Sympathetic signaling activation alleviated acute respiratory distress syndrome via the HDC/SLC7A11 axis in lipopolysaccharide-induced macrophages

Sympathetic signaling activation alleviated acute respiratory distress syndrome via the HDC/SLC7A11 axis in lipopolysaccharide-induced macrophages | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Sympathetic signaling activation alleviated acute respiratory distress syndrome via the HDC/SLC7A11 axis in lipopolysaccharide-induced macrophages Xing Lv, Chenhao Jiang, Xu Zhang, Xuxia Wei, Yang Zhao, JianHao Zhang, and 10 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7374244/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Acute respiratory distress syndrome (ARDS) represents a severe pulmonary condition characterized by excessive inflammation, wherein alveolar macrophages (AMs), pivotal components of the innate immune system, play a critical role in the pathogenesis of the disease. Despite its high morbidity and mortality, effective targeted therapies for ARDS remain unavailable. Norepinephrine (NE) is an endogenous neurotransmitter with immunomodulatory and anti-inflammatory properties, and has been reported to mitigate ARDS symptoms in sepsis models. While sympathetic signaling exerts protective effects, the underlying immunomodulatory mechanisms-especially those involving macrophages-remain poorly defined. Our in vitro experiments demonstrated that NE confers protection against LPS-induced injury in AMs by limiting lipid peroxidation, sustaining mitochondrial integrity, and upregulating antioxidant regulators SLC7A11 and GPX4, leading to improved cell viability. Mechanistically, the anti-ferroptotic effect of NE on LPS-treated AMs was significantly impaired by β2-adrenergic receptor (β2-AR) blockade or knockdown of histidine decarboxylase (HDC). Our in vivo experiments further demonstrated that salbutamol, a selective β2-AR agonist, upregulated SLC7A11 and GPX4 expression in septic mice and concurrently increased HDC expression in AMs. Furthermore, salbutamol alleviated lipid peroxidation, mitigated macrophage and lung tissue injury. These findings identify a HDC/SLC7A11 axis that mediates the neuroimmune regulation of ferroptosis in AMs, offering a potential therapeutic target for ARDS. Acute respiratory distress syndrome Ferroptosis Alveolar macrophages Norepinephrine β2-adrenergic receptor Histidine decarboxylase Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction Acute respiratory distress syndrome (ARDS) is a critical clinical condition characterized by bilateral pulmonary infiltrates and severe hypoxemia resulting from noncardiogenic pulmonary edema 1 , 2 . Despite substantial advances in supportive care and mechanical ventilation strategies, ARDS is still associated with high morbidity and mortality rates 3 – 5 . Among various immune populations, alveolar macrophages (AMs), as key innate immune sentinels of the pulmonary microenvironment, have been recognized to orchestrate the initiation and propagation of inflammatory responses during ARDS 6 , 7 . Our previous studies have shown that targeted modulation of the macrophage cholinergic anti-inflammatory pathway (CAP) can effectively alleviate lung injury in ARDS, indicating a mechanistic link between cholinergic neural signaling and innate immune regulation 8 . Further data indicate that sympathetic signaling may contribute to the therapeutic effects either. However, it remains unknown whether AMs are influenced by sympathetic neuroregulation to reduce lung injury. Norepinephrine (NE), a major sympathetic neurotransmitter of the sympathetic nervous system (SNS), exerts diverse biological effects through activation of α- and β-adrenergic receptors. Although many previous reports have clarified that sympathetic signaling certainly affects immune systems, the direction of its immunologic regulation remain uncertain and varies according to the disease situation and responsible cell types. Studies have shown that NE modulates cellular metabolism, suppresses inflammatory responses, and promotes cell survival pathways via β2-adrenergic receptor (β2-AR) signaling 9 , 10 . Furthermore, the β2-AR is the major subtype expressed on immune cells, particularly macrophages 9 . Taken together, these findings raise the possibility that NE exerts anti-inflammatory effects on AMs through β2-AR signaling during ARDS 11 . Nonetheless, further investigation is required to clarify the specific molecular pathways involved. While AMs play a central role in mediating inflammatory responses during ARDS, the downstream molecular mechanisms that contribute to sustained tissue damage and disruption of the alveolar-capillary barrier remain incompletely understood. Meanwhile, accumulating evidence indicates that ferroptosis-a regulated cell death modality driven by iron overload and excessive lipid oxidation-substantially influences macrophage behavior in inflammatory conditions 12 , 13 . However, whether sympathetic signaling modulates macrophage ferroptosis during ARDS remains largely unknown. Ferroptosis is mechanistically distinct from alternative types of programmed cell demise, and is chiefly defined by iron-catalyzed lipid oxidation and morphological alterations of mitochondria, such as shrinkage and cristae loss, while maintaining nuclear integrity 13 . Increasing evidence highlights ferroptosis as a pivotal contributor to the pathogenesis of various inflammatory and degenerative diseases 14 – 16 , including intestinal inflammation 17 and endothelial injury 18 . Moreover, accumulating research suggests that ferroptosis may underlie key pathological mechanisms in chronic respiratory conditions such as COPD, asthma, and other lower airway inflammatory diseases 19 . Recent studies have shown that AMs not only orchestrate inflammatory responses but also undergo ferroptosis themselves, thereby exacerbating lung injury 20 . These findings underscore the central role of macrophages at the intersection of inflammation and ferroptosis. Recent studies have revealed that norepinephrine signaling may influence ferroptosis 21 , 22 . For example, norepinephrine depletion in a Parkinson’s disease model induced by paraquat and maneb administration has been associated with hippocampal iron accumulation and activation of ferroptotic signaling pathways 23 . While norepinephrine itself has been reported to exacerbate ferroptosis through disruption of iron homeostasis and suppression of GPX4 22 . These seemingly paradoxical findings indicate a complex and context-dependent role of norepinephrine in ferroptosis regulation. Herein, we investigated the role of sympathetic signaling activation in sepsis-induced ARDS. Activation of β2-AR signaling in alveolar macrophages suppressed ferroptosis and attenuated pulmonary inflammation. Overall, sympathetic signaling is identified as a key neuroimmune regulatory pathway, and targeting β2-AR may offer a promising therapeutic strategy for ARDS. Materials and Methods Mouse model Male C57BL/6 mice (6–10 weeks old, 20–25 g; GemPharmatech, Guangzhou, China) were maintained under specific-pathogen-free (SPF) conditions in individually ventilated cages, with unrestricted access to standard chow and water. After a 1-week acclimation period, animals were randomly allocated to either sham or ARDS groups. To establish the ARDS model, mice received an intranasal instillation of lipopolysaccharide (LPS; 5 mg/kg, L2880, Sigma-Aldrich, USA) dissolved in 50 µL sterile saline. Mice in the sham group were administered an equal volume of sterile saline. For intervention studies, salbutamol (SAL; 10 mg/kg, T1139, TargetMol, USA) was administered by nebulization 3 hours prior to LPS exposure. Nebulized saline was administered to control mice following the same schedule. At 24 hours after LPS exposure, mice were euthanized by CO₂ inhalation under anesthesia. Blood and bronchoalveolar lavage fluid (BALF) samples were collected. Lung tissues were either fixed in 4% neutral-buffered formalin or rapidly frozen in liquid nitrogen and stored at − 80°C for downstream analysis. All experimental procedures were approved by the Institutional Animal Care and Use Committee (IACUC) of Jennio Bio, with ethical approval number #JENNIO-IACUC-2025-A015. Isolation, culture and treatment of alveolar macrophages AMs were isolated from C57BL/6 mice via bronchoalveolar lavage (BAL). Lavage was performed using pre-warmed PBS containing 2 mM EDTA and 0.5% fetal bovine serum (FBS), with 10 sequential instillations of 1 mL buffer through a tracheal cannula per mouse. BALF samples were passed through a 70 µm strainer and centrifuged at 300 × g for 5 min at 4°C. Red blood cells were lysed with hemolysis buffer, and viable cells were counted using Trypan Blue exclusion. For culture, 3–4*10⁵ AMs were seeded into non-treated 6-well plates containing RPMI-1640 supplemented with 10% fetal bovine and 1% penicillin-streptomycin. Cells were incubated at 37°C in a humidified atmosphere with 5% CO₂, and the medium was refreshed every two days. AMs were exposed to LPS(1 µg/mL) for 24 h. Norepinephrine (0.1 µM, 1 µM, or 10 µM; HY-13715, MCE, China), salbutamol (100 nM; T1139, TargetMol, USA), and butoxamine (10 µM; HY-118470, MCE, China) were administered 3 h before LPS stimulation. Erastin (5 µM; 571203-78-6, GLPBIO, USA) was co-administered with LPS to induce ferroptosis under inflammatory conditions. All samples were collected 24 h after LPS stimulation for subsequent analyses. Enzyme-linked immunosorbent assay (ELISA) Levels of TNF-α and IL-6 in AMs culture supernatants were quantified using commercial ELISA kits for mouse TNF-α (MM-0132M2, MEIMIAN, China) and IL-6 (MM-0163M2, MEIMIAN, China), following the protocols provided by the manufacturer. Western blotting Proteins were isolated from alveolar macrophages (AMs) using RIPA buffer (P0039, Beyotime, China), and quantified with a BCA assay kit (PC0020, Solarbio, China). Equal protein amounts (20 µg per lane) were resolved via 12% SDS–PAGE and electrotransferred onto PVDF membranes. After blocking in 3% BSA for 1 h at room temperature, membranes were incubated overnight at 4°C with the following primary antibodies: SLC7A11 (26864-1-AP, Proteintech, 1:1000), FTH1 (ab75973, Abcam, 1:1000), GPX4 (GB124327, Servicebio, 1:1000), HDC (ab315444, Abcam, 1:1000), STAT3 (YT4443, Immunoway, 1:1000), p-STAT3 (Tyr705; YP0251, Immunoway, 1:1000), and β-actin (20536-1-AP, Proteintech, 1:2000). After TBST washes, membranes were exposed to HRP-labeled secondary antibodies (1:5000) for 1 h at room temperature. Signal detection was performed using enhanced chemiluminescence substrate (PE0010, Solarbio, China), and band intensities were analyzed with ImageJ software. Flow cytometry analysis For flow cytometry analysis, AMs were resuspended in staining buffer and blocked with anti-mouse CD16/32 (553142 BD, USA) at 4°C for 15 minutes to prevent nonspecific binding. Cells were stained with FITC-CD45 (E-AB-F1136C, Elabscience, China), APC-F4/80 ( E-AB-F0995E, Elabscience, China), and PE-CD86 (E-AB-F0994UD, Elabscience, China) for 30 min at 4°C in the dark. After staining and washing, cells were resuspended in staining buffer, and 7-AAD (5µl, 420403, BioLegend, USA) was added immediately before flow cytometric analysis for live/dead discrimination. Data were processed using FlowJo software, and CD86⁺ cells within the CD45⁺F4/80⁺ macrophage population were quantified. MDA and Fe²⁺ Measurement Malondialdehyde (MDA) and ferrous iron (Fe²⁺) levels in cells and tissues were assessed using a lipid peroxidation detection kit (E-BC-K025-M-96T, Elabscience, China) and a colorimetric iron quantification kit (MA0647-2, Meilunbio, China), respectively, following the protocols provided by the manufacturers. ROS measurement Intracellular reactive oxygen species (ROS) levels were evaluated using a commercial detection kit (S0033S, Beyotime, China), following the manufacturer’s instructions. Briefly, cells were exposed to 10 µM 2′,7′-dichlorodihydrofluorescein diacetate (DCFH-DA) diluted in serum-free medium and incubated at 37°C for 20 minutes in the dark. After treatment, excess dye was removed by washing the cells three times with serum-free medium. Fluorescence was detected using a fluorescence microscope (excitation/emission: 488/525 nm). To assess lipid peroxidation, cells were stained with 10µM dihydroethidium(DHE, S0064S, Beyotime, China) in the dark for 30min and visualized via fluorescence microscopy (excitation/emission: 518/605 nm). Transmission electron microscopy (TEM) Cells were initially fixed in 2.5% glutaraldehyde, followed by secondary fixation with 1% osmium tetroxide for 2 h at room temperature. After rinsing in phosphate buffer, samples underwent graded ethanol dehydration and acetone infiltration, then embedded in epoxy resin and polymerized overnight at 60–70°C. Ultrathin sections (70–90 nm) were prepared in a Leica EM UC7 ultramicrotome and stained with uranyl acetate and lead citrate. The sections were then observed under a transmission electron microscope (JEM-1200EX, JEOL, Japan), and representative ultrastructural images were acquired for analysis. RNA isolation and real-time quantitative PCR(RT-qPCR) analysis Total RNA was isolated from AMs by using TRIzol reagent (10296010, Thermo Fisher Scientific, USA) following standard procedures. Complementary DNA (cDNA) was generated from 1 µg of RNA with the HiScript III RT SuperMix (R323-01, Vazyme, China). Quantitative real-time PCR was performed using ChamQ Universal SYBR qPCR Master Mix (Q711-02, Vazyme, China) on a real-time detection system following standard cycling parameters. GAPDH was used as the internal reference gene for normalization. The primer information is provided in Table 1 . Relative transcript levels were quantified using the 2^–ΔΔCt approach. Table 1 Primer sequences used for RT-qPCR Gene Forward primer (5′→3′) Reverse primer (5′→3′) SLC7A11 CCTCTGCCAGCTGTTATTGTT CCTGGCAAAACTGAGGAAAT FTH1 CCATCAACCGCCAGATCAAC GAAACATCATCTCGGTCAAA GPX4 GCCTGGATAAGTACAGGGGTT CATGCAGATCGACTAGCTGAG HDC ACTCCAAATGTGCAGCCTGGATACC GGCTAGATGCCCACGTGAATCCTAA STAT3 GCCGCCGTAGTGACAGAGAA GGCAGCAACATCCCCAGAGT GAPDH GTGGCAAAGTGGAGATTGTTG CGTTGAATTTGCCGTGAGTG H&E staining and lung injury scoring Lung samples underwent 4% paraformaldehyde fixation, followed by paraffin embedding and microtome sectioning at 4 µm. Sections were deparaffinized, rehydrated through graded ethanol (95%, 85%, 75%), and stained with hematoxylin and eosin. Lung injury severity was evaluated according to five histopathological parameters: (A) neutrophilic infiltration within alveolar spaces, (B) interstitial neutrophil accumulation, (C) formation of hyaline membranes, (D) intra-alveolar proteinaceous exudate, and (E) alveolar septal thickening. The injury index was derived using the following formula: [(20×A) + (14×B) + (7×C) + (7×D) + (2×E)] divided by the number of 100× microscopic fields, yielding a continuous score ranging from 0 to 1. Two independent, blinded pathologists conducted the histological assessments. Evans Blue dye extravasation assay Following anesthesia, mice received a 100 µL intravenous injection of 1% Evans Blue solution (E2129, Sigma-Aldrich, USA). After 30 minutes of circulation, mice were euthanized, and the pulmonary vasculature was perfused through the right ventricle with 50 mL PBS to remove intravascular dye. Lungs were collected, weighed, and incubated in 2 mL of N,N-Dimethylformamide (DMF) (N807507, Macklin, China) at 55°C for 24 h to extract the dye. Supernatant absorbance was detected at 620 nm with a microplate spectrophotometer. Dye content was normalized to tissue weight and expressed as micrograms of Evans Blue per gram of lung tissue. Lung wet/dry weight ratio The left lung was carefully excised, and excess blood was gently removed using filter paper. The wet weight was measured immediately using an analytical balance. Lung tissues were dried at 60°C for 72 h to determine their dry weight. The wet-to-dry (W/D) ratio was computed as the quotient of wet weight and dry weight, serving as an indicator of pulmonary edema severity. Immunofluorescence staining Paraffin-embedded lung tissues were sliced into 4 µm sections, deparaffinized in xylene, and rehydrated through a graded ethanol series (95%, 85%, 75%). To quench endogenous peroxidase activity, sections were treated with 3% hydrogen peroxide for 10 minutes at room temperature. Antigen retrieval was conducted by heating in 10 mM sodium citrate buffer (pH 6.0) for 15 minutes. Tissue sections were permeabilized with 0.1% Triton X-100 for 15 minutes and then blocked in 2% bovine serum albumin (BSA) for 30 minutes at room temperature. Subsequently, the slides were incubated overnight at 4°C with primary antibodies against 4-HNE (ab46545, Abcam, 1:500). After washing with PBS, sections were incubated with a fluorescent secondary antibody (1:1000) for 1 hour at room temperature, followed by nuclear counterstaining with DAPI for 5 minutes. Images were acquired using a fluorescence microscope (Nikon, Japan). Statistical analysis Statistical analyses were performed using SPSS version 23.0 and GraphPad Prism 8.0. Results are expressed as mean ± standard deviation (SD). For comparisons involving more than two groups, one-way ANOVA was applied, followed by appropriate post hoc testing. Non-parametric data, such as lung injury scores, were evaluated using the Kruskal–Wallis test. Unless otherwise indicated, all experiments were conducted independently at least three times. Statistical significance was defined as p < 0.05, based on a 95% confidence interval. Results Norepinephrine suppressed inflammation and oxidative stress in AMs Our previous transcriptomic analysis 8 of murine lung tissues revealed that neural regulatory pathways, particularly sympathetic and parasympathetic signaling, may participate in modulating inflammatory responses. Consistently, analysis of a GEO dataset from human AMs revealed differential expression of sympathetic signaling–related genes after LPS stimulation (Fig. 1 A), indicating a potential role of sympathetic pathways in regulating macrophage inflammatory responses. To functionally validate this hypothesis, primary AMs isolated from mice were exposed to LPS (1µg/ml) for 24 hours in the presence or absence of graded concentrations of norepinephrine (0.1, 1, and 10µM). ELISA analysis of cell culture supernatants revealed that LPS markedly elevated TNF-α (Fig. 1 B) and IL-6 (Fig. 1 C) secretion, while norepinephrine co-treatment suppressed the production of both cytokines. Macrophages are well established to adopt a pro-inflammatory M1 phenotype in response to inflammatory stimuli, characterized by the production of TNF-α and IL-6 24 . Western blot analysis showed that the LPS group exhibited increased CD86 and decreased CD206 expression, whereas norepinephrine co-treatment reversed this phenotype in a dose-dependent manner, indicating a transition in macrophage polarization from the M1 pro-inflammatory subtype to the M2 anti-inflammatory phenotype (Fig. 1 D-F). Similarly, flow cytometry showed that the LPS group markedly increased the percentage of CD86⁺ macrophages, while norepinephrine treatment (1 µM) significantly reduced this proportion (Fig. 1 G, H). Fluorescence microscopy of DCFH-DA staining revealed strong ROS signals in the LPS group, which were markedly attenuated by norepinephrine treatment, particularly at 1 µM (Fig. 1 I). Quantitative analysis confirmed a similar trend, with norepinephrine reducing ROS levels in a dose-dependent manner (Fig. 1 J). Based on the above findings and considering the potential adverse effects of higher concentrations, norepinephrine was used at 1 µM in subsequent experiments. Taken together, these results suggest that norepinephrine reduces LPS-induced inflammatory responses, oxidative stress, and polarization changes in AMs in vitro. Norepinephrine attenuates LPS-induced ferroptosis in a dose-dependent manner To elucidate the mechanism by which norepinephrine mitigates LPS-induced macrophage inflammation, we noted that recent studies have identified ferroptosis as a critical link between macrophage polarization and proinflammatory cytokine production 25 , 26 . Ferroptosis, a recently identified type of regulated cell demise, involves excessive iron buildup and oxidative lipid damage, and is modulated by critical regulators including GPX4, FTH1, and SLC7A11. Supplementary data further support this finding, demonstrating that LPS alone led to marked downregulation of these genes, accompanied by increased intracellular MDA and Fe²⁺ levels (Supplementary Fig. S1 ). As shown in Fig. 2 A, LPS stimulation significantly downregulated the mRNA expression of ferroptosis-related genes, while norepinephrine treatment effectively reversed these changes. Both malondialdehyde (MDA) content and intracellular Fe²⁺ levels in AMs were also elevated following LPS stimulation and progressively reduced by norepinephrine treatment (Fig. 2 B, C). Western blot images and densitometric analysis demonstrated that norepinephrine significantly upregulated the expression of GPX4 and SLC7A11 following LPS exposure, whereas co-administration of the ferroptosis inducer Erastin (5 µM) reversed these effects (Fig. 2 D-F). ROS staining was then conducted to examine oxidative stress. Fluorescence remained low in the Erastin + Sham group but was markedly elevated in the Erastin + LPS group. Notably, norepinephrine co-treatment (Erastin + LPS + NE) did not effectively reduce ROS accumulation, suggesting that the antioxidative effect of norepinephrine was attenuated in the presence of Erastin (Fig. 2 G). Quantitative analysis confirmed this observation (Fig. 2 H). Collectively, these findings highlight ferroptosis as a key pathogenic mechanism in LPS-induced macrophage injury and support the protective effect of norepinephrine. Norepinephrine suppresses ferroptosis via β2-adrenergic receptor signaling It has been discovered that norepinephrine exerts its biological effects mainly through α- and β-adrenergic receptors, including α1, α2, β1, β2, and β3 subtypes 27 . To determine the receptor subtype involved in the antiferroptotic effect of norepinephrine, selective antagonists for α1 (prazosin, 5 µM), α2 (yohimbine, 10 µM), β1 (atenolol, 5 µM), and β2 (butoxamine, 10 µM) receptors were applied at the beginning of LPS stimulation. Among them, only butoxamine reversed the norepinephrine-mediated reduction in MDA levels, indicating a β2-AR-dependent mechanism (Fig. 3 A). Based on this finding, the selective β2 agonist salbutamol (5 µM) was utilized. Both norepinephrine and salbutamol significantly reduced MDA and Fe²⁺ levels in LPS-treated cells (Fig. 3 B, 3 C). Western blot analysis showed increased expression of SLC7A11 and GPX4 after norepinephrine or salbutamol treatment, which was blocked by butoxamine (Fig. 3 D). Consistent with these findings, immunofluorescence staining revealed that ROS accumulation was significantly reduced by norepinephrine and salbutamol, whereas this effect was abolished by co-treatment with butoxamine (Fig. 3 E). Quantitative analysis of ROS intensity further confirmed these observations (Fig. 3 F). In addition, salbutamol and butoxamine were also shown to modulate inflammatory cytokine levels, including TNF-α and IL-6(Supplementary Fig. S2). Transmission electron microscopy revealed that LPS induced mitochondrial shrinkage, membrane density, and cristae loss - hallmarks of ferroptosis. These alterations were alleviated by norepinephrine and salbutamol, but reappeared in the presence of butoxamine, confirming that β2 receptor activation protects against ferroptotic mitochondrial damage in AMs (Fig. 3 G). Together, these results indicate that the anti-ferroptotic effect of norepinephrine in LPS-induced macrophage injury is specifically mediated through the β2-AR. The application of salbutamol resulted in similar anti-inflammatory and antioxidative outcomes as norepinephrine. Norepinephrine upregulates HDC expression and enriches oxidative stress-related pathways To investigate how norepinephrine confers protection at the molecular level, transcriptomic analysis was performed in LPS-injured AMs with norepinephrine treatment. Hierarchical clustering of differentially expressed genes revealed a clear separation between the LPS + NE and LPS + NE + BUT groups, indicating distinct gene expression profiles (Fig. 4 A). Bubble plot analysis demonstrated that norepinephrine-regulated genes were significantly enriched in pathway such as regulation of oxidative stress, glutathione metabolic process, and mitochondrial organization (Fig. 4 B). Volcano plot analysis identified numerous differentially expressed genes (Fig. 4 C). To identify ferroptosis-related targets potentially involved in the anti-inflammatory effects of norepinephrine, we integrated differentially expressed genes (DEGs) from RNA-seq data with the ferroptosis-associated gene sets (drivers, suppressors, and markers) curated from FerrDb ( http://www.zhounan.org/ferrdb/current/ ) and relevant literature (Fig. 4 D). A total of 15 genes overlapped between DEGs and ferroptosis suppressors, among which histidine decarboxylase (HDC) was selected for further validation based on its potential regulatory role in macrophage redox balance. We focused on HDC, given its reported role in redox homeostasis and ferroptosis regulation 28 . qPCR analysis was performed to confirm the upregulation of HDC mRNA, and showed a significant increase in the LPS + NE group compared to LPS alone. (Fig. 4 E). Western blot analysis also showed a pronounced elevation of HDC protein in norepinephrine-treated cells (Fig. 4 F). Norepinephrine inhibits ferroptosis via the HDC/SLC7A11 axis in AMs Given the regulatory effect of norepinephrine on HDC expression via β2-adrenergic signaling, we next explored whether HDC plays a functional role in modulating ferroptosis and inflammation in AMs. Firstly, we knocked down the HDC gene in AMs using siRNA transfection. DHE staining (Fig. 5 A) demonstrated a pronounced elevation of ROS levels in the LPS + siHDC group relative to the LPS + siNC group. Quantitative assessment further verified an increased proportion of DHE-positive cells following HDC silencing (Fig. 5 C). Meanwhile, qPCR analysis further revealed that HDC silencing markedly downregulated the mRNA expression of ferroptosis-suppressor genes, including GPX4, FTH1, and SLC7A11, in response to LPS stimulation (Fig. 5 B). To validate these findings in vivo, rAAV-F4/80-mHdc-P2A-EGFP (5×10¹² vg/mL, 40 µL) was administered via intratracheal injection 21 days prior to modeling to induce HDC overexpression in AMs. After 21 days, LPS (5 mg/kg) was administered intranasally to induce ARDS. Twenty-four hours post-induction, lung samples, BALF, and primary alveolar macrophages were collected for downstream analyses. Subsequently, HDC overexpression was found to significantly reduce ROS accumulation (Fig. 5 D) and the proportion of DHE-positive cells (Fig. 5 E) compared with the AAV-NC group. Consistently, the AAV-HDC group exhibited significantly increased transcript levels of GPX4, FTH1, and SLC7A11 (Fig. 5 F), supporting the notion that HDC alleviates LPS-induced ferroptosis in AMs and contributes to the cytoprotective phenotype. It is well established that HDC catalyzes the synthesis of histamine, a biologically active monoamine involved in diverse physiological and pathological processes. Histamine mediates its biological functions via four distinct G protein-coupled receptors (GPCRs), namely H1R, H2R, H3R, and H4R. Notably, H1R has been implicated in the regulation of ferroptosis, suggesting a mechanistic link between histamine signaling and redox imbalance–associated cell death 29 . HDC deficiency has also been reported to promote ferroptosis in cardiomyocytes via inhibition of the H1R-STAT3-SLC7A11 pathway 28 . To investigate this mechanism, AMs were exposed to LPS and norepinephrine, with parallel groups receiving an H1R antagonist to assess receptor-specific effects. Our results demonstrated that although norepinephrine treatment reduced MDA content, this effect was abolished by H1R blockade, indicating that H1R signaling is required for norepinephrine-mediated suppression of lipid peroxidation (Fig. 5 G). Similarly, SLC7A11 mRNA expression, which was suppressed by LPS, was restored following norepinephrine treatment, but this restoration was prevented by H1R antagonist (Fig. 5 H). Western blot analysis showed that the upregulation of phosphorylated STAT3 (p-STAT3) and SLC7A11 proteins by norepinephrine was significantly inhibited by either H1R antagonist (Fig. 5 I) or the STAT3 inhibitor c188-9 (Supplementary Fig. S3). Quantitative analysis of SLC7A11 and p-STAT3 protein levels confirmed these findings (Fig. 5 J, K). Similarly, ROS staining revealed that the decrease in intracellular ROS levels conferred by norepinephrine was completely abrogated by H1R antagonist (Fig. 5 L). This finding supports the involvement of the HDC-STAT3–SLC7A11 axis as a downstream effector pathway mediating ferroptosis inhibition. Salbutamol alleviates lung injury via HDC-dependent ferroptosis suppression To further verify the role of norepinephrine in alleviating ARDS through the inhibition of ferroptosis, in vivo experiments were conducted. we pretreated mice with salbutamol (10 mg/kg) 3 hours before intranasal instillation of LPS (5 mg/kg) to clarify the contribution of β₂-adrenergic signaling. Erastin (10 mg/kg) was administered intraperitoneally concurrently with intranasal LPS stimulation. HDC overexpression via intratracheal viral delivery was performed as previously described. Lung tissues were harvested 24 hours after LPS administration for subsequent analyses. Histological analysis revealed that LPS induced severe lung injury, evidenced by hemorrhage, edema, and alveolar destruction. Both salbutamol treatment and alveolar macrophage-targeted HDC overexpression significantly reduced lung injury scores, while the protective effect of salbutamol was partially reversed by Erastin (Fig. 6 A, D). Similarly, pulmonary vascular permeability and Evans blue extravasation were decreased in salbutamol and AAV-HDC groups (Fig. 6 B, E). Lung W/D ratios (Fig. 6 F) and TNF-α levels (Fig. 6 G) were also reduced by salbutamol or HDC overexpression, with Erastin attenuating these effects. 4-HNE staining confirmed reduced lipid peroxidation in treated groups (Fig. 6 C). Salbutamol increased SLC7A11 and GPX4 expression (Fig. 6 H), and decreased MDA and Fe²⁺ levels, further enhanced by HDC overexpression (Fig. 6 I, J). These results suggest that salbutamol mitigates LPS-triggered pulmonary damage by suppressing ferroptosis in AMs. Notably, targeted HDC overexpression in AMs conferred comparable protective effects, and our in vitro data further support a potential link between β2-adrenergic signaling and HDC expression. Discussion Although neuroimmune regulation is increasingly recognized as a critical modulator of inflammation, the precise role of sympathetic activity in acute inflammatory conditions, including ARDS, remains poorly defined. In particular, its potential involvement in regulating macrophage function and redox homeostasis has not been fully elucidated. In this study, we demonstrated that norepinephrine signaling alleviates LPS-induced acute lung injury by targeting AMs and modulating ferroptosis via the HDC/SLC7A11 axis. We found that sympathetic activation, specifically β2-AR signaling, upregulated HDC expression in AMs, thereby enhancing endogenous histamine production. Through both in vivo and in vitro models of ARDS, we showed that histamine/H1R signaling mitigated oxidative stress and ferroptotic cell death in macrophages, ultimately preserving lung function. Moreover, blockade of β2-AR or H1R exacerbated macrophage ferroptosis and lung injury, underscoring the specificity of this axis. Our findings reveal a previously unrecognized neuroimmune regulatory mechanism providing new insight into the resolution of inflammation and redox imbalance in ARDS (Fig. 7 ). ARDS is a life-threatening pulmonary condition marked by pronounced pulmonary inflammation, disruption of the alveolar-capillary barrier, and extensive recruitment of neutrophils and macrophages into the lung interstitium and bronchoalveolar compartments 30 . Emerging evidence implicates ferroptosis-an iron-dependent, lipid peroxidation-driven form of regulated cell death-as a pivotal mechanism underlying the pathogenesis of multiple inflammatory disorders, including ARDS 31 , 32 . Despite accumulating evidence underscoring its pathological relevance, the precise molecular pathways mediating ferroptosis in ARDS remain incompletely understood. Importantly, the pathogenesis of ARDS is largely driven by the abnormal activation of AMs, which coordinate inflammatory responses via cytokine secretion, phagocytosis, and immune modulation 7 , 33 , 34 . Emerging evidence indicates that ferroptosis induces intracellular iron overload in macrophages, thereby promoting their polarization toward the pro-inflammatory M1 phenotype 25 . In this context, ferroptosis of AMs is increasingly recognized as a key driver in the progression of ARDS, primarily through the amplification of oxidative stress and promotion of inflammatory responses. Recent findings have shown that melatonin suppresses macrophage ferroptosis by inhibiting NCOA4-mediated ferritinophagy, thereby reducing lipid peroxidation and improving outcomes in septic ARDS models 35 . However, the precise regulatory mechanisms underlying macrophage ferroptosis remain incompletely understood. Modulating ferroptotic pathways in alveolar macrophages holds potential as a novel intervention approach for ARDS management. Norepinephrine–a major catecholamine neurotransmitter released by sympathetic nerve terminals, plays crucial functions in cardiovascular homeostasis, metabolic regulations, and immune modulation. Its immunomodulatory effects exhibit remarkable complexity, dictated by both the specific physiological context and the differential status of adrenergic receptor subtypes (α1, α2, β1 and β2). Notably, β2-AR signaling has revealed as a dominant anti-inflammatory pathway across various immune cell types. For instance, studies on neuroinflammation and neuropathic pain have shown that norepinephrine attenuates inflammatory responses by inhibiting microglial activation 36 . It has also been reported that activation of sympathetic signaling in macrophages promotes anti-inflammatory phenotypic shift, partially by upregulating Tim3, which leads to diminished systemic inflammation and enhanced protection against tissue injury 37 . Emerging studies indicate that neuroimmune regulation can alleviate ARDS by suppressing ferroptosis, as demonstrated by electroacupuncture acting through α7 nicotinic acetylcholine receptors 38 . However, the specific relationship between sympathetic neuroimmune regulation, ferroptosis, and ARDS has not yet been fully elucidated. Our study further demonstrated that norepinephrine suppresses ferroptosis in LPS-induced macrophage injury specifically through β2-AR signaling. Pharmacological activation of the β2-AR with salbutamol reproduced the protective effects of norepinephrine, while selective blockade with butoxamine abolished these benefits, as evidenced by reductions in MDA, Fe²⁺, and ROS levels. Notably, salbutamol treatment also upregulated the expression of SLC7A11, FTH1, and GPX4, and preserved mitochondrial ultrastructure, indicating a suppression of ferroptotic cell death. These results align with previous work by Liyan Hou and colleagues, who showed that norepinephrine deficiency aggravates ferroptosis, whereas normal norepinephrine levels help maintain antioxidant defenses, preserve mitochondrial function, and sustain intracellular homeostasis, thereby suppressing neuronal ferroptosis in mouse parkinson's disease model 23 . Meanwhile, inhibition of macrophage ferroptosis via the Nrf2 signaling pathway has been demonstrated to alleviate ARDS 39 ​. Taken together, these mechanistic insights not only reinforce the neuroimmune axis as a key modulator of ferroptosis in the context of acute lung injury, but also suggest that targeting sympathetic β2-adrenergic signaling may offer a promising therapeutic avenue for the management of ARDS. Importantly, salbutamol—a clinically approved selective β2-AR agonist widely used in clinical practice—exhibited protective effects comparable to those of norepinephrine in our model. These findings suggest that targeting macrophage ferroptosis via β2-AR signaling may represent a viable strategy for mitigating inflammation-induced lung injury. Given its well-characterized safety profile and extensive clinical application, our results provide a rational basis for repurposing β2-AR agonists as immunomodulatory therapeutics in ARDS. HDC catalyzes the decarboxylation of histidine to generate histamine, a biogenic amine that functions as a neurotransmitter and modulator of various metabolic processes. Depending on its receptor context, histamine can exert either pro-inflammatory or anti-inflammatory effects 27 , 40 . Previous studies have shown that histamine deficiency in Hdc knockout (Hdc⁻/⁻) mice significantly reduces blood perfusion and impairs muscle regeneration 41 . In addition, histamine attenuates cardiomyocyte autophagy and apoptosis in acute myocardial infarction via H1 receptor signaling 42 . Our enrichment analysis indicated that norepinephrine-induced upregulation of HDC is associated with ferroptosis-related antioxidant and metabolic pathways, suggesting an indirect regulatory role in ferroptosis susceptibility. Similarly, recent researches also implied that HDC plays a protective role against ferroptosis. For example, in a cisplatin-induced ototoxicity model, histamine deficiency resulting from HDC knockout was shown to exacerbate ferroptotic cell death in cochlear hair cells, as evidenced by increased lipid peroxidation, iron accumulation, and decreased antioxidant capacity 43 . Studies in myocardial infarction models have demonstrated that HDC deficiency aggravates cardiac injury, characterized by increased neutrophil infiltration, elevated ROS production, and excessive formation of neutrophil extracellular traps (NETs) 28 . Multi-omics analyses suggest that HDC and its metabolic pathways may contribute to resistance against ferroptosis by enhancing cellular antioxidant defenses in pressure-overload cardiac dysfunction 44 . In the context of doxorubicin-induced cardiotoxicity, disruption of histamine signaling—either by HDC deletion or H1 receptor inhibition—leads to increased susceptibility to ferroptosis 45 . Mechanistically, the HDC/histamine-H1R axis protects against ferroptosis by activating the STAT3-SLC7A11 pathway, which promotes glutathione biosynthesis and enhances cellular antioxidant defenses 28 . Consistently, our experiments showed that the anti-ferroptotic effect of norepinephrine was partially attenuated by both an H1 receptor antagonist and the STAT3 inhibitor C188-9, further confirming that the HDC/histamine-H1R/STAT3 axis is essential for mediating the protective actions of norepinephrine against ferroptosis. These results highlight the importance of HDC in maintaining cellular redox balance, further confirming the crucial role of the HDC/SLC7A11 signaling cascade in macrophage ferroptosis regulation. In summary, previous studies have identified ferroptosis as a key pathological mechanism in various inflammatory and oxidative stress-related diseases, including ARDS. To summarize, our study demonstrates that ferroptosis contributes to LPS-induced ARDS and identifies AMs as key targets. Distinct from conventional antioxidant pathways, we highlight a previously unrecognized role of β2-adrenergic signaling in modulating neuroimmune interactions. Moreover, our results emphasize neuroimmune modulation involving endogenous histamine synthesis and H1R/STAT3 signaling, providing a novel therapeutic perspective based on immune-neurotransmitter interactions to alleviate ferroptosis and pulmonary inflammation. However, several limitations should be noted. Although primary AMs were used, they may not fully reflect the complexity of human AMs or the in vivo immune microenvironment. Our study primarily focused on macrophages, while the involvement of other immune and structural cells in ARDS remains unexplored. Moreover, the neuroimmune mechanisms linking β2-AR signaling to macrophage function, such as the upstream regulation of HDC and its downstream interactions, require further investigation. Future studies should also assess the therapeutic value of β2-agonists like salbutamol in broader inflammatory contexts. Conclusion Our study identifies a novel neuroimmune mechanism in which norepinephrine suppresses macrophage ferroptosis to alleviate LPS-induced ARDS. This effect is mediated by β2-AR activation, which promotes histamine synthesis and triggers downstream signaling via the HDC/SLC7A11 axis. These findings highlight a previously unrecognized link between sympathetic signaling and ferroptosis regulation, offering new insights into the immunopathogenesis of ARDS and a potential therapeutic strategy targeting neuroimmune interactions. Declarations Author contributions Xing Lv, Chenhao Jiang and Xu Zhang conceived the study, conducted the experiments, and contributed to data acquisition and analysis. Xuxia Wei, Yang Zhao, Jianhao Zhang, Xuegang Zhao, Lu Han, Yufeng He, Jianrong Liu, Yujun Zhang, Yuling An, and Xiaomeng Yi assisted with experimental procedures and data interpretation. Yingcai Zhang, Xin Sui, and Huimin Yi supervised the study, provided critical input, and revised the manuscript. All authors read and approved the final manuscript. Funding This work was supported by the National Natural Science Foundation of China (Grant Nos. 82270690, 82200732, and 82270689), Science and Technology Program of Guangzhou (Grant No. 2023A04J1795). Data Availability All data are available from the corresponding author with reasonable request. Ethics approval All animal experiments were performed in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals. The study protocol was approved by the Institutional Animal Care and Use Committee of Guangzhou Jennio Biotech Company Limited (No. JENNIO-IACUC-2025-A015). Conflict of Interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Declaration of generative AI and AI-assisted technologies in the writing process During the preparation of this work, the authors used ChatGPT (OpenAI) to improve language and readability. After using this tool, the authors reviewed and edited the content as needed and take full responsibility for the content of the publication. Correspondence Prof. Yingcai Zhang Department of Hepatic Surgery and Liver Transplantation Center, The Third Affiliated Hospital of Sun Yat-sen University, China E-mail: [email protected] Prof. Xin Sui Surgical and Transplant Intensive Care Unit, The Third Affiliated Hospital, Sun Yat-sen University, Guangzhou, China E-mail: [email protected] Prof. HuiMin Yi Surgical and Transplant Intensive Care Unit, The Third Affiliated Hospital, Sun Yat-sen University, Guangzhou, China E-mail: [email protected] References Meyer NJ, Gattinoni L, Calfee CS. Acute respiratory distress syndrome. Lancet. 2021;398:622–37. 10.1016/S0140-6736(21)00439-6 . Gorman EA, O'Kane CM, McAuley DF. Acute respiratory distress syndrome in adults: diagnosis, outcomes, long-term sequelae, and management. Lancet. 2022;400(20220904):1157–70. 10.1016/S0140-6736(22)01439-8 . Ware LB, Matthay MA, Mebazaa A. Designing an ARDS trial for 2020 and beyond: focus on enrichment strategies. Intensive Care Med. 2020;46(20201102):2153–6. 10.1007/s00134-020-06232-x . Ahmad S, Wrennall JA, Goriounova AS, et al. Specific Inhibition of Orai1-mediated Calcium Signalling Resolves Inflammation and Clears Bacteria in an Acute Respiratory Distress Syndrome Model. Am J Respir Crit Care Med. 2024;209:703–15. 10.1164/rccm.202308-1393OC . Latronico N, Eikermann M, Ely EW, et al. Improving management of ARDS: uniting acute management and long-term recovery. Crit Care. 2024;28:58. 10.1186/s13054-024-04810-9 . Xian H, Liu Y, Rundberg Nilsson A, et al. Metformin inhibition of mitochondrial ATP and DNA synthesis abrogates NLRP3 inflammasome activation and pulmonary inflammation. Immunity. 2021;54:1463–77. 10.1016/j.immuni.2021.05.004 . e1411. 20210610. Grant RA, Morales-Nebreda L, Markov NS, et al. Circuits between infected macrophages and T cells in SARS-CoV-2 pneumonia. Nature. 2021;590(20210111):635–41. 10.1038/s41586-020-03148-w . Zhang X, Wei X, Deng Y, et al. Mesenchymal stromal cells alleviate acute respiratory distress syndrome through the cholinergic anti-inflammatory pathway. Signal Transduct Target Ther. 2022;7:307. 10.1038/s41392-022-01124-6 . Lubahn CL, Lorton D, Schaller JA, et al. Targeting alpha- and beta-Adrenergic Receptors Differentially Shifts Th1, Th2, and Inflammatory Cytokine Profiles in Immune Organs to Attenuate Adjuvant Arthritis. Front Immunol. 2014;5:346. 10.3389/fimmu.2014.00346 . Bacou E, Haurogne K, Allard M, et al. beta2-adrenoreceptor stimulation dampens the LPS-induced M1 polarization in pig macrophages. Dev Comp Immunol. 2017;76:169–17620170617. 10.1016/j.dci.2017.06.007 . Calverley PM, Anderson JA, Celli B, et al. Salmeterol and fluticasone propionate and survival in chronic obstructive pulmonary disease. N Engl J Med. 2007;356:775–89. 10.1056/NEJMoa063070 . Tang D, Chen X, Kang R, et al. Ferroptosis: molecular mechanisms and health implications. Cell Res. 2021;31:107–12520201202. 10.1038/s41422-020-00441-1 . Bell HN, Stockwell BR, Zou W. Ironing out the role of ferroptosis in immunity. Immunity. 2024;57:941–56. 10.1016/j.immuni.2024.03.019 . Stockwell BR, Friedmann Angeli JP, Bayir H, et al. Ferroptosis: A Regulated Cell Death Nexus Linking Metabolism, Redox Biology, and Disease. Cell. 2017;171:273–85. 10.1016/j.cell.2017.09.021 . Chen Y, Fang ZM, Yi X, et al. The interaction between ferroptosis and inflammatory signaling pathways. Cell Death Dis. 2023;14:205. 10.1038/s41419-023-05716-0 . Cui Y, Zhang Z, Zhou X, et al. Microglia and macrophage exhibit attenuated inflammatory response and ferroptosis resistance after RSL3 stimulation via increasing Nrf2 expression. J Neuroinflammation. 2021;18:249. 10.1186/s12974-021-02231-x . Li X, He J, Gao X, et al. GPX4 restricts ferroptosis of NKp46(+)ILC3s to control intestinal inflammation. Cell Death Dis. 2024;15:687. 10.1038/s41419-024-07060-3 . Qin X, Zhang J, Wang B, et al. Ferritinophagy is involved in the zinc oxide nanoparticles-induced ferroptosis of vascular endothelial cells. Autophagy. 2021;17:4266–428520210412. 10.1080/15548627.2021.1911016 . Wang Y, Hu J, Wu S, et al. Targeting epigenetic and posttranslational modifications regulating ferroptosis for the treatment of diseases. Signal Transduct Target Ther. 2023;8:449. 10.1038/s41392-023-01720-0 . Ye R, Wei Y, Li J, et al. Plasma-derived extracellular vesicles prime alveolar macrophages for autophagy and ferroptosis in sepsis-induced acute lung injury. Mol Med. 2025;31:40. 10.1186/s10020-025-01111-x . Luo C, Liang H, Ji M, et al. Autophagy induced by mechanical stress sensitizes cells to ferroptosis by NCOA4-FTH1 axis. Autophagy. 2025;20250310:1–20. 10.1080/15548627.2025.2469129 . Hong H, Xiao C, Weng L, et al. The effect of norepinephrine on ovarian dysfunction by mediating ferroptosis in mice model. Acta Biochim Biophys Sin (Shanghai). 2024;57:542–53. 10.3724/abbs.2024187 . Hou L, Sun F, Sun W, et al. Lesion of the Locus Coeruleus Damages Learning and Memory Performance in Paraquat and Maneb-induced Mouse Parkinson's Disease Model. Neuroscience. 2019;419:129–14020191018. 10.1016/j.neuroscience.2019.09.006 . Kiss M, Pittet MJ. Mitochondrial control of macrophage polarity in tumors. Immunity. 2025;58:1618–20. 10.1016/j.immuni.2025.06.008 . Xu S, Min J, Wang F. Ferroptosis: an emerging player in immune cells. Sci Bull (Beijing). 2021;66:2257–226020210216. 10.1016/j.scib.2021.02.026 . Xiao Y, Yuan Y, Yang Y, et al. GCH1 reduces LPS-induced alveolar macrophage polarization and inflammation by inhibition of ferroptosis. Inflamm Res. 2023;72:1941–55. 10.1007/s00011-023-01785-1 . Bissonnette EY, Befus AD. Anti-inflammatory effect of beta 2-agonists: inhibition of TNF-alpha release from human mast cells. J Allergy Clin Immunol. 1997;100:825–31. 10.1016/s0091-6749(97)70280-x . Zhang Z, Ding S, Wang Z, et al. Prmt1 upregulated by Hdc deficiency aggravates acute myocardial infarction via NETosis. Acta Pharm Sin B. 2022;12(20211022):1840–55. 10.1016/j.apsb.2021.10.016 . Linher-Melville K, Haftchenary S, Gunning P, et al. Signal transducer and activator of transcription 3 and 5 regulate system Xc- and redox balance in human breast cancer cells. Mol Cell Biochem. 2015;405:205–22120150421. 10.1007/s11010-015-2412-4 . Yamashita M, Niisato M, Kawasaki Y, et al. VEGF-C/VEGFR-3 signalling in macrophages ameliorates acute lung injury. Eur Respir J. 2022;59:20220414. 10.1183/13993003.00880-2021 . Gong F, Zheng X, Xu W et al. H3K14la drives endothelial dysfunction in sepsis-induced ARDS by promoting SLC40A1/transferrin-mediated ferroptosis. MedComm (2020) 2025; 6: e70049. 20250114. 10.1002/mco2.70049 Zhou RP, Chen Y, Wei X, et al. Novel insights into ferroptosis: Implications for age-related diseases. Theranostics. 2020;10(20201026):11976–97. 10.7150/thno.50663 . Yang J, Huang X, Yu Q, et al. Extracellular vesicles derived from M2-like macrophages alleviate acute lung injury in a miR-709-mediated manner. J Extracell Vesicles. 2024;13:e12437. 10.1002/jev2.12437 . Wang L, Wang D, Zhang T, et al. The role of immunometabolism in macrophage polarization and its impact on acute lung injury/acute respiratory distress syndrome. Front Immunol. 2023;14:1117548. 10.3389/fimmu.2023.1117548 . Xu W, Wu Y, Wang S, et al. Melatonin alleviates septic ARDS by inhibiting NCOA4-mediated ferritinophagy in alveolar macrophages. Cell Death Discov. 2024;10:253. 10.1038/s41420-024-01991-8 . Zou HL, Li J, Zhou JL, et al. Effects of norepinephrine on microglial neuroinflammation and neuropathic pain. Ibrain. 2021;7(20211208):309–17. 10.1002/ibra.12001 . Hasegawa S, Inoue T, Nakamura Y, et al. Activation of Sympathetic Signaling in Macrophages Blocks Systemic Inflammation and Protects against Renal Ischemia-Reperfusion Injury. J Am Soc Nephrol. 2021;32:1599–615. 10.1681/ASN.2020121723 . Zhang Y, Zheng L, Deng H, et al. Electroacupuncture Alleviates LPS-Induced ARDS Through alpha7 Nicotinic Acetylcholine Receptor-Mediated Inhibition of Ferroptosis. Front Immunol. 2022;13:832432. 10.3389/fimmu.2022.832432 . He R, Liu B, Xiong R, et al. Itaconate inhibits ferroptosis of macrophage via Nrf2 pathways against sepsis-induced acute lung injury. Cell Death Discov. 2022;8:43. 10.1038/s41420-021-00807-3 . Chen X, Deng H, Churchill MJ, et al. Bone Marrow Myeloid Cells Regulate Myeloid-Biased Hematopoietic Stem Cells via a Histamine-Dependent Feedback Loop. Cell Stem Cell. 2017;21:747–e760747. 10.1016/j.stem.2017.11.003 . Abudupataer M, Zou W, Zhang W, et al. Histamine deficiency delays ischaemic skeletal muscle regeneration via inducing aberrant inflammatory responses and repressing myoblast proliferation. J Cell Mol Med. 2019;23:8392–409. 10.1111/jcmm.14720 . Ding S, Abudupataer M, Zhou Z, et al. Histamine deficiency aggravates cardiac injury through miR-206/216b-Atg13 axis-mediated autophagic-dependant apoptosis. Cell Death Dis. 2018;9:694. 10.1038/s41419-018-0723-6 . Wu D, Zhu B, Yang X, et al. Histamine deficiency exacerbates cisplatin-induced ferroptosis in cochlea hair cells of HDC knockout mice. Int Immunopharmacol. 2024;138:112639. 10.1016/j.intimp.2024.112639 . Xu Q, Liu X, Chen Z, et al. Combination decoction of Astragalus mongholicus and Salvia miltiorrhiza mitigates pressure-overload cardiac dysfunction by inhibiting multiple ferroptosis pathways. Front Pharmacol. 2024;15:1447546. 10.3389/fphar.2024.1447546 . Zhu X, Wang X, Zhu B, et al. Disruption of histamine/H(1)R-STAT3-SLC7A11 axis exacerbates doxorubicin-induced cardiac ferroptosis. Free Radic Biol Med. 2022;192(20220919):98–114. 10.1016/j.freeradbiomed.2022.09.012 . Additional Declarations No competing interests reported. Supplementary Files supplementarymaterials.pdf SuppFig.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7374244","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":516098717,"identity":"62a55d4c-69db-43f1-8c4b-a53077b1f931","order_by":0,"name":"Xing Lv","email":"","orcid":"","institution":"Sun Yat-sen University","correspondingAuthor":false,"prefix":"","firstName":"Xing","middleName":"","lastName":"Lv","suffix":""},{"id":516098719,"identity":"b8cd16f7-dbb4-4034-ab8b-0a343d878628","order_by":1,"name":"Chenhao Jiang","email":"","orcid":"","institution":"Sun Yat-sen University","correspondingAuthor":false,"prefix":"","firstName":"Chenhao","middleName":"","lastName":"Jiang","suffix":""},{"id":516098720,"identity":"e3eb5505-e99b-4149-993a-e25998eb2f8e","order_by":2,"name":"Xu Zhang","email":"","orcid":"","institution":"Sun Yat-sen University","correspondingAuthor":false,"prefix":"","firstName":"Xu","middleName":"","lastName":"Zhang","suffix":""},{"id":516098721,"identity":"70a11d3d-6f70-4fa5-8313-d25b85fa91df","order_by":3,"name":"Xuxia Wei","email":"","orcid":"","institution":"Sun Yat-sen University","correspondingAuthor":false,"prefix":"","firstName":"Xuxia","middleName":"","lastName":"Wei","suffix":""},{"id":516098723,"identity":"9b24030c-3dad-4635-ac8d-8b38e04ec659","order_by":4,"name":"Yang Zhao","email":"","orcid":"","institution":"Sun Yat-sen University","correspondingAuthor":false,"prefix":"","firstName":"Yang","middleName":"","lastName":"Zhao","suffix":""},{"id":516098725,"identity":"3afdfa61-d519-48b9-8d4b-151991e63603","order_by":5,"name":"JianHao Zhang","email":"","orcid":"","institution":"Sun Yat-sen University","correspondingAuthor":false,"prefix":"","firstName":"JianHao","middleName":"","lastName":"Zhang","suffix":""},{"id":516098727,"identity":"03cc1f65-dac9-4010-8d53-c625e7e659b8","order_by":6,"name":"Xuegang Zhao","email":"","orcid":"","institution":"Sun Yat-sen University","correspondingAuthor":false,"prefix":"","firstName":"Xuegang","middleName":"","lastName":"Zhao","suffix":""},{"id":516098729,"identity":"f89c1026-5299-45b5-baaa-eb83823071f6","order_by":7,"name":"Lu Han","email":"","orcid":"","institution":"Sun Yat-sen University","correspondingAuthor":false,"prefix":"","firstName":"Lu","middleName":"","lastName":"Han","suffix":""},{"id":516098730,"identity":"55157025-b2ea-4c3a-8374-2f8d342a67d7","order_by":8,"name":"Yufeng He","email":"","orcid":"","institution":"Sun Yat-sen University","correspondingAuthor":false,"prefix":"","firstName":"Yufeng","middleName":"","lastName":"He","suffix":""},{"id":516098733,"identity":"b97bd412-ac5d-4c66-899b-87df003f01d9","order_by":9,"name":"Jianrong Liu","email":"","orcid":"","institution":"Sun Yat-sen University","correspondingAuthor":false,"prefix":"","firstName":"Jianrong","middleName":"","lastName":"Liu","suffix":""},{"id":516098734,"identity":"be095222-b17f-4473-b465-da529fce02a9","order_by":10,"name":"YuJun Zhang","email":"","orcid":"","institution":"Sun Yat-sen University","correspondingAuthor":false,"prefix":"","firstName":"YuJun","middleName":"","lastName":"Zhang","suffix":""},{"id":516098735,"identity":"88a7756c-393b-493f-b2d2-8a3aa6f47330","order_by":11,"name":"Yuling An","email":"","orcid":"","institution":"Sun Yat-sen University","correspondingAuthor":false,"prefix":"","firstName":"Yuling","middleName":"","lastName":"An","suffix":""},{"id":516098740,"identity":"a82a86a1-4f5e-4af6-ba5e-903be7ad6b8a","order_by":12,"name":"Xiaomeng Yi","email":"","orcid":"","institution":"Sun Yat-sen University","correspondingAuthor":false,"prefix":"","firstName":"Xiaomeng","middleName":"","lastName":"Yi","suffix":""},{"id":516098741,"identity":"9addce68-87ca-4469-9e45-34098114dbc0","order_by":13,"name":"Yingcai Zhang","email":"","orcid":"","institution":"Sun Yat-sen University","correspondingAuthor":false,"prefix":"","firstName":"Yingcai","middleName":"","lastName":"Zhang","suffix":""},{"id":516098742,"identity":"9d397b2a-bcaf-4d73-9f90-602651dbc878","order_by":14,"name":"Xin Sui","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA/UlEQVRIiWNgGAWjYFACxgaGBAYbOSCj8QBMTIIILWnGIAaxWsDgcGIDkCROi/yM5DaJhzvS0te2Hwba8uewvcEB5oO3eRjs8nBpMbiR2GyQeMYmd9uZxIYDjG2HEzccYEu25mFILsapRSKx8UFiW1rutgMgLQ2HEwwO8JhJ8zAcADsVu8OAKhPbDqebnX8Icxj/N7xaGG6AbTmcYHYDqJeB7TDjhgM8bHi1GJx5CPRLW5rhthsPQdalJ848zGZsOccgGbfD2tOfSf5ss5E3O5/+8MGHP9b2fMebH954U2GH22EoIIGhmYGBGWw7UerBoI54paNgFIyCUTBiAAANtWJKtZ4uDgAAAABJRU5ErkJggg==","orcid":"","institution":"Sun Yat-sen University","correspondingAuthor":true,"prefix":"","firstName":"Xin","middleName":"","lastName":"Sui","suffix":""},{"id":516098746,"identity":"7676d7d5-c9f5-4316-9b41-6d4196fb470f","order_by":15,"name":"Huimin Yi","email":"","orcid":"","institution":"Sun Yat-sen University","correspondingAuthor":false,"prefix":"","firstName":"Huimin","middleName":"","lastName":"Yi","suffix":""}],"badges":[],"createdAt":"2025-08-14 13:23:10","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7374244/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7374244/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":91914967,"identity":"fe5889a8-4de2-4be1-96cd-eeb0cd5e05a5","added_by":"auto","created_at":"2025-09-23 00:46:03","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":7056529,"visible":true,"origin":"","legend":"","description":"","filename":"Manuscript..docx","url":"https://assets-eu.researchsquare.com/files/rs-7374244/v1/f18d3a616ca3fb67238b8bff.docx"},{"id":91912922,"identity":"4ade95d0-bc90-4670-890a-fabf5d09f538","added_by":"auto","created_at":"2025-09-23 00:38:03","extension":"json","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":14906,"visible":true,"origin":"","legend":"","description":"","filename":"1b3a238f7d9b436194ecd9006d56204d.json","url":"https://assets-eu.researchsquare.com/files/rs-7374244/v1/a91818ca1fdfcbd962957852.json"},{"id":91912924,"identity":"3fdeb7c4-5613-4e72-926d-afe6b41baa4b","added_by":"auto","created_at":"2025-09-23 00:38:03","extension":"pdf","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":651879,"visible":true,"origin":"","legend":"","description":"","filename":"supplementarymaterials.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7374244/v1/cc7aac901ae10b1cabd436ca.pdf"},{"id":91917536,"identity":"200cf52b-568b-4a6f-a757-7ead170b28b8","added_by":"auto","created_at":"2025-09-23 01:02:03","extension":"xml","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":144732,"visible":true,"origin":"","legend":"","description":"","filename":"1b3a238f7d9b436194ecd9006d56204d1enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7374244/v1/d582099fd96f7f542a1527cc.xml"},{"id":91912929,"identity":"9715f76a-5044-4cd9-97c1-224267036916","added_by":"auto","created_at":"2025-09-23 00:38:03","extension":"jpeg","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":553116,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7374244/v1/bbd70f6ca35889efecf2a57f.jpeg"},{"id":91914962,"identity":"b9093afb-e2d2-477c-8a2a-f9c6a39dd3d5","added_by":"auto","created_at":"2025-09-23 00:46:03","extension":"jpeg","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":159626,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage10.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7374244/v1/464352d085d8244723b1a8ae.jpeg"},{"id":91915851,"identity":"caab1bdc-493f-45f2-a12d-b03e05bd30ca","added_by":"auto","created_at":"2025-09-23 00:54:03","extension":"jpeg","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":719380,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7374244/v1/6ec5bc2a63c2f9ddb15e5241.jpeg"},{"id":91912935,"identity":"cc750c3c-ff0a-4e6a-a420-77ba0c93ef44","added_by":"auto","created_at":"2025-09-23 00:38:03","extension":"jpeg","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1163798,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7374244/v1/98a7deb5949f0c91528801fd.jpeg"},{"id":91915854,"identity":"e6ba84f9-9842-46a6-b80d-a0035ef18156","added_by":"auto","created_at":"2025-09-23 00:54:03","extension":"jpeg","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":319020,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7374244/v1/0f5ced4bf44acbbd55fef78f.jpeg"},{"id":91917535,"identity":"964c7f87-1ab6-47d1-bc24-fb18f8105a75","added_by":"auto","created_at":"2025-09-23 01:02:03","extension":"jpeg","order_by":20,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":990212,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7374244/v1/b2d2022727f363e80f0dd87f.jpeg"},{"id":91914972,"identity":"a8f610af-840e-42b2-bbc9-d4c3bfba1c68","added_by":"auto","created_at":"2025-09-23 00:46:03","extension":"jpeg","order_by":21,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2297282,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage6.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7374244/v1/3dcceeafd5ad1cfcd10560c9.jpeg"},{"id":91914969,"identity":"b2998d13-2d39-481b-9b58-aba490d6e0b4","added_by":"auto","created_at":"2025-09-23 00:46:03","extension":"png","order_by":22,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":220099,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-7374244/v1/eefebf56451b7694728c46df.png"},{"id":91915855,"identity":"483ff37c-3364-439d-8235-921175a1255e","added_by":"auto","created_at":"2025-09-23 00:54:03","extension":"jpeg","order_by":23,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":283014,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage8.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7374244/v1/6bd7abce7ee71fdeb922b3d1.jpeg"},{"id":91914968,"identity":"938cd16c-f295-4b33-8d7d-a937301521fc","added_by":"auto","created_at":"2025-09-23 00:46:03","extension":"jpeg","order_by":24,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":190968,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage9.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7374244/v1/5192f088c190f2228e038b77.jpeg"},{"id":91912937,"identity":"d9576bcf-5cba-4404-b0ef-32113f4f1bf8","added_by":"auto","created_at":"2025-09-23 00:38:03","extension":"png","order_by":25,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":72741,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7374244/v1/a62e451f3da90bb5a436c82a.png"},{"id":91912932,"identity":"9ee4aab8-8287-4e28-a402-a9935b68ea2e","added_by":"auto","created_at":"2025-09-23 00:38:03","extension":"png","order_by":26,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":26845,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage10.png","url":"https://assets-eu.researchsquare.com/files/rs-7374244/v1/83900ddd78472335c3e864a0.png"},{"id":91912939,"identity":"ccf2a657-b89f-48a7-aaad-001edec47d8f","added_by":"auto","created_at":"2025-09-23 00:38:03","extension":"png","order_by":27,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":53434,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7374244/v1/51079be57bd06a89f8c55882.png"},{"id":91915852,"identity":"1097f0a0-150f-472c-8b74-0e295b5869a8","added_by":"auto","created_at":"2025-09-23 00:54:03","extension":"png","order_by":28,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":224751,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7374244/v1/16c7a70360ff8b05516efd3c.png"},{"id":91915858,"identity":"ac238643-d245-4ba1-bdf5-c05e510762ac","added_by":"auto","created_at":"2025-09-23 00:54:03","extension":"png","order_by":29,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":49075,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7374244/v1/9cae45d9071a36aa014e19c0.png"},{"id":91912946,"identity":"c7ef300b-4b33-4e10-8917-92e3583198bd","added_by":"auto","created_at":"2025-09-23 00:38:03","extension":"png","order_by":30,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":114270,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-7374244/v1/bb9f597c65511502d0ec5c7d.png"},{"id":91912948,"identity":"73d39629-b317-41c0-9274-0b858fa7f909","added_by":"auto","created_at":"2025-09-23 00:38:03","extension":"png","order_by":31,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":263699,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-7374244/v1/64ee8349a437c97a721eeba9.png"},{"id":91914971,"identity":"ed8deec9-6311-4126-8727-5b5493c0aeee","added_by":"auto","created_at":"2025-09-23 00:46:03","extension":"png","order_by":32,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":56133,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-7374244/v1/15ce543c10a5b21cf3faf1c1.png"},{"id":91912942,"identity":"8b96bb57-1927-4676-95e7-a62b9b18901d","added_by":"auto","created_at":"2025-09-23 00:38:03","extension":"png","order_by":33,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":42685,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage8.png","url":"https://assets-eu.researchsquare.com/files/rs-7374244/v1/925057fb3cf3b79997a04d3c.png"},{"id":91912934,"identity":"b5bf1ec4-bd9d-4cfb-b787-59718479028b","added_by":"auto","created_at":"2025-09-23 00:38:03","extension":"png","order_by":34,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":23655,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage9.png","url":"https://assets-eu.researchsquare.com/files/rs-7374244/v1/85c4b3b60507f31957efb914.png"},{"id":91914975,"identity":"2db6a5af-0ef4-40c5-a648-46b7e7da485c","added_by":"auto","created_at":"2025-09-23 00:46:03","extension":"xml","order_by":35,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":145429,"visible":true,"origin":"","legend":"","description":"","filename":"1b3a238f7d9b436194ecd9006d56204d1structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7374244/v1/79804b3470207ddcacc718ad.xml"},{"id":91914973,"identity":"3206bece-241b-4cc4-af8b-1a3cf213b53d","added_by":"auto","created_at":"2025-09-23 00:46:03","extension":"html","order_by":36,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":162541,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7374244/v1/a315b247e2b1488b9cc4d67e.html"},{"id":91912914,"identity":"8ec2d359-7428-4231-b26e-da850c176eb6","added_by":"auto","created_at":"2025-09-23 00:38:02","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":991392,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eNorepinephrine suppressed inflammation and oxidative stress in AMs. (A)\u003c/strong\u003e Volcano plot of DEGs in GEO dataset (blue color indicates down-regulated DEGs and red color indicates up-regulated DEGs). \u003cstrong\u003e(B)\u003c/strong\u003e TNF-α levels in AMs(n=6). \u003cstrong\u003e(C) \u003c/strong\u003eIL-6 levels in AMs(n=6).\u003cstrong\u003e (D)\u003c/strong\u003e The protein expression of CD206 relative to GAPDH (n=5). \u003cstrong\u003e(E)\u003c/strong\u003e The protein expression of CD86 relative to GAPDH (n=5). \u003cstrong\u003e(F)\u003c/strong\u003e Representative Western blotting images of CD86, CD206, and GAPDH in AMs. \u003cstrong\u003e(G)\u003c/strong\u003e Macrophage polarization was determined by flow cytometry assay. \u003cstrong\u003e(H)\u003c/strong\u003e Percentage of CD86-positive F4/80⁺ macrophages determined by flow cytometry assay(n=3). \u003cstrong\u003e(I)\u003c/strong\u003e Representative images of fluorescence probe for ROS in AMs. Scale bar: 200 μm. \u003cstrong\u003e(J)\u003c/strong\u003e Quantification of intracellular ROS fluorescence intensity in AMs (n=6). Data are shown as mean ± SD. Two-way ANOVA with Tukey’s post hoc test was used for analysis. ns, not significant; *p \u0026lt; 0.05; **p \u0026lt; 0.01; ***p \u0026lt; 0.001; ****p \u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"image1.png","url":"https://assets-eu.researchsquare.com/files/rs-7374244/v1/507a3ffe980e158ffbd3913a.png"},{"id":91914977,"identity":"00082f96-b786-4623-a2c2-3b30ca703317","added_by":"auto","created_at":"2025-09-23 00:46:04","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":486533,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eNorepinephrine attenuates LPS-induced ferroptosis in a dose-dependent manner. (A)\u003c/strong\u003e The mRNA expression of GPX4, FTH1, and SLC7A11 was measured via quantitative real-time PCR in AMs(n=5).\u003cstrong\u003e (B) \u003c/strong\u003eMDA levels in AMs(n=5). \u003cstrong\u003e(C) \u003c/strong\u003eIntracellular\u003cstrong\u003e \u003c/strong\u003eFe²⁺ levels in AMs(n=5). \u003cstrong\u003e(D) \u003c/strong\u003eRepresentative Western blotting images of GPX4 , SLC7A11 and GAPDH with or without Erastin treatment in AMs.\u003cstrong\u003e (E-F)\u003c/strong\u003e Relative protein expression levels of GPX4, FTH1 and SLC7A11 to GAPDH (n=5). \u003cstrong\u003e(G)\u003c/strong\u003e Representative images of fluorescence probe for ROS in AMs. Scale bar: 200 μm.\u003cstrong\u003e (H) \u003c/strong\u003eQuantification of intracellular ROS fluorescence intensity in AMs (n=6). Data are shown as mean ± SD. One-way ANOVA and Two-way ANOVA with Tukey’s post hoc test were used for analysis. ns, not significant; *p \u0026lt; 0.05; **p \u0026lt; 0.01; ***p \u0026lt; 0.001; ****p \u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"image2.png","url":"https://assets-eu.researchsquare.com/files/rs-7374244/v1/e7233fb95ab78ead4af9c4fc.png"},{"id":91912915,"identity":"37c12adb-36c2-4ef9-8d17-0cab028c5085","added_by":"auto","created_at":"2025-09-23 00:38:02","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":736340,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eNorepinephrine suppresses ferroptosis via β2-adrenergic receptor signaling. (A) \u003c/strong\u003eMDA levels in AMs co-treated with LPS and selective adrenergic receptor antagonists (α1, α2, β1, β2). \u003cstrong\u003e(B-C)\u003c/strong\u003eIntracellular MDA and Fe²⁺ levels in AMs treated with LPS and salbutamol (SAL) (n=5). \u003cstrong\u003e(D) \u003c/strong\u003eRepresentative Western blotting images of GPX4, SLC7A11 and GAPDH with or without Erastin treatment in AMs. \u003cstrong\u003e(E-F) \u003c/strong\u003eRepresentative fluorescence images and corresponding quantification of intracellular ROS levels in AMs (n=6). Scale bar: 200 μm. \u003cstrong\u003e(G) \u003c/strong\u003eRepresentative TEM images showing mitochondrial ultrastructure in AMs. Magnifications highlight mitochondrial morphology. Scale bars: upper panel, 1.0 μm; lower panel, 10.0 μm. Data are shown as mean ± SD. Two-way ANOVA with Tukey’s post hoc test was used for analysis. ns, not significant; *p \u0026lt; 0.05; **p \u0026lt; 0.01; ***p \u0026lt; 0.001; ****p \u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"image3.png","url":"https://assets-eu.researchsquare.com/files/rs-7374244/v1/abf684075f61b5c14e204703.png"},{"id":91915850,"identity":"e5d31cca-03ab-46f3-95ca-50e0f232d266","added_by":"auto","created_at":"2025-09-23 00:54:03","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":561939,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eNorepinephrine upregulates HDC and activates oxidative stress-related pathways in AMs. (A) \u003c/strong\u003eHierarchical clustering heatmap of differentially expressed genes in AMs treated with LPS or LPS + NE (n=3). \u003cstrong\u003e(B)\u003c/strong\u003e KEGG enrichment analyses indicating enrichment of oxidative stress response pathways.\u003cstrong\u003e (C) \u003c/strong\u003eVolcano plot highlighting upregulation of HDC after NE treatment. \u003cstrong\u003e(D)\u003c/strong\u003e Venn diagram of differentially expressed genes (DEGs) with known ferroptosis driver, marker, and suppressor gene sets. \u003cstrong\u003e(F) \u003c/strong\u003eImmunoblotting and densitometry confirming increased HDC protein levels. Data are shown as mean ± SD. Two-way ANOVA with Tukey’s post hoc test was used for analysis. ns, not significant; *p \u0026lt; 0.05; **p \u0026lt; 0.01; ***p \u0026lt; 0.001; ****p \u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"image4.png","url":"https://assets-eu.researchsquare.com/files/rs-7374244/v1/924f9835bf49f94172b26885.png"},{"id":91914959,"identity":"22537a03-63d7-4d43-a88a-f7d9a6ab7754","added_by":"auto","created_at":"2025-09-23 00:46:03","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":771820,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eNorepinephrine inhibits ferroptosis via the HDC/SLC7A11 axis in AMs. (A) \u003c/strong\u003eRepresentative fluorescence images of intracellular ROS in AMs transfected with siHDC and stimulated with LPS. Scale bar: 10 μm. \u003cstrong\u003e(B) \u003c/strong\u003eThe mRNA expression of GPX4, FTH1, and SLC7A11 was measured via qPCR in AMs transfected with siHDC and stimulated with LPS. \u003cstrong\u003e(C) \u003c/strong\u003eQuantification of DHE-positive cells in each group (n=5). \u003cstrong\u003e(D-E) \u003c/strong\u003eRepresentative ROS fluorescence images and quantification of DHE-positive primary alveolar macrophages from LPS-treated mice transduced with AAV-HDC or AAV-NC(n=6). Scale bar: 10 μm.\u003cstrong\u003e (F) \u003c/strong\u003eThe mRNA levels of GPX4, FTH1, and SLC7A11 in primary AMs. \u003cstrong\u003e(G) \u003c/strong\u003eMDA levels in AMs(n=4). \u003cstrong\u003e(H) \u003c/strong\u003eSLC7A11 mRNA expression in cells(n=4).\u003cstrong\u003e (I) \u003c/strong\u003eRepresentative Western blotting images of p-STAT3, STAT3, SLC7A11 and GAPDH.\u003cstrong\u003e (J) \u003c/strong\u003eThe protein expression of p-STAT3 relative to total STAT3 (n=3). \u003cstrong\u003e(K) \u003c/strong\u003eThe protein expression of SLC7A11 relative to GAPDH (n=4).\u003cstrong\u003e (L) \u003c/strong\u003eRepresentative fluorescence images of ROS in AMs. Scale bar: 200 μm. Data are shown as mean ± SD. Two-way ANOVA with Tukey’s post hoc test was used for analysis. ns, not significant; *p \u0026lt; 0.05; **p \u0026lt; 0.01; ***p \u0026lt; 0.001; ****p \u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"image5.png","url":"https://assets-eu.researchsquare.com/files/rs-7374244/v1/87bae4ad04920b9c46293eef.png"},{"id":91912923,"identity":"9b82fa36-de33-49c5-af77-914746dd5772","added_by":"auto","created_at":"2025-09-23 00:38:03","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":903652,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSalbutamol alleviates lung injury via HDC-dependent ferroptosis suppression. (A) \u003c/strong\u003eRepresentative gross morphology and H\u0026amp;E staining sections of mouse lung tissues. Scale bars: 1mm (middle panels), 20 μm (bottom panels). \u003cstrong\u003e(B)\u003c/strong\u003eGross images of Evans blue-stained lungs. \u003cstrong\u003e(C)\u003c/strong\u003e 4-HNE expression in the lung tissues of mice was tested by immunohistochemistry. Scale bar: 100 μm. \u003cstrong\u003e(D) \u003c/strong\u003eLung injury scores based on histological evaluation (n=6). \u003cstrong\u003e(E) \u003c/strong\u003eQuantification of Evans blue extravasation in lung tissue (n=4). \u003cstrong\u003e(F) \u003c/strong\u003eLung wet/dry weight ratio (W/D) (n=6). \u003cstrong\u003e(G)\u003c/strong\u003e Plasma TNF-α levels measured by ELISA (n=6). \u003cstrong\u003e(H)\u003c/strong\u003e Representative Western blotting images of SLC7A11 and GPX4 in lung tissue. \u003cstrong\u003e(I) \u003c/strong\u003eMDA content in lung tissue (n=5). \u003cstrong\u003e(J) \u003c/strong\u003eFe²⁺ levels in lung tissue (n=5). Data are shown as mean ± SD. Two-way ANOVA with Tukey’s post hoc test was used for analysis. ns, not significant; *p \u0026lt; 0.05; **p \u0026lt; 0.01; ***p \u0026lt; 0.001; ****p \u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"image6.png","url":"https://assets-eu.researchsquare.com/files/rs-7374244/v1/aae5b44a6956da08038b97f2.png"},{"id":91915861,"identity":"e8fd63af-ce85-4a03-9483-8b57adeb8e93","added_by":"auto","created_at":"2025-09-23 00:54:03","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":220099,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eActivation of β2-adrenergic signaling upregulates HDC to inhibit ferroptosis and relieve ARDS. \u003c/strong\u003eSchematic illustration of β2-adrenergic signaling-mediated protection by salbutamol against LPS-induced ferroptosis via the HDC/SLC7A11 pathway.\u003c/p\u003e","description":"","filename":"image7.png","url":"https://assets-eu.researchsquare.com/files/rs-7374244/v1/eea5351a4d507e76457d8803.png"},{"id":92626655,"identity":"40705295-32d0-42ea-b0bc-f9851070a4c1","added_by":"auto","created_at":"2025-10-02 00:16:30","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":5598720,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7374244/v1/315570cb-23e8-4aec-ac76-cd283f0deb60.pdf"},{"id":91912921,"identity":"50512227-307c-4d13-afc6-e4bc60e611b7","added_by":"auto","created_at":"2025-09-23 00:38:03","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":651879,"visible":true,"origin":"","legend":"","description":"","filename":"supplementarymaterials.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7374244/v1/1d2b1e40ce25416f25b27f68.pdf"},{"id":91912917,"identity":"c7eac31c-d9ab-4a58-9f4c-d00a99c98c01","added_by":"auto","created_at":"2025-09-23 00:38:03","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":649576,"visible":true,"origin":"","legend":"","description":"","filename":"SuppFig.docx","url":"https://assets-eu.researchsquare.com/files/rs-7374244/v1/9e46851c2d35f7adaf7c19cc.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Sympathetic signaling activation alleviated acute respiratory distress syndrome via the HDC/SLC7A11 axis in lipopolysaccharide-induced macrophages","fulltext":[{"header":"Introduction","content":"\u003cp\u003eAcute respiratory distress syndrome (ARDS) is a critical clinical condition characterized by bilateral pulmonary infiltrates and severe hypoxemia resulting from noncardiogenic pulmonary edema\u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e. Despite substantial advances in supportive care and mechanical ventilation strategies, ARDS is still associated with high morbidity and mortality rates\u003csup\u003e\u003cspan additionalcitationids=\"CR4\" citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e. Among various immune populations, alveolar macrophages (AMs), as key innate immune sentinels of the pulmonary microenvironment, have been recognized to orchestrate the initiation and propagation of inflammatory responses during ARDS\u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e. Our previous studies have shown that targeted modulation of the macrophage cholinergic anti-inflammatory pathway (CAP) can effectively alleviate lung injury in ARDS, indicating a mechanistic link between cholinergic neural signaling and innate immune regulation\u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e. Further data indicate that sympathetic signaling may contribute to the therapeutic effects either. However, it remains unknown whether AMs are influenced by sympathetic neuroregulation to reduce lung injury.\u003c/p\u003e\u003cp\u003eNorepinephrine (NE), a major sympathetic neurotransmitter of the sympathetic nervous system (SNS), exerts diverse biological effects through activation of α- and β-adrenergic receptors. Although many previous reports have clarified that sympathetic signaling certainly affects immune systems, the direction of its immunologic regulation remain uncertain and varies according to the disease situation and responsible cell types. Studies have shown that NE modulates cellular metabolism, suppresses inflammatory responses, and promotes cell survival pathways via β2-adrenergic receptor (β2-AR) signaling\u003csup\u003e\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e. Furthermore, the β2-AR is the major subtype expressed on immune cells, particularly macrophages\u003csup\u003e\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003e. Taken together, these findings raise the possibility that NE exerts anti-inflammatory effects on AMs through β2-AR signaling during ARDS\u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e. Nonetheless, further investigation is required to clarify the specific molecular pathways involved.\u003c/p\u003e\u003cp\u003eWhile AMs play a central role in mediating inflammatory responses during ARDS, the downstream molecular mechanisms that contribute to sustained tissue damage and disruption of the alveolar-capillary barrier remain incompletely understood. Meanwhile, accumulating evidence indicates that ferroptosis-a regulated cell death modality driven by iron overload and excessive lipid oxidation-substantially influences macrophage behavior in inflammatory conditions\u003csup\u003e\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e. However, whether sympathetic signaling modulates macrophage ferroptosis during ARDS remains largely unknown. Ferroptosis is mechanistically distinct from alternative types of programmed cell demise, and is chiefly defined by iron-catalyzed lipid oxidation and morphological alterations of mitochondria, such as shrinkage and cristae loss, while maintaining nuclear integrity\u003csup\u003e\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e. Increasing evidence highlights ferroptosis as a pivotal contributor to the pathogenesis of various inflammatory and degenerative diseases\u003csup\u003e\u003cspan additionalcitationids=\"CR15\" citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e, including intestinal inflammation\u003csup\u003e\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u003c/sup\u003e and endothelial injury\u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e. Moreover, accumulating research suggests that ferroptosis may underlie key pathological mechanisms in chronic respiratory conditions such as COPD, asthma, and other lower airway inflammatory diseases\u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e. Recent studies have shown that AMs not only orchestrate inflammatory responses but also undergo ferroptosis themselves, thereby exacerbating lung injury\u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e. These findings underscore the central role of macrophages at the intersection of inflammation and ferroptosis.\u003c/p\u003e\u003cp\u003eRecent studies have revealed that norepinephrine signaling may influence ferroptosis\u003csup\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u003c/sup\u003e. For example, norepinephrine depletion in a Parkinson\u0026rsquo;s disease model induced by paraquat and maneb administration has been associated with hippocampal iron accumulation and activation of ferroptotic signaling pathways\u003csup\u003e\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e. While norepinephrine itself has been reported to exacerbate ferroptosis through disruption of iron homeostasis and suppression of GPX4\u003csup\u003e22\u003c/sup\u003e. These seemingly paradoxical findings indicate a complex and context-dependent role of norepinephrine in ferroptosis regulation. Herein, we investigated the role of sympathetic signaling activation in sepsis-induced ARDS. Activation of β2-AR signaling in alveolar macrophages suppressed ferroptosis and attenuated pulmonary inflammation. Overall, sympathetic signaling is identified as a key neuroimmune regulatory pathway, and targeting β2-AR may offer a promising therapeutic strategy for ARDS.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003eMouse model\u003c/h2\u003e\u003cp\u003eMale C57BL/6 mice (6\u0026ndash;10 weeks old, 20\u0026ndash;25 g; GemPharmatech, Guangzhou, China) were maintained under specific-pathogen-free (SPF) conditions in individually ventilated cages, with unrestricted access to standard chow and water. After a 1-week acclimation period, animals were randomly allocated to either sham or ARDS groups.\u003c/p\u003e\u003cp\u003eTo establish the ARDS model, mice received an intranasal instillation of lipopolysaccharide (LPS; 5 mg/kg, L2880, Sigma-Aldrich, USA) dissolved in 50 \u0026micro;L sterile saline. Mice in the sham group were administered an equal volume of sterile saline. For intervention studies, salbutamol (SAL; 10 mg/kg, T1139, TargetMol, USA) was administered by nebulization 3 hours prior to LPS exposure. Nebulized saline was administered to control mice following the same schedule. At 24 hours after LPS exposure, mice were euthanized by CO₂ inhalation under anesthesia. Blood and bronchoalveolar lavage fluid (BALF) samples were collected. Lung tissues were either fixed in 4% neutral-buffered formalin or rapidly frozen in liquid nitrogen and stored at \u0026minus;\u0026thinsp;80\u0026deg;C for downstream analysis.\u003c/p\u003e\u003cp\u003e All experimental procedures were approved by the Institutional Animal Care and Use Committee (IACUC) of Jennio Bio, with ethical approval number #JENNIO-IACUC-2025-A015.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eIsolation, culture and treatment of alveolar macrophages\u003c/h3\u003e\n\u003cp\u003eAMs were isolated from C57BL/6 mice via bronchoalveolar lavage (BAL). Lavage was performed using pre-warmed PBS containing 2 mM EDTA and 0.5% fetal bovine serum (FBS), with 10 sequential instillations of 1 mL buffer through a tracheal cannula per mouse. BALF samples were passed through a 70 \u0026micro;m strainer and centrifuged at 300 \u0026times; g for 5 min at 4\u0026deg;C. Red blood cells were lysed with hemolysis buffer, and viable cells were counted using Trypan Blue exclusion. For culture, 3\u0026ndash;4*10⁵ AMs were seeded into non-treated 6-well plates containing RPMI-1640 supplemented with 10% fetal bovine and 1% penicillin-streptomycin. Cells were incubated at 37\u0026deg;C in a humidified atmosphere with 5% CO₂, and the medium was refreshed every two days.\u003c/p\u003e\u003cp\u003eAMs were exposed to LPS(1 \u0026micro;g/mL) for 24 h. Norepinephrine (0.1 \u0026micro;M, 1 \u0026micro;M, or 10 \u0026micro;M; HY-13715, MCE, China), salbutamol (100 nM; T1139, TargetMol, USA), and butoxamine (10 \u0026micro;M; HY-118470, MCE, China) were administered 3 h before LPS stimulation. Erastin (5 \u0026micro;M; 571203-78-6, GLPBIO, USA) was co-administered with LPS to induce ferroptosis under inflammatory conditions. All samples were collected 24 h after LPS stimulation for subsequent analyses.\u003c/p\u003e\n\u003ch3\u003eEnzyme-linked immunosorbent assay (ELISA)\u003c/h3\u003e\n\u003cp\u003eLevels of TNF-α and IL-6 in AMs culture supernatants were quantified using commercial ELISA kits for mouse TNF-α (MM-0132M2, MEIMIAN, China) and IL-6 (MM-0163M2, MEIMIAN, China), following the protocols provided by the manufacturer.\u003c/p\u003e\n\u003ch3\u003eWestern blotting\u003c/h3\u003e\n\u003cp\u003eProteins were isolated from alveolar macrophages (AMs) using RIPA buffer (P0039, Beyotime, China), and quantified with a BCA assay kit (PC0020, Solarbio, China). Equal protein amounts (20 \u0026micro;g per lane) were resolved via 12% SDS\u0026ndash;PAGE and electrotransferred onto PVDF membranes. After blocking in 3% BSA for 1 h at room temperature, membranes were incubated overnight at 4\u0026deg;C with the following primary antibodies: SLC7A11 (26864-1-AP, Proteintech, 1:1000), FTH1 (ab75973, Abcam, 1:1000), GPX4 (GB124327, Servicebio, 1:1000), HDC (ab315444, Abcam, 1:1000), STAT3 (YT4443, Immunoway, 1:1000), p-STAT3 (Tyr705; YP0251, Immunoway, 1:1000), and β-actin (20536-1-AP, Proteintech, 1:2000). After TBST washes, membranes were exposed to HRP-labeled secondary antibodies (1:5000) for 1 h at room temperature. Signal detection was performed using enhanced chemiluminescence substrate (PE0010, Solarbio, China), and band intensities were analyzed with ImageJ software.\u003c/p\u003e\n\u003ch3\u003eFlow cytometry analysis\u003c/h3\u003e\n\u003cp\u003eFor flow cytometry analysis, AMs were resuspended in staining buffer and blocked with anti-mouse CD16/32 (553142 BD, USA) at 4\u0026deg;C for 15 minutes to prevent nonspecific binding. Cells were stained with FITC-CD45 (E-AB-F1136C, Elabscience, China), APC-F4/80 ( E-AB-F0995E, Elabscience, China), and PE-CD86 (E-AB-F0994UD, Elabscience, China) for 30 min at 4\u0026deg;C in the dark. After staining and washing, cells were resuspended in staining buffer, and 7-AAD (5\u0026micro;l, 420403, BioLegend, USA) was added immediately before flow cytometric analysis for live/dead discrimination. Data were processed using FlowJo software, and CD86⁺ cells within the CD45⁺F4/80⁺ macrophage population were quantified.\u003c/p\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003eMDA and Fe\u0026sup2;⁺ Measurement\u003c/h2\u003e\u003cp\u003eMalondialdehyde (MDA) and ferrous iron (Fe\u0026sup2;⁺) levels in cells and tissues were assessed using a lipid peroxidation detection kit (E-BC-K025-M-96T, Elabscience, China) and a colorimetric iron quantification kit (MA0647-2, Meilunbio, China), respectively, following the protocols provided by the manufacturers.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eROS measurement\u003c/h3\u003e\n\u003cp\u003eIntracellular reactive oxygen species (ROS) levels were evaluated using a commercial detection kit (S0033S, Beyotime, China), following the manufacturer\u0026rsquo;s instructions. Briefly, cells were exposed to 10 \u0026micro;M 2\u0026prime;,7\u0026prime;-dichlorodihydrofluorescein diacetate (DCFH-DA) diluted in serum-free medium and incubated at 37\u0026deg;C for 20 minutes in the dark. After treatment, excess dye was removed by washing the cells three times with serum-free medium. Fluorescence was detected using a fluorescence microscope (excitation/emission: 488/525 nm).\u003c/p\u003e\u003cp\u003eTo assess lipid peroxidation, cells were stained with 10\u0026micro;M dihydroethidium(DHE, S0064S, Beyotime, China) in the dark for 30min and visualized via fluorescence microscopy (excitation/emission: 518/605 nm).\u003c/p\u003e\n\u003ch3\u003eTransmission electron microscopy (TEM)\u003c/h3\u003e\n\u003cp\u003eCells were initially fixed in 2.5% glutaraldehyde, followed by secondary fixation with 1% osmium tetroxide for 2 h at room temperature. After rinsing in phosphate buffer, samples underwent graded ethanol dehydration and acetone infiltration, then embedded in epoxy resin and polymerized overnight at 60\u0026ndash;70\u0026deg;C. Ultrathin sections (70\u0026ndash;90 nm) were prepared in a Leica EM UC7 ultramicrotome and stained with uranyl acetate and lead citrate. The sections were then observed under a transmission electron microscope (JEM-1200EX, JEOL, Japan), and representative ultrastructural images were acquired for analysis.\u003c/p\u003e\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003eRNA isolation and real-time quantitative PCR(RT-qPCR) analysis\u003c/h2\u003e\u003cp\u003eTotal RNA was isolated from AMs by using TRIzol reagent (10296010, Thermo Fisher Scientific, USA) following standard procedures. Complementary DNA (cDNA) was generated from 1 \u0026micro;g of RNA with the HiScript III RT SuperMix (R323-01, Vazyme, China). Quantitative real-time PCR was performed using ChamQ Universal SYBR qPCR Master Mix (Q711-02, Vazyme, China) on a real-time detection system following standard cycling parameters. GAPDH was used as the internal reference gene for normalization. The primer information is provided in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. Relative transcript levels were quantified using the 2^\u0026ndash;ΔΔCt approach.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003ePrimer sequences used for RT-qPCR\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"3\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGene\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward primer (5\u0026prime;\u0026rarr;3\u0026prime;)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eReverse primer (5\u0026prime;\u0026rarr;3\u0026prime;)\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSLC7A11\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCCTCTGCCAGCTGTTATTGTT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCCTGGCAAAACTGAGGAAAT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eFTH1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCCATCAACCGCCAGATCAAC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGAAACATCATCTCGGTCAAA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGPX4\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGCCTGGATAAGTACAGGGGTT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCATGCAGATCGACTAGCTGAG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eHDC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eACTCCAAATGTGCAGCCTGGATACC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGGCTAGATGCCCACGTGAATCCTAA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSTAT3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGCCGCCGTAGTGACAGAGAA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGGCAGCAACATCCCCAGAGT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGAPDH\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGTGGCAAAGTGGAGATTGTTG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCGTTGAATTTGCCGTGAGTG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003eH\u0026amp;E staining and lung injury scoring\u003c/h2\u003e\u003cp\u003eLung samples underwent 4% paraformaldehyde fixation, followed by paraffin embedding and microtome sectioning at 4 \u0026micro;m. Sections were deparaffinized, rehydrated through graded ethanol (95%, 85%, 75%), and stained with hematoxylin and eosin. Lung injury severity was evaluated according to five histopathological parameters: (A) neutrophilic infiltration within alveolar spaces, (B) interstitial neutrophil accumulation, (C) formation of hyaline membranes, (D) intra-alveolar proteinaceous exudate, and (E) alveolar septal thickening. The injury index was derived using the following formula: [(20\u0026times;A) + (14\u0026times;B) + (7\u0026times;C) + (7\u0026times;D) + (2\u0026times;E)] divided by the number of 100\u0026times; microscopic fields, yielding a continuous score ranging from 0 to 1. Two independent, blinded pathologists conducted the histological assessments.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003eEvans Blue dye extravasation assay\u003c/h2\u003e\u003cp\u003eFollowing anesthesia, mice received a 100 \u0026micro;L intravenous injection of 1% Evans Blue solution (E2129, Sigma-Aldrich, USA). After 30 minutes of circulation, mice were euthanized, and the pulmonary vasculature was perfused through the right ventricle with 50 mL PBS to remove intravascular dye. Lungs were collected, weighed, and incubated in 2 mL of N,N-Dimethylformamide (DMF) (N807507, Macklin, China) at 55\u0026deg;C for 24 h to extract the dye. Supernatant absorbance was detected at 620 nm with a microplate spectrophotometer. Dye content was normalized to tissue weight and expressed as micrograms of Evans Blue per gram of lung tissue.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003eLung wet/dry weight ratio\u003c/h2\u003e\u003cp\u003eThe left lung was carefully excised, and excess blood was gently removed using filter paper. The wet weight was measured immediately using an analytical balance. Lung tissues were dried at 60\u0026deg;C for 72 h to determine their dry weight. The wet-to-dry (W/D) ratio was computed as the quotient of wet weight and dry weight, serving as an indicator of pulmonary edema severity.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\u003ch2\u003eImmunofluorescence staining\u003c/h2\u003e\u003cp\u003eParaffin-embedded lung tissues were sliced into 4 \u0026micro;m sections, deparaffinized in xylene, and rehydrated through a graded ethanol series (95%, 85%, 75%). To quench endogenous peroxidase activity, sections were treated with 3% hydrogen peroxide for 10 minutes at room temperature. Antigen retrieval was conducted by heating in 10 mM sodium citrate buffer (pH 6.0) for 15 minutes. Tissue sections were permeabilized with 0.1% Triton X-100 for 15 minutes and then blocked in 2% bovine serum albumin (BSA) for 30 minutes at room temperature. Subsequently, the slides were incubated overnight at 4\u0026deg;C with primary antibodies against 4-HNE (ab46545, Abcam, 1:500). After washing with PBS, sections were incubated with a fluorescent secondary antibody (1:1000) for 1 hour at room temperature, followed by nuclear counterstaining with DAPI for 5 minutes. Images were acquired using a fluorescence microscope (Nikon, Japan).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\u003ch2\u003eStatistical analysis\u003c/h2\u003e\u003cp\u003eStatistical analyses were performed using SPSS version 23.0 and GraphPad Prism 8.0. Results are expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (SD). For comparisons involving more than two groups, one-way ANOVA was applied, followed by appropriate post hoc testing. Non-parametric data, such as lung injury scores, were evaluated using the Kruskal\u0026ndash;Wallis test. Unless otherwise indicated, all experiments were conducted independently at least three times. Statistical significance was defined as p\u0026thinsp;\u0026lt;\u0026thinsp;0.05, based on a 95% confidence interval.\u003c/p\u003e\u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\u003cdiv id=\"Sec18\" class=\"Section3\"\u003e\u003ch2\u003eNorepinephrine suppressed inflammation and oxidative stress in AMs\u003c/h2\u003e\u003cp\u003eOur previous transcriptomic analysis\u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e of murine lung tissues revealed that neural regulatory pathways, particularly sympathetic and parasympathetic signaling, may participate in modulating inflammatory responses. Consistently, analysis of a GEO dataset from human AMs revealed differential expression of sympathetic signaling\u0026ndash;related genes after LPS stimulation (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA), indicating a potential role of sympathetic pathways in regulating macrophage inflammatory responses. To functionally validate this hypothesis, primary AMs isolated from mice were exposed to LPS (1\u0026micro;g/ml) for 24 hours in the presence or absence of graded concentrations of norepinephrine (0.1, 1, and 10\u0026micro;M). ELISA analysis of cell culture supernatants revealed that LPS markedly elevated TNF-α (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB) and IL-6 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC) secretion, while norepinephrine co-treatment suppressed the production of both cytokines. Macrophages are well established to adopt a pro-inflammatory M1 phenotype in response to inflammatory stimuli, characterized by the production of TNF-α and IL-6\u003csup\u003e24\u003c/sup\u003e. Western blot analysis showed that the LPS group exhibited increased CD86 and decreased CD206 expression, whereas norepinephrine co-treatment reversed this phenotype in a dose-dependent manner, indicating a transition in macrophage polarization from the M1 pro-inflammatory subtype to the M2 anti-inflammatory phenotype (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD-F). Similarly, flow cytometry showed that the LPS group markedly increased the percentage of CD86⁺ macrophages, while norepinephrine treatment (1 \u0026micro;M) significantly reduced this proportion (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eG, H). Fluorescence microscopy of DCFH-DA staining revealed strong ROS signals in the LPS group, which were markedly attenuated by norepinephrine treatment, particularly at 1 \u0026micro;M (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eI). Quantitative analysis confirmed a similar trend, with norepinephrine reducing ROS levels in a dose-dependent manner (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eJ). Based on the above findings and considering the potential adverse effects of higher concentrations, norepinephrine was used at 1 \u0026micro;M in subsequent experiments. Taken together, these results suggest that norepinephrine reduces LPS-induced inflammatory responses, oxidative stress, and polarization changes in AMs in vitro.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e\u003ch2\u003eNorepinephrine attenuates LPS-induced ferroptosis in a dose-dependent manner\u003c/h2\u003e\u003cp\u003eTo elucidate the mechanism by which norepinephrine mitigates LPS-induced macrophage inflammation, we noted that recent studies have identified ferroptosis as a critical link between macrophage polarization and proinflammatory cytokine production\u003csup\u003e\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/sup\u003e. Ferroptosis, a recently identified type of regulated cell demise, involves excessive iron buildup and oxidative lipid damage, and is modulated by critical regulators including GPX4, FTH1, and SLC7A11. Supplementary data further support this finding, demonstrating that LPS alone led to marked downregulation of these genes, accompanied by increased intracellular MDA and Fe\u0026sup2;⁺ levels (Supplementary Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA, LPS stimulation significantly downregulated the mRNA expression of ferroptosis-related genes, while norepinephrine treatment effectively reversed these changes. Both malondialdehyde (MDA) content and intracellular Fe\u0026sup2;⁺ levels in AMs were also elevated following LPS stimulation and progressively reduced by norepinephrine treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB, C). Western blot images and densitometric analysis demonstrated that norepinephrine significantly upregulated the expression of GPX4 and SLC7A11 following LPS exposure, whereas co-administration of the ferroptosis inducer Erastin (5 \u0026micro;M) reversed these effects (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD-F). ROS staining was then conducted to examine oxidative stress. Fluorescence remained low in the Erastin\u0026thinsp;+\u0026thinsp;Sham group but was markedly elevated in the Erastin\u0026thinsp;+\u0026thinsp;LPS group. Notably, norepinephrine co-treatment (Erastin\u0026thinsp;+\u0026thinsp;LPS\u0026thinsp;+\u0026thinsp;NE) did not effectively reduce ROS accumulation, suggesting that the antioxidative effect of norepinephrine was attenuated in the presence of Erastin (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eG). Quantitative analysis confirmed this observation (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eH). Collectively, these findings highlight ferroptosis as a key pathogenic mechanism in LPS-induced macrophage injury and support the protective effect of norepinephrine.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e\u003ch2\u003eNorepinephrine suppresses ferroptosis via β2-adrenergic receptor signaling\u003c/h2\u003e\u003cp\u003eIt has been discovered that norepinephrine exerts its biological effects mainly through α- and β-adrenergic receptors, including α1, α2, β1, β2, and β3 subtypes\u003csup\u003e\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e. To determine the receptor subtype involved in the antiferroptotic effect of norepinephrine, selective antagonists for α1 (prazosin, 5 \u0026micro;M), α2 (yohimbine, 10 \u0026micro;M), β1 (atenolol, 5 \u0026micro;M), and β2 (butoxamine, 10 \u0026micro;M) receptors were applied at the beginning of LPS stimulation. Among them, only butoxamine reversed the norepinephrine-mediated reduction in MDA levels, indicating a β2-AR-dependent mechanism (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). Based on this finding, the selective β2 agonist salbutamol (5 \u0026micro;M) was utilized. Both norepinephrine and salbutamol significantly reduced MDA and Fe\u0026sup2;⁺ levels in LPS-treated cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB, \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). Western blot analysis showed increased expression of SLC7A11 and GPX4 after norepinephrine or salbutamol treatment, which was blocked by butoxamine (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD). Consistent with these findings, immunofluorescence staining revealed that ROS accumulation was significantly reduced by norepinephrine and salbutamol, whereas this effect was abolished by co-treatment with butoxamine (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE). Quantitative analysis of ROS intensity further confirmed these observations (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF). In addition, salbutamol and butoxamine were also shown to modulate inflammatory cytokine levels, including TNF-α and IL-6(Supplementary Fig. S2).\u003c/p\u003e\u003cp\u003eTransmission electron microscopy revealed that LPS induced mitochondrial shrinkage, membrane density, and cristae loss - hallmarks of ferroptosis. These alterations were alleviated by norepinephrine and salbutamol, but reappeared in the presence of butoxamine, confirming that β2 receptor activation protects against ferroptotic mitochondrial damage in AMs (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eG). Together, these results indicate that the anti-ferroptotic effect of norepinephrine in LPS-induced macrophage injury is specifically mediated through the β2-AR. The application of salbutamol resulted in similar anti-inflammatory and antioxidative outcomes as norepinephrine.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec21\" class=\"Section2\"\u003e\u003ch2\u003eNorepinephrine upregulates HDC expression and enriches oxidative stress-related pathways\u003c/h2\u003e\u003cp\u003eTo investigate how norepinephrine confers protection at the molecular level, transcriptomic analysis was performed in LPS-injured AMs with norepinephrine treatment. Hierarchical clustering of differentially expressed genes revealed a clear separation between the LPS\u0026thinsp;+\u0026thinsp;NE and LPS\u0026thinsp;+\u0026thinsp;NE\u0026thinsp;+\u0026thinsp;BUT groups, indicating distinct gene expression profiles (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). Bubble plot analysis demonstrated that norepinephrine-regulated genes were significantly enriched in pathway such as regulation of oxidative stress, glutathione metabolic process, and mitochondrial organization (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). Volcano plot analysis identified numerous differentially expressed genes (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). To identify ferroptosis-related targets potentially involved in the anti-inflammatory effects of norepinephrine, we integrated differentially expressed genes (DEGs) from RNA-seq data with the ferroptosis-associated gene sets (drivers, suppressors, and markers) curated from FerrDb (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.zhounan.org/ferrdb/current/\u003c/span\u003e\u003cspan address=\"http://www.zhounan.org/ferrdb/current/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) and relevant literature (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). A total of 15 genes overlapped between DEGs and ferroptosis suppressors, among which histidine decarboxylase (HDC) was selected for further validation based on its potential regulatory role in macrophage redox balance. We focused on HDC, given its reported role in redox homeostasis and ferroptosis regulation\u003csup\u003e\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/sup\u003e. qPCR analysis was performed to confirm the upregulation of HDC mRNA, and showed a significant increase in the LPS\u0026thinsp;+\u0026thinsp;NE group compared to LPS alone. (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE). Western blot analysis also showed a pronounced elevation of HDC protein in norepinephrine-treated cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec22\" class=\"Section2\"\u003e\u003ch2\u003eNorepinephrine inhibits ferroptosis via the HDC/SLC7A11 axis in AMs\u003c/h2\u003e\u003cp\u003eGiven the regulatory effect of norepinephrine on HDC expression via β2-adrenergic signaling, we next explored whether HDC plays a functional role in modulating ferroptosis and inflammation in AMs. Firstly, we knocked down the HDC gene in AMs using siRNA transfection. DHE staining (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA) demonstrated a pronounced elevation of ROS levels in the LPS\u0026thinsp;+\u0026thinsp;siHDC group relative to the LPS\u0026thinsp;+\u0026thinsp;siNC group. Quantitative assessment further verified an increased proportion of DHE-positive cells following HDC silencing (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). Meanwhile, qPCR analysis further revealed that HDC silencing markedly downregulated the mRNA expression of ferroptosis-suppressor genes, including GPX4, FTH1, and SLC7A11, in response to LPS stimulation (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB).\u003c/p\u003e\u003cp\u003eTo validate these findings in vivo, rAAV-F4/80-mHdc-P2A-EGFP (5\u0026times;10\u0026sup1;\u0026sup2; vg/mL, 40 \u0026micro;L) was administered via intratracheal injection 21 days prior to modeling to induce HDC overexpression in AMs. After 21 days, LPS (5 mg/kg) was administered intranasally to induce ARDS. Twenty-four hours post-induction, lung samples, BALF, and primary alveolar macrophages were collected for downstream analyses. Subsequently, HDC overexpression was found to significantly reduce ROS accumulation (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD) and the proportion of DHE-positive cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE) compared with the AAV-NC group. Consistently, the AAV-HDC group exhibited significantly increased transcript levels of GPX4, FTH1, and SLC7A11 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eF), supporting the notion that HDC alleviates LPS-induced ferroptosis in AMs and contributes to the cytoprotective phenotype.\u003c/p\u003e\u003cp\u003eIt is well established that HDC catalyzes the synthesis of histamine, a biologically active monoamine involved in diverse physiological and pathological processes. Histamine mediates its biological functions via four distinct G protein-coupled receptors (GPCRs), namely H1R, H2R, H3R, and H4R. Notably, H1R has been implicated in the regulation of ferroptosis, suggesting a mechanistic link between histamine signaling and redox imbalance\u0026ndash;associated cell death\u003csup\u003e\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u003c/sup\u003e. HDC deficiency has also been reported to promote ferroptosis in cardiomyocytes via inhibition of the H1R-STAT3-SLC7A11 pathway\u003csup\u003e\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/sup\u003e. To investigate this mechanism, AMs were exposed to LPS and norepinephrine, with parallel groups receiving an H1R antagonist to assess receptor-specific effects. Our results demonstrated that although norepinephrine treatment reduced MDA content, this effect was abolished by H1R blockade, indicating that H1R signaling is required for norepinephrine-mediated suppression of lipid peroxidation (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eG). Similarly, SLC7A11 mRNA expression, which was suppressed by LPS, was restored following norepinephrine treatment, but this restoration was prevented by H1R antagonist (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eH). Western blot analysis showed that the upregulation of phosphorylated STAT3 (p-STAT3) and SLC7A11 proteins by norepinephrine was significantly inhibited by either H1R antagonist (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eI) or the STAT3 inhibitor c188-9 (Supplementary Fig. S3). Quantitative analysis of SLC7A11 and p-STAT3 protein levels confirmed these findings (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eJ, K). Similarly, ROS staining revealed that the decrease in intracellular ROS levels conferred by norepinephrine was completely abrogated by H1R antagonist (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eL). This finding supports the involvement of the HDC-STAT3\u0026ndash;SLC7A11 axis as a downstream effector pathway mediating ferroptosis inhibition.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cdiv id=\"Sec23\" class=\"Section3\"\u003e\u003ch2\u003eSalbutamol alleviates lung injury via HDC-dependent ferroptosis suppression\u003c/h2\u003e\u003cp\u003eTo further verify the role of norepinephrine in alleviating ARDS through the inhibition of ferroptosis, in vivo experiments were conducted. we pretreated mice with salbutamol (10 mg/kg) 3 hours before intranasal instillation of LPS (5 mg/kg) to clarify the contribution of β₂-adrenergic signaling. Erastin (10 mg/kg) was administered intraperitoneally concurrently with intranasal LPS stimulation. HDC overexpression via intratracheal viral delivery was performed as previously described. Lung tissues were harvested 24 hours after LPS administration for subsequent analyses.\u003c/p\u003e\u003cp\u003eHistological analysis revealed that LPS induced severe lung injury, evidenced by hemorrhage, edema, and alveolar destruction. Both salbutamol treatment and alveolar macrophage-targeted HDC overexpression significantly reduced lung injury scores, while the protective effect of salbutamol was partially reversed by Erastin (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA, D). Similarly, pulmonary vascular permeability and Evans blue extravasation were decreased in salbutamol and AAV-HDC groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB, E). Lung W/D ratios (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eF) and TNF-α levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eG) were also reduced by salbutamol or HDC overexpression, with Erastin attenuating these effects. 4-HNE staining confirmed reduced lipid peroxidation in treated groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC). Salbutamol increased SLC7A11 and GPX4 expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eH), and decreased MDA and Fe\u0026sup2;⁺ levels, further enhanced by HDC overexpression (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eI, J). These results suggest that salbutamol mitigates LPS-triggered pulmonary damage by suppressing ferroptosis in AMs. Notably, targeted HDC overexpression in AMs conferred comparable protective effects, and our in vitro data further support a potential link between β2-adrenergic signaling and HDC expression.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eAlthough neuroimmune regulation is increasingly recognized as a critical modulator of inflammation, the precise role of sympathetic activity in acute inflammatory conditions, including ARDS, remains poorly defined. In particular, its potential involvement in regulating macrophage function and redox homeostasis has not been fully elucidated. In this study, we demonstrated that norepinephrine signaling alleviates LPS-induced acute lung injury by targeting AMs and modulating ferroptosis via the HDC/SLC7A11 axis. We found that sympathetic activation, specifically β2-AR signaling, upregulated HDC expression in AMs, thereby enhancing endogenous histamine production. Through both in vivo and in vitro models of ARDS, we showed that histamine/H1R signaling mitigated oxidative stress and ferroptotic cell death in macrophages, ultimately preserving lung function. Moreover, blockade of β2-AR or H1R exacerbated macrophage ferroptosis and lung injury, underscoring the specificity of this axis. Our findings reveal a previously unrecognized neuroimmune regulatory mechanism providing new insight into the resolution of inflammation and redox imbalance in ARDS (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eARDS is a life-threatening pulmonary condition marked by pronounced pulmonary inflammation, disruption of the alveolar-capillary barrier, and extensive recruitment of neutrophils and macrophages into the lung interstitium and bronchoalveolar compartments\u003csup\u003e\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u003c/sup\u003e. Emerging evidence implicates ferroptosis-an iron-dependent, lipid peroxidation-driven form of regulated cell death-as a pivotal mechanism underlying the pathogenesis of multiple inflammatory disorders, including ARDS\u003csup\u003e\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u003c/sup\u003e. Despite accumulating evidence underscoring its pathological relevance, the precise molecular pathways mediating ferroptosis in ARDS remain incompletely understood. Importantly, the pathogenesis of ARDS is largely driven by the abnormal activation of AMs, which coordinate inflammatory responses via cytokine secretion, phagocytosis, and immune modulation\u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u003c/sup\u003e. Emerging evidence indicates that ferroptosis induces intracellular iron overload in macrophages, thereby promoting their polarization toward the pro-inflammatory M1 phenotype\u003csup\u003e\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u003c/sup\u003e. In this context, ferroptosis of AMs is increasingly recognized as a key driver in the progression of ARDS, primarily through the amplification of oxidative stress and promotion of inflammatory responses. Recent findings have shown that melatonin suppresses macrophage ferroptosis by inhibiting NCOA4-mediated ferritinophagy, thereby reducing lipid peroxidation and improving outcomes in septic ARDS models\u003csup\u003e\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u003c/sup\u003e. However, the precise regulatory mechanisms underlying macrophage ferroptosis remain incompletely understood. Modulating ferroptotic pathways in alveolar macrophages holds potential as a novel intervention approach for ARDS management.\u003c/p\u003e\u003cp\u003eNorepinephrine\u0026ndash;a major catecholamine neurotransmitter released by sympathetic nerve terminals, plays crucial functions in cardiovascular homeostasis, metabolic regulations, and immune modulation. Its immunomodulatory effects exhibit remarkable complexity, dictated by both the specific physiological context and the differential status of adrenergic receptor subtypes (α1, α2, β1 and β2). Notably, β2-AR signaling has revealed as a dominant anti-inflammatory pathway across various immune cell types. For instance, studies on neuroinflammation and neuropathic pain have shown that norepinephrine attenuates inflammatory responses by inhibiting microglial activation\u003csup\u003e\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u003c/sup\u003e. It has also been reported that activation of sympathetic signaling in macrophages promotes anti-inflammatory phenotypic shift, partially by upregulating Tim3, which leads to diminished systemic inflammation and enhanced protection against tissue injury\u003csup\u003e\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u003c/sup\u003e. Emerging studies indicate that neuroimmune regulation can alleviate ARDS by suppressing ferroptosis, as demonstrated by electroacupuncture acting through α7 nicotinic acetylcholine receptors\u003csup\u003e\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u003c/sup\u003e. However, the specific relationship between sympathetic neuroimmune regulation, ferroptosis, and ARDS has not yet been fully elucidated. Our study further demonstrated that norepinephrine suppresses ferroptosis in LPS-induced macrophage injury specifically through β2-AR signaling. Pharmacological activation of the β2-AR with salbutamol reproduced the protective effects of norepinephrine, while selective blockade with butoxamine abolished these benefits, as evidenced by reductions in MDA, Fe\u0026sup2;⁺, and ROS levels. Notably, salbutamol treatment also upregulated the expression of SLC7A11, FTH1, and GPX4, and preserved mitochondrial ultrastructure, indicating a suppression of ferroptotic cell death. These results align with previous work by Liyan Hou and colleagues, who showed that norepinephrine deficiency aggravates ferroptosis, whereas normal norepinephrine levels help maintain antioxidant defenses, preserve mitochondrial function, and sustain intracellular homeostasis, thereby suppressing neuronal ferroptosis in mouse parkinson's disease model\u003csup\u003e\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e. Meanwhile, inhibition of macrophage ferroptosis via the Nrf2 signaling pathway has been demonstrated to alleviate ARDS\u003csup\u003e\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e\u003c/sup\u003e​. Taken together, these mechanistic insights not only reinforce the neuroimmune axis as a key modulator of ferroptosis in the context of acute lung injury, but also suggest that targeting sympathetic β2-adrenergic signaling may offer a promising therapeutic avenue for the management of ARDS. Importantly, salbutamol\u0026mdash;a clinically approved selective β2-AR agonist widely used in clinical practice\u0026mdash;exhibited protective effects comparable to those of norepinephrine in our model. These findings suggest that targeting macrophage ferroptosis via β2-AR signaling may represent a viable strategy for mitigating inflammation-induced lung injury. Given its well-characterized safety profile and extensive clinical application, our results provide a rational basis for repurposing β2-AR agonists as immunomodulatory therapeutics in ARDS.\u003c/p\u003e\u003cp\u003eHDC catalyzes the decarboxylation of histidine to generate histamine, a biogenic amine that functions as a neurotransmitter and modulator of various metabolic processes. Depending on its receptor context, histamine can exert either pro-inflammatory or anti-inflammatory effects\u003csup\u003e\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e\u003c/sup\u003e. Previous studies have shown that histamine deficiency in Hdc knockout (Hdc⁻/⁻) mice significantly reduces blood perfusion and impairs muscle regeneration\u003csup\u003e\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e\u003c/sup\u003e. In addition, histamine attenuates cardiomyocyte autophagy and apoptosis in acute myocardial infarction via H1 receptor signaling\u003csup\u003e\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e\u003c/sup\u003e. Our enrichment analysis indicated that norepinephrine-induced upregulation of HDC is associated with ferroptosis-related antioxidant and metabolic pathways, suggesting an indirect regulatory role in ferroptosis susceptibility. Similarly, recent researches also implied that HDC plays a protective role against ferroptosis. For example, in a cisplatin-induced ototoxicity model, histamine deficiency resulting from HDC knockout was shown to exacerbate ferroptotic cell death in cochlear hair cells, as evidenced by increased lipid peroxidation, iron accumulation, and decreased antioxidant capacity\u003csup\u003e\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e\u003c/sup\u003e. Studies in myocardial infarction models have demonstrated that HDC deficiency aggravates cardiac injury, characterized by increased neutrophil infiltration, elevated ROS production, and excessive formation of neutrophil extracellular traps (NETs)\u003csup\u003e\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/sup\u003e. Multi-omics analyses suggest that HDC and its metabolic pathways may contribute to resistance against ferroptosis by enhancing cellular antioxidant defenses in pressure-overload cardiac dysfunction\u003csup\u003e\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e\u003c/sup\u003e. In the context of doxorubicin-induced cardiotoxicity, disruption of histamine signaling\u0026mdash;either by HDC deletion or H1 receptor inhibition\u0026mdash;leads to increased susceptibility to ferroptosis\u003csup\u003e\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e\u003c/sup\u003e. Mechanistically, the HDC/histamine-H1R axis protects against ferroptosis by activating the STAT3-SLC7A11 pathway, which promotes glutathione biosynthesis and enhances cellular antioxidant defenses\u003csup\u003e\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/sup\u003e. Consistently, our experiments showed that the anti-ferroptotic effect of norepinephrine was partially attenuated by both an H1 receptor antagonist and the STAT3 inhibitor C188-9, further confirming that the HDC/histamine-H1R/STAT3 axis is essential for mediating the protective actions of norepinephrine against ferroptosis. These results highlight the importance of HDC in maintaining cellular redox balance, further confirming the crucial role of the HDC/SLC7A11 signaling cascade in macrophage ferroptosis regulation.\u003c/p\u003e\u003cp\u003eIn summary, previous studies have identified ferroptosis as a key pathological mechanism in various inflammatory and oxidative stress-related diseases, including ARDS. To summarize, our study demonstrates that ferroptosis contributes to LPS-induced ARDS and identifies AMs as key targets. Distinct from conventional antioxidant pathways, we highlight a previously unrecognized role of β2-adrenergic signaling in modulating neuroimmune interactions. Moreover, our results emphasize neuroimmune modulation involving endogenous histamine synthesis and H1R/STAT3 signaling, providing a novel therapeutic perspective based on immune-neurotransmitter interactions to alleviate ferroptosis and pulmonary inflammation.\u003c/p\u003e\u003cp\u003eHowever, several limitations should be noted. Although primary AMs were used, they may not fully reflect the complexity of human AMs or the in vivo immune microenvironment. Our study primarily focused on macrophages, while the involvement of other immune and structural cells in ARDS remains unexplored. Moreover, the neuroimmune mechanisms linking β2-AR signaling to macrophage function, such as the upstream regulation of HDC and its downstream interactions, require further investigation. Future studies should also assess the therapeutic value of β2-agonists like salbutamol in broader inflammatory contexts.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eOur study identifies a novel neuroimmune mechanism in which norepinephrine suppresses macrophage ferroptosis to alleviate LPS-induced ARDS. This effect is mediated by β2-AR activation, which promotes histamine synthesis and triggers downstream signaling via the HDC/SLC7A11 axis. These findings highlight a previously unrecognized link between sympathetic signaling and ferroptosis regulation, offering new insights into the immunopathogenesis of ARDS and a potential therapeutic strategy targeting neuroimmune interactions.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eXing Lv, Chenhao Jiang and Xu Zhang conceived the study, conducted the experiments, and contributed to data acquisition and analysis. Xuxia Wei, Yang Zhao, Jianhao Zhang, Xuegang Zhao, Lu Han, Yufeng He, Jianrong Liu, Yujun Zhang, Yuling An, and Xiaomeng Yi assisted with experimental procedures and data interpretation. Yingcai Zhang, Xin Sui, and Huimin Yi supervised the study, provided critical input, and revised the manuscript. All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the National Natural Science Foundation of China (Grant Nos. 82270690, 82200732, and 82270689), Science and Technology Program of Guangzhou (Grant No. 2023A04J1795).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data are available from the corresponding author with reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll animal experiments were performed in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals. The study protocol was approved by the Institutional Animal Care and Use Committee of Guangzhou Jennio Biotech Company Limited (No. JENNIO-IACUC-2025-A015).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of Interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDeclaration of generative AI and AI-assisted technologies in the writing process\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eDuring the preparation of this work, the authors used ChatGPT (OpenAI) to improve language and readability. After using this tool, the authors reviewed and edited the content as needed and take full responsibility for the content of the publication.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCorrespondence\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eProf. Yingcai Zhang\u003c/p\u003e\n\u003cp\u003eDepartment of Hepatic Surgery and Liver Transplantation Center, The Third Affiliated Hospital of Sun Yat-sen University, China\u003c/p\u003e\n\u003cp\u003eE-mail: [email protected]\u003c/p\u003e\n\u003cp\u003eProf. Xin Sui\u003c/p\u003e\n\u003cp\u003eSurgical and Transplant Intensive Care Unit, The Third Affiliated Hospital, Sun Yat-sen University, Guangzhou, China\u003c/p\u003e\n\u003cp\u003eE-mail: [email protected]\u003c/p\u003e\n\u003cp\u003eProf. HuiMin Yi\u003c/p\u003e\n\u003cp\u003eSurgical and Transplant Intensive Care Unit, The Third Affiliated Hospital, Sun Yat-sen University, Guangzhou, China\u003c/p\u003e\n\u003cp\u003eE-mail: [email protected]\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eMeyer NJ, Gattinoni L, Calfee CS. Acute respiratory distress syndrome. Lancet. 2021;398:622\u0026ndash;37. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/S0140-6736(21)00439-6\u003c/span\u003e\u003cspan address=\"10.1016/S0140-6736(21)00439-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGorman EA, O'Kane CM, McAuley DF. Acute respiratory distress syndrome in adults: diagnosis, outcomes, long-term sequelae, and management. Lancet. 2022;400(20220904):1157\u0026ndash;70. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/S0140-6736(22)01439-8\u003c/span\u003e\u003cspan address=\"10.1016/S0140-6736(22)01439-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWare LB, Matthay MA, Mebazaa A. Designing an ARDS trial for 2020 and beyond: focus on enrichment strategies. Intensive Care Med. 2020;46(20201102):2153\u0026ndash;6. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s00134-020-06232-x\u003c/span\u003e\u003cspan address=\"10.1007/s00134-020-06232-x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAhmad S, Wrennall JA, Goriounova AS, et al. Specific Inhibition of Orai1-mediated Calcium Signalling Resolves Inflammation and Clears Bacteria in an Acute Respiratory Distress Syndrome Model. Am J Respir Crit Care Med. 2024;209:703\u0026ndash;15. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1164/rccm.202308-1393OC\u003c/span\u003e\u003cspan address=\"10.1164/rccm.202308-1393OC\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLatronico N, Eikermann M, Ely EW, et al. Improving management of ARDS: uniting acute management and long-term recovery. Crit Care. 2024;28:58. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s13054-024-04810-9\u003c/span\u003e\u003cspan address=\"10.1186/s13054-024-04810-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eXian H, Liu Y, Rundberg Nilsson A, et al. Metformin inhibition of mitochondrial ATP and DNA synthesis abrogates NLRP3 inflammasome activation and pulmonary inflammation. Immunity. 2021;54:1463\u0026ndash;77. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.immuni.2021.05.004\u003c/span\u003e\u003cspan address=\"10.1016/j.immuni.2021.05.004\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. e1411. 20210610.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGrant RA, Morales-Nebreda L, Markov NS, et al. Circuits between infected macrophages and T cells in SARS-CoV-2 pneumonia. Nature. 2021;590(20210111):635\u0026ndash;41. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41586-020-03148-w\u003c/span\u003e\u003cspan address=\"10.1038/s41586-020-03148-w\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhang X, Wei X, Deng Y, et al. Mesenchymal stromal cells alleviate acute respiratory distress syndrome through the cholinergic anti-inflammatory pathway. Signal Transduct Target Ther. 2022;7:307. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41392-022-01124-6\u003c/span\u003e\u003cspan address=\"10.1038/s41392-022-01124-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLubahn CL, Lorton D, Schaller JA, et al. Targeting alpha- and beta-Adrenergic Receptors Differentially Shifts Th1, Th2, and Inflammatory Cytokine Profiles in Immune Organs to Attenuate Adjuvant Arthritis. Front Immunol. 2014;5:346. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fimmu.2014.00346\u003c/span\u003e\u003cspan address=\"10.3389/fimmu.2014.00346\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBacou E, Haurogne K, Allard M, et al. beta2-adrenoreceptor stimulation dampens the LPS-induced M1 polarization in pig macrophages. Dev Comp Immunol. 2017;76:169\u0026ndash;17620170617. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.dci.2017.06.007\u003c/span\u003e\u003cspan address=\"10.1016/j.dci.2017.06.007\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCalverley PM, Anderson JA, Celli B, et al. Salmeterol and fluticasone propionate and survival in chronic obstructive pulmonary disease. N Engl J Med. 2007;356:775\u0026ndash;89. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1056/NEJMoa063070\u003c/span\u003e\u003cspan address=\"10.1056/NEJMoa063070\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTang D, Chen X, Kang R, et al. Ferroptosis: molecular mechanisms and health implications. Cell Res. 2021;31:107\u0026ndash;12520201202. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41422-020-00441-1\u003c/span\u003e\u003cspan address=\"10.1038/s41422-020-00441-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBell HN, Stockwell BR, Zou W. Ironing out the role of ferroptosis in immunity. Immunity. 2024;57:941\u0026ndash;56. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.immuni.2024.03.019\u003c/span\u003e\u003cspan address=\"10.1016/j.immuni.2024.03.019\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eStockwell BR, Friedmann Angeli JP, Bayir H, et al. Ferroptosis: A Regulated Cell Death Nexus Linking Metabolism, Redox Biology, and Disease. Cell. 2017;171:273\u0026ndash;85. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.cell.2017.09.021\u003c/span\u003e\u003cspan address=\"10.1016/j.cell.2017.09.021\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChen Y, Fang ZM, Yi X, et al. The interaction between ferroptosis and inflammatory signaling pathways. Cell Death Dis. 2023;14:205. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41419-023-05716-0\u003c/span\u003e\u003cspan address=\"10.1038/s41419-023-05716-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCui Y, Zhang Z, Zhou X, et al. Microglia and macrophage exhibit attenuated inflammatory response and ferroptosis resistance after RSL3 stimulation via increasing Nrf2 expression. J Neuroinflammation. 2021;18:249. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s12974-021-02231-x\u003c/span\u003e\u003cspan address=\"10.1186/s12974-021-02231-x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLi X, He J, Gao X, et al. GPX4 restricts ferroptosis of NKp46(+)ILC3s to control intestinal inflammation. Cell Death Dis. 2024;15:687. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41419-024-07060-3\u003c/span\u003e\u003cspan address=\"10.1038/s41419-024-07060-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eQin X, Zhang J, Wang B, et al. Ferritinophagy is involved in the zinc oxide nanoparticles-induced ferroptosis of vascular endothelial cells. Autophagy. 2021;17:4266\u0026ndash;428520210412. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1080/15548627.2021.1911016\u003c/span\u003e\u003cspan address=\"10.1080/15548627.2021.1911016\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang Y, Hu J, Wu S, et al. Targeting epigenetic and posttranslational modifications regulating ferroptosis for the treatment of diseases. Signal Transduct Target Ther. 2023;8:449. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41392-023-01720-0\u003c/span\u003e\u003cspan address=\"10.1038/s41392-023-01720-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYe R, Wei Y, Li J, et al. Plasma-derived extracellular vesicles prime alveolar macrophages for autophagy and ferroptosis in sepsis-induced acute lung injury. Mol Med. 2025;31:40. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s10020-025-01111-x\u003c/span\u003e\u003cspan address=\"10.1186/s10020-025-01111-x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLuo C, Liang H, Ji M, et al. Autophagy induced by mechanical stress sensitizes cells to ferroptosis by NCOA4-FTH1 axis. Autophagy. 2025;20250310:1\u0026ndash;20. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1080/15548627.2025.2469129\u003c/span\u003e\u003cspan address=\"10.1080/15548627.2025.2469129\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHong H, Xiao C, Weng L, et al. The effect of norepinephrine on ovarian dysfunction by mediating ferroptosis in mice model. Acta Biochim Biophys Sin (Shanghai). 2024;57:542\u0026ndash;53. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3724/abbs.2024187\u003c/span\u003e\u003cspan address=\"10.3724/abbs.2024187\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHou L, Sun F, Sun W, et al. Lesion of the Locus Coeruleus Damages Learning and Memory Performance in Paraquat and Maneb-induced Mouse Parkinson's Disease Model. Neuroscience. 2019;419:129\u0026ndash;14020191018. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.neuroscience.2019.09.006\u003c/span\u003e\u003cspan address=\"10.1016/j.neuroscience.2019.09.006\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKiss M, Pittet MJ. Mitochondrial control of macrophage polarity in tumors. Immunity. 2025;58:1618\u0026ndash;20. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.immuni.2025.06.008\u003c/span\u003e\u003cspan address=\"10.1016/j.immuni.2025.06.008\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eXu S, Min J, Wang F. Ferroptosis: an emerging player in immune cells. Sci Bull (Beijing). 2021;66:2257\u0026ndash;226020210216. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.scib.2021.02.026\u003c/span\u003e\u003cspan address=\"10.1016/j.scib.2021.02.026\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eXiao Y, Yuan Y, Yang Y, et al. GCH1 reduces LPS-induced alveolar macrophage polarization and inflammation by inhibition of ferroptosis. Inflamm Res. 2023;72:1941\u0026ndash;55. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s00011-023-01785-1\u003c/span\u003e\u003cspan address=\"10.1007/s00011-023-01785-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBissonnette EY, Befus AD. Anti-inflammatory effect of beta 2-agonists: inhibition of TNF-alpha release from human mast cells. J Allergy Clin Immunol. 1997;100:825\u0026ndash;31. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/s0091-6749(97)70280-x\u003c/span\u003e\u003cspan address=\"10.1016/s0091-6749(97)70280-x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhang Z, Ding S, Wang Z, et al. Prmt1 upregulated by Hdc deficiency aggravates acute myocardial infarction via NETosis. Acta Pharm Sin B. 2022;12(20211022):1840\u0026ndash;55. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.apsb.2021.10.016\u003c/span\u003e\u003cspan address=\"10.1016/j.apsb.2021.10.016\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLinher-Melville K, Haftchenary S, Gunning P, et al. Signal transducer and activator of transcription 3 and 5 regulate system Xc- and redox balance in human breast cancer cells. Mol Cell Biochem. 2015;405:205\u0026ndash;22120150421. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s11010-015-2412-4\u003c/span\u003e\u003cspan address=\"10.1007/s11010-015-2412-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYamashita M, Niisato M, Kawasaki Y, et al. VEGF-C/VEGFR-3 signalling in macrophages ameliorates acute lung injury. Eur Respir J. 2022;59:20220414. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1183/13993003.00880-2021\u003c/span\u003e\u003cspan address=\"10.1183/13993003.00880-2021\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGong F, Zheng X, Xu W et al. H3K14la drives endothelial dysfunction in sepsis-induced ARDS by promoting SLC40A1/transferrin-mediated ferroptosis. \u003cem\u003eMedComm (2020)\u003c/em\u003e 2025; 6: e70049. 20250114. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/mco2.70049\u003c/span\u003e\u003cspan address=\"10.1002/mco2.70049\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhou RP, Chen Y, Wei X, et al. Novel insights into ferroptosis: Implications for age-related diseases. Theranostics. 2020;10(20201026):11976\u0026ndash;97. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.7150/thno.50663\u003c/span\u003e\u003cspan address=\"10.7150/thno.50663\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYang J, Huang X, Yu Q, et al. Extracellular vesicles derived from M2-like macrophages alleviate acute lung injury in a miR-709-mediated manner. J Extracell Vesicles. 2024;13:e12437. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/jev2.12437\u003c/span\u003e\u003cspan address=\"10.1002/jev2.12437\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang L, Wang D, Zhang T, et al. The role of immunometabolism in macrophage polarization and its impact on acute lung injury/acute respiratory distress syndrome. Front Immunol. 2023;14:1117548. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fimmu.2023.1117548\u003c/span\u003e\u003cspan address=\"10.3389/fimmu.2023.1117548\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eXu W, Wu Y, Wang S, et al. Melatonin alleviates septic ARDS by inhibiting NCOA4-mediated ferritinophagy in alveolar macrophages. Cell Death Discov. 2024;10:253. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41420-024-01991-8\u003c/span\u003e\u003cspan address=\"10.1038/s41420-024-01991-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZou HL, Li J, Zhou JL, et al. Effects of norepinephrine on microglial neuroinflammation and neuropathic pain. Ibrain. 2021;7(20211208):309\u0026ndash;17. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/ibra.12001\u003c/span\u003e\u003cspan address=\"10.1002/ibra.12001\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHasegawa S, Inoue T, Nakamura Y, et al. Activation of Sympathetic Signaling in Macrophages Blocks Systemic Inflammation and Protects against Renal Ischemia-Reperfusion Injury. J Am Soc Nephrol. 2021;32:1599\u0026ndash;615. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1681/ASN.2020121723\u003c/span\u003e\u003cspan address=\"10.1681/ASN.2020121723\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhang Y, Zheng L, Deng H, et al. Electroacupuncture Alleviates LPS-Induced ARDS Through alpha7 Nicotinic Acetylcholine Receptor-Mediated Inhibition of Ferroptosis. Front Immunol. 2022;13:832432. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fimmu.2022.832432\u003c/span\u003e\u003cspan address=\"10.3389/fimmu.2022.832432\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHe R, Liu B, Xiong R, et al. Itaconate inhibits ferroptosis of macrophage via Nrf2 pathways against sepsis-induced acute lung injury. Cell Death Discov. 2022;8:43. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41420-021-00807-3\u003c/span\u003e\u003cspan address=\"10.1038/s41420-021-00807-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChen X, Deng H, Churchill MJ, et al. Bone Marrow Myeloid Cells Regulate Myeloid-Biased Hematopoietic Stem Cells via a Histamine-Dependent Feedback Loop. Cell Stem Cell. 2017;21:747\u0026ndash;e760747. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.stem.2017.11.003\u003c/span\u003e\u003cspan address=\"10.1016/j.stem.2017.11.003\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAbudupataer M, Zou W, Zhang W, et al. Histamine deficiency delays ischaemic skeletal muscle regeneration via inducing aberrant inflammatory responses and repressing myoblast proliferation. J Cell Mol Med. 2019;23:8392\u0026ndash;409. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/jcmm.14720\u003c/span\u003e\u003cspan address=\"10.1111/jcmm.14720\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDing S, Abudupataer M, Zhou Z, et al. Histamine deficiency aggravates cardiac injury through miR-206/216b-Atg13 axis-mediated autophagic-dependant apoptosis. Cell Death Dis. 2018;9:694. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41419-018-0723-6\u003c/span\u003e\u003cspan address=\"10.1038/s41419-018-0723-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWu D, Zhu B, Yang X, et al. Histamine deficiency exacerbates cisplatin-induced ferroptosis in cochlea hair cells of HDC knockout mice. Int Immunopharmacol. 2024;138:112639. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.intimp.2024.112639\u003c/span\u003e\u003cspan address=\"10.1016/j.intimp.2024.112639\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eXu Q, Liu X, Chen Z, et al. Combination decoction of Astragalus mongholicus and Salvia miltiorrhiza mitigates pressure-overload cardiac dysfunction by inhibiting multiple ferroptosis pathways. Front Pharmacol. 2024;15:1447546. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fphar.2024.1447546\u003c/span\u003e\u003cspan address=\"10.3389/fphar.2024.1447546\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhu X, Wang X, Zhu B, et al. Disruption of histamine/H(1)R-STAT3-SLC7A11 axis exacerbates doxorubicin-induced cardiac ferroptosis. Free Radic Biol Med. 2022;192(20220919):98\u0026ndash;114. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.freeradbiomed.2022.09.012\u003c/span\u003e\u003cspan address=\"10.1016/j.freeradbiomed.2022.09.012\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Acute respiratory distress syndrome, Ferroptosis, Alveolar macrophages, Norepinephrine, β2-adrenergic receptor, Histidine decarboxylase","lastPublishedDoi":"10.21203/rs.3.rs-7374244/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7374244/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eAcute respiratory distress syndrome (ARDS) represents a severe pulmonary condition characterized by excessive inflammation, wherein alveolar macrophages (AMs), pivotal components of the innate immune system, play a critical role in the pathogenesis of the disease. Despite its high morbidity and mortality, effective targeted therapies for ARDS remain unavailable. Norepinephrine (NE) is an endogenous neurotransmitter with immunomodulatory and anti-inflammatory properties, and has been reported to mitigate ARDS symptoms in sepsis models. While sympathetic signaling exerts protective effects, the underlying immunomodulatory mechanisms-especially those involving macrophages-remain poorly defined. Our in vitro experiments demonstrated that NE confers protection against LPS-induced injury in AMs by limiting lipid peroxidation, sustaining mitochondrial integrity, and upregulating antioxidant regulators SLC7A11 and GPX4, leading to improved cell viability. Mechanistically, the anti-ferroptotic effect of NE on LPS-treated AMs was significantly impaired by β2-adrenergic receptor (β2-AR) blockade or knockdown of histidine decarboxylase (HDC). Our in vivo experiments further demonstrated that salbutamol, a selective β2-AR agonist, upregulated SLC7A11 and GPX4 expression in septic mice and concurrently increased HDC expression in AMs. Furthermore, salbutamol alleviated lipid peroxidation, mitigated macrophage and lung tissue injury. These findings identify a HDC/SLC7A11 axis that mediates the neuroimmune regulation of ferroptosis in AMs, offering a potential therapeutic target for ARDS.\u003c/p\u003e","manuscriptTitle":"Sympathetic signaling activation alleviated acute respiratory distress syndrome via the HDC/SLC7A11 axis in lipopolysaccharide-induced macrophages","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-09-23 00:37:58","doi":"10.21203/rs.3.rs-7374244/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"0a53a428-609a-46be-a911-51aa02a1f541","owner":[],"postedDate":"September 23rd, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-10-02T00:08:21+00:00","versionOfRecord":[],"versionCreatedAt":"2025-09-23 00:37:58","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7374244","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7374244","identity":"rs-7374244","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}