Cyclophosphamide: Potential Hepatorenal Toxicity and the Possible Therapeutic Role of Mesenchymal Stem Cell-Derived Exosomes in Wistar Rats

Cyclophosphamide: Potential Hepatorenal Toxicity and the Possible Therapeutic Role of Mesenchymal Stem Cell-Derived Exosomes in Wistar Rats | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Cyclophosphamide: Potential Hepatorenal Toxicity and the Possible Therapeutic Role of Mesenchymal Stem Cell-Derived Exosomes in Wistar Rats Ahmed Nour Eldine Abdallah, Heba Effat, Ahmed M. Mousbah, Hanaa H. Ahmed, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4409545/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background: Cyclophosphamide (CTX) is an alkylating agent widely described in management of several non-neoplastic and neoplastic disorders. The most observed adverse consequence of CTX is organ damage. Exosomes derived from mesenchymal stem cells (MSCs-Exos) have been shown to exhibit therapeutic effects in various tissue-injury models. Aim: The aim of this work was to examine impact of AD-MSCs-Exos in a rat model of hepatorenal toxicity. Methods: 32 rats were grouped into 4 groups (n=8): Control group: rats received intraperitoneally (i.p.) PBS (phosphate buffered saline), CTX group: rats injected i.p. with a single dose of CTX (50 mg/kg) followed by rotating doses of 8 mg/kg of CTX daily for 2 weeks, CTX+AD-MSCs group: rats infused with (1×10 6 AD-MSCs cells/rat) dissolved in PBS intravenously (i.v.) day after day for one week starting from second day of CTX last dose, and CTX+AD-MSCs-Exos group: rats injected with 100 μg of Exos derived from AD-MSCs in 1 ml PBS by i.v. injection for one week starting from second day of CTX last dose. 5 weeks following initial CTX dose, blood, liver, and kidneys were extracted. Serum ALT, AST, creatinine and urea levels; hepatic malate dehydrogenase (MDH) and glutamate dehydrogenase (GLDH); renal kidney injury molecule-1 (KIM-1) and clusterin were measured. The inflammatory molecule (TNF-α) and malonialdehyde (MDA); lipid peroxidation one were estimated in hepatic and renal tissues. Furthermore, NF-κB/TLR-4, Nrf-2/HO-1 and Bax/Bcl-2 signaling pathways were analyzed by qRT-PCR. Immunohistochemical staining for cyclooxygenase-2 "COX-2" and inducible nitric oxide synthase "iNOS" were also performed in hepatic and renal tissues. Finally, histopathological investigation of both liver and kidney tissue was carried out. Results: treatment with AD-MSCs-Exos improved liver and kidney functions, diminished oxidative stress (MDA) and enhanced antioxidative Nrf-2/HO-1 pathway; inhibited inflammatory response (TNF-α) and NF-κB/TLR-4 pathway; and downregulated apoptotic Bax/Bcl-2 signaling pathway compared to CTX and CTX+AD-MSCs treated groups. Also, immunological and histopathological investigation verified curative effect of AD-MSCs-Exos against CTX-induced hepatorenal toxicity. Conclusion: these findings uncovered therapeutic impact of AD-MSCs-Exos against hepatorenal insult from holistic perspective. The mechanisms behind this action included restoration of oxidant/antioxidant equilibrium, inhibition of inflammatory reaction and suppression of apoptotic machinery. Cyclophosphamide Mesenchymal stem cells Exosomes Inflammation Oxidative stress Apoptosis Rats Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Figure 11 Figure 12 BACKGROUND Cyclophosphamide (CTX) is one among the anticancer medications most commonly used to treat hematological malignancies and various solid tumors ( Hu et al., 2022 ). CTX-induced nephrotoxicity is a typical limiting issue for its application, despite its widespread clinical use as antineoplastic medication ( Iqubal et al., 2023 ). The kidney is the body's primary excretory organ and a vital organ that controls both extracellular and intracellular physiological processes ( Ayza et al., 2022 ). Its checkpoint function makes it one of the primary organs targeted by drug toxicity ( Salama et al., 2022 ). Hepatotoxicity of CTX is also reported by Refaie et al. ( 2022 ) because it is a prodrug and so undergoes hepatic metabolism. CYP34A acts on CTX in the liver, converting it to phosphoramide mustard and acrolein ( Barnett et al., 2021 ). Several investigations have shown that acrolein, which produces reactive oxygen species (ROS) and compromises cellular antioxidant defenses, is the cause of the severe toxicity of CTX ( El-kashef, 2018 ) . This results in oxidative stress and damages cellular macromolecules like proteins, lipids, and nucleic acids through oxidative damage ( Mahmoud et al., 2017 ). Furthermore, the oxidative stress brought on by CTX treatment also induces inflammation through the regulation of the Nrf2, NlRP3, NF-κB, and p38 MAPK pathways ( Lin et al., 2020 ). Additionally, the treatment induces apoptosis by raising cleaved caspase-3 and other pro-apoptotic protein levels, accelerating cytochrome c activity, and impairing mitochondria ( Zhang et al., 2021 ). Numerous approaches are used to combat the side effects of CTX, including the use of the antioxidant Mesna, alternative CTX analogs, and low-dose of CTX combined with other anticancer medications ( Casak et al., 2011 ). However, these approaches are ineffective and are not suitable for a variety of applications ( Basu et al., 2014 ). Thus, the search for an appropriate and potent chemoprotective drug that might lessen the harmful effects of CTX is urgently needed ( Patwa et al., 2020 ). As a regenerative medicine technique, stem cell-based therapy has attracted a lot of interest since it provides patients with previously incurable illnesses with new alternatives ( Hoang et al., 2022 ). Because of their capacity for proliferation, differentiation, and immunomodulation, mesenchymal stem cells (MSCs) are frequently employed in regenerative medicine. MSC infusion may aid in the reduction and recovery of drug-induced toxicities, as evidenced by the recent finding of MSCs' therapeutic advantages in situations of liver disorders ( Awadalla et al., 2023 ). Furthermore, previous studies have demonstrated that MSCs can prevent renal interstitial fibrosis and protect renal tubular epithelial cells from injury ( He et al., 2020 ). Nevertheless, there are disadvantages to clinical use of cell-based MSC treatment. These comprise: 1) the challenge of preserving an adequate supply of cells with a stable phenotype (Musial-Wysocka et al., 2019) ; and 2) the risk of pulmonary microvasculature entrapment following intravenous delivery of a large number of cells ( Mäkelä et al., 2015 ). Moreover, they have a risk of tumor formation ( Barkholt et al., 2013 ). Alternative MSC-based products are also required, preferably with minimal side effects and therapeutic potential. Exosomes are nanoscale, spherical, and lipid bi-layered single membrane extracellular vesicles, which act as intercellular messengers. They have been regarded as miniature versions of their parental cells, partially because exosomes from a certain cell type provide cell-specific or unique sets of biomolecules ( Vizoso et al., 2017 ) . These biomaterials are intelligent and controlled, exhibiting enormous potential in cell-free tissue regeneration and capable of engaging in a range of physiological and pathological activities, including tissue repair and regeneration through the transmission of various biological signals ( Wang and Pan, 2023 ) . Exosomes generated from stem cells carry over similar medicinal properties from their parent cells, such as tissue regeneration, immunomodulation, and anti-inflammation ( Ren, 2019 ) . Stem cell-derived exosomes have many advantages over stem cells, including non-immunogenicity, non-infusion toxicity, ease of access, simple preservation, lack of tumorigenic potential, and lack of ethical concerns ( Tan et al., 2024 ). Exosomes incorporate within recipient cells by micropinocytosis and phagocytosis after interacting with them through their surface receptor molecules and ligand. Because MSCs have remarkable regeneration potential for treating diseases, advances in regenerative medicine have made it easier for researchers to separate exosomes from these cells (Mut hu et al., 2021 ). Exosomes generated from MSCs (MSC-Exos) replicate the functions of their parent MSCs by delivering different genetic and protein cargos to target cells ( Cao et al., 2022 ). According to recent research, MSCs-Exos may be able to treat both acute and chronic liver disorders ( Wang et al., 2022 ). They stimulated quiescent hepatocytes to reenter the cell cycle and enhanced the production of PCNA and hepatocyte regeneration genes, ultimately aiding in hepatocyte proliferation ( Nong et al., 2016 ). According to recent data, MSCs-Exos also boost hepatocyte function, limit hepatocyte death, encourage angiogenesis and hepatocyte proliferation, and lessen inflammatory responses by obstructing inflammatory cytokine production and immune cell infiltration ( Psaraki et al., 2022 ). Furthermore, MSCs-Exos have become an effective therapy for chronic kidney disorders ( Cao et al., 2022 ). In an AKI model of renal ischemia-reperfusion injury, MSC-Exos promoted both the mitochondrial function of tubular epithelial cells and the recovery of kidney function via the Keap1-Nrf2 signaling pathway ( Cao et al., 2020 ). In an AKI model brought on by toxins, they can also lessen the occurrence of tubular hyaline casts and tubular cell necrosis ( Zhou et al., 2013 ). The purpose of this study was to evaluate the potential therapeutic benefit of Exos produced from AD-MSCs in comparison to AD-MSCs against CTX-induced hepatorenal toxicity in a rat model. The study was further expanded to investigate the mechanisms of action and associated signal pathways in an attempt to establish an experimental basis for the development of a cell-free treatment strategy for the management of hepatorenal toxicity caused by anti-cancer medications. MATERIAL AND METHODS Chemicals and kits Dulbecco’s Modified Eagle’s Medium (DMEM), fetal bovine serum (FBS), 0.25% trypsin/ EDTA, antibiotic including streptomycin and penicillin, phosphate-buffered saline (PBS), 0.075% collagenase digestion solution, Roswell Park Memorial Institute (RPMI) medium, bovine serum albumin (BSA) and serum-free medium 199 containing HEPES 25mM were purchased from Sigma-Aldrich, USA. Cyclophosphamide (CTX, Endoxan®) 1g vial was obtained from Baxter Oncology GmbH, Germany. All other unspecified chemicals used in this study were of analytical grade and were not further purified. Colorimetric kits for measurement of urea, creatinine, ALT, AST, and MDA were acquired from Biodiagnostic Co., Egypt. The enzyme-linked immunosorbent assay (ELISA) kits for the detection of KIM-1, MDH, and GLDH were purchased from MyBioSource, USA. TNF-α kit was obtained from Cloud-Clone, USA. Clusterin was supplied from LSBio, USA. Isolation and propagation of adipose tissue-derived MSCs (AD-MSCs) Adipose tissue around epididymis of adult male Wistar rats was utilized in this study. Next, to avoid tissue dehydration, 200–300 µl of sterile saline were added for every 0.5 g of adipose tissue. With a pair of sterilized, sharp scissors, the tissue was sliced into pieces smaller than one millimeter. Adipose tissue was mixed with sterilized saline at a ratio of 3:1 (saline: adipose tissue), followed by the addition of collagenase solution to a final concentration of 0.5 units/ ml. The falcon tubes with their contents were set on a shaker (60 ± 15 min). The tubes were then centrifuged for five minutes at room temperature at 600 x g. Gently drain off the supernatant and lipid layer from the tube. The cell pellet was extracted, reconstituted in 40 ml of PBS, and centrifuged again at 600 x g for five minutes at room temperature. After being resuspended again in 5 ml PBS, the cell suspension was filtered through a 100-mm filter into a 50-ml falcon tube to which 2 ml of PBS was added to rinse the remaining cells through the filter. The flow-through was pipetted into a new falcon tube through a 40-mm filter. The tubes were centrifuged for the third time at 600×g for 5 min at room temperature, and the cells were resuspended in PBS. After that, an aliquot of the cell suspension was taken out for cell culture in DMEM media with 20% FBS. The medium was changed every 3 days thereafter. After about 7 days, cells reached subconfluence and was detached with trypsin/EDTA, reseeded at 4 × 10 3 cells/cm 2 , and used for infusion after the third passage ( Chen et al., 2011 ). Characterization of AD-MSCs Morphological identification Using inverted microscopy, the morphology of the cells in cultures was investigated. MSCs in culture were identified by their adhesiveness to the tissue culture flask and fusiform shape. Flow cytometry identification: The surface profile of the cultivated MSCs was examined by flow cytometric analysis (CD90, CD105, and CD34). Cells were then washed and resuspended in PBS provided with 3% FBS containing saturating concentrations (1: 100) dilution of the following fluorescein isothiocyanate-conjugated monoclonal antibodies: anti-CD90 (+ ve marker), anti-CD105 (+ ve marker) and anti-CD34 (-ve marker) (BD Pharmingen). Next, forward scatter analysis (Becton-Dickinson, Canada) was used to investigate the samples ( Ghaneialvar et al., 2018 ). Exosomes isolation The supernatants of the fourth passage of AD-MSCs (5x10 6 cells/ml) were used to extract exosomes, which were then cultivated in RPMI medium devoid of FBS and supplemented with 0.5% BSA. Following centrifugation for 20 minutes at 2000xg to eliminate debris, Using a Beckman Coulter Optima L 90K ultracentrifuge, cell-free supernatants were centrifuged for one hour at 4°C at 100,000xg, cleaned in serum-free medium 199 containing 25 mM HEPES and then subjected to another ultracentrifugation in the same settings. The Bradford technique (BioRad, Hercules, Canada) was used to quantify the protein content. Following an overnight stay in the medium used to collect them, the pellet was frozen at -80°C ( El-Tookhy et al., 2017 ). Characterization of exosomes Exosomes morphology Utilizing transmission electron microscopy (TEM), the morphological appearance of exosomes was obtained. They were put on copper grids and then stained with phosphotungstic acid and examined. Images were obtained by a secondary electron at a working distance of 15 to 25 mm and an accelerating voltage of 20 and 30 KV. With the Jeol T300 system, digital acquisition and analysis were carried out. Exosome protein content Following the manufacturer's instructions, the total protein content of the exosomes was determined using the BCA protein assay kit (Novagen). After isolating the exosome, it was diluted in PBS at a ratio of 1:10 (by ten times), mixed with the BCA reagent, and incubated for fifteen minutes at 60°C, after which, using a NanoDropTM spectrophotometer (ND-1000, Thermo Fisher Scientific, USA), record the corresponding absorbance at 562 nm. The standard curve was drawn by performing the same procedure for different concentrations (50–250 µg/ml) of BSA ( Szatanek et al., 2017 ). Animals Our methods has been reported in line with the ARRIVE guidelines 2.0 and the checklist is available Animals caring Thirty-two adult male Wistar rats, weighing between 190 and 220 g and averaging 4–5 months of age, were used in this study. From the Holding Company for Biological Products & Vaccines (Vacsera), Helwan, Egypt, they were acquired. Animals were housed under constant humidity (55 ± 5%) and temperature (23 ± 2°C), with 12-h alternating light and dark cycles with unlimited access to rodent food and water. Before the experiment started, the animals were kept under observation for two weeks to allow them to become acclimated. The experimental protocol was conducted in compliance with the approval of the Scientific Research Ethics Committee, Suez Canal University, Egypt (No. SCU 2023075). Animals grouping The rats were randomized into 4 groups, each with 8 rats, after the acclimatization period: Group (1) : Control, healthy rats served as control, and received PBS intraperitonealy (i.p.). Group (2) : CTX, rats were injected i.p. with a single dose of CTX (50 mg/kg) dissolved in PBS followed by rotating doses of 8 mg/kg of CTX daily for two weeks ( Neosar, 2013 ) . Group (3) : CTX + AD-MSCs, rats were infused i.v. with 1×10 6 cells/rat dissolved in PBS day after day for one week starting from the second day of the CTX last dose ( Abbasy et al., 2010 ), and Group (4) : CTX + AD-MSCs- Exo, rats were injected i.v. with 100 µg of exosomes derived from AD-MSCs dissolved in 1 ml PBS day after day for one week starting from the second day of the CTX last dose ( Guo et al., 2021 ). Preparation of blood samples At finishing the experiment, rats were fasted overnight and blood samples were taken from the tail vein. The blood was then centrifuged for 15 minutes at 4°C and 3000 rpm to obtain sera. Serum samples were cryopreserved at -20°C until future assays were conducted (Urea, creatinine, ALT, and AST) according to the protocols provided with the assay kits. Dissection and tissue preparation Following the collection of blood samples, the animals were euthanized by cervical dislocation, and samples of their liver and kidney were quickly and carefully removed. They were then immediately cleaned in ice-cold PBS (pH 7.4). Every kidney and liver was separated into three portions; the first portion was weighed and homogenized in ice-cold PBS (pH 7.4) and the resulting homogenates (10% w/v) were centrifuged for 15 min at 4°C at 3000 rpm to get the supernatants, which were separated, aliquoted and stored at -20°C pending biochemical analysis (KIM-1, clusterin, MDH, GLDH, MDA and TNF-α) according to the manufacturer's manuals. The second portion was immediately frozen in liquid nitrogen and preserved at − 80°C prior to RNA extraction for molecular genetic analysis. For histological and immunohistochemical procedures, the third portion was fixed in formalin saline (10%). Gene expression analyses Total RNA was extracted from liver and kidney tissues by using the RNeasy Mini Kit from Qiagen (Germany). One µg of total RNA was reverse transcribed using QuantiTect Reverse Transcription kit (Qiagen, Germany). The RNA integrity was evaluated using Nano Drop 2000 (Thermo Fisher Scientifc, USA) using 260/280 nm ratio. Then, the cDNA synthesis was performed using Revert Aid first-strand cDNA synthesis kit (Thermo Fisher Scientifc, USA) according to the manufacturer’s instruction. qPCR was carried out in accordance with the manufacturer's manual using the Quantinova SYBR Green PCR kit (Qiagen, Germany). Specific primers for NF-κB /TLR-4 /Nrf-2 /HO-1 /Bax/ Bcl-2 and GAPDH were used for qPCR. The primer sequences of each target gene are delineated in Table 1 . The PCR cycling was set as follows: initial denaturation step at 94°C for 15 min, followed by 40 cycles of denaturation at 94°C for 15 s, annealing at 60°C for 30 s, and extension at 72°C for 30 s for 5 min. The main equations used were: ∆Ct = Ct (gene of interest) – Ct (housekeeping gene) followed by ∆∆Ct = ∆Ct (treated sample) – ∆Ct (untreated sample). The overall formula was 2 –∆∆C to calculate the relative fold of change. Table 1 Primers sequence of the target genes for the real-time quantitative reverse transcription-polymerase (RT-qPCR) Gene name Forward primer Reverse primer NF-κB ( Younis et al. 2021 ) CTGCGATACCTTAATGACAGCG AATTTGGCTTCCTTTCTTGGCT TLR-4 ( Younis et al. 2021 ) AGACATCCAAAGGAATACTGCAA GCCTTCATGTCTATAGGTGATGC Nrf-2 ( El-Agamy et al., 2018 ) TTTGTAGATGACCATGAGTCGC TGTCCTGCTGTATGCTGCTT HO-1 ( El-Agamy et al., 2018 ) TCTGCAGGGGAGAATCTTGC TTGGTGAGGGAAATGTGCCA Bax ( Awadalla et al., 2023 ) GGCGATGAACTGGACAACAA CAAAGTAGAAAAGGGCAACC Bcl-2 ( Awadalla et al., 2023 ) GGTGAACTGGGGGAGGATTG GCATGCTGGGGCCATATAGT GAPDH ( Awadalla et al., 2023 ) AGACAGCCGCATCTTCTTGT TTCCCATTCTCAGCCTTGAC Histopathological procedure of liver and kidney tissues The liver and kidney tissues were fixed for 24 hours in 10% neutral formalin saline. The tissues were then rinsed with tap water and dehydrated using various grades of ethyl alcohol. After that, the specimens were cleaned in xylene and embedded in paraffin bee wax for a whole day at 56°C in a hot air oven. The paraffin bee wax tissue blocks were divided into 4 micron-thick segments using a rotary microtome. Hematoxylin and eosin staining was used following standard de-waxing and hydration, and to identify the histological alterations in the liver and kidney tissues, an optical microscope was employed (Bancroft et al., 1996) . Immunohistochemical Assay The other paraffin sections of liver and kidney from each group were mounted on positively charged slides by using avidinbiotin- peroxidase complex (ABC) method for detection of the expression of COX-2 and iNOS. Rat COX-2 polyclonal Antibody (ABclonal, USA, Dil.: 1:100) and rat iNOS polyclonal Antibody (ABclonal, USA, Dil.: 1:100). Sections from each group were incubated with these antibodies; then the reagents required for ABC method were added (Vectastain ABC-HRP kit, Vector laboratories). Each marker expression was labeled with peroxidase and colored with diaminobenzidine (DAB, produced by Sigma) to detect antigen-antibody complex. Negative controls were included using non-immune serum in place of the primary or secondary antibodies. IHC stained sections were examined via using Olympus microscope (BX-53). Statistical Analysis All the results were presented as mean ± standard deviation. Moreover, mean comparisons and analysis of variance (ANOVA) were applied, P < 0.05 was considered significant. All statistics were calculated using SPSS software (Chicago, Illinois, USA, V.20) for computer program. RESULTS Characterization of AD-MSCs Morphological characterization Seven days from the primary culture, the MSCs of cultured flasks proliferated, exhibited different shapes with well-developed cytoplasmic processes, granular cytoplasms, and vesicular nuclei. Twelve days from the primary culture, the adherent cells reached 70–90% confluency and appeared triangular, star-shaped, and spindle-shaped ( Fig. 1 ) . Flow cytometric surface marker expression analysis for characterization of isolated AD-MSCs The identity of the isolated AD-MSCs was confirmed as mesenchymal stem cells using flow cytometric analysis. The isolated cells exhibited positive expression of specific mesenchymal stem cells markers, namely CD90 (94.20%) and CD105 (99.80%), while the expression of the hematopoietic marker CD34 (6.43%) was negative (Fig. 2 ). Characterization of Exosomes Morphological characterization Transmission electron microscopy (TEM) images for the isolated exosomes revealed the presence of macrovesicles that have the characteristic and morphology of exosomes, with their expected structures and with a diameter range of 28.38–58.77 nm on a 200 nm scale as seen in Fig. 3 . Quantification of protein content of AD- MSCs derived exosomes The protein concentration of AD-MSCs-Exos using BCA-Kit showed that the protein concentration of the isolated Exos was 200 ± 20 ug/ml. AD-MSCs-Exo recovered liver functions after CTX- induced hepatorenal toxicity in rats As showed in Table 2 , CTX group exhibited significant rise ( P < 0.05) in serum levels of ALT and AST activities; MDH and GLDH levels in hepatic tissues in contrast to the control group. On the opposite side, CTX + AD-MSCs group and CTX + AD-MSCs-Exo group brought about significant reduction ( P < 0.05) in their values relative to CTX group. It is worthy to emphasize that the reduction of ALT, AST and GLDH values were more significant ( P < 0.05) in CTX + AD-MSCs-Exo group than CTX + AD-MSCs group. Table 2 Effect of AD-MSCs-Exo treatment on the values of ALT, AST, MDH, and GLDH after CTX- induced hepatorenal toxicity in rats Control CTX CTX + AD-MSCs CTX + AD-MSCs -Exo ALT (U/L) 41.00 ± 1.41 155.00 ± 5.90 a 91.00 ± 1.41 b 67.50 ± 3.53 cd AST (U/L) 43.50 ± 2.12 164.50 ± 7.77 a 92.50 ± 3.53 b 63.00 ± 4.24 cd MDH (Pg/mg protein) 3.15 ± 0.76 25.74 ± 0.97 a 18.49 ± 0.98 b 16.19 ± 3.39 c GLDH (ng/mg protein) 1.73 ± 0.09 6.52 ± 0.19 a 4.10 ± 0.33 b 2.91 ± 0.29 cd a: Significant difference between control and CTX group, b: Significant difference between CTX group and CTX + AD-MSCs group, c: Significant difference between CTX group and CTX + AD-MSCs-Exo group, d: Significant difference between CTX + AD-MSCs group and CTX + AD-MSCs-Exo group. Data are mean ± SD (n = 8). AD-MSCs-Exos restored kidney functions after CTX induced hepatorenal toxicity in rats As illustrated in Table 3 , compared to the control group, CTX group displayed significant rise ( P < 0.05) in serum levels of urea and creatinine, kidney contents of KIM-1 and clusterin. Conversely, CTX + AD-MSCs group and CTX + AD-MSCs- Exo group disclosed significant drop ( P < 0.05) in their levels equated to their values in CTX group. Noteworthy, the reduction in urea, creatinine and KIM-1 levels were more significant ( P < 0.05) in CTX + AD-MSCs-Exo than CTX + AD-MSCs group. Table 3 Effect of AD-MSCs-Exo treatment on kidney function indices; urea, creatinine, KIM-1 and clusterin after CTX- induced hepatorenal toxicity in rats Control CTX CTX + AD-MSCs CTX + AD-MSCs- Exo Urea (mg/dL) 24.85 ± 1.62 44.00 ± 2.82 a 34.00 ± 1.41 b 28.00 ± 1.41 cd Creatinine (mg/dL) 0.46 ± 0.06 1.56 ± 0.23 a 0.96 ± 0.06 b 0.67 ± 0.11 cd KIM-1 (Pg/mg protein) 40.16 ± 5.82 449.86 ± 40.17 a 246.52 ± 17.87 b 194.10 ± 3.48 cd Clusterin (ng/mg protein) 7.29 ± 0.54 34.92 ± 1.43 a 16.72 ± 0.58 b 13.50 ± 2.00 c a: Significant difference between control and CTX group, b: Significant difference between CTX group and CTX + AD-MSCs group, c: Significant difference between CTX group and CTX + AD-MSCs-Exo group, d: Significant difference between CTX + AD-MSCs group and CTX + AD-MSCs-Exo group. Data are mean ± SD (n = 5). AD-MSCs-Exo attenuated hepatic and renal oxidative stress induced by CTX in rats Oxidative stress plays a key role in the pathomechanism of CTX-induced hepatorenal toxicity. Compared to the control group, CTX group experienced significant enhancement ( P < 0.05) in liver and kidney contents of MDA as a lipid peroxidation marker ( Fig. 4 ) . On the other hand, CTX + AD-MSCs group and CTX + AD-MSCs-Exo group produced significant decline ( P < 0.05) in liver and kidney MDA contents contrary to CTX group. The most prominent reduction of MDA values was observed in CTX + AD-MSCs-Exo group compared to CTX + AD-MSCs group. AD-MSCs-Exo mitigated hepatic and renal TNF-α activated by CTX in rats Because TNF-α activation is a critical mediator of hepatorenal injury after CTX exposure, we studied the effects of AD-MSCs-Exo on inflammatory response as well. Herein, CTX induced significant ( P < 0.05) increase in hepatic and renal contents of TNF-α in contrast to the control group. On the opposite side, CTX + AD-MSCs group and CTX + AD-MSCs-Exo group disclosed significant decrease ( P < 0.05) in the hepatic and renal TNF-α contents versus CTX group. It is noticed that the reduction in hepatic TNF-α content was more significant ( P < 0.05) in CTX + AD-MSCs-Exo group than CTX + AD-MSCs group. AD-MSCs-Exo upregulated Nrf-2/HO-1 pathway in hepatic and renal tissues of rats challenged with CTX To explore the molecular background of the therapeutic effects of AD-MSCs-Exo on CTX-induced hepatorenal toxicity, we assessed Nrf-2/ HO-1 gene expression ( Fig. 6 ) in the liver and kidney tissues. In the liver tissues, there were insignificant ( P > 0.05) downregulation in the gene expression of Nrf-2/HO-1 in CTX group compared to control group. In kidneys of CTX-treated rats, significant ( P < 0.05) downregulation in Nrf-2 and HO-1 gene expression was observed contrary to the control rats. Such downregulation of Nrf-2 and HO-1 in the liver and kidney tissues of CTX-challenged rats was significantly ( P < 0.05) attenuated by AD-MSCs and AD-MSCs-Exo treatments. AD-MSCs-Exo downregulated hepatic and renal NF-κB/TLR-4 pathway in rats challenged with CTX NF-κB/TLR-4 pathway is the critical inflammatory avenue implicated in liver and kidney intoxication after CTX exposure. Here in we studied the impact of AD-MSCs-Exo treatment on this pathway from molecular point of view. CTX induced significant ( P < 0.05) upregulation in hepatic and renal NF-κB and TLR-4 gene expressions ( Fig. 7 ) . Remarkably, CTX + AD-MSCs and CTX + AD-MSCs-Exo treatment exerted an anti-inflammatory effect in the liver of CTX-treated rats, as evidenced by both mitigation of the NF-κB and TLR-4 gene expression versus CTX group. It was noticed that the downregulation of NF-κB and TLR-4 expressions was more significant ( P < 0.05) in CTX + AD-MSCs-Exo group than CTX + AD-MSCs group. Likewise, CTX + AD-MSCs and CTX + AD-MSCs-Exo treatments exhibited an anti-inflammatory effect in the kidney of CTX-treated rats, as manifested by the significant downregulation ( P < 0.05) of the NF-κB and TLR-4 gene expression. The most significant downregulation in NF-κB gene expression was perceived in CTX + AD-MSCs-Exo group. AD-MSCs-Exo suppressed apoptosis of liver and kidney tissues of rats challenged with CTX To further investigate the therapeutic efficacy of AD-MSCs-Exo on CTX-induced liver and kidney intoxication in rats, we assessed hepatic and renal expression of apoptosis regulatory genes, such as Bax and Bcl-2. CTX significantly ( P < 0.05) downregulated Bcl-2 gene expression level; paralleled with significant ( P < 0.05) upregulation in Bax gene expression ( Fig. 8 ) . Intriguingly, the CTX-induced apoptosis in the liver and kidney was attenuated by AD-MSCs and AD-MSCs-Exo treatments. This regulatory effect was documented by the significant upregulation ( P < 0.05) of Bcl-2 gene expression along with the significant downregulation ( P < 0.05) of Bax gene expression in both liver and kidney tissues. The downregulation of Bax and upregulation of Bcl-2 were more significant ( P < 0.05) in CTX + AD-MSCs- Exo group than CTX + AD-MSCs group. Effect of AD-MSCs Exo treatment on liver and kidney histopathological features in CTX- induced hepatorenal toxicity in rats The CTX-induced hepatorenal injury and histopathological alterations were ameliorated by both AD-MSCs and AD-MSCs-Exo treatments. The impact of these therapeutic approaches in counteracting liver and kidney injury was assessed by evaluation of histological changes in liver and kidney tissues stained with H&E staining. Histopathological analysis of H&E-stained hepatic sections from control rats showed normal histological of portal area and hepatocytes ( Fig. 9 A ) . Analysis of H&E-stained liver sections of CTX-treated rats demonstrated the presence of portal fibrosis with infiltration of high number of mononuclear inflammatory cells and the hepatic sinusoid dilated and engorged with blood ( Fig. 9 B ) . CTX + AD-MSCs treated rats showed portal fibrosis with infiltration by low number of mononuclear inflammatory cells, presence of nuclear pyknosis and vacuolar degeneration in hepatocytes ( Fig. 9 C ) . While in CTX + AD-MSCs-Exo treated rats, there was improvement in tissues architecture as evidenced by minimal portal fibrosis, infiltration of low number of mononuclear inflammatory cells, and less nuclear pyknosis in some hepatocytes compared to CTX group and CTX + AD-MSCs group ( Fig. 9 D ) . Histopathological analysis of H&E-stained kidney sections from control showed normal histological structure of glomeruli and renal tubules ( Fig. 10 A ) . CTX-treated rats showed atrophy of renal glomeruli, presence of nuclear pyknosis and mild vacuolar degeneration in epithelial lining of some renal tubules with mild congestion of renal blood vessels ( Fig. 10 B ) . CTX + AD-MSCs treated rats' illustrated mild nuclear pyknosis in epithelial lining of some renal tubules ( Fig. 10 C ) . On the other side, CTX + AD-MSCs Exo treated rats showed less nuclear pyknosis in epithelial lining of some renal tubules ( Fig. 10 D ) . Immunohistochemical findings of AD-MSCs Exo treatment on liver and kidney tissues in CTX- induced hepatorenal toxicity in rats Evaluation of the immunohistochemical examination of liver and kidney tissues obtained from rat in the control group showed negative expression of COX-2 and iNOS. While in rat obtained from CTX group, high positive expression of COX-2 and iNOS in the liver and kidney tissues was detected. Immunohistochemical investigation of COX-2 and iNOS in liver and kidney tissues of rat in CTX + AD-MSCs revealed positive expression of COX-2 and iNOS in the cytoplasm of the hepatocytes. While the positive expression of COX-2 and moderate expression of iNOS was demonstrated in the cytoplasm of renal tubular epithelium. Immunohistochemical evaluation of COX-2 and iNOS in liver and kidney tissues of rat in AD-MSCs-Exo group showed moderate expression of COX-2 and mild expression of iNOS ( Figs. 11 , 12 ) . DISCUSSION One major adverse effect that prevents CTX from being used in the treatment of cancer is hepatorenal toxicity. It has been shown that CTX can cause oxidative stress-related damage to the liver and kidneys ( Mahmoud et al., 2017 ; Lim et al., 2017 ). Despite the fact that numerous studies have focused their attention on CTX hepatorenal toxicity, there are still very few effective treatment options available. Here, we looked at how well AD-MSCs Exo protected rats' hepatorenal toxicity caused by CTX. Our findings demonstrated that by upregulating Nrf-2/HO-1, downregulating NF-κB/TLR-4 and Bax/Bcl-2 signaling pathways, and suppressing oxido-inflammatory stress and apoptotic end points in CTX-challenged rats, AD-MSCs Exo may mitigate liver and kidney injury. In the current investigation, liver transaminases (ALT and AST) activity in serum was significantly elevated in rats treated with CTX; significant indicators for assessing liver damage because their blood leakage indicates the degree of liver damage ( Yogalakshmi et al., 2010 ) where the increased lipid peroxidation caused by CTX changes the fluidity and integrity of the membrane, which in turn disrupts the permeability of the membrane ( Catalá and Díaz, 2016 ) and thereby causes them to leak into the bloodstream. Althunibat et al. ( 2023 ) shown that in the rat model of CTX-induced hepatotoxicity, blood levels of ALT and AST were elevated. Additionally, hepatic MDH and GLDH levels were significantly higher in the CTX group compared to the control. These findings are similar to those of Schomaker et al. ( 2013 ), who found that acetaminophen toxicity in the liver was associated with higher levels of GLDH and MDH. These elevations may result from hepatic induction of these enzymes in response to specific medications ( Shimizu et al., 1997 ) (like CTX in this study) and glucocorticoids in other studies ( Timmerman et al., 2003 ). CTX administration also results in considerable elevation in the levels of serum urea and creatinine compared to control group. Similar findings were reported by Alaqeel and Al-Hariri ( 2023 ) , who found that rats treated with CTX, had elevated serum urea and creatinine levels. They are only seen in considerable quantities in the blood, kidneys, and proximal-distal tubules following renal membrane damage and ischemia ( Mori et al., 2005 ). Therefore, elevated release of these indicators into the bloodstream suggests renal injury resulting from CTX. In the current investigation, nephrotoxicity resulted in the elevation of KIM-1 protein in kidney tissues. According to results from Ijaz et al. ( 2022 ), the renal KIM-1 level increased in the rat model of CTX-induced nephrotoxicity. The hypothesis illustrated the cause of high renal KIM-1 level was attributed to extracellular regulated kinase ½ (ERK½) and signal transducer and activator of transcription 3 (STAT3) phosphorylated pathway where STAT3 bounded to KIM-1 promotor and raised its expression at both mRNA and protein level ( Moresco et al., 2018 ). It was illustrated that CTX was more efficient in upregulation of STAT3 phosphorylation ( Noori et al., 2020 ) and therefore raise renal KIM-1 protein levels through STAT3 binding to KIM-1 promotor. Furthermore, compared to the control group, the CTX group had an elevated level of renal clusterin protein. The overexpression of the clusterin protein indicates the presence of renal damage and serves as a possible indicator of nephrotoxicity ( Girton et al., 2002 ). Previous research revealed a connection between the TGF-β signaling system and clusterin expression. TGF-β1 activates protein kinase C and AP-1 transcriptor protein, which in turn causes the expression of clusterin ( Jin and Howe, 1997 ) . CTX induces TGF-β1 ( Iqubal et al., 2023 ) and thereby caused a rise in renal clusterin protein levels. According to the current findings, liver and kidney tissues treated with CTX showed a substantial increase in MDA protein concentration and iNOS protein expression when compared to the control. These findings are similar to those of Alaqeel and Al-Hariri ( 2023 ) , where CTX significantly raised the level of MDA protein and iNOS antibody expression in the renal tissues relative to the control. The active toxic metabolites of CTX, phosphoramide and acrolein, are probably responsible for its anti-malignant effects. Phosphoramide is responsible for CTX's mutagenic effects. On the other hand, acrolein hinders the cellular antioxidant defense system, resulting in highly reactive oxygen species (ROS) formation which interacts with amino acids of the body; which in turn causes morphological and physiological alterations ( Caglayan et al., 2018 ). Additionally, hepatocyte-cytochrome P450 mixed function oxidase enzymes oxidize CTX multiple times in the hepatic tissues to generate oxidative agents like acrolein, which contributes to the overproduction of free radicals like ROS and NO ( Althunibat et al., 2023 ). Lipid peroxidation produces MDA as an end product, and MDA level elevated due to oxidative stress ( Mahipal and Pawar, 2017 ) resulted from CTX. Additionally, NF-κB activated by CTX ( Lan et al., 2022 ) causes iNOS synthesis ( Yang et al., 2015 ) and this led to increased iNOS immunoreactivity. The findings demonstrated that, in comparison to control, CTX downregulated the Nrf-2/HO-1 signaling pathway in the liver and kidneys. This matches previous research by Mahmoud et al. ( 2017 ) and Althunibat et al. ( 2023 ) that demonstrated decreased expression of HO-1 and Nrf-2 in the liver in a rat model of CTX hepatotoxicity. Nuclear factor erythroid 2-related factor 2 (Nrf-2) stimulates the production of many antioxidant enzymes in response to reactive oxygen species (ROS), hence suppressing oxidative stress ( Satta, et al., 2017 ). Under normal circumstances, Kelch-like ECH-associated protein 1 (Keap1), a sensor protein towards electrophiles and ROS, sequesters Nrf2 in the cytoplasm. A moderate degree of oxidative stress causes Nrf2 to be released and enter the nucleus, where it attaches to the DNA promoter region's antioxidant response element (ARE) and initiates heme oxygenase (HO)-1 transcription ( Satta, et al., 2017 ). It is believed that the transcription regulator Nrf-2 triggers expression of HO-1, which is among the body's most significant antioxidant systems ( Lan et al., 2022 ). Here, CTX suppressed Nrf-2 signaling as illustrated by Nrf-2 downregulation, and HO-1 gene expression. Despite ROS represent the signal that induces Nrf-2 to dissociate from Keap1 and trigger the antioxidant genes transcription; it inhibited Nrf-2 signaling after injection of CTX. The declined Nrf-2/HO-1 pathway might be due to sustained surplus ROS levels which have been reported to inhibit Nrf-2 in the liver ( Abd El-Twab et al., 2019 ), and the kidney ( Mahmoud et al., 2018 ). According to the current approach, rats given CTX showed a considerable increase in the levels of TNF-α in their liver and kidney, as well as a high degree of positive expression for the COX-2 antibody in the liver and kidney. It is also upregulated NF-κB/TLR-4 signaling pathway. These results are consistent with those of Lan et al. ( 2022 ), who demonstrated that CTX enhanced TNF-α protein levels and raised the expression levels of TLR-4, MyD88, and NF-κB p65 genes in thymus and spleen tissues. NF-κB is a transcription factor that regulates the immune response and many inflammatory illnesses in various tissues. It is essential for the activation of pro-inflammatory cytokines like COX-2 and TNF-α ( Semis et al., 2021 ). Oxidative stress in CTX-treated tissues activates NF-κB, which leads to the generation of pro-inflammatory cytokines such as IL-1β, TNF-α, and IL-6, which in turn causes tissue damage ( Caglayan et al., 2018 ). Additionally, Nrf-2 inhibits the inflammatory response mediated by NF-κB by reducing the activation of NF-κB triggered by oxidative stress, blocking the proteasomal breakdown of IκB-α, and subsequently blocking the nuclear translocation of NF-κB ( Saha et al., 2020 ). Nevertheless, downregulation of Nrf-2 produced from CTX increased severity of CTX-induced toxicity via NF-κB upregulation. These results showed that Nrf-2 plays a critical role in avoiding drug toxicity, mostly by enhancing the inflammatory response within cells through the NF-κB/TLR-4 signaling pathway. It was demonstrated in this work that CTX-induced apoptosis. In the liver and kidney tissue of the CTX group, we showed that, in comparison to the control, there was an elevation of the pro-apoptotic marker Bax and a decrease in the expression of the anti-apoptotic Bcl-2. Consistent with our findings, earlier research demonstrated that CTX could cause kidney tissue to undergo apoptosis by upregulating the expression of apoptotic markers such as caspase-3 and Bax ( Caglayan et al., 2018 ). Furthermore, Asiri (2010) reported that in cardiac tissues, CTX dramatically lowers the expression of Bcl-2 and enhances the mRNA expression of P53 and Bax. CTX-induced generation of ROS and therefore increase NF-κB activation, which in turn causes the production of pro-inflammatory mediators. This results in a concerted expression of different pro-apoptotic proteins, such caspases and Bax, or anti-apoptotic proteins, like Bcl-2 ( Ullrich et al., 2022 ). Overproduction of ROS promotes the dissipation of the mitochondrial membrane potential, which in turn allows cytochrome c to be released into the cytosol. Apoptosis activating factor-1 (Apaf-1) and procaspase-9 combine with cytochrome c to form what is known as an apoptosome, this causes caspase-9 to become auto-activated, ultimately resulting in DNA breakage, cleavage of cellular proteins, and cell death through apoptosis via activation of the executioner caspase-3 ( Circu and Aw, 2010 ) , all of those are crucial mediators of the intrinsic pathway of pro- and anti-apoptotic signals (Bax and Bcl-2) ( Radhiga et al., 2012 ). Hepatonephrototoxic effects of CTX were further ascertained by the assessment of histological alterations of the liver and kidneys tissue. Histological examination of the liver tissue of rats given CTX treatment revealed portal fibrosis, hepatic sinusoid dilatation, and engorgement of blood vessels in addition to a substantial infiltration of mononuclear inflammatory cells. Furthermore, histological examination of the kidney tissue of rats given CTX revealed nuclear pyknosis, atrophy of the renal glomeruli, and minor vacuolar degeneration in the epithelial lining of some renal tubules accompanied with moderate renal blood vessel congestion. According to Althunibat et al. ( 2023 ), mice administered CTX exhibited pronounced centrilobular hepatic necrosis linked to hepatic vacuolation. Studies by Ijaz et al. ( 2022 ) demonstrated that renal tissue inter-tubular vessels, tubular dilatation, glomerular hyperemia, and tubule epithelium underwent degenerative alterations as a result of CTX treatment. These pathological alterations could be linked to CTX's capacity to weaken the antioxidant defense system and produce free radicals. According to several reports, the injection of CTX can directly harm the kidney, resulting in glomerulus degeneration, necrosis in the proximal convoluted tubule, distal tubules, pyknosis, etc ( El-shabrawy et al., 2020 ). In addition to oxidative stress, nephrotoxicity is also significantly influenced by elevated pro-inflammatory cytokines, apoptotic, and fibrotic proteins synthesis ( El-shabrawy et al., 2020 ). In contrast, the injured liver and kidney tissues showed improved histological characteristics, reduced inflammatory response, decreased apoptosis, and increased antioxidant capacity in both AD-MSCs and AD-MSCs-Exo. These effects may account for the hepatorenal protective properties of both AD-MSCs as well as AD-MSCs-Exo upon CTX-induced tissue damage. These results are consistent with earlier research by El Araby et al. (2022) , who examined the hepatotherapeutic effects of MSCs treatment on rats' acetaminophen-induced hepatotoxicity. According to Lin et al. ( 2020 ), MSCs have the potential to be a treatment for kidney illness caused by toxicants. Furthermore, MSC-Exos have become an attractive cell-free treatment for chronic renal disease ( Cao et al., 2022 ). Additionally, MSC-derived Exos have been shown by Tan et al. ( 2014 ) to have hepatoprotective properties against injury caused by toxicants. We used MSCs in this work because of their multipotent characteristics, ease of isolation from many tissues, ease of in vitro expansion, and their extensive therapeutic potential demonstrated in clinical trials. The AD-MSCs employed in this work showed the typical morphological characteristics of MSCs, such as adhesion to the growth plates and a fibroblast-like appearance. Also, AD-MSCs were characterized by flowcytometry through positive expression of CD90 and CD105 and negative expression of CD 34. According to findings by Niyaz et al. ( 2012 ), AD-MSCs isolated from rats were negative for CD45, CD106, and MHC Class II, and positive for CD29, CD90, CD54, and MHC Class I. According to Yao et al. ( 2015 ), MSCs were found to express CD14, CD34, CD45, and CD71 at very low levels, whereas they expressed high levels of CD13, CD90, CD44, and CD105. The present investigation clarifed the regenerative effects of MSCs on the livers and kidneys of the CTX + AD-MSCs-treated group in comparison to the CTX group. The results showed improvements in the shape and arrangement of cells, as well as an inhibition of the infiltration of mononuclear inflammatory cells, at the level of histopathological examination. Additionally, improvements were observed at the level of biochemical investigations (ALT, AST, MDH, GLDH, urea, creatinine, KIM-1, and clusterin) where liver and kidney functions were restored. The protective effects of MSCs also appeared with decreased levels of MDA, TNF-α in the treated group; also the reaction and distribution of COX-2 and iNOS were decreased. Furthermore, on the molecular level, there were upregulation of Nrf-2/HO-1 and downregulation of NF-κB/TLR-4 and Bax/Bcl-2 signaling pathways. MSCs treatment provides a hepatotherapeutic impact on acetaminophen-induced hepatotoxicity in rats, as demonstrated by El Araby et al. (2022) . The hepatoprotective impact of MSCs may be attributed to their anti-inflammatory, anti-apoptotic, and immunomodulatory properties. The exact mechanism underlying MSCs' therapeutic potential remains unclear. These cells are thought to have other qualities that make them appealing for therapeutic uses in addition to their unique ability to differentiate, but also the release of a wide variety of bioactive substances that play a vital biological role in damage circumstances, such as chemokines, growth factors, and cytokines; this makes the properties of MSCs in vivo an issue of therapeutic concerns ( da Silva Meirelles et al., 2009 ). Another possibility is that MSCs could repair damaged cells by releasing microvesicles that include proteins, mRNAs, or microRNAs ( Barnes et al., 2016 ). However, as previously indicated, disadvantages of MSCs have limited their clinical usage. Therefore, different MSC-based and non-complicationous treatment approaches are required. Using a conventional procedure previously outlined, the exosomes were separated and purified from AD-MSCs. Exosomes were identified by electron microscope analysis as being spheroids or cup-shaped particles. The AD-MSC Exos's particle size is less than 200 nm, according to protein content analysis. Hu et al.'s ( 2021 ) findings are similar to these data. Comparing the liver and kidneys of the CTX + MSCs Exo-treated group to those of the CTX group and the CTX + AD-MSCs group, the results further clarified the curative properties of MSC-derived exosomes; more significant results were obtained from the regeneration effect of MSCs-Exo than from AD-MSCs alone. At the histopathological level infiltration of mononuclear inflammatory became low with decreased pyknosis in the epithelial lining of certain renal tubules and minor congestion in the hepatic sinusoids. Biochemical analyses revealed that the CTX + AD-MSCs group had significantly lower levels of ALT, AST, MDH, GLDH, urea, creatinine, KIM-1, and clusterin. The CTX + AD-MSCs-Exo group experienced a greater reduction in MDA and TNF-α levels compared to the AD-MSCs alone group. Additionally, immunohistochemical reactions demonstrated that the distribution of iNOS and COX-2 was reduced. Furthermore, on a molecular genetic level, the Nrf-2/HO-1 signaling pathway was elevated, and the NF-κB/TLR-4 and Bax/Bcl-2 signaling pathways were downregulated more strongly in the CTX + AD-MSCs-Exo group compared to the CTX + AD-MSCs group. MSC-Exos have been shown by Wang et al. ( 2022 ) to activate proliferative and regenerative responses, which may mitigate acute and chronic liver injury. Additionally, MSC-Exos have shown promise as a cell-free treatment for chronic kidney disease, as demonstrated by Cao et al. ( 2022 ). MSC-Exos have the ability to repair tissue by stimulating angiogenesis, dedifferentiation, and cell proliferation while also reducing oxidative stress and apoptosis (Harrel et al., 2020) . MSC- Exos replicate the functions of their originator MSCs through delivery of several genetic and protein cargos to the target cells ( Cao et al., 2022 ). MiRNA cargos (like miRNA- 10a, miRNA-486) were regarded as pro-regenerative miRNAs due to their ability to promote cell proliferation ( Tapparo et al., 2019 ) while miRNA-199a-3p was discovered to reduce apoptosis by downregulating genes linked to apoptosis ( Zhang et al., 2020 ). Protein cargos (such as extracellular matrix metalloproteinase inducer (EMMPRIN) and metalloproteinase-9 (MMP-9)) have been found to stimulate angiogenesis ( Abu El-Asrar et al., 2017 ). Furthermore, MSC-Exos mitigate inflammatory responses by reducing invasion of immune cells such as macrophages, T cells, and NK cells ( Harrell et al., 2019 ). For example, cytokines including IL-6, IL-10, and hepatocyte growth factor (HGF), as well as miRNA-155 ( Pers et al., 2021 ) and miRNA-146a (Tavasolian et al., 2021) , contribute to MSC-Exos mediated immunoregulation ( Wu et al., 2019 ). Exos therapy also offers unique benefits: it doesn't require engraftment, which lowers the risk of cancer ( Tracy et al., 2019 ); additionally, because of its nanoscale level, it improves the penetration of barriers, biomembranes, and vasculature ( Chen et al., 2016 ). Collectively, Exos recapitulate to a large extent the immensely broad therapeutic actions previously linked to MSCs (Phinney et al., 2017) . CONCLUSION In conclusion, the present approach reveals insightful information for understanding the mechanisms of AD-MSCs-Exos against CTX-induced hepatorenal injury. These include stabilization of oxidative/antioxidant status repression of inflammatory response and arresting the apoptotic pathway. Therefore, AD-MSCs- Exos may be useful for reducing the CTX‐associated target organ toxicities, particularly hepatorenal toxicity, in patients undergoing active chemotherapy regimen with CTX. However, further studies focusing on the standardization of MSC-Exos production, purification, and characterization to improve quality and safety should be carried out to broaden its therapeutic suitability and future clinical applications. Declarations Ethics approval and consent for publication: Our methods were carried out in accordance with the National Institute of Health Guide for the Care and Use of Laboratory Animals (NIH Publications No. 80-23) revised 1996. With the least number possible of animals and that the approval sheet from our institutional committee can be offered upon request. (1) Title of the approved project: Cyclophosphamide: Potential Hepatorenal Toxicity and the Possible Therapeutic Role of Mesenchymal Stem Cell-Derived Exosomes in Wistar Rats (2) Name of the institutional approval committee: Scientific Research Ethics Committee, Suez Canal University, Egypt; (3) Approval number: SCU 2023075 (4) Date of approval: 8/11/2023. Consent for publication: All authors confirm their consent for publication Competing interest: The authors declare that they have no competing interests Author’s contribution AN carried out the isolation and characterization of the stem cells and exosomes; HE carried out the molecular assays; AM implemented the animal study design and the animal injection, follow up, blood and tissue sampling; HH wrote and revised the manuscript and RS Carried out the biochemical, immunological and statistical assays. All authors read and approved the final manuscript. Funding : no funding was received for this study. Data Availability: All data are available upon reasonable request References Abbasy, A., Azmy, O., Atta, H., Ali, A., Rashed, L., El-Khaiat, Z., ... & Aziz, M. T. A. (2010). Stem cells restored ovarian function and folliculogenesis following cyclophosphamide-induced ovarian failure in rats. International Journal of Health Science , 3 (1). ‏ Abd El-Twab, S. M., Hussein, O. E., Hozayen, W. G., Bin-Jumah, M., & Mahmoud, A. M. (2019). Chicoric acid prevents methotrexate-induced kidney injury by suppressing NF-κB/NLRP3 inflammasome activation and up-regulating Nrf2/ARE/HO-1 signaling. Inflammation Research , 68 , 511-523. ‏ Abu El‐Asrar, A. M., Ahmad, A., Alam, K., Siddiquei, M. M., Mohammad, G., Hertogh, G. D., ... & Opdenakker, G. (2017). Extracellular matrix metalloproteinase inducer (EMMPRIN) is a potential biomarker of angiogenesis in proliferative diabetic retinopathy. Acta Ophthalmologica , 95 (7), 697-704. ‏ Alaqeel, N. K., & Al-Hariri, M. T. (2023). Naringenin ameliorates Cyclophosphamide-induced nephrotoxicity in experimental model. Saudi Journal of Biological Sciences , 30 (6), 103674. ‏ Althunibat, O. Y., Abukhalil, M. H., Jghef, M. M., Alfwuaires, M. A., Algefare, A. I., Alsuwayt, B., ... & Aladaileh, S. H. (2023). Hepatoprotective effect of taxifolin on cyclophosphamide-induced oxidative stress, inflammation, and apoptosis in mice: Involvement of Nrf2/HO-1 signaling. Biomolecules and Biomedicine . ‏ Awadalla, A., Hamam, E. T., Mostafa, S. A., Mahmoud, S. A., Elazab, K. M., El Nakib, A. M., ... & Ali, M. (2023). Hepatoprotective Effects of Hyaluronic Acid-Preconditioned Bone Marrow Mesenchymal Stem Cells against Liver Toxicity via the Inhibition of Apoptosis and the Wnt/β-Catenin Signaling Pathway. Cells , 12 (11), 1526. ‏ Ayza, M. A., Zewdie, K. A., Yigzaw, E. F., Ayele, S. G., Tesfaye, B. A., Tafere, G. G., & Abrha, M. G. (2022). Potential protective effects of antioxidants against cyclophosphamide-induced nephrotoxicity. International Journal of Nephrology , 2022 . ‏ Banchroft JD, Stevens A, Turner DR. Theory and practice of histological techniques. Churchill Livingstone, Philadelphia, 4 th Ed/ 1996. Barkholt, L., Flory, E., Jekerle, V., Lucas-Samuel, S., Ahnert, P., Bisset, L., ... & Salmikangas, P. (2013). Risk of tumorigenicity in mesenchymal stromal cell–based therapies—bridging scientific observations and regulatory viewpoints. Cytotherapy , 15 (7), 753-759. ‏ Barnes, C. J., Distaso, C. T., Spitz, K. M., Verdun, V. A., & Haramati, A. (2016). Comparison of stem cell therapies for acute kidney injury. American Journal of Stem Cells , 5 (1), 1. ‏ Barnett, S., Errington, J., Sludden, J., Jamieson, D., Poinsignon, V., Paci, A., & Veal, G. J. (2021). Pharmacokinetics and pharmacogenetics of cyclophosphamide in a neonate and infant childhood cancer patient population. Pharmaceuticals , 14 (3), 272. ‏ Basu, A., Bhattacharjee, A., Roy, S. S., Ghosh, P., Chakraborty, P., Das, I., & Bhattacharya, S. (2014). Vanadium as a chemoprotectant: effect of vanadium (III)-L-cysteine complex against cyclophosphamide-induced hepatotoxicity and genotoxicity in Swiss albino mice. JBIC Journal of Biological Inorganic Chemistry , 19 , 981-996. ‏ Caglayan, C., Temel, Y., Kandemir, F. M., Yildirim, S., & Kucukler, S. (2018). Naringin protects against cyclophosphamide-induced hepatotoxicity and nephrotoxicity through modulation of oxidative stress, inflammation, apoptosis, autophagy, and DNA damage. Environmental Science and Pollution Research , 25 , 20968-20984. ‏ Cao, H., Cheng, Y., Gao, H., Zhuang, J., Zhang, W., Bian, Q., ... & Wang, Y. (2020). In vivo tracking of mesenchymal stem cell-derived extracellular vesicles improving mitochondrial function in renal ischemia–reperfusion injury. Acs Nano , 14 (4), 4014-4026. ‏ Cao, Q., Huang, C., Chen, X. M., & Pollock, C. A. (2022). Mesenchymal stem cell-derived exosomes: toward cell-free therapeutic strategies in chronic kidney disease. Frontiers in Medicine , 9 , 816656. ‏ Casak, S. J., Lemery, S. J., Shen, Y. L., Rothmann, M. D., Khandelwal, A., Zhao, H., ... & Pazdur, R. (2011). US Food and Drug Administration approval: rituximab in combination with fludarabine and cyclophosphamide for the treatment of patients with chronic lymphocytic leukemia. The Oncologist , 16 (1), 97-104. ‏ Catalá, A., & Díaz, M. (2016). Impact of lipid peroxidation on the physiology and pathophysiology of cell membranes. Frontiers in physiology , 7 , 423. ‏ Chen, C. C., Liu, L., Ma, F., Wong, C. W., Guo, X. E., Chacko, J. V., ... & Zhao, W. (2016). Elucidation of exosome migration across the blood–brain barrier model in vitro. Cellular and molecular bioengineering , 9 , 509-529. ‏ Chen, Y. T., Sun, C. K., Lin, Y. C., Chang, L. T., Chen, Y. L., Tsai, T. H., ... & Yip, H. K. (2011). Adipose-derived mesenchymal stem cell protects kidneys against ischemia-reperfusion injury through suppressing oxidative stress and inflammatory reaction. Journal of translational medicine , 9 , 1-17. ‏ Circu, M. L., & Aw, T. Y. (2010). Reactive oxygen species, cellular redox systems, and apoptosis. Free radical biology and medicine , 48 (6), 749-762. ‏ da Silva Meirelles, L., Fontes, A. M., Covas, D. T., & Caplan, A. I. (2009). Mechanisms involved in the therapeutic properties of mesenchymal stem cells. Cytokine & growth factor reviews , 20 (5-6), 419-427. ‏ El-Agamy, D. S., El-Harbi, K. M., Khoshhal, S., Ahmed, N., Elkablawy, M. A., Shaaban, A. A., & Abo-Haded, H. M. (2018). Pristimerin protects against doxorubicin-induced cardiotoxicity and fibrosis through modulation of Nrf2 and MAPK/NF-kB signaling pathways. Cancer management and research , 47-61. ‏ El-Araby, H. A., Sobhy, G. A., Naeem, S. A. M., Alsayed, A. F. M., Zakaria, H. M., & Khedr, M. A. (2022). The regenerative effect of stem cells on acetaminophen-induced hepatotoxicity in male albino rats. Egyptian Liver Journal , 12 (1), 1-9. ‏ El-Kashef, D. H. (2018). Role of venlafaxine in prevention of cyclophosphamide-induced lung toxicity and airway hyperactivity in rats. Environmental toxicology and pharmacology , 58 , 70-76. ‏ El‐Shabrawy, M., Mishriki, A., Attia, H., Emad Aboulhoda, B., Emam, M., & Wanas, H. (2020). Protective effect of tolvaptan against cyclophosphamide‐induced nephrotoxicity in rat models. Pharmacology Research & Perspectives , 8 (5), e00659. ‏ El-Tookhy, O. S., Shamaa, A. A., Shehab, G. G., Abdallah, A. N., & Azzam, O. M. (2017). Histological evaluation of experimentally induced critical size defect skin wounds using exosomal solution of mesenchymal stem cells derived microvesicles. International journal of stem cells , 10 (2), 144-153. ‏ Ghaneialvar, H., Soltani, L., Rahmani, H. R., Lotfi, A. S., & Soleimani, M. (2018). Characterization and classification of mesenchymal stem cells in several species using surface markers for cell therapy purposes. Indian Journal of Clinical Biochemistry , 33 , 46-52. ‏ Girton, R. A., Sundin, D. P., & Rosenberg, M. E. (2002). Clusterin protects renal tubular epithelial cells from gentamicin-mediated cytotoxicity. American Journal of Physiology-Renal Physiology , 282 (4), F703-F709. ‏ Guo, J., Wu, C., Lin, X., Zhou, J., Zhang, J., Zheng, W., ... & Cui, Y. (2021). Establishment of a simplified dichotomic size‐exclusion chromatography for isolating extracellular vesicles toward clinical applications. Journal of Extracellular Vesicles , 10 (11), e12145. ‏ Harrell, C. R., Jovicic, N., Djonov, V., & Volarevic, V. (2020). Therapeutic use of mesenchymal stem cell-derived exosomes: from basic science to clinics. Pharmaceutics , 12 (5), 474. ‏ Harrell, C. R., Jovicic, N., Djonov, V., Arsenijevic, N., & Volarevic, V. (2019). Mesenchymal stem cell-derived exosomes and other extracellular vesicles as new remedies in the therapy of inflammatory diseases. Cells , 8 (12), 1605. ‏ He, J., Jiang, Y. L., Wang, Y., Tian, X. J., & Sun, S. R. (2020). Micro-vesicles from mesenchymal stem cells over-expressing miR-34a inhibit transforming growth factor-β1-induced epithelial-mesenchymal transition in renal tubular epithelial cells in vitro. Chinese medical journal , 133 (07), 800-807. ‏ Hoang, D. M., Pham, P. T., Bach, T. Q., Ngo, A. T., Nguyen, Q. T., Phan, T. T., ... & Nguyen, L. T. (2022). Stem cell-based therapy for human diseases. Signal transduction and targeted therapy , 7 (1), 1-41. ‏ Hu, W., Song, M., & Li, L. (2022). Grading evaluation of cardiotoxicity in patients with breast cancer treated with adjuvant paclitaxel anthracycline/cyclophosphamide chemotherapy: a meta-analysis. Computational and Mathematical Methods in Medicine , 2022 . ‏ Hu, Y., Tao, R., Wang, L., Chen, L., Lin, Z., Panayi, A. C., ... & Liu, G. (2021). Exosomes derived from bone mesenchymal stem cells alleviate compression-induced nucleus pulposus cell apoptosis by inhibiting oxidative stress. Oxidative Medicine and Cellular Longevity , 2021 . ‏ Ijaz, M. U., Mustafa, S., Batool, R., Naz, H., Ahmed, H., & Anwar, H. (2022). Ameliorative effect of herbacetin against cyclophosphamide-induced nephrotoxicity in rats via attenuation of oxidative stress, inflammation, apoptosis and mitochondrial dysfunction. Human & Experimental Toxicology , 41 , 09603271221132140. ‏ Iqubal, A., Najmi, A. K., Md, S., Alkreathy, H. M., Ali, J., Syed, M. A., & Haque, S. E. (2023). Oral delivery of nerolidol alleviates cyclophosphamide-induced renal inflammation, apoptosis, and fibrosis via modulation of NF-κB/cleaved caspase-3/TGF-β signaling molecules. Drug Delivery , 30 (1), 2241661. ‏ Jin, G., & Howe, P. H. (1997). Regulation of clusterin gene expression by transforming growth factor β. Journal of Biological Chemistry , 272 (42), 26620-26626. ‏ Lan, Z., Wang, H., Wang, S., Zhu, T., Ma, S., Song, Y., ... & Tian, C. (2022). Rutin protects against cyclophosphamide induced immunological stress by inhibiting TLR4-NF-κB-mediated inflammation and activating the Nrf2-mediated antioxidant responses. Pharmacological Research-Modern Chinese Medicine , 4 , 100135. ‏ Lim, S. R., Hyun, S. H., Lee, S. G., Kim, J. Y., Kim, S. H., Park, S. J., ... & Choi, H. K. (2017). Potential urinary biomarkers of nephrotoxicity in cyclophosphamide‐treated rats investigated by NMR‐based metabolic profiling. Journal of biochemical and molecular toxicology , 31 (3), e21871. ‏ Lin, X., Yang, F., Huang, J., Jiang, S., Tang, Y., & Li, J. (2020). Ameliorate effect of pyrroloquinoline quinone against cyclophosphamide-induced nephrotoxicity by activating the Nrf2 pathway and inhibiting the NLRP3 pathway. Life Sciences , 256 , 117901. ‏ Mahipal, P., & Pawar, R. S. (2017). Nephroprotective effect of Murraya koenigii on cyclophosphamide induced nephrotoxicity in rats. Asian Pacific journal of tropical medicine , 10 (8), 808-812. ‏ Mahmoud, A. M., Germoush, M. O., Al-Anazi, K. M., Mahmoud, A. H., Farah, M. A., & Allam, A. A. (2018). Commiphora molmol protects against methotrexate-induced nephrotoxicity by up-regulating Nrf2/ARE/HO-1 signaling. Biomedicine & Pharmacotherapy , 106 , 499-509. ‏ Mahmoud, A. M., Germoush, M. O., Alotaibi, M. F., & Hussein, O. E. (2017). Possible involvement of Nrf2 and PPARγ up-regulation in the protective effect of umbelliferone against cyclophosphamide-induced hepatotoxicity. Biomedicine & Pharmacotherapy , 86 , 297-306. ‏‏ Mäkelä, T., Takalo, R., Arvola, O., Haapanen, H., Yannopoulos, F., Blanco, R., ... & Lehenkari, P. (2015). Safety and biodistribution study of bone marrow–derived mesenchymal stromal cells and mononuclear cells and the impact of the administration route in an intact porcine model. Cytotherapy , 17 (4), 392-402. ‏ Moresco, R. N., Bochi, G. V., Stein, C. S., De Carvalho, J. A., Cembranel, B. M., & Bollick, Y. S. (2018). Urinary kidney injury molecule-1 in renal disease. Clinica chimica acta , 487 , 15-21. ‏ Mori, K., Lee, H. T., Rapoport, D., Drexler, I. R., Foster, K., Yang, J., ... & Barasch, J. (2005). Endocytic delivery of lipocalin-siderophore-iron complex rescues the kidney from ischemia-reperfusion injury. The Journal of clinical investigation , 115 (3), 610-621. ‏ Musiał-Wysocka, A., Kot, M., & Majka, M. (2019). The pros and cons of mesenchymal stem cell-based therapies. Cell transplantation , 28 (7), 801-812. Muthu, S., Bapat, A., Jain, R., Jeyaraman, N., & Jeyaraman, M. (2021). Exosomal therapy—A new frontier in regenerative medicine. Stem cell investigation , 8 . ‏ ‏ Neosar, (2013). Cyclophosphamide. BC Cancer Agency Cancer Drug Manual, 1-12. Niyaz, M., Gürpinar, Ö. A., Günaydin, S., & Onur, M. A. (2012). Isolation, culturing and characterization of rat adipose tissue-derived mesenchymal stem cells: a simple technique. Turkish Journal of Biology , 36 (6), 658-664. Nong, K., Wang, W., Niu, X., Hu, B., Ma, C., Bai, Y., ... & Ai, K. (2016). Hepatoprotective effect of exosomes from human-induced pluripotent stem cell–derived mesenchymal stromal cells against hepatic ischemia-reperfusion injury in rats. Cytotherapy , 18 (12), 1548-1559. ‏ Noori, S., Tavirani, M. R., Deravi, N., Rabbani, M. I. M., & Zarghi, A. (2020). Naringenin enhances the anti-cancer effect of cyclophosphamide against MDA-MB-231 breast cancer cells via targeting the STAT3 signaling pathway. Iranian journal of pharmaceutical research: IJPR , 19 (3), 122. ‏‏‏ Patwa, J., Khan, S., & Jena, G. (2020). Nicotinamide attenuates cyclophosphamide‐induced hepatotoxicity in SD rats by reducing oxidative stress and apoptosis. Journal of Biochemical and Molecular Toxicology , 34 (10), e22558. ‏ Pers, Y. M., Bony, C., Duroux-Richard, I., Bernard, L., Maumus, M., Assou, S., ... & Noël, D. (2021). miR-155 contributes to the immunoregulatory function of human mesenchymal stem cells. Frontiers in immunology , 12 , 624024. ‏ Phinney, D. G., & Pittenger, M. F. (2017). Concise review: MSC-derived exosomes for cell-free therapy. Stem cells , 35 (4), 851-858. ‏ Psaraki, A., Ntari, L., Karakostas, C., Korrou‐Karava, D., & Roubelakis, M. G. (2022). Extracellular vesicles derived from mesenchymal stem/stromal cells: The regenerative impact in liver diseases. Hepatology , 75 (6), 1590-1603. ‏ Radhiga, T.; Rajamanickam, C.; Sundaresan, A.; Ezhumalai, M.; Pugalendi, K.V (2012). Effect of ursolic acid treatment on apoptosis and DNA damage in isoproterenol-induced myocardial infarction. Biochimie , 94 , 1135–1142. Refaie, M. M., El-Hussieny, M., Bayoumi, A. M., Shehata, S., Welson, N. N., & Abdelzaher, W. Y. (2022). Simvastatin cardioprotection in cyclophosphamide-induced toxicity via the modulation of inflammasome/caspase1/interleukin1β pathway. Human & Experimental Toxicology , 41 , 09603271221111440. ‏ Ren, K. Exosomes in perspective: a potential surrogate for stem cell therapy. Odontology. 107, 271–284 (2019). Saha, S., Buttari, B., Panieri, E., Profumo, E., & Saso, L. (2020). An overview of Nrf2 signaling pathway and its role in inflammation. Molecules , 25 (22), 5474. ‏ Salama, R. M., Nasr, M. M., Abdelhakeem, J. I., Roshdy, O. K., & ElGamal, M. A. (2022). Alogliptin attenuates cyclophosphamide-induced nephrotoxicity: a novel therapeutic approach through modulating MAP3K/JNK/SMAD3 signaling cascade. Drug and Chemical Toxicology , 45 (3), 1254-1263. ‏ Satta, S., Mahmoud, A. M., Wilkinson, F. L., Yvonne Alexander, M., & White, S. J. (2017). The role of Nrf2 in cardiovascular function and disease. Oxidative medicine and cellular longevity , 2017 . ‏ Schomaker, S., Warner, R., Bock, J., Johnson, K., Potter, D., Van Winkle, J., & Aubrecht, J. (2013). Assessment of emerging biomarkers of liver injury in human subjects. toxicological sciences , 132 (2), 276-283. ‏ Semis, H. S., Gur, C., Ileriturk, M., Kaynar, O., & Kandemir, F. M. (2021). Investigation of the anti-inflammatory effects of caffeic acid phenethyl ester in a model of λ-Carrageenan–induced paw edema in rats. Human & experimental toxicology , 40 (12_suppl), S721-S738. ‏ Shimizu, E., Shirasawa, H., Kodama, K., Kuroyanagi, H., Shirasawa, T., Sato, T., & Simizu, B. (1997). Glutamate dehydrogenase mRNA is immediately induced after phencyclidine treatment in the rat brain. Schizophrenia research , 25 (3), 251-258. ‏ Szatanek, R., Baj-Krzyworzeka, M., Zimoch, J., Lekka, M., Siedlar, M., & Baran, J. (2017). The methods of choice for extracellular vesicles (EVs) characterization. International journal of molecular sciences , 18 (6), 1153. ‏ Tan, C. Y., Lai, R. C., Wong, W., Dan, Y. Y., Lim, S. K., & Ho, H. K. (2014). Mesenchymal stem cell-derived exosomes promote hepatic regeneration in drug-induced liver injury models. Stem cell research & therapy , 5 , 1-14. Tan, F., Li, X., Wang, Z., Li, J., Shahzad, K., & Zheng, J. (2024). Clinical applications of stem cell-derived exosomes. Signal Transduction and Targeted Therapy , 9 (1), 17. ‏ ‏ Tapparo, M., Bruno, S., Collino, F., Togliatto, G., Deregibus, M. C., Provero, P., ... & Camussi, G. (2019). Renal regenerative potential of extracellular vesicles derived from miRNA-engineered mesenchymal stromal cells. International Journal of Molecular Sciences , 20 (10), 2381. ‏ Tavasolian, F., Hosseini, A. Z., Soudi, S., & Naderi, M. (2020). miRNA-146a improves immunomodulatory effects of MSC-derived exosomes in rheumatoid arthritis. Current gene therapy , 20 (4), 297-312. ‏ Timmerman, M., Wilkening, R. B., & Regnault, T. R. H. (2003). Induction of Glutamate Dehydrogenase in the Ovine Fetal Liver by Dexamethasone Infusion during Late Gestation1. Experimental Biology and Medicine , 228 (1), 100-105. ‏ Tracy, S. A., Ahmed, A., Tigges, J. C., Ericsson, M., Pal, A. K., Zurakowski, D., & Fauza, D. O. (2019). A comparison of clinically relevant sources of mesenchymal stem cell-derived exosomes: bone marrow and amniotic fluid. Journal of Pediatric Surgery , 54 (1), 86-90. ‏ Ullrich, E., Vogler, M., & von Metzler, I. (2022). Mitochondrial apoptosis: facilitator of NK cell-mediated immunotherapy. Signal Transduction and Targeted Therapy , 7 (1), 291. ‏ Vizoso, F. J. et al. Mesenchymal stem cell secretome: toward cell-free therapeutic strategies in regenerative medicine. Int. J. Mol. Sci. 18, 1852–1875 (2017). Wang, C., Liu, J., Yan, Y., & Tan, Y. (2022). Role of Exosomes in Chronic Liver Disease Development and Their Potential Clinical Applications. Journal of Immunology Research , 2022 . ‏ Wang, D. R., & Pan, J. (2023). Extracellular vesicles: Emerged as a promising strategy for regenerative medicine. World Journal of Stem Cells , 15 (4), 165. ‏ Wu, H., Fan, H., Shou, Z., Xu, M., Chen, Q., Ai, C., ... & Liu, X. (2019). Extracellular vesicles containing miR-146a attenuate experimental colitis by targeting TRAF6 and IRAK1. International immunopharmacology , 68 , 204-212. ‏ Yang, Y., Yu, T., Lian, Y. J., Ma, R., Yang, S., & Cho, J. Y. (2015). Nitric oxide synthase inhibitors: a review of patents from 2011 to the present. Expert Opinion on Therapeutic Patents , 25 (1), 49-68. ‏ Yao, W., Hu, Q., Ma, Y., Xiong, W., Wu, T., Cao, J., & Wu, D. (2015). Human adipose-derived mesenchymal stem cells repair cisplatin-induced acute kidney injury through antiapoptotic pathways. Experimental and therapeutic medicine , 10 (2), 468-476. ‏ Yogalakshmi, B., Viswanathan, P., & Anuradha, C. V. (2010). Investigation of antioxidant, anti-inflammatory and DNA-protective properties of eugenol in thioacetamide-induced liver injury in rats. Toxicology , 268 (3), 204-212. ‏ Younis, N. S., Ghanim, A. M., Elmorsy, M. A., & Metwaly, H. A. (2021). RETRACTED ARTICLE: Taurine ameliorates thioacetamide induced liver fibrosis in rats via modulation of toll like receptor 4/nuclear factor kappa B signaling pathway. Scientific Reports , 11 (1), 12296. Zhang, R., Qin, L., & Shi, J. (2020). MicroRNA‑199a‑3p suppresses high glucose‑induced apoptosis and inflammation by regulating the IKKβ/NF‑κB signaling pathway in renal tubular epithelial cells. International journal of molecular medicine , 46 (6), 2161-2171. ‏ Zhang, Y., Chang, J., Gao, H., Qu, X., Zhai, J., Tao, L., ... & Song, Y. (2021). Huaiqihuang (HQH) granule alleviates cyclophosphamide-induced nephrotoxicity via suppressing the MAPK/NF-κB pathway and NLRP3 inflammasome activation. Pharmaceutical Biology , 59 (1), 1423-1429. ‏ Zhou, Y., Xu, H., Xu, W., Wang, B., Wu, H., Tao, Y., ... & Qian, H. (2013). Exosomes released by human umbilical cord mesenchymal stem cells protect against cisplatin-induced renal oxidative stress and apoptosis in vivo and in vitro. Stem cell research & therapy , 4 , 1-13. ‏ Supplementary Files AuthorChecklistFull.pdf Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4409545","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":306905070,"identity":"d71a7c05-dd43-4f00-a6f0-64d3bd9a0819","order_by":0,"name":"Ahmed Nour Eldine Abdallah","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA+klEQVRIiWNgGAWjYDADPobEBgaGCigvgRgtbGAtZ0jTAlTG2EaESv7ZDWwPPrbdk2NjT2578HHenXz+BvaHHx4w2Ng14NAicecAu+HMtmJjNp6H7YYztz2znHGAx1gigSEtGZcWhhsJbNK8bQmJbRKJbdK82w4bGDDwgBx5OBmXDnmolnqwlr9zQFrYnwG1/MepxQCqJYENpIWxAaSFwQyo5YAdLi2GNxLbJGecSzBs43nYJtlz7LCBxGGQXwySE3BpkbuRfEziQ1mCPD97+jOJHzWHDfjb2x9+/FFhZ49LCzAuGtAEmMEOBscsiQCPLaNgFIyCUTDCAACT/U/ccS09HQAAAABJRU5ErkJggg==","orcid":"https://orcid.org/0000-0003-0517-6470","institution":"National Research Centre","correspondingAuthor":true,"prefix":"","firstName":"Ahmed","middleName":"Nour Eldine","lastName":"Abdallah","suffix":""},{"id":306905071,"identity":"e4237a5f-f216-4356-a6b4-106996dd94d7","order_by":1,"name":"Heba Effat","email":"","orcid":"","institution":"National Cancer Institute","correspondingAuthor":false,"prefix":"","firstName":"Heba","middleName":"","lastName":"Effat","suffix":""},{"id":306905072,"identity":"870cf514-d5b5-49bb-93ba-ba6c2a64f5d4","order_by":2,"name":"Ahmed M. Mousbah","email":"","orcid":"","institution":"Al-Azhar University College for Boys' Faculty of Agriculture","correspondingAuthor":false,"prefix":"","firstName":"Ahmed","middleName":"M.","lastName":"Mousbah","suffix":""},{"id":306905073,"identity":"3dc4beab-f7cf-43fe-afb5-3ef9548e264b","order_by":3,"name":"Hanaa H. Ahmed","email":"","orcid":"","institution":"National Research Centre","correspondingAuthor":false,"prefix":"","firstName":"Hanaa","middleName":"H.","lastName":"Ahmed","suffix":""},{"id":306905074,"identity":"b3f61007-23c5-4723-9c41-26adf69cdbff","order_by":4,"name":"Rehab S. Abohashem","email":"","orcid":"","institution":"National Research Centre","correspondingAuthor":false,"prefix":"","firstName":"Rehab","middleName":"S.","lastName":"Abohashem","suffix":""}],"badges":[],"createdAt":"2024-05-12 19:02:10","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4409545/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4409545/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":57831957,"identity":"08bf06b3-29ce-4820-9b58-4db1212f2a21","added_by":"auto","created_at":"2024-06-06 08:08:48","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":34296,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMorphologic characterization of the isolated AD-MSCs.\u003c/strong\u003e Cells demonstrated fibroblast like appearance\u003cstrong\u003e.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4409545/v1/ed23158448e4381c9cb27796.jpg"},{"id":57830547,"identity":"8ffddc46-a58a-49a2-9912-01fac5aaae0a","added_by":"auto","created_at":"2024-06-06 07:52:48","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":74861,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFlow cytometric characterization of the isolated AD-MSCs.\u003c/strong\u003e The cells illustrated positive expression CD90 (94.20%) and CD105 (99.80%) and negative expression of CD 34 (6.43%).\u003c/p\u003e","description":"","filename":"2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4409545/v1/27a028254c4f4804a2993863.jpg"},{"id":57832547,"identity":"77502b7f-2b26-41fd-ae64-42222093f429","added_by":"auto","created_at":"2024-06-06 08:16:48","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":67261,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTEM image of exosomes\u003c/strong\u003e. The exosomes expressing regular rounded architecture within the size not exceeding 200 nm; scale bar: 200 nm.\u003c/p\u003e","description":"","filename":"3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4409545/v1/99be5e42044e8c14c7143c9a.jpg"},{"id":57830548,"identity":"0984ec0a-612e-4046-bbf0-818cc95386b6","added_by":"auto","created_at":"2024-06-06 07:52:48","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":40389,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffect of AD-MSCs Exo treatment on hepatic and renal contents of MDA after CTX- induced hepatorenal toxicity in rats. \u003c/strong\u003ea: Significant difference between control and CTX group, b: Significant difference between CTX group and CTX+ AD-MSCs group, c: Significant difference between CTX group and CTX+ AD-MSCs-Exo group, d: Significant difference between CTX+ AD-MSCs group and CTX+ AD-MSCs-Exo group. Data are mean± SD (n=8).\u003c/p\u003e","description":"","filename":"4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4409545/v1/45bf4dd1cefcd04e73868c38.jpg"},{"id":57831460,"identity":"6194d6c1-615d-4cc4-bb30-574ce3f158ce","added_by":"auto","created_at":"2024-06-06 08:00:48","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":48994,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffect of AD-MSCs Exo treatment on hepatic and renal contents of TNF-α after CTX- induced hepatorenal toxicity in rats. \u003c/strong\u003ea: Significant difference between control and CTX group, b: Significant difference between CTX group and CTX+ AD-MSCs group, c: Significant difference between CTX group and CTX+ AD-MSCs-Exo group, d: Significant difference between CTX+ AD-MSCs group and CTX+ AD-MSCs-Exo group. Data are mean± SD (n=8).\u003c/p\u003e","description":"","filename":"5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4409545/v1/9aab7f72191af1c7fe25b23a.jpg"},{"id":57831959,"identity":"ad81fea2-8024-49f9-8729-2b4fa50cca9e","added_by":"auto","created_at":"2024-06-06 08:08:48","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":52921,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffect of AD-MSCs-Exo treatment on Nrf-2/HO-1 gene expression after CTX- induced hepatorenal toxicity in rats. \u003c/strong\u003ea: Significant difference between control and CTX group, b: Significant difference between CTX group and CTX+ AD-MSCs group, c: Significant difference between CTX group and CTX+ AD-MSCs Exo group. Data are mean± SD (n=3).\u003c/p\u003e","description":"","filename":"6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4409545/v1/fc5c3a377c1ac41a9eb6850f.jpg"},{"id":57831956,"identity":"b466f8c3-b156-4222-a946-20497e2c3df5","added_by":"auto","created_at":"2024-06-06 08:08:48","extension":"jpg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":51414,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffect of AD-MSCs Exo treatment on NF-κB/TLR-4 gene expression after CTX- induced hepatorenal toxicity in rats. \u003c/strong\u003ea: Significant difference between control and CTX group, b: Significant difference between CTX group and CTX+ AD-MSCs group, c: Significant difference between CTX group and CTX+ AD-MSCs Exo group, d: Significant difference between CTX+ AD-MSCs group and CTX+ AD-MSCs Exo group. Data are mean± SD (n=3).\u003c/p\u003e","description":"","filename":"7.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4409545/v1/4cb1e0ccb77e4bd2a0d0afe5.jpg"},{"id":57830552,"identity":"423e7135-25ca-4138-8a53-14af9f30e524","added_by":"auto","created_at":"2024-06-06 07:52:48","extension":"jpg","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":51070,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffect of AD-MSCs-Exo treatment on Bax/BCL2 gene expression after CTX- induced hepatorenal toxicity in rats. \u003c/strong\u003ea: Significant difference between control and CTX group, b: Significant difference between CTX group and CTX+ AD-MSCs group, c: Significant difference between CTX group and CTX+ AD-MSCs-Exo group, d: Significant difference between CTX+ AD-MSCs group and CTX+ AD-MSCs-Exo group. Data are mean± SD (n=3).\u003c/p\u003e","description":"","filename":"8.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4409545/v1/7bb9283419b24f65bc9cd5b2.jpg"},{"id":57831960,"identity":"7ddad7ad-0603-44ef-9139-357dd3199aef","added_by":"auto","created_at":"2024-06-06 08:08:48","extension":"jpg","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":262815,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eHistopathological features of rats’ hepatic tissues in the different groups (H\u0026amp;E, ×400, scale bar: 25 μm). \u003c/strong\u003eA: Control group showing normal histological architecture of portal area and hepatocytes. \u003cstrong\u003eB:\u003c/strong\u003e CTX group showing portal fibrosis with infiltration by high number of mononuclear inflammatory cells (star), hepatic sinusoid dilated and engorged with blood (arrow). \u003cstrong\u003eC:\u003c/strong\u003eCTX+ AD-MSCs showing portal fibrosis with infiltration by low number of mononuclear inflammatory cells (star), presence of nuclear pyknosis and vacuolar degeneration in hepatocytes (arrow). D: CTX+ AD-MSCs-Exo showing minimal portal fibrosis with infiltration of less number of mononuclear inflammatory cells (star), presence of less nuclear pyknosis in some hepatocytes (arrow).\u003c/p\u003e","description":"","filename":"9.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4409545/v1/e0b3968a34edb6057b7ddef5.jpg"},{"id":57830558,"identity":"8af6aaa5-bc5d-4e68-8de6-22a65b35252a","added_by":"auto","created_at":"2024-06-06 07:52:48","extension":"jpg","order_by":10,"title":"Figure 10","display":"","copyAsset":false,"role":"figure","size":262250,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eHistopathological features of rats’ kidney tissues in the different groups (H\u0026amp;E,×400, scale bar: 25 μm). \u003c/strong\u003eA: Control group showing normal histological structure of glomeruli and renal tubules. \u003cstrong\u003eB:\u003c/strong\u003e CTX group showing atrophy of renal glomeruli (black arrow), presence of nuclear pyknosis and mild vacuolar degeneration in epithelial lining of some renal tubules (blue arrow) with mild congestion of renal blood vessels (red arrow). \u003cstrong\u003eC:\u003c/strong\u003e CTX+ AD-MSCs showing presence of mild nuclear pyknosis in epithelial lining of some renal tubules (arrow). \u003cstrong\u003eD:\u003c/strong\u003e CTX+ AD-MSCs-Exo showing less nuclear pyknosis in epithelial lining of some renal tubules (arrow).\u003c/p\u003e","description":"","filename":"10.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4409545/v1/aaaa9a4db0b904a9f74775f1.jpg"},{"id":57831465,"identity":"bb82fd33-8811-4081-accb-871ca88b96d2","added_by":"auto","created_at":"2024-06-06 08:00:48","extension":"jpg","order_by":11,"title":"Figure 11","display":"","copyAsset":false,"role":"figure","size":161196,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eImmunohistochemical evaluation (200x) of COX-2 and iNOS of rat liver (IHC- Peroxidase -DAB). A, E:\u003c/strong\u003e Control group showing negative expression for COX-2 and iNOS in hepatocytes. \u003cstrong\u003eB, F:\u003c/strong\u003e CTX group showing high positive expression for COX-2 and iNOS in cytoplasm of hepatocytes. \u003cstrong\u003eC, G:\u003c/strong\u003e CTX+ AD-MSCs showing positive expression for COX-2 and iNOS in cytoplasm of hepatocytes. \u003cstrong\u003eD, H:\u003c/strong\u003e CTX+ AD-MSCs-Exo showed moderate expression for COX-2 and mild expression for iNOS in cytoplasm of hepatocytes, respectively. \u003cstrong\u003e#: \u003c/strong\u003eGraph showing area percent of COX-2 and iNOS immunostaining in different groups. a: Significant difference between control and CTX group, b: Significant difference between CTX group and CTX+ AD-MSCs group, c: Significant difference between CTX group and CTX+ AD-MSCs-Exo group, d: Significant difference between CTX+ AD-MSCs group and CTX+ AD-MSCs-Exo group. Data are mean± SD.\u003c/p\u003e","description":"","filename":"11.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4409545/v1/ac1f92e947dbaede62452524.jpg"},{"id":57830555,"identity":"7d344b06-e55b-498e-80fc-cbfb3ed42170","added_by":"auto","created_at":"2024-06-06 07:52:48","extension":"jpg","order_by":12,"title":"Figure 12","display":"","copyAsset":false,"role":"figure","size":194282,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eImmunohistochemical evaluation (200x) of COX-2 and iNOS of rat kidney (IHC- Peroxidase -DAB).\u003c/strong\u003e \u003cstrong\u003eA, E:\u003c/strong\u003e Control group showed negative expression for COX-2 and iNOS in epithelium of renal tubules. \u003cstrong\u003eB, F:\u003c/strong\u003eCTX group demonstrated high positive expression for COX-2 and iNOS in cytoplasm of renal tubular epithelium. \u003cstrong\u003eC, G:\u003c/strong\u003e CTX+ AD-MSCs showed positive expression for COX-2 and moderate expression for iNOS in cytoplasm of renal tubular epithelium, respectively. \u003cstrong\u003eD, H:\u003c/strong\u003e CTX+ AD-MSCs-Exo showed moderate expression for COX-2 in cytoplasm of renal tubular epithelium and\u003cstrong\u003e \u003c/strong\u003emild expression for iNOS, respectively.\u003cstrong\u003e #: \u003c/strong\u003eGraph showing area percent of COX-2 and iNOS immunostaining in different groups. a: Significant difference between control and CTX group, b: Significant difference between CTX group and CTX+ AD-MSCs group, c: Significant difference between CTX group and CTX+ AD-MSCs-Exo group, d: Significant difference between CTX+ AD-MSCs group and CTX+ AD-MSCs-Exo group. Data are mean± SD.\u003c/p\u003e","description":"","filename":"12.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4409545/v1/8441692cc0de77b5efc28ace.jpg"},{"id":58139887,"identity":"2c6d4091-4cce-4411-8436-79fe33b85ff9","added_by":"auto","created_at":"2024-06-11 17:01:20","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2854149,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4409545/v1/60247b43-ca3f-4a2a-8c24-4e50d7fb5af9.pdf"},{"id":57830560,"identity":"43965469-4c91-443b-a89b-add3eaa91abb","added_by":"auto","created_at":"2024-06-06 07:52:49","extension":"pdf","order_by":19,"title":"","display":"","copyAsset":false,"role":"supplement","size":175939,"visible":true,"origin":"","legend":"","description":"","filename":"AuthorChecklistFull.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4409545/v1/a3026a4f5313192ac8c8f0f3.pdf"}],"financialInterests":"","formattedTitle":"Cyclophosphamide: Potential Hepatorenal Toxicity and the Possible Therapeutic Role of Mesenchymal Stem Cell-Derived Exosomes in Wistar Rats","fulltext":[{"header":"BACKGROUND","content":"\u003cp\u003eCyclophosphamide (CTX) is one among the anticancer medications most commonly used to treat hematological malignancies and various solid tumors \u003cb\u003e(\u003c/b\u003eHu et al., \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). CTX-induced nephrotoxicity is a typical limiting issue for its application, despite its widespread clinical use as antineoplastic medication \u003cb\u003e(\u003c/b\u003eIqubal et al., \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). The kidney is the body's primary excretory organ and a vital organ that controls both extracellular and intracellular physiological processes \u003cb\u003e(\u003c/b\u003eAyza et al., \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Its checkpoint function makes it one of the primary organs targeted by drug toxicity \u003cb\u003e(\u003c/b\u003eSalama et al., \u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Hepatotoxicity of CTX is also reported by Refaie et al. (\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e2022\u003c/span\u003e) because it is a prodrug and so undergoes hepatic metabolism. CYP34A acts on CTX in the liver, converting it to phosphoramide mustard and acrolein \u003cb\u003e(\u003c/b\u003eBarnett et al., \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eSeveral investigations have shown that acrolein, which produces reactive oxygen species (ROS) and compromises cellular antioxidant defenses, is the cause of the severe toxicity of CTX \u003cb\u003e(\u003c/b\u003eEl-kashef, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2018\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e. This results in oxidative stress and damages cellular macromolecules like proteins, lipids, and nucleic acids through oxidative damage \u003cb\u003e(\u003c/b\u003eMahmoud et al., \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Furthermore, the oxidative stress brought on by CTX treatment also induces inflammation through the regulation of the Nrf2, NlRP3, NF-κB, and p38 MAPK pathways \u003cb\u003e(\u003c/b\u003eLin et al., \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Additionally, the treatment induces apoptosis by raising cleaved caspase-3 and other pro-apoptotic protein levels, accelerating cytochrome c activity, and impairing mitochondria \u003cb\u003e(\u003c/b\u003eZhang et al., \u003cspan citationid=\"CR84\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eNumerous approaches are used to combat the side effects of CTX, including the use of the antioxidant Mesna, alternative CTX analogs, and low-dose of CTX combined with other anticancer medications \u003cb\u003e(\u003c/b\u003eCasak et al., \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). However, these approaches are ineffective and are not suitable for a variety of applications \u003cb\u003e(\u003c/b\u003eBasu et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). Thus, the search for an appropriate and potent chemoprotective drug that might lessen the harmful effects of CTX is urgently needed \u003cb\u003e(\u003c/b\u003ePatwa et al., \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e2020\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eAs a regenerative medicine technique, stem cell-based therapy has attracted a lot of interest since it provides patients with previously incurable illnesses with new alternatives \u003cb\u003e(\u003c/b\u003eHoang et al., \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Because of their capacity for proliferation, differentiation, and immunomodulation, mesenchymal stem cells (MSCs) are frequently employed in regenerative medicine. MSC infusion may aid in the reduction and recovery of drug-induced toxicities, as evidenced by the recent finding of MSCs' therapeutic advantages in situations of liver disorders \u003cb\u003e(\u003c/b\u003eAwadalla et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Furthermore, previous studies have demonstrated that MSCs can prevent renal interstitial fibrosis and protect renal tubular epithelial cells from injury \u003cb\u003e(\u003c/b\u003eHe et al., \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Nevertheless, there are disadvantages to clinical use of cell-based MSC treatment. These comprise: \u003cb\u003e1)\u003c/b\u003e the challenge of preserving an adequate supply of cells with a stable phenotype \u003cb\u003e(Musial-Wysocka et al., 2019)\u003c/b\u003e; and \u003cb\u003e2)\u003c/b\u003e the risk of pulmonary microvasculature entrapment following intravenous delivery of a large number of cells \u003cb\u003e(\u003c/b\u003eM\u0026auml;kel\u0026auml; et al., \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Moreover, they have a risk of tumor formation \u003cb\u003e(\u003c/b\u003eBarkholt et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). Alternative MSC-based products are also required, preferably with minimal side effects and therapeutic potential.\u003c/p\u003e \u003cp\u003eExosomes are nanoscale, spherical, and lipid bi-layered single membrane extracellular vesicles, which act as intercellular messengers. They have been regarded as miniature versions of their parental cells, partially because exosomes from a certain cell type provide cell-specific or unique sets of biomolecules \u003cb\u003e(\u003c/b\u003eVizoso et al., \u003cspan citationid=\"CR75\" class=\"CitationRef\"\u003e2017\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e. These biomaterials are intelligent and controlled, exhibiting enormous potential in cell-free tissue regeneration and capable of engaging in a range of physiological and pathological activities, including tissue repair and regeneration through the transmission of various biological signals \u003cb\u003e(\u003c/b\u003eWang and Pan, \u003cspan citationid=\"CR77\" class=\"CitationRef\"\u003e2023\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e. Exosomes generated from stem cells carry over similar medicinal properties from their parent cells, such as tissue regeneration, immunomodulation, and anti-inflammation \u003cb\u003e(\u003c/b\u003eRen, \u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e2019\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e. Stem cell-derived exosomes have many advantages over stem cells, including non-immunogenicity, non-infusion toxicity, ease of access, simple preservation, lack of tumorigenic potential, and lack of ethical concerns \u003cb\u003e(\u003c/b\u003eTan et al., \u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Exosomes incorporate within recipient cells by micropinocytosis and phagocytosis after interacting with them through their surface receptor molecules and ligand. Because MSCs have remarkable regeneration potential for treating diseases, advances in regenerative medicine have made it easier for researchers to separate exosomes from these cells \u003cb\u003e(Mut\u003c/b\u003ehu et al., \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eExosomes generated from MSCs (MSC-Exos) replicate the functions of their parent MSCs by delivering different genetic and protein cargos to target cells \u003cb\u003e(\u003c/b\u003eCao et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). According to recent research, MSCs-Exos may be able to treat both acute and chronic liver disorders \u003cb\u003e(\u003c/b\u003eWang et al., \u003cspan citationid=\"CR76\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). They stimulated quiescent hepatocytes to reenter the cell cycle and enhanced the production of PCNA and hepatocyte regeneration genes, ultimately aiding in hepatocyte proliferation \u003cb\u003e(\u003c/b\u003eNong et al., \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). According to recent data, MSCs-Exos also boost hepatocyte function, limit hepatocyte death, encourage angiogenesis and hepatocyte proliferation, and lessen inflammatory responses by obstructing inflammatory cytokine production and immune cell infiltration \u003cb\u003e(\u003c/b\u003ePsaraki et al., \u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Furthermore, MSCs-Exos have become an effective therapy for chronic kidney disorders \u003cb\u003e(\u003c/b\u003eCao et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). In an AKI model of renal ischemia-reperfusion injury, MSC-Exos promoted both the mitochondrial function of tubular epithelial cells and the recovery of kidney function via the Keap1-Nrf2 signaling pathway \u003cb\u003e(\u003c/b\u003eCao et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). In an AKI model brought on by toxins, they can also lessen the occurrence of tubular hyaline casts and tubular cell necrosis \u003cb\u003e(\u003c/b\u003eZhou et al., \u003cspan citationid=\"CR85\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). The purpose of this study was to evaluate the potential therapeutic benefit of Exos produced from AD-MSCs in comparison to AD-MSCs against CTX-induced hepatorenal toxicity in a rat model. The study was further expanded to investigate the mechanisms of action and associated signal pathways in an attempt to establish an experimental basis for the development of a cell-free treatment strategy for the management of hepatorenal toxicity caused by anti-cancer medications.\u003c/p\u003e"},{"header":"MATERIAL AND METHODS","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eChemicals and kits\u003c/h2\u003e \u003cp\u003eDulbecco\u0026rsquo;s Modified Eagle\u0026rsquo;s Medium (DMEM), fetal bovine serum (FBS), 0.25% trypsin/ EDTA, antibiotic including streptomycin and penicillin, phosphate-buffered saline (PBS), 0.075% collagenase digestion solution, Roswell Park Memorial Institute (RPMI) medium, bovine serum albumin (BSA) and serum-free medium 199 containing HEPES 25mM were purchased from Sigma-Aldrich, USA. Cyclophosphamide (CTX, Endoxan\u0026reg;) 1g vial was obtained from Baxter Oncology GmbH, Germany. All other unspecified chemicals used in this study were of analytical grade and were not further purified.\u003c/p\u003e \u003cp\u003eColorimetric kits for measurement of urea, creatinine, ALT, AST, and MDA were acquired from Biodiagnostic Co., Egypt. The enzyme-linked immunosorbent assay (ELISA) kits for the detection of KIM-1, MDH, and GLDH were purchased from MyBioSource, USA. TNF-α kit was obtained from Cloud-Clone, USA. Clusterin was supplied from LSBio, USA.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eIsolation and propagation of adipose tissue-derived MSCs (AD-MSCs)\u003c/h2\u003e \u003cp\u003eAdipose tissue around epididymis of adult male \u003cem\u003eWistar\u003c/em\u003e\u003c/p\u003e \u003cp\u003erats was utilized in this study. Next, to avoid tissue dehydration, 200\u0026ndash;300 \u0026micro;l of sterile saline were added for every 0.5 g of adipose tissue. With a pair of sterilized, sharp scissors, the tissue was sliced into pieces smaller than one millimeter. Adipose tissue was mixed with sterilized saline at a ratio of 3:1 (saline: adipose tissue), followed by the addition of collagenase solution to a final concentration of 0.5 units/ ml. The falcon tubes with their contents were set on a shaker (60\u0026thinsp;\u0026plusmn;\u0026thinsp;15 min). The tubes were then centrifuged for five minutes at room temperature at 600 x g. Gently drain off the supernatant and lipid layer from the tube. The cell pellet was extracted, reconstituted in 40 ml of PBS, and centrifuged again at 600 x g for five minutes at room temperature. After being resuspended again in 5 ml PBS, the cell suspension was filtered through a 100-mm filter into a 50-ml falcon tube to which 2 ml of PBS was added to rinse the remaining cells through the filter. The flow-through was pipetted into a new falcon tube through a 40-mm filter. The tubes were centrifuged for the third time at 600\u0026times;g for 5 min at room temperature, and the cells were resuspended in PBS. After that, an aliquot of the cell suspension was taken out for cell culture in DMEM media with 20% FBS. The medium was changed every 3 days thereafter. After about 7 days, cells reached subconfluence and was detached with trypsin/EDTA, reseeded at 4 \u0026times; 10\u003csup\u003e3\u003c/sup\u003e cells/cm\u003csup\u003e2\u003c/sup\u003e, and used for infusion after the third passage \u003cb\u003e(\u003c/b\u003eChen et al., \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2011\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eCharacterization of AD-MSCs\u003c/h2\u003e \u003cdiv id=\"Sec6\" class=\"Section3\"\u003e \u003ch2\u003eMorphological identification\u003c/h2\u003e \u003cp\u003eUsing inverted microscopy, the morphology of the cells in cultures was investigated. MSCs in culture were identified by their adhesiveness to the tissue culture flask and fusiform shape.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eFlow cytometry identification:\u003c/h2\u003e \u003cp\u003eThe surface profile of the cultivated MSCs was examined by flow cytometric analysis (CD90, CD105, and CD34). Cells were then washed and resuspended in PBS provided with 3% FBS containing saturating concentrations (1: 100) dilution of the following fluorescein isothiocyanate-conjugated monoclonal antibodies: anti-CD90 (+\u0026thinsp;ve marker), anti-CD105 (+\u0026thinsp;ve marker) and anti-CD34 (-ve marker) (BD Pharmingen). Next, forward scatter analysis (Becton-Dickinson, Canada) was used to investigate the samples \u003cb\u003e(\u003c/b\u003eGhaneialvar et al., \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2018\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eExosomes isolation\u003c/h2\u003e \u003cp\u003eThe supernatants of the fourth passage of AD-MSCs (5x10\u003csup\u003e6\u003c/sup\u003e cells/ml) were used to extract exosomes, which were then cultivated in RPMI medium devoid of FBS and supplemented with 0.5% BSA. Following centrifugation for 20 minutes at 2000xg to eliminate debris, Using a Beckman Coulter Optima L 90K ultracentrifuge, cell-free supernatants were centrifuged for one hour at 4\u0026deg;C at 100,000xg, cleaned in serum-free medium 199 containing 25 mM HEPES and then subjected to another ultracentrifugation in the same settings. The Bradford technique (BioRad, Hercules, Canada) was used to quantify the protein content. Following an overnight stay in the medium used to collect them, the pellet was frozen at -80\u0026deg;C \u003cb\u003e(\u003c/b\u003eEl-Tookhy et al., \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2017\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eCharacterization of exosomes\u003c/h2\u003e \u003cdiv id=\"Sec10\" class=\"Section3\"\u003e \u003ch2\u003eExosomes morphology\u003c/h2\u003e \u003cp\u003eUtilizing transmission electron microscopy (TEM), the morphological appearance of exosomes was obtained. They were put on copper grids and then stained with phosphotungstic acid and examined. Images were obtained by a secondary electron at a working distance of 15 to 25 mm and an accelerating voltage of 20 and 30 KV. With the Jeol T300 system, digital acquisition and analysis were carried out.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eExosome protein content\u003c/h2\u003e \u003cp\u003eFollowing the manufacturer's instructions, the total protein content of the exosomes was determined using the BCA protein assay kit (Novagen). After isolating the exosome, it was diluted in PBS at a ratio of 1:10 (by ten times), mixed with the BCA reagent, and incubated for fifteen minutes at 60\u0026deg;C, after which, using a NanoDropTM spectrophotometer (ND-1000, Thermo Fisher Scientific, USA), record the corresponding absorbance at 562 nm. The standard curve was drawn by performing the same procedure for different concentrations (50\u0026ndash;250 \u0026micro;g/ml) of BSA \u003cb\u003e(\u003c/b\u003eSzatanek et al., \u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e2017\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eAnimals\u003c/h2\u003e \u003cp\u003eOur methods has been reported in line with the ARRIVE guidelines 2.0 and the checklist is available\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eAnimals caring\u003c/h2\u003e \u003cp\u003eThirty-two adult male \u003cem\u003eWistar\u003c/em\u003e rats, weighing between 190 and 220 g and averaging 4\u0026ndash;5 months of age, were used in this study. From the Holding Company for Biological Products \u0026amp; Vaccines (Vacsera), Helwan, Egypt, they were acquired. Animals were housed under constant humidity (55\u0026thinsp;\u0026plusmn;\u0026thinsp;5%) and temperature (23\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C), with 12-h alternating light and dark cycles with unlimited access to rodent food and water. Before the experiment started, the animals were kept under observation for two weeks to allow them to become acclimated. The experimental protocol was conducted in compliance with the approval of the Scientific Research Ethics Committee, Suez Canal University, Egypt (No. SCU 2023075).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eAnimals grouping\u003c/h2\u003e \u003cp\u003eThe rats were randomized into 4 groups, each with 8 rats, after the acclimatization period: \u003cb\u003eGroup (1)\u003c/b\u003e: Control, healthy rats served as control, and received PBS intraperitonealy (i.p.). \u003cb\u003eGroup (2)\u003c/b\u003e: CTX, rats were injected i.p. with a single dose of CTX (50 mg/kg) dissolved in PBS followed by rotating doses of 8 mg/kg of CTX daily for two weeks \u003cb\u003e(\u003c/b\u003eNeosar, \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2013\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e. \u003cb\u003eGroup (3)\u003c/b\u003e: CTX\u0026thinsp;+\u0026thinsp;AD-MSCs, rats were infused i.v. with 1\u0026times;10\u003csup\u003e6\u003c/sup\u003e cells/rat dissolved in PBS day after day for one week starting from the second day of the CTX last dose \u003cb\u003e(\u003c/b\u003eAbbasy et al., \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2010\u003c/span\u003e), and \u003cb\u003eGroup (4)\u003c/b\u003e: CTX\u0026thinsp;+\u0026thinsp;AD-MSCs- Exo, rats were injected i.v. with 100 \u0026micro;g of exosomes derived from AD-MSCs dissolved in 1 ml PBS day after day for one week starting from the second day of the CTX last dose \u003cb\u003e(\u003c/b\u003eGuo et al., \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003ePreparation of blood samples\u003c/h2\u003e \u003cp\u003eAt finishing the experiment, rats were fasted overnight and blood samples were taken from the tail vein. The blood was then centrifuged for 15 minutes at 4\u0026deg;C and 3000 rpm to obtain sera. Serum samples were cryopreserved at -20\u0026deg;C until future assays were conducted (Urea, creatinine, ALT, and AST) according to the protocols provided with the assay kits.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eDissection and tissue preparation\u003c/h2\u003e \u003cp\u003eFollowing the collection of blood samples, the animals were euthanized by cervical dislocation, and samples of their liver and kidney were quickly and carefully removed. They were then immediately cleaned in ice-cold PBS (pH 7.4). Every kidney and liver was separated into three portions; the first portion was weighed and homogenized in ice-cold PBS (pH 7.4) and the resulting homogenates (10% w/v) were centrifuged for 15 min at 4\u0026deg;C at 3000 rpm to get the supernatants, which were separated, aliquoted and stored at -20\u0026deg;C pending biochemical analysis (KIM-1, clusterin, MDH, GLDH, MDA and TNF-α) according to the manufacturer's manuals. The second portion was immediately frozen in liquid nitrogen and preserved at \u0026minus;\u0026thinsp;80\u0026deg;C prior to RNA extraction for molecular genetic analysis. For histological and immunohistochemical procedures, the third portion was fixed in formalin saline (10%).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eGene expression analyses\u003c/h2\u003e \u003cp\u003eTotal RNA was extracted from liver and kidney tissues by using the RNeasy Mini Kit from Qiagen (Germany). One \u0026micro;g of total RNA was reverse transcribed using QuantiTect Reverse Transcription kit (Qiagen, Germany). The RNA integrity was evaluated using Nano Drop 2000 (Thermo Fisher Scientifc, USA) using 260/280 nm ratio. Then, the cDNA synthesis was performed using Revert Aid first-strand cDNA synthesis kit (Thermo Fisher Scientifc, USA) according to the manufacturer\u0026rsquo;s instruction. qPCR was carried out in accordance with the manufacturer's manual using the Quantinova SYBR Green PCR kit (Qiagen, Germany). Specific primers for NF-κB /TLR-4 /Nrf-2 /HO-1 /Bax/ Bcl-2 and GAPDH were used for qPCR. The primer sequences of each target gene are delineated in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. The PCR cycling was set as follows: initial denaturation step at 94\u0026deg;C for 15 min, followed by 40 cycles of denaturation at 94\u0026deg;C for 15 s, annealing at 60\u0026deg;C for 30 s, and extension at 72\u0026deg;C for 30 s for 5 min. The main equations used were: ∆Ct\u0026thinsp;=\u0026thinsp;Ct (gene of interest) \u0026ndash; Ct (housekeeping gene) followed by ∆∆Ct = ∆Ct (treated sample) \u0026ndash; ∆Ct (untreated sample). The overall formula was 2\u003csup\u003e\u0026ndash;∆∆C\u003c/sup\u003e to calculate the relative fold of change.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimers sequence of the target genes for the real-time quantitative reverse transcription-polymerase (RT-qPCR)\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward primer\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse primer\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eNF-κB (\u003c/b\u003eYounis et al. \u003cspan citationid=\"CR82\" class=\"CitationRef\"\u003e2021\u003c/span\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTGCGATACCTTAATGACAGCG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAATTTGGCTTCCTTTCTTGGCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eTLR-4 (\u003c/b\u003eYounis et al. \u003cspan citationid=\"CR82\" class=\"CitationRef\"\u003e2021\u003c/span\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGACATCCAAAGGAATACTGCAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCCTTCATGTCTATAGGTGATGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eNrf-2 (\u003c/b\u003eEl-Agamy et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2018\u003c/span\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTTGTAGATGACCATGAGTCGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGTCCTGCTGTATGCTGCTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eHO-1 (\u003c/b\u003eEl-Agamy et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2018\u003c/span\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCTGCAGGGGAGAATCTTGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTGGTGAGGGAAATGTGCCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eBax (\u003c/b\u003eAwadalla et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2023\u003c/span\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGCGATGAACTGGACAACAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCAAAGTAGAAAAGGGCAACC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eBcl-2 (\u003c/b\u003eAwadalla et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2023\u003c/span\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGTGAACTGGGGGAGGATTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCATGCTGGGGCCATATAGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eGAPDH (\u003c/b\u003eAwadalla et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2023\u003c/span\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGACAGCCGCATCTTCTTGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTCCCATTCTCAGCCTTGAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eHistopathological procedure of liver and kidney tissues\u003c/h2\u003e \u003cp\u003eThe liver and kidney tissues were fixed for 24 hours in 10% neutral formalin saline. The tissues were then rinsed with tap water and dehydrated using various grades of ethyl alcohol. After that, the specimens were cleaned in xylene and embedded in paraffin bee wax for a whole day at 56\u0026deg;C in a hot air oven. The paraffin bee wax tissue blocks were divided into 4 micron-thick segments using a rotary microtome. Hematoxylin and eosin staining was used following standard de-waxing and hydration, and to identify the histological alterations in the liver and kidney tissues, an optical microscope was employed \u003cb\u003e(Bancroft et al., 1996)\u003c/b\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eImmunohistochemical Assay\u003c/h2\u003e \u003cp\u003eThe other paraffin sections of liver and kidney from each group were mounted on positively charged slides by using avidinbiotin- peroxidase complex (ABC) method for detection of the expression of COX-2 and iNOS. Rat COX-2 polyclonal Antibody (ABclonal, USA, Dil.: 1:100) and rat iNOS polyclonal Antibody (ABclonal, USA, Dil.: 1:100). Sections from each group were incubated with these antibodies; then the reagents required for ABC method were added (Vectastain ABC-HRP kit, Vector laboratories). Each marker expression was labeled with peroxidase and colored with diaminobenzidine (DAB, produced by Sigma) to detect antigen-antibody complex. Negative controls were included using non-immune serum in place of the primary or secondary antibodies. IHC stained sections were examined \u003cem\u003evia\u003c/em\u003e using Olympus microscope (BX-53).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eStatistical Analysis\u003c/h2\u003e \u003cp\u003eAll the results were presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation. Moreover, mean comparisons and analysis of variance (ANOVA) were applied, \u003cem\u003eP\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.05 was considered significant. All statistics were calculated using SPSS software (Chicago, Illinois, USA, V.20) for computer program.\u003c/p\u003e \u003c/div\u003e"},{"header":"RESULTS","content":"\u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003eCharacterization of AD-MSCs\u003c/h2\u003e \u003cdiv id=\"Sec23\" class=\"Section3\"\u003e \u003ch2\u003eMorphological characterization\u003c/h2\u003e \u003cp\u003eSeven days from the primary culture, the MSCs of cultured flasks proliferated, exhibited different shapes with well-developed cytoplasmic processes, granular cytoplasms, and vesicular nuclei. Twelve days from the primary culture, the adherent cells reached 70\u0026ndash;90% confluency and appeared triangular, star-shaped, and spindle-shaped \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec24\" class=\"Section2\"\u003e \u003ch2\u003eFlow cytometric surface marker expression analysis for characterization of isolated AD-MSCs\u003c/h2\u003e \u003cp\u003eThe identity of the isolated AD-MSCs was confirmed as mesenchymal stem cells using flow cytometric analysis. The isolated cells exhibited positive expression of specific mesenchymal stem cells markers, namely CD90 (94.20%) and CD105 (99.80%), while the expression of the hematopoietic marker CD34 (6.43%) was negative (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cdiv id=\"Sec25\" class=\"Section3\"\u003e \u003ch2\u003eCharacterization of Exosomes\u003c/h2\u003e \u003cdiv id=\"Sec26\" class=\"Section4\"\u003e \u003ch2\u003eMorphological characterization\u003c/h2\u003e \u003cp\u003eTransmission electron microscopy (TEM) images for the isolated exosomes revealed the presence of macrovesicles that have the characteristic and morphology of exosomes, with their expected structures and with a diameter range of 28.38\u0026ndash;58.77 nm on a 200 nm scale as seen in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec27\" class=\"Section3\"\u003e \u003ch2\u003eQuantification of protein content of AD- MSCs derived exosomes\u003c/h2\u003e \u003cp\u003eThe protein concentration of AD-MSCs-Exos using BCA-Kit showed that the protein concentration of the isolated Exos was 200\u0026thinsp;\u0026plusmn;\u0026thinsp;20 ug/ml.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec28\" class=\"Section2\"\u003e \u003ch2\u003eAD-MSCs-Exo recovered liver functions after CTX- induced hepatorenal toxicity in rats\u003c/h2\u003e \u003cp\u003eAs showed in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, CTX group exhibited significant rise (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) in serum levels of ALT and AST activities; MDH and GLDH levels in hepatic tissues in contrast to the control group. On the opposite side, CTX\u0026thinsp;+\u0026thinsp;AD-MSCs group and CTX\u0026thinsp;+\u0026thinsp;AD-MSCs-Exo group brought about significant reduction (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) in their values relative to CTX group. It is worthy to emphasize that the reduction of ALT, AST and GLDH values were more significant (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) in CTX\u0026thinsp;+\u0026thinsp;AD-MSCs-Exo group than CTX\u0026thinsp;+\u0026thinsp;AD-MSCs group.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eEffect of AD-MSCs-Exo treatment on the values of ALT, AST, MDH, and GLDH after CTX- induced hepatorenal toxicity in rats\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eControl\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTX\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCTX\u0026thinsp;+\u0026thinsp;AD-MSCs\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eCTX\u0026thinsp;+\u0026thinsp;AD-MSCs -Exo\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eALT (U/L)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e41.00\u0026thinsp;\u0026plusmn;\u0026thinsp;1.41\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e155.00\u0026thinsp;\u0026plusmn;\u0026thinsp;5.90\u003csup\u003e\u003cb\u003ea\u003c/b\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e91.00\u0026thinsp;\u0026plusmn;\u0026thinsp;1.41\u003csup\u003e\u003cb\u003eb\u003c/b\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e67.50\u0026thinsp;\u0026plusmn;\u0026thinsp;3.53\u003csup\u003e\u003cb\u003ecd\u003c/b\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eAST (U/L)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e43.50\u0026thinsp;\u0026plusmn;\u0026thinsp;2.12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e164.50\u0026thinsp;\u0026plusmn;\u0026thinsp;7.77\u003csup\u003e\u003cb\u003ea\u003c/b\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e92.50\u0026thinsp;\u0026plusmn;\u0026thinsp;3.53\u003csup\u003e\u003cb\u003eb\u003c/b\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e63.00\u0026thinsp;\u0026plusmn;\u0026thinsp;4.24\u003csup\u003e\u003cb\u003ecd\u003c/b\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eMDH\u003c/b\u003e\u003c/p\u003e \u003cp\u003e\u003cb\u003e(Pg/mg protein)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e3.15\u0026thinsp;\u0026plusmn;\u0026thinsp;0.76\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e25.74\u0026thinsp;\u0026plusmn;\u0026thinsp;0.97\u003csup\u003e\u003cb\u003ea\u003c/b\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e18.49\u0026thinsp;\u0026plusmn;\u0026thinsp;0.98\u003csup\u003e\u003cb\u003eb\u003c/b\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e16.19\u0026thinsp;\u0026plusmn;\u0026thinsp;3.39\u003csup\u003e\u003cb\u003ec\u003c/b\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eGLDH\u003c/b\u003e\u003c/p\u003e \u003cp\u003e\u003cb\u003e(ng/mg protein)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e1.73\u0026thinsp;\u0026plusmn;\u0026thinsp;0.09\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e6.52\u0026thinsp;\u0026plusmn;\u0026thinsp;0.19\u003csup\u003e\u003cb\u003ea\u003c/b\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4.10\u0026thinsp;\u0026plusmn;\u0026thinsp;0.33\u003csup\u003e\u003cb\u003eb\u003c/b\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2.91\u0026thinsp;\u0026plusmn;\u0026thinsp;0.29\u003csup\u003e\u003cb\u003ecd\u003c/b\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003ea: Significant difference between control and CTX group, b: Significant difference between CTX group and CTX\u0026thinsp;+\u0026thinsp;AD-MSCs group, c: Significant difference between CTX group and CTX\u0026thinsp;+\u0026thinsp;AD-MSCs-Exo group, d: Significant difference between CTX\u0026thinsp;+\u0026thinsp;AD-MSCs group and CTX\u0026thinsp;+\u0026thinsp;AD-MSCs-Exo group. Data are mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD (n\u0026thinsp;=\u0026thinsp;8).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec29\" class=\"Section2\"\u003e \u003ch2\u003eAD-MSCs-Exos restored kidney functions after CTX induced hepatorenal toxicity in rats\u003c/h2\u003e \u003cp\u003eAs illustrated in Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e, compared to the control group, CTX group displayed significant rise (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) in serum levels of urea and creatinine, kidney contents of KIM-1 and clusterin. Conversely, CTX\u0026thinsp;+\u0026thinsp;AD-MSCs group and CTX\u0026thinsp;+\u0026thinsp;AD-MSCs- Exo group disclosed significant drop (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) in their levels equated to their values in CTX group. Noteworthy, the reduction in urea, creatinine and KIM-1 levels were more significant (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) in CTX\u0026thinsp;+\u0026thinsp;AD-MSCs-Exo than CTX\u0026thinsp;+\u0026thinsp;AD-MSCs group.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eEffect of AD-MSCs-Exo treatment on kidney function indices; urea, creatinine, KIM-1 and clusterin after CTX- induced hepatorenal toxicity in rats\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eControl\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTX\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCTX\u0026thinsp;+\u0026thinsp;AD-MSCs\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eCTX\u0026thinsp;+\u0026thinsp;AD-MSCs- Exo\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eUrea (mg/dL)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e24.85\u0026thinsp;\u0026plusmn;\u0026thinsp;1.62\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e44.00\u0026thinsp;\u0026plusmn;\u0026thinsp;2.82\u003csup\u003e\u003cb\u003ea\u003c/b\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e34.00\u0026thinsp;\u0026plusmn;\u0026thinsp;1.41\u003csup\u003e\u003cb\u003eb\u003c/b\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e28.00\u0026thinsp;\u0026plusmn;\u0026thinsp;1.41\u003csup\u003e\u003cb\u003ecd\u003c/b\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eCreatinine (mg/dL)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.46\u0026thinsp;\u0026plusmn;\u0026thinsp;0.06\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1.56\u0026thinsp;\u0026plusmn;\u0026thinsp;0.23\u003csup\u003e\u003cb\u003ea\u003c/b\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.96\u0026thinsp;\u0026plusmn;\u0026thinsp;0.06\u003csup\u003e\u003cb\u003eb\u003c/b\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.67\u0026thinsp;\u0026plusmn;\u0026thinsp;0.11\u003csup\u003e\u003cb\u003ecd\u003c/b\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eKIM-1\u003c/b\u003e\u003c/p\u003e \u003cp\u003e\u003cb\u003e(Pg/mg protein)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e40.16\u0026thinsp;\u0026plusmn;\u0026thinsp;5.82\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e449.86\u0026thinsp;\u0026plusmn;\u0026thinsp;40.17\u003csup\u003e\u003cb\u003ea\u003c/b\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e246.52\u0026thinsp;\u0026plusmn;\u0026thinsp;17.87\u003csup\u003e\u003cb\u003eb\u003c/b\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e194.10\u0026thinsp;\u0026plusmn;\u0026thinsp;3.48\u003csup\u003e\u003cb\u003ecd\u003c/b\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eClusterin\u003c/b\u003e\u003c/p\u003e \u003cp\u003e\u003cb\u003e(ng/mg protein)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e7.29\u0026thinsp;\u0026plusmn;\u0026thinsp;0.54\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e34.92\u0026thinsp;\u0026plusmn;\u0026thinsp;1.43\u003csup\u003e\u003cb\u003ea\u003c/b\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e16.72\u0026thinsp;\u0026plusmn;\u0026thinsp;0.58\u003csup\u003e\u003cb\u003eb\u003c/b\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e13.50\u0026thinsp;\u0026plusmn;\u0026thinsp;2.00\u003csup\u003e\u003cb\u003ec\u003c/b\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003ea: Significant difference between control and CTX group, b: Significant difference between CTX group and CTX\u0026thinsp;+\u0026thinsp;AD-MSCs group, c: Significant difference between CTX group and CTX\u0026thinsp;+\u0026thinsp;AD-MSCs-Exo group, d: Significant difference between CTX\u0026thinsp;+\u0026thinsp;AD-MSCs group and CTX\u0026thinsp;+\u0026thinsp;AD-MSCs-Exo group. Data are mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD (n\u0026thinsp;=\u0026thinsp;5).\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eAD-MSCs-Exo attenuated hepatic and renal oxidative stress induced by CTX in rats\u003c/h3\u003e\n\u003cp\u003eOxidative stress plays a key role in the pathomechanism of CTX-induced hepatorenal toxicity. Compared to the control group, CTX group experienced significant enhancement (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) in liver and kidney contents of MDA as a lipid peroxidation marker \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e. On the other hand, CTX\u0026thinsp;+\u0026thinsp;AD-MSCs group and CTX\u0026thinsp;+\u0026thinsp;AD-MSCs-Exo group produced significant decline (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) in liver and kidney MDA contents contrary to CTX group. The most prominent reduction of MDA values was observed in CTX\u0026thinsp;+\u0026thinsp;AD-MSCs-Exo group compared to CTX\u0026thinsp;+\u0026thinsp;AD-MSCs group.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cdiv id=\"Sec31\" class=\"Section2\"\u003e \u003ch2\u003eAD-MSCs-Exo mitigated hepatic and renal TNF-α activated by CTX in rats\u003c/h2\u003e \u003cp\u003eBecause TNF-α activation is a critical mediator of hepatorenal injury after CTX exposure, we studied the effects of AD-MSCs-Exo on inflammatory response as\u003c/p\u003e \u003cp\u003ewell. Herein, CTX induced significant (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) increase in hepatic and renal contents of TNF-α in contrast to the control group. On the opposite side, CTX\u0026thinsp;+\u0026thinsp;AD-MSCs group and CTX\u0026thinsp;+\u0026thinsp;AD-MSCs-Exo group disclosed significant decrease (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) in the hepatic and renal TNF-α contents \u003cem\u003eversus\u003c/em\u003e CTX group. It is noticed that the reduction in hepatic TNF-α content was more significant (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) in CTX\u0026thinsp;+\u0026thinsp;AD-MSCs-Exo group than CTX\u0026thinsp;+\u0026thinsp;AD-MSCs group.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec32\" class=\"Section2\"\u003e \u003ch2\u003eAD-MSCs-Exo upregulated Nrf-2/HO-1 pathway in hepatic and renal tissues of rats challenged with CTX\u003c/h2\u003e \u003cp\u003eTo explore the molecular background of the therapeutic effects of AD-MSCs-Exo on CTX-induced hepatorenal toxicity, we assessed Nrf-2/ HO-1 gene expression \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e in the liver and kidney tissues. In the liver tissues, there were insignificant (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05) downregulation in the gene expression of Nrf-2/HO-1 in CTX group compared to control group. In kidneys of CTX-treated rats, significant (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) downregulation in Nrf-2 and HO-1 gene expression was observed contrary to the control rats. Such downregulation of Nrf-2 and HO-1 in the liver and kidney tissues of CTX-challenged rats was significantly (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) attenuated by AD-MSCs and AD-MSCs-Exo treatments.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cdiv id=\"Sec33\" class=\"Section3\"\u003e \u003ch2\u003eAD-MSCs-Exo downregulated hepatic and renal NF-κB/TLR-4 pathway in rats challenged with CTX\u003c/h2\u003e \u003cp\u003eNF-κB/TLR-4 pathway is the critical inflammatory avenue implicated in liver and kidney intoxication after CTX exposure. Here in we studied the impact of AD-MSCs-Exo treatment on this pathway from molecular point of view. CTX induced significant (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) upregulation in hepatic and renal NF-κB and TLR-4 gene expressions \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e. Remarkably, CTX\u0026thinsp;+\u0026thinsp;AD-MSCs and CTX\u0026thinsp;+\u0026thinsp;AD-MSCs-Exo treatment exerted an anti-inflammatory effect in the liver of CTX-treated rats, as evidenced by both mitigation of the NF-κB and TLR-4 gene expression \u003cem\u003eversus\u003c/em\u003e CTX group. It was noticed that the downregulation of NF-κB and TLR-4 expressions was more significant (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) in CTX\u0026thinsp;+\u0026thinsp;AD-MSCs-Exo group than CTX\u0026thinsp;+\u0026thinsp;AD-MSCs group. Likewise, CTX\u0026thinsp;+\u0026thinsp;AD-MSCs and CTX\u0026thinsp;+\u0026thinsp;AD-MSCs-Exo treatments exhibited an anti-inflammatory effect in the kidney of CTX-treated rats, as manifested by the significant downregulation (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) of the NF-κB and TLR-4 gene expression. The most significant downregulation in NF-κB gene expression was perceived in CTX\u0026thinsp;+\u0026thinsp;AD-MSCs-Exo group.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec34\" class=\"Section3\"\u003e \u003ch2\u003eAD-MSCs-Exo suppressed apoptosis of liver and kidney tissues of rats challenged with CTX\u003c/h2\u003e \u003cp\u003eTo further investigate the therapeutic efficacy of AD-MSCs-Exo on CTX-induced liver and kidney intoxication in rats, we assessed hepatic and renal expression of apoptosis regulatory genes, such as Bax and Bcl-2. CTX significantly (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) downregulated Bcl-2 gene expression level; paralleled with significant (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) upregulation in Bax gene expression \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e. Intriguingly, the CTX-induced apoptosis in the liver and kidney was attenuated by AD-MSCs and AD-MSCs-Exo treatments. This regulatory effect was documented by the significant upregulation (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) of Bcl-2 gene expression along with the significant downregulation (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) of Bax gene expression in both liver and kidney tissues. The downregulation of Bax and upregulation of Bcl-2 were more significant (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) in CTX\u0026thinsp;+\u0026thinsp;AD-MSCs- Exo group than CTX\u0026thinsp;+\u0026thinsp;AD-MSCs group.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eEffect of AD-MSCs Exo treatment on liver and kidney histopathological features in CTX- induced hepatorenal toxicity in rats\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThe CTX-induced hepatorenal injury and histopathological alterations were ameliorated by both AD-MSCs and AD-MSCs-Exo treatments. The impact of these therapeutic approaches in counteracting liver and kidney injury was assessed by evaluation of histological changes in liver and kidney tissues stained with H\u0026amp;E staining.\u003c/p\u003e \u003cp\u003eHistopathological analysis of H\u0026amp;E-stained hepatic sections from control rats showed normal histological of portal area and hepatocytes \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eA\u003cb\u003e)\u003c/b\u003e. Analysis of H\u0026amp;E-stained liver sections of CTX-treated rats demonstrated the presence of portal fibrosis with infiltration of high number of mononuclear inflammatory cells and the hepatic sinusoid dilated and engorged with blood \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eB\u003cb\u003e)\u003c/b\u003e. CTX\u0026thinsp;+\u0026thinsp;AD-MSCs treated rats showed portal fibrosis with infiltration by low number of mononuclear inflammatory cells, presence of nuclear pyknosis and vacuolar degeneration in hepatocytes \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eC\u003cb\u003e)\u003c/b\u003e. While in CTX\u0026thinsp;+\u0026thinsp;AD-MSCs-Exo treated rats, there was improvement in tissues architecture as evidenced by minimal portal fibrosis, infiltration of low number of mononuclear inflammatory cells, and less nuclear pyknosis in some hepatocytes compared to CTX group and CTX\u0026thinsp;+\u0026thinsp;AD-MSCs group \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eD\u003cb\u003e)\u003c/b\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eHistopathological analysis of H\u0026amp;E-stained kidney sections from control showed normal histological structure of glomeruli and renal tubules \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003eA\u003cb\u003e)\u003c/b\u003e. CTX-treated rats showed atrophy of renal glomeruli, presence of nuclear pyknosis and mild vacuolar degeneration in epithelial lining of some renal tubules with mild congestion of renal blood vessels \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003eB\u003cb\u003e)\u003c/b\u003e. CTX\u0026thinsp;+\u0026thinsp;AD-MSCs treated rats' illustrated mild nuclear pyknosis in epithelial lining of some renal tubules \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003eC\u003cb\u003e)\u003c/b\u003e. On the other side, CTX\u0026thinsp;+\u0026thinsp;AD-MSCs Exo treated rats showed less nuclear pyknosis in epithelial lining of some renal tubules \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003eD\u003cb\u003e)\u003c/b\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eImmunohistochemical findings of AD-MSCs Exo treatment on liver and kidney tissues in CTX- induced hepatorenal toxicity in rats\u003c/b\u003e \u003c/p\u003e \u003cp\u003eEvaluation of the immunohistochemical examination of liver and kidney tissues obtained from rat in the control group showed negative expression of COX-2 and iNOS. While in rat obtained from CTX group, high positive expression of COX-2 and iNOS in the liver and kidney tissues was detected. Immunohistochemical investigation of COX-2 and iNOS in liver and kidney tissues of rat in CTX\u0026thinsp;+\u0026thinsp;AD-MSCs revealed positive expression of COX-2 and iNOS in the cytoplasm of the hepatocytes. While the positive expression of COX-2 and moderate expression of iNOS was demonstrated in the cytoplasm of renal tubular epithelium. Immunohistochemical evaluation of COX-2 and iNOS in liver and kidney tissues of rat in AD-MSCs-Exo group showed moderate expression of COX-2 and mild expression of iNOS \u003cb\u003e(\u003c/b\u003eFigs.\u0026nbsp;\u003cspan refid=\"Fig11\" class=\"InternalRef\"\u003e11\u003c/span\u003e,\u003cspan refid=\"Fig12\" class=\"InternalRef\"\u003e12\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"DISCUSSION","content":"\u003cp\u003eOne major adverse effect that prevents CTX from being used in the treatment of cancer is hepatorenal toxicity. It has been shown that CTX can cause oxidative stress-related damage to the liver and kidneys \u003cb\u003e(\u003c/b\u003eMahmoud et al., \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Lim et al., \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Despite the fact that numerous studies have focused their attention on CTX hepatorenal toxicity, there are still very few effective treatment options available. Here, we looked at how well AD-MSCs Exo protected rats' hepatorenal toxicity caused by CTX. Our findings demonstrated that by upregulating Nrf-2/HO-1, downregulating NF-κB/TLR-4 and Bax/Bcl-2 signaling pathways, and suppressing oxido-inflammatory stress and apoptotic end points in CTX-challenged rats, AD-MSCs Exo may mitigate liver and kidney injury.\u003c/p\u003e \u003cp\u003eIn the current investigation, liver transaminases (ALT and AST) activity in serum was significantly elevated in rats treated with CTX; significant indicators for assessing liver damage because their blood leakage indicates the degree of liver damage \u003cb\u003e(\u003c/b\u003eYogalakshmi et al., \u003cspan citationid=\"CR81\" class=\"CitationRef\"\u003e2010\u003c/span\u003e) where the increased lipid peroxidation caused by CTX changes the fluidity and integrity of the membrane, which in turn disrupts the permeability of the membrane \u003cb\u003e(\u003c/b\u003eCatal\u0026aacute; and D\u0026iacute;az, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2016\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e and thereby causes them to leak into the bloodstream. Althunibat et al. (\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2023\u003c/span\u003e) shown that in the rat model of CTX-induced hepatotoxicity, blood levels of ALT and AST were elevated. Additionally, hepatic MDH and GLDH levels were significantly higher in the CTX group compared to the control. These findings are similar to those of Schomaker et al. (\u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e2013\u003c/span\u003e), who found that acetaminophen toxicity in the liver was associated with higher levels of GLDH and MDH. These elevations may result from hepatic induction of these enzymes in response to specific medications \u003cb\u003e(\u003c/b\u003eShimizu et al., \u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e1997\u003c/span\u003e) (like CTX in this study) and glucocorticoids in other studies \u003cb\u003e(\u003c/b\u003eTimmerman et al., \u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e2003\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eCTX administration also results in considerable elevation in the levels of serum urea and creatinine compared to control group. Similar findings were reported by Alaqeel and Al-Hariri (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2023\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e, who found that rats treated with CTX, had elevated serum urea and creatinine levels. They are only seen in considerable quantities in the blood, kidneys, and proximal-distal tubules following renal membrane damage and ischemia \u003cb\u003e(\u003c/b\u003eMori et al., \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2005\u003c/span\u003e). Therefore, elevated release of these indicators into the bloodstream suggests renal injury resulting from CTX.\u003c/p\u003e \u003cp\u003eIn the current investigation, nephrotoxicity resulted in the elevation of KIM-1 protein in kidney tissues. According to results from Ijaz et al. (\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2022\u003c/span\u003e), the renal KIM-1 level increased in the rat model of CTX-induced nephrotoxicity. The hypothesis illustrated the cause of high renal KIM-1 level was attributed to extracellular regulated kinase \u0026frac12; (ERK\u0026frac12;) and signal transducer and activator of transcription 3 (STAT3) phosphorylated pathway where STAT3 bounded to KIM-1 promotor and raised its expression at both mRNA and protein level \u003cb\u003e(\u003c/b\u003eMoresco et al., \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). It was illustrated that CTX was more efficient in upregulation of STAT3 phosphorylation \u003cb\u003e(\u003c/b\u003eNoori et al., \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2020\u003c/span\u003e) and therefore raise renal KIM-1 protein levels through STAT3 binding to KIM-1 promotor.\u003c/p\u003e \u003cp\u003eFurthermore, compared to the control group, the CTX group had an elevated level of renal clusterin protein. The overexpression of the clusterin protein indicates the presence of renal damage and serves as a possible indicator of nephrotoxicity \u003cb\u003e(\u003c/b\u003eGirton et al., \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2002\u003c/span\u003e). Previous research revealed a connection between the TGF-β signaling system and clusterin expression. TGF-β1 activates protein kinase C and AP-1 transcriptor protein, which in turn causes the expression of clusterin \u003cb\u003e(\u003c/b\u003eJin and Howe, \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e1997\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e. CTX induces TGF-β1 \u003cb\u003e(\u003c/b\u003eIqubal et al., \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2023\u003c/span\u003e) and thereby caused a rise in renal clusterin protein levels.\u003c/p\u003e \u003cp\u003eAccording to the current findings, liver and kidney tissues treated with CTX showed a substantial increase in MDA protein concentration and iNOS protein expression when compared to the control. These findings are similar to those of Alaqeel and Al-Hariri (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2023\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e, where CTX significantly raised the level of MDA protein and iNOS antibody expression in the renal tissues relative to the control. The active toxic metabolites of CTX, phosphoramide and acrolein, are probably responsible for its anti-malignant effects. Phosphoramide is responsible for CTX's mutagenic effects. On the other hand, acrolein hinders the cellular antioxidant defense system, resulting in highly reactive oxygen species (ROS) formation which interacts with amino acids of the body; which in turn causes morphological and physiological alterations \u003cb\u003e(\u003c/b\u003eCaglayan et al., \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Additionally, hepatocyte-cytochrome P450 mixed function oxidase enzymes oxidize CTX multiple times in the hepatic tissues to generate oxidative agents like acrolein, which contributes to the overproduction of free radicals like ROS and NO \u003cb\u003e(\u003c/b\u003eAlthunibat et al., \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Lipid peroxidation produces MDA as an end product, and MDA level elevated due to oxidative stress \u003cb\u003e(\u003c/b\u003eMahipal and Pawar, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2017\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e resulted from CTX. Additionally, NF-κB activated by CTX \u003cb\u003e(\u003c/b\u003eLan et al., \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2022\u003c/span\u003e) causes iNOS synthesis \u003cb\u003e(\u003c/b\u003eYang et al., \u003cspan citationid=\"CR79\" class=\"CitationRef\"\u003e2015\u003c/span\u003e) and this led to increased iNOS immunoreactivity.\u003c/p\u003e \u003cp\u003eThe findings demonstrated that, in comparison to control, CTX downregulated the Nrf-2/HO-1 signaling pathway in the liver and kidneys. This matches previous research by Mahmoud et al. (\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2017\u003c/span\u003e) \u003cb\u003eand\u003c/b\u003e Althunibat et al. (\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2023\u003c/span\u003e) that demonstrated decreased expression of HO-1 and Nrf-2 in the liver in a rat model of CTX hepatotoxicity. Nuclear factor erythroid 2-related factor 2 (Nrf-2) stimulates the production of many antioxidant enzymes in response to reactive oxygen species (ROS), hence suppressing oxidative stress \u003cb\u003e(\u003c/b\u003eSatta, et al., \u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Under normal circumstances, Kelch-like ECH-associated protein 1 (Keap1), a sensor protein towards electrophiles and ROS, sequesters Nrf2 in the cytoplasm. A moderate degree of oxidative stress causes Nrf2 to be released and enter the nucleus, where it attaches to the DNA promoter region's antioxidant response element (ARE) and initiates heme oxygenase (HO)-1 transcription \u003cb\u003e(\u003c/b\u003eSatta, et al., \u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). It is believed that the transcription regulator Nrf-2 triggers expression of HO-1, which is among the body's most significant antioxidant systems \u003cb\u003e(\u003c/b\u003eLan et al., \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Here, CTX suppressed Nrf-2 signaling as illustrated by Nrf-2 downregulation, and HO-1 gene expression. Despite ROS represent the signal that induces Nrf-2 to dissociate from Keap1 and trigger the antioxidant genes transcription; it inhibited Nrf-2 signaling after injection of CTX. The declined Nrf-2/HO-1 pathway might be due to sustained surplus ROS levels which have been reported to inhibit Nrf-2 in the liver \u003cb\u003e(\u003c/b\u003eAbd El-Twab et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2019\u003c/span\u003e), and the kidney \u003cb\u003e(\u003c/b\u003eMahmoud et al., \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2018\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eAccording to the current approach, rats given CTX showed a considerable increase in the levels of TNF-α in their liver and kidney, as well as a high degree of positive expression for the COX-2 antibody in the liver and kidney. It is also upregulated NF-κB/TLR-4 signaling pathway. These results are consistent with those of Lan et al. (\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2022\u003c/span\u003e), who demonstrated that CTX enhanced TNF-α protein levels and raised the expression levels of TLR-4, MyD88, and NF-κB p65 genes in thymus and spleen tissues. NF-κB is a transcription factor that regulates the immune response and many inflammatory illnesses in various tissues. It is essential for the activation of pro-inflammatory cytokines like COX-2 and TNF-α \u003cb\u003e(\u003c/b\u003eSemis et al., \u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Oxidative stress in CTX-treated tissues activates NF-κB, which leads to the generation of pro-inflammatory cytokines such as IL-1β, TNF-α, and IL-6, which in turn causes tissue damage \u003cb\u003e(\u003c/b\u003eCaglayan et al., \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Additionally, Nrf-2 inhibits the inflammatory response mediated by NF-κB by reducing the activation of NF-κB triggered by oxidative stress, blocking the proteasomal breakdown of IκB-α, and subsequently blocking the nuclear translocation of NF-κB \u003cb\u003e(\u003c/b\u003eSaha et al., \u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Nevertheless, downregulation of Nrf-2 produced from CTX increased severity of CTX-induced toxicity \u003cem\u003evia\u003c/em\u003e NF-κB upregulation. These results showed that Nrf-2 plays a critical role in avoiding drug toxicity, mostly by enhancing the inflammatory response within cells through the NF-κB/TLR-4 signaling pathway.\u003c/p\u003e \u003cp\u003eIt was demonstrated in this work that CTX-induced apoptosis. In the liver and kidney tissue of the CTX group, we showed that, in comparison to the control, there was an elevation of the pro-apoptotic marker Bax and a decrease in the expression of the anti-apoptotic Bcl-2. Consistent with our findings, earlier research demonstrated that CTX could cause kidney tissue to undergo apoptosis by upregulating the expression of apoptotic markers such as caspase-3 and Bax \u003cb\u003e(\u003c/b\u003eCaglayan et al., \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Furthermore, Asiri (2010) reported that in cardiac tissues, CTX dramatically lowers the expression of Bcl-2 and enhances the mRNA expression of P53 and Bax. CTX-induced generation of ROS and therefore increase NF-κB activation, which in turn causes the production of pro-inflammatory mediators. This results in a concerted expression of different pro-apoptotic proteins, such caspases and Bax, or anti-apoptotic proteins, like Bcl-2 \u003cb\u003e(\u003c/b\u003eUllrich et al., \u003cspan citationid=\"CR74\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Overproduction of ROS promotes the dissipation of the mitochondrial membrane potential, which in turn allows cytochrome c to be released into the cytosol. Apoptosis activating factor-1 (Apaf-1) and procaspase-9 combine with cytochrome c to form what is known as an apoptosome, this causes caspase-9 to become auto-activated, ultimately resulting in DNA breakage, cleavage of cellular proteins, and cell death through apoptosis via activation of the executioner caspase-3 \u003cb\u003e(\u003c/b\u003eCircu and Aw, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2010\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e, all of those are crucial mediators of the intrinsic pathway of pro- and anti-apoptotic signals (Bax and Bcl-2) \u003cb\u003e(\u003c/b\u003eRadhiga et al., \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e2012\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eHepatonephrototoxic effects of CTX were further ascertained by the assessment of histological alterations of the liver and kidneys tissue. Histological examination of the liver tissue of rats given CTX treatment revealed portal fibrosis, hepatic sinusoid dilatation, and engorgement of blood vessels in addition to a substantial infiltration of mononuclear inflammatory cells. Furthermore, histological examination of the kidney tissue of rats given CTX revealed nuclear pyknosis, atrophy of the renal glomeruli, and minor vacuolar degeneration in the epithelial lining of some renal tubules accompanied with moderate renal blood vessel congestion. According to Althunibat et al. (\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2023\u003c/span\u003e), mice administered CTX exhibited pronounced centrilobular hepatic necrosis linked to hepatic vacuolation. Studies by Ijaz et al. (\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2022\u003c/span\u003e) demonstrated that renal tissue inter-tubular vessels, tubular dilatation, glomerular hyperemia, and tubule epithelium underwent degenerative alterations as a result of CTX treatment. These pathological alterations could be linked to CTX's capacity to weaken the antioxidant defense system and produce free radicals. According to several reports, the injection of CTX can directly harm the kidney, resulting in glomerulus degeneration, necrosis in the proximal convoluted tubule, distal tubules, pyknosis, etc \u003cb\u003e(\u003c/b\u003eEl-shabrawy et al., \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). In addition to oxidative stress, nephrotoxicity is also significantly influenced by elevated pro-inflammatory cytokines, apoptotic, and fibrotic proteins synthesis \u003cb\u003e(\u003c/b\u003eEl-shabrawy et al., \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2020\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn contrast, the injured liver and kidney tissues showed improved histological characteristics, reduced inflammatory response, decreased apoptosis, and increased antioxidant capacity in both AD-MSCs and AD-MSCs-Exo. These effects may account for the hepatorenal protective properties of both AD-MSCs as well as AD-MSCs-Exo upon CTX-induced tissue damage. These results are consistent with earlier research by \u003cb\u003eEl Araby et al. (2022)\u003c/b\u003e, who examined the hepatotherapeutic effects of MSCs treatment on rats' acetaminophen-induced hepatotoxicity. According to Lin et al. (\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2020\u003c/span\u003e), MSCs have the potential to be a treatment for kidney illness caused by toxicants. Furthermore, MSC-Exos have become an attractive cell-free treatment for chronic renal disease \u003cb\u003e(\u003c/b\u003eCao et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Additionally, MSC-derived Exos have been shown by Tan et al. (\u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e2014\u003c/span\u003e) to have hepatoprotective properties against injury caused by toxicants.\u003c/p\u003e \u003cp\u003eWe used MSCs in this work because of their multipotent characteristics, ease of isolation from many tissues, ease of in vitro expansion, and their extensive therapeutic potential demonstrated in clinical trials. The AD-MSCs employed in this work showed the typical morphological characteristics of MSCs, such as adhesion to the growth plates and a fibroblast-like appearance. Also, AD-MSCs were characterized by flowcytometry through positive expression of CD90 and CD105 and negative expression of CD 34. According to findings by Niyaz et al. (\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e2012\u003c/span\u003e), AD-MSCs isolated from rats were negative for CD45, CD106, and MHC Class II, and positive for CD29, CD90, CD54, and MHC Class I. According to Yao et al. (\u003cspan citationid=\"CR80\" class=\"CitationRef\"\u003e2015\u003c/span\u003e), MSCs were found to express CD14, CD34, CD45, and CD71 at very low levels, whereas they expressed high levels of CD13, CD90, CD44, and CD105.\u003c/p\u003e \u003cp\u003eThe present investigation clarifed the regenerative effects of MSCs on the livers and kidneys of the CTX\u0026thinsp;+\u0026thinsp;AD-MSCs-treated group in comparison to the CTX group. The results showed improvements in the shape and arrangement of cells, as well as an inhibition of the infiltration of mononuclear inflammatory cells, at the level of histopathological examination. Additionally, improvements were observed at the level of biochemical investigations (ALT, AST, MDH, GLDH, urea, creatinine, KIM-1, and clusterin) where liver and kidney functions were restored. The protective effects of MSCs also appeared with decreased levels of MDA, TNF-α in the treated group; also the reaction and distribution of COX-2 and iNOS were decreased. Furthermore, on the molecular level, there were upregulation of Nrf-2/HO-1 and downregulation of NF-κB/TLR-4 and Bax/Bcl-2 signaling pathways. MSCs treatment provides a hepatotherapeutic impact on acetaminophen-induced hepatotoxicity in rats, as demonstrated by \u003cb\u003eEl Araby et al. (2022)\u003c/b\u003e. The hepatoprotective impact of MSCs may be attributed to their anti-inflammatory, anti-apoptotic, and immunomodulatory properties.\u003c/p\u003e \u003cp\u003eThe exact mechanism underlying MSCs' therapeutic potential remains unclear. These cells are thought to have other qualities that make them appealing for therapeutic uses in addition to their unique ability to differentiate, but also the release of a wide variety of bioactive substances that play a vital biological role in damage circumstances, such as chemokines, growth factors, and cytokines; this makes the properties of MSCs \u003cem\u003ein vivo\u003c/em\u003e an issue of therapeutic concerns \u003cb\u003e(\u003c/b\u003eda Silva Meirelles et al., \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). Another possibility is that MSCs could repair damaged cells by releasing microvesicles that include proteins, mRNAs, or microRNAs \u003cb\u003e(\u003c/b\u003eBarnes et al., \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). However, as previously indicated, disadvantages of MSCs have limited their clinical usage. Therefore, different MSC-based and non-complicationous treatment approaches are required.\u003c/p\u003e \u003cp\u003eUsing a conventional procedure previously outlined, the exosomes were separated and purified from AD-MSCs. Exosomes were identified by electron microscope analysis as being spheroids or cup-shaped particles. The AD-MSC Exos's particle size is less than 200 nm, according to protein content analysis. Hu et al.'s (\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2021\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e findings are similar to these data.\u003c/p\u003e \u003cp\u003eComparing the liver and kidneys of the CTX\u0026thinsp;+\u0026thinsp;MSCs Exo-treated group to those of the CTX group and the CTX\u0026thinsp;+\u0026thinsp;AD-MSCs group, the results further clarified the curative properties of MSC-derived exosomes; more significant results were obtained from the regeneration effect of MSCs-Exo than from AD-MSCs alone. At the histopathological level infiltration of mononuclear inflammatory became low with decreased pyknosis in the epithelial lining of certain renal tubules and minor congestion in the hepatic sinusoids. Biochemical analyses revealed that the CTX\u0026thinsp;+\u0026thinsp;AD-MSCs group had significantly lower levels of ALT, AST, MDH, GLDH, urea, creatinine, KIM-1, and clusterin. The CTX\u0026thinsp;+\u0026thinsp;AD-MSCs-Exo group experienced a greater reduction in MDA and TNF-α levels compared to the AD-MSCs alone group. Additionally, immunohistochemical reactions demonstrated that the distribution of iNOS and COX-2 was reduced. Furthermore, on a molecular genetic level, the Nrf-2/HO-1 signaling pathway was elevated, and the NF-κB/TLR-4 and Bax/Bcl-2 signaling pathways were downregulated more strongly in the CTX\u0026thinsp;+\u0026thinsp;AD-MSCs-Exo group compared to the CTX\u0026thinsp;+\u0026thinsp;AD-MSCs group. MSC-Exos have been shown by Wang et al. (\u003cspan citationid=\"CR76\" class=\"CitationRef\"\u003e2022\u003c/span\u003e) to activate proliferative and regenerative responses, which may mitigate acute and chronic liver injury. Additionally, MSC-Exos have shown promise as a cell-free treatment for chronic kidney disease, as demonstrated by Cao et al. (\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2022\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eMSC-Exos have the ability to repair tissue by stimulating angiogenesis, dedifferentiation, and cell proliferation while also reducing oxidative stress and apoptosis \u003cb\u003e(Harrel et al., 2020)\u003c/b\u003e. MSC- Exos replicate the functions of their originator MSCs through delivery of several genetic and protein cargos to the target cells \u003cb\u003e(\u003c/b\u003eCao et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). MiRNA cargos (like miRNA- 10a, miRNA-486) were regarded as pro-regenerative miRNAs due to their ability to promote cell proliferation \u003cb\u003e(\u003c/b\u003eTapparo et al., \u003cspan citationid=\"CR70\" class=\"CitationRef\"\u003e2019\u003c/span\u003e) while miRNA-199a-3p was discovered to reduce apoptosis by downregulating genes linked to apoptosis \u003cb\u003e(\u003c/b\u003eZhang et al., \u003cspan citationid=\"CR83\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Protein cargos (such as extracellular matrix metalloproteinase inducer (EMMPRIN) and metalloproteinase-9 (MMP-9)) have been found to stimulate angiogenesis \u003cb\u003e(\u003c/b\u003eAbu El-Asrar et al., \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Furthermore, MSC-Exos mitigate inflammatory responses by reducing invasion of immune cells such as macrophages, T cells, and NK cells \u003cb\u003e(\u003c/b\u003eHarrell et al., \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). For example, cytokines including IL-6, IL-10, and hepatocyte growth factor (HGF), as well as miRNA-155 \u003cb\u003e(\u003c/b\u003ePers et al., \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e2021\u003c/span\u003e) and miRNA-146a \u003cb\u003e(Tavasolian et al., 2021)\u003c/b\u003e, contribute to MSC-Exos mediated immunoregulation \u003cb\u003e(\u003c/b\u003eWu et al., \u003cspan citationid=\"CR78\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Exos therapy also offers unique benefits: it doesn't require engraftment, which lowers the risk of cancer \u003cb\u003e(\u003c/b\u003eTracy et al., \u003cspan citationid=\"CR73\" class=\"CitationRef\"\u003e2019\u003c/span\u003e); additionally, because of its nanoscale level, it improves the penetration of barriers, biomembranes, and vasculature \u003cb\u003e(\u003c/b\u003eChen et al., \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Collectively, Exos recapitulate to a large extent the immensely broad therapeutic actions previously linked to MSCs \u003cb\u003e(Phinney et al., 2017)\u003c/b\u003e.\u003c/p\u003e"},{"header":"CONCLUSION","content":"\u003cp\u003eIn conclusion, the present approach reveals insightful information for understanding the mechanisms of AD-MSCs-Exos against CTX-induced hepatorenal injury. These include stabilization of oxidative/antioxidant status repression of inflammatory response and arresting the apoptotic pathway. Therefore, AD-MSCs- Exos may be useful for reducing the CTX‐associated target organ toxicities, particularly hepatorenal toxicity, in patients undergoing active chemotherapy regimen with CTX. However, further studies focusing on the standardization of MSC-Exos production, purification, and characterization to improve quality and safety should be carried out to broaden its therapeutic suitability and future clinical applications.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent for publication:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eOur methods were carried out in accordance with the National Institute of Health Guide for the Care and Use of Laboratory Animals (NIH Publications No. 80-23) revised 1996. With the least number possible of animals and that the approval sheet from our institutional committee can be offered upon request.\u003c/p\u003e\n\u003cp\u003e(1) Title of the approved project: Cyclophosphamide: Potential Hepatorenal Toxicity and the Possible Therapeutic Role of Mesenchymal Stem Cell-Derived Exosomes in Wistar Rats (2) Name of the institutional approval committee: Scientific Research Ethics Committee, Suez Canal University, Egypt; (3) Approval number: SCU 2023075 (4) Date of approval: 8/11/2023.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003c/strong\u003eAll authors confirm their consent for publication\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interest:\u0026nbsp;\u003c/strong\u003eThe authors declare that they have no competing interests\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor\u0026rsquo;s contribution\u0026nbsp;\u003c/strong\u003eAN\u0026nbsp;carried out the isolation and characterization of the stem cells and exosomes; HE carried out the molecular assays; AM implemented the animal study design and the animal injection, follow up, blood and tissue sampling; HH wrote and revised the manuscript and RS Carried out the biochemical, immunological and statistical assays.\u003csup\u003e\u0026nbsp;\u003c/sup\u003eAll authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e: no funding was received for this study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability:\u003c/strong\u003e All data are available upon reasonable request\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eAbbasy, A., Azmy, O., Atta, H., Ali, A., Rashed, L., El-Khaiat, Z., ... \u0026amp; Aziz, M. T. A. (2010). Stem cells restored ovarian function and folliculogenesis following cyclophosphamide-induced ovarian failure in rats. \u003cem\u003eInternational Journal of Health Science\u003c/em\u003e, \u003cem\u003e3\u003c/em\u003e(1).\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003eAbd El-Twab, S. M., Hussein, O. E., Hozayen, W. G., Bin-Jumah, M., \u0026amp; Mahmoud, A. M. (2019). Chicoric acid prevents methotrexate-induced kidney injury by suppressing NF-\u0026kappa;B/NLRP3 inflammasome activation and up-regulating Nrf2/ARE/HO-1 signaling. \u003cem\u003eInflammation Research\u003c/em\u003e, \u003cem\u003e68\u003c/em\u003e, 511-523.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003eAbu El‐Asrar, A. M., Ahmad, A., Alam, K., Siddiquei, M. M., Mohammad, G., Hertogh, G. D., ... \u0026amp; Opdenakker, G. (2017). Extracellular matrix metalloproteinase inducer (EMMPRIN) is a potential biomarker of angiogenesis in proliferative diabetic retinopathy. \u003cem\u003eActa Ophthalmologica\u003c/em\u003e, \u003cem\u003e95\u003c/em\u003e(7), 697-704.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003eAlaqeel, N. K., \u0026amp; Al-Hariri, M. T. (2023). Naringenin ameliorates Cyclophosphamide-induced nephrotoxicity in experimental model. \u003cem\u003eSaudi Journal of Biological Sciences\u003c/em\u003e, \u003cem\u003e30\u003c/em\u003e(6), 103674.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003eAlthunibat, O. Y., Abukhalil, M. H., Jghef, M. M., Alfwuaires, M. A., Algefare, A. I., Alsuwayt, B., ... \u0026amp; Aladaileh, S. H. (2023). Hepatoprotective effect of taxifolin on cyclophosphamide-induced oxidative stress, inflammation, and apoptosis in mice: Involvement of Nrf2/HO-1 signaling. \u003cem\u003eBiomolecules and Biomedicine\u003c/em\u003e.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003eAwadalla, A., Hamam, E. T., Mostafa, S. A., Mahmoud, S. A., Elazab, K. M., El Nakib, A. M., ... \u0026amp; Ali, M. (2023). Hepatoprotective Effects of Hyaluronic Acid-Preconditioned Bone Marrow Mesenchymal Stem Cells against Liver Toxicity via the Inhibition of Apoptosis and the Wnt/\u0026beta;-Catenin Signaling Pathway. \u003cem\u003eCells\u003c/em\u003e, \u003cem\u003e12\u003c/em\u003e(11), 1526.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003eAyza, M. A., Zewdie, K. A., Yigzaw, E. F., Ayele, S. G., Tesfaye, B. A., Tafere, G. G., \u0026amp; Abrha, M. G. (2022). Potential protective effects of antioxidants against cyclophosphamide-induced nephrotoxicity. \u003cem\u003eInternational Journal of Nephrology\u003c/em\u003e, \u003cem\u003e2022\u003c/em\u003e.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003eBanchroft JD, Stevens A, Turner DR. Theory and practice of histological techniques. Churchill Livingstone, Philadelphia, 4\u003csup\u003eth\u003c/sup\u003e Ed/ 1996.\u003c/li\u003e\n \u003cli\u003eBarkholt, L., Flory, E., Jekerle, V., Lucas-Samuel, S., Ahnert, P., Bisset, L., ... \u0026amp; Salmikangas, P. (2013). Risk of tumorigenicity in mesenchymal stromal cell\u0026ndash;based therapies\u0026mdash;bridging scientific observations and regulatory viewpoints. \u003cem\u003eCytotherapy\u003c/em\u003e, \u003cem\u003e15\u003c/em\u003e(7), 753-759.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003eBarnes, C. J., Distaso, C. T., Spitz, K. M., Verdun, V. A., \u0026amp; Haramati, A. (2016). Comparison of stem cell therapies for acute kidney injury. \u003cem\u003eAmerican Journal of Stem Cells\u003c/em\u003e, \u003cem\u003e5\u003c/em\u003e(1), 1.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003eBarnett, S., Errington, J., Sludden, J., Jamieson, D., Poinsignon, V., Paci, A., \u0026amp; Veal, G. J. (2021). Pharmacokinetics and pharmacogenetics of cyclophosphamide in a neonate and infant childhood cancer patient population. \u003cem\u003ePharmaceuticals\u003c/em\u003e, \u003cem\u003e14\u003c/em\u003e(3), 272.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003eBasu, A., Bhattacharjee, A., Roy, S. S., Ghosh, P., Chakraborty, P., Das, I., \u0026amp; Bhattacharya, S. (2014). Vanadium as a chemoprotectant: effect of vanadium (III)-L-cysteine complex against cyclophosphamide-induced hepatotoxicity and genotoxicity in Swiss albino mice. \u003cem\u003eJBIC Journal of Biological Inorganic Chemistry\u003c/em\u003e, \u003cem\u003e19\u003c/em\u003e, 981-996.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003eCaglayan, C., Temel, Y., Kandemir, F. M., Yildirim, S., \u0026amp; Kucukler, S. (2018). Naringin protects against cyclophosphamide-induced hepatotoxicity and nephrotoxicity through modulation of oxidative stress, inflammation, apoptosis, autophagy, and DNA damage. \u003cem\u003eEnvironmental Science and Pollution Research\u003c/em\u003e, \u003cem\u003e25\u003c/em\u003e, 20968-20984.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003eCao, H., Cheng, Y., Gao, H., Zhuang, J., Zhang, W., Bian, Q., ... \u0026amp; Wang, Y. (2020). In vivo tracking of mesenchymal stem cell-derived extracellular vesicles improving mitochondrial function in renal ischemia\u0026ndash;reperfusion injury. \u003cem\u003eAcs Nano\u003c/em\u003e, \u003cem\u003e14\u003c/em\u003e(4), 4014-4026.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003eCao, Q., Huang, C., Chen, X. M., \u0026amp; Pollock, C. A. (2022). Mesenchymal stem cell-derived exosomes: toward cell-free therapeutic strategies in chronic kidney disease. \u003cem\u003eFrontiers in Medicine\u003c/em\u003e, \u003cem\u003e9\u003c/em\u003e, 816656.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003eCasak, S. J., Lemery, S. J., Shen, Y. L., Rothmann, M. D., Khandelwal, A., Zhao, H., ... \u0026amp; Pazdur, R. (2011). US Food and Drug Administration approval: rituximab in combination with fludarabine and cyclophosphamide for the treatment of patients with chronic lymphocytic leukemia. \u003cem\u003eThe Oncologist\u003c/em\u003e, \u003cem\u003e16\u003c/em\u003e(1), 97-104.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003eCatal\u0026aacute;, A., \u0026amp; D\u0026iacute;az, M. (2016). Impact of lipid peroxidation on the physiology and pathophysiology of cell membranes. \u003cem\u003eFrontiers in physiology\u003c/em\u003e, \u003cem\u003e7\u003c/em\u003e, 423.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003eChen, C. C., Liu, L., Ma, F., Wong, C. W., Guo, X. E., Chacko, J. V., ... \u0026amp; Zhao, W. (2016). Elucidation of exosome migration across the blood\u0026ndash;brain barrier model in vitro. \u003cem\u003eCellular and molecular bioengineering\u003c/em\u003e, \u003cem\u003e9\u003c/em\u003e, 509-529.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003eChen, Y. T., Sun, C. K., Lin, Y. C., Chang, L. T., Chen, Y. L., Tsai, T. H., ... \u0026amp; Yip, H. K. (2011). Adipose-derived mesenchymal stem cell protects kidneys against ischemia-reperfusion injury through suppressing oxidative stress and inflammatory reaction. \u003cem\u003eJournal of translational medicine\u003c/em\u003e, \u003cem\u003e9\u003c/em\u003e, 1-17.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003eCircu, M. L., \u0026amp; Aw, T. Y. (2010). Reactive oxygen species, cellular redox systems, and apoptosis. \u003cem\u003eFree radical biology and medicine\u003c/em\u003e, \u003cem\u003e48\u003c/em\u003e(6), 749-762.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003eda Silva Meirelles, L., Fontes, A. M., Covas, D. T., \u0026amp; Caplan, A. I. (2009). Mechanisms involved in the therapeutic properties of mesenchymal stem cells. \u003cem\u003eCytokine \u0026amp; growth factor reviews\u003c/em\u003e, \u003cem\u003e20\u003c/em\u003e(5-6), 419-427.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003eEl-Agamy, D. S., El-Harbi, K. M., Khoshhal, S., Ahmed, N., Elkablawy, M. A., Shaaban, A. A., \u0026amp; Abo-Haded, H. M. (2018). Pristimerin protects against doxorubicin-induced cardiotoxicity and fibrosis through modulation of Nrf2 and MAPK/NF-kB signaling pathways. \u003cem\u003eCancer management and research\u003c/em\u003e, 47-61.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003eEl-Araby, H. A., Sobhy, G. A., Naeem, S. A. M., Alsayed, A. F. M., Zakaria, H. M., \u0026amp; Khedr, M. A. (2022). The regenerative effect of stem cells on acetaminophen-induced hepatotoxicity in male albino rats. \u003cem\u003eEgyptian Liver Journal\u003c/em\u003e, \u003cem\u003e12\u003c/em\u003e(1), 1-9.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003eEl-Kashef, D. H. (2018). Role of venlafaxine in prevention of cyclophosphamide-induced lung toxicity and airway hyperactivity in rats. \u003cem\u003eEnvironmental toxicology and pharmacology\u003c/em\u003e, \u003cem\u003e58\u003c/em\u003e, 70-76.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003eEl‐Shabrawy, M., Mishriki, A., Attia, H., Emad Aboulhoda, B., Emam, M., \u0026amp; Wanas, H. (2020). Protective effect of tolvaptan against cyclophosphamide‐induced nephrotoxicity in rat models. \u003cem\u003ePharmacology Research \u0026amp; Perspectives\u003c/em\u003e, \u003cem\u003e8\u003c/em\u003e(5), e00659.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003eEl-Tookhy, O. S., Shamaa, A. A., Shehab, G. G., Abdallah, A. N., \u0026amp; Azzam, O. M. (2017). Histological evaluation of experimentally induced critical size defect skin wounds using exosomal solution of mesenchymal stem cells derived microvesicles. \u003cem\u003eInternational journal of stem cells\u003c/em\u003e, \u003cem\u003e10\u003c/em\u003e(2), 144-153.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003eGhaneialvar, H., Soltani, L., Rahmani, H. R., Lotfi, A. S., \u0026amp; Soleimani, M. (2018). Characterization and classification of mesenchymal stem cells in several species using surface markers for cell therapy purposes. \u003cem\u003eIndian Journal of Clinical Biochemistry\u003c/em\u003e, \u003cem\u003e33\u003c/em\u003e, 46-52.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003eGirton, R. A., Sundin, D. P., \u0026amp; Rosenberg, M. E. (2002). Clusterin protects renal tubular epithelial cells from gentamicin-mediated cytotoxicity. \u003cem\u003eAmerican Journal of Physiology-Renal Physiology\u003c/em\u003e, \u003cem\u003e282\u003c/em\u003e(4), F703-F709.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003eGuo, J., Wu, C., Lin, X., Zhou, J., Zhang, J., Zheng, W., ... \u0026amp; Cui, Y. (2021). Establishment of a simplified dichotomic size‐exclusion chromatography for isolating extracellular vesicles toward clinical applications. \u003cem\u003eJournal of Extracellular Vesicles\u003c/em\u003e, \u003cem\u003e10\u003c/em\u003e(11), e12145.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003eHarrell, C. R., Jovicic, N., Djonov, V., \u0026amp; Volarevic, V. (2020). Therapeutic use of mesenchymal stem cell-derived exosomes: from basic science to clinics. \u003cem\u003ePharmaceutics\u003c/em\u003e, \u003cem\u003e12\u003c/em\u003e(5), 474.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003eHarrell, C. R., Jovicic, N., Djonov, V., Arsenijevic, N., \u0026amp; Volarevic, V. (2019). Mesenchymal stem cell-derived exosomes and other extracellular vesicles as new remedies in the therapy of inflammatory diseases. \u003cem\u003eCells\u003c/em\u003e, \u003cem\u003e8\u003c/em\u003e(12), 1605.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003eHe, J., Jiang, Y. L., Wang, Y., Tian, X. J., \u0026amp; Sun, S. R. (2020). Micro-vesicles from mesenchymal stem cells over-expressing miR-34a inhibit transforming growth factor-\u0026beta;1-induced epithelial-mesenchymal transition in renal tubular epithelial cells in vitro. \u003cem\u003eChinese medical journal\u003c/em\u003e, \u003cem\u003e133\u003c/em\u003e(07), 800-807.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003eHoang, D. M., Pham, P. T., Bach, T. Q., Ngo, A. T., Nguyen, Q. T., Phan, T. T., ... \u0026amp; Nguyen, L. T. (2022). Stem cell-based therapy for human diseases. \u003cem\u003eSignal transduction and targeted therapy\u003c/em\u003e, \u003cem\u003e7\u003c/em\u003e(1), 1-41.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003eHu, W., Song, M., \u0026amp; Li, L. (2022). Grading evaluation of cardiotoxicity in patients with breast cancer treated with adjuvant paclitaxel anthracycline/cyclophosphamide chemotherapy: a meta-analysis. \u003cem\u003eComputational and Mathematical Methods in Medicine\u003c/em\u003e, \u003cem\u003e2022\u003c/em\u003e.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003eHu, Y., Tao, R., Wang, L., Chen, L., Lin, Z., Panayi, A. C., ... \u0026amp; Liu, G. (2021). Exosomes derived from bone mesenchymal stem cells alleviate compression-induced nucleus pulposus cell apoptosis by inhibiting oxidative stress. \u003cem\u003eOxidative Medicine and Cellular Longevity\u003c/em\u003e, \u003cem\u003e2021\u003c/em\u003e.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003eIjaz, M. U., Mustafa, S., Batool, R., Naz, H., Ahmed, H., \u0026amp; Anwar, H. (2022). Ameliorative effect of herbacetin against cyclophosphamide-induced nephrotoxicity in rats via attenuation of oxidative stress, inflammation, apoptosis and mitochondrial dysfunction. \u003cem\u003eHuman \u0026amp; Experimental Toxicology\u003c/em\u003e, \u003cem\u003e41\u003c/em\u003e, 09603271221132140.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003eIqubal, A., Najmi, A. K., Md, S., Alkreathy, H. M., Ali, J., Syed, M. A., \u0026amp; Haque, S. E. (2023). Oral delivery of nerolidol alleviates cyclophosphamide-induced renal inflammation, apoptosis, and fibrosis via modulation of NF-\u0026kappa;B/cleaved caspase-3/TGF-\u0026beta; signaling molecules. \u003cem\u003eDrug Delivery\u003c/em\u003e, \u003cem\u003e30\u003c/em\u003e(1), 2241661.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003eJin, G., \u0026amp; Howe, P. H. (1997). Regulation of clusterin gene expression by transforming growth factor \u0026beta;. \u003cem\u003eJournal of Biological Chemistry\u003c/em\u003e, \u003cem\u003e272\u003c/em\u003e(42), 26620-26626.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003eLan, Z., Wang, H., Wang, S., Zhu, T., Ma, S., Song, Y., ... \u0026amp; Tian, C. (2022). Rutin protects against cyclophosphamide induced immunological stress by inhibiting TLR4-NF-\u0026kappa;B-mediated inflammation and activating the Nrf2-mediated antioxidant responses. \u003cem\u003ePharmacological Research-Modern Chinese Medicine\u003c/em\u003e, \u003cem\u003e4\u003c/em\u003e, 100135.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003eLim, S. R., Hyun, S. H., Lee, S. G., Kim, J. Y., Kim, S. H., Park, S. J., ... \u0026amp; Choi, H. K. (2017). Potential urinary biomarkers of nephrotoxicity in cyclophosphamide‐treated rats investigated by NMR‐based metabolic profiling. \u003cem\u003eJournal of biochemical and molecular toxicology\u003c/em\u003e, \u003cem\u003e31\u003c/em\u003e(3), e21871.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003eLin, X., Yang, F., Huang, J., Jiang, S., Tang, Y., \u0026amp; Li, J. (2020). Ameliorate effect of pyrroloquinoline quinone against cyclophosphamide-induced nephrotoxicity by activating the Nrf2 pathway and inhibiting the NLRP3 pathway. \u003cem\u003eLife Sciences\u003c/em\u003e, \u003cem\u003e256\u003c/em\u003e, 117901.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003eMahipal, P., \u0026amp; Pawar, R. S. (2017). Nephroprotective effect of Murraya koenigii on cyclophosphamide induced nephrotoxicity in rats. \u003cem\u003eAsian Pacific journal of tropical medicine\u003c/em\u003e, \u003cem\u003e10\u003c/em\u003e(8), 808-812.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003eMahmoud, A. M., Germoush, M. O., Al-Anazi, K. M., Mahmoud, A. H., Farah, M. A., \u0026amp; Allam, A. A. (2018). Commiphora molmol protects against methotrexate-induced nephrotoxicity by up-regulating Nrf2/ARE/HO-1 signaling. \u003cem\u003eBiomedicine \u0026amp; Pharmacotherapy\u003c/em\u003e, \u003cem\u003e106\u003c/em\u003e, 499-509.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003eMahmoud, A. M., Germoush, M. O., Alotaibi, M. F., \u0026amp; Hussein, O. E. (2017). Possible involvement of Nrf2 and PPAR\u0026gamma; up-regulation in the protective effect of umbelliferone against cyclophosphamide-induced hepatotoxicity. \u003cem\u003eBiomedicine \u0026amp; Pharmacotherapy\u003c/em\u003e, \u003cem\u003e86\u003c/em\u003e, 297-306.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003eM\u0026auml;kel\u0026auml;, T., Takalo, R., Arvola, O., Haapanen, H., Yannopoulos, F., Blanco, R., ... \u0026amp; Lehenkari, P. (2015). Safety and biodistribution study of bone marrow\u0026ndash;derived mesenchymal stromal cells and mononuclear cells and the impact of the administration route in an intact porcine model. \u003cem\u003eCytotherapy\u003c/em\u003e, \u003cem\u003e17\u003c/em\u003e(4), 392-402.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003eMoresco, R. N., Bochi, G. V., Stein, C. S., De Carvalho, J. A., Cembranel, B. M., \u0026amp; Bollick, Y. S. (2018). Urinary kidney injury molecule-1 in renal disease. \u003cem\u003eClinica chimica acta\u003c/em\u003e, \u003cem\u003e487\u003c/em\u003e, 15-21.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003eMori, K., Lee, H. T., Rapoport, D., Drexler, I. R., Foster, K., Yang, J., ... \u0026amp; Barasch, J. (2005). Endocytic delivery of lipocalin-siderophore-iron complex rescues the kidney from ischemia-reperfusion injury. \u003cem\u003eThe Journal of clinical investigation\u003c/em\u003e, \u003cem\u003e115\u003c/em\u003e(3), 610-621.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003eMusiał-Wysocka, A., Kot, M., \u0026amp; Majka, M. (2019). The pros and cons of mesenchymal stem cell-based therapies. \u003cem\u003eCell transplantation\u003c/em\u003e, \u003cem\u003e28\u003c/em\u003e(7), 801-812.\u003c/li\u003e\n \u003cli\u003eMuthu, S., Bapat, A., Jain, R., Jeyaraman, N., \u0026amp; Jeyaraman, M. (2021). Exosomal therapy\u0026mdash;A new frontier in regenerative medicine. \u003cem\u003eStem cell investigation\u003c/em\u003e, \u003cem\u003e8\u003c/em\u003e.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003eNeosar, (2013). Cyclophosphamide. BC Cancer Agency Cancer Drug Manual, 1-12.\u003c/li\u003e\n \u003cli\u003eNiyaz, M., G\u0026uuml;rpinar, \u0026Ouml;. A., G\u0026uuml;naydin, S., \u0026amp; Onur, M. A. (2012). Isolation, culturing and characterization of rat adipose tissue-derived mesenchymal stem cells: a simple technique. \u003cem\u003eTurkish Journal of Biology\u003c/em\u003e, \u003cem\u003e36\u003c/em\u003e(6), 658-664.\u003c/li\u003e\n \u003cli\u003eNong, K., Wang, W., Niu, X., Hu, B., Ma, C., Bai, Y., ... \u0026amp; Ai, K. (2016). Hepatoprotective effect of exosomes from human-induced pluripotent stem cell\u0026ndash;derived mesenchymal stromal cells against hepatic ischemia-reperfusion injury in rats. \u003cem\u003eCytotherapy\u003c/em\u003e, \u003cem\u003e18\u003c/em\u003e(12), 1548-1559.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003eNoori, S., Tavirani, M. R., Deravi, N., Rabbani, M. I. M., \u0026amp; Zarghi, A. (2020). Naringenin enhances the anti-cancer effect of cyclophosphamide against MDA-MB-231 breast cancer cells via targeting the STAT3 signaling pathway. \u003cem\u003eIranian journal of pharmaceutical research: IJPR\u003c/em\u003e, \u003cem\u003e19\u003c/em\u003e(3), 122.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u0026rlm;\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003ePatwa, J., Khan, S., \u0026amp; Jena, G. (2020). Nicotinamide attenuates cyclophosphamide‐induced hepatotoxicity in SD rats by reducing oxidative stress and apoptosis. \u003cem\u003eJournal of Biochemical and Molecular Toxicology\u003c/em\u003e, \u003cem\u003e34\u003c/em\u003e(10), e22558.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003ePers, Y. M., Bony, C., Duroux-Richard, I., Bernard, L., Maumus, M., Assou, S., ... \u0026amp; No\u0026euml;l, D. (2021). miR-155 contributes to the immunoregulatory function of human mesenchymal stem cells. \u003cem\u003eFrontiers in immunology\u003c/em\u003e, \u003cem\u003e12\u003c/em\u003e, 624024.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003ePhinney, D. G., \u0026amp; Pittenger, M. F. (2017). Concise review: MSC-derived exosomes for cell-free therapy. \u003cem\u003eStem cells\u003c/em\u003e, \u003cem\u003e35\u003c/em\u003e(4), 851-858.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003ePsaraki, A., Ntari, L., Karakostas, C., Korrou‐Karava, D., \u0026amp; Roubelakis, M. G. (2022). Extracellular vesicles derived from mesenchymal stem/stromal cells: The regenerative impact in liver diseases. \u003cem\u003eHepatology\u003c/em\u003e, \u003cem\u003e75\u003c/em\u003e(6), 1590-1603.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003eRadhiga, T.; Rajamanickam, C.; Sundaresan, A.; Ezhumalai, M.; Pugalendi, K.V (2012). Effect of ursolic acid treatment on apoptosis and\u003cbr\u003eDNA damage in isoproterenol-induced myocardial infarction. \u003cem\u003eBiochimie\u003c/em\u003e, \u003cem\u003e94\u003c/em\u003e, 1135\u0026ndash;1142.\u003c/li\u003e\n \u003cli\u003eRefaie, M. M., El-Hussieny, M., Bayoumi, A. M., Shehata, S., Welson, N. N., \u0026amp; Abdelzaher, W. Y. (2022). Simvastatin cardioprotection in cyclophosphamide-induced toxicity via the modulation of inflammasome/caspase1/interleukin1\u0026beta; pathway. \u003cem\u003eHuman \u0026amp; Experimental Toxicology\u003c/em\u003e, \u003cem\u003e41\u003c/em\u003e, 09603271221111440.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003eRen, K. Exosomes in perspective: a potential surrogate for stem cell therapy. Odontology. 107, 271\u0026ndash;284 (2019).\u003c/li\u003e\n \u003cli\u003eSaha, S., Buttari, B., Panieri, E., Profumo, E., \u0026amp; Saso, L. (2020). An overview of Nrf2 signaling pathway and its role in inflammation. \u003cem\u003eMolecules\u003c/em\u003e, \u003cem\u003e25\u003c/em\u003e(22), 5474.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003eSalama, R. M., Nasr, M. M., Abdelhakeem, J. I., Roshdy, O. K., \u0026amp; ElGamal, M. A. (2022). Alogliptin attenuates cyclophosphamide-induced nephrotoxicity: a novel therapeutic approach through modulating MAP3K/JNK/SMAD3 signaling cascade. \u003cem\u003eDrug and Chemical Toxicology\u003c/em\u003e, \u003cem\u003e45\u003c/em\u003e(3), 1254-1263.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003eSatta, S., Mahmoud, A. M., Wilkinson, F. L., Yvonne Alexander, M., \u0026amp; White, S. J. (2017). The role of Nrf2 in cardiovascular function and disease. \u003cem\u003eOxidative medicine and cellular longevity\u003c/em\u003e, \u003cem\u003e2017\u003c/em\u003e.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003eSchomaker, S., Warner, R., Bock, J., Johnson, K., Potter, D., Van Winkle, J., \u0026amp; Aubrecht, J. (2013). Assessment of emerging biomarkers of liver injury in human subjects. \u003cem\u003etoxicological sciences\u003c/em\u003e, \u003cem\u003e132\u003c/em\u003e(2), 276-283.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003eSemis, H. S., Gur, C., Ileriturk, M., Kaynar, O., \u0026amp; Kandemir, F. M. (2021). Investigation of the anti-inflammatory effects of caffeic acid phenethyl ester in a model of \u0026lambda;-Carrageenan\u0026ndash;induced paw edema in rats. \u003cem\u003eHuman \u0026amp; experimental toxicology\u003c/em\u003e, \u003cem\u003e40\u003c/em\u003e(12_suppl), S721-S738.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003eShimizu, E., Shirasawa, H., Kodama, K., Kuroyanagi, H., Shirasawa, T., Sato, T., \u0026amp; Simizu, B. (1997). Glutamate dehydrogenase mRNA is immediately induced after phencyclidine treatment in the rat brain. \u003cem\u003eSchizophrenia research\u003c/em\u003e, \u003cem\u003e25\u003c/em\u003e(3), 251-258.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003eSzatanek, R., Baj-Krzyworzeka, M., Zimoch, J., Lekka, M., Siedlar, M., \u0026amp; Baran, J. (2017). The methods of choice for extracellular vesicles (EVs) characterization. \u003cem\u003eInternational journal of molecular sciences\u003c/em\u003e, \u003cem\u003e18\u003c/em\u003e(6), 1153.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003eTan, C. Y., Lai, R. C., Wong, W., Dan, Y. Y., Lim, S. K., \u0026amp; Ho, H. K. (2014). Mesenchymal stem cell-derived exosomes promote hepatic regeneration in drug-induced liver injury models. \u003cem\u003eStem cell research \u0026amp; therapy\u003c/em\u003e, \u003cem\u003e5\u003c/em\u003e, 1-14.\u003c/li\u003e\n \u003cli\u003eTan, F., Li, X., Wang, Z., Li, J., Shahzad, K., \u0026amp; Zheng, J. (2024). Clinical applications of stem cell-derived exosomes. \u003cem\u003eSignal Transduction and Targeted Therapy\u003c/em\u003e, \u003cem\u003e9\u003c/em\u003e(1), 17.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003eTapparo, M., Bruno, S., Collino, F., Togliatto, G., Deregibus, M. C., Provero, P., ... \u0026amp; Camussi, G. (2019). Renal regenerative potential of extracellular vesicles derived from miRNA-engineered mesenchymal stromal cells. \u003cem\u003eInternational Journal of Molecular Sciences\u003c/em\u003e, \u003cem\u003e20\u003c/em\u003e(10), 2381.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003eTavasolian, F., Hosseini, A. Z., Soudi, S., \u0026amp; Naderi, M. (2020). miRNA-146a improves immunomodulatory effects of MSC-derived exosomes in rheumatoid arthritis. \u003cem\u003eCurrent gene therapy\u003c/em\u003e, \u003cem\u003e20\u003c/em\u003e(4), 297-312.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003eTimmerman, M., Wilkening, R. B., \u0026amp; Regnault, T. R. H. (2003). Induction of Glutamate Dehydrogenase in the Ovine Fetal Liver by Dexamethasone Infusion during Late Gestation1. \u003cem\u003eExperimental Biology and Medicine\u003c/em\u003e, \u003cem\u003e228\u003c/em\u003e(1), 100-105.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003eTracy, S. A., Ahmed, A., Tigges, J. C., Ericsson, M., Pal, A. K., Zurakowski, D., \u0026amp; Fauza, D. O. (2019). A comparison of clinically relevant sources of mesenchymal stem cell-derived exosomes: bone marrow and amniotic fluid. \u003cem\u003eJournal of Pediatric Surgery\u003c/em\u003e, \u003cem\u003e54\u003c/em\u003e(1), 86-90.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003eUllrich, E., Vogler, M., \u0026amp; von Metzler, I. (2022). Mitochondrial apoptosis: facilitator of NK cell-mediated immunotherapy. \u003cem\u003eSignal Transduction and Targeted Therapy\u003c/em\u003e, \u003cem\u003e7\u003c/em\u003e(1), 291.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003eVizoso, F. J. et al. Mesenchymal stem cell secretome: toward cell-free therapeutic strategies in regenerative medicine. Int. J. Mol. Sci. 18, 1852\u0026ndash;1875 (2017).\u003c/li\u003e\n \u003cli\u003eWang, C., Liu, J., Yan, Y., \u0026amp; Tan, Y. (2022). Role of Exosomes in Chronic Liver Disease Development and Their Potential Clinical Applications. \u003cem\u003eJournal of Immunology Research\u003c/em\u003e, \u003cem\u003e2022\u003c/em\u003e.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003eWang, D. R., \u0026amp; Pan, J. (2023). Extracellular vesicles: Emerged as a promising strategy for regenerative medicine. \u003cem\u003eWorld Journal of Stem Cells\u003c/em\u003e, \u003cem\u003e15\u003c/em\u003e(4), 165.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003eWu, H., Fan, H., Shou, Z., Xu, M., Chen, Q., Ai, C., ... \u0026amp; Liu, X. (2019). Extracellular vesicles containing miR-146a attenuate experimental colitis by targeting TRAF6 and IRAK1. \u003cem\u003eInternational immunopharmacology\u003c/em\u003e, \u003cem\u003e68\u003c/em\u003e, 204-212.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003eYang, Y., Yu, T., Lian, Y. J., Ma, R., Yang, S., \u0026amp; Cho, J. Y. (2015). Nitric oxide synthase inhibitors: a review of patents from 2011 to the present. \u003cem\u003eExpert Opinion on Therapeutic Patents\u003c/em\u003e, \u003cem\u003e25\u003c/em\u003e(1), 49-68.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003eYao, W., Hu, Q., Ma, Y., Xiong, W., Wu, T., Cao, J., \u0026amp; Wu, D. (2015). Human adipose-derived mesenchymal stem cells repair cisplatin-induced acute kidney injury through antiapoptotic pathways. \u003cem\u003eExperimental and therapeutic medicine\u003c/em\u003e, \u003cem\u003e10\u003c/em\u003e(2), 468-476.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003eYogalakshmi, B., Viswanathan, P., \u0026amp; Anuradha, C. V. (2010). Investigation of antioxidant, anti-inflammatory and DNA-protective properties of eugenol in thioacetamide-induced liver injury in rats. \u003cem\u003eToxicology\u003c/em\u003e, \u003cem\u003e268\u003c/em\u003e(3), 204-212.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003eYounis, N. S., Ghanim, A. M., Elmorsy, M. A., \u0026amp; Metwaly, H. A. (2021). RETRACTED ARTICLE: Taurine ameliorates thioacetamide induced liver fibrosis in rats via modulation of toll like receptor 4/nuclear factor kappa B signaling pathway. \u003cem\u003eScientific Reports\u003c/em\u003e, \u003cem\u003e11\u003c/em\u003e(1), 12296.\u003c/li\u003e\n \u003cli\u003eZhang, R., Qin, L., \u0026amp; Shi, J. (2020). MicroRNA‑199a‑3p suppresses high glucose‑induced apoptosis and inflammation by regulating the IKK\u0026beta;/NF‑\u0026kappa;B signaling pathway in renal tubular epithelial cells. \u003cem\u003eInternational journal of molecular medicine\u003c/em\u003e, \u003cem\u003e46\u003c/em\u003e(6), 2161-2171.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003eZhang, Y., Chang, J., Gao, H., Qu, X., Zhai, J., Tao, L., ... \u0026amp; Song, Y. (2021). Huaiqihuang (HQH) granule alleviates cyclophosphamide-induced nephrotoxicity via suppressing the MAPK/NF-\u0026kappa;B pathway and NLRP3 inflammasome activation. \u003cem\u003ePharmaceutical Biology\u003c/em\u003e, \u003cem\u003e59\u003c/em\u003e(1), 1423-1429.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003eZhou, Y., Xu, H., Xu, W., Wang, B., Wu, H., Tao, Y., ... \u0026amp; Qian, H. (2013). Exosomes released by human umbilical cord mesenchymal stem cells protect against cisplatin-induced renal oxidative stress and apoptosis in vivo and in vitro. \u003cem\u003eStem cell research \u0026amp; therapy\u003c/em\u003e, \u003cem\u003e4\u003c/em\u003e, 1-13.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Cyclophosphamide, Mesenchymal stem cells, Exosomes, Inflammation, Oxidative stress, Apoptosis, Rats","lastPublishedDoi":"10.21203/rs.3.rs-4409545/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4409545/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground:\u003c/strong\u003e Cyclophosphamide (CTX) is an alkylating agent widely described in management of several non-neoplastic and neoplastic disorders. The most observed adverse consequence of CTX is organ damage. Exosomes derived from mesenchymal stem cells (MSCs-Exos) have been shown to exhibit therapeutic effects in various tissue-injury models. Aim: The aim of this work was to examine impact of AD-MSCs-Exos in a rat model of hepatorenal toxicity.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethods:\u003c/strong\u003e 32 rats were grouped into 4 groups (n=8): Control group: rats received intraperitoneally (i.p.) PBS (phosphate buffered saline), CTX group: rats injected i.p. with a single dose of CTX (50 mg/kg) followed by rotating doses of 8 mg/kg of CTX daily for 2 weeks, CTX+AD-MSCs group: rats infused with (1×10\u003csup\u003e6\u003c/sup\u003e AD-MSCs cells/rat) dissolved in PBS intravenously (i.v.) day after day for one week starting from second day of CTX last dose, and CTX+AD-MSCs-Exos group: rats injected with 100 μg of Exos derived from AD-MSCs in 1 ml PBS by i.v. injection for one week starting from second day of CTX last dose. 5 weeks following initial CTX dose, blood, liver, and kidneys were extracted. Serum ALT, AST, creatinine and urea levels; hepatic malate dehydrogenase (MDH) and glutamate dehydrogenase (GLDH); renal kidney injury molecule-1 (KIM-1) and clusterin were measured. The inflammatory molecule (TNF-α) and malonialdehyde (MDA); lipid peroxidation one were estimated in hepatic and renal tissues. Furthermore, NF-κB/TLR-4, Nrf-2/HO-1 and Bax/Bcl-2 signaling pathways were analyzed by qRT-PCR. Immunohistochemical staining for cyclooxygenase-2 \"COX-2\" and inducible nitric oxide synthase \"iNOS\" were also performed in hepatic and renal tissues. Finally, histopathological investigation of both liver and kidney tissue was carried out.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults:\u003c/strong\u003e treatment with AD-MSCs-Exos improved liver and kidney functions, diminished oxidative stress (MDA) and enhanced antioxidative Nrf-2/HO-1 pathway; inhibited inflammatory response (TNF-α) and NF-κB/TLR-4 pathway; and downregulated apoptotic Bax/Bcl-2 signaling pathway compared to CTX and CTX+AD-MSCs treated groups. Also, immunological and histopathological investigation verified curative effect of AD-MSCs-Exos against CTX-induced hepatorenal toxicity.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusion:\u003c/strong\u003e these findings uncovered therapeutic impact of AD-MSCs-Exos against hepatorenal insult from holistic perspective. The mechanisms behind this action included restoration of oxidant/antioxidant equilibrium, inhibition of inflammatory reaction and suppression of apoptotic machinery.\u003c/p\u003e","manuscriptTitle":"Cyclophosphamide: Potential Hepatorenal Toxicity and the Possible Therapeutic Role of Mesenchymal Stem Cell-Derived Exosomes in Wistar Rats","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-06-06 07:52:43","doi":"10.21203/rs.3.rs-4409545/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"a2c6436a-53ed-4121-86ef-662a77a54ed6","owner":[],"postedDate":"June 6th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-06-27T08:55:06+00:00","versionOfRecord":[],"versionCreatedAt":"2024-06-06 07:52:43","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4409545","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4409545","identity":"rs-4409545","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}