CRISPR/Cas9-mediated mutagenesis of Phytoene desaturase in pigeonpea and groundnut

CRISPR/Cas9-mediated mutagenesis of Phytoene desaturase in pigeonpea and groundnut | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article CRISPR/Cas9-mediated mutagenesis of Phytoene desaturase in pigeonpea and groundnut Kalyani Prasad, Harika Gadeela, Pradeep Reddy Bommineni, Palakolanu Sudhakar Reddy, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3914711/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 13 Mar, 2024 Read the published version in Functional & Integrative Genomics → Version 1 posted 7 You are reading this latest preprint version Abstract The CRISPR/Cas9 technology, renowned for its ability to induce precise genetic alterations in various crop species, has encountered challenges in its application to grain legume crops such as pigeonpea and groundnut. Despite attempts at gene editing in groundnut, the low rates of transformation and editing have impeded its widespread adoption in producing genetically modified plants. This study seeks to establish an effective and stable CRISPR/Cas9 system in pigeonpea and groundnut through Agrobacterium -mediated transformation, with a focus on targeting the phytoene desaturase ( PDS ) gene. The PDS gene is pivotal in carotenoid biosynthesis, and its disruption leads to albino phenotypes and dwarfism. Two constructs (one each for pigeonpea and groundnut) were developed for the PDS gene, and transformation was carried out using different explants (leaf petiolar tissue for pigeonpea and cotyledonary nodes for groundnut). By adjusting the composition of the growth media and refining Agrobacterium infection techniques, transformation efficiencies of 15.2% in pigeonpea and 20% in groundnut were achieved. Mutation in PDS resulted in albino phenotype, with editing efficiencies ranging from 4–6%. Sequence analysis uncovered a nucleotide deletion (A) in pigeonpea and an A insertion in groundnut, leading to a premature stop codon and, thereby, an albino phenotype. This research offers a significant foundation for the swift assessment and enhancement of CRISPR/Cas9-based genome editing technologies in legume crops. CRISPR/Cas9 Gene editing Groundnut Pigeonpea Phytoene desaturase (PDS) Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction As the human population is anticipated to rise, there is a need for agricultural production to expand to fulfill growing requirements for food, feed, and fiber, while ensuring minimal adverse effects on the environment (Hickey et al. 2019 ; Janssens et al. 2020 ). Agricultural crop production faces additional challenges due to climate change scenarios, including elevated global mean temperatures, shifts in atmospheric CO 2 concentration, and a heightened occurrence of extreme weather events with increased frequency and intensity (Kulshreshtha and Wheaton 2018). At the same time, these alterations will impact the proliferation and intensity of both biotic and abiotic stresses, presenting a challenge to food security. Pigeonpea ( Cajanus cajan ) and groundnut ( Arachis hypogaea ), prominent dryland legume crops in India and other arid regions, are primarily cultivated by resource-limited farmers in areas prone to drought and depleted soils. These crops serve as a crucial source of high-value protein, playing a vital nutritional role, particularly for vegetarian and economically disadvantaged populations in Asia and Eastern Africa (Ojiewo et al. 2020; Singh et al. 2022). Both crops contribute to environmental sustainability by enhancing soil productivity through nitrogen fixation (Móring et al. 2021). Nevertheless, the yield of these legumes has stagnated for numerous decades due to various biotic and abiotic stresses. To address this challenge, the integration of novel breeding technologies (NBTs), such as gene editing, aims to develop crops that are resilient to evolving environmental conditions. The clustered regularly interspaced short palindromic repeat (CRISPR)/CRISPR-associated nuclease 9 (Cas9) system has been modified to serve as a potent gene editing technology, enabling precise alterations at specific sites in a diverse array of plant species. This technology is employed for both validating gene function and enhancing crops by introducing desired phenotype for traits of interest (Ma et al. 2015). This mechanism induces DNA double-strand breaks (DSBs) at predetermined locations in the genome, guided by a specific RNA called guide RNA (gRNA) that binds with the Cas9 endonuclease. The inherent nonhomologous end-joining (NHEJ) pathway typically repairs these DSBs, and this process is error-prone, often leading to the insertion or deletion of a few nucleotides at the designated target site (Jinek et al. 2012). The CRISPR/Cas9 technology has been effectively harnessed for accurate gene editing in a variety of crops, encompassing model plants like Medicago (Meng et al. 2017) and Arabidopsis (Jiang et al. 2014), legumes including, soybean (Lu and Tian 2022), and cowpea (Che et al. 2021 ; Ji et al. 2019), cereals including rice (Biswas et al. 2023 ; Zhang et al. 2014), wheat (Wang et al. 2019; Zhang et al. 2021), and maize (Liu et al. 2024). Numerous initiatives have been undertaken within legume breeding programs to fully leverage the capabilities of gene editing technologies for enhancement. The application of CRISPR/Cas9-mediated knockdown has been successfully illustrated in legumes like soybean, cowpea, chickpea, Medicago truncatula , and Lotus japonicus . However, the challenge lies in the resistance to invitro regeneration, hindering the widespread application of gene editing in legumes such as pigeonpea and groundnut (Ochatt et al. 2018; Pratap et al. 2018). Numerous investigators have endeavored to establish a proficient Agrobacterium -mediated genetic transformation system for pigeonpea (Ghosh et al. 2017 ; Sharma et al. 2006) and groundnut (Mehta et al. 2013; Prasad et al. 2013). However, these endeavors have been marked by a low level of transformation efficiency and reproducibility. Gene editing studies in groundnut are sparse, and the investigations primarily focus on groundnut protoplast/hairy root transformation systems (Neelakandan et al. 2022; Shu et al. 2020). Notably, there is an absence of reports on the successful application of Agrobacterium -mediated CRISPR/Cas9 gene editing in pigeonpea. In the present study, we establish a stable and efficient CRISPR/Cas9-mediated mutagenesis system in pigeonpea and groundnut through Agrobacterium mediated transformation. We selected pigeonpea and groundnut phytoene desaturase (PDS) genes to validate gene editing methodology due to the distinctive phenotypes of the loss of function mutant (Qin et al. 2007). The alteration or knockout of the PDS gene impairs carotenoid biosynthesis, leading to albino phenotype and plant growth retardation (Tian 2015), and is widely used as a marker for gene editing in plants (Bánfalvi et al. 2020 ; Hooghvorst et al. 2019 ; Lu and Tian 2022; Naim et al. 2018; Ntui et al. 2020). One homolog of PDS gene in pigeonpea and two in groundnut are present. We designed two constructs employing a single guide RNA targeting one and two homologs of PDS , respectively in pigeonpea and groundnut. Subsequently, we conducted Agrobacterium -mediated transformations for pigeonpea and groundnut, respectively. Among the resulting transformants from both constructs, mutations at the intended loci were introduced in T 0 plants for both pigeonpea and groundnut PDS genes, leading to conspicuous albino phenotypes. To our knowledge, this is the first successful Agrobacterium -mediated CRISPR/Cas9 gene editing system established in pigeonpea and groundnut, ushering in a new era of gene functionality and laying the groundwork for further advancements in crop improvement. Methods Identification of PDS gene in pigeonpea and groundnut and designing Guide RNAs The coding sequence of AtPDS (AT4G14210.1) served as the query in BLAST searches against the genomic databases of pigeonpea ( Cajanus cajan ICPL87119 v2 genome) and groundnut ( Arachis hypogaea Tifrunner v2 genome) within the Legume Information System (LIS) ( https://www.legumeinfo.org/ ). This search aimed to identify sequences encoding PDS genes. Utilizing the CHOPCHOP sgRNA (single guide) design online tool ( https://chopchop.cbu.uib.no/ ) (Labun et al. 2019), single guide sequences targeting one homolog in pigeonpea ( CcPDS ) and two homologs of groundnut ( AhPDS ) PDS gene were designed separately. The selected guide sequences exhibited minimal off-target impact, as assessed by Cas-OFFinder ( http://www.rgenome.net/cas-offinder/ ). Subsequently, the 20-nucleotide guide sequences were used as queries for nucleotide BLAST searches provided by the National Center for Biotechnology Information (NCBI) to identify similar sequences in the pigeonpea and groundnut genomes, respectively. Guides with minimal off-target effects were retained for further analysis. Construction of CRISPR/Cas9 plasmid The plasmids pFH52 (Plasmid #128181) (Hahn et al. 2020 ) and pYPQ150 (Plasmid # 69301) (Lowder et al. 2015) were procured from The Addgene Repository ( http://www.addgene.org ) (Kamens 2015). The promoter sequence, 2X35S, was amplified from the pFH52 vector utilizing a forward primer (FP) with Kpn I and a reverse primer (RP) with Bam HI restriction sites. Additionally, the plant codon-optimized Cas9 (pcoCas9) and Nos terminator were amplified from pYPQ150 with FP- Bam HI and RP- Xba I restriction sites (Table S1 ). These two fragments were then ligated to create a pcoCas9 gene driven by 2X35S promoter through sequential cloning and mobilised into pCAMBIA2300 expression vector (Fig. S1 ). A 20-nucleotide sgRNA targeting the CcPDS/AhPDS gene was cloned after the MtU6 promoter, along with a SpCas9-specific conserved scaffold sequence spanning 76 nucleotides and a Poly-T terminator sequence. The MtU6 promoter was amplified by PCR from Medicago truncatula genomic DNA using SbfI-MtU6-FP/MtU6-RP primers and confirmed by sequencing. An overlap PCR approach was employed to construct sgRNA driven by MtU6 promoter utilizing four primers (Table S1 ). The Sbf I and Hind III restriction sites were subsequently employed to integrate the sgRNA into Sbf I- and Hind III- digested pCAMBIA2300-2X35S-pcoCas9-NosT, generating the CRISPR/Cas9 binary vector for plant transformation (Fig. 1 and S1 ). Genetic transformation of Pigeonpea and Groundnut The gene editing constructs were introduced into Agrobacterium tumefaciens strain C58 through electroporation. The pCAMBIA2300 vector carries an aminoglycoside phosphotransferase (Apt) gene, providing resistance to kanamycin in bacteria, and the neomycin phosphotransferase (NptII) gene for plant kanamycin selection. A. tumefaciens colonies grown on yeast extract peptone (YEP) media (Sigma-Aldrich Chemicals Pvt. Ltd, Bangalore, India), containing 50 mg/L kanamycin (Sigma-Aldrich Chemicals Pvt. Ltd, Bangalore, India) and 25 mg/L rifampicin (Sigma-Aldrich Chemicals Pvt. Ltd, Bangalore, India), were confirmed via polymerase chain reaction (PCR) using vector-specific primers (Table S1 ). A single PCR positive colony was inoculated into 5 mL YEP starter broth having 50 mg/L kanamycin and 25 mg/L rifampicin and grown overnight at 28°C with shaking at 200 rpm. The overnight grown starter culture was used to inoculate a 25 mL fresh YEP containing same antibiotic concentrations and allowed to grow until the OD 600 reached 0.6–0.8. Before transformation, the bacterial pellet was collected by centrifugation at 5000 Xg for 10 min at room temperature. The cells were re-suspended in 25 mL of co-cultivation infection media (for pigeonpea) or half MS medium (liquid, for groundnut) and stored at 4°C for 2 hours. Pigeonpea transformation : Pigeonpea transformation was done using a previous standardized protocol (Dayal et al. 2003 ) with slight modifications. To enhance transformation efficiency, we supplemented the Agrobacterium culture with 100 µm acetosyringone along with 0.1% silwet L-77. We adjusted the shoot induction and elongation media by introducing MES (0.59 g/L) to ensure pH stability. Additionally, we incorporated silver nitrate (2 mg/L) into the shoot elongation and root induction media to counteract senescence caused by ethylene. Transformed plants underwent screening using varying concentrations of kanamycin selection: 100 mg/L in shoot development and 150 mg/L in shoot elongation media. Elongated shoots (> 3 cm) were then transferred to MS basal medium to discontinue antibiotic selection and strengthen the shoots. Subsequently, they were sub-cultured onto root induction medium composed of MS medium supplemented with 11.54 µM indole acetic acid (IAA). Rooted plants were transplanted into pots containing a mixture of 2 parts cocopeat and 1 part perlite. After a week of acclimatization, during which they were initially covered with a plastic bag and gradually exposed to the open environment, the plants were transferred to a glasshouse (Fig. S2 ). Groundnut transformation Previously reported transformation procedure was used with slight modifications (Sharma and Bhatnagar-Mathur 2006). The previous transformation protocol demonstrated limited shoot induction in the elite cultivar ICGV 15083. To overcome this limitation, we introduced 5 µM TDZ (equivalent to 1.2 mg/L) to facilitate shoot formation, replacing the previously utilized BAP. Additionally, modifications were made to the shoot elongation medium, where 2µM GA3 was employed instead of BAP, and to the root induction medium, which now includes 2.5 µM IBA along with 5 µM NAA, aiming to enhance regeneration and transformation efficiency. Moreover, we incorporated the inclusion of 100 µM acetosyringone in both the co-cultivation medium and the Agrobacterium culture. Furthermore, we optimized the immersion of explants in Agrobacterium culture for 8–10 minutes before transfer to the co-cultivation medium to activate virulence genes, thereby augmenting the transformation efficiency. Finally, well-rooted plants were acclimatized and transferred to the glasshouse for further cultivation (Fig. S3 ). Molecular characterization of edited plants To extract total genomic DNA, leaf samples from pigeonpea and groundnut putative transformants were collected and homogenized using liquid nitrogen. Homogenized tissue was resuspended in DNA extraction buffer made of 2% hexadecyltrimethylammonium bromide (CTAB), 100 mM Tris pH 8.0, 20 mM ethylenediaminetetraacetic acid (EDTA) pH 8.0, 1.4 M sodium chloride (NaCl), 2% polyvinylpyrrolidone (PVP)-40 (Sigma-Aldrich Chemicals Pvt. Ltd, Bangalore, India), followed by centrifugation at 5000 rpm for 10 min to settle the debris. The supernatant was incubated at 65°C for 1h before being mixed with 1 volume of chloroform: isoamyl alcohol (24:1) (Sigma-Aldrich Chemicals Pvt. Ltd, Bangalore, India), then centrifuged at 13000 rpm for 10 min to separate the aqueous and organic phases. The aqueous phase was mixed with 1 volume of isopropanol (Sigma-Aldrich Chemicals Pvt. Ltd, Bangalore, India) for DNA precipitation. Following centrifugation at 13000 rpm for 10 min at 4°C, the DNA pellet was washed with 70% ethanol. The final DNA pellet was dried in a 60°C oven for 10 min and resuspended in 1XTE buffer. DNA samples were quantified by fluorometry using Qubit ™ dsDNA BR Assay Kit (Life Technologies, Carlsbad, California, USA) on Qubit™ 3 Fluorometer (Invitrogen, Life Technologies, Carlsbad, California, USA) as per the manufacturer’s instructions and assessed for purity by gel electrophoresis. To verify transformation, PCR was carried out using Cas9 and Npt II-specific primers (Table S1 ) and Emerald Amp® GT PCR 2X master mix (Takara Bio Inc., San Jose, CA, USA) as per the manufacturer’s instructions. To detect putative edits, target gene fragments were amplified by PCR using gene specific primers (Table S1 ) by PrimeSTAR GXL DNA polymerase (Takara Bio Inc., San Jose, CA, USA) and were sequenced using Sanger’s dideoxy method.. Sequences were further analyzed using Geneious R11 ( http://www.geneious.com ) (Kearse et al. 2012) and the ICE v2 CRISPR analysis tool (ICE v2) from Synthego (Conant et al. 2022 ). Results Identification of PDS gene in Pigeonpea and Groundnut The AtPDS3 protein sequence was used to identify a homologous gene in pigeonpea on chromosome 1 ( cajca.ICPL87119.gnm2.ann1.Cc_00066.1 ; CcPDS01) and two homologous genes in groundnut on chromosome 14 ( arahy.Tifrunner.gnm2.ann1.TUF7J0.1 ; AhPDS14) and 04 ( arahy.Tifrunner.gnm2.ann1.M5MKEZ.1 ; AhPDS04). The protein sequences of AtPDS exhibit an 80% identity with CcPDS01, AhPDS14, and AhPDS04, indicating a conserved function in both pigeonpea and groundnut. However, AhPDS14 and AhPDS04 display a high similarity of 98% to each other. The genomic sequence of CcPDS01 spans 6978 bp, with 1713 bp encoding transcript for 570 amino acids. Similarly, the genomic sequences of groundnut PDS genes - AhPDS14 and AhPDS04 - are 6386 bp and 6159 bp in size, respectively, with transcripts coding for 583 and 580 amino acids. Both the pigeonpea and groundnut PDS genes consist of 13 exons and 12 introns. Selection of sgRNA targets and vector construction for the CRISPR/Cas9 system Guide RNAs (gRNAs) targeting the disruption of the PDS gene were designed based on the most conserved regions within the pigeonpea and groundnut genomes, utilizing the CHOPCHOP sgRNA design online tool. In pigeonpea, a single gRNA (5′-GCGGCCACAGAAACCCTTGA-3′) was designed to target exon 1, while in groundnut, a corresponding single gRNA (5′-TGCCTTAAACCGATTTCTTC-3′) was designed to target exon 6 of both homologous genes (Fig. 2 , Table 1 ). Subsequently, these sequences were employed as queries for a BLAST search on NCBI to verify their specificity. All sgRNA target sequences exhibit minimal off-target effects. Table 1. Overview of the gene editing constructs targeting PDS gene (s) The pCAMBIA 2300 vector was modified as mentioned in the materials and method (Fig. S1 ). Briefly, a 2X35S promoter driving the expression of a plant codon-optimized Cas9 and a MtU6 promoter directing the expression of sgRNA (Fig. 1 ) were incorporated into the binary vector pCAMBIA2300, with kanamycin resistance. The sgRNAs were integrated into the T-DNA region of the binary vector pCAMBIA2300, resulting in the creation of the CRISPR/Cas9 constructs pCAMBIA2300-pcoCas9-CcPDS and pCAMBIA2300-pcoCas9-AhPDS (Fig. 1 ). Agrobacterium mediated delivery of CRISPR/Cas9 system into pigeonpea and groundnut targeting PDS gene Pigeonpea cv. ICPL 88039 was transformed using Agrobacterium utilizing leaf petiolar explants. Out of 1000 explants co-cultivated in shoot initiation media for 7–10 days, 675 exhibited regeneration. Following subculturing to shoot development media with kanamycin selection (100 mg/L) after 7–10 days, 450 explants survived. Among these survivors, 209 explants-producing shoots were subcultured to shoot elongation media supplemented with 0.5 mg/L GA3 (gibberellic acid) and a higher concentration of kanamycin selection (150 mg/L), being maintained for 10–15 days. Cas 9 and Npt II gene-specific primers were employed to test 163 shoots (symptomatic/albino and non-symptomatic), of which 152 (approximately 90%) tested positive for both genes (Fig. 3 ). Within this group, 56 shoots exhibited varying degrees of albino phenotype (Fig. 4 , Table 2 ). Albino plants did not develop further, and asymptomatic cas9 positives were transferred to soil pots, where they were maintained under controlled glasshouse conditions. Table 2 Summary of pigeonpea and groundnut transformations with genome editing constructs Crop Total No. of explants No. of elongated shoots Plants established Transformation efficiency (Cas9 and NptII positive) Albino Phenotype No. of mutated plants and efficiency Pigeonpea 1000 209 (20.9%) 163 (16.3%) 152 (15.2%) 56 (5.6%) 8 (5.26%) Groundnut 250 80 (32%) 70 (28%) 50 (20%) 25 (10%) 2 (4%) In groundnut, Agrobacterium -mediated transformation was conducted in cv. ICGV 15083 employing cotyledonary node explants. A total of 250 explants were co-cultivated with the CRISPR/Cas9 construct, resulting in 80 explants producing multiple shoots within 30–40 days under shoot initiation medium. The explants generating multiple shoots were isolated and subcultured in a shoot elongation medium with kanamycin selection (125 mg/L) every 10–15 days. In total, 70 shoots were subjected to testing with Cas 9 and Npt II gene-specific primers. Among these, 50 (approximately 70%) tested positive for both Cas 9 and Npt II genes (Fig. 3 ). Within this group, 25 shoots (about 25%) exhibited with varying degree of albino phenotype (Fig. 4 , Table 2 ). Albino shoots did not survive beyond three months post-regeneration. Some of the albino plant with green shoots and asymptomatic positives ( Cas 9) were transferred to soil pots and maintained under controlled glasshouse conditions. Molecular analysis of CRISPR/Cas9 induced mutations of PDS genes To confirm whether the observed albino phenotype resulted from PDS gene modification, we sequenced PCR amplicons of genomic DNA spanning the targeted PDS regions in Cas9-positive plants (Fig. 5 A, 6 A). The sequencing data revealed the presence of mutations in the targeted gene. In pigeonpea, we selected 120 plants positive for Cas 9 and Npt II, along with wild-type plants for sequencing.. The sequencing results revealed an A nucleotide deletion in plants #98, 12, 13, 11, 17, and 26 (Fig. 5 ). This deletion occurred 65 base pairs upstream of the PAM sequence (Fig. 5 B) leading to a premature stop codon resulting in an albino phenotype compared to the wild-type plants (Fig. 5 C). Additionally, plant #34 exhibited a heterozygous (T/C) mutation in the third nucleotide upstream of the PAM sequence (Fig. S4 ). To further analyse this mutation, we cloned and sequenced it. Among the five colonies examined, four displayed a T nucleotide, while the fifth colony still exhibited the heterozygous (T/C) mutation. We selected twenty plants positive for Cas 9 and Npt II, including wild-type plants, for sequencing to identify mutations in groundnut (Fig. 6 ). The sequencing results uncovered a mutation in the PAM sequence of plant #110 (Fig. 6 B) and the insertion of a single A nucleotide in plant #125 (Fig. 6 B), resulting in albino phenotype compared to the wild-type plants (Fig. 6 C) due to premature stop codon. The CRISPR Edits of Synthego (ICE) inference indicated a 39% InDel percentage for the albino groundnut plant #125, with a knockout score of 39 representing the proportion of cells with the mutation (Fig. S5 ). In the case of plant #110, the amino acid sequence alignment (Fig. S6 ) with the wild type of control revealed the substitution of a Glutamine (Q) residue with Arginine (R) in the phytoene desaturase domain. As a result, the albino phenotype in this plant may be attributed to the partially functional PDS protein. Discussion The CRISPR/Cas9-based gene editing has been developed as a site-specific, precise, and efficient technology for editing genes in plants. It holds significant potential for gene functional studies and crop improvement, allowing the desired phenotypes for traits such as enhanced nutritional quality and increased resilience to biotic and abiotic stresses (Kumar et al. 2021). To evaluate the efficiency of gene editing in pigeonpea and groundnut, we employed the CRISPR/Cas9-based gene editing system to target the phytoene desaturase ( PDS ) gene. PDS plays a crucial role in the biosynthesis of carotenoids, and its disruption results in an albino phenotype (Qin, et al. 2007). Thus, the PDS gene has been employed as a marker to establish a gene editing platform in numerous plant species (Bánfalvi, et al. 2020 ; Hooghvorst, et al. 2019 ; Lu and Tian 2022; Naim, et al. 2018; Ntui, et al. 2020). Gene editing methods have been established in model legume plants such as Medicago (Wolabu et al. 2020) and lotus (Wang et al. 2019) along with other legume crops such as cowpea (Che, et al. 2021 ) and soybean (Bao et al. 2019 ; Cai et al. 2020 ; Sun et al. 2015). While gene editing tools have proven effective in various crops, groundnut and pigeonpea have lagged behind due to the intricate nature of their genomes and their inherent resistance to regeneration (Pratap, et al. 2018). The success of efficient gene editing is primarily contingent on the regeneration efficiency of the transformation method. Transformation studies in highly recalcitrant crop species such as pigeonpea and groundnut face significant challenges, including issues related to the generation of chimeras, genotype specificity, prolonged crop duration, and low regeneration efficiency (Karmakar et al. 2019). In our investigation, Agrobacterium -mediated transformation was employed in pigeonpea, utilizing leaf petiolar explants, and in groundnut, using cotyledonary node explants. We observed a regeneration efficiency of 21% in pigeonpea and 32% in groundnut, coupled with a transformation efficiency of 15.2% in pigeonpea and 20% in groundnut. Despite various attempts by different research groups to tackle this challenge, success in establishing efficient transformation systems for legumes remains elusive, especially in pigeonpea (Ghosh, et al. 2017 ) and groundnut (Mehta, et al. 2013; Prasad, et al. 2013). Our findings, along with prior research, indicate that the enhancement of regeneration and transformation efficiency is contingent on factors such as genotype, the initial explant, culture conditions, the Agrobacterium strain utilized for infection, and the selective agents incorporated into the culture medium. In groundnut, which is an allotetraploid, genes predominantly exist in two copies (A and B). The existence of gene homeologs presents challenges in CRISPR-mediated knockouts in polyploid crops like groundnut, as a deletion in the A-sub genome may be compensated by a highly similar gene in the B-sub genome (Yuan et al. 2019). Therefore, in this study, we opted for sgRNAs targeting conserved regions of all homeologs of the AhPDS gene to maximize efficacy. Likewise, the disruption of the PDS gene through CRISPR/Cas9 was reported in soybean, utilizing a single guide RNA that targeted both homologs of the PDS gene, resulting in dwarf and albino phenotypes (Lu and Tian 2022). The recent attempts at CRISPR/Cas9-based gene editing in groundnut are restricted to transient transformation methods, such as hairy root or protoplast-mediated transformations (Biswas et al. 2022 ; Shu, et al. 2020; Yuan, et al. 2019). Increasing the oleic acid content by targeting fatty acid desaturases, AhFAD2A and AhFAD2B was the first report on CRISPR/Cas9-based gene-editing in groundnut by using protoplast and hairy root transformation methods (Yuan, et al. 2019). However, the attempts at generating stably edited lines were unsuccessful in this study. Further, increasing the nodulation by editing Nod factor receptors (NFRs) using similar constructs with GFP in groundnut using the hairy root transformation system (Shu, et al. 2020). More recently, base editing to target FAD2 genes in groundnut using the hairy root transformation system has increased the oleic acid content (Neelakandan, et al. 2022). Furthermore, extended scaffold plus terminator increases the editing efficiency compared to normal sgRNA in groundnut while targeting FAD2 genes (Neelakandan et al. 2022). A multiplex approach was used in groundnut protoplasts to target an allergen gene, Arah2 , using a polycistronic tRNA–gRNA (PTG) system and Cas9 endonuclease (Biswas, et al. 2022 ). Furthermore, to the best of our knowledge, there has been no prior study reporting gene editing in pigeonpea using CRISPR/Cas9 technology. This lack of reports can be attributed to the requirement for an efficient, stable, and effective gene editing system. The effectiveness of CRISPR/Cas9 relies on the design and selection of guide RNA (gRNA) that guides the Cas9 endonuclease to perform double-stranded DNA cleavage. In our study, the availability of the reference genome sequence of pigeonpea (Varshney et al. 2012) and groundnut (Bertioli et al. 2019 ; Zhuang et al. 2019) facilitates designing specific and efficient guide RNA. We proceeded to induce double-stranded breaks (DSBs) in the CcPDS and AhPDS genes within the genomes of pigeonpea and groundnut. This was accomplished by utilizing a CRISPR vector containing the pcoCas9 gene and sgRNAs driven by the MtU6 promoter, leading to the generation of albino plants. Our Agrobacterium -mediated transformation yielded albino phenotypes in pigeonpea (5.6%) and groundnut (10%) compared to the wild types. Furthermore, the sequencing results unveiled a deletion of an A nucleotide in the edited pigeonpea plants and insertion of an A nucleotide in the edited groundnut, resulting in the creation of a premature stop codon. This in turn, resulted in the inactivation of the PDS gene, leading to the albino phenotype. Although the mutation of the PDS gene in both legume crops was successful, sequencing revealed a lower editing efficiency. This could be attributed to variations in intrinsic DNA repair mechanisms among plant species, the tetraploid genetic background of groundnut, the possibility that PCR amplicons may have carried a mixture of edited and unedited heterogenous DNA, or the use of non-endogenous promoters, which might have further diminished the efficiency of the CRISPR/Cas9 system (Poczai et al. 2013; Wolabu, et al. 2020). Various studies have demonstrated that Cas9 typically cleaves target sites at the fourth base upstream of the PAM sequence (Jinek et al. 2012). However, in our study mutation occurred at the 65 bp upstream of PAM in pigeonpea edited plants, and at the third base of the PAM sequence in groundnut edited plant #110. This divergence may be attributed to simultaneous activation of homologous recombination (HR) and non-homologous end joining (NHEJ) pathway for repairing double stranded breaks in the PDS region (Mainkar et al. 2023; Odipio et al. 2017). Prior research has indicated that the editing efficiency of the CRISPR/Cas9 system is influenced by various factors. These include the expression level of Cas9-gRNA, the sequence of the guide RNA (gRNA), the promoters governing Cas9 and small guide RNA (sgRNA), terminators, the composition of the target sequence (spacer), T-DNA architecture, chromatin state, and the duration of culture incubation (Castel et al. 2019 ; Gao et al. 2018 ; Mikami et al. 2016). The employment of codon-optimized Cas9 and endogenous promoters for Cas9 and sgRNA expression has demonstrated an elevated mutation frequency in various crops, such as soybean (Sun, et al. 2015), rice (Wang et al. 2016), and M. truncatula (Wolabu, et al. 2020). We postulate that the use of an optimized construct could potentially result in higher mutation efficiencies. Conclusion The current study showcases that the Agrobacterium -mediated CRISPR/Cas9 system yields albino-phenotype mutants in the T 0 generation of both pigeonpea and groundnut. Despite the relatively low editing efficiency observed in this study, the incorporation of a GFP tag, the exploration of regeneration-promoting genes, design of gRNA with higher efficiency, and the utilization of alternative promoters for gRNA or Cas9, may further enhance editing efficiency. This study opens avenues for exploring functions for various candidate genes in basic research and harnesses the potential of CRISPR/Cas9 gene-editing technologies for advancing agronomic traits in legume crops. To the best of our knowledge, this marks the initial success of establishing an Agrobacterium -mediated CRISPR/Cas9 gene editing system in pigeonpea and groundnut, bridging the gap from a basic genetic model to the contemporary gene functional era. Declarations AUTHOR CONTRIBUTIONS Conceptualization: KY and PSR; methodology: KP, HG, PRB, and KY; software: KY and PSR; data analysis: KY, and WT; writing—original draft preparation: KP, HG, and KY; writing—review and editing: KY, WT, and PSR; supervision and funding acquisition: KY. All authors have read and agreed to the published version of the manuscript. ACKNOWLEDGMENT This work was carried out with the aid of a grant from the Start-up Research Grant (SRG) (File No. SRG/2021/000422) from the Science and Engineering Research Board (SERB), Govt. of India to KY. The authors express their gratitude to Dr Prakash Gangashetty, the Pigeonpea breeder at ICRISAT, and Dr Janila Pasupuleti, the Groundnut breeder at ICRISAT, for generously supplying the pigeonpea and groundnut seeds required for plant transformation. Data availability statement The dataset supporting the findings of this article are included within the article. Conflict of Interest The authors declare no competing interest. References Bánfalvi Z, Csákvári E, Villányi V, Kondrák M (2020) Generation of transgene-free PDS mutants in potato by Agrobacterium -mediated transformation. BMC Biotechnol. 20:1-10 Bao A, Chen H, Chen L, Chen S, Hao Q, Guo W, Qiu D, Shan Z, Yang Z, Yuan S (2019) CRISPR/Cas9-mediated targeted mutagenesis of GmSPL9 genes alters plant architecture in soybean. BMC Plant Biol. 19:1-12 Bertioli DJ, Jenkins J, Clevenger J, Dudchenko O, Gao D, Seijo G, Leal-Bertioli SC, Ren L, Farmer AD, Pandey MK (2019) The genome sequence of segmental allotetraploid peanut Arachis hypogaea . Nat. Genet. 51:877-884 Biswas S, Ibarra O, Shaphek M, Molina‐Risco M, Faion‐Molina M, Bellinatti‐Della Gracia M, Thomson MJ, Septiningsih EM (2023) Increasing the level of resistant starch in ‘Presidio’rice through multiplex CRISPR–Cas9 gene editing of starch branching enzyme genes. Plant Genome. 16:e20225 Biswas S, Wahl NJ, Thomson MJ, Cason JM, McCutchen BF, Septiningsih EM (2022) Optimization of protoplast isolation and transformation for a pilot study of genome editing in peanut by targeting the allergen gene Ara h 2. Int. J. Mol. Sci. 23:837 Cai Y, Chen L, Zhang Y, Yuan S, Su Q, Sun S, Wu C, Yao W, Han T, Hou W (2020) Target base editing in soybean using a modified CRISPR/Cas9 system. Plant Biotechnol. J. 18:1996 Castel B, Tomlinson L, Locci F, Yang Y, Jones JD (2019) Optimization of T-DNA architecture for Cas9-mediated mutagenesis in Arabidopsis. PloS One. 14:e0204778 Che P, Chang S, Simon MK, Zhang Z, Shaharyar A, Ourada J, O’Neill D, Torres‐Mendoza M, Guo Y, Marasigan KM (2021) Developing a rapid and highly efficient cowpea regeneration, transformation and genome editing system using embryonic axis explants. Plant J. 106:817-830 Conant D, Hsiau T, Rossi N, Oki J, Maures T, Waite K, Yang J, Joshi S, Kelso R, Holden K (2022) Inference of CRISPR edits from Sanger trace data. CRISPR J.5:123-130 Dayal S, Lavanya M, Devi P, Sharma K (2003) An efficient protocol for shoot regeneration and genetic transformation of pigeonpea [Cajanus cajan (L.) Millsp.] using leaf explants. Plant Cell Rep. 21:1072-1079 Gao R, Feyissa BA, Croft M, Hannoufa A (2018) Gene editing by CRISPR/Cas9 in the obligatory outcrossing Medicago sativa. Planta. 247:1043-1050 Ghosh G, Ganguly S, Purohit A, Chaudhuri RK, Das S, Chakraborti D (2017) Transgenic pigeonpea events expressing Cry1Ac and Cry2Aa exhibit resistance to Helicoverpa armigera . Plant Cell Rep. 36:1037-1051 Hahn F, Korolev A, Sanjurjo Loures L, Nekrasov V (2020) A modular cloning toolkit for genome editing in plants. BMC Plant Biol. 20:1-10 Hickey LT, A NH, Robinson H, Jackson SA, Leal-Bertioli SCM, Tester M, Gao C, Godwin ID, Hayes BJ, Wulff BBH (2019) Breeding crops to feed 10 billion. Nat. Biotechnol. 37:744-754. Hooghvorst I, López-Cristoffanini C, Nogués S (2019) Efficient knockout of phytoene desaturase gene using CRISPR/Cas9 in melon. Sci. Rep. 9:17077 Janssens C, Havlik P, Krisztin T, Baker J, Frank S, Hasegawa T, Leclere D, Ohrel S, Ragnauth S, Schmid E, Valin H, Van Lipzig N, Maertens M (2020) Global hunger and climate change adaptation through international trade.Nat. Clim. Change. 10:829-835. Ji J, Zhang C, Sun Z, Wang L, Duanmu D, Fan Q (2019) Genome editing in cowpea Vigna unguiculata using CRISPR-Cas9. Int. J. Mol. Sci. 20:2471 Jiang W, Yang B, Weeks DP (2014) Efficient CRISPR/Cas9-mediated gene editing in Arabidopsis thaliana and inheritance of modified genes in the T2 and T3 generations. PloS One. 9:e99225 Jinek M, Chylinski K, Fonfara I, Hauer M, Doudna JA, Charpentier E (2012) A programmable dual-RNA–guided DNA endonuclease in adaptive bacterial immunity. Science. 337:816-821 Kamens J (2015) The Addgene repository: an international nonprofit plasmid and data resource. Nucleic Acids Res. 43:D1152-D1157 Karmakar S, Molla KA, Gayen D, Karmakar A, Das K, Sarkar SN, Datta K, Datta SK (2019) Development of a rapid and highly efficient Agrobacterium-mediated transformation system for pigeon pea [ Cajanus cajan (L.) Millsp]. GM Crops Food. 10:115-138 Kearse M, Moir R, Wilson A, Stones-Havas S, Cheung M, Sturrock S, Buxton S, Cooper A, Markowitz S, Duran C (2012) Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinform. 28:1647-1649 Kulshreshtha SN, Wheaton EE (2018) Sustainable Agriculture and Climate ChangeMDPI Basel. Kumar S, Rymarquis LA, Ezura H, Nekrasov V (2021) CRISPR-Cas in agriculture: Opportunities and challenges. Front. Plant Sci. 12:672329 Labun K, Montague TG, Krause M, Torres Cleuren YN, Tjeldnes H, Valen E (2019) CHOPCHOP v3: expanding the CRISPR web toolbox beyond genome editing. Nucleic Acids Res. 47:W171-W174 Liu Y, Chen Z, Zhang C, Guo J, Liu Q, Yin Y, Hu Y, Xia H, Li B, Sun X (2024) Gene editing of ZmGA20ox3 improves plant architecture and drought tolerance in maize. Plant Cell Rep. 43:18 Lowder LG, Zhang D, Baltes NJ, Paul III JW, Tang X, Zheng X, Voytas DF, Hsieh T-F, Zhang Y, Qi Y (2015) A CRISPR/Cas9 toolbox for multiplexed plant genome editing and transcriptional regulation. Plant Physiol. 169:971-985 Lu QSM, Tian L (2022) An efficient and specific CRISPR-Cas9 genome editing system targeting soybean phytoene desaturase genes. BMC Biotechnol. 22:7 Ma X, Zhang Q, Zhu Q, Liu W, Chen Y, Qiu R, Wang B, Yang Z, Li H, Lin Y (2015) A robust CRISPR/Cas9 system for convenient, high-efficiency multiplex genome editing in monocot and dicot plants. Mol. Plant. 8:1274-1284 Mainkar P, Manape TK, Satheesh V, Anandhan S (2023) CRISPR/Cas9-mediated editing of PHYTOENE DESATURASE gene in onion ( Allium cepa L.). Front. Plant Sci. 14 Mehta R, Radhakrishnan T, Kumar A, Yadav R, Dobaria JR, Thirumalaisamy PP, Jain RK, Chigurupati P (2013) Coat protein-mediated transgenic resistance of peanut ( Arachis hypogaea L.) to peanut stem necrosis disease through Agrobacterium-mediated genetic transformation. Indian J. Virol. 24:205-213 Meng Y, Hou Y, Wang H, Ji R, Liu B, Wen J, Niu L, Lin H (2017) Targeted mutagenesis by CRISPR/Cas9 system in the model legume Medicago truncatula . Plant Cell Rep. 36:371-374 Mikami M, Toki S, Endo M (2016) Precision targeted mutagenesis via Cas9 paired nickases in rice. Plant Cell Physiol. 57:1058-1068 Móring A, Hooda S, Raghuram N, Adhya TK, Ahmad A, Bandyopadhyay SK, Barsby T, Beig G, Bentley AR, Bhatia A (2021) Nitrogen challenges and opportunities for agricultural and environmental science in India. Front. sustain. food syst. 5:505347 Naim F, Dugdale B, Kleidon J, Brinin A, Shand K, Waterhouse P, Dale J (2018) Gene editing the phytoene desaturase alleles of Cavendish banana using CRISPR/Cas9. Transgenic Res. 27:451-460 Neelakandan AK, Subedi B, Traore SM, Binagwa P, Wright DA, He G (2022) Base editing in peanut using CRISPR/nCas9. Front. genome ed. 4:901444 Neelakandan AK, Wright DA, Traore SM, Chen X, Spalding MH, He G (2022) CRISPR/Cas9 based site-specific modification of FAD2 cis-regulatory motifs in peanut (Arachis hypogaea L). Front. Genet. 13:849961 Ntui VO, Tripathi JN, Tripathi L (2020) Robust CRISPR/Cas9 mediated genome editing tool for banana and plantain ( Musa spp.). Curr. Plant Biol. 21:100128 Ochatt S, Conreux C, Moussa Mcolo R, Despierre G, Magnin-Robert J-B, Raffiot B (2018) Phytosulfokine-alpha, an enhancer of in vitro regeneration competence in recalcitrant legumes. Plant Cell, Tissue Organ Cult. 135:189-201 Odipio J, Alicai T, Ingelbrecht I, Nusinow DA, Bart R, Taylor NJ (2017) Efficient CRISPR/Cas9 genome editing of phytoene desaturase in cassava. Front. Plant Sci. 8:1780 Ojiewo CO, Janila P, Bhatnagar-Mathur P, Pandey MK, Desmae H, Okori P, Mwololo J, Ajeigbe H, Njuguna-Mungai E, Muricho G (2020) Advances in crop improvement and delivery research for nutritional quality and health benefits of groundnut ( Arachis hypogaea L.). Front. Plant Sci. 11:29 Poczai P, Varga I, Laos M, Cseh A, Bell N, Valkonen JP, Hyvönen J (2013) Advances in plant gene-targeted and functional markers: a review. Plant Methods. 9:1-32 Prasad K, Bhatnagar-Mathur P, Waliyar F, Sharma KK (2013) Overexpression of a chitinase gene in transgenic peanut confers enhanced resistance to major soil borne and foliar fungal pathogens. J. Plant Biochem. Biotechnol. 22:222-233 Pratap A, Prajapati U, Singh CM, Gupta S, Rathore M, Malviya N, Tomar R, Gupta AK, Tripathi S, Singh NP (2018) Potential, constraints and applications of in vitro methods in improving grain legumes. Plant Breed. 137:235-249 Qin G, Gu H, Ma L, Peng Y, Deng XW, Chen Z, Qu L-J (2007) Disruption of phytoene desaturase gene results in albino and dwarf phenotypes in Arabidopsis by impairing chlorophyll, carotenoid, and gibberellin biosynthesis. Cell Res. 17:471-482 Sharma K, Sreelatha G, Dayal S (2006) Pigeonpea ( Cajanus cajan L. Millsp.). Agrobacterium Protocols. 2006; 359–368. Sharma KK, Bhatnagar-Mathur P (2006) Peanut ( Arachis hypogaea l.). Agrobacterium Protocols:347-358 Shu H, Luo Z, Peng Z, Wang J (2020) The application of CRISPR/Cas9 in hairy roots to explore the functions of AhNFR1 and AhNFR5 genes during peanut nodulation. BMC Plant Biol. 20:1-15 Singh N, Jain P, Ujinwal M, Langyan S (2022) Escalate protein plates from legumes for sustainable human nutrition. Front. nutr. 9:977986 Sun X, Hu Z, Chen R, Jiang Q, Song G, Zhang H, Xi Y (2015) Targeted mutagenesis in soybean using the CRISPR-Cas9 system. Sci. Rep. 5:10342 Tian L (2015) Recent advances in understanding carotenoid-derived signaling molecules in regulating plant growth and development. Front. Plant Sci. 6:790 Varshney RK, Chen W, Li Y, Bharti AK, Saxena RK, Schlueter JA, Donoghue MT, Azam S, Fan G, Whaley AM (2012) Draft genome sequence of pigeonpea (Cajanus cajan), an orphan legume crop of resource-poor farmers. Nat. Biotechnol. 30:83 Wang F, Wang C, Liu P, Lei C, Hao W, Gao Y, Liu Y-G, Zhao K (2016) Enhanced rice blast resistance by CRISPR/Cas9-targeted mutagenesis of the ERF transcription factor gene OsERF922. PloS One. 11:e0154027 Wang L, Rubio MC, Xin X, Zhang B, Fan Q, Wang Q, Ning G, Becana M, Duanmu D (2019) CRISPR/Cas9 knockout of leghemoglobin genes in Lotus japonicus uncovers their synergistic roles in symbiotic nitrogen fixation. New Phytol. 224:818-832 Wang W, Pan Q, Tian B, He F, Chen Y, Bai G, Akhunova A, Trick HN, Akhunov E (2019) Gene editing of the wheat homologs of TONNEAU 1‐recruiting motif encoding gene affects grain shape and weight in wheat. Plant J. 100:251-264 Wolabu TW, Cong L, Park J-J, Bao Q, Chen M, Sun J, Xu B, Ge Y, Chai M, Liu Z (2020) Development of a highly efficient multiplex genome editing system in outcrossing tetraploid alfalfa (Medicago sativa). Front. Plant Sci. 11:1063 Yuan M, Zhu J, Gong L, He L, Lee C, Han S, Chen C, He G (2019) Mutagenesis of FAD2 genes in peanut with CRISPR/Cas9 based gene editing. BMC Biotechnol.19:1-7 Zhang H, Zhang J, Wei P, Zhang B, Gou F, Feng Z, Mao Y, Yang L, Zhang H, Xu N (2014) The CRISPR/C as9 system produces specific and homozygous targeted gene editing in rice in one generation. Plant Biotechnol. J. 12:797-807 Zhang S, Zhang R, Gao J, Song G, Li J, Li W, Qi Y, Li Y, Li G (2021) CRISPR/Cas9‐mediated genome editing for wheat grain quality improvement. Plant Biotechnol. J. 19:1684 Zhuang W, Chen H, Yang M, Wang J, Pandey MK, Zhang C, Chang W-C, Zhang L, Zhang X, Tang R (2019) The genome of cultivated peanut provides insight into legume karyotypes, polyploid evolution and crop domestication. Nat. Genet. 51:865-876 Additional Declarations No competing interests reported. Supplementary Files Fig.S1.jpg Fig. S1Schematic strategy for the construction of Cas9/sgRNA (CRISPR/Cas9) vector for genome editing of PDS gene through Agrobacterium -mediated transformation. A. 2X35S promoter amplified from pFH52 vector and cloned in pCAMBIA2300, B. pcoCas9 with an intron and nuclear localization signal amplified from pYPQ150 vector and cloned in pCAMBIA 2300, C. PDS gRNA cloned between MtU6 promoter and gRNA scaffold using overlap PCR D. The resultant MtU6-gRNA-polyT finally cloned in pCAMBIA 2300-Cas9 vector using Sbf I and Hind III restriction site. Fig.S2.jpg Fig. S2 Different stages of genetic transformation in pigeonpea through direct organogenesis. A. Sterilized and decoated seeds on MS media B. Germinated seeds C. Co-cultivated Leaf Explants, D. Shoot bud differentiation from petiolar cut end on shoot induction media, F-E. Elongated shoots on shoot elongation media, F. Rooting of elongated shoots on root induction media G. Hardening of rooted plants in jiffy cups, H. Acclimatized T 0 plant under glasshouse. Fig.S3.jpg Fig. S3 Different stages of genetic transformation in groundnut through direct organogenesis. A. Co-cultivated cotyledonary explants B-C. Swelling and greening of explants, D. Shoot bud differentiation on shoot initiation media, E-F. Elongated shoots on shoot elongation media, G. Rooting of elongated shoots on root induction media, H. Hardening of rooted plants in jiffy cups, I. Acclimatized T 0 plant under glasshouse. Fig.S4.jpg Fig. S4 Detection of mutation in CcPDS in Pigeonpea plants; Chromatogram sequence of wild type (WT) with pigeonpea edited Plant #34. Guide RNA regions are marked in black lines, and PAM sequences are marked in black dotted lines. Fig.S5.jpg Fig. S5 Illustration of the outputs from the ICE (Inference of CRISPR Edits) software for a guide (sgRNA; TGCCTTAAACCGATTTCTTC targeting the groundnut PDS gene. Transformed groundnut samples were sequenced with Sanger sequencing and further analyzed with ICE. A) Representation of ICE outputs generated from sequence files (.ab1) received from Sanger sequencing edited Plant # 125 and WT samples. A 20 nucleotide gRNA sequence and PAM sequences denote the software output. Knockout score and InDel percentage received as output post ICE analysis are also exhibited. Fig.S6.jpg Fig. S6 Amino acid sequence alignment of the WT- control and edited groundnut plant# 110; amino acid change marked with a red box. The phytoene desaturase domain (113-563 amino acids) is marked in a black rectangular box. TableS1.docx Cite Share Download PDF Status: Published Journal Publication published 13 Mar, 2024 Read the published version in Functional & Integrative Genomics → Version 1 posted Editorial decision: Revision requested 19 Feb, 2024 Reviews received at journal 01 Feb, 2024 Reviewers agreed at journal 01 Feb, 2024 Reviewers invited by journal 01 Feb, 2024 Editor assigned by journal 01 Feb, 2024 Submission checks completed at journal 01 Feb, 2024 First submitted to journal 31 Jan, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3914711","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":270517816,"identity":"9e3c4b35-8d72-4d93-853a-0f7d1671bd62","order_by":0,"name":"Kalyani Prasad","email":"","orcid":"","institution":"International Crops Research Institute for the Semi-Arid Tropics (ICRISAT)","correspondingAuthor":false,"prefix":"","firstName":"Kalyani","middleName":"","lastName":"Prasad","suffix":""},{"id":270517817,"identity":"8f79f484-00c9-4f7e-a193-11349b895a70","order_by":1,"name":"Harika Gadeela","email":"","orcid":"","institution":"International Crops Research Institute for the Semi-Arid Tropics (ICRISAT)","correspondingAuthor":false,"prefix":"","firstName":"Harika","middleName":"","lastName":"Gadeela","suffix":""},{"id":270517818,"identity":"61e7542a-5e6e-47eb-8c23-e9d1bbb158cd","order_by":2,"name":"Pradeep Reddy Bommineni","email":"","orcid":"","institution":"International Crops Research Institute for the Semi-Arid Tropics (ICRISAT)","correspondingAuthor":false,"prefix":"","firstName":"Pradeep","middleName":"Reddy","lastName":"Bommineni","suffix":""},{"id":270517819,"identity":"db22b04d-60a3-48b1-b4fb-2172e16dc746","order_by":3,"name":"Palakolanu Sudhakar Reddy","email":"","orcid":"","institution":"International Crops Research Institute for the Semi-Arid Tropics (ICRISAT)","correspondingAuthor":false,"prefix":"","firstName":"Palakolanu","middleName":"Sudhakar","lastName":"Reddy","suffix":""},{"id":270517820,"identity":"c57dc672-f4d4-4e90-a476-7b1292940046","order_by":4,"name":"Wricha Tyagi","email":"","orcid":"","institution":"International Crops Research Institute for the Semi-Arid Tropics (ICRISAT)","correspondingAuthor":false,"prefix":"","firstName":"Wricha","middleName":"","lastName":"Tyagi","suffix":""},{"id":270517821,"identity":"300bb82e-4e19-49ee-b9b1-ef46648ec2a6","order_by":5,"name":"Kalenahalli Yogendra","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABRElEQVRIie3RsUrDQBjA8TsCzXJp1kiH+ggXXBQ0fZU7Au0SNBIoBQdPCtel0jUu+grt5phwYJaj4NappDi4prgoKngx0OEI6CiYPxyB4358xwWApqY/W0stBGCiPgSYBksKXG3+REBFDMjSuCKQ/ZoYqNqvJTibPD6Fw3UXIJEn23vv1B7DK3EcemdtWzznYLT2NIeljA7iZeQyi+P0RvqRIyATAfaPuNN3GZCRr5NV0O9YnEBmAywsblBWkQS3HOAyyImvX2wVDN4V6THbLMQnv6R3JTksiZ1t68ngwVCEMmuKBeSCzksCSgKC7ymeRvakNDpoSXyOZJhe84wuFEmn2FcXC85jIgnRSDubbF7QkJzM0GCRv/ELepuNRfH64eHuLJsXxYj0NLKfILz7NTWpEVR7sS4z8/rDu/QpTU1NTf+uL9wRfMrIFQJsAAAAAElFTkSuQmCC","orcid":"","institution":"International Crops Research Institute for the Semi-Arid Tropics (ICRISAT)","correspondingAuthor":true,"prefix":"","firstName":"Kalenahalli","middleName":"","lastName":"Yogendra","suffix":""}],"badges":[],"createdAt":"2024-01-31 18:00:10","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3914711/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3914711/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s10142-024-01336-9","type":"published","date":"2024-03-13T09:32:09+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":50532646,"identity":"ebaa6ca5-9867-4051-a329-e7e9aaee916c","added_by":"auto","created_at":"2024-02-02 03:16:15","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":3062709,"visible":true,"origin":"","legend":"\u003cp\u003eSchematic diagram of Cas9/sgRNA expression and T-DNA region of the editing vector. A. T-DNA region containing Cas9 and gRNA cassette, B. pCAMBIA2300-pcoCas9-CcPDS, and C. pCAMBIA2300-pcoCas9-AhPDS, The \u003cem\u003eCas9\u003c/em\u003e gene from \u003cem\u003eStreptococcus pyogenes\u003c/em\u003e is driven by 2X35S promoter and gRNA by MtU6 promoters from \u003cem\u003eMedicago truncatula\u003c/em\u003e. Transformants were selected with a \u003cem\u003enptII\u003c/em\u003e gene controlled by a 2X35S promoter.\u003c/p\u003e","description":"","filename":"Fig.1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3914711/v1/c97a465b546d72bd2ad0a530.jpg"},{"id":50532645,"identity":"997d0ebe-288f-4260-952b-acafe091dca1","added_by":"auto","created_at":"2024-02-02 03:16:15","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":2327314,"visible":true,"origin":"","legend":"\u003cp\u003eSelection of target sites in \u003cem\u003eCcPDS \u003c/em\u003eand \u003cem\u003eAhPDS \u003c/em\u003egene. gRNA designed targeting exon 1 in pigeonpea and at exon 6 in groundnut using CHOPCHOP sgRNA design online tool.\u003c/p\u003e","description":"","filename":"Fig.2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3914711/v1/4d33782a6815c86e2cbb9b09.jpg"},{"id":50532653,"identity":"36f7218c-f8b1-4cab-a4a7-753593157aca","added_by":"auto","created_at":"2024-02-02 03:16:15","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":2395077,"visible":true,"origin":"","legend":"\u003cp\u003eConfirmation of transformants by PCR analysis with \u003cem\u003eCas9\u003c/em\u003e gene-specific primers. \u0026nbsp;B - blank, WT - negative control, M1 - 100 bp DNA size marker, M2- 1Kb DNA size marker, P - Plasmid used as a positive control.\u003c/p\u003e","description":"","filename":"Fig.3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3914711/v1/cbdf7d2c73dc85194c6713f9.jpg"},{"id":50532647,"identity":"c0b3a81f-7670-4781-8c12-4504dbb98a57","added_by":"auto","created_at":"2024-02-02 03:16:15","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":6093211,"visible":true,"origin":"","legend":"\u003cp\u003ePhenotypic variation observed in Pigeonpea and Groundnut containing CRISPR-PDS construct. A \u0026amp; E. Induced albino shoots, B \u0026amp; F. Elongated albino shoots, C \u0026amp; G. leaf showing albino symptoms, D \u0026amp; H. Non-edited wild type control.\u003c/p\u003e","description":"","filename":"Fig.4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3914711/v1/7c175fbc01406101e1ff1783.jpg"},{"id":50532690,"identity":"fb78d8db-19f3-41a2-ac72-cb3399ed5985","added_by":"auto","created_at":"2024-02-02 03:24:15","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":18404426,"visible":true,"origin":"","legend":"\u003cp\u003eDetection of mutation in CcPDS in Pigeonpea plants; A. Schematic representation of the Pigeonpea PDS sequence used for sequence confirmation, B. Chromatogram sequence of edited Plant# 98, 12, 13, 11, 17, and 26 showing an A deletion compared to WT. The Black arrow indicates the deletion. C. Amino acid sequence alignment of edited and WT-pigeonpea plants showing a premature stop codon.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-3914711/v1/5efc3b9ab6d22ab711bea81d.png"},{"id":50532648,"identity":"4fcd1f62-e8d0-400d-9b74-908fcd7cd91e","added_by":"auto","created_at":"2024-02-02 03:16:15","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":12094880,"visible":true,"origin":"","legend":"\u003cp\u003eDetection of mutation in AhPDS in groundnut plants. A. Schematic representation of the Pigeonpea PDS sequence used for sequence confirmation, B. Chromatogram sequence of wild type (WT), groundnut edited Plant #110, and 125, gRNA sequence in green color, PAM sequence in red color, and black arrow indicates mutation site. C. Amino acid sequence alignment of edited (#125) and WT-groundnut plants showing a premature stop codon.\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-3914711/v1/c496233f873294b1385ef550.png"},{"id":52810436,"identity":"68d90231-f690-442d-8364-cbc5ca69465a","added_by":"auto","created_at":"2024-03-16 09:32:18","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1825202,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3914711/v1/7c572c95-40a5-4250-96df-f18c91fc3441.pdf"},{"id":50532654,"identity":"9a5a0960-3d5f-4b7a-9983-ba582548cd4d","added_by":"auto","created_at":"2024-02-02 03:16:15","extension":"jpg","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":3265329,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFig. S1\u003c/strong\u003eSchematic strategy for the construction of Cas9/sgRNA (CRISPR/Cas9) vector for genome editing of \u003cem\u003ePDS\u003c/em\u003e gene through \u003cem\u003eAgrobacterium\u003c/em\u003e-mediated transformation. A. 2X35S promoter amplified from pFH52 vector and cloned in pCAMBIA2300, B. pcoCas9 with an intron and nuclear localization signal amplified from pYPQ150 vector and cloned in pCAMBIA 2300, C. \u003cem\u003ePDS\u003c/em\u003e gRNA cloned between MtU6 promoter and \u0026nbsp;gRNA scaffold using overlap PCR D. The resultant MtU6-gRNA-polyT finally cloned in pCAMBIA 2300-Cas9 vector using \u003cem\u003eSbf\u003c/em\u003eI and \u003cem\u003eHind\u003c/em\u003eIII restriction site.\u003c/p\u003e","description":"","filename":"Fig.S1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3914711/v1/e00d7865e571c7d59ec54f80.jpg"},{"id":50532650,"identity":"bae45754-b653-423f-a89a-dda9187697ee","added_by":"auto","created_at":"2024-02-02 03:16:15","extension":"jpg","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":3766960,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFig. S2\u003c/strong\u003e Different stages of genetic transformation in pigeonpea through direct organogenesis. A. Sterilized and decoated seeds on MS media B. Germinated seeds C. Co-cultivated Leaf Explants, D. Shoot bud differentiation from petiolar cut end on shoot induction media, F-E. Elongated shoots on shoot elongation media, F. Rooting of elongated shoots on root induction media G. Hardening of rooted plants in jiffy cups, H. Acclimatized T\u003csub\u003e0\u003c/sub\u003e plant under glasshouse.\u003c/p\u003e","description":"","filename":"Fig.S2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3914711/v1/d49e50f5c8f0e8a30c21c7c1.jpg"},{"id":50532688,"identity":"b3d7df1c-1776-416f-ae65-e851f9ae0623","added_by":"auto","created_at":"2024-02-02 03:24:15","extension":"jpg","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":4401455,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFig. S3\u003c/strong\u003e Different stages of genetic transformation in groundnut through direct organogenesis. A. Co-cultivated cotyledonary explants B-C. Swelling and greening of explants, D. Shoot bud differentiation on shoot initiation media, E-F. Elongated shoots on shoot elongation media, G. Rooting of elongated shoots on root induction media, H. Hardening of rooted plants in jiffy cups, I. Acclimatized T\u003csub\u003e0\u003c/sub\u003e plant under glasshouse.\u003c/p\u003e","description":"","filename":"Fig.S3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3914711/v1/e0c49e5825e4b8c8b68d3206.jpg"},{"id":50532652,"identity":"ce5949d7-3cfd-4ec8-8f16-476cbbc26da9","added_by":"auto","created_at":"2024-02-02 03:16:15","extension":"jpg","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":3093439,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFig. S4\u003c/strong\u003e Detection of mutation in \u003cem\u003eCcPDS\u003c/em\u003e in Pigeonpea plants; Chromatogram sequence of wild type (WT) with pigeonpea edited Plant #34. Guide RNA regions are marked in black lines, and PAM sequences are marked in black dotted lines.\u003c/p\u003e","description":"","filename":"Fig.S4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3914711/v1/eeb7a2dd52ee1761840fda2e.jpg"},{"id":50532689,"identity":"63c8a743-7113-422c-ae89-722ac4f95c8b","added_by":"auto","created_at":"2024-02-02 03:24:15","extension":"jpg","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":4708729,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFig. S5\u003c/strong\u003e Illustration of the outputs from the ICE (Inference of CRISPR Edits) software for a guide (sgRNA; TGCCTTAAACCGATTTCTTC targeting the groundnut PDS gene. Transformed groundnut samples were sequenced with Sanger sequencing and further analyzed with ICE. A) Representation of ICE outputs generated from sequence files (.ab1) received from Sanger sequencing edited Plant # 125 and WT samples. A 20 nucleotide gRNA sequence and PAM sequences denote the software output. Knockout score and InDel percentage received as output post ICE analysis are also exhibited.\u003c/p\u003e","description":"","filename":"Fig.S5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3914711/v1/7a21769cb72ba88af8f09af4.jpg"},{"id":50532656,"identity":"c014bd60-29e4-4291-a00d-d3b2453c281d","added_by":"auto","created_at":"2024-02-02 03:16:15","extension":"jpg","order_by":6,"title":"","display":"","copyAsset":false,"role":"supplement","size":6325479,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFig. S6\u003c/strong\u003e Amino acid sequence alignment of the WT- control and edited groundnut plant# 110; amino acid change marked with a red box. The phytoene desaturase domain (113-563 amino acids) is marked in a black rectangular box.\u003c/p\u003e","description":"","filename":"Fig.S6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3914711/v1/bd1dbb437d4a4a6cea747e51.jpg"},{"id":50532651,"identity":"c2c2b9a5-a349-4888-ac1e-3adf4427d868","added_by":"auto","created_at":"2024-02-02 03:16:15","extension":"docx","order_by":7,"title":"","display":"","copyAsset":false,"role":"supplement","size":15473,"visible":true,"origin":"","legend":"","description":"","filename":"TableS1.docx","url":"https://assets-eu.researchsquare.com/files/rs-3914711/v1/cdac19e18e292dd81fec042c.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"CRISPR/Cas9-mediated mutagenesis of Phytoene desaturase in pigeonpea and groundnut","fulltext":[{"header":"Introduction","content":"\u003cp\u003eAs the human population is anticipated to rise, there is a need for agricultural production to expand to fulfill growing requirements for food, feed, and fiber, while ensuring minimal adverse effects on the environment (Hickey et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Janssens et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Agricultural crop production faces additional challenges due to climate change scenarios, including elevated global mean temperatures, shifts in atmospheric CO\u003csub\u003e2\u003c/sub\u003e concentration, and a heightened occurrence of extreme weather events with increased frequency and intensity (Kulshreshtha and Wheaton 2018). At the same time, these alterations will impact the proliferation and intensity of both biotic and abiotic stresses, presenting a challenge to food security. Pigeonpea (\u003cem\u003eCajanus cajan\u003c/em\u003e) and groundnut (\u003cem\u003eArachis hypogaea\u003c/em\u003e), prominent dryland legume crops in India and other arid regions, are primarily cultivated by resource-limited farmers in areas prone to drought and depleted soils. These crops serve as a crucial source of high-value protein, playing a vital nutritional role, particularly for vegetarian and economically disadvantaged populations in Asia and Eastern Africa (Ojiewo et al. 2020; Singh et al. 2022). Both crops contribute to environmental sustainability by enhancing soil productivity through nitrogen fixation (M\u0026oacute;ring et al. 2021). Nevertheless, the yield of these legumes has stagnated for numerous decades due to various biotic and abiotic stresses. To address this challenge, the integration of novel breeding technologies (NBTs), such as gene editing, aims to develop crops that are resilient to evolving environmental conditions.\u003c/p\u003e \u003cp\u003eThe clustered regularly interspaced short palindromic repeat (CRISPR)/CRISPR-associated nuclease 9 (Cas9) system has been modified to serve as a potent gene editing technology, enabling precise alterations at specific sites in a diverse array of plant species. This technology is employed for both validating gene function and enhancing crops by introducing desired phenotype for traits of interest (Ma et al. 2015). This mechanism induces DNA double-strand breaks (DSBs) at predetermined locations in the genome, guided by a specific RNA called guide RNA (gRNA) that binds with the Cas9 endonuclease. The inherent nonhomologous end-joining (NHEJ) pathway typically repairs these DSBs, and this process is error-prone, often leading to the insertion or deletion of a few nucleotides at the designated target site (Jinek et al. 2012). The CRISPR/Cas9 technology has been effectively harnessed for accurate gene editing in a variety of crops, encompassing model plants like \u003cem\u003eMedicago\u003c/em\u003e (Meng et al. 2017) and \u003cem\u003eArabidopsis\u003c/em\u003e (Jiang et al. 2014), legumes including, soybean (Lu and Tian 2022), and cowpea (Che et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Ji et al. 2019), cereals including rice (Biswas et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Zhang et al. 2014), wheat (Wang et al. 2019; Zhang et al. 2021), and maize (Liu et al. 2024).\u003c/p\u003e \u003cp\u003eNumerous initiatives have been undertaken within legume breeding programs to fully leverage the capabilities of gene editing technologies for enhancement. The application of CRISPR/Cas9-mediated knockdown has been successfully illustrated in legumes like soybean, cowpea, chickpea, \u003cem\u003eMedicago truncatula\u003c/em\u003e, and \u003cem\u003eLotus japonicus\u003c/em\u003e. However, the challenge lies in the resistance to \u003cem\u003einvitro\u003c/em\u003e regeneration, hindering the widespread application of gene editing in legumes such as pigeonpea and groundnut (Ochatt et al. 2018; Pratap et al. 2018). Numerous investigators have endeavored to establish a proficient \u003cem\u003eAgrobacterium\u003c/em\u003e-mediated genetic transformation system for pigeonpea (Ghosh et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Sharma et al. 2006) and groundnut (Mehta et al. 2013; Prasad et al. 2013). However, these endeavors have been marked by a low level of transformation efficiency and reproducibility. Gene editing studies in groundnut are sparse, and the investigations primarily focus on groundnut protoplast/hairy root transformation systems (Neelakandan et al. 2022; Shu et al. 2020). Notably, there is an absence of reports on the successful application of \u003cem\u003eAgrobacterium\u003c/em\u003e-mediated CRISPR/Cas9 gene editing in pigeonpea.\u003c/p\u003e \u003cp\u003eIn the present study, we establish a stable and efficient CRISPR/Cas9-mediated mutagenesis system in pigeonpea and groundnut through \u003cem\u003eAgrobacterium\u003c/em\u003e mediated transformation. We selected pigeonpea and groundnut \u003cem\u003ephytoene desaturase (PDS)\u003c/em\u003e genes to validate gene editing methodology due to the distinctive phenotypes of the loss of function mutant (Qin et al. 2007). The alteration or knockout of the \u003cem\u003ePDS\u003c/em\u003e gene impairs carotenoid biosynthesis, leading to albino phenotype and plant growth retardation (Tian 2015), and is widely used as a marker for gene editing in plants (B\u0026aacute;nfalvi et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Hooghvorst et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Lu and Tian 2022; Naim et al. 2018; Ntui et al. 2020). One homolog of \u003cem\u003ePDS\u003c/em\u003e gene in pigeonpea and two in groundnut are present. We designed two constructs employing a single guide RNA targeting one and two homologs of \u003cem\u003ePDS\u003c/em\u003e, respectively in pigeonpea and groundnut. Subsequently, we conducted \u003cem\u003eAgrobacterium\u003c/em\u003e-mediated transformations for pigeonpea and groundnut, respectively. Among the resulting transformants from both constructs, mutations at the intended loci were introduced in T\u003csub\u003e0\u003c/sub\u003e plants for both pigeonpea and groundnut \u003cem\u003ePDS\u003c/em\u003e genes, leading to conspicuous albino phenotypes. To our knowledge, this is the first successful \u003cem\u003eAgrobacterium\u003c/em\u003e-mediated CRISPR/Cas9 gene editing system established in pigeonpea and groundnut, ushering in a new era of gene functionality and laying the groundwork for further advancements in crop improvement.\u003c/p\u003e"},{"header":"Methods","content":"\u003cp\u003e \u003cb\u003eIdentification of\u003c/b\u003e \u003cb\u003ePDS\u003c/b\u003e \u003cb\u003egene in pigeonpea and groundnut and designing Guide RNAs\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe coding sequence of \u003cem\u003eAtPDS\u003c/em\u003e (AT4G14210.1) served as the query in BLAST searches against the genomic databases of pigeonpea (\u003cem\u003eCajanus cajan\u003c/em\u003e ICPL87119 v2 genome) and groundnut (\u003cem\u003eArachis hypogaea\u003c/em\u003e Tifrunner v2 genome) within the Legume Information System (LIS) (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.legumeinfo.org/\u003c/span\u003e\u003cspan address=\"https://www.legumeinfo.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). This search aimed to identify sequences encoding \u003cem\u003ePDS\u003c/em\u003e genes. Utilizing the CHOPCHOP sgRNA (single guide) design online tool (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://chopchop.cbu.uib.no/\u003c/span\u003e\u003cspan address=\"https://chopchop.cbu.uib.no/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) (Labun et al. 2019), single guide sequences targeting one homolog in pigeonpea (\u003cem\u003eCcPDS\u003c/em\u003e) and two homologs of groundnut (\u003cem\u003eAhPDS\u003c/em\u003e) \u003cem\u003ePDS\u003c/em\u003e gene were designed separately. The selected guide sequences exhibited minimal off-target impact, as assessed by Cas-OFFinder (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.rgenome.net/cas-offinder/\u003c/span\u003e\u003cspan address=\"http://www.rgenome.net/cas-offinder/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). Subsequently, the 20-nucleotide guide sequences were used as queries for nucleotide BLAST searches provided by the National Center for Biotechnology Information (NCBI) to identify similar sequences in the pigeonpea and groundnut genomes, respectively. Guides with minimal off-target effects were retained for further analysis.\u003c/p\u003e \u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eConstruction of CRISPR/Cas9 plasmid\u003c/h2\u003e \u003cp\u003eThe plasmids pFH52 (Plasmid #128181) (Hahn et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2020\u003c/span\u003e) and pYPQ150 (Plasmid # 69301) (Lowder et al. 2015) were procured from The Addgene Repository (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.addgene.org\u003c/span\u003e\u003cspan address=\"http://www.addgene.org\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) (Kamens 2015). The promoter sequence, 2X35S, was amplified from the pFH52 vector utilizing a forward primer (FP) with \u003cem\u003eKpn\u003c/em\u003eI and a reverse primer (RP) with \u003cem\u003eBam\u003c/em\u003eHI restriction sites. Additionally, the plant codon-optimized Cas9 (pcoCas9) and Nos terminator were amplified from pYPQ150 with FP-\u003cem\u003eBam\u003c/em\u003eHI and RP-\u003cem\u003eXba\u003c/em\u003eI restriction sites (Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). These two fragments were then ligated to create a \u003cem\u003epcoCas9\u003c/em\u003e gene driven by 2X35S promoter through sequential cloning and mobilised into pCAMBIA2300 expression vector (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eA 20-nucleotide sgRNA targeting the \u003cem\u003eCcPDS/AhPDS\u003c/em\u003e gene was cloned after the MtU6 promoter, along with a SpCas9-specific conserved scaffold sequence spanning 76 nucleotides and a Poly-T terminator sequence. The MtU6 promoter was amplified by PCR from \u003cem\u003eMedicago truncatula\u003c/em\u003e genomic DNA using SbfI-MtU6-FP/MtU6-RP primers and confirmed by sequencing. An overlap PCR approach was employed to construct sgRNA driven by MtU6 promoter utilizing four primers (Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). The \u003cem\u003eSbf\u003c/em\u003eI and \u003cem\u003eHind\u003c/em\u003eIII restriction sites were subsequently employed to integrate the sgRNA into \u003cem\u003eSbf\u003c/em\u003eI- and \u003cem\u003eHind\u003c/em\u003eIII- digested pCAMBIA2300-2X35S-pcoCas9-NosT, generating the CRISPR/Cas9 binary vector for plant transformation (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003e and \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eGenetic transformation of Pigeonpea and Groundnut\u003c/h2\u003e \u003cp\u003eThe gene editing constructs were introduced into \u003cem\u003eAgrobacterium tumefaciens\u003c/em\u003e strain C58 through electroporation. The pCAMBIA2300 vector carries an \u003cem\u003eaminoglycoside phosphotransferase (Apt)\u003c/em\u003e gene, providing resistance to kanamycin in bacteria, and the \u003cem\u003eneomycin phosphotransferase (NptII)\u003c/em\u003e gene for plant kanamycin selection. \u003cem\u003eA. tumefaciens\u003c/em\u003e colonies grown on yeast extract peptone (YEP) media (Sigma-Aldrich Chemicals Pvt. Ltd, Bangalore, India), containing 50 mg/L kanamycin (Sigma-Aldrich Chemicals Pvt. Ltd, Bangalore, India) and 25 mg/L rifampicin (Sigma-Aldrich Chemicals Pvt. Ltd, Bangalore, India), were confirmed via polymerase chain reaction (PCR) using vector-specific primers (Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). A single PCR positive colony was inoculated into 5 mL YEP starter broth having 50 mg/L kanamycin and 25 mg/L rifampicin and grown overnight at 28\u0026deg;C with shaking at 200 rpm. The overnight grown starter culture was used to inoculate a 25 mL fresh YEP containing same antibiotic concentrations and allowed to grow until the OD 600 reached 0.6\u0026ndash;0.8. Before transformation, the bacterial pellet was collected by centrifugation at 5000 Xg for 10 min at room temperature. The cells were re-suspended in 25 mL of co-cultivation infection media (for pigeonpea) or half MS medium (liquid, for groundnut) and stored at 4\u0026deg;C for 2 hours.\u003c/p\u003e \u003cp\u003e \u003cb\u003ePigeonpea transformation\u003c/b\u003e: Pigeonpea transformation was done using a previous standardized protocol (Dayal et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2003\u003c/span\u003e) with slight modifications. To enhance transformation efficiency, we supplemented the \u003cem\u003eAgrobacterium\u003c/em\u003e culture with 100 \u0026micro;m acetosyringone along with 0.1% silwet L-77. We adjusted the shoot induction and elongation media by introducing MES (0.59 g/L) to ensure pH stability. Additionally, we incorporated silver nitrate (2 mg/L) into the shoot elongation and root induction media to counteract senescence caused by ethylene. Transformed plants underwent screening using varying concentrations of kanamycin selection: 100 mg/L in shoot development and 150 mg/L in shoot elongation media. Elongated shoots (\u0026gt;\u0026thinsp;3 cm) were then transferred to MS basal medium to discontinue antibiotic selection and strengthen the shoots. Subsequently, they were sub-cultured onto root induction medium composed of MS medium supplemented with 11.54 \u0026micro;M indole acetic acid (IAA). Rooted plants were transplanted into pots containing a mixture of 2 parts cocopeat and 1 part perlite. After a week of acclimatization, during which they were initially covered with a plastic bag and gradually exposed to the open environment, the plants were transferred to a glasshouse (Fig. \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003eGroundnut transformation\u003c/strong\u003e \u003cp\u003ePreviously reported transformation procedure was used with slight modifications (Sharma and Bhatnagar-Mathur 2006). The previous transformation protocol demonstrated limited shoot induction in the elite cultivar ICGV 15083. To overcome this limitation, we introduced 5 \u0026micro;M TDZ (equivalent to 1.2 mg/L) to facilitate shoot formation, replacing the previously utilized BAP. Additionally, modifications were made to the shoot elongation medium, where 2\u0026micro;M GA3 was employed instead of BAP, and to the root induction medium, which now includes 2.5 \u0026micro;M IBA along with 5 \u0026micro;M NAA, aiming to enhance regeneration and transformation efficiency. Moreover, we incorporated the inclusion of 100 \u0026micro;M acetosyringone in both the co-cultivation medium and the \u003cem\u003eAgrobacterium\u003c/em\u003e culture. Furthermore, we optimized the immersion of explants in \u003cem\u003eAgrobacterium\u003c/em\u003e culture for 8\u0026ndash;10 minutes before transfer to the co-cultivation medium to activate virulence genes, thereby augmenting the transformation efficiency. Finally, well-rooted plants were acclimatized and transferred to the glasshouse for further cultivation (Fig. \u003cspan refid=\"MOESM3\" class=\"InternalRef\"\u003eS3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eMolecular characterization of edited plants\u003c/h2\u003e \u003cp\u003eTo extract total genomic DNA, leaf samples from pigeonpea and groundnut putative transformants were collected and homogenized using liquid nitrogen. Homogenized tissue was resuspended in DNA extraction buffer made of 2% hexadecyltrimethylammonium bromide (CTAB), 100 mM Tris pH 8.0, 20 mM ethylenediaminetetraacetic acid (EDTA) pH 8.0, 1.4 M sodium chloride (NaCl), 2% polyvinylpyrrolidone (PVP)-40 (Sigma-Aldrich Chemicals Pvt. Ltd, Bangalore, India), followed by centrifugation at 5000 rpm for 10 min to settle the debris. The supernatant was incubated at 65\u0026deg;C for 1h before being mixed with 1 volume of chloroform: isoamyl alcohol (24:1) (Sigma-Aldrich Chemicals Pvt. Ltd, Bangalore, India), then centrifuged at 13000 rpm for 10 min to separate the aqueous and organic phases. The aqueous phase was mixed with 1 volume of isopropanol (Sigma-Aldrich Chemicals Pvt. Ltd, Bangalore, India) for DNA precipitation. Following centrifugation at 13000 rpm for 10 min at 4\u0026deg;C, the DNA pellet was washed with 70% ethanol. The final DNA pellet was dried in a 60\u0026deg;C oven for 10 min and resuspended in 1XTE buffer. DNA samples were quantified by fluorometry using Qubit \u0026trade; dsDNA BR Assay Kit (Life Technologies, Carlsbad, California, USA) on Qubit\u0026trade; 3 Fluorometer (Invitrogen, Life Technologies, Carlsbad, California, USA) as per the manufacturer\u0026rsquo;s instructions and assessed for purity by gel electrophoresis.\u003c/p\u003e \u003cp\u003eTo verify transformation, PCR was carried out using \u003cem\u003eCas9\u003c/em\u003e and \u003cem\u003eNpt\u003c/em\u003eII-specific primers (Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e) and Emerald Amp\u0026reg; GT PCR 2X master mix (Takara Bio Inc., San Jose, CA, USA) as per the manufacturer\u0026rsquo;s instructions. To detect putative edits, target gene fragments were amplified by PCR using gene specific primers (Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e) by PrimeSTAR GXL DNA polymerase (Takara Bio Inc., San Jose, CA, USA) and were sequenced using Sanger\u0026rsquo;s dideoxy method.. Sequences were further analyzed using Geneious R11 (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.geneious.com\u003c/span\u003e\u003cspan address=\"http://www.geneious.com\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) (Kearse et al. 2012) and the ICE v2 CRISPR analysis tool (ICE v2) from Synthego (Conant et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2022\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eIdentification of\u003c/strong\u003e \u003cstrong\u003ePDS\u003c/strong\u003e \u003cstrong\u003egene in Pigeonpea and Groundnut\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe AtPDS3 protein sequence was used to identify a homologous gene in pigeonpea on chromosome 1 (\u003cem\u003ecajca.ICPL87119.gnm2.ann1.Cc_00066.1\u003c/em\u003e; CcPDS01) and two homologous genes in groundnut on chromosome 14 (\u003cem\u003earahy.Tifrunner.gnm2.ann1.TUF7J0.1\u003c/em\u003e; AhPDS14) and 04 (\u003cem\u003earahy.Tifrunner.gnm2.ann1.M5MKEZ.1\u003c/em\u003e; AhPDS04). The protein sequences of AtPDS exhibit an 80% identity with CcPDS01, AhPDS14, and AhPDS04, indicating a conserved function in both pigeonpea and groundnut. However, AhPDS14 and AhPDS04 display a high similarity of 98% to each other. The genomic sequence of \u003cem\u003eCcPDS01\u003c/em\u003e spans 6978 bp, with 1713 bp encoding transcript for 570 amino acids. Similarly, the genomic sequences of groundnut PDS genes - \u003cem\u003eAhPDS14\u003c/em\u003e and \u003cem\u003eAhPDS04\u003c/em\u003e - are 6386 bp and 6159 bp in size, respectively, with transcripts coding for 583 and 580 amino acids. Both the pigeonpea and groundnut \u003cem\u003ePDS\u003c/em\u003e genes consist of 13 exons and 12 introns.\u003c/p\u003e\n\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e\n \u003ch2\u003eSelection of sgRNA targets and vector construction for the CRISPR/Cas9 system\u003c/h2\u003e\n \u003cp\u003eGuide RNAs (gRNAs) targeting the disruption of the \u003cem\u003ePDS\u003c/em\u003e gene were designed based on the most conserved regions within the pigeonpea and groundnut genomes, utilizing the CHOPCHOP sgRNA design online tool. In pigeonpea, a single gRNA (5\u0026prime;-GCGGCCACAGAAACCCTTGA-3\u0026prime;) was designed to target exon 1, while in groundnut, a corresponding single gRNA (5\u0026prime;-TGCCTTAAACCGATTTCTTC-3\u0026prime;) was designed to target exon 6 of both homologous genes (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e, Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e). Subsequently, these sequences were employed as queries for a BLAST search on NCBI to verify their specificity. All sgRNA target sequences exhibit minimal off-target effects.\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eTable 1. Overview of the gene editing constructs targeting \u0026nbsp;\u003cem\u003ePDS\u003c/em\u003e gene (s)\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cimg src=\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAu8AAAE0CAYAAACckt0gAAAAAXNSR0IArs4c6QAAAARnQU1BAACxjwv8YQUAAAAJcEhZcwAADsMAAA7DAcdvqGQAAABhaVRYdFNuaXBNZXRhZGF0YQAAAAAAeyJjbGlwUG9pbnRzIjpbeyJ4IjowLCJ5IjowfSx7IngiOjc1MSwieSI6MH0seyJ4Ijo3NTEsInkiOjMwOH0seyJ4IjowLCJ5IjozMDh9XX1a3hgGAABi00lEQVR4Xu29vY4Vx7u+PbyHwUYI2T4GAst24MD4ABzYRERIOPhHyN4BoRMskv0LsOTIEXhvcQCGgAAsAo7BWAghToO3r551z9zzUP2xhjUzq2fdl1SrV3d9PfVUddXT1dXdF9537IUQQgghhBC2nv9vtQ0hhBBCCCFsOTHeQwghhBBCWAgx3kMIIYQQQlgIMd5DCCGEEEJYCDHeQwghhBBCWAgx3kMIIYQQQlgIMd5DCCGEEEJYCDHeQwghhBBCWAgx3kMIIYQQQlgIMd5DCCGEEEJYCDHeQwghhBBCWAgx3kMIIYQQQlgIMd5DCCGEEEJYCDHeQwghhBBCWAgx3kMIIYQQQlgIMd5DCCGEEEJYCDHeQwghhBBCWAgx3kMIIYQQQlgIMd5DCCGEEEJYCDHeQwghhBBCWAgx3kMIIYQQQlgIF953rP6fCRcuXFj9CyGEEEII4XyyKZN7K4z3MxYhnFPStkLYTnbx3Ex/FMJus8k+IMtmQgghhBBCWAgx3kMIIYQQQlgIizDev/322/52w5DDP4SP5ddff/2gbf34448r37Pj77//7mX57LPP+v1///33AznltkHeEDZF+v71oZ9o6Qrn/YP6FRz/HfWFrf5EdRLd7za1ffBf7UlObeTPP/88sj+Et0kc8URNQ/u17e4KmXnfEDQob2hhWTDg/fzzz6u9Q3777bcDo3kJLE3eEJbOkvp++gcM88ovv/yy+jcOEwePHz/u/7Nlfw7bpiP6yF01+jaBjPbr16/3W3jy5Mnq3/GgPr788svV3j4//PDDYLv5/vvv++2NGzf67a6xCOP9r7/+6hf5427dutUfu3v37sEx/M8SOiZ1aGF50BG9evWq/89W7erhw4cHx1oD3jYgWXFehm2VN4R1SN9/fJ4/f36gJxx6g99//73fOpRhjnH96NGjfqu60P4Y26YjDHf1leF4cBH46aef7n3xxRerI/vjDnib0/mJoU37++STT/r9Fg8ePOi3tC1vr8+ePeu3rTQIS747eSHWKelMWVeErrL6OF0lro7s03VU/XF3HqZraP0xxcd1ld77aV/Hqj94mGvXrq2Ovu//ux/5DOHhhvKRnLialo53RuXBfxxld6pMu8rcsktPXg+C9oJzqv7ZF/KjDryt1bqs7bW2Z0dhlYa3nYrnH8K20mq7Uyy57wfCTNEqi/cv4Pnip32FU3nruKDySc5WXgL9sV/7PuIqfo3TYkhH6qfceTl1zOsMvI5wvi9qGC+DdCPn9emo/O68TUAtW8VlJ+yceqphYCwfpVH16fGhlqeeQ9W/th1HebleW20JuQX+qvu5SCbJ2kqjJcs2g6ybYnMpHZN1C6MTojY+jrWcGmE9adUIWsf1n5O1dgRyapj1xKqNS0zlA+4v5+m1/OVEzaf67xJzyq1OZ6jeKrWTk1NnWTtRd+pghsLUNi2qjN4mK2N+IWwLx2mfS+37BWHGGMoPhx9IB+4kt/og7av8Qn2X5Pd+RX7qo+o+KHwNo3xbtHQ0p5z1uGSux1VWHEjG6iSzh8cpXWeofyauqOnIiVY9yY3Vk/RVw1QnhvxxY20GpzyG/Gv7EQrv56HaQnXS+7qoXGzH8Da8BJB1U5ybNe9dWY647iToj799+7bfiq4x9f7//PNPf5uwa+D9ccW7efNmvy90W7BrnEfS5jYgt2q4LaS8upOhT7cyJx/dspR8OP4Tr97OlCxKE1h7iDwcQx6lQVjIMopx6jpxf2jGH5LRLWf07HVw586dfusojOpA60P/+OOPftt1PAf1BK019yGEcXQOyW1T378O796967edIXKQnxxLBeg/WK4A6jvYqhwV1g97H6b+pdVX/fTTT32+pD+0jl3LGrTO+bvvvuu36s9atHREWWr5yBukAyHdk47GMNfPN9980x8TkpG8PG2Vi/yVF7rTsg7nzZs3/dbHYpzqd844q3qSHEN1NMY647nLKqTLVpsBtQP5K778h56DUPu4fPlyv4XXr1/3W9WX0lDa6yJ9sUUPQ1y8eLHfHke/S+fcPbCKkUVHNbTGzh+w8JNU0Ik5T58+7bd0fOoElXYdHIaYk4/WddHYlY8avuILdZp0gt7pvXjxov+PfEpDHbZOrtBmzsBLp6VOAr2jX+m/dh50uFqb9/nnn/db5aH244OrGBo4QwjjbGPfvw6sH6Y/oS9Rfj6p4Ma91hqzlXE8BfEwrHydsiNjrfWGGdB4pH5LfR86OW6/RflIa8j40lgHGsP8Iuv27durf/vooUkedJQOlXa9MBhCefpY7DqZGmelC/SjhyoZC+bWk1hnPPe2rXxoozJ8a5uhHTAeuWGsPPTQ6NSYeOnSpdW/vb379+/3aeocIg+1j1bbqG+mqRcjpKV6qw+xOhpjd5FzY7yrEXAlTcWve6Ich2pUnxSbMLxjFLZRh0ZH4R0ZbQjHzMlcNqHjuQPMEC9fvuy3p9H+Q9gGzlPfj8FEGWT4yJCvd1/noJlWzdbWPq6CoYnuMBbrQ61T+c95cFXQT1ImDPda3pNk7gWX7gzIeAQZ8lN9/GmNs6eRj5d/Cl2EjbWvKWoaPjl5WnpdEufCeNdVm8+iaIZkDN320YwC1CtAXdnpdpC7OlMzxJx8rly50m/99pccV7VzUD50wDWN1u3BsI/aDVf4tZPwW8x+lU/HVnU8dxZAHZIGV3dDs2JzYcYJvv76634bwnlm2/v+4yKjVoY3d2Z9iYAMHLZT5UVWpTM2iwkaa6rh1lrqh1M4zQjP4d69e/1WM+j0uXMMRY2RfmGhtITuVPiyGTnNgs+F+ldcXRAyOTI1zqrdUCZd9IzVky4qaphNjOetySn0jZGMU5uCmgduDL8Y0vIlLVvSsjTGuta4qJl6Odqo0tAdIOSdahc7bdR3ijtT1hWh66T7OF1ntDoy/pAgftA1on6/63z6faHjcr7fNZxZD9d0J9fBMeK3mMoH3N+dZNa+woPSUZiaj5z0sEtQ7rkM6U1O+qPdtfxpA6C2qH2gbjhGHjDUXuVfqfHH2iRuKJ0QtgXa6boste8XhBlD53nLqSzSgTvJPVVeyaq+qfYrwvs48pMehsqndJV/pepoqA/FSWbtS8/Cw+JUVhyM6VB4HOnCGZNP8nga7sbqSW6dMFP5yN/rutbHUD46j4b8Od5C+lF8GNK7ZJjD0Pk2JAco31Y9biPIuik2l9IxWbcwamjecMAbIP9Vqar4ViMXiofzfdFqVN6peMMlnyE8vu87Hgbn8uqY590qVz3h1zmBzhOUfR3Qk+sN1+o4aufuHYfS8GNqH942al5j7abGH+rkcC15Q9g2aKvroj5+iX0/EGYKT0+u9t8yznCE177KN1ReLws6VF4tuRUOHaq/q3oXrT7P8TIpLy8D6SoN5SE/1zV4GUhL+14Gz0/O8b53SGaV2V2VRXqWq/VU26XK7OHkPxZmLB/5eV230qjlqXXpsuLYH0L6rWGq3qs+5uD1i6tyVshjTrhtAVk3xeZSOiabLMy6eGNT4/djm+K08glHiW5D2E7O+tw8iz55E+lKPjdWdEzlOK/IUMPJkNYxN963lZZRvVS2Ree66FhK20fWTXHu3jazDr6+WE/Qa01g1yj67SY4rXxCCCFMs9Q+uTMA+62/AQc6Q+qjn5fZdq5evbr6t19eyq5nfOprPsPJ0l08HllHf1bwzArnxHlv+y122ngHGmCFxjD3IdG5nFY+IYQQpllin8yDihiulanX+p0HePDx+er94Q4XWyf9AHE4ivStB1TPAj0M3PpuwS5wgen31f8zgavnMxYhnFPStkLYTnbx3Ex/FMJus8k+YOdn3kMIIYQQQlgKMd5DCCGEEEJYCDHeQwghLJJNfNkxhBCWRoz3EEII5wa+lPrjjz+u9kII4fwR4z2EEMIi4S0rPACmV8VhuK/zqf4QQlgiMd5DCCFsJSyHYVmMO70iDnzZjBvuvP+Z4//++2+/z0y8p6HjIYSwRGK8hxBC2DowsPXhJIcP86xjfH/77be9Me/wrvQY8CGEpRLjPYQQwtbx7t27fouhzdIYd3ywp8KHY/jyI/DhHsLB48ePj6Tx8OHD/vi9e/f6bQghLI0Y7yGEELYO1rFjdPMlVC13YZnMOrx8+bLfehr6pH5m3kMISyXGewghhK1ED6RixIOMcF/3flxIO4QQlkiM9xBCCFuNjHgti3n27Fm/neLSpUv9trX0JsZ7CGGpxHgPIYSwdbTeNKO3yXz11Vf9dgi9bebixYt7165dO7JsRo6304QQwhKJ8R5CCGHrYM378+fPV3uH8MDp999/v9o7Cg+tVv7666/egHeYwW+FDSGEJXDhPfcPzxBmQM5YhHBOSdsKYTvZxXMz/VEIu80m+4DMvIcQQgghhLAQtmLmPYQQQgghhPPMpkzuLJsJ55a0rRC2k108N9MfhbDbbLIPyLKZEEIIIYQQFkKM9xBCCCGEEBZCjPcQQgghhBAWQoz3EEIIIYQQFkKM9xBCCCGEEBZCjPcQQgghhBAWQoz3EEIIIYQQFkKM9xBCCCGEEBZCjPcQQgghhBAWQoz3EEIIIYQQFkKM9xBCCCGEEBZCjPcQQgghhBAWQoz3EEIIIYQQFkKM9xBCCCGEEBZCjPcQQgghhBAWQoz3EEIIIYQQFsKF9x2r/2fChQsXVv9CCCGEEEI4n2zK5N4K4/2MRQjnlLStELaTXTw30x+FcJKc9UTw9Lm9yT4gy2ZCCCGEEEJYCDHeQwghhBBCWAiLM97//PPP/taDu7///nvlO82PP/74QXw50hZD4X799ddViKN89tlnR8J9++23K5/lQBlauqQsrhv4999/j5RXjuPHAX0vUWchhJOj9qvVbQPIcdx+bwj64VrWof6x1RfX/lqsky609D9U1jpmErfFOvJ62DEog6c3ViaFHcoTWjIOlQewCwiDDsaYkzcozyFdw1x9g4fDDdkxyFXDugzVr7r//u//bh53V8vesrU+tj0QnSAjzaCH6iKcu6GqwTSqYafSP1HenzHriHDt2rU+/KtXr1ZH3r9//vx5f+zhw4erI+N8+umn72/durXaO4T4nvZQOMLU461jyEoaSwH57969u9o7RDqv+pXet5ltly+EXWXuuUkf2uqXtgXKgfMxaYi5ZaYvbqWpvthBNzUs/zlW9bZOuurfaxoaJ+t4wLE6Bio/Zx15gWNDYxAMxR0afxUef1wLyYgOnCH9AXm19OjMyRsoJ+mNtX3SmaNv1VctSys+MlWdDcUH+Y2B/K16EMSvupCeqnww3h6QZd9du7bvCPfq1eFxd/t5Hz1G2P28jx5nv5WW8tjfn2Y/7GbYXErHZG5hdEK1mGogDml8WOn7kIb8hsKpU9MJrP0WY3ltEzpZHB2Tq+XQSbTN1DKFELaDuefmmAFzltAfev+o8WCMOWWu40vF9TEWVvLJb510YUzvHMdfMA60DC0gnPzWkVdIDtJojTdjcpJe9ZPsQ7Kwz3H8W7TK6mmxHRrzp/IWykPhK3P1PVYWySC/obyA9Fp+qrMxptJt1SkM6Yi0SLMdF1mIs39OPn++14WnDewfd4cxXg13OeLt593er+4wj2mm9LUOm0vpmMwpzNRJUVGjklMDHWvMQMMgbm3YFYWDqbBLQCeDwz7HgfJV3eNf48yBE4705HRy1pOxhjuOfokXQtg+5p6bGqzHIExNj32OC/oXjsl5f0Jfo/5H/lN9G2mThvr/amS0INwUkmUOtc9sIbnWSVfj5xymxlQY6uNbuB5dty09z9F99fP21Gpbc2SseJyx+FN5A/JKn/5ftI5VVGbSJ58xFHZIHqFwzpx2MiTDnHJUvL79/yHIsm9IY1DX/3Ju3PvxIYeRX2fi226aKX2tw+ZSOiZzCrNOZ0Jj8bC+r3RaDdEbw1R+taFzwhJ+6kTZVpCbMg9B2ao/cXD4yU2diHRq3rG5nsc6wKn6GOI4cUIIJ8/cc7P2tUMQzvsP9kXdV3+i/op4vi/DYqxPFG0jos2cMiPnnHxhrm5gnXRJ0/vfMdbpm9eRF+o4QHyOCdLi2FxqXRG/yk5+68gIpCHdKg+1JTEnb6hlQh7XwTr6Jp7rawi19yrzFHNkGaoj6WMdptpDVxO989l2GeoPH+7v4zSTrv0pR3oef9hNs26Zx1jEA6vPnj3b6ypttTcMDzP8/PPPe13DWB3Z2/vpp5/6LQ/qvHnzZq+r8L1PPvmkPyaI9+WXX+51Da33Iz/CjXH58uXVv729+/fv73UnQO/0MMXYgybbBHIi96VLl1ZH5kGcb7755qDldidyr8Ohh4fJ5/Hjx72uxPfff9/HndKVwoUQdg/6dPWr7vyhuz/++KPvX3gg8Lfffuv3gb7F94H+pBv093755ZfVkb1+fPniiy/6/4wB7DNenDb0q5X60OjYw5hDrJPu69ev+62jBzLdnfQYR73duHFjtbe3d/Pmzf7YcXnw4EFfrxr/v/vuu37rD0f+888/q3+H6CFTOX8wVHFpU0AbwnYgL2dO3vD777/35RSUn3Z90ro+bd6+fbv6d0jrYWrXz5z2gPlBU1+pt9M35zb9w/4+NLJuPoyqrBunTtcGjoY9iwdXz9WrIh89etSfOOqEBYYfx54+fdp3YrWBEAeDX4Y+JwqGaQv8SOPq1aurI/twUsqQJT3c0BPT28jFixdX/+ZBOashTudUOy3x8uXLfqvOy6nHbt++3XdYqp8l6TGEsFmYVFHf6k79NdC/E45+g63GgHfv3vXb2r9duXLliKHW6pdaRuxJw7hRQU6VmYsOMfZ2kco66aKbCrpWWJ8cW2fSZx15q1EM1eD1CbQ5VOOPOmfM8gu7lox//fXXQdlpWw5xXXfQMirn5I3xim2hcoLKj20D6+i71aZbzA23SVrl4JyVnnHOnPYAmB8Y614k1N51C53ttr/fUiHdBVnKOY1Tpzt3DsOW6j81FmG8tzoTRwYene1YB0FnNTQQuMHPADCUJyeRrqB5xVHr1VDkwwntJ+YuoE6AupDhjVt3poh0VC/o+ocffujToXOrr5UaeuVVCGG3YHLGt0uE8Ys7v3OgnxwrK2mpf1wnXYxixsA56KJo6I6rxgJYR16Nnd7X6wJEfhiAGLtDs9KkJXtABp7GEjnKiVMaUzI6xCEuhrmnyZ0iUJ5z89bEF+X0cMCMPKyjb2yYJ0+e9P9bMC7LfiHPFy9e9P8ryEeaQ3keh6lyVOa0B+CaqVNp53/oOrX3rK5/urz3t3OLQxOaeeqcKosw3j///PMjjdyh8WHg+RXZEJzoU1fryoM8K/hxYt65c6ffnzo5ZMwuAc1QzYETjpOn1gf76IS68AsjZi50pd2qwzE060Ed07kw2+9p++xbCGE3wWhhjGBWmK0MJhkJtX+bmug5KxhbMAbn9JPXr18fHBfpoxnvNI6tky79N4bRnIkRxjj65qE7rhhW+MNcefFXXXpfj9PdFcIw4YacmpWuYPDqDjpyMKFW0yNPUBq66zvHqNSd/pomjuMyKufmTf2w/LSG4xhhkWkdfTMzrXgV6firr77q97lboAuEiuTzCc6PhXKgE1+6NsTc9rA65bvjHzpUouJhljFbPiPrHsw9Lgq6LLaLTgFnylwRugb5Qdiu8o8c0wMUXYNdHdlPn3Bdxff/2Y7RSkNwvGssq719lL6jNKby2ha6jqaXeQjKUv2JQ50I9EK4MQjvcbxO0KH8ajjqoiXDFFPyhBDOhrnnJv1M7XMr6h8UTn2R+vChcUL9M31N7cNbx1qoD2uNFxWXYQzJX8cPdMFx7wdVNs9fMlX510lXOh1Ko9U/t3TIcZdtjrxskamF8lJdK672hcoEClPLLZDT81P7qOONyqO8WvkK6am2tYryVvgh8JN+1tG30vX8FZ/wDnJUvXs5KirbGMSvaTqtPFVfSntue+A6qnGN1DuuiQjn9j/h67UX/od5HzoWbNT4OOJzfP+aa5r9dDfD5lI6JusUhkokvFxtfKDGJqdGN6ehQY3vbggalocba6zbCGVu6VJQptbJW8s9B3UwcupUqFuXoabdyn8K4oUQto+552btB6rTQF/7L/Uzoo4dbswQtmUI1WMtlL8bTEO4PFPIKHFXyyjc2JEb6i/XSRekR3dDZa1hh8bBKXnZZ0wagnxq2rWdeJmoxyFZQLaBtwnw9HCehuIM6cL1PCdv3Fh7U/t15uq7VedD+m3ZP0NllOxjkN5Y+aGV57rt4b/+67/6cI3J+QOHfzXuZZS7a9z86N2r1Ztr3F078q74aYizKS7w0yV4ZrD84oxF2Hm45dSdYOeuHtK2QthOdvHcTH8Uwkmyv9b/7Jg+tzfZB5yrt82E46H1Z3n4M4QQQghhu8nMeziAunj+/PlGH0w5S9K2QthOdvHcTH8UwkmyWzPvMd7DuSVtK4TtJMZ7CGHX2GQfkGUzIYQQQgghLIQY7yGEEEIIISyEc2G8+5fZjgNvW5nzUYZtwr+OdhrooychhBBCCOHs2PmZd70mMQzDhcLcT2vvKujopN7Ww0Va62uQrJ9zVy/mkKeGkXNZFW4M0vb4fjGHbO7nrgVpjekKv1oWzlNPdxsvJqu+t21CgHqaI1PVNW6svkIIIZwuWTYTwgb466+/9n766afV3mbBmNJnvgHDFYPqLl+YeH/4FYknT570FxHi6dOn/aeyPQyONwr9/PPPB4Ycn4on3BAY0qTt8X/44YeD+P/888+R9F+tPvv98OHDfusgH58B12fbK+SFbPpsN+gCm/SUvue/DWDcIjeySUdffvnl1shIe0G2qTdJUQ7XtRxlqxdUIYQQzoiuYz5T5ohAGH3NS86/hsYXvOpXuvRFLsXzr4Txn2P/+7//24wDfpz0KxzzMA77VV72nSpv9a/oC2s4viiG8y+y1fy8LFDldX2gS/fDKT756Jj0IH07fkyyKZ7Kpn05wgnViZzyEtXf4w5BuPMA5ZAOpYdWe5Gfzo1WPQn0Jz/CeVuq4F/zax0TyFDzrW2sUuuXfYFstb45NibzadPStc6DswSZpNOpc0Z15H2rkJ/Xy8dAWrvGLpY5hHDIJvuAM+9N5hSGMDgNKhgNvs/A6fsaaNzfB1b+cwyqwQPse3gGPYUH/vugLHk0sPEfJ6q/BlSHfc/TIS/PX/ElQ00fXMZqREyVX+krvRqfuFVWP0b4ljweR3UkA9D/g+cpGd0fP5VhCOKsA+HlvLygMsm5LPx3WVS2VlhwP5zrqaK0VD/IgZsD8WregjSoj5ZuK14XQNghuQlX5VN4IM9abyoj6XlYQfgqXysfR+ngiK9yslV+oDDyE+wTjrjyB+TXvrfnFlVvFfyUVk0P+V1uOTGnDK6jKVmA/KbCiCrXlC4qxNk1drHMIYRDNtkHnHlvMqcwrcHBB6PWoMMxDfg+iAH/lZ4GIRlHHCduhTCkp0G14mm25PU8/L8YShda4b3MXlbhg/vYwO2DvVBc+dX45FfL58cIj3Na+ZCH5Pb/FfJuyd/Si6PyT6E2oPzrfi1/1Y/LRxz3q/ueLgy1N6H4osYfQjK29KPy4VfL0kLh5Vp1AXPSGmuLgF9tO632zbEaTlSda1961j5OuFwqh6dBXPbVxpXGEPJv6R9qOaVjhScf9r1t8L/m7zKM6ZZwxBmi5j+G9KOwdX8OLveusItlDiEcssk+YDFr3i9fvrz6t8/XX3/dr4UVV65cWf075M2bN/32+vXre48fP+7D4/g/tOaW9b+thwO7gbNPD9cNdEce5sKRJnFFlRfevn17IDPrYT0+a3hJt6I1sxcvXuy3wmUkHvE9PdIH8rtz506/zlh+vg73k08+Wf07fABScd+9e9dvj4OnC9pnzbPyAdVRZ5QcKYNDGVx+D4NOPxbW8nZGz97333/f7yMr+3pIF/3dv3+//w+qC+mH9eBqf5ShM5IOykuatJ2XL1/2eu/OuYN8gHbSqneBDMQH1dvVq1f77RjSS2uNM+lRPvxevHjRH6v1JciT8JQJ2XHUResBxl9++aVPdygt4Dzx9ewVdMm57bDeH70K6gudDeUzVAc6Z1SvlKWFdFfzoGz+XIPqpYLOkIE2PbTGnD6J5ySE8lHePK9A+jxP0GKqDM6cdkP7hDlfV75x48aRsrHtLhwO2lIIIYSTZSceWGVwYSB89OhR7/g/Z5AagoFKhow7N/CmwDBopXFcnj9/3kwPo4Cyap+y68JBFxIyhhmQCUNam0ZGO0gWB6OIYzJkCesXKJKtOjeEj4Mu5jCmHOpS9Yn+pCOcjDYZ8cjMxaDegFJlwgDjGOlgSHlaGHlKrwXGrD+sOhcZd56XHIatyqaHWoeQQe5loi5+//331d4+lAs93r59e3XkQ9TeLl261G9boMt64YusyCj5daHUuggYqgPaki4KkIMyOdSR0kV35CeDmvDI5W2EMK2LfC5qOL/Q0dgDzLQF4nu9gHSDPDdv3uz/C9fNVBkcXRD4hchxoZ6R47vvvlsd2eckH9gOIYRwlMUY75qhFRgd6wxGDITEwdVB0WHwa812aeDEYaQcF8msma4pdJFRZ8FdRoy/ubNexMPoJQ4y6O0SHNPgOzWb3TJa0M8QMuwIo9lGGXIV9IMshMURjmPU20kgvdY7GwL9YFj5zDOGGTpDLs1qUk+00TFDnAsYDDvKpbQwEseMc8LKSB2SUTAjrbfNyLhTPu7csKU91JluZ2qmXDx48KDPb+ycnJrdlS5bM8S0G8kvA7YVbqgOKIfuttUyyTiXP/uuk1YbUbt09KYcLn7HDFm9LYh+SGWifQG6qfJA1c1UGRxdjIwxdkEFtCvKt8kLgRBCCMdjMcY7gyIDFDD4MXiNzfJVmCkijg/iLRh0GQQZqAQDFwYBRg+O/zKSALkYjFtLCVpg/DHjqvIA6bWMYsAo0lIWIB9kFMyOoh8N8ID8ms0jXS8P4YjPgI0h5Gkhky9RaMHA7TOvU+Wuy0zADVbpT7OmwB0SIC/qmXrzfGQAeZlPAspJfbnBy4WE6oqLpjGDXVBGyoBh54YPx1qzpaCyybAiHnlJNw5hWc6iGfWhWVgHmah7GcNzofz1goO8692LCob1mBGJYUj5XD/Ucz0vWMY0dKHQKovaFe1Q55wb/mqXuqhAd55OSy7CuPHM+YsO0OfQxYn4448/evndwMfAVjuq8oDLMKcMDuHHLtBA8fwcFByjnapthRBCOGPenzFzRCBMN9j1W7lukFz5Hn2QSwwdw1U6g+IgD+F5teJwzMM8tIfB6j7UY8jm8ZFhDC8/YXEuL2l7elVm98P5w2Uqvxy6ZSv9edrCy0849hW+yga1vKSpcgDyuD/OkUzuvA20qGkMQTjJDtI1uIwgP5WPrf6rDK5b9KL4NR/psLYVIZ05qguPo3x1TLoaSlcorTE9UjZvS2MyTYEepKsW+LmuQWWRTgkzllctu3SjMrRkpUzyr/lBlauGkU48zhhDOlUeLo9wGabKUCGs9DFGqxzKS8eqfgG5hvIeosq/C+ximUMIh2yyDzjz3mROYepgcVwYZBigwm4w90SRQSLXMtTkZESxBYwWb1MyduTG/LSvtu3pghtsDoaUp4NDTiF/P9ZCxlrLVTncrzIkZ4W4Y+dx1aVwvVUjsVVW1w/hXT7Sr7Lir/IqrkN4l6uGIQ/l505pErfK7eFI32V0eYTLMFUGZ6gtzNG1XMX1i2vlO0Ur3fPOLpY5hHDIJvuAC/x0CZ4ZLH2YEoEw3aDywUNo68Ct427A6m9rt263h/PHnLb1MahNdcbM5FKJcHaw7Ib15Xmgcns46XNzG9nFMocQDtlkH7ATb5vRmvW7d+/GcA8bY53X64XTgXPdn+9gvTYX7DHcQwghnBcWMfMewnE4qbalGXf42DtCYbN43Yjcbds+MvMeQtg1NtkHxHgP55a0rRC2kxjvIYRdY5N9wE4smwkhhBBCCOE8sCjjnauWit5n3nL+zuK6/7Fwe37qHeP4E27bQA/o42PYpC5DCCGEEMI8FmO8YwjfunX0c+Di2rVr/a0Id7wBhI8NTRnYx6G1rrZCvv5hpfMEF0x8aGYX4c0lrYtD4ReT/uCk0Bdbcf6hL0G7kT+uXvyx7/7rtG9kP4nzIYQQQginx2KMdz6/Pucz7YI3gGDUEy+ETYCxrE/a8xBkvTjEGMe41gXkkydPjnwVFmOeL7bKX8cEFwNc8HHhiT9vR/IvmZIXF408JIs/27kXiMiOzHkzTgghhLBwOiPgTJkrQme0ND86wwdC6gdLBMf1ARHy4QMkgvQ4Jse+4OMl7LOt/sjg8VofOqkfMfmf//mffuv5g/IA+Xs80nEoy5i/IE2VXWFdR8rHy4cT8nOUXpVBTMlWy+bp839I36LqfajOHcJtCspX85Q+QOVzOKZyqE14G9YxwX/Xi8qsOKSl/AT+Q+0AXKdzdBbCaUB73DV2scwhhEM22QcsYuZdSwfWed0bs5iPHz/eu379+urIIcyQMqPZlb93nXHUO58lZR8UBpglRQb5dUZT8/3RzG7iB4T9f//v//VLfnypCbOo+H333XerI3v9TC7xyK8z/PpZVc3skjczuS4z/kNrzym7zwL/888/HyzTePr06YF/Z9gd+HcGXz9DLEhHurx//35fFsITD6psVXZkpGzIrDCk77PO0qn8Qf7k3xmuBzPOOOqBZSCnAfn/9ttvezdu3Fgd+ZA7d+4MLuuCX375pdfZUBtWPXp7IqzKqvZy+/btle8++A/NpqM/1fFY3iGEEEJYEN3AfqbMEYHZQ5+RdJiJJI2W8xlJ9pkJhc4I6reOZn5Bs5UOxzRzSfyafgU/wigv8vY0PT3Ar5YRf8qn/KrcNQ3Rkt/lkSyeHseGZondD5BpShcehrjSvVAe0JLXy0ZauEorX6emeVxq3YlaP1UWyiC94V914OmSlhzHcMQX5ENabOXf0skQhK/5h3BW0B53jV0scwjhkE32AYuYeWf28PPPP1/tfUhn8KCRD9zQjKRmIJmZ1IN/nQG29/r16/44dIbS6t8hzF4fF33IRzOszDx//fXX/X9x+fLl1b998GfW9927d/0+Mkle3M8//zwoU5VfulBaUGdi0QEQlviPHj3q97lj4GuvHaV38eLFfiuuXLlyIBvpMvPusmutNuWDMX1r5tvj4+Dt27f99iR59uxZ38YqyEc5h760Snvyh0SvXr3ab8WbN28Oys2dDRwz+LTd7kKgr1+1F+5soEee+8Cf/+jE7xYNMZR/CCGEEJbHIox3jJohQ/w4yGj3pR4t43Eu/gYSnIylyq3V0hktgfAlM3OQrO4+5oJiDB7M5AIDw1lLZj4GjNGW/HOXcty9e7cZ/zS+booOqpwcow65qHQj3KF9cQGmC4yaBhelXBTpAoYyqp2zpb1w4QDkxb7KS1qEJ40phvIPIYQQwvLYeuMdQ7c163lcNIuLMemGL8bRcSEdNyiHLjQwgDGEX7x40VyDjBHoYJgRRrPaQxcFLWp5FLfOkA/BhQVpMPuOYTpUJqXnM/qgWWcgPmU+LuhgjpF6kjDD7tTZ9rr+3o17aBn3tAV/g9LY3SVY521LztCdgxBCCCEsj6033nnV49iDgusig9mXW7Tet30SYOhhxLEcoi6ZAY5rFpblEhh3PKCIzMy61tcCYjCOye4PhKJD0qgXDEMQDoMPmYaWzEBLNmTnAoklIMDDmqTjFx+6+zEHdIAufIkIeYzd5dg0vqQKKBsz36LeAbl3716vPxn39WKKstAWmEkfqhN0KIO9Zfy3ll61oE3NCRdCCCGEBfD+jJkSoTNajjxYWekMx4MHG8cgHz2wpwcF5XgwkHTIC9jXf1GPkSdxiTcE4ZW+IDzHapmUFlu5Gqb6D+UtWSVjDesPSorWMdLhWH0Qk32lKxmrbDVO1bnrco6+ycfj48baBRBmE1TdUNaWbCqzwrt87HMcpD/XUU2Tuqs6qjL4/hiedwjbwNy2e57YxTKHEA7ZZB9w5r3JrnVoGGGti41NGlgtY/g4IM8m0jkrNtm2ZDzjWjrxCxpcvbCoFx/14gb8AqjVRsZk4Fir/UiuqQudEE4T2uSusYtlDiEcssk+4AI/XYJnBksfzliEU4WlLiwjqQ9aoofO+NrIA5gsyWBJxcc+zMqSHJZbtN5lvwR2rW2FsBR28dxMfxTCbrPJPmARb5s5D2BQU3EY76fxhpSPQevJMf6XariHEEIIIZxHMvMezi1TbQv/MT799NOPvnsRQviQXez3M9aFsNtssg+I8R7OLWlbIWwnMd5DCLvGJvuAxS6bQQn6+uRpcJp5rQuyndbrLkMIIYQQwtmRNe8z4EJhm9G7wud8Kj+EEEIIISyXGO/nBD5kxIeQQgghhBDC+WUxxjtvaWEGHNeaYdYXO+XqlzfdD+foTTDuFF9hf/jhhz4Pvlbp/lCP8d/lwR8/7ct5Oap/XQajN8DIVR3oi6jbvLwnhBBCCCF8HIsw3jHc+UQ/C/1xT58+Xfnsg6H85MmTA/9Xr171n+uXIUv8u3fvHvjfunXrwDgmDDPW8sNhBN+4caP3Zx94B/v9+/f7/3NweQB5nj9/fnAMecgXwx5X/XnLiQx0ZOTigXLJn/e4U26Hd7L/8ccfq70QQgghhHDe2HrjnRlpjFY3nP0/hu9vv/3WG8uCWWiM4yFDlvh//fVX///q1au9MexgBH8sN2/eXP3bhzy++OKL1d7e3ueff77618bfsX7nzp3+4oFyCcpGuZ3Lly/vPX78eLUXQgghhBDOG1tvvL948aJ/37bjRuy7d+/6LWF8WQmz2npHN180ZV9+GPxCafmyFcJywfAxYEgLl1d5MNMOyI8/dwM4hh93ChxkYeZdcT2+l+XSpUurfyGEEEII4Txybh5Y1XISdzLeeRuLjoEMfZDR7stWmLXfNDK6tXyHvBzuBug4xjphfd27L6lx5xcGIYQQQgjhfLP1xjvLS+osuM82X7x4sd9ihM9BRi8Qh1l5Zr05pmUtr1+/7rctWsayZv+HYO06FwzkoaUwb9++7bcVZCAcxrqWwBCXOxBTDKUZQgghhBDOB1tvvGPMYrz6LLQ/qOlLThyWnigOs9j+dhY9yIrhT3y/GMCvriWvIM+DBw9We/vLcsZgCY1fgJAfy2CEZv/9AoT0yQe07Mf99TYb582bN/3DtiGEEEII4Zzy/oyZK0JnyPZhcXfv3u23Dx8+XPm+f98Z8Af+OPZFZzgf8cNxTPhx8nn+/Hn/ny0o7c4w7vdresjh4XXMIa7HURqUBZSGHHI4U/7AsZrvLoOeQgjbxy6em+mPQthtNtkHXOCnS/DMYPb4jEU4FzCb3xnv0aWRthXCdrKL52b6oxB2m032AefmgdVd5969eyfyoG0IIYQQQtgeMvN+DmCdPu+C19t1wj5pWyFsJ5l5DyHsGpvsA2K8h3NL2lYI20mM9xDCrrHJPiDLZkIIIYQQQlgIMd5DCCGEEEJYCDHeQwghhBBCWAgx3kMIIYQQQlgIMd5DCCGEEEJYCDHeQwghhBBCWAgx3kMIIYQQQlgIMd5DCCGEEEJYCDHeQwghhBBCWAgx3kMIIYQQQlgIMd5DCCGEEEJYCDHeQwghhBBCWAgx3kMIIYQQQlgIMd5DCCGEEEJYCDHeQwghhBBCWAgx3kMIIYQQQlgIMd5DCCGEEEJYCDHeQwghhBBCWAgx3kMIIYQQQlgIMd5DCCGEEEJYCDHeQwghhBBCWAgX3nes/p8JFy5cWP0LIYQQQgjhfLIpk3srjPczFiGcU9K2QthOdvHcTH8Uwrpsw+Tu5s7ZTfYBWTYTQgghhBDCQojxHkIIIYQQwkJYpPH+448/9rcf2FY49u233672PuTXX3/t47YcfkJ5jIVxyNPDffbZZyuf5YDMf//992rvEMr2559/rvb2+ffff4+UV47jx2Gq3paIdNTS6bqQRtV1ddRR1SN1Kv+wHvWc3ibUtsZw2VtO/Sf/6/kNykN+HtfdSfZ13n5b7ixxOaTLj6G2t+pq/9jqE4b60FZ/3apzaI2RYk4/dP/+/eZxd7VP1Hg7NL4KtYexPtXLOobylBtqx+vobp06AdV5TW/MTpGr8ldHeeaEcZCjhqH80NJDdf/5z3+ax93VstZzfOxc6rx7txKpCU1D4eRGqqDL/8PwY+lvDe/PmHVFePXqVR/n2rVrvatw7O7du6u9DxmK9/z58z5dtvDpp5++v3XrVv/fIUw9TtiaJmG2QL2zQd6W3igX5Xj48OHqyD7S1zZz1vKdpI6ol1b7dKizJbXBbQL9cl4Lzo1t0aXaVasfGwL5vTyi9nuO2g997li44zBXl8g81p+fBRqDXK6632JumUF5DOlb4wvhHPXXjtquh22VAVpjWSu+QI6pdjgnDOkTptVGhdog4cb6PuQlDGHruCXwq2lIp846ulP8qifJUlE6+OPGmHMekNZQecVYGGSo+lcf0GqHyDNWXzAWRvVZ5SH8oT7Q2757+HCv89t3d+8eHnd361a/QL3T7dHj167tH/djz5/vH6tpkc++XDq2OfZl2AyblewYrFsYdQRUeKtR7Ct9uAETZ+gkIF35DaWjBqcTVCdgPWFhLK9tQmVwdEyu6oJyTXU4Z00t02kz1nF9LJRtqm3pXAnrobZfB6zWeXDaUJ/IMaf+HeK12gJpkFYL2o/aL+UeCncc5qa1jX1o67xCP1Pn+jr6G2qDUMegiutsLKzqVH5j/cVQ+5nTx0yFcTmGygxKZ6otqvxD+XIMvxbEld86ulunTgT7HJ+KC634FdJArjGGwkiWFuij5TcWR4yFGZJF7WDfj3redxjgGOcY2xjw7oeTMV4Nd7lq9I9dBBzNY3Mg36bYrGTHYJ3CqJGzbTV4P8ZWzsOwP9TAOalpbJ5PCxqj0jja0JYJZa6dGfsch1b58K9x5oCOSU9OdUNa3tHWcEN1MQbx5lLbTI2rOmeLH/+n4miQQI/yl84UV+UXpD+lV8WtOhlq/35MYfy/p+NpgPy9PrwtSC/ILH+1G+F+OC+zdMoWP/638DT4r3hAfsjnZfN0vEzyV1vzcrkeWhDGy14hT6VV00NmyS1/yQBTZQD2x87JMTyug0wuh8Nx/IG4VZ6PAfnnMCS3Q5iaXtUf5eCYnNeNyslW/ip3izkytSDdufj5WvF6mULlGsPP9bE25eetmJP+VBgvz1jZXL4hWXX+IKv/F2N6FQq/ju7G5B7C29FUm5rT5oZ04gyFmUrfdSgIT7wxhsIgA7KMsZ8nYahDnbdH/8sfJ+Pejw05za63/D50m2OqzOuwWcmOwTqF4QTRydQ6CdUgPE0/qXQyt05cT2+qYdWGzv+a75KgPGMnPeWq/sTBqdy4sQ4RvP7A9ewdZe00p+pjiLlxWm2pyoA/Tp3YnDjSj9oKYT2NGn9uOYfCcZw8hacveT1elQc8DY+jdGpnLH/iQZUNfbTqUnnq3NE52gI/z5N9j6P9Wl+SSXmMlYs0PH5FeQxB2qpnaOmBfcksGTx/9ofK4LTqbYyal1PldogjP+SS7JuAtOcwJp9DOOkOOVXXUPdVN9KH6kb70ldL96CwpMl/3BzdEG4uU3U2JFuFsHP0Rz7kN7dNCcrtbbbFWJhaTtVNlUPHRa1TUfMijNdNTWeMubqDdeoEqr7JZ0yuObIQf0qGVpixtjYG8rTqwBkKM6fd7INO6kz4vqGO0z4O/8OlLuOO9Gr8Ybc5xup4XRbzwCoPgjx+/Hjvzp07/f4nn3zSb9++fdtv4dmzZ3tdQ+k13kJhv/jii37rEK9rUL2f0hnj8uXLq397ez/99NNBnnroYuyBmm2Ch1C6k3fv0qVLqyPzIM4333yj1r3XdQh7X3755WC5yYf642Em8f333/dx9UDMEAp3Urx7965P39vFlStX9v7555/+v8rUdW4H7W4qjvSKXmgfLWhj3n5p24SfYqh9clwPIEnmixcv9tuXL1/2W2QS5E06KhN4GopDuVvnjPJAZuqowoNJ1Plff/21OrJfl6C0nz59utd14kfahUMev/32296TJ09WR/b2bt++3W/RN+BHGp6P8/r1676cqhuB3F4u14PDw2PIgB5aUNfI4PWs80ltGz3QvwyVc6oMzosXLz6otzGka7UFoTbqfZlQ3X7++ef9Ft2hA3+w7LT6up9//rmZrz/c+Mcff/Q65gFA5GQfKKPvA22Quvjll19WR/Z63astoFf237x50++3oK+jzugDcOQx9qDdJvFzWNSH/sYektwmHj161Ldl6V79A8cd6o86E9evX+/1UNse9XDjxo3V3t7ezZs3+2Mnzbp18uDBg76N6Rz+7rvv+u3Qg7C7zu+/U5ernQ6quDvdu/N7daCjUQUfPIyqKuiGhA+gO/GwOE9/21iM8c4J6R0scNJ7B0tnysnq0KF/9dVX/X8ME/ATSo6BXAMrHT6GaQsNeFevXl0dOUQdOXLSuU89Ob9N1IF9CspZDXHKTafUQgZEy+CoxzDOqDfVzUl3aLSp+pQ9BoOMWBlL3vam4qi8btRWo4uwapNqKx5+iKH2Sfv/+uuv+/81L/LxwQLcUBekrTQ4t2q5MYQVRxceLrPigAwm1xHOoZ59sK3UQQ70X4Yl56OnQRlABnTtF1p1QxhdDDgMuNTr0AUMSB4vI+c/4Cd5MDgEF3+g826qDI7XwRxUJ65DkB5afRntBygzsiAffaT6OHdDetkUdwcWpvrFEjIQjvbEVjJVPQu/0IaqG0DPQ6ALj0P7wEhUvZ0kOr8cyiK9uJE7t52s2/9vit87q6yO2cjPcYFOqVc/f6hf9ODjjcYJP6+rUbzOJNU659g6dQL1IoO2RD/nF5mnRavtnzStvnYIrs8wzFdV2aMq9mu8RhV0dYCtsu+8ClrZ050o7MA8zVaxCOOdE4/Bww06HMeYuRPsa0AHdaQanNjnJNIJ5c5PePIZalzMCMiYwOBqzXAwe8YA4h3QLqBOoBq1684CkY7qBV3/8MMPfTrMstRXX23iAolOmjy8PdAZy4hlEK/G8lQcDCZkd2o6hFUbxUD0mcAxaJ+6IHW8/de8yEeyidYx0lYanFu13H6BoAsCx+MweA0ZXpxv9fxsQZg6uGi2jQFc/z0NGaUy4Gq/4BcYgjB1Bpo6Rh/Iq7Ra0CZJDwNO5aOfkW6qPOAXV3PK4HgdzKFVjzBk1IPuiIAM4LF62gY0Fmh7klQj8DSNX9qlLvqnoG7H9EFa9KFqA2p3Fdoo/a3O2U1Ampx39c4Khi3HdV5oFp4LYg9HGJ9Vb00W6DyXn+pJaVc0dsFc3en/3DrRhYTGNTn6GtwmdTwX9KQL9gryIN+Qzo4DfS1lHYI+VXaDrs+oSqpGDtzE6qqgq4PVzgR09SPZL4JFGO8sJ2gZ3RgGmj1Rw/JOVB2ROibCTl3x6cTxwV7gR0ejpTtTDZATeilogJ4DuuZkrp0M++gXw8zriYuZuoxgLsQlDQwJOhdm+z3toSUpc6EsDAI4gYzsy5jDWHJjeU4cOv1qFNXZXcLSJhkAKJ9fQA6hdl6Nh9r+a16009qmOSZ5QYOK0kC2epFAGZUOZa5GZCvOEJyfQ8ajaPkx26ZBubX0xy+c1N68X2hd2IAbp7RvoI1NgQFRl+Cgf8k0dSE3VYaK18EcqOepfs9BH8TRzKDusIzV01lD20VmLqDY1rZc+zf0f9z+WX2Ro/RPQ0eMP3Nn+ZmtRh+tsOrH1JYYY4dmfnXObbJ8uqvm/bmc/IFJsNYkgJaxUddqs34BLUdc6QD5ydNn7B3Kr/NuHd2tUyfk0bJnSA/qkqHTgLsfQ5ONkmdsAmNdNNbpPK2gS40tXJ913Wuno6OOY6hsNfR1dbAfdkYVdPnvXwxsYO7v7OgazZkyJUJ34vVhuoa9OnJIN2AexCdc17n0/0V3ghw8FEF8whJnDKXZyo/j5OOQp/IQXQcyK69tgTKMydoqSy236mkMwnsc6Ymt11UNN7fuKlPyQCtt9iWX/L09TMXRvvsrjvxB5a/HxyBNwle8/de8lI8zFGYoDVAY/ID/Y2Vsnbvsq26pc9wYKq/SUJqK5+1GsC//lr4oo5/HNQzxa5wxSM/LofjKw+URLsNUGZxaB1PUOnHkV/PhmMvTku9jIY851LpqoXIoHFv2pSPk9/xU39JJS9dD+gfVgeuU/aHwwmWYYqzeQGWs/uiL435eqvzSB6gMVWaO1bpW/JYs+E21jVYYlc/ldJSn6spldyiv6or/LZSX2of2ieOQTs1LcvixId3NqRPFbekSkKFVDo5J/iGUxxhjYcij5q0yteLg15LVGQujuq1pc0xxuGZjvzvadPj5dZDC12u4zlBf5XV4rDP8P4iPUxqH15Wbg3Q3xWYlOwZjhaknXUUnAuE4kerJRANQXA87hhpryw2hk35O2G2EMtfO1aE8rZMX/a5b5qordWLUnctQ0x7qcMYg3hxqnatTQTa1m8pYHLVbb2vyr3Cs6n6srVY9CW//VWbybnWghCecZPB20Cq3p9MqYyuO54EjDaE8HfarrK5r0sNf8Vpp4K988Kv6Ih1kFR5G5Wo5pUlY6RpUbjnScxldHkE4yTBVBkdpO5LZyyRIA78xJLdclaWWdxNMySQoa5XPnXRf65h9jovaDl1XrfJNlbm2kzn6IdxcxupUtNpq1YOQnty12hdUXeGGIOxQnqIVhjY2lq7LO5a+0sHVduuQRj1vOKa4uOov1tHdVJ2gi6F8QOdrrXfijJUPiDckl5gK4/qUo0wtCDtWFpgTpubn5xJGd+MmxYHDjzh+TEa5u4EbPL3Dr4YnjcMwm4O0N8UFfroEzwxuT5+xCDsPt/q6E+zc1cO2ty1uvbKOs+sct3pJwjahttoNbhu9jRtOl13s9zPWhbAuq8XtZ8rmztlN9gGLedtMODkwHLur3Y08/BnmwwOq6D2G+zB0dr4u8t69e/2a1BjuIYQQdpXMvIcDqIvzNKO5rW2LJ+l5IAcjdM57vXcZDHfeyiCYdddD6mG57GK/n7EuhHXJzPsQMd7DuSVtK4TtJMZ7CGHX2GQfkGUzIYQQQgghLIQY7yGEEEIIISyEc2G8+5fOjgNvsNBHbpYCXx9j7fRpMfQxhfMCt7NabuhDLugDf4c2qHjrfFWW9lfTCiGEEEJosfMz73r1XBgGQ3Tup5+XCuvQ3PHgLgx9cbB+Yp8LKb5Qp/g6NgUXjaTDw6shhBBCCFNk2UwIBS7oeP/6w/LJe+fp06cHn7fHAOftMXwSX+hz2WNwUUQ+oE9BhxBCCCGMsQjjnSUFWqYg11rm4v5aRqN4GGRCyxT+7//+72D2FCPKl954Wq2lExzzMA77Vd667MSXWLT8K8ziKmxrSUbNry4jqvK6PtCl++EUn7weP37cG6LSA9tW+h7H5VXZPH2cl0N1Iqe8RPVv6WBTIDvvX//+++9XRz4EnVy5cqX/z/vamTlf533tlA+DXbP0ly9f7rchhBBCCKN0xsOZMkcEwuD0yeD6CeHOAD+yz7b6+6eF/ZO9rc9Qs+/h+byxwgP//RO+kkefEeY/TlR/0nZ/YN/zdMjL81d8yVDTB5cR+V3eqfIrfaVX4xO3yurHCN+Sx+OojpAd/D94npLR/fFTGYYgzrpIl2NUnVXZYE46ID24rkI478w5N84bu1jmEMIhm+wDFrNspjP8DpYwMCPaGXd7Dx486PehM+YO/Nl2ht3e27dv+32WN7DMQfD/5s2bq72jMHtM3J9++ml1ZK//kE5nXPUzyJpFvn//fr8FyfPo0aPVkX15hWZw3717129//vnngzXVojP2+jXTLZj19rXXyIaMgiUaxPeZX8IPLdsgvn/opmsHR5aHfP7556t/xwd9uDwsKXGdDi1HEehcOuarmtSvz4TjR51s+kFjdOl11+Lly5f9ljIo/6tXr/ZbUdfED/HixYs+XL6yGkIIIYQ5LMZ4r8sKWHLgSz+0hMHBgILr16/3yxwIj+P/kIH6+vXrD5ZsAAYW6eEwGn0JB440iStayyC4mJDMLNPx+HxFknQrMg4vXrzYb4XLSDzie3paS01+Wn8tPzd43WiscXWxcRyqMap9lrsoH1AdYTB7GRzK4PJ7GF2gbQIuzNClX2S04OFdGebKv5bX18SPMdTeQgghhBBa7MQDq5qJZ2Ycx/+pmd8xmFVmtro6n42fAiOxlcZxYSa/lR5GJWXVPmXXhYMuJGQMY0ATpt4V2AQy2kGyOBjMHNMFDGHdqJVs1fls/MfC3YqpWXdAb26Yy5B3uJj76quvVnvDcEciD6uGEEIIYS6LMd41QyuY2ayznWOwTIY4Y0tmgBl8X1IiMCqZTcdhmB0XyaylF1PoIqPOgruMGI8sv5gD8TB6iYMMWibEMc04T81mt2aKZXS3YKYfnRGG5TCgC4cK+kEWwuIIxzHq7SQhH2T87rvvVkf20YPATjXMa9ml0zkXFsTdxDKlEEIIIewGizHeWScugw+DCgPq9u3b/f4cMMqIgxszljBgMaj8Hd3MGssYw/G/9aaU+gaWIbRExA1Y0htaPsF6by1lAfJxg5G3naAfXw6jt70A6Xp5CEf8S5cu9RcjnhYyIdsYGNO+Pn+q3Fry4xcgPnMt/el5AtDzA+RFPVNvno+Mai/zx6A7Mrq4EugIVFeSQYa5tpIdeaiLoffDO5K9LokKIYQQQhjk/RkzRwTC8HYRtnKdwbnynX77ieAYrsKbTZSH8LxacTjmYfxtI3Uf6jFk8/jIMIaXn7A4l5e0Pb0qs/vh9KYUUPnl0C1b6c/TFl5+wrGv8FU2qOUlTZUD9NYVd45kcudtoEVNY4yWzMJ138q3yua6le5aSG8h7BpD58R5ZhfLHEI4ZJN9wAV+ugTPDGZPp0QgTGcEzVqGMAaz26wvnnogMZwP5rStEMLps4vnZvqjEHabTfYBO/HAKrDsgaUXdU1zCCGEEEIIS2EnjHetWb979+4Ha5pDCCGEEEJYCotYNhPCcUjbCmE7ybKZEMKukWUzIYQQQggh7CAx3kMIIYQQQlgIizLeueVQ0fvMW87fG173PxYegJ16xzj+ej/4NqF3pH8Mm9TleUXvr9/Eu+hJQ+16yFEnnA/+DQLe8S//sB7o0fW7TahtTSHZh/ohtQ/58x0DxZHz9qT+dujbDoo/5B9CCOHjWYzxjvFy69at1d5Rrl271q8jcscn/vnY0CYMpwoDHQ/AjkG+/mGl8wQD+JyPEO06+iiVvpL7MZCGt2/aPOeDH+NVqvfv3z/4ii3G/KtXrw78w3wwWPU1YhwPu2OUbgP0LfQ/tIEx1PcRtn6hGWRgk44e5OdLxpRV5capPcGTJ0/69F6/fr06cgj9Ih8oI718NTiEEE6OxRjvDx48OPJJ+ikwdhhEiBfCWfDixYvJi7zjwmtPr1y5stpr8+zZs0kDL3wIRij69QtUfRvirO84cVGhSQG+WTGG2t/Ql5v1JWAZ7ir30Ot08edi0L+O7Ny7d6//HgcXPZu4YA0hhNBmMcY7Mz5Xr15d7X08vpwA5wMcM1Ls6xaw+/usO4No6/awz7oT9j//+U+fRh34lQfIX/nh6l2DukSo+gvSZJD38H7rW3j5cIL/tVxKD/fbb7/1g7zHmZKtls3T5/+QvgV69/it8nwMNX2cgzyUgS1+/J+Kwywmho6XCz2B4rJ1SF9hhlCcOruJzpUmW68nHVMY/+915WmA/NG34nk7ll68/mvbqW3DyyydssWP/y08Df4rHpAf8nnZPB0vk/zVfrxc0gPGLDPO6xqg5Km0PD1AZsktf2/DU2UA9jHYkQ0uX77cb4dgdpw4lOft27ero/uQHzPsv/zyy8GkyMuXL/v+auh1upq9J7zXIbBPHw1V7hBCCBumGwjOlDki8Pn5blBZ7R2FT9dfW31i39Fn6fWpev5zDAjvn8LX5+35XD2w9X0gf8VReP8MfkWf+ycsVDmrP/89zSo/8V0HkkFlciS/50dc7Stt9+e/9onfystl8bhVtiq79lVWcH3O1beXtebZgjhzqOWDWkb8cSrDnDjIRxiVi7CeRo0vPU0xFI7jrhNPX/J6vCoPeBoeR+nUtiF/1U2VzdsVyF95qu5V1y1qXbPvcbRf60syKY+xcpGGx68ojyFI29tvSw/sS2bJ4PmzP1QGp1VvLSQTabtsyhuqDMThmJznTxr4E166FMhNWNJQGcdQ/rvELpY5hHDIJvuAM+9N5hSGQcMHH0eDXstpUAL2NRC1Bj0ffNkS3uGYBtY68LaoA2wdzD09wK+WEX/Kp/yq3DUN0ZLf5ZEsnh7HNCC3ZPfBGpmmdOFhiCvdC+UBLXm9bKSFq7TydWqaQ7TSIP+qDw83FUd68XIrHem16qWlpxboQvk4rvOaF+n6PnCspuNpKI6XtaUXl1lx6n/H45CX8mtRywHSLbIA8tQ0PI+qL8V3uQmDa0E+hHc9OKTn8kGVm/+evmRQmlNlcLwOhvAyEt7z5j/H8COMqDLIXzKqrpS2wF/yDMlc8fi7wi6WOYRwyCb7gEUsm2H5wdgDUN2AgkY+cEO3vXVb2G/FdwPSkYewusFo9e8Q1nIeFx4mBG6bw++///7BmtV6Gxx/bkfrdjUySV4ca1aHZKrySxf+4Fq9PY4OgLDEf/ToUb/Putihda5K7+LFi/1WsB5bspEuDw+77FpWpNvvY/omDEtAPD4O6nKA40B5fTkDDt3q9r/WDnt7morDEgRQvYPSkd4Jy7p00FITDz8E+mjVB8sW1KZqXlr/7nXOsbrEgbSVxps3bz4ot5ZigHTvMisOaM246wjnsKznxo0bq70P4ZmVKrf+q0+gfXkaalOXLl3qt+jl5s2b/X9o1Q1hWs8QsJSFeu0M1CN6cCSPl1HtGz/Jc/369X4L9byZKoPjdTCE0mepIf2K0mPLucQa/vpMBOebP5yKfvCnLQH+tA2VV2my9AanZUKbXN4YQgjhQxZhvDPADw2cx0FGOwO2DH0ZHMeBgdQHbl/r6ty6das3aPBnsB56MGwIvzCRGzLePxaMHS4wGKDRvxsexwHjpyW/G2Vj3C1vwJCbY+xOQf1xceHp0h5kxGIsVWN5Kg5GrBtGUNMhrAwgDEQMoDlQH62Ht2lTMmhrXuQj2UTrGGkrDa3Zd/wCofVArMehbY7Vm8o+ZuwRprYRnV/0CS2DUca5+gzXC/gFhiBMvXimjtEH8o71P/QnpOdtnHNduqnygF9czSmD43UwhKfPBYD6CT1UCi3dVhSPsK5H0uYCQbJTn7qYm3tOhxBCOB5bb7wzOFQD4WNgEGLmiYHWDV8GpuNCOhq0xwZ6DGCMAQZWylQHOYwKB0OIMJqd00A5h1oexa0z5ENwYUEazL4zUA+VSen5jD747CDxNXt3HNABujgJ0AvldH3JUJExh7HkxvKcOKo7p87uEpa2w6w77WHOhYjqsc7I1vqteblRLjjmBqvuCikNZKsXCZRR6VDmakS24gyBgSoDc4iWH7PxxAMMxpqGXzghI3i7b13YgBvPXIQD5/MU9CcYxH6OoH/JNHUhN1WGitfBELQ/nX9eduRSO6P+VVd6oNZROycvXUwoLaVNXdy5c6f/37qYCyGEsHm23nhncBi7rb4uGiB9uYW/9eEkYXBnkGaWtTVzxnEZEhhSDK63b9/uZWYmT7fiBQPomOw+GKND0nADYQzCMRAjU519dVqyITsGjQZ1ZpRJRwYm6O7HHNAButDSEtCSFU/zOMgYkXECMgwxkGWUu2E3FQfcMAKl40YXYTmGbqSrKdRu68WUz7TWvKQjj6N2JnkJw52EmoZfJCgdlb8a/zUOd2+8TQN1pjaLsTfWtgAd0paUBm2AfcVrLf3xCyfVkfahXtjUMJLPL+7HQGfIIYiPHpTH1IXcVBmcWgdDILv6GNJBHs4Z3d1ROmrXVc9sOac5t2k3ulshmdjSFgmndkWZpu4IhBBC+Hi23nhnQHDDaRMwS+ZrsBlwGKTIaw4MXBi2DG51tkrIUMe50Smjo7VkBhkIj0zIx4CrwZKP7+AvmXGk5WtUHdJhYPWwpLEOGojrkhndQSBd8qiyIbuvEWamD52jL4VB13NmNUHGB4ag58ExN0iPA2mztMPbg5YVgO4oqB5gKo4MoKllEPpPW/LjGFakqXScodlNn8mVzEpTM7sOZaDOVCcYdZRJRmRNA3yGuFXGGod11d6mpSe1WdJwIxo4V9yQpe0gl9KgnPxXPNKoBqPP/rdmsGk3fhFVZ+pp2yCZ5XRnAuPcz3uWwmH4KhzyuL43eQfDL9IE8clXBjn7tYzEQU7NuutOmNLROSo9s2VffQYXE2pfgP5p//JXnn4xF0II4WS40BlQ8yyoE4KB4oxFOFUwThgIq9GNHhgsNbh+DOTBevW5M4dDYKwwI/yx6ZwV2962MLYwnjF63BgLw2AkYliOPUAatp9d6/dhF8scQjhkk33AIh5YPU9gVG9yGdBJwkydv6UjbBZmu5mZjuE+DJ2dZryBBy7rnYoQQghhl4jxfkowG44hwpKATcyunyRaT86Muz4LHzaHr/dfdynTrsHdKF+exHKroaViIYQQwi6QZTPh3JK2FcJ2sovnZvqjEHabTfYBmXkPIYQQQghhISzWeOcKxtfCnjSnmde6INvYKyPDNFrWVNFx+fl+y/FApd4WM+T0VpAxCFNfHxhCCCGEkJn3GWBwbTOsoeehRwzLcDx4BWF9pSD65PWU+kooKBz7LUc98A7ulh/wgOrUw5ZcjPEWGn81XwghhBACxHg/J/AhIwzNcDyYMfe3vvBQKfrkgUl/aHfOh2hab49hFp1XHE49oEo4HtCE1nu+QwghhLDbLMZ4x6jRsoPWDLPe4CFXlya4H85pLYVQfIXFoCIPjDz3h3qM/y7P0FIKL0f1r8tg9AYYuaoDDEZmhLd5ec82w4d59OEfdM9Hd+p796nH43yIhrZAvKn35VOvvD6SsOBfNw0hhBBCgEUY7xjuLCHQ8gM+cuRgHOmLnTiMH5YdyJAlvpY+4Fi6IOOYMMywyg+HEax3sbMP/rXBObg8gDx8WEbHkId8MQhx1R9DTwY6MnLxQLnkz/viKbfDjDDvZg/rgf6BL1LSVjDkqYv6Sk99QXSdL/5Sd1wIkN4U1Ct5tr7GGkIIIYQAW2+8MyON0eqGs//H8MI4wlgWzEJjHA8ZssTXu6IxxDCanKllEXOoHzciDzfG/NPlLfwd63zllIsHX46hT7I7zAjr0+5hPjKW9bVTlrc8ePCgP+bok/L6hHx1uggQtF0uumiL6xjiz549+2D9fQghhBACbL3xjsGEseS4EavZ0GpQMautZQosRWC/ZWQpLV+2QlgtXTguvrTC5VUeGIqA/PhzN4Bj+DH76yCLf6jG43tZsszieLx586bf0oa4yKK9cGFEm3C44zP1sKpDHVGv637oijqtaYUQQgghwLl5YLVlTMl4ZymCjoEMfZDRjqGlZSvMlG4aGd1avlOXUXA3QMcx1gnr694lW3Ux8j4eGeXeXtjHiHfwn3tXhgsw2tk6S60Ed0/ysGoIIYQQWmy98c7ykjoL7rPNvJYP6izpEDJ6gTgYaMyOckxLG3gd4BAtY1mz/0Owdl2zupqFffv2bb+tIAPhMNa1BIa4WrIxxlCaYZyWUc5SJfSv5yZoc7TDOQ+r6gFVX8o1F7XtddbVhxBCCGF32HrjHWMW49Vnof1BTV9y4jDzqTjMYvvbWWSQYfgT3y8G9IDhGMjja6LrDG0Fg88vQMhPrwMEzf77BQjpkw9o2Y/7owPiOCz/yFrp9WkZ5bQ72hVGPGhd/JRR7Q+oHueuiPLJHZUQQgghNHl/xswVoTNk+7C4u3fv9tuHDx+ufN+/7wytA38c+6Izzo744Tgm/Dj5dIZX/58tKO3OMO73a3rI4eF1zCGux1EalAWUhhxyOFP+wLGa7y6Dnqaode2ojqh/tbkhp/bm7bTlSJO0WvUHpKN2FsJ5hXNh19jFMocQDtlkH3CBny7BM4PZ4zMW4VzAbH5nEEaXRtpWCNvJLp6b6Y9C2G022QecmwdWd5179+6dyIO2IYQQQghhe8jM+zmAddaszdbbUsI+aVshbCeZeQ8h7Bqb7ANivIdzS9pWCNtJjPcQwq6xyT4gy2ZCCCGEEEJYCDHeQwghhBBCWAgx3kMIIYQQQlgIMd5DCCGEEEJYCDHeQwghhBBCWAgx3kMIIYQQQlgIMd5DCCGEEEJYCDHeQwghhBBCWAgx3kMIIYQQQlgIMd5DCCGEEEJYCDHeQwghhBBCWAgx3kMIIYQQQlgIMd5DCCGEEEJYCDHeQwghhBBCWAgx3kMIIYQQQlgIMd5DCCGEEEJYCDHeQwghhBBCWAgx3kMIIYQQQlgIMd5DCCGEEEJYCDHeQwghhBBCWAgx3kMIIYQQQlgIF953rP6fCRcuXFj9CyGEEEII4XyyKZP7zI33EEIIIYQQwjyybCaEEEIIIYSFEOM9hBBCCCGEhRDjPYQQQgghhIUQ432Cb7/9tn+otuV+/fXXVaij/P333wdhWhBvLD4ojT///HN1JByXzz77bO/HH39c7bWZqo8K6ZHuGB7m33//Xbs+5+QBtNGPZUq+48h/Eui8YAuUfRPl3xTI5m6dNvUxqE9xdxykX+p7F6DtTPUNJ8XcceIk8LxPs67ntC/KPaffG4I+6qT0FsK2EON9BteuXeufEHb36tWrvZ9//rk5OD948KCPA2PGzu+//z7of+PGjdW/cBpQpz/99NNqb/N88sknfR7ff//96shmwPD4559/Vnsnx0nJf16QofX8+fODPgJHH3HSFxfkS1/i+d66detYhtkXX3zRx6e+d4G//vpr7/79+6u902XuOHES/PLLLwd5v3v3rt+eBi9evOi3Y+2Lfvhj+rRnz57tffrpp6u9EM4nMd6PCZ0PAySDZuW3337rjW86xz/++GN19EO++eabvqOp0JHjF0LYfphNxEjHcMf4dbjIf/z48YkZZ8xQ0s9UYweDlONnNascppk7Tmwa2itt8s6dO/2+DOrT4PXr1wcXDScFF6wZP8N5J8b7R3DlypV+cHY0SF+9erXvmOkkh2a/rl+/3nfgFTpy/KYgXWbX3NW8kMf9W3cKmBmUv24j+23LVjzC1RlF4ikdHIOEkKx+uxbXkoe8PYynA9V/Lh6vys4xl6XqTftVv7XMQ6j8bsR9bB4cp/3QBjnuevLwXpdC8sg9evRo5dOmyo+uSLeWocrutNoMeLpAmLlpthiKr7bnemodU9n0H/8xNINaDXfgIh+j/tKlS6sj+9Q27PnPBZ1R90Mzx+p/nKqbmi9y+Xkg/cjV+lO7IJyn7el6GIdjXu+Ki2u12UqVzeUG5StX01Tbdeq55vKB2oan7enynzSmULpzxgm1QbmhcHPRrDvtlRlqDGpHZfMyqu6m9APoQP5V50+ePNn7+uuvD3SPc30pT0933f4AXX711VdH9OZtg/RadeTh+F/bV83X9YOrZQVPQ/5sXZ6aTz3HwPWFa+m9hpnTDsOCeR9G6Tq53rW4devW+67zW+3tU8Oj4rt376729mFfqmfbDe79f+gG4z5Ntvg9fPhw5fMhNe0qD3Fr+jUOsnJMkAb7nk6NA7WciifIk33lrfLg+A9D8pGWkK4UB7k8X9flEMQhjHQpWbxMvl/lUllwkkPldVmrbPhJj8pTMpxEHqLGqWGqLKC8/ZhT40jvLgv/qyyOyqzygY6JmkaNIz1Jb4R3GYjbiq/w+Hm9qxx+jPRcf1PUNKcgP09fMrhe5rCunFVXrfpwXVVdA2X1PJUGxxWO8rTqwFHayrumi5yeRqXKzpZ9jrf2oZYfOX2f/D3PVvkll4fj/zr1D1UW8qlpqF14OOV/XKQ3lanKAQqDc+boh30vh6evOmFfda00VI91v+Ypnci/ovjkITlUHkGatcyEVT5Ko8ZplX2orKB8JSth8ecY8UHpaB/IR/oB/ns6rTg1L2Df5Qvni6NnZ/iAekIKnUCcNIITpx6rJz1wQhEOSNtPVPxwrbQc+fsJDH7y1k4AdJLDUBrEc5kJUzsB18uQrORdw9R0yEfH2Eq2CvElu5cRPI0W+Nc6dNnAZeN41Rv7nrf2HdctEEZ6rDo6iTxgSIeeN3GqPpSuwlSq/MrH60LnhB+r4O91hRySRfFre3Rd1TAeX2Wo+XuYWnb5+bGWDGPUMo0xVD8wprcWpDNUXxXpzfPgv5e1hkEn0ruo+mO/plvLWOMAYbzdEt7L0pLXqeHB5Z2Tp4evuhA1H/ZruqSpdOagvDxd4rtsID26Dqb0MgV5uPxVJ9DKd45+WjrHjzAg2V1XNV3lLbyOhOdZUX6kI6rOCFPL7GnOKX+rzpWPwniagngcF63yuR6VZk2nxiNdLzO00g7nhyybmQG34fx2FO7LL7/c606oIw/waemBH2P5S3fiH9x2rHDL1JfOsIb+u+++W+0Nw+347oTt5fDbY3oQiFt65FuX33CbFpDn5cuX/f96u3/d9YJKpz7MyK3Letv+8uXLq38fMrYeknLxfAD+KqNA3qdPn6722tQ4MPRQlG67OnUf0H+Lqdu6cFJ5oIeuw17tHYLe9HyFbl07ahfr0tLrGMjmdYUeOAeAtbeUt7ZHZEXmKfSgWpXJl494m0SHyl9tQbejW0tgNsFUG5+L6r8uxxni4sWLWAxH8tB5ix9I/wrDcpy6JId68DTYp079GGX0dkv/VtsbbcD7GcL/8MMPB/0k+q/yCtVR7W/84dPbt2/3+w55+tKGeg6Sn9e7ZJGOta+14oJ+liWUc1l3nGjp4DgPmaI38nD56Y855qCnVj87pR+t4XcoI/FAa+u9TdU2WM8PZCBdX2ZCerXuhfoAf/lAfUgWeb3MjJ/EUZqSoaV3oNzEp405KgNI3ionbd7PjalzjCV5LpvA38cA4tQXLtC+12mXYVnEeJ8BJzIdRnX1hNLDq9XIB07CFm5MqzMc6jQqGBwMnHRuyk+dhjp38nd51HG8ffu2326CN2/e9FvPB8dgDFPGLJ0lTIWTsVXzofwf83YCZ0iGuUbSHE4yD/Tg7UEOvU3pd1OMGRYynpGlGmG0AwbFKjsPg1YD47jUi1fObY6RPjLpAnEdOKfUhqc4rTqoUNaqV52f6m8ogxu3GBo1DnqSQUBZ2K8XnRgSMszVp33++ef9VlTDWeev+ivFazGnjjDIquzkqbKqHnTO0WZrePXdfnEDLQO2lm+M44wTmwCjHb25/Cq/6xs9VSN8Sj+KPzYJIKPY0diheqHt+IUehi1x6API0434FtSrXxQC+brBrPokLI7+0h8YrjJU6kVui1ZZoco3dY4hC/s1DDI7yFPDwNhkWVg2Md43BJ0XJ9nz8qo4nAzsFnQAnHh02ribN2+ufOZB5+b50MnJKIKWPDi/8NBA9rG08sGNdXLrQofYymNTxvsmZR3ipPOgHbR05DORc43NTaN2hzHZMsI4F1qy446LDATQ+cYATP4M0jqGTAyW1XCZggF47BzCkGw9zNaCcD4ADxkrakNjF+GKj2wY6twpdH3STlz/brTobp6Hp38DGaqaNXWDjbzcoB8zeKuhp3yoCwxD78fWgTJjgLrsOJBckl1ykd/du3ePhGcfWaRrzUg7rfKNcdxxogVpeVvBDbVDzbqjFw8vA1ztSPFr3czRzxQto7jqFBmrwUm/Jf0wvvmd5kq9KATydYNZ8tIG7t271+fv9deSobaXFnPCME7JMJ9zjkHVu5z6cx5wpQzuR/uCsYupsGxivG8I3d5qnbhaujI0GGGw08HQca8zg1PR7TeMFcmhwUWow2erE1udjkCWKdxYlswalAWDKHnNhY6dzneIIX86r9YT+seFjhDDzql6/Fg2lUe9Lcog1ao/jEINFq0wtQ2cJAzCzHTR3t1QZtBl8KoGyFzjdyh+NRA43ziGDrREDZ0gE/HXHfC4fU67rO0fkIVy6qJ8qo1zXvkgPPbtAemxBece/RHxdSeklgu53PByowW53eABLffQzCXttxpvakfKq2Xw8rYTxfP+SKAD/Ov5MYb3Na1ZT/W9mmmmjyQPUHupfS8z5N7uqLcp43OKjxknKqThbQU3ZEhz8UZ7qeFxoAtc1Z+nM1c/FeJRJ5SH/96+hOtUbUBth7jUq2B8owxD45Pi+x1M5VsNevW/nAO+jKh1DgNhyFuQZsXDtJar6AJKekS2qXOspV/SQTeqF86X2i51B2eoPYRzQHfyhhG6k/zg4ZExUGV34q72PqTrsA/S6a6k+/BCD6UQRnQneX+sPqgiFMf9+c8x/ED5aB9cDkBmwgjFcVkI7/sK4+nw39OR/IT1/Voe0nW9Ecb3azn57/nWMreoeQD7XibSkKw1TcmAoxxQ44PitcLU8m8qD2T2MMrHy6v6UhyFUXmBfZzkqyiO/JWmozKoTEN4WSuUxcujsMq35kFb8PZQ41c9g9JohfNj6yB9uP6ks5omx7x+ahnnovS9/EDaHBe17gCZOKY2IBkIC7XtST+eLv5eDqjxav1INo/HvoeRvF5njmSVv2TTfm2bCo9T+civyuDnA/4cU5iap6jxpvA0W6A76aKWA4bkGEPpqOwVr0fCel2IWs6qH6jtwf0lt8tQ67mWV3k45OFyOGoHTitfQC6O17KSdi1HlQvYb+lDKF+dc9rHSRbyIC/ROsd0THGUTs3byyF5Pe1w/jjaIsMH1BOjRR08WuiEIsxQZ+Adhjo2nfwtvEOQqzJ4h4DzPITkwanjqie+p0H4ll6I5+Fc9qHy1I4SOObp1DJV/9oxV1p51DKSDuUSVW/S0VDHC4rTCtMq/ybyULo4T1vH5CoeD6d0PQ2nyi9ZHbXHWl8tCDd0XnEcfzlPr+bRaoc1vnTlcNzbhNL1NgCtcg6hNNzV9AT16uG8jOtS0/JyCdWvHPvEk3ytcnq6/FcaUNuD8DSh6kRp1HgeBjelD6UjV+u41YY8HP/H5MSPNKTLln5qmkD5W/oHyTxWNuVDmLE8x9JwVE9DMgF+yA1eZkf5ylX9iBpGtMoifUh/pEWaTq1HT7Pi5RCtfEHHqx4lg/SGq2kK+eOq3OBtVOdFTYt9D6M4Tm3rrbp3f2Rp5RXOFxf46So8hANYpsCtSV8as+twq5Jbzyd5upxGHtsCt327QemDh763EZZk1TeXnDc457kNf97LCZSzM2z6dcFj65OPA2mzjrq+QSRsF1pmWds7y1RY4ja2XO24kDbLZNI2wibImvcQCnSydQ09RvXdu3dXex/PaeSxrWg99hIMd9iFi1jW/tZ1s+cVrSvetOEOrBlvrXcO2wPr2llrX41oLrxeNdblHwet9Rda715f3RzCsWHmPQSndftx1+DUcMdtyE1zGnlsE37rXbfKtx1uWePOK5zn1McunO++/OCk6rS1fCJsB97/tJaeyH8TfZO3Nbml9HlhGWTZTAghhBBCCAshy2ZCCCGEEEJYCDHeQwghhBBCWAgx3kMIIYQQQlgIMd5DCCGEEEJYCDHeQwghhBBCWAgx3kMIIYQQQlgIMd5DCCGEEEJYCDHeQwghhBBCWAgx3kMIIYQQQlgIMd5DCCGEEEJYCDHeQwghhBBCWAgx3kMIIYQQQlgIMd5DCCGEEEJYCDHeQwghhBBCWAgx3kMIIYQQQlgIMd5DCCGEEEJYCDHeQwghhBBCWAgx3kMIIYQQQlgIMd5DCCGEEEJYCDHeQwghhBBCWAgx3kMIIYQQQlgIMd5DCCGEEEJYCDHeQwghhBBCWAgx3kMIIYQQQlgIMd5DCCGEEEJYCDHeQwghhBBCWAgx3kMIIYQQQlgIMd5DCCGEEEJYCDHeQwghhBBCWAgx3kMIIYQQQlgIMd5DCCGEEEJYCDHeQwghhBBCWAgx3kMIIYQQQlgEe3v/P6rvqbYL7qhOAAAAAElFTkSuQmCC\"\u003e\u003c/p\u003e\n \u003cdiv class=\"gridtable\"\u003e\n \u003cdiv align=\"left\" class=\"colspec\"\u003eThe pCAMBIA 2300 vector was modified as mentioned in the materials and method (Fig. \u003cspan class=\"InternalRef\"\u003eS1\u003c/span\u003e). Briefly, a 2X35S promoter driving the expression of a plant codon-optimized Cas9 and a MtU6 promoter directing the expression of sgRNA (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e) were incorporated into the binary vector pCAMBIA2300, with kanamycin resistance. The sgRNAs were integrated into the T-DNA region of the binary vector pCAMBIA2300, resulting in the creation of the CRISPR/Cas9 constructs pCAMBIA2300-pcoCas9-CcPDS and pCAMBIA2300-pcoCas9-AhPDS (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/div\u003e\n \u003c/div\u003e\n \u003cp\u003e\u003cstrong\u003eAgrobacterium\u003c/strong\u003e \u003cstrong\u003emediated delivery of CRISPR/Cas9 system into pigeonpea and groundnut targeting PDS gene\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003ePigeonpea cv. ICPL 88039 was transformed using \u003cem\u003eAgrobacterium\u003c/em\u003e utilizing leaf petiolar explants. Out of 1000 explants co-cultivated in shoot initiation media for 7\u0026ndash;10 days, 675 exhibited regeneration. Following subculturing to shoot development media with kanamycin selection (100 mg/L) after 7\u0026ndash;10 days, 450 explants survived. Among these survivors, 209 explants-producing shoots were subcultured to shoot elongation media supplemented with 0.5 mg/L GA3 (gibberellic acid) and a higher concentration of kanamycin selection (150 mg/L), being maintained for 10\u0026ndash;15 days. \u003cem\u003eCas\u003c/em\u003e9 and \u003cem\u003eNpt\u003c/em\u003eII gene-specific primers were employed to test 163 shoots (symptomatic/albino and non-symptomatic), of which 152 (approximately 90%) tested positive for both genes (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e). Within this group, 56 shoots exhibited varying degrees of albino phenotype (Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003e, Table \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e). Albino plants did not develop further, and asymptomatic cas9 positives were transferred to soil pots, where they were maintained under controlled glasshouse conditions.\u003c/p\u003e\n \u003cdiv class=\"gridtable\"\u003e\u0026nbsp;\u003ctable id=\"Tab2\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eSummary of pigeonpea and groundnut transformations with genome editing constructs\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003ccolgroup cols=\"7\"\u003e\u003c/colgroup\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eCrop\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eTotal No. of explants\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eNo. of elongated shoots\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003ePlants established\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eTransformation efficiency (Cas9 and NptII positive)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eAlbino Phenotype\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eNo. of mutated plants and efficiency\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003ePigeonpea\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e209 (20.9%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e163 (16.3%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e152 (15.2%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e56 (5.6%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e8 (5.26%)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGroundnut\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e250\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e80 (32%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e70 (28%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e50 (20%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e25 (10%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2 (4%)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003c/div\u003e\n \u003cp\u003eIn groundnut, \u003cem\u003eAgrobacterium\u003c/em\u003e-mediated transformation was conducted in cv. ICGV 15083 employing cotyledonary node explants. A total of 250 explants were co-cultivated with the CRISPR/Cas9 construct, resulting in 80 explants producing multiple shoots within 30\u0026ndash;40 days under shoot initiation medium. The explants generating multiple shoots were isolated and subcultured in a shoot elongation medium with kanamycin selection (125 mg/L) every 10\u0026ndash;15 days. In total, 70 shoots were subjected to testing with \u003cem\u003eCas\u003c/em\u003e9 and \u003cem\u003eNpt\u003c/em\u003eII gene-specific primers. Among these, 50 (approximately 70%) tested positive for both \u003cem\u003eCas\u003c/em\u003e9 and \u003cem\u003eNpt\u003c/em\u003eII genes (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e). Within this group, 25 shoots (about 25%) exhibited with varying degree of albino phenotype (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003e, Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e). Albino shoots did not survive beyond three months post-regeneration. Some of the albino plant with green shoots and asymptomatic positives (\u003cem\u003eCas\u003c/em\u003e9) were transferred to soil pots and maintained under controlled glasshouse conditions.\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eMolecular analysis of CRISPR/Cas9 induced mutations of\u003c/strong\u003e \u003cstrong\u003ePDS\u003c/strong\u003e \u003cstrong\u003egenes\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003eTo confirm whether the observed albino phenotype resulted from \u003cem\u003ePDS\u003c/em\u003e gene modification, we sequenced PCR amplicons of genomic DNA spanning the targeted PDS regions in Cas9-positive plants (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eA, \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003eA). The sequencing data revealed the presence of mutations in the targeted gene.\u003c/p\u003e\n \u003cp\u003eIn pigeonpea, we selected 120 plants positive for \u003cem\u003eCas\u003c/em\u003e9 and \u003cem\u003eNpt\u003c/em\u003eII, along with wild-type plants for sequencing.. The sequencing results revealed an A nucleotide deletion in plants #98, 12, 13, 11, 17, and 26 (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003e). This deletion occurred 65 base pairs upstream of the PAM sequence (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eB) leading to a premature stop codon resulting in an albino phenotype compared to the wild-type plants (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eC). Additionally, plant #34 exhibited a heterozygous (T/C) mutation in the third nucleotide upstream of the PAM sequence (Fig. \u003cspan class=\"InternalRef\"\u003eS4\u003c/span\u003e). To further analyse this mutation, we cloned and sequenced it. Among the five colonies examined, four displayed a T nucleotide, while the fifth colony still exhibited the heterozygous (T/C) mutation.\u003c/p\u003e\n \u003cp\u003eWe selected twenty plants positive for \u003cem\u003eCas\u003c/em\u003e9 and \u003cem\u003eNpt\u003c/em\u003eII, including wild-type plants, for sequencing to identify mutations in groundnut (Fig. \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003e). The sequencing results uncovered a mutation in the PAM sequence of plant #110 (Fig. \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003eB) and the insertion of a single A nucleotide in plant #125 (Fig. \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003eB), resulting in albino phenotype compared to the wild-type plants (Fig. \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003eC) due to premature stop codon. The CRISPR Edits of Synthego (ICE) inference indicated a 39% InDel percentage for the albino groundnut plant #125, with a knockout score of 39 representing the proportion of cells with the mutation (Fig. \u003cspan class=\"InternalRef\"\u003eS5\u003c/span\u003e). In the case of plant #110, the amino acid sequence alignment (Fig. \u003cspan class=\"InternalRef\"\u003eS6\u003c/span\u003e) with the wild type of control revealed the substitution of a Glutamine (Q) residue with Arginine (R) in the phytoene desaturase domain. As a result, the albino phenotype in this plant may be attributed to the partially functional PDS protein.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe CRISPR/Cas9-based gene editing has been developed as a site-specific, precise, and efficient technology for editing genes in plants. It holds significant potential for gene functional studies and crop improvement, allowing the desired phenotypes for traits such as enhanced nutritional quality and increased resilience to biotic and abiotic stresses (Kumar et al. 2021). To evaluate the efficiency of gene editing in pigeonpea and groundnut, we employed the CRISPR/Cas9-based gene editing system to target the phytoene desaturase (\u003cem\u003ePDS\u003c/em\u003e) gene. PDS plays a crucial role in the biosynthesis of carotenoids, and its disruption results in an albino phenotype (Qin, et al. 2007). Thus, the \u003cem\u003ePDS\u003c/em\u003e gene has been employed as a marker to establish a gene editing platform in numerous plant species (B\u0026aacute;nfalvi, et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Hooghvorst, et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Lu and Tian 2022; Naim, et al. 2018; Ntui, et al. 2020).\u003c/p\u003e \u003cp\u003eGene editing methods have been established in model legume plants such as Medicago (Wolabu et al. 2020) and lotus (Wang et al. 2019) along with other legume crops such as cowpea (Che, et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2021\u003c/span\u003e) and soybean (Bao et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Cai et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Sun et al. 2015). While gene editing tools have proven effective in various crops, groundnut and pigeonpea have lagged behind due to the intricate nature of their genomes and their inherent resistance to regeneration (Pratap, et al. 2018). The success of efficient gene editing is primarily contingent on the regeneration efficiency of the transformation method. Transformation studies in highly recalcitrant crop species such as pigeonpea and groundnut face significant challenges, including issues related to the generation of chimeras, genotype specificity, prolonged crop duration, and low regeneration efficiency (Karmakar et al. 2019). In our investigation, \u003cem\u003eAgrobacterium\u003c/em\u003e-mediated transformation was employed in pigeonpea, utilizing leaf petiolar explants, and in groundnut, using cotyledonary node explants. We observed a regeneration efficiency of 21% in pigeonpea and 32% in groundnut, coupled with a transformation efficiency of 15.2% in pigeonpea and 20% in groundnut. Despite various attempts by different research groups to tackle this challenge, success in establishing efficient transformation systems for legumes remains elusive, especially in pigeonpea (Ghosh, et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2017\u003c/span\u003e) and groundnut (Mehta, et al. 2013; Prasad, et al. 2013). Our findings, along with prior research, indicate that the enhancement of regeneration and transformation efficiency is contingent on factors such as genotype, the initial explant, culture conditions, the \u003cem\u003eAgrobacterium\u003c/em\u003e strain utilized for infection, and the selective agents incorporated into the culture medium.\u003c/p\u003e \u003cp\u003eIn groundnut, which is an allotetraploid, genes predominantly exist in two copies (A and B). The existence of gene homeologs presents challenges in CRISPR-mediated knockouts in polyploid crops like groundnut, as a deletion in the A-sub genome may be compensated by a highly similar gene in the B-sub genome (Yuan et al. 2019). Therefore, in this study, we opted for sgRNAs targeting conserved regions of all homeologs of the \u003cem\u003eAhPDS\u003c/em\u003e gene to maximize efficacy. Likewise, the disruption of the \u003cem\u003ePDS\u003c/em\u003e gene through CRISPR/Cas9 was reported in soybean, utilizing a single guide RNA that targeted both homologs of the PDS gene, resulting in dwarf and albino phenotypes (Lu and Tian 2022).\u003c/p\u003e \u003cp\u003eThe recent attempts at CRISPR/Cas9-based gene editing in groundnut are restricted to transient transformation methods, such as hairy root or protoplast-mediated transformations (Biswas et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Shu, et al. 2020; Yuan, et al. 2019). Increasing the oleic acid content by targeting fatty acid desaturases, \u003cem\u003eAhFAD2A\u003c/em\u003e and \u003cem\u003eAhFAD2B\u003c/em\u003e was the first report on CRISPR/Cas9-based gene-editing in groundnut by using protoplast and hairy root transformation methods (Yuan, et al. 2019). However, the attempts at generating stably edited lines were unsuccessful in this study. Further, increasing the nodulation by editing Nod factor receptors (NFRs) using similar constructs with GFP in groundnut using the hairy root transformation system (Shu, et al. 2020). More recently, base editing to target \u003cem\u003eFAD2\u003c/em\u003e genes in groundnut using the hairy root transformation system has increased the oleic acid content (Neelakandan, et al. 2022). Furthermore, extended scaffold plus terminator increases the editing efficiency compared to normal sgRNA in groundnut while targeting \u003cem\u003eFAD2\u003c/em\u003e genes (Neelakandan et al. 2022). A multiplex approach was used in groundnut protoplasts to target an allergen gene, \u003cem\u003eArah2\u003c/em\u003e, using a polycistronic tRNA\u0026ndash;gRNA (PTG) system and Cas9 endonuclease (Biswas, et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Furthermore, to the best of our knowledge, there has been no prior study reporting gene editing in pigeonpea using CRISPR/Cas9 technology. This lack of reports can be attributed to the requirement for an efficient, stable, and effective gene editing system. The effectiveness of CRISPR/Cas9 relies on the design and selection of guide RNA (gRNA) that guides the Cas9 endonuclease to perform double-stranded DNA cleavage. In our study, the availability of the reference genome sequence of pigeonpea (Varshney et al. 2012) and groundnut (Bertioli et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Zhuang et al. 2019) facilitates designing specific and efficient guide RNA. We proceeded to induce double-stranded breaks (DSBs) in the \u003cem\u003eCcPDS\u003c/em\u003e and \u003cem\u003eAhPDS\u003c/em\u003e genes within the genomes of pigeonpea and groundnut. This was accomplished by utilizing a CRISPR vector containing the \u003cem\u003epcoCas9\u003c/em\u003e gene and sgRNAs driven by the MtU6 promoter, leading to the generation of albino plants. Our \u003cem\u003eAgrobacterium\u003c/em\u003e-mediated transformation yielded albino phenotypes in pigeonpea (5.6%) and groundnut (10%) compared to the wild types. Furthermore, the sequencing results unveiled a deletion of an A nucleotide in the edited pigeonpea plants and insertion of an A nucleotide in the edited groundnut, resulting in the creation of a premature stop codon. This in turn, resulted in the inactivation of the \u003cem\u003ePDS\u003c/em\u003e gene, leading to the albino phenotype.\u003c/p\u003e \u003cp\u003eAlthough the mutation of the \u003cem\u003ePDS\u003c/em\u003e gene in both legume crops was successful, sequencing revealed a lower editing efficiency. This could be attributed to variations in intrinsic DNA repair mechanisms among plant species, the tetraploid genetic background of groundnut, the possibility that PCR amplicons may have carried a mixture of edited and unedited heterogenous DNA, or the use of non-endogenous promoters, which might have further diminished the efficiency of the CRISPR/Cas9 system (Poczai et al. 2013; Wolabu, et al. 2020). Various studies have demonstrated that Cas9 typically cleaves target sites at the fourth base upstream of the PAM sequence (Jinek et al. 2012). However, in our study mutation occurred at the 65 bp upstream of PAM in pigeonpea edited plants, and at the third base of the PAM sequence in groundnut edited plant #110. This divergence may be attributed to simultaneous activation of homologous recombination (HR) and non-homologous end joining (NHEJ) pathway for repairing double stranded breaks in the PDS region (Mainkar et al. 2023; Odipio et al. 2017).\u003c/p\u003e \u003cp\u003ePrior research has indicated that the editing efficiency of the CRISPR/Cas9 system is influenced by various factors. These include the expression level of Cas9-gRNA, the sequence of the guide RNA (gRNA), the promoters governing Cas9 and small guide RNA (sgRNA), terminators, the composition of the target sequence (spacer), T-DNA architecture, chromatin state, and the duration of culture incubation (Castel et al. \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Gao et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Mikami et al. 2016). The employment of codon-optimized Cas9 and endogenous promoters for Cas9 and sgRNA expression has demonstrated an elevated mutation frequency in various crops, such as soybean (Sun, et al. 2015), rice (Wang et al. 2016), and \u003cem\u003eM. truncatula\u003c/em\u003e (Wolabu, et al. 2020). We postulate that the use of an optimized construct could potentially result in higher mutation efficiencies.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThe current study showcases that the \u003cem\u003eAgrobacterium\u003c/em\u003e-mediated CRISPR/Cas9 system yields albino-phenotype mutants in the T\u003csub\u003e0\u003c/sub\u003e generation of both pigeonpea and groundnut. Despite the relatively low editing efficiency observed in this study, the incorporation of a GFP tag, the exploration of regeneration-promoting genes, design of gRNA with higher efficiency, and the utilization of alternative promoters for gRNA or Cas9, may further enhance editing efficiency. This study opens avenues for exploring functions for various candidate genes in basic research and harnesses the potential of CRISPR/Cas9 gene-editing technologies for advancing agronomic traits in legume crops. To the best of our knowledge, this marks the initial success of establishing an \u003cem\u003eAgrobacterium\u003c/em\u003e-mediated CRISPR/Cas9 gene editing system in pigeonpea and groundnut, bridging the gap from a basic genetic model to the contemporary gene functional era.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAUTHOR CONTRIBUTIONS\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eConceptualization: KY and PSR; methodology: KP, HG, PRB, and KY; software: KY and PSR; data analysis: KY, and WT; writing\u0026mdash;original draft preparation: KP, HG, and KY; writing\u0026mdash;review and editing: KY, WT, and PSR; supervision and funding acquisition: KY. All authors have read and agreed to the published version of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eACKNOWLEDGMENT\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was carried out with the aid of a grant from the Start-up Research Grant (SRG) (File No. SRG/2021/000422) from the Science and Engineering Research Board (SERB), Govt. of India to KY. The authors express their gratitude to Dr Prakash Gangashetty, the Pigeonpea breeder at ICRISAT, and Dr Janila Pasupuleti, the Groundnut breeder at ICRISAT, for generously supplying the pigeonpea and groundnut seeds required for plant transformation.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability statement\u0026nbsp;\u003c/strong\u003eThe dataset supporting the findings of this article are included within the article.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of Interest\u003c/strong\u003e The authors declare no competing interest.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eB\u0026aacute;nfalvi Z, Cs\u0026aacute;kv\u0026aacute;ri E, Vill\u0026aacute;nyi V, Kondr\u0026aacute;k M (2020) Generation of transgene-free PDS mutants in potato by \u003cem\u003eAgrobacterium\u003c/em\u003e-mediated transformation. BMC Biotechnol. 20:1-10\u003c/li\u003e\n \u003cli\u003eBao A, Chen H, Chen L, Chen S, Hao Q, Guo W, Qiu D, Shan Z, Yang Z, Yuan S (2019) CRISPR/Cas9-mediated targeted mutagenesis of GmSPL9 genes alters plant architecture in soybean. BMC Plant Biol. 19:1-12\u003c/li\u003e\n \u003cli\u003eBertioli DJ, Jenkins J, Clevenger J, Dudchenko O, Gao D, Seijo G, Leal-Bertioli SC, Ren L, Farmer AD, Pandey MK (2019) The genome sequence of segmental allotetraploid peanut \u003cem\u003eArachis hypogaea\u003c/em\u003e. Nat. Genet. 51:877-884\u003c/li\u003e\n \u003cli\u003eBiswas S, Ibarra O, Shaphek M, Molina‐Risco M, Faion‐Molina M, Bellinatti‐Della Gracia M, Thomson MJ, Septiningsih EM (2023) Increasing the level of resistant starch in \u0026lsquo;Presidio\u0026rsquo;rice through multiplex CRISPR\u0026ndash;Cas9 gene editing of starch branching enzyme genes. Plant Genome. 16:e20225\u003c/li\u003e\n \u003cli\u003eBiswas S, Wahl NJ, Thomson MJ, Cason JM, McCutchen BF, Septiningsih EM (2022) Optimization of protoplast isolation and transformation for a pilot study of genome editing in peanut by targeting the allergen gene Ara h 2. Int. J. Mol. Sci. \u0026nbsp;23:837\u003c/li\u003e\n \u003cli\u003eCai Y, Chen L, Zhang Y, Yuan S, Su Q, Sun S, Wu C, Yao W, Han T, Hou W (2020) Target base editing in soybean using a modified CRISPR/Cas9 system. Plant Biotechnol. J. \u0026nbsp;18:1996\u003c/li\u003e\n \u003cli\u003eCastel B, Tomlinson L, Locci F, Yang Y, Jones JD (2019) Optimization of T-DNA architecture for Cas9-mediated mutagenesis in Arabidopsis. PloS One. 14:e0204778\u003c/li\u003e\n \u003cli\u003eChe P, Chang S, Simon MK, Zhang Z, Shaharyar A, Ourada J, O\u0026rsquo;Neill D, Torres‐Mendoza M, Guo Y, Marasigan KM (2021) Developing a rapid and highly efficient cowpea regeneration, transformation and genome editing system using embryonic axis explants. Plant J. 106:817-830\u003c/li\u003e\n \u003cli\u003eConant D, Hsiau T, Rossi N, Oki J, Maures T, Waite K, Yang J, Joshi S, Kelso R, Holden K (2022) Inference of CRISPR edits from Sanger trace data. CRISPR J.5:123-130\u003c/li\u003e\n \u003cli\u003eDayal S, Lavanya M, Devi P, Sharma K (2003) An efficient protocol for shoot regeneration and genetic transformation of pigeonpea [Cajanus cajan (L.) Millsp.] using leaf explants. Plant Cell Rep. 21:1072-1079\u003c/li\u003e\n \u003cli\u003eGao R, Feyissa BA, Croft M, Hannoufa A (2018) Gene editing by CRISPR/Cas9 in the obligatory outcrossing Medicago sativa. Planta. 247:1043-1050\u003c/li\u003e\n \u003cli\u003eGhosh G, Ganguly S, Purohit A, Chaudhuri RK, Das S, Chakraborti D (2017) Transgenic pigeonpea events expressing Cry1Ac and Cry2Aa exhibit resistance to \u003cem\u003eHelicoverpa armigera\u003c/em\u003e. Plant Cell Rep. 36:1037-1051\u003c/li\u003e\n \u003cli\u003eHahn F, Korolev A, Sanjurjo Loures L, Nekrasov V (2020) A modular cloning toolkit for genome editing in plants. BMC Plant Biol. 20:1-10\u003c/li\u003e\n \u003cli\u003eHickey LT, A NH, Robinson H, Jackson SA, Leal-Bertioli SCM, Tester M, Gao C, Godwin ID, Hayes BJ, Wulff BBH (2019) Breeding crops to feed 10 billion. Nat. Biotechnol. 37:744-754.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eHooghvorst I, L\u0026oacute;pez-Cristoffanini C, Nogu\u0026eacute;s S (2019) Efficient knockout of phytoene desaturase gene using CRISPR/Cas9 in melon. Sci. Rep. 9:17077\u003c/li\u003e\n \u003cli\u003eJanssens C, Havlik P, Krisztin T, Baker J, Frank S, Hasegawa T, Leclere D, Ohrel S, Ragnauth S, Schmid E, Valin H, Van Lipzig N, Maertens M (2020) Global hunger and climate change adaptation through international trade.Nat. Clim. Change. 10:829-835.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eJi J, Zhang C, Sun Z, Wang L, Duanmu D, Fan Q (2019) Genome editing in cowpea Vigna unguiculata using CRISPR-Cas9. Int. J. Mol. Sci. 20:2471\u003c/li\u003e\n \u003cli\u003eJiang W, Yang B, Weeks DP (2014) Efficient CRISPR/Cas9-mediated gene editing in Arabidopsis thaliana and inheritance of modified genes in the T2 and T3 generations. PloS One. 9:e99225\u003c/li\u003e\n \u003cli\u003eJinek M, Chylinski K, Fonfara I, Hauer M, Doudna JA, Charpentier E (2012) A programmable dual-RNA\u0026ndash;guided DNA endonuclease in adaptive bacterial immunity. Science. 337:816-821\u003c/li\u003e\n \u003cli\u003eKamens J (2015) The Addgene repository: an international nonprofit plasmid and data resource. Nucleic Acids Res. 43:D1152-D1157\u003c/li\u003e\n \u003cli\u003eKarmakar S, Molla KA, Gayen D, Karmakar A, Das K, Sarkar SN, Datta K, Datta SK (2019) Development of a rapid and highly efficient Agrobacterium-mediated transformation system for pigeon pea [\u003cem\u003eCajanus cajan\u003c/em\u003e (L.) Millsp]. GM Crops Food. 10:115-138\u003c/li\u003e\n \u003cli\u003eKearse M, Moir R, Wilson A, Stones-Havas S, Cheung M, Sturrock S, Buxton S, Cooper A, Markowitz S, Duran C (2012) Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinform. 28:1647-1649\u003c/li\u003e\n \u003cli\u003eKulshreshtha SN, Wheaton EE (2018) Sustainable Agriculture and Climate ChangeMDPI Basel.\u003c/li\u003e\n \u003cli\u003eKumar S, Rymarquis LA, Ezura H, Nekrasov V (2021) CRISPR-Cas in agriculture: Opportunities and challenges. Front. Plant Sci. 12:672329\u003c/li\u003e\n \u003cli\u003eLabun K, Montague TG, Krause M, Torres Cleuren YN, Tjeldnes H, Valen E (2019) CHOPCHOP v3: expanding the CRISPR web toolbox beyond genome editing. Nucleic Acids Res. 47:W171-W174\u003c/li\u003e\n \u003cli\u003eLiu Y, Chen Z, Zhang C, Guo J, Liu Q, Yin Y, Hu Y, Xia H, Li B, Sun X (2024) Gene editing of ZmGA20ox3 improves plant architecture and drought tolerance in maize. Plant Cell Rep. 43:18\u003c/li\u003e\n \u003cli\u003eLowder LG, Zhang D, Baltes NJ, Paul III JW, Tang X, Zheng X, Voytas DF, Hsieh T-F, Zhang Y, Qi Y (2015) A CRISPR/Cas9 toolbox for multiplexed plant genome editing and transcriptional regulation. Plant Physiol. 169:971-985\u003c/li\u003e\n \u003cli\u003eLu QSM, Tian L (2022) An efficient and specific CRISPR-Cas9 genome editing system targeting soybean phytoene desaturase genes. BMC Biotechnol. 22:7\u003c/li\u003e\n \u003cli\u003eMa X, Zhang Q, Zhu Q, Liu W, Chen Y, Qiu R, Wang B, Yang Z, Li H, Lin Y (2015) A robust CRISPR/Cas9 system for convenient, high-efficiency multiplex genome editing in monocot and dicot plants. Mol. Plant. 8:1274-1284\u003c/li\u003e\n \u003cli\u003eMainkar P, Manape TK, Satheesh V, Anandhan S (2023) CRISPR/Cas9-mediated editing of PHYTOENE DESATURASE gene in onion (\u003cem\u003eAllium cepa\u003c/em\u003e L.). Front. Plant Sci. 14\u003c/li\u003e\n \u003cli\u003eMehta R, Radhakrishnan T, Kumar A, Yadav R, Dobaria JR, Thirumalaisamy PP, Jain RK, Chigurupati P (2013) Coat protein-mediated transgenic resistance of peanut (\u003cem\u003eArachis hypogaea\u003c/em\u003e L.) to peanut stem necrosis disease through Agrobacterium-mediated genetic transformation. Indian J. Virol. 24:205-213\u003c/li\u003e\n \u003cli\u003eMeng Y, Hou Y, Wang H, Ji R, Liu B, Wen J, Niu L, Lin H (2017) Targeted mutagenesis by CRISPR/Cas9 system in the model legume \u003cem\u003eMedicago truncatula\u003c/em\u003e. Plant Cell Rep. 36:371-374\u003c/li\u003e\n \u003cli\u003eMikami M, Toki S, Endo M (2016) Precision targeted mutagenesis via Cas9 paired nickases in rice. Plant Cell Physiol. 57:1058-1068\u003c/li\u003e\n \u003cli\u003eM\u0026oacute;ring A, Hooda S, Raghuram N, Adhya TK, Ahmad A, Bandyopadhyay SK, Barsby T, Beig G, Bentley AR, Bhatia A (2021) Nitrogen challenges and opportunities for agricultural and environmental science in India. Front. sustain. food syst. \u0026nbsp;5:505347\u003c/li\u003e\n \u003cli\u003eNaim F, Dugdale B, Kleidon J, Brinin A, Shand K, Waterhouse P, Dale J (2018) Gene editing the phytoene desaturase alleles of Cavendish banana using CRISPR/Cas9. Transgenic Res. 27:451-460\u003c/li\u003e\n \u003cli\u003eNeelakandan AK, Subedi B, Traore SM, Binagwa P, Wright DA, He G (2022) Base editing in peanut using CRISPR/nCas9. Front. genome ed. 4:901444\u003c/li\u003e\n \u003cli\u003eNeelakandan AK, Wright DA, Traore SM, Chen X, Spalding MH, He G (2022) CRISPR/Cas9 based site-specific modification of FAD2 cis-regulatory motifs in peanut (Arachis hypogaea L). Front. Genet. 13:849961\u003c/li\u003e\n \u003cli\u003eNtui VO, Tripathi JN, Tripathi L (2020) Robust CRISPR/Cas9 mediated genome editing tool for banana and plantain (\u003cem\u003eMusa\u003c/em\u003e spp.). Curr. Plant Biol. 21:100128\u003c/li\u003e\n \u003cli\u003eOchatt S, Conreux C, Moussa Mcolo R, Despierre G, Magnin-Robert J-B, Raffiot B (2018) Phytosulfokine-alpha, an enhancer of in vitro regeneration competence in recalcitrant legumes. Plant Cell, Tissue Organ Cult. 135:189-201\u003c/li\u003e\n \u003cli\u003eOdipio J, Alicai T, Ingelbrecht I, Nusinow DA, Bart R, Taylor NJ (2017) Efficient CRISPR/Cas9 genome editing of phytoene desaturase in cassava. Front. Plant Sci. \u0026nbsp;8:1780\u003c/li\u003e\n \u003cli\u003eOjiewo CO, Janila P, Bhatnagar-Mathur P, Pandey MK, Desmae H, Okori P, Mwololo J, Ajeigbe H, Njuguna-Mungai E, Muricho G (2020) Advances in crop improvement and delivery research for nutritional quality and health benefits of groundnut (\u003cem\u003eArachis hypogaea\u003c/em\u003e L.). Front. Plant Sci. \u0026nbsp;11:29\u003c/li\u003e\n \u003cli\u003ePoczai P, Varga I, Laos M, Cseh A, Bell N, Valkonen JP, Hyv\u0026ouml;nen J (2013) Advances in plant gene-targeted and functional markers: a review. Plant Methods. 9:1-32\u003c/li\u003e\n \u003cli\u003ePrasad K, Bhatnagar-Mathur P, Waliyar F, Sharma KK (2013) Overexpression of a chitinase gene in transgenic peanut confers enhanced resistance to major soil borne and foliar fungal pathogens. J. Plant Biochem. Biotechnol. 22:222-233\u003c/li\u003e\n \u003cli\u003ePratap A, Prajapati U, Singh CM, Gupta S, Rathore M, Malviya N, Tomar R, Gupta AK, Tripathi S, Singh NP (2018) Potential, constraints and applications of in vitro methods in improving grain legumes. Plant Breed. 137:235-249\u003c/li\u003e\n \u003cli\u003eQin G, Gu H, Ma L, Peng Y, Deng XW, Chen Z, Qu L-J (2007) Disruption of phytoene desaturase gene results in albino and dwarf phenotypes in Arabidopsis by impairing chlorophyll, carotenoid, and gibberellin biosynthesis. Cell Res. \u0026nbsp;17:471-482\u003c/li\u003e\n \u003cli\u003eSharma K, Sreelatha G, Dayal S (2006) Pigeonpea (\u003cem\u003eCajanus cajan\u003c/em\u003e L. Millsp.). Agrobacterium Protocols. 2006; 359\u0026ndash;368.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eSharma KK, Bhatnagar-Mathur P (2006) Peanut (\u003cem\u003eArachis hypogaea\u003c/em\u003e l.). Agrobacterium Protocols:347-358\u003c/li\u003e\n \u003cli\u003eShu H, Luo Z, Peng Z, Wang J (2020) The application of CRISPR/Cas9 in hairy roots to explore the functions of AhNFR1 and AhNFR5 genes during peanut nodulation. BMC Plant Biol. 20:1-15\u003c/li\u003e\n \u003cli\u003eSingh N, Jain P, Ujinwal M, Langyan S (2022) Escalate protein plates from legumes for sustainable human nutrition. Front. nutr. 9:977986\u003c/li\u003e\n \u003cli\u003eSun X, Hu Z, Chen R, Jiang Q, Song G, Zhang H, Xi Y (2015) Targeted mutagenesis in soybean using the CRISPR-Cas9 system. Sci. Rep. 5:10342\u003c/li\u003e\n \u003cli\u003eTian L (2015) Recent advances in understanding carotenoid-derived signaling molecules in regulating plant growth and development. Front. Plant Sci. 6:790\u003c/li\u003e\n \u003cli\u003eVarshney RK, Chen W, Li Y, Bharti AK, Saxena RK, Schlueter JA, Donoghue MT, Azam S, Fan G, Whaley AM (2012) Draft genome sequence of pigeonpea (Cajanus cajan), an orphan legume crop of resource-poor farmers. Nat. Biotechnol. 30:83\u003c/li\u003e\n \u003cli\u003eWang F, Wang C, Liu P, Lei C, Hao W, Gao Y, Liu Y-G, Zhao K (2016) Enhanced rice blast resistance by CRISPR/Cas9-targeted mutagenesis of the ERF transcription factor gene OsERF922. PloS One. 11:e0154027\u003c/li\u003e\n \u003cli\u003eWang L, Rubio MC, Xin X, Zhang B, Fan Q, Wang Q, Ning G, Becana M, Duanmu D (2019) CRISPR/Cas9 knockout of leghemoglobin genes in Lotus japonicus uncovers their synergistic roles in symbiotic nitrogen fixation. New Phytol. \u0026nbsp;224:818-832\u003c/li\u003e\n \u003cli\u003eWang W, Pan Q, Tian B, He F, Chen Y, Bai G, Akhunova A, Trick HN, Akhunov E (2019) Gene editing of the wheat homologs of TONNEAU 1‐recruiting motif encoding gene affects grain shape and weight in wheat. Plant J. 100:251-264\u003c/li\u003e\n \u003cli\u003eWolabu TW, Cong L, Park J-J, Bao Q, Chen M, Sun J, Xu B, Ge Y, Chai M, Liu Z (2020) Development of a highly efficient multiplex genome editing system in outcrossing tetraploid alfalfa (Medicago sativa). Front. Plant Sci. 11:1063\u003c/li\u003e\n \u003cli\u003eYuan M, Zhu J, Gong L, He L, Lee C, Han S, Chen C, He G (2019) Mutagenesis of FAD2 genes in peanut with CRISPR/Cas9 based gene editing. BMC Biotechnol.19:1-7\u003c/li\u003e\n \u003cli\u003eZhang H, Zhang J, Wei P, Zhang B, Gou F, Feng Z, Mao Y, Yang L, Zhang H, Xu N (2014) The CRISPR/C as9 system produces specific and homozygous targeted gene editing in rice in one generation. Plant Biotechnol. J. 12:797-807\u003c/li\u003e\n \u003cli\u003eZhang S, Zhang R, Gao J, Song G, Li J, Li W, Qi Y, Li Y, Li G (2021) CRISPR/Cas9‐mediated genome editing for wheat grain quality improvement. Plant Biotechnol. J. 19:1684\u003c/li\u003e\n \u003cli\u003eZhuang W, Chen H, Yang M, Wang J, Pandey MK, Zhang C, Chang W-C, Zhang L, Zhang X, Tang R (2019) The genome of cultivated peanut provides insight into legume karyotypes, polyploid evolution and crop domestication. Nat. Genet. 51:865-876\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"functional-and-integrative-genomics","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"fige","sideBox":"Learn more about [Functional \u0026 Integrative Genomics](http://link.springer.com/journal/10142)","snPcode":"10142","submissionUrl":"https://submission.nature.com/new-submission/10142/3","title":"Functional \u0026 Integrative Genomics","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"CRISPR/Cas9, Gene editing, Groundnut, Pigeonpea, Phytoene desaturase (PDS) ","lastPublishedDoi":"10.21203/rs.3.rs-3914711/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3914711/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThe CRISPR/Cas9 technology, renowned for its ability to induce precise genetic alterations in various crop species, has encountered challenges in its application to grain legume crops such as pigeonpea and groundnut. Despite attempts at gene editing in groundnut, the low rates of transformation and editing have impeded its widespread adoption in producing genetically modified plants. This study seeks to establish an effective and stable CRISPR/Cas9 system in pigeonpea and groundnut through \u003cem\u003eAgrobacterium\u003c/em\u003e-mediated transformation, with a focus on targeting the \u003cem\u003ephytoene desaturase\u003c/em\u003e (\u003cem\u003ePDS\u003c/em\u003e) gene. The \u003cem\u003ePDS\u003c/em\u003e gene is pivotal in carotenoid biosynthesis, and its disruption leads to albino phenotypes and dwarfism. Two constructs (one each for pigeonpea and groundnut) were developed for the \u003cem\u003ePDS\u003c/em\u003e gene, and transformation was carried out using different explants (leaf petiolar tissue for pigeonpea and cotyledonary nodes for groundnut). By adjusting the composition of the growth media and refining \u003cem\u003eAgrobacterium\u003c/em\u003e infection techniques, transformation efficiencies of 15.2% in pigeonpea and 20% in groundnut were achieved. Mutation in \u003cem\u003ePDS\u003c/em\u003e resulted in albino phenotype, with editing efficiencies ranging from 4\u0026ndash;6%. Sequence analysis uncovered a nucleotide deletion (A) in pigeonpea and an A insertion in groundnut, leading to a premature stop codon and, thereby, an albino phenotype. This research offers a significant foundation for the swift assessment and enhancement of CRISPR/Cas9-based genome editing technologies in legume crops.\u003c/p\u003e","manuscriptTitle":"CRISPR/Cas9-mediated mutagenesis of Phytoene desaturase in pigeonpea and groundnut","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-02-02 03:16:10","doi":"10.21203/rs.3.rs-3914711/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-02-19T21:00:47+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-02-02T03:44:39+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"d30d0ef2-4e20-4efa-87bb-d652df971d82","date":"2024-02-01T18:42:29+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-02-01T18:39:08+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-02-01T13:12:52+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-02-01T13:12:52+00:00","index":"","fulltext":""},{"type":"submitted","content":"Functional \u0026 Integrative Genomics","date":"2024-01-31T17:28:16+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"functional-and-integrative-genomics","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"fige","sideBox":"Learn more about [Functional \u0026 Integrative Genomics](http://link.springer.com/journal/10142)","snPcode":"10142","submissionUrl":"https://submission.nature.com/new-submission/10142/3","title":"Functional \u0026 Integrative Genomics","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"167fb8f0-fab7-4b5e-a969-477e21ec6e7d","owner":[],"postedDate":"February 2nd, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2024-03-16T09:32:09+00:00","versionOfRecord":{"articleIdentity":"rs-3914711","link":"https://doi.org/10.1007/s10142-024-01336-9","journal":{"identity":"functional-and-integrative-genomics","isVorOnly":false,"title":"Functional \u0026 Integrative Genomics"},"publishedOn":"2024-03-13 09:32:09","publishedOnDateReadable":"March 13th, 2024"},"versionCreatedAt":"2024-02-02 03:16:10","video":"","vorDoi":"10.1007/s10142-024-01336-9","vorDoiUrl":"https://doi.org/10.1007/s10142-024-01336-9","workflowStages":[]},"version":"v1","identity":"rs-3914711","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3914711","identity":"rs-3914711","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}