. Download figure Open in new tab Figure 4. The thioredoxin system is not required for the suppression of gsr-1 embryonic lethality upon impairment of the NMD pathway. a) C. elegans TRXR-1 is devoid of GSSG reducing activity in vitro . NADPH consumption in the presence of 1 mM GSSG of recombinantly expressed human glutathione reductase ( Hs GR) and C. elegans thioredoxin reductase 1 ( Ce TRXR-1). b, c) The thioredoxins DPY-11, TRX-1, TXDC-17 and TXL-1 are not required for the embryonic development of gsr-1; smg-3 animals. All triple mutants combinations of genes encoding thioredoxin proteins with GSSG reducing activity in a gsr-1; smg-3 doble mutant background develop similarly as gsr-1; smg-3 control animals Data are the mean +/− SEM of three independent experiments (three biological replicates) with at least 100 embryos laid per plate. Strains with the wild type gsr-1 allele are depicted in blue and strains with the gsr-1 mutant allele are depicted in red. The transsulfuration pathway supports development of gsr-1; smg-3 double mutants We have previously shown that C. elegans expressing aggregation-prone proteins in muscle cells are extremely sensitive to GSH depletion ( 50 ) and that these animals rely on functional transsulfuration and cystine reduction pathways for survival, most likely by provisioning cysteine for de novo GSH synthesis ( 23 ). Cystine reduction is performed by TRXR-1 and TRP14/TXDC-17 in both mammals and C. elegans ( 23 ). However, our data indicate that TRXR-1 and TXDC-17 are not required for viability of gsr-1; smg-2 or gsr-1; smg-3 mutants ( Figure 3 and 4c ). Hence, we asked whether the transsulfuration pathway would suffice to supply the necessary cysteine for de novo GSH synthesis to allow development of gsr-1; smg-3 embryos. To test this hypothesis, we employed animals that carry loss of function mutations in the cth-1 and cth-2 genes, encoding two paralogues of the enzyme cystathionine γ-lyase that catalyzes the last step in the transsulfuration pathway, converting cystathionine into cysteine and α-ketobutyrate ( 20 ). Similar to txdc-17 mutants, worms bearing mutations either in the cth-1 or cth-2 genes did not impair the development of gsr-1; smg-3 embryos ( Figure 5a ). However, gsr-1; smg-3; cth-1; cth-2 quadruple mutant worms produced about 80% of arrested embryos ( Figure 5a ), demonstrating a functional redundancy of CTH-1 and CTH-2 in the viability of gsr-1; smg-3 embryos and suggesting that cystathionine to cysteine conversion through transsulfuration is the main pathway responsible for sustaining development of gsr-1; smg-3 embryos. Interestingly, a gsr-1; smg-3; txdc-17; cth-1; cth-2 quintuple mutant increased the number of arrested embryos to 93% as compared with the 80% of the gsr-1; smg-3; cth-1; cth-2 quadruple mutant ( Figure 5a ), indicating that some cysteine provisioning through the cystine reduction pathway can occur in the absence of a functional transsulfuration pathway, but that it is not enough on its own to allow gsr-1 embryos survival. Download figure Open in new tab Figure 5. Inactivation of the transsulfuration pathway impairs gsr-1; smg-3 double mutants development. a) Simultaneous inactivation of cth-1 and cth-2 genes restores the embryonic lethal phenotype in gsr-1; smg-3 double mutants. Data are the mean +/− SEM of three independent experiments (three biological replicates) with at least 100 embryos laid per plate. Strains with the wild type gsr-1 allele are depicted in blue and strains with the gsr-1 mutant allele are depicted in red . b) cth-1 and cth-2 mRNA levels in gsr-1 and smg-3 mutants. Data are the mean +/− SEM of three independent experiments (three biological replicates). Data were not significantly different by one-way ANOVA multiple comparisons test. c,d) CTH-1 and CTH-2 protein levels in gsr-1 and smg-3 mutants. Differential interference contrast (left panel) and fluorescence (right panel) microscopy images and quantification of CTH-1::GFP and CTH-2::GFP endogenous reporters in gsr-1 and smg-3 mutants. Graphs represent the data of 3 independent experiments with at least 30 embryos. *** p<0.001 by Kruskal-Willis with Dunńs multiple comparisons test. Error bars are SEM. Because the NMD pathway regulates the dynamics and stability of part of the eukaryotic transcriptome, we reasoned that the smg-3 mutation may stabilize or increase the levels of cth-1 and cth-2 mRNAs, probably resulting in higher levels of protein expression, thus allowing the development of gsr-1 embryos. To test this hypothesis, we first quantified cth-1 and cth-2 transcript levels in embryos of the different genetic backgrounds by qPCR. As shown in Figure 5b , the smg-3 mutation did not significantly increase the amount of cth-1 and cth-2 mRNAs. Next, to address if the smg-3 mutation would increase CTH-1 and CTH-2 proteins amount without altering their corresponding mRNA levels, we generated by CRISPR-Cas9 transgenic strains that produce CTH-1::GFP and CTH-2::GFP fusion proteins, expressed from their respective endogenous promoters (Supplemental Table 1). Using these endogenous GFP reporters we found that the smg-3 embryos only slightly increased the levels of CTH-1::GFP but not those of CTH-2::GFP ( Figure 5c and 5d ). In contrast, in a gsr-1; smg-3 double mutant background CTH-1::GFP levels remained similar to those found in smg-3 single mutants while CTH-2::GFP levels were significantly increased ( Figure 5c and 5d ). Finally, gsr-1 mutant embryos slightly decrease CTH-1::GFP while increased CTH-2::GFP levels( Figure 5c and 5d ). Taken together, these data indicate that gsr-1 embryos do not substantially increase cth-1 and cth-2 mRNA and protein levels to compensate for the lack of GSSG reducing capacity. However, impairing NMD pathway activity would result in stabilization of cth-1 and cth-2 mRNAs, thus allowing gsr-1 embryos to bypass the pregastrula stage checkpoint ( 8 ) thanks to a sustained provision of CTH-1 and CTH-2. Discussion Glutathione is the most prevalent thiol-based redox metabolite in virtually all organisms, with few exceptions like the low molecular weight thiols bacillithiol or mycothiol that serve similar functions in some Gram-positive bacteria, ergothioneine in some fungi or trypanothionine in euglenozoa ( 51 ). Hence, inactivating mutations in genes encoding the first step in glutathione synthesis enzymes are lethal in all those organisms that use glutathione ( 3 – 7 ). In contrast, mutations in the gene encoding glutathione reductase, the enzyme that recycles oxidized glutathione to its reduced form, not always result in lethal phenotypes. For instance, human patients with mutations in the GSR gene can reach old age, although they suffer hemolytic anemia, cataracts, deafness and hyperbilirubinemia ( 52 , 53 ). GSR knockout mice do not show any phenotype under stabulary conditions ( 14 ) but are highly sensitive to bacterial and fungal infections ( 54 , 55 ). Similarly, putative null GSR zebrafish develop similar to wild type control animals ( 15 ). The viability of vertebrate GSR mutants has been explained by the thioredoxin system acting as a backup pathway to reduce GSSG ( 16 , 17 ), although the embryonic lethality of TXNRD1 and TXN1 knockout mice ( 56 , 57 ) has hampered the experimental demonstration with double knockout mice combinations. Consistent with the thioredoxin system acting as an alternative mechanism to maintain GSH pool, Drosophila melanogaster and probably other insects do not possess glutathione reductase and GSSG recycling is carried out by dedicated thioredoxin reductase and thioredoxin proteins ( 58 ). Also, yeast lacking glutathione reductase glr1 gene have an absolute requirement of the thioredoxin system for survival ( 13 ). An exception to this rule is the nematode C. elegans as gsr-1 mutants are embryonic lethal ( 8 ), despite having a complete thioredoxin system ( 49 ). Why C. elegans gsr-1 mutants are the only eukaryotes that have an embryonic lethal phenotype even when TRXR-1 can functionally substitute GSR-1 in the worm molting cycle ( 18 )? One possibility is that the trxr-1 gene is not expressed at enough levels to compensate for the lack of gsr-1 during the first embryonic divisions, as the gsr-1 embryos arrest at the pregastrula stage ( 8 ). This is consistent with the fact that trxr-1 gene expression gradually increases during the first 200 minutes of embryonic development ( 59 ). Alternatively, mammalian cells with strongly impairment of glutathione reductase activity excrete GSSG to the extracellular medium to alleviate its toxic intracellular built-up ( 60 ). Should this mechanism also operate in C. elegans embryonic cells, the constrain imposed by the embryo eggshell could hamper the survival of the gsr-1 embryos by avoiding GSSG dilution in the extracellular milieu. To test this hypothesis, we eliminated the eggshell of wild type and gsr-1 embryos by chitinase treatment and found that gsr-1 embryos lacking eggshell still displayed an embryonic lethal phenotype while wild type embryos develop normally. Because gsr-1 embryos lacking eggshell maintained the integrity of the permeability barrier, GSSG could still accumulate within the peri-embryonic. However, removing the embryo permeability barrier to allow GSSG diffusion provokes wild type embryos death, thus precluding any conclusion in this direction (Supplemental Figure 4). The serendipitous finding of the inactivation of the NMD pathway allowing the development of gsr-1(m-,z-) embryos suggested that expression or stabilization of one or more unknown mRNAs as the cause of the suppression of the embryonic lethal phenotype. Given that the thioredoxin system has been shown to act as backup system to reduce GSSG in the absence of glutathione reductase ( 13 , 16 , 17 ), and that C. elegans TRXR-1 cooperates with GSR-1 in the worm molting cycle ( 18 ), we first approached to evaluate if the thioredoxin system was behind the suppression of the gsr-1 embryos lethal phenotype by smg-1 , smg-2 or smg-3 mutations. To our surprise, mutations in the trxr-1 gene encoding cytoplasmic thioredoxin reductase as well as in dpy-11 , trx-1 and txdc-14 genes, encoding the orthologues of those thioredoxins that have been reported in other organisms to reduce GSSG, failed to restore embryonic arrest in gsr-1; smg-2 or gsr-1; smg-3 double mutant backgrounds. Thus, the worm thioredoxin system was not directly involved in the development of gsr-1 embryos with inactivated NMD pathway function. Mouse hepatocytes that lack cytoplasmic thioredoxin reductase TRXR1 and glutathione reductase GSR can grow in vitro as long as methionine is supplied to allow cysteine production for de novo GSH synthesis by the reverse transsulfuration pathway ( 19 ). In this pathway, methionine enters the S-adenosylmethionine cycle to generate homocysteine, whose accumulation is toxic in both mammals and worms ( 61 , 62 ). Homocysteine is then converted into cysteine by a two-step enzymatic process: first homocysteine is used by cystathionine β-synthase to generate cystathionine and subsequently, cystathionine γ-lyase converts cystathionine into cysteine and a-α-ketobutyrate ( 20 ). While in mammals there is only one enzyme of each class, C. elegans has two cystathionine β-synthases CBS-1 and CBS-2 ( 61 , 63 ) and two cystathionine γ-lyases CTH-1 and CTH-2 ( 64 ). To evaluate whether the activity of the transsulfuration pathway underlays the viability of gsr-1; smg-3 embryos we combined this double mutant with cth-1 and/or cth-2 mutants and found that only the quadruple mutant gsr-1; smg-3 cth-1 ; cth-2 restored the embryonic lethality. This result implies that NMD pathway inactivation somehow stabilizes the activity of the reverse transsulfuration pathway to a level that counteracts the absence of GSR-1 to reduce GSSG, probably providing enough cysteine for de novo GSH synthesis. The dual requirement of cth-1 and cth-2 genes in the survival of gsr-1 embryos is in sharp contrast with previous data demonstrating non-redundant functions of C. elegans cth-1 and cth-2 in molybdenum cofactor transfer from bacteria to worms ( 64 ), nematode longevity ( 65 ) or muscle proteostasis ( 23 ) where only cth-2 is required. In this last scenario, cystine reduction pathway via TRP14/TXDC-17 and transsulfuration pathway via CTH-2 cooperate to maintain worm viability when muscle proteostasis is compromised ( 23 ). However, the viability of gsr-1; smg-3 embryos is only dependent on the transsulfuration pathway, that requires both CTH-1 and CTH-2. This can be explained by the fact that cystine is mostly incorporated from the extracellular environment. However, given the impermeability of C. elegans embryos eggshell, cystine cannot be imported into the embryonic cells, therefore relying exclusively cysteine provision by the transsulfuration pathway. In summary, we have found that in C. elegans , like in mammals, the reverse transsulfuration pathway is able, under certain circumstances, to allow survival of gsr-1(m-,z-) embryos, probably by supplying cysteine for de novo GSH synthesis when GSSG reduction is compromised. Why this mechanism is not operative in gsr-1 mutants is intriguing and may be related to low expression levels or tissue specificity of CTH-1 and/or CTH-2 proteins during the early embryo development, thus causing embryonic lethality by accumulation of the toxic metabolite homocysteine and GSSG. Experimental Procedures C. elegans strains The standard methods used for culturing and maintenance of C. elegans were as previously described ( 66 ). A list of all strains used and generated in this study is provided in Supplemental Table 1. The alleles gsr-1(syb2363) , dpy-11(syb4162), cth-1(syb7115) and cth-2(syb7086) were generated at SunyBiotech ( http://www.sunybiotech.com ) by CRISPR-Cas9 editing. All VZ strains are 6x outcrossed with N2 wild type, except those strains generated by CRISPR-Cas9 that were 2x outcrossed. Worm reagents and details on the protocols used for genotyping the different alleles reported in this work can be provided upon request. Whole genome sequencing single-nucleotide polymorphism (WGS-SNP) mapping Using the Hawaiian single-nucleotide polymorphism (SNP) mapping method, we backcrossed the GRU102 strain carrying the gnaIs2 transgene with the polymorphic C. elegans Hawaiian strain CB4856 ( 67 ). Next, we isolated the newly generated F2 recombinants homozygous for the gnaIs2 transgene. Total DNA extraction was performed using the Plant/Fungi DNA Isolation Kit (Norgen Biotek Corp). Sequencing libraries were constructed using the NEXTflex Rapid DNA-Seq Kit according to manufactureŕs instructions (Bioo Scientific). DNA quality and integrity were evaluated by Experion Automated Electrophoresis System (Bio-Rad) and the concentration was calculated using qPCR. Libraries were prepared at the Genomic Platform at CIBIR ( http://cibir.es/es/plataformas-tecnologicas-y-servicios/genomica-y-bioinformatica ) and sequenced on an Illumina HiSeq15000. The quality of DNAseq results was assessed using FastQC ( http://www.bioinformatics.babraham.ac.uk/projects/fastqc/ ). The FastQ files were analyzed using a Cloud-Based Pipeline for Analysis of Mutant Genome Sequences (Cloudmap tool, https://usegalaxy.org/cloudmap ) with standard parameters following Cloudmap workflow ( 68 ). Embryonic arrest phenotype All experiments were performed on synchronized embryos generated by allowing 10 to 15 gravid hermaphrodites to lay eggs during 2.5 hours on seeded plates at 20°C. After parent removal, laid embryos were counted and plates were further incubated at 20°C. During the next two days arrested embryos are count and the number of arrested embryos at day 2 were used for quantification. Viable progeny was quantified on the plates that were incubated for one or two more days (depending on the strain) at days at 20°C. Larval arrest phenotype Synchronized animals were generated by allowing 10 to 15 gravid hermaphrodites to lay eggs during 2.5 hours on seeded plates at 20°C. After parent removal, laid embryos were counted and further incubated for four days at 20°C. For quantification, all larvae were censored and only animals that passed the L4 molt and became young adults were counted. Recombinant expression and enzymatic characterization of C. elegans TRXR-1 The amino acid sequence encoding the C. elegans thioredoxin reductase 1 (TRXR-1) was retrieved from the GenBank database (Accession No. AAD41826.1). The open reading frame (ORF) was subsequently synthesized by Integrated DNA Technologies (IDT) with codon optimization for enhanced expression in E. coli . Additionally, an N-terminal hexahistidine-tagged Small Ubiquitin-like Modifier (H6SUMO) fusion was engineered upstream of TRXR-1, and a selenocysteine insertion sequence (SECIS) element was placed downstream. This construct was cloned into the pABC2 vector as previously described ( 69 ), yielding the plasmid pABC2a- Ce TRXR-1, which was subsequently transformed into the E. coli C321.ΔA strain ( 70 ). For the protein expression, a single bacterial colony was cultured in 10 ml of Terrific Broth (TB) at 30°C with constant shaking at 250 rpm overnight. The resultant culture was then scaled up to 2 liters of TB, and incubation was continued under the same conditions until the optical density at 600 nm (OD600) reached 1-1.5. At this point, 5 µM sodium selenite and 0.5 mM IPTG were added into the culture, which was then incubated at a reduced temperature of 24°C overnight. The bacterial cells were harvested by centrifugation at 5,000 × g for 15 minutes and resuspended in IMAC binding buffer (50 mM Tris-HCl, 250 mM NaCl, and 20 mM imidazole). The cells were then lysed, and the lysate was centrifuged at 30,000 × g for 30 minutes at 4°C. The resulting supernatant was subjected to affinity chromatography purification. The Ce TRXR-1 protein was engineered with an N-terminal His-tagged SUMO tag (H6SUMO). The H6SUMO- Ce TRXR-1 was initially purified using IMAC (ÄKTAExplorer 10 FPLC equipped with a 5 ml HisTrap FF column, GE Healthcare). To the eluted fraction containing H6SUMO- Ce TRXR-1, 15 µg/ml His-tagged ULP1 (SUMO protease) was added, and the protein mixture was incubated at 4°C overnight with gentle shaking to cleave the Ce TRXR-1. Excess imidazole in the digestion mixture was removed using a NAP-25 desalting column (GE Healthcare), and the protein mixture was subjected to a second round of IMAC. During this step, non-cleaved H6SUMO- Ce TRXR-1, the cleaved H6SUMO tag, His-tagged ULP1, and any impurities from the first round of IMAC bound to the nickel column, while the non-tagged Ce TRXR-1 was collected in the flow-through. The purified protein was concentrated and stored in TE buffer containing 30% glycerol for long-term storage at −20°C. Protein concentration was determined spectrophotometrically by measuring FAD absorption at 463 nm (ε = 13,600 M⁻¹cm⁻¹, with one FAD corresponding to one Ce TRXR-1 subunit). Enzyme activity assays were conducted using previously established protocols ( 71 , 72 ). Specifically, the NADPH-dependent reduction of 5,5’-dithiobis(2-nitrobenzoic) acid (DTNB) was employed to determine the specific activities of Ce TRXR-1. This assay involves the reduction of one DTNB molecule to two 5-thio-2-nitrobenzoic acid (TNB) molecules by Ce TRXR-1. TNB exhibits a strong absorbance at 412 nm, allowing the reaction velocity to be quantified as µmol DTNB reduced per minute, calculated using the extinction coefficient for TNB (13,600 M⁻¹cm⁻¹). To further verify Sec-dependent activities of Ce TRXR-1, the alternative insulin-coupled Trx reduction assay was used. Insulin is a substrate of human Trx1 that can be recycled by Ce TRXR-1 in the consumption of NADPH. This assay therefore monitored the consumption of NADPH through the decreased absorbance at 340 nm, using NADPH’s extinction coefficient of 6,200 M⁻¹cm⁻¹. For measuring human glutathione reductase (GR) activity, the assay utilized GSSG as the substrate, which was reduced by GR using NADPH, which can be monitored similarly. Microscopy For protruding vulva phenotype analysis ( Fig. 2a ), second day adult animals were used. For CTH-1::GFP and CTH-2::GFP fluorescence determination in embryos ( Fig. 5c,d ) an one hour egg lay was performed and then allow the embryos to develop 2 more hours at 20°C on the plate to match the stage at which gsr-1 embryos arrest. Next, embryos are transferred to a 3% agarose pad on a microscope slide and imaged. Differential interference contrast and fluorescence imaging was performed in an Olympus BX61 microscope equipped with a DP72 digital camera coupled to CellSens Software for image acquisition and analysis. Photoshop CC 2018 and Adobe Illustrator software were used to produce figures. ImageJ Software was used to quantify the fluorescence of the embryos. qPCR analysis To determine the transcriptional activity of cth-1 and cth-2 genes in embryos, young adult worms were collected and bleached, to use only embryos at the early stage of division. This way they can be compared with gsr-1 embryos that arrest between 15 and 120 cells stage ( 8 ). For total RNA extraction, eggs were lysed using mirVana Kit, following manufactureŕs instructions (Ambion). Homogenization of the lysate was performed using a conventional rotor-stator homogenizer polytron, pre-chilled with liquid nitrogen. For cDNA synthesis, RNA was extracted with DNAse to eliminate any DNA contamination. In each sample, a total reaction of 10 µl contained: 500ng RNA, 1 µl RQ1 RNase-Free DNAse (Promega), 1x RQ1 DNAse 10x Reaction Buffer and DEPC water. Reactions were incubated for 30 min at 37°C and then stopped by adding 1 µl STOP solution (Promega) and further incubation for 15 min at 65°C. cDNA synthesis was performed using SuperScript III First-Strand Synthesis System for RT-PCR (Invitrogen) following instructions for random hexamers primed. cDNA was eluted in TE buffer. For qRT-PCR analysis Power SYBR Green Master Mix (ThermoFisher Scientific) and specific primers were used in a QuantStudio 5 Real Time PCR System (Applied Biosystems, ThermoFisher). Normalization to actin act-1 expression was used to calculate relative expression. The experiments were carried out in three independent replicas. Primers pairs used were (5’->3-): cth-1 Fw: ATGACTCCGTACTTCCAGCG; cth-1 Rv: TAGATGCTGCTGGAACTCGT; cth-2 Fw: GCCGTGTTGCTGTTCCTAAT; cth-2 Rv: CCACTGCGGCAATATCAACA; act-1 Fw: ACGCCAACACTGTTCTTTCC; act-1 Rv: GATGATCTTGATCTTCATGGTTGA. Eggshell and permeability barrier removal For eggshell removal, embryos were collected from dissected adult gsr-1 (m+,z-) worms in egg buffer(118 mM NaCl, 48 mM KCl, 2 mM CaCl2, 2 mM MgCl2, 25 μM HEPES(pH7.4)). Developmental stages of collected embryos were not sorted out. Embryos of 2-cell-stage and later-stages were included. The embryos were incubated in 1% NaOCl for 2 min followed by the incubation in chitinase-chymotrypsine solution (2U/ml chitinase in egg buffer pH6.0) for 4 min at 22°C. It is noted that the permeability barrier inside the eggshell still remains around the embryos after this procedure. For lethality measurements, the eggshell-removed embryos as well as intact gsr-1 (m-, z-) embryos were incubated in 100 μl of egg buffer in a chamber slide. After overnight incubation at 22 °C, unhatched embryos were counted under a stereomicroscope (Leica, M205C). DIC imaging was performed on an optical microscope (Olympus, BX51). For the permeability barrier integrity assay, embryos were placed into a solution of 5 μg/ml FM4-64 in egg buffer and were mounted on a microscope slide. Fluorescent images were obtained with a confocal microscope (Nikon Ti-E with the spinning disk confocal unit CSU-X1(Yokogawa electric Corp.)) with a solid-state laser line (561 nm, Andor Technology). Graphical and Statistical Analysis Data were processed in Excel (Microsoft Corporation) then Prism (GraphPad Software) was used to generate bar charts and perform the statistical analyses described in the Figure Legends. Data availability statement C. elegans strains, E. coli strains and plasmids are available upon request. The authors affirm that all data necessary for confirming the conclusions of the article are present within the article, figures and tables with the exception of Supplementary Table 1 which contains C. elegans strains and genotypes used in this study. WGS data will be deposited at the Gene Expression Omnibus repository of NCBI (pending). Author contribution A.M.V. and J.C. designed and supervised the research. M.V.V. and D.G.G. generated strains, performed C. elegans experiments and analyzed the data. E.G.O. performed qPCR analysis and analyzed the data. A.Z. performed single-nucleotide polymorphism (WGS-SNP) mapping strategy. Q.C. and E.S.J.A. performed all experiments with recombinant TRXR-1. J.A.M.L. identified gnaIs2 transgene as suppressor of gsr-1 mutants embryonic lethality. D.P. M.F. and J.C. contributed with reagents and strains. N.J.O. identified the microdeletion at smg-3 locus. A.H. and S.O. performed the embryo eggshell and permeability barrier experiments. A.M.V. wrote the manuscript and all the authors edited and reviewed it. Competing interests Authors declare no competing interests Acknowledgements and funding Some C. elegans strains were provided by the CGC, which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440) USA and by the National BioResearch Project, Japan. We thank SunyBiotech ( https://www.sunybiotech.com/ ) for their excellent assistance generating CRISPR-Cas9 edited alleles and the Genomics and Bioinformatic facility at CIBIR for their support. We also thank Profs Jan Gruber, Paul Sternberg, Gary Ruvkun and Chris Link for kindly providing strains. M.V.V., D.G.G, E.G.O, J.C and A.M.V. were supported by Projects PGC2018-094276-B-I00, PID2021-122311NB-I00 and PID2021-127388NB-I00, financed by MICIU/AEI/10.13039/501100011033 and from FEDER, UE as well as by Projects P20_00229 and DOC_01674 Ayudas a proyectos I+D+I (PAIDI 2020) CTEICU – Junta de Andalucía. Co-financed with FEDER at 80%. Andalucía se mueve con Europa. Footnotes ↵ # Current position: Molecular Therapeutics Program, Center for Applied Medical Research, CIMA, University of Navarra and Instituto de Investigación Sanitaria de Navarra (IDISNA), Recinto de Complejo Hospitalario de Navarra, Pamplona, Spain References 1. ↵ Wang , L. , Ahn , Y. J. , and Asmis , R . ( 2020 ) Sexual dimorphism in glutathione metabolism and glutathione-dependent responses . Redox Biol 31 , 101410 OpenUrl CrossRef PubMed 2. ↵ Lu , S. C . ( 2013 ) Glutathione synthesis . Biochim Biophys Acta 1830 , 3143 – 3153 OpenUrl CrossRef PubMed 3. ↵ Wu , A. L. , and Moye-Rowley , W. S . ( 1994 ) GSH1, which encodes gamma-glutamylcysteine synthetase, is a target gene for yAP-1 transcriptional regulation . Mol Cell Biol 14 , 5832 – 5839 OpenUrl Abstract / FREE Full Text 4. Romero-Aristizabal , C. , Marks , D. S. , Fontana , W. , and Apfeld , J . ( 2014 ) Regulated spatial organization and sensitivity of cytosolic protein oxidation in Caenorhabditis elegans . Nat Commun 5 , 5020 OpenUrl CrossRef PubMed 5. Shi , Z. Z. , Osei-Frimpong , J. , Kala , G. , Kala , S. V. , Barrios , R. J. , Habib , G. M. , Lukin , D. J. , Danney , C. M. , Matzuk , M. M. , and Lieberman , M. W . ( 2000 ) Glutathione synthesis is essential for mouse development but not for cell growth in culture . Proc Natl Acad Sci U S A 97 , 5101 – 5106 OpenUrl Abstract / FREE Full Text 6. Dalton , T. P. , Dieter , M. Z. , Yang , Y. , Shertzer , H. G. , and Nebert , D. W . ( 2000 ) Knockout of the mouse glutamate cysteine ligase catalytic subunit (Gclc) gene: embryonic lethal when homozygous, and proposed model for moderate glutathione deficiency when heterozygous . Biochem Biophys Res Commun 279 , 324 – 329 OpenUrl CrossRef PubMed Web of Science 7. ↵ Enya , S. , Yamamoto , C. , Mizuno , H. , Esaki , T. , Lin , H. K. , Iga , M. , Morohashi , K. , Hirano , Y. , Kataoka , H. , Masujima , T. , Shimada-Niwa , Y. , and Niwa , R . ( 2017 ) Dual Roles of Glutathione in Ecdysone Biosynthesis and Antioxidant Function During Larval Development in Drosophila . Genetics 207 , 1519 – 1532 OpenUrl Abstract / FREE Full Text 8. ↵ Mora-Lorca , J. A. , Saenz-Narciso , B. , Gaffney , C. J. , Naranjo-Galindo , F. J. , Pedrajas , J. R. , Guerrero-Gomez , D. , Dobrzynska , A. , Askjaer , P. , Szewczyk , N. J. , Cabello , J. , and Miranda-Vizuete , A . ( 2016 ) Glutathione reductase gsr-1 is an essential gene required for Caenorhabditis elegans early embryonic development . Free Radic Biol Med 96 , 446 – 461 OpenUrl CrossRef PubMed 9. ↵ Winkler , A. , Njalsson , R. , Carlsson , K. , Elgadi , A. , Rozell , B. , Abraham , L. , Ercal , N. , Shi , Z. Z. , Lieberman , M. W. , Larsson , A. , and Norgren , S . ( 2011 ) Glutathione is essential for early embryogenesis--analysis of a glutathione synthetase knockout mouse . Biochem Biophys Res Commun 412 , 121 – 126 OpenUrl CrossRef PubMed 10. ↵ Grant , C. M. , MacIver , F. H. , and Dawes , I. W . ( 1997 ) Glutathione synthetase is dispensable for growth under both normal and oxidative stress conditions in the yeast Saccharomyces cerevisiae due to an accumulation of the dipeptide gamma-glutamylcysteine . Mol Biol Cell 8 , 1699 – 1707 OpenUrl Abstract / FREE Full Text 11. ↵ Njalsson , R . ( 2005 ) Glutathione synthetase deficiency . Cell Mol Life Sci 62 , 1938 – 1945 OpenUrl CrossRef PubMed Web of Science 12. ↵ Ristoff , E. , Hebert , C. , Njalsson , R. , Norgren , S. , Rooyackers , O. , and Larsson , A . ( 2002 ) Glutathione synthetase deficiency: is gamma-glutamylcysteine accumulation a way to cope with oxidative stress in cells with insufficient levels of glutathione? J Inherit Metab Dis 25 , 577 – 584 OpenUrl CrossRef PubMed 13. ↵ Muller , E. G . ( 1996 ) A glutathione reductase mutant of yeast accumulates high levels of oxidized glutathione and requires thioredoxin for growth . Mol Biol Cell 7 , 1805 – 1813 OpenUrl Abstract / FREE Full Text 14. ↵ Rogers , L. K. , Tamura , T. , Rogers , B. J. , Welty , S. E. , Hansen , T. N. , and Smith , C. V . ( 2004 ) Analyses of glutathione reductase hypomorphic mice indicate a genetic knockout . Toxicol Sci 82 , 367 – 373 OpenUrl CrossRef PubMed 15. ↵ Zhao , X. , Lorent , K. , Escobar-Zarate , D. , Rajagopalan , R. , Loomes , K. M. , Gillespie , K. , Mesaros , C. , Estrada , M. A. , Blair , I. A. , Winkler , J. D. , Spinner , N. B. , Devoto , M. , and Pack , M . ( 2020 ) Impaired Redox and Protein Homeostasis as Risk Factors and Therapeutic Targets in Toxin-Induced Biliary Atresia . Gastroenterology 159 , 1068 – 1084 e1062 OpenUrl CrossRef PubMed 16. ↵ Sun , Q. A. , Kirnarsky , L. , Sherman , S. , and Gladyshev , V. N . ( 2001 ) Selenoprotein oxidoreductase with specificity for thioredoxin and glutathione systems . Proc Natl Acad Sci U S A 98 , 3673 – 3678 OpenUrl Abstract / FREE Full Text 17. ↵ Tan , S. X. , Greetham , D. , Raeth , S. , Grant , C. M. , Dawes , I. W. , and Perrone , G. G . ( 2010 ) The thioredoxin-thioredoxin reductase system can function in vivo as an alternative system to reduce oxidized glutathione in Saccharomyces cerevisiae . J Biol Chem 285 , 6118 – 6126 OpenUrl Abstract / FREE Full Text 18. ↵ Stenvall , J. , Fierro-Gonzalez , J. C. , Swoboda , P. , Saamarthy , K. , Cheng , Q. , Cacho-Valadez , B. , Arner , E. S. , Persson , O. P. , Miranda-Vizuete , A. , and Tuck , S . ( 2011 ) Selenoprotein TRXR-1 and GSR-1 are essential for removal of old cuticle during molting in Caenorhabditis elegans . Proc Natl Acad Sci U S A 108 , 1064 – 1069 OpenUrl Abstract / FREE Full Text 19. ↵ Eriksson , S. , Prigge , J. R. , Talago , E. A. , Arner , E. S. , and Schmidt , E. E . ( 2015 ) Dietary methionine can sustain cytosolic redox homeostasis in the mouse liver . Nat Commun 6 , 6479 OpenUrl CrossRef PubMed 20. ↵ Sbodio , J. I. , Snyder , S. H. , and Paul , B. D . ( 2019 ) Regulators of the transsulfuration pathway . Br J Pharmacol 176 , 583 – 593 OpenUrl CrossRef PubMed 21. ↵ Pader , I. , Sengupta , R. , Cebula , M. , Xu , J. , Lundberg , J. O. , Holmgren , A. , Johansson , K. , and Arner , E. S . ( 2014 ) Thioredoxin-related protein of 14 kDa is an efficient L-cystine reductase and S-denitrosylase . Proc Natl Acad Sci U S A 111 , 6964 – 6969 OpenUrl Abstract / FREE Full Text 22. ↵ Jeong , W. , Yoon , H. W. , Lee , S. R. , and Rhee , S. G . ( 2004 ) Identification and characterization of TRP14, a thioredoxin-related protein of 14 kDa. New insights into the specificity of thioredoxin function . J Biol Chem 279 , 3142 – 3150 OpenUrl Abstract / FREE Full Text 23. ↵ Marti-Andres , P. , Finamor , I. , Torres-Cuevas , I. , Perez , S. , Rius-Perez , S. , Colino-Lage , H. , Guerrero-Gomez , D. , Morato , E. , Marina , A. , Michalska , P. , Leon , R. , Cheng , Q. , Juranyi , E. P. , Borbenyi-Galambos , K. , Millan , I. , Nagy , P. , Miranda-Vizuete , A. , Schmidt , E. E. , Martinez-Ruiz , A. , Arner , E. S. , and Sastre , J . ( 2024 ) TRP14 is the rate-limiting enzyme for intracellular cystine reduction and regulates proteome cysteinylation . EMBO J 24. ↵ He , F. , and Jacobson , A . ( 2015 ) Nonsense-Mediated mRNA Decay: Degradation of Defective Transcripts Is Only Part of the Story . Annu Rev Genet 49 , 339 – 366 OpenUrl CrossRef PubMed 25. ↵ Mendell , J. T. , Sharifi , N. A. , Meyers , J. L. , Martinez-Murillo , F. , and Dietz , H. C . ( 2004 ) Nonsense surveillance regulates expression of diverse classes of mammalian transcripts and mutes genomic noise . Nat Genet 36 , 1073 – 1078 OpenUrl CrossRef PubMed Web of Science 26. Ramani , A. K. , Nelson , A. C. , Kapranov , P. , Bell , I. , Gingeras , T. R. , and Fraser , A. G . ( 2009 ) High resolution transcriptome maps for wild-type and nonsense-mediated decay-defective Caenorhabditis elegans . Genome Biol 10 , R101 OpenUrl CrossRef PubMed 27. Lelivelt , M. J. , and Culbertson , M. R . ( 1999 ) Yeast Upf proteins required for RNA surveillance affect global expression of the yeast transcriptome . Mol Cell Biol 19 , 6710 – 6719 OpenUrl Abstract / FREE Full Text 28. ↵ Rehwinkel , J. , Letunic , I. , Raes , J. , Bork , P. , and Izaurralde , E . ( 2005 ) Nonsense-mediated mRNA decay factors act in concert to regulate common mRNA targets . RNA 11 , 1530 – 1544 OpenUrl Abstract / FREE Full Text 29. ↵ Leeds , P. , Wood , J. M. , Lee , B. S. , and Culbertson , M. R . ( 1992 ) Gene products that promote mRNA turnover in Saccharomyces cerevisiae . Mol Cell Biol 12 , 2165 – 2177 OpenUrl Abstract / FREE Full Text 30. ↵ Yi , Z. , Sanjeev , M. , and Singh , G . ( 2021 ) The Branched Nature of the Nonsense-Mediated mRNA Decay Pathway . Trends Genet 37 , 143 – 159 OpenUrl CrossRef PubMed 31. ↵ Monaghan , L. , Longman , D. , and Caceres , J. F . ( 2023 ) Translation-coupled mRNA quality control mechanisms . EMBO J , e114378 32. ↵ Hodgkin , J. , Papp , A. , Pulak , R. , Ambros , V. , and Anderson , P . ( 1989 ) A new kind of informational suppression in the nematode Caenorhabditis elegans . Genetics 123 , 301 – 313 OpenUrl Abstract / FREE Full Text 33. ↵ Pulak , R. , and Anderson , P . ( 1993 ) mRNA surveillance by the Caenorhabditis elegans smg genes . Genes Dev 7 , 1885 – 1897 OpenUrl Abstract / FREE Full Text 34. ↵ Johns , L. , Grimson , A. , Kuchma , S. L. , Newman , C. L. , and Anderson , P . ( 2007 ) Caenorhabditis elegans SMG-2 selectively marks mRNAs containing premature translation termination codons . Mol Cell Biol 27 , 5630 – 5638 OpenUrl Abstract / FREE Full Text 35. Grimson , A. , O’Connor , S. , Newman , C. L. , and Anderson , P . ( 2004 ) SMG-1 is a phosphatidylinositol kinase-related protein kinase required for nonsense-mediated mRNA Decay in Caenorhabditis elegans . Mol Cell Biol 24 , 7483 – 7490 OpenUrl Abstract / FREE Full Text 36. ↵ Page , M. F. , Carr , B. , Anders , K. R. , Grimson , A. , and Anderson , P . ( 1999 ) SMG-2 is a phosphorylated protein required for mRNA surveillance in Caenorhabditis elegans and related to Upf1p of yeast . Mol Cell Biol 19 , 5943 – 5951 OpenUrl Abstract / FREE Full Text 37. ↵ Casadio , A. , Longman , D. , Hug , N. , Delavaine , L. , Vallejos Baier , R. , Alonso , C. R. , and Caceres , J. F . ( 2015 ) Identification and characterization of novel factors that act in the nonsense-mediated mRNA decay pathway in nematodes, flies and mammals . EMBO Rep 16 , 71 – 78 OpenUrl Abstract / FREE Full Text 38. ↵ Chang , Y. F. , Imam , J. S. , and Wilkinson , M. F . ( 2007 ) The nonsense-mediated decay RNA surveillance pathway . Annu Rev Biochem 76 , 51 – 74 OpenUrl CrossRef PubMed Web of Science 39. ↵ Fong , S. , Teo , E. , Ng , L. F. , Chen , C. B. , Lakshmanan , L. N. , Tsoi , S. Y. , Moore , P. K. , Inoue , T. , Halliwell , B. , and Gruber , J . ( 2016 ) Energy crisis precedes global metabolic failure in a novel Caenorhabditis elegans Alzheimer Disease model . Sci Rep 6 , 33781 OpenUrl CrossRef PubMed 40. ↵ Doitsidou , M. , Poole , R. J. , Sarin , S. , Bigelow , H. , and Hobert , O . ( 2010 ) C. elegans mutant identification with a one-step whole-genome-sequencing and SNP mapping strategy . PLoS One 5 , e15435 OpenUrl CrossRef PubMed 41. ↵ Hodgkin , J. , Horvitz , H. R. , and Brenner , S . ( 1979 ) Nondisjunction Mutants of the Nematode CAENORHABDITIS ELEGANS . Genetics 91 , 67 – 94 OpenUrl Abstract / FREE Full Text 42. ↵ Garcia-Rodriguez , F. J. , Martinez-Fernandez , C. , Brena , D. , Kukhtar , D. , Serrat , X. , Nadal , E. , Boxem , M. , Honnen , S. , Miranda-Vizuete , A. , Villanueva , A. , and Ceron , J . ( 2018 ) Genetic and cellular sensitivity of Caenorhabditis elegans to the chemotherapeutic agent cisplatin . Dis Model Mech 11 43. ↵ Zhong , L. , Arner , E. S. , Ljung , J. , Aslund , F. , and Holmgren , A . ( 1998 ) Rat and calf thioredoxin reductase are homologous to glutathione reductase with a carboxyl-terminal elongation containing a conserved catalytically active penultimate selenocysteine residue . J Biol Chem 273 , 8581 – 8591 OpenUrl Abstract / FREE Full Text 44. ↵ Ko , F. C. , and Chow , K. L . ( 2002 ) A novel thioredoxin-like protein encoded by the C. elegans dpy-11 gene is required for body and sensory organ morphogenesis . Development 129 , 1185 – 1194 OpenUrl Abstract / FREE Full Text 45. ↵ Matsuo , Y. , and Hirota , K . ( 2017 ) Transmembrane thioredoxin-related protein TMX1 is reversibly oxidized in response to protein accumulation in the endoplasmic reticulum . FEBS Open Bio 7 , 1768 – 1777 OpenUrl CrossRef PubMed 46. ↵ Chiu , H. , Schwartz , H. T. , Antoshechkin , I. , and Sternberg , P. W . ( 2013 ) Transgene-free genome editing in Caenorhabditis elegans using CRISPR-Cas . Genetics 195 , 1167 – 1171 OpenUrl Abstract / FREE Full Text 47. ↵ Gromer , S. , Merkle , H. , Schirmer , R. H. , and Becker , K . ( 2002 ) Human placenta thioredoxin reductase: preparation and inhibitor studies . Methods Enzymol 347 , 382 – 394 OpenUrl CrossRef PubMed Web of Science 48. ↵ Andor , A. , Mohanraj , M. , Pato , Z. A. , Uri , K. , Biri-Kovacs , B. , Cheng , Q. , and Arner , E. S. J . ( 2023 ) TXNL1 has dual functions as a redox active thioredoxin-like protein as well as an ATP- and redox-independent chaperone . Redox Biol 67 , 102897 OpenUrl CrossRef PubMed 49. ↵ Johnston , A. D. , and Ebert , P. R . ( 2012 ) The Redox System in C. elegans, a Phylogenetic Approach . J Toxicol 2012 , 546915 OpenUrl PubMed 50. ↵ Guerrero-Gomez , D. , Mora-Lorca , J. A. , Saenz-Narciso , B. , Naranjo-Galindo , F. J. , Munoz-Lobato , F. , Parrado-Fernandez , C. , Goikolea , J. , Cedazo-Minguez , A. , Link , C. D. , Neri , C. , Sequedo , M. D. , Vazquez-Manrique , R. P. , Fernandez-Suarez , E. , Goder , V. , Pane , R. , Cabiscol , E. , Askjaer , P. , Cabello , J. , and Miranda-Vizuete , A . ( 2019 ) Loss of glutathione redox homeostasis impairs proteostasis by inhibiting autophagy-dependent protein degradation . Cell Death Differ 26 , 1545 – 1565 OpenUrl CrossRef PubMed 51. ↵ Poole , L. B . ( 2015 ) The basics of thiols and cysteines in redox biology and chemistry . Free Radic Biol Med 80 , 148 – 157 OpenUrl CrossRef PubMed 52. ↵ Kamerbeek , N. M. , van Zwieten , R. , de Boer , M. , Morren , G. , Vuil , H. , Bannink , N. , Lincke , C. , Dolman , K. M. , Becker , K. , Schirmer , R. H. , Gromer , S. , and Roos , D. ( 2007 ) Molecular basis of glutathione reductase deficiency in human blood cells . Blood 109 , 3560 – 3566 OpenUrl Abstract / FREE Full Text 53. ↵ Loos , H. , Roos , D. , Weening , R. , and Houwerzijl , J . ( 1976 ) Familial deficiency of glutathione reductase in human blood cells . Blood 48 , 53 – 62 OpenUrl Abstract / FREE Full Text 54. ↵ Kim , V. Y. , Batty , A. , Li , J. , Kirk , S. G. , Crowell , S. A. , Jin , Y. , Tang , J. , Zhang , J. , Rogers , L. K. , Deng , H. X. , Nelin , L. D. , and Liu , Y . ( 2019 ) Glutathione Reductase Promotes Fungal Clearance and Suppresses Inflammation during Systemic Candida albicans Infection in Mice . J Immunol 203 , 2239 – 2251 OpenUrl Abstract / FREE Full Text 55. ↵ Yan , J. , Ralston , M. M. , Meng , X. , Bongiovanni , K. D. , Jones , A. L. , Benndorf , R. , Nelin , L. D. , Joshua Frazier , W. , Rogers , L. K. , Smith , C. V. , and Liu , Y . ( 2013 ) Glutathione reductase is essential for host defense against bacterial infection . Free Radic Biol Med 61 , 320 – 332 OpenUrl CrossRef PubMed 56. ↵ Jakupoglu , C. , Przemeck , G. K. , Schneider , M. , Moreno , S. G. , Mayr , N. , Hatzopoulos , A. K. , de Angelis , M. H. , Wurst , W. , Bornkamm , G. W. , Brielmeier , M. , and Conrad , M. ( 2005 ) Cytoplasmic thioredoxin reductase is essential for embryogenesis but dispensable for cardiac development . Mol Cell Biol 25 , 1980 – 1988 OpenUrl Abstract / FREE Full Text 57. ↵ Matsui , M. , Oshima , M. , Oshima , H. , Takaku , K. , Maruyama , T. , Yodoi , J. , and Taketo , M. M . ( 1996 ) Early embryonic lethality caused by targeted disruption of the mouse thioredoxin gene . Dev Biol 178 , 179 – 185 OpenUrl CrossRef PubMed Web of Science 58. ↵ Kanzok , S. M. , Fechner , A. , Bauer , H. , Ulschmid , J. K. , Muller , H. M. , Botella-Munoz , J. , Schneuwly , S. , Schirmer , R. , and Becker , K . ( 2001 ) Substitution of the thioredoxin system for glutathione reductase in Drosophila melanogaster . Science 291 , 643 – 646 OpenUrl Abstract / FREE Full Text 59. ↵ Hutter , H. , and Suh , J . ( 2016 ) GExplore 1.4: An expanded web interface for queries on Caenorhabditis elegans protein and gene function . Worm 5 , e1234659 OpenUrl CrossRef PubMed 60. ↵ Eklow , L. , Moldeus , P. , and Orrenius , S . ( 1984 ) Oxidation of glutathione during hydroperoxide metabolism. A study using isolated hepatocytes and the glutathione reductase inhibitor 1,3-bis(2-chloroethyl)-1-nitrosourea . Eur J Biochem 138 , 459 – 463 OpenUrl PubMed Web of Science 61. ↵ Vozdek , R. , Hnizda , A. , Krijt , J. , Kostrouchova , M. , and Kozich , V . ( 2012 ) Novel structural arrangement of nematode cystathionine beta-synthases: characterization of Caenorhabditis elegans CBS-1 . Biochem J 443 , 535 – 547 OpenUrl Abstract / FREE Full Text 62. ↵ Watanabe , M. , Osada , J. , Aratani , Y. , Kluckman , K. , Reddick , R. , Malinow , M. R. , and Maeda , N . ( 1995 ) Mice deficient in cystathionine beta-synthase: animal models for mild and severe homocyst(e)inemia . Proc Natl Acad Sci U S A 92 , 1585 – 1589 OpenUrl Abstract / FREE Full Text 63. ↵ Santonicola , P. , Germoglio , M. , d’Abbusco , D. S. , and Adamo , A. ( 2020 ) Functional characterization of Caenorhabditis elegans cbs-2 gene during meiosis . Sci Rep 10 , 20913 OpenUrl CrossRef PubMed 64. ↵ Warnhoff , K. , and Ruvkun , G . ( 2019 ) Molybdenum cofactor transfer from bacteria to nematode mediates sulfite detoxification . Nat Chem Biol 15 , 480 – 488 OpenUrl CrossRef PubMed 65. ↵ Statzer , C. , Meng , J. , Venz , R. , Bland , M. , Robida-Stubbs , S. , Patel , K. , Petrovic , D. , Emsley , R. , Liu , P. , Morantte , I. , Haynes , C. , Mair , W. B. , Longchamp , A. , Filipovic , M. R. , Blackwell , T. K. , and Ewald , C. Y . ( 2022 ) ATF-4 and hydrogen sulfide signalling mediate longevity in response to inhibition of translation or mTORC1 . Nat Commun 13 , 967 OpenUrl CrossRef PubMed 66. ↵ Stiernagle , T . ( 2006 ) Maintenance of C. elegans . WormBook , 1 – 11 67. ↵ Davis , M. W. , Hammarlund , M. , Harrach , T. , Hullett , P. , Olsen , S. , and Jorgensen , E. M . ( 2005 ) Rapid single nucleotide polymorphism mapping in C. elegans . BMC Genomics 6 , 118 OpenUrl CrossRef PubMed 68. ↵ Minevich , G. , Park , D. S. , Blankenberg , D. , Poole , R. J. , and Hobert , O . ( 2012 ) CloudMap: a cloud-based pipeline for analysis of mutant genome sequences . Genetics 192 , 1249 – 1269 OpenUrl Abstract / FREE Full Text 69. ↵ Cheng , Q. , and Arner , E. S . ( 2017 ) Selenocysteine Insertion at a Predefined UAG Codon in a Release Factor 1 (RF1)-depleted Escherichia coli Host Strain Bypasses Species Barriers in Recombinant Selenoprotein Translation . J Biol Chem 292 , 5476 – 5487 OpenUrl Abstract / FREE Full Text 70. ↵ Lajoie , M. J. , Rovner , A. J. , Goodman , D. B. , Aerni , H. R. , Haimovich , A. D. , Kuznetsov , G. , Mercer , J. A. , Wang , H. H. , Carr , P. A. , Mosberg , J. A. , Rohland , N. , Schultz , P. G. , Jacobson , J. M. , Rinehart , J. , Church , G. M. , and Isaacs , F. J . ( 2013 ) Genomically recoded organisms expand biological functions . Science 342 , 357 – 360 OpenUrl Abstract / FREE Full Text 71. ↵ Cheng , Q. , and Arner , E. S. J . ( 2022 ) Expressing recombinant selenoproteins using redefinition of a single UAG codon in an RF1-depleted E. coli host strain . Methods Enzymol 662 , 95 – 118 OpenUrl CrossRef PubMed 72. ↵ Arner , E. S. , and Holmgren , A . ( 2001 ) Measurement of thioredoxin and thioredoxin reductase . Curr Protoc Toxicol Chapter 7 , Unit 7 4 View the discussion thread. Back to top Previous Next Posted January 13, 2025. Download PDF Supplementary Material Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following The transsulfuration pathway suppresses the embryonic lethal phenotype of glutathione reductase mutants in Caenorhabditis elegans Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share The transsulfuration pathway suppresses the embryonic lethal phenotype of glutathione reductase mutants in Caenorhabditis elegans Marina Valenzuela-Villatoro , David Guerrero-Gómez , Eva Gómez-Orte , Qing Cheng , Angelina Zheleva , José Antonio Mora-Lorca , Dunja Petrovic , Nigel J. O’Neil , Julián Cerón , Akiko Hatakeyama , Shuichi Onami , Milos Filipovic , Elias S.J. Arnér , Juan Cabello , Antonio Miranda-Vizuete bioRxiv 2025.01.09.632117; doi: https://doi.org/10.1101/2025.01.09.632117 Share This Article: Copy Citation Tools The transsulfuration pathway suppresses the embryonic lethal phenotype of glutathione reductase mutants in Caenorhabditis elegans Marina Valenzuela-Villatoro , David Guerrero-Gómez , Eva Gómez-Orte , Qing Cheng , Angelina Zheleva , José Antonio Mora-Lorca , Dunja Petrovic , Nigel J. O’Neil , Julián Cerón , Akiko Hatakeyama , Shuichi Onami , Milos Filipovic , Elias S.J. Arnér , Juan Cabello , Antonio Miranda-Vizuete bioRxiv 2025.01.09.632117; doi: https://doi.org/10.1101/2025.01.09.632117 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Genetics Subject Areas All Articles Animal Behavior and Cognition (7622) Biochemistry (17650) Bioengineering (13871) Bioinformatics (41881) Biophysics (21424) Cancer Biology (18566) Cell Biology (25461) Clinical Trials (138) Developmental Biology (13365) Ecology (19866) Epidemiology (2067) Evolutionary Biology (24290) Genetics (15590) Genomics (22476) Immunology (17713) Microbiology (40331) Molecular Biology (17148) Neuroscience (88473) Paleontology (666) Pathology (2827) Pharmacology and Toxicology (4816) Physiology (7635) Plant Biology (15114) Scientific Communication and Education (2044) Synthetic Biology (4286) Systems Biology (9815) Zoology (2268)