Prevalence of antibiotic resistance genes in different Salmonella enterica serovars isolated from national food outbreaks

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher
AI-generated summary by claude@2026-07, 2026-07-17

This study assessed antibiotic resistance genes in 39 Salmonella isolates from food outbreaks, finding that 80% were multidrug-resistant, with specific genes like sul2, sul3, tetA, and gyrA detected in resistant strains.

One-sentence paraphrase of the abstract; not a substitute for reading it. No clinical advice. How this works

Abstract

Abstract Background Due to various reasons, outbreaks of foodborne diseases are spreading worldwide causing significant mortality and morbidity. The purpose of this study was the prevalence of antibiotic resistance genes in different Salmonella enterica serovars isolated from national food outbreaks. Materials and Methods From 360 stool swab samples, 39 Salmonella were isolated based on phenotypic tests. Then the frequency of qnr A, G test, A, qnr B, qnr S, gyr A, sul 1, sul 2, sul 3, tet A, tet B, and tet G resistance genes was assessed using PCR amplification followed by DNA electrophoresis. Also, the pattern of antibiotic susceptibility of the isolates was determined by disk diffusion method. Results Among 39 Salmonella isolates, 80% of them were resistant to at least two or more antibiotics. Out of resistant isolates, 7 isolates indicated resistance to cotrimoxazole, 5 of them had sul 2 gene and 2 carried sul 3 gene. All tetracycline-resistant isolates carried the tet A gene. Only one isolate was found as resistant to nalidixic acid, due to gyr A gene detection. Conclusion In this study an increase in antibiotic resistance was observed. Therefore, surveying the antibiotic resistance pattern in Salmonella and similar bacterial enteric pathogens should to be a priority for public health authorities.
Full text 103,653 characters · extracted from preprint-html · click to expand
Prevalence of antibiotic resistance genes in different Salmonella enterica serovars isolated from national food outbreaks | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Prevalence of antibiotic resistance genes in different Salmonella enterica serovars isolated from national food outbreaks Mohammad Mehdi Soltan-Dallal, Zahra Rajabi, Elahe Ahmadi, Moslem Papizadeh This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7052748/v1 This work is licensed under a CC BY 4.0 License Status: Under Revision Version 1 posted 13 You are reading this latest preprint version Abstract Background Due to various reasons, outbreaks of foodborne diseases are spreading worldwide causing significant mortality and morbidity. The purpose of this study was the prevalence of antibiotic resistance genes in different Salmonella enterica serovars isolated from national food outbreaks. Materials and Methods From 360 stool swab samples, 39 Salmonella were isolated based on phenotypic tests. Then the frequency of qnr A, G test, A, qnr B, qnr S, gyr A, sul 1, sul 2, sul 3, tet A, tet B, and tet G resistance genes was assessed using PCR amplification followed by DNA electrophoresis. Also, the pattern of antibiotic susceptibility of the isolates was determined by disk diffusion method. Results Among 39 Salmonella isolates, 80% of them were resistant to at least two or more antibiotics. Out of resistant isolates, 7 isolates indicated resistance to cotrimoxazole, 5 of them had sul 2 gene and 2 carried sul 3 gene. All tetracycline-resistant isolates carried the tet A gene. Only one isolate was found as resistant to nalidixic acid, due to gyr A gene detection. Conclusion In this study an increase in antibiotic resistance was observed. Therefore, surveying the antibiotic resistance pattern in Salmonella and similar bacterial enteric pathogens should to be a priority for public health authorities. Salmonella Antibiotic resistance Outbreak Foodborne disease Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Foodborne pathogens are causing a great number of diseases with significant effects on human health and economy even in industrialized countries. Recent data have highlighted the fact that more than 30% of people get foodborne disease each year [ 1 ]. The emergence of food-borne pathogens, along with antibiotic resistance caused by these bacteria and their effects on public health is one of the most important challenges in the health care system [ 2 ]. Many of these emerging pathogens have become highly resistant to antimicrobial agents resulted from the overuse of antibiotics as supplements in the livestock industry [ 3 ]. Salmonellosis is an important health problem and is responsible for the highest number of deaths due to foodborne disease worldwide. Among the various Salmonella serovars, Salmonella enterica is one of the most important gastrointestinal pathogen in humans [ 4 ]. Salmonella gastroenteritis is a self-limiting infection without the need for antibiotic treatment. Salmonella can lead to systemic diseases such as bacteremia, meningitis, endocarditis and osteomyelitis, which mediated high mortality, especially in people with defective immune systems [ 5 ]. According to the CLSI standard protocol, ampicillin, chloramphenicol, and cotrimoxazole were the antibiotics of choice for the treatment of salmonellosis up to the 1980s, when the first resistant strains to ampicillin, chloramphenicol, cotrimaxazole, tetracycline, and streptomycin were identified in S. Typhimurium DT 104 [ 6 ]. S. Typhimurium DT 104 first reported in the exotic bird in the United Kingdom, however, it was soon reported from the cattle and the human, worldwide [ 7 ]. Over the past two decades, Multi drug resistance (MDR) strains of Salmonella have been reported from around the world, leading to the use of broad-spectrum cephalosporins and fluoroquinolones to treat infections mediated by MDR strains of Salmonella [ 8 ]. Tetracycline is a broad-spectrum antibiotic that inhibits the growth of most gram-positive and gram-negative bacteria. Different tet genes have been identified for tetracycline resistance in Salmonella . Most types of tet genes belong to classes A, B, C, D, and G [ 9 , 10 ]. tet gene belongs to class A are found on both plasmid and chromosome. In place, tet B, C, and D genes are located on the chromosome of various Salmonella enterica serovars [ 11 ]. The most common tet genes in gram-negatives are efflux pumps, which are encoded by tet G, tet D, tet C, tet B, and tet A genes [ 12 ]. Interestingly, the main mechanism of tetracycline resistance is the acquisition of the tet genes which attribute drug resistance via efflux pumps, ribosomal protection, and enzyme inactivation. Other mechanisms of tetracycline resistance in some bacteria include mutations, impermeability barriers, and multiple transmission systems. Fluoroquinolones are broad-spectrum antibiotics, and resistance to this group of antibiotics is due to mutations in genes which code for the DNA gyrase and DNA topoisomerase, the two enzymes responsible for modifying the DNA configurations. It is also the result of reduced drug accumulation within the bacterium due to the high expression of efflux pump. Recently, antibiotic-resistant qnr plasmids ( qnr A, B and S ) have been identified in different strains of intestinal bacterial pathogens, including Salmonella . Qnr are repetitive penta-peptide proteins that inhibit the binding of quinolones to topoisomerase. These proteins develop resistance to nalidixic acid and reduce bacterial susceptibility to fluoroquinolones [ 13 ]. The most important mechanism of resistance of fluoroquinolones in Enterobacteriaceae is the accumulation of mutations in the target enzymes of fluoroquinolones such as DNA gyrase and DNA topoisomerase. Each of these enzymes has a (quinolone resistance determining region) QRDR [ 14 ]. Considering the importance of the drug resistance in Salmonella as one of the major enteric bacterial pathogens, the frequency of various antibiotic resistance genes in isolates detected in national food outbreaks was investigated in this research. Materials & Methods In this research 360 fecal samples from food outbreaks were collected and examined for detection of the Salmonella . Cases with conventional biochemical and serological tests were considered as positive samples [ 15 ]. Determination of microbial susceptibility pattern The antibiotic susceptibility test was determined by disk diffusion method [ 17 ]. Isolates to be characterized based on biochemical tests. Pure colony from fresh culture was inoculated into 0.09% saline solution to prepare a turbidity equivalent to the McFarland 0.5 turbidity standard. The microbial suspension was cultured on Müller-Hinton agar medium. Antibiotic disks of ampicillin, cefotaxime, ceftazidime, ceftriaxone, cefpime, streptomycin, tetracycline, nalidixic acid, ciprofloxacin, chloramphenicol, cotrimoxazole, imipenem, were placed on the agar medium. Distance between disks was around 21 mm. Determination of MIC ciprofloxacin in nalidixic acid resistant strains using E-test Ciprofloxacin MIC was performed for isolates that have reduced resistance or sensitive to nalidixic acid by disk diffusion method (18). Pure colony from fresh culture was swabbed on Müller-Hinton agar medium like above. With sterile forceps, the E-Test strip was placed on the agar medium and after 18–24 hours, the intersection of bacterial growth with the lowest concentration of the strip was measured. Determination of Ceftriaxone MIC in Salmonella enteritidis strains using E-test Ceftriaxone MIC was performed for isolates that had intermediate sresistance or sensitivity to ceftriaxone by disk diffusion method [ 18 ]. Pure colony from fresh culture was inoculated into a 0.09% saline solution to have a turbidity equivalent to McFarland 0.5 turbidity standard. The microbial suspension was swabbed on Müller-Hinton agar medium. With sterile forceps, the E-Test strip was placed on the agar medium and after 18–24 hours, the intersection of bacterial growth with the lowest concentration of the strip was measured. Molecular detection of antibiotic resistance genes DNA was extracted using the simple boiling procedure as described previously [ 19 ]. Resistance genes to the selected antibiotics was assessed using PCR amplification by specific primers demonstrated in Table 1 [ 20 , 21 ]. The final reaction volume was 20 microliters. For each reaction, 10 µl of ready-to-use amplicon master-mix and 0.5 µl of Forward primer, 0.5 µl of Reverse primer and 1 µl of DNA were added and made up to 20 µl with distilled water [ 16 ]. After the microtube were prepared, the peQSTAR model was placed in a PeQLab thermocycler, and the reaction was performed with a temperature program that was set for each primer. The primers used are introduced in Table 1 . Table 1 Required Primers to identify antibiotic resistance genes. Gene Name Primers sequence Product band size References qnrA F: ATTTCTCACGCCAGGATTTG R: GATCGGCAAAGGTTAGGTCA 516 Ahmet et al. (2009b) [ 20 ] qnrB F: GATCGTGAAAGCCAGAAAGG R: ACGATGCCTGGTAGTTGTCC 469 Ahmet et al. (2009b) [ 20 ] qnrS F: ACGACATTCGTCAACTGCAA R: TAAATTGGCACCCTGTAGGC 417 Ahmet et al. (2009b) [ 20 ] Sul1 F: ATGGTGACGGTGTTCGGCATTCTG R: GCTAGGCATGATCTAACCCTCGG 841 Phuong Hoa et al. [ 21 ] Sul2 F: AGGGGGCAGATGTGATCGAC R: GCAGATGATTTCGCCAATTG 249 Phuong Hoa et al. (2008) [ 21 ] Sul3 F: TCAAAGCAAAATGATATGAGC R: TTTCAAGGCATCTGATAAAGAC 787 Phuong Hoa et al. (2008) [ 21 ] tetA F: GCTACATCCTGCTTGCCTTC 210 R: CATAGATCGCCGTGAAGAGG 469 Sheykhsaran et al. (2018)[ 22 ] tetB F: TTGGTTAGGGGCAAGTTTTG R: GTAATGGGCCAATAACACCG 659 Sheykhsaran et al. (2018)[ 22 ] tetG F: AGCAGCCTCAACCATTGCCGAT R: GGTGTTCCACTGAAAACGGTCCT 391 Sheykhsaran et al. (2018) [ 22 ] gyrA F: GGTACACCGTGCCGTACTTT R: TCCACGAAATCCACCGTC 312 Brown JC et al. (1996)[ 23 ] For DNA electrophoresis,1% (W/V) agarose gel was used. In order to estimate the sizes of the PCR-amplified bands, electrophoresis of PCR product was performed in the presence of 100 bp marker (100 volts, 37 minutes). DNA gel stain-100.000x was used for gel staining and DNA visualization. Results In this study, from 360 samples of fecal swaps, 39 Salmonella isolates were detected. Based on serological reactions, out of 39 Salmonella isolates, 24 isolates were identified as Salmonella serogroup (D), 6 isolates as serogroup (B), 6 isolates as serogroup (C), and 3 isolates as serogroup (A). Antibiotic susceptibility test results showed that all the Salmonella enterica were sensitive to imipenem and meropenem (100%). The ceftriaxone, chloramphenicol, and cefotaxime they showed almost the same result (97.43%), ciprofloxacin (98.74%) and cotrimoxazole (82.05%). The highest level of resistance was seen against nalidixic acid (71.8%) (Table 2 ). Table 2 Antibiotic susceptibility in 39 isolates of Salmonella enterica subgroup D Type of antibiotic 24 = No Total Sensitive Intermediate Resistance Ampicillin 14 (58/4) 2 (8/3) 8 (33/3) 24 (100/0) Cefotaxime 24 (100/0) 0 (0/0) 0 (0/0) 24 (100/0) Ceftazidime 15 (62/5) 2 (8/3) 7 (29/2) 24 (100/0) Ceftriaxone 23 (95/9) 0 (0/0) 1 (4/1) 24 (100/0) Cefepime 20 (83/4) 2 (8/3) 2 (8/3) 24 (100/0) Streptomycin 24 (100/0) 0 (0/0) 0 (0/0) 24 (100/0) Tetracyclin 24 (100/0) 0 (0/0) 0 (0/0) 24 (100/0) Nalidixic acid 3 (8/4) 3 (12/5) 19 (79/1) 24 (100/0) Ciprofloxacin 22 (91/7) 0 (0/0) 2 (8/3) 24 (100/0) Chloramphenic 24 (100/0) 0 (0/0) 0 (0/0) 24 (100/0) Imipenem 24 (100/0) 0 (0/0) 0 (0/0) 24 (100/0) Meropenem 24 (100/0) 0 (0/0) 0 (0/0) 24 (100/0) Cotrimoxazole 23 (95/9) 0 (0/0) 1 (4/1) 24 (100/0) MIC test was performed on isolates that were resistant, intermediate, or sensitive to ciprofloxacin and ceftriaxone, according to CLSI2016 and EUCAST2017 guidelines. The MIC level in Salmonella enteritidis isolates is shown in Table 3 , and different MIC values of ciprofloxacin and ceftriaxone in Fig. 3 . Table 3 MIC rate of isolates based on CLSI Antibiotic CLSI2018 µg/ml Sensitive Intermediate Resistance ciprofloxaci 0.002–0.064 0.5-0.125 1–32 ceftriaxone 1-0.016 2 4-256 In this study, among 39 Salmonella enteritidis , 5 isolate (12.8%) had tetracycline resistance. All of them were positive for tet A gene and none of the tetracycline-resistant isolates had tet B and tet G genes (Fig. 1 ). In addition, among 39 Salmonella enterica isolates from different sources, 7 isolates (17.94%) were resistant to cotrimoxazole. Among cotrimoxazole-resistant isolates, 5 (12.8%) had sul -2 gene and 2 (5.12%) had sul -1 gene. The sul -3 gene was not observed in any of the cotrimoxazole-resistant isolates (Fig. 2 , 3 ). Among 39 Salmonella enterica isolates, 2 (5.1%) were resistant to ciprofloxacin. None of the isolates had qnr A and qnr B genes and only 1 (2.56%) had qnr S gene. see Fig. 4 . Among 39 Salmonella enterica isolates, 28 isolates (71.8%) were resistant to nalidixic acid antibiotic, of which only 1 isolate had gyr A gene Fig. 5 . Discussions Salmonellosis is gastroenteritis caused by infection with various Salmonell a serovars and is the most common type of food poisoning in the world. Among bacterial pathogens, Salmonella has a special place and Salmonella enterica is a subspecies of enterica serovars enteritidis, one of the most important causes of the epidemic and endemic gastroenteritis in humans worldwide [ 24 ]. The results of serotyping of human and food Salmonella isolates highlighted the Enteritidis as the most important serotype. In the study by Soltan Dallal, et al (2009), diarrhea samples of 1950 children under 5 years of age were studied and the rate of infection with various bacterial pathogens was (7.5%). The rate of infection with various Salmonella serovars was (8. 17%) and the most common serovars Salmonella Enteritidis has been reported [ 25 ]. The prevalence of Salmonella Enteritidis infection has increased in many countries and currently is the most predominant serotype in Europe (26). In Germany, between 1985 and 1995 the rate of salmonellosis almost tripled and this phenomenon is due to the excessive increase in the prevalence of serovars Enteritidis [ 26 ]. The distribution of Salmonella serovars vary according to geographical area and type of ecology (animal reservoirs). According to the World Health Organization, the global distribution of Salmonella serovars as follow, Salmonella Enteritidis with a frequency of (65%), Salmonella Typhimurium (12%), and Salmonella Newport (4%,) respectively [ 27 ]. Despite appropriate measures to control and prevent infections caused by this serovar, Salmonella Enteritidis is still the most common cause of Salmonella gastroenteritis worldwide. The high prevalence of multiple antibiotic resistance in foodborne pathogens has been reported in recent years due to the widespread use of antimicrobials in medical and veterinary [ 28 ]. Increasing antibiotic resistance in non-typhoid Salmonella serovars has led to an increase in the development of multidrug-resistant serovars which is a global public health problem [ 29 ]. Transmission of resistance genes from infected animals to humans through the food chain is a serious risk to human health [ 30 ]. Soltan Dallal et al, (2020) reported that 24 Salmonella isolates have been detected in screening of 800 rectal swab samples. The most prevalent serotype was S. enteritidis (n = 10, 41.7%), followed by S. paratyphi C, (n = 6, 25%), S. paratyphi B (n = 4, 16.7%), S. arizonae 2 (n = 2, 8.3%), and S. paratyphi A (n = 2, 8.3%). The highest rates of antibiotic resistance were obtained for nitrofurantoin (100%), followed by nalidixic acid (45.8%), and tetracycline (16.7%). Of 24 S. enteritidis , 9 distinct antibiotypes (Abs) were observed. In this respect, 3 isolates (12.5%) were resistant to at least three or more antibiotics [ 31 ]. Valdezate (2007) et al. examined the antibiotic resistance pattern of 264 Salmonella enterica isolates in food, S. entritidis serovar, which was the most common serovar (36.3%). The most common resistance antibiotic was nalidixic acid (40.6%), tetracycline (15.6%), ampicillin (8.3%), trimethoprim sulfamethoxazole (7.3%), and streptomycin (3.1%) respectively. All the isolates were sensitive to chloramphenicol [ 32 ]. The fluoroquinolones and third-generation cephalosporin are the drugs of choice for the treatment of salmonellosis in humans and animals. In recent years, resistance to the above antibiotics has developed among Salmonella serovars, which has complicated the treatment of salmonellosis. Kumar et al. showed that Salmonella typhimurium isolates with high resistance to nalidixic acid showed reduced sensitivity to ciprofloxacin [ 33 ]. In a 2007 study by Martínez et al. In Spain it was shown that the MIC of ciprofloxacin for Salmonella brandenburg isolates from fecal samples of patients with gastroenteritis symptoms and food samples as well as sewage was reported to be 2 µg.ml for some isolates [ 34 ]. Resistance to broad-spectrum cephalosporin among Salmonella strains has been increasing over the past two decades. The present study showed that S. enterica isolated in human and foods were resistant to third-generation cephalosporin such as ceftriaxone, cefotaxime and ceftazidime. Studies conducted by Zahraei Salehi et al., in (2011) showed all Salmonella isolates were susceptible to third-generation cephalosporin [ 35 ]. In a study by Wu et al., resistance to ceftazidime was not observed [ 36 ]. Tetracycline is the most common antibiotic used in veterinary medicine in many parts of the world. Genes encoding tetracycline resistance are easily propagated by locating on mobile genetic elements such as plasmids and transposons. Recently, a variety of genes have been identified for resistance to tetracycline, including tet A, tet B, tet D, tet E, and tet G. The tet A gene, which encodes the proteins of the efflux pump, is located on the unconjugated transposon Tn / 721. This transposon has been found on mobile and conjugated plasmids in various Salmonella hosts from various sources. Recent studies have shown that transposon Tn / 721 and transposon Tn3 (which carries the TEM-1 gene) have a similar genetic map and are found in conjugated and non-conjugated plasmids on the host chromosome. These two transposons have been found in different Salmonella serotypes [ 37 ]. Previous study shown an upward trend in antimicrobial resistance toward next generation of antibiotics [ 38 , 39 ]. Investigation of antibiotic resistant in the Salmonella in the previous study shown that the less than a quarter of isolates have multidrug resistance [ 40 ], however in this study this amount increased to three-quarters of the isolates. Since the increasing the antimicrobial resistant toward antibiotics are increasing rapidly other way to treatment such as phage-therapy can be used [ 41 – 43 ]. Other strategy can be used against antibiotic resistant isolate is efflux pump inhibitor. Efflux pump inhibitor lead to prevent pump activity that cause the accumulation of antibiotic within the pathogenic bacteria and cause their death [ 44 ]. Conclusion Salmonella serovars are resilient microorganisms with a complex genomic system that makes the microorganism able to react to different harsh environmental conditions. Resistance in Salmonella spp. is rising towards critical levels. Regular monitoring of the pattern of resistance of bacteriological isolates is critical to develop antibiotic policy to combat the problem. Further monitoring will be critical in the coming years to analyses the evolution of Salmonella strains and their resistance patterns. In addition to monitoring the progress of antimicrobial resistance, using other strategy such as phage-therapy and efflux pump inhibitor also can be used as complementary strategies. Declarations Acknowledgment We would like to thank the Vice Chancellor for Research of Tehran University of Medical Sciences for sponsoring this research project. This article is the result of a research grant approved by the Zoonoses Research Center, Tehran University of Medical Sciences with the code 39152. We would like to thank the Vice Chancellor for Research of Tehran University of Medical Sciences for sponsoring this research project. Clinical trial number Not applicable. Authors’ contributions MMSD, ZR, designed the study. ZR and EA collected samples and performed experiments and analyzed the data and prepared the graphs. MP wrote the manuscript and contributed in data analyses. MMSD and MP revised the manuscript and made constructive suggestions. All authors read and approved the final manuscript. Funding This work was supported by Tehran University of Medical Sciences. This article is the result of a research grant approved by the Zoonoses Research Center, Tehran University of Medical Sciences with the code 39152. Ethics approval and consent to participate The study protocol was approved by the Ethics Committee on Tehran University of Medical Sciences (the ethics code IR.TUMS.VCR.REC.1397.589). All participants were willing to participate in this study and informed consent was obtained. Their choices did not affect the treatment process. This study adheres to the Declaration of Helsinki. Consent for publication Not applicable. Competing interests The authors declare no competing interests. References Marino DD. 2007. Water and food safety in the developing world: global implications for health and nutrition of infants and young children. JAD A . 107(11):1930-4. Koluman A, Dikici A. 2013. Antimicrobial resistance of emerging foodborne pathogens: status quo and global trends. Crit Rev Microbiol . 39(1):57-69. El Allaoui A, Rhazi FF, Essahale A, Bouchrif B, Karraouan B, Ameur N, et al. 2013. Characterization of antimicrobial susceptibility, virulence genes and identification by 16S ribosomal RNA gene sequencing of Salmonella serovars isolated from turkey meat in Meknes, Morocco. Int J Microbiol Immunol Res .1:68-79. Nair S, Lin TK, Pang T, Altwegg M. 2002. Characterization of Salmonella serovars by PCR-single-strand conformation polymorphism analysis. J C lin M icrobiol . 40(7):2346-51. Santos AC, Roberts JA, Cook AJC, Simons R, Sheehan R, Lane C, et al. 2011. Salmonella Typhimurium and Salmonella Enteritidis in England: costs to patients, their families, and primary and community health services of the NHS. Epidemiol Infect . 139(5):742-53. Schiaffino A, Beuzon CR, Uzzau S, Leori G, Cappuccinelli P, Casadesús J, et al. 1996. Strain typing with IS200 fingerprints in Salmonella abortusovis. Appl Environ Microbiol . 62(7):2375-80. Meunier D, Boyd D, Mulvey MR, Baucheron S, Mammina C, Nastasi A, et al. 2022. Salmonella enterica serotype Typhimurium DT 104 antibiotic resistance genomic island I in serotype Paratyphi B. Emerg Infect Dis . 8(4):430. Woodford N, Stigter JM. Molecular investigation of glycopeptide resistance in gram-positive bacteria. Molecular bacteriology: Springer; 1998. p. 579-615. Chopra I, Roberts M. 2001. Tetracycline antibiotics: mode of action, applications, molecular biology, and epidemiology of bacterial resistance. M MBR . 65(2):232-60. Frech G, Schwarz S. 1998. Tetracycline resistance in Salmonella enterica subsp. enterica serovar Dublin. Antimicrob Agents Chemother . 42(5):1288-9. Frech G, Schwarz S. 2000. Molecular analysis of tetracycline resistance in Salmonella enterica subsp. enterica serovars Typhimurium, Enteritidis, Dublin, Choleraesuis, Hadar and Saintpaul: construction and application of specific gene probes. J A ppl M icrobiol . 89(4):633-41. Schwarz S, Chaslus-Dancla E. 2001. Use of antimicrobials in veterinary medicine and mechanisms of resistance. Vet R es . 32(3-4):201-25. Cattoir V, Weill F-X, Poirel L, Fabre L, Soussy C-J, Nordmann P. 2007. Prevalence of qnr genes in Salmonella in France. J Antimicrob Chemother . 59(4):751-4. Robicsek A, Jacoby GA, Hooper DC. 2006. The worldwide emergence of plasmid-mediated quinolone resistance. Lancet I nfect D is . 6(10):629-40. Procop GW, Church DL, Hall GS, Janda WM. Koneman's color atlas and textbook of diagnostic microbiology: Jones & Bartlett Publishers; 2020. Eshaghi Zadeh SH, Fahimi H, Fardsanei F, Soltan Dallal MM. 2020. Antimicrobial resistance and presence of class 1 integrons among different serotypes of Salmonella spp. recovered from children with diarrhea in Tehran, Iran. Infect Disord-Drug Targets (Formerly Current Drug Targets-Infectious Disorders). 20(2):160-6. Wayne PA. Clinical and laboratory standards institute. Performance standards for antimicrobial susceptibility testing. 2016. Patel JB, Cockerill FR, Bradford PA. Performance standards for antimicrobial susceptibility testing: twenty-fifth informational supplement. 2015. Mirzaie S, Hassanzadeh M, Ashrafi I. 2010. Identification and characterization of Salmonella isolates from captured house sparrows. Turk J Vet Anim Sci . 34(2):181-6. Ahmed AM, Ishida Y, Shimamoto T. 2009. Molecular characterization of antimicrobial resistance in Salmonella isolated from animals in Japan. J A ppl M icrobiol .106(2):402-9. Hoa PTP, Nonaka L, Viet PH, Suzuki S. 2008. Detection of the sul1 , sul2 , and sul3 genes in sulfonamide-resistant bacteria from wastewater and shrimp ponds of north Vietnam. Sci Total Environ . 405(1-3):377-84. Sheykhsaran E, Bannazadeh Baghi H, Soroush Barhaghi MH, Alizadeh N, Memar MY, Etemadi S, et al. 2018. The rate of resistance to tetracyclines and distribution of tetA, tetB, tetC, tetD, tetE, tetG, tetJ and tetY genes in Enterobacteriaceae isolated from Azerbaijan, Iran during 2017. Physiol Pharmacol . 22(3):205-12. Brown JC, Thomson CJ, Amyes SGB. 1996. Mutations of the gyrA gene of clinical isolates of Salmonella typhimurium and three other Salmonella species leading to decreased susceptibilities to 4-quinolone drugs. J Antimicrob Chemother . 37(2):351-6. Pardo G, Cerdán M, Jm JV. 2012. Salmonella enteritidis bacteraemia as clinical onset of acquired immune deficiency syndrome. Rev Esp Anestesiol Reanim . 60(2):103-5. Fardsanei F, Dallal MMS, Douraghi M, Salehi TZ, Mahmoodi M, Memariani H, et al. 2017. Genetic diversity and virulence genes of Salmonella enterica subspecies enterica serotype Enteritidis isolated from meats and eggs. Microb P athog . 107:451-6. Kist M. 1991. Increase in Salmonella enteritidis infections in man: a world-wide problem. ÖGD . 53(10):687-92. Ferrari RG, Rosario DKA, Cunha-Neto A, Mano SB, Figueiredo EES, Conte-Junior CA. 2019. Worldwide epidemiology of Salmonella serovars in animal-based foods: a meta-analysis. Appl E nviron M icrobiol . 85(14):e00591-19. World Health O. WHO estimates of the global burden of foodborne diseases: foodborne disease burden epidemiology reference group 2007-2015: World Health Organization; 2015. Meakins S, Fisher IST, Berghold C, Gerner-Smidt P, Tschäpe H, Cormican M, et al. 2008. Antimicrobial drug resistance in human nontyphoidal Salmonella isolates in Europe 2000–2004: a report from the Enter-net International Surveillance Network. MD R . 14(1):31-5. Choi S-H, Woo JH, Lee JE, Park SJ, Choo EJ, Kwak YG, et al. 2005. Increasing incidence of quinolone resistance in human non-typhoid Salmonella enterica isolates in Korea and mechanisms involved in quinolone resistance. J Antimicrob Chemother . 56(6):1111-4. Fardsanei F, Soltan Dallal MM, Memariani M, Sharifi-Yazdi S, Nabatchian F, Sharifi-Yazdi MK. 2020. The Study of Antimicrobial Resistance among Salmonella enterica Strains Isolated from Children with Gastroenteritisin in Tehran, Iran. J Med Bacteriol . 25-32. Valdezate S, Arroyo M, González-Sanz R, Ramiro R, Herrera-Leon S, Usera MA, et al. 2007. Antimicrobial resistance and phage and molecular typing of Salmonella strains isolated from food for human consumption in Spain. J F ood P rot. 70(12):2741-8. Kumar Y, Sharma A, Mani KR. 2009. High level of resistance to nalidixic acid in Salmonella enterica serovar Typhi in Central India. J Infect Dev Ctries . 3(06):467-9. Martínez N, Mendoza MC, Rodríguez I, Soto S, Bances M, Rodicio MR. 2007. Detailed structure of integrons and transposons carried by large conjugative plasmids responsible for multidrug resistance in diverse genomic types of Salmonella enterica serovar Brandenburg. J A ntimicrob C hemother . 60(6):1227-34. Salehi TZ, Madadgar O, Tadjbakhsh H, Mahzounieh MR, Feizabadi MM. 2011. A molecular study of the Salmonella enterica serovars Abortusovis, Typhimurium, and Enteritidis. Turk J Vet Anim Sci . 35(5):281-94. Vo ATT, Van Duijkeren E, Gaastra W, Fluit AC. 2010. Antimicrobial resistance, class 1 integrons, and genomic island 1 in Salmonella isolates from Vietnam. PloS one . 5(2):e9440. Pezzella C, Ricci A, DiGiannatale E, Luzzi I, Carattoli A. 2004. Tetracycline and streptomycin resistance genes, transposons, and plasmids in Salmonella enterica isolates from animals in Italy. Antimicrob Agents Chemother . 48(3):903-8. Soltan Dallal MM, Doyle MP, Rezadehbashi M, Dabiri H, Sanaei M, Modarresi S, et al. 2010. Prevalence and antimicrobial resistance profiles of Salmonella serotypes, Campylobacter and Yersinia spp. isolated from retail chicken and beef, Tehran, Iran. Food Control . 21(4):388-92. Nadi ZR, Salehi TZ, Tamai IA, Foroushani AR, Sillanpaa M, Dallal MMS. 2020. Evaluation of antibiotic resistance and prevalence of common Salmonella enterica serovars isolated from foodborne outbreaks. Microchem J . 155:104660. Soltan Dallal MM, Taremi M, Gachkar L, Modaresi SH, Sanaei M, Bakhtiari R, et al. 2009. Characterization of antibiotic resistant patterns of Salmonella serotypes isolated from beef and chicken samples in Tehran. 2009. Jundishapur J Microbiol . 2(4): 124- 131. Nikkhahi F, Dallal MMS, Alimohammadi M, Foroushani AR, Rajabi Z, Fardsanei F, et al. 2017. Phage therapy: assessment of the efficacy of a bacteriophage isolated in the treatment of salmonellosis induced by Salmonella enteritidis in mice. GHFBB . 10(2):131. Vahedi A, Soltan Dallal MM, Douraghi M, Nikkhahi F, Rajabi Z, Yousefi M, et al. 2018. Isolation and identification of specific bacteriophage against enteropathogenic Escherichia coli (EPEC) and in vitro and in vivo characterization of bacteriophage. FEMS M icrobiol L ett . 365(16):fny136. Torabi BP, Soltan Dallal MM, Akbarzadeh S. 2018. Isolation and specificity of Salmonella enteritidis bacteriophage from hospital sewage sample. RJMS . 25(2): 1-9 . Khosravani M, Soltan Dallal MM, Norouzi M. 2019. marA efflux pump gene expression in Salmonella enteritidis strains treated with Artemisia tournefortiana hydroalcoholic extract and comparison with commercial efflux pump inhibitor, carbonyl cyanide 3-chlorophenylhydrazone (CCCP). Arch Med Lab Sci . 4(1). Additional Declarations No competing interests reported. Cite Share Download PDF Status: Under Revision Version 1 posted Editorial decision: Revision requested 25 Aug, 2025 Reviews received at journal 21 Aug, 2025 Reviewers agreed at journal 16 Aug, 2025 Reviews received at journal 16 Aug, 2025 Reviews received at journal 15 Aug, 2025 Reviewers agreed at journal 13 Aug, 2025 Reviewers agreed at journal 12 Aug, 2025 Reviewers agreed at journal 11 Aug, 2025 Reviewers invited by journal 11 Aug, 2025 Editor invited by journal 06 Aug, 2025 Editor assigned by journal 05 Aug, 2025 Submission checks completed at journal 05 Aug, 2025 First submitted to journal 05 Jul, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7052748","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":501352399,"identity":"b0173493-7f35-4fb3-bb55-4926ae253fbb","order_by":0,"name":"Mohammad Mehdi Soltan-Dallal","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA60lEQVRIie2PoQrCUBSGdxloEawrPoIgCOK7WHaLydsXplwZzCJaDbK9wizmMw7MMlkdaDCZl2RJPNcouGkTvF84/Bz+j8MxDI3mN2Gghmya0rg4FE0KdQAoxWTSsFOlsG8U7j/PVivdNQIW7rmz9ti84MF01F6QUjr7t8ogH9sAybW/QeZZfH8QFCRbpqcKpdUDaCCX1CQlESqYzK9QspSUO/KQrpR8m4iwVoFJD2IfeYTMt7h0RVSrqF+OK+zvSBnaCQgKMq78JcP44tywExw8zAt3JgK1KZ33yiv4nPBxn5h9U9ZoNJo/4QEWxG2BcG1VRAAAAABJRU5ErkJggg==","orcid":"","institution":"Tehran University of Medical Sciences","correspondingAuthor":true,"prefix":"","firstName":"Mohammad","middleName":"Mehdi","lastName":"Soltan-Dallal","suffix":""},{"id":501352400,"identity":"9f23d64b-fa32-4cf8-aee9-fd9c15a4f8d9","order_by":1,"name":"Zahra Rajabi","email":"","orcid":"","institution":"Tehran University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Zahra","middleName":"","lastName":"Rajabi","suffix":""},{"id":501352401,"identity":"30943791-0fc8-4b85-8ba3-688e8fc49a27","order_by":2,"name":"Elahe Ahmadi","email":"","orcid":"","institution":"Tehran University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Elahe","middleName":"","lastName":"Ahmadi","suffix":""},{"id":501352402,"identity":"2d14f7f3-f08a-4320-933d-62cbbb6ebeb3","order_by":3,"name":"Moslem Papizadeh","email":"","orcid":"","institution":"Biotechnology and Modern Medicine Organization, Tehran, Iran.","correspondingAuthor":false,"prefix":"","firstName":"Moslem","middleName":"","lastName":"Papizadeh","suffix":""}],"badges":[],"createdAt":"2025-07-05 11:23:20","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7052748/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7052748/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":89385593,"identity":"60c4b9bf-7a73-4f5e-95ad-4e5f25b747b8","added_by":"auto","created_at":"2025-08-19 12:31:26","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":76723,"visible":true,"origin":"","legend":"\u003cp\u003eAgarose gel electrophoresis of the PCR amplification products for \u003cem\u003etet\u003c/em\u003eA gene (950 base pairs). M: Marker. NC: Negative control, 1 to 4: Isolates with \u003cem\u003etet\u003c/em\u003eA gene.\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7052748/v1/8e22e546a471c7a73859a6cd.png"},{"id":89385595,"identity":"420f462f-fa70-4f90-9e16-a3d9e89bc8d0","added_by":"auto","created_at":"2025-08-19 12:31:26","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":63578,"visible":true,"origin":"","legend":"\u003cp\u003eThe Product display of 249 \u003cem\u003esul\u003c/em\u003e-1 gene game pairs\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7052748/v1/15b7ad5b1fc66a42b0fdc913.png"},{"id":89387811,"identity":"9c9e4eb1-abe8-47d7-aef0-09b4775d78c6","added_by":"auto","created_at":"2025-08-19 12:39:26","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":69693,"visible":true,"origin":"","legend":"\u003cp\u003eAgarose gel electrophoresis of the PCR amplification products for \u003cem\u003esul\u003c/em\u003e-2 gene (841 base pairs). M: Marker. NC: Negative control, 1 to 4: Isolates with \u003cem\u003esul\u003c/em\u003e-2 gene.\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7052748/v1/f4fae0a00ee30c424689d8ae.png"},{"id":89385596,"identity":"a68c7b7f-6806-4449-90d1-ec5407f2aca5","added_by":"auto","created_at":"2025-08-19 12:31:26","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":59543,"visible":true,"origin":"","legend":"\u003cp\u003eAgarose gel electrophoresis of the PCR amplification products for \u003cem\u003eqnr\u003c/em\u003eS gene (417 base pairs). M: Marker. NC: Negative control, 1 to 4: Isolates with \u003cem\u003eqnr\u003c/em\u003eS gene.\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7052748/v1/213e58feacf21d55e29a7a26.png"},{"id":89390490,"identity":"607628a7-28e7-4b00-b023-256552a3570e","added_by":"auto","created_at":"2025-08-19 12:55:26","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":38770,"visible":true,"origin":"","legend":"\u003cp\u003eAgarose gel electrophoresis of the PCR amplification products for \u003cem\u003egyr\u003c/em\u003eA gene (663 base pairs). M: Marker. NC: Negative control, 1 to 4: Isolates with \u003cem\u003egyr\u003c/em\u003eA gene.\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-7052748/v1/7aa4b26e14d66d9689b22302.png"},{"id":89391073,"identity":"d2f13fa2-4613-4642-961f-6e1cab31e0dd","added_by":"auto","created_at":"2025-08-19 13:03:27","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1112441,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7052748/v1/86de1667-a5bf-45e3-b7cf-7e176cdf4558.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Prevalence of antibiotic resistance genes in different Salmonella enterica serovars isolated from national food outbreaks","fulltext":[{"header":"Introduction","content":"\u003cp\u003eFoodborne pathogens are causing a great number of diseases with significant effects on human health and economy even in industrialized countries. Recent data have highlighted the fact that more than 30% of people get foodborne disease each year [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. The emergence of food-borne pathogens, along with antibiotic resistance caused by these bacteria and their effects on public health is one of the most important challenges in the health care system [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Many of these emerging pathogens have become highly resistant to antimicrobial agents resulted from the overuse of antibiotics as supplements in the livestock industry [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Salmonellosis is an important health problem and is responsible for the highest number of deaths due to foodborne disease worldwide. Among the various \u003cem\u003eSalmonella\u003c/em\u003e serovars, \u003cem\u003eSalmonella enterica\u003c/em\u003e is one of the most important gastrointestinal pathogen in humans [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. \u003cem\u003eSalmonella\u003c/em\u003e gastroenteritis is a self-limiting infection without the need for antibiotic treatment. \u003cem\u003eSalmonella\u003c/em\u003e can lead to systemic diseases such as bacteremia, meningitis, endocarditis and osteomyelitis, which mediated high mortality, especially in people with defective immune systems [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. According to the CLSI standard protocol, ampicillin, chloramphenicol, and cotrimoxazole were the antibiotics of choice for the treatment of salmonellosis up to the 1980s, when the first resistant strains to ampicillin, chloramphenicol, cotrimaxazole, tetracycline, and streptomycin were identified in \u003cem\u003eS. Typhimurium\u003c/em\u003e DT 104 [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. \u003cem\u003eS. Typhimurium\u003c/em\u003e DT 104 first reported in the exotic bird in the United Kingdom, however, it was soon reported from the cattle and the human, worldwide [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eOver the past two decades, Multi drug resistance (MDR) strains of \u003cem\u003eSalmonella\u003c/em\u003e have been reported from around the world, leading to the use of broad-spectrum cephalosporins and fluoroquinolones to treat infections mediated by MDR strains of \u003cem\u003eSalmonella\u003c/em\u003e [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Tetracycline is a broad-spectrum antibiotic that inhibits the growth of most gram-positive and gram-negative bacteria. Different \u003cem\u003etet\u003c/em\u003e genes have been identified for tetracycline resistance in \u003cem\u003eSalmonella\u003c/em\u003e. Most types of \u003cem\u003etet\u003c/em\u003e genes belong to classes A, B, C, D, and G [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. \u003cem\u003etet\u003c/em\u003e gene belongs to class A are found on both plasmid and chromosome. In place, \u003cem\u003etet\u003c/em\u003e B, C, and D genes are located on the chromosome of various \u003cem\u003eSalmonella enterica\u003c/em\u003e serovars [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eThe most common \u003cem\u003etet\u003c/em\u003e genes in gram-negatives are efflux pumps, which are encoded by \u003cem\u003etet\u003c/em\u003eG, \u003cem\u003etet\u003c/em\u003eD, \u003cem\u003etet\u003c/em\u003eC, \u003cem\u003etet\u003c/em\u003eB, and \u003cem\u003etet\u003c/em\u003eA genes [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Interestingly, the main mechanism of tetracycline resistance is the acquisition of the \u003cem\u003etet\u003c/em\u003e genes which attribute drug resistance via efflux pumps, ribosomal protection, and enzyme inactivation. Other mechanisms of tetracycline resistance in some bacteria include mutations, impermeability barriers, and multiple transmission systems. Fluoroquinolones are broad-spectrum antibiotics, and resistance to this group of antibiotics is due to mutations in genes which code for the DNA gyrase and DNA topoisomerase, the two enzymes responsible for modifying the DNA configurations. It is also the result of reduced drug accumulation within the bacterium due to the high expression of efflux pump. Recently, antibiotic-resistant \u003cem\u003eqnr\u003c/em\u003e plasmids (\u003cem\u003eqnr A, B\u003c/em\u003e and \u003cem\u003eS\u003c/em\u003e) have been identified in different strains of intestinal bacterial pathogens, including \u003cem\u003eSalmonella\u003c/em\u003e. Qnr are repetitive penta-peptide proteins that inhibit the binding of quinolones to topoisomerase. These proteins develop resistance to nalidixic acid and reduce bacterial susceptibility to fluoroquinolones [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. The most important mechanism of resistance of fluoroquinolones in \u003cem\u003eEnterobacteriaceae\u003c/em\u003e is the accumulation of mutations in the target enzymes of fluoroquinolones such as DNA gyrase and DNA topoisomerase. Each of these enzymes has a (quinolone resistance determining region) QRDR [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eConsidering the importance of the drug resistance in \u003cem\u003eSalmonella\u003c/em\u003e as one of the major enteric bacterial pathogens, the frequency of various antibiotic resistance genes in isolates detected in national food outbreaks was investigated in this research.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e"},{"header":"Materials \u0026 Methods","content":"\u003cp\u003eIn this research 360 fecal samples from food outbreaks were collected and examined for detection of the \u003cem\u003eSalmonella\u003c/em\u003e. Cases with conventional biochemical and serological tests were considered as positive samples [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e].\u003c/p\u003e\u003cp\u003e\u003cb\u003eDetermination of microbial susceptibility pattern\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe antibiotic susceptibility test was determined by disk diffusion method [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Isolates to be characterized based on biochemical tests. Pure colony from fresh culture was inoculated into 0.09% saline solution to prepare a turbidity equivalent to the McFarland 0.5 turbidity standard. The microbial suspension was cultured on Müller-Hinton agar medium. Antibiotic disks of ampicillin, cefotaxime, ceftazidime, ceftriaxone, cefpime, streptomycin, tetracycline, nalidixic acid, ciprofloxacin, chloramphenicol, cotrimoxazole, imipenem, were placed on the agar medium. Distance between disks was around 21 mm.\u003c/p\u003e\u003cp\u003e\u003cb\u003eDetermination of MIC ciprofloxacin in nalidixic acid resistant strains using E-test\u003c/b\u003e\u003c/p\u003e\u003cp\u003eCiprofloxacin MIC was performed for isolates that have reduced resistance or sensitive to nalidixic acid by disk diffusion method (18). Pure colony from fresh culture was swabbed on Müller-Hinton agar medium like above. With sterile forceps, the E-Test strip was placed on the agar medium and after 18–24 hours, the intersection of bacterial growth with the lowest concentration of the strip was measured.\u003c/p\u003e\u003cp\u003e\u003cb\u003eDetermination of Ceftriaxone MIC in\u003c/b\u003e \u003cb\u003eSalmonella enteritidis\u003c/b\u003e \u003cb\u003estrains using E-test\u003c/b\u003e\u003c/p\u003e\u003cp\u003eCeftriaxone MIC was performed for isolates that had intermediate sresistance or sensitivity to ceftriaxone by disk diffusion method [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Pure colony from fresh culture was inoculated into a 0.09% saline solution to have a turbidity equivalent to McFarland 0.5 turbidity standard. The microbial suspension was swabbed on Müller-Hinton agar medium. With sterile forceps, the E-Test strip was placed on the agar medium and after 18–24 hours, the intersection of bacterial growth with the lowest concentration of the strip was measured.\u003c/p\u003e\u003cp\u003e\u003cb\u003eMolecular detection of antibiotic resistance genes\u003c/b\u003e\u003c/p\u003e\u003cp\u003eDNA was extracted using the simple boiling procedure as described previously [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Resistance genes to the selected antibiotics was assessed using PCR amplification by specific primers demonstrated in Table \u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. The final reaction volume was 20 microliters. For each reaction, 10 µl of ready-to-use amplicon master-mix and 0.5 µl of Forward primer, 0.5 µl of Reverse primer and 1 µl of DNA were added and made up to 20 µl with distilled water [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. After the microtube were prepared, the peQSTAR model was placed in a PeQLab thermocycler, and the reaction was performed with a temperature program that was set for each primer. The primers used are introduced in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e\u003cdiv class=\"gridtable\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eRequired Primers to identify antibiotic resistance genes.\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"4\"\u003e\u003c/colgroup\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGene\u003c/p\u003e\u003cp\u003eName\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePrimers sequence\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eProduct band size\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eReferences\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eqnrA\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF: ATTTCTCACGCCAGGATTTG\u003c/p\u003e\u003cp\u003eR: GATCGGCAAAGGTTAGGTCA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e516\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eAhmet et al. (2009b) [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eqnrB\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF: GATCGTGAAAGCCAGAAAGG\u003c/p\u003e\u003cp\u003eR: ACGATGCCTGGTAGTTGTCC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e469\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eAhmet et al. (2009b) [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eqnrS\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF: ACGACATTCGTCAACTGCAA\u003c/p\u003e\u003cp\u003eR: TAAATTGGCACCCTGTAGGC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e417\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eAhmet et al. (2009b) [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eSul1\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF: ATGGTGACGGTGTTCGGCATTCTG\u003c/p\u003e\u003cp\u003eR: GCTAGGCATGATCTAACCCTCGG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e841\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003ePhuong Hoa et al. [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eSul2\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF: AGGGGGCAGATGTGATCGAC\u003c/p\u003e\u003cp\u003eR: GCAGATGATTTCGCCAATTG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e249\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003ePhuong Hoa et al. (2008) [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eSul3\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF: TCAAAGCAAAATGATATGAGC\u003c/p\u003e\u003cp\u003eR: TTTCAAGGCATCTGATAAAGAC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e787\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003ePhuong Hoa et al. (2008) [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003etetA\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF: GCTACATCCTGCTTGCCTTC 210\u003c/p\u003e\u003cp\u003eR: CATAGATCGCCGTGAAGAGG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e469\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eSheykhsaran et al. (2018)[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003etetB\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF: TTGGTTAGGGGCAAGTTTTG\u003c/p\u003e\u003cp\u003eR: GTAATGGGCCAATAACACCG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e659\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eSheykhsaran et al. (2018)[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003etetG\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF: AGCAGCCTCAACCATTGCCGAT\u003c/p\u003e\u003cp\u003eR: GGTGTTCCACTGAAAACGGTCCT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e391\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eSheykhsaran et al. (2018) [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003egyrA\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF: GGTACACCGTGCCGTACTTT\u003c/p\u003e\u003cp\u003eR: TCCACGAAATCCACCGTC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e312\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eBrown JC et al. (1996)[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/table\u003e\u003c/div\u003e\u003cp\u003eFor DNA electrophoresis,1% (W/V) agarose gel was used. In order to estimate the sizes of the PCR-amplified bands, electrophoresis of PCR product was performed in the presence of 100 bp marker (100 volts, 37 minutes). DNA gel stain-100.000x was used for gel staining and DNA visualization.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003eIn this study, from 360 samples of fecal swaps, 39 \u003cem\u003eSalmonella\u003c/em\u003e isolates were detected. Based on serological reactions, out of 39 \u003cem\u003eSalmonella\u003c/em\u003e isolates, 24 isolates were identified as \u003cem\u003eSalmonella\u003c/em\u003e serogroup (D), 6 isolates as serogroup (B), 6 isolates as serogroup (C), and 3 isolates as serogroup (A). Antibiotic susceptibility test results showed that all the \u003cem\u003eSalmonella enterica\u003c/em\u003e were sensitive to imipenem and meropenem (100%). The ceftriaxone, chloramphenicol, and cefotaxime they showed almost the same result (97.43%), ciprofloxacin (98.74%) and cotrimoxazole (82.05%). The highest level of resistance was seen against nalidixic acid (71.8%) (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eAntibiotic susceptibility in 39 isolates of \u003cem\u003eSalmonella enterica\u003c/em\u003e subgroup D\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"5\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eType of antibiotic\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colspan=\"3\" nameend=\"c4\" namest=\"c2\"\u003e\u003cp\u003e24\u0026thinsp;=\u0026thinsp;No\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eTotal\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSensitive\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eIntermediate\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eResistance\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eAmpicillin\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e14 (58/4)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e2 (8/3)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e8 (33/3)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e24 (100/0)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCefotaxime\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e24 (100/0)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e0 (0/0)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e0 (0/0)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e24 (100/0)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCeftazidime\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e15 (62/5)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e2 (8/3)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e7 (29/2)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e24 (100/0)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCeftriaxone\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e23 (95/9)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e0 (0/0)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e1 (4/1)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e24 (100/0)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCefepime\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e20 (83/4)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e2 (8/3)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e2 (8/3)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e24 (100/0)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eStreptomycin\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e24 (100/0)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e0 (0/0)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e0 (0/0)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e24 (100/0)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTetracyclin\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e24 (100/0)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e0 (0/0)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e0 (0/0)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e24 (100/0)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eNalidixic acid\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e3 (8/4)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e3 (12/5)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e19 (79/1)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e24 (100/0)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCiprofloxacin\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e22 (91/7)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e0 (0/0)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e2 (8/3)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e24 (100/0)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eChloramphenic\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e24 (100/0)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e0 (0/0)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e0 (0/0)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e24 (100/0)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eImipenem\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e24 (100/0)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e0 (0/0)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e0 (0/0)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e24 (100/0)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eMeropenem\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e24 (100/0)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e0 (0/0)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e0 (0/0)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e24 (100/0)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCotrimoxazole\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e23 (95/9)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e0 (0/0)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e1 (4/1)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e24 (100/0)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003eMIC test was performed on isolates that were resistant, intermediate, or sensitive to ciprofloxacin and ceftriaxone, according to CLSI2016 and EUCAST2017 guidelines. The MIC level in \u003cem\u003eSalmonella enteritidis\u003c/em\u003e isolates is shown in Table \u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e, and different MIC values of ciprofloxacin and ceftriaxone in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e3\u003c/span\u003e.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eMIC rate of isolates based on CLSI\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"4\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eAntibiotic\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colspan=\"3\" nameend=\"c4\" namest=\"c2\"\u003e\u003cp\u003eCLSI2018\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u0026micro;g/ml\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSensitive\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eIntermediate\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eResistance\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eciprofloxaci\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e0.002\u0026ndash;0.064\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e0.5-0.125\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e1\u0026ndash;32\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eceftriaxone\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e1-0.016\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e4-256\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eIn this study, among 39 \u003cem\u003eSalmonella enteritidis\u003c/em\u003e, 5 isolate (12.8%) had tetracycline resistance. All of them were positive for \u003cem\u003etet\u003c/em\u003eA gene and none of the tetracycline-resistant isolates had \u003cem\u003etet\u003c/em\u003eB and \u003cem\u003etet\u003c/em\u003eG genes (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eIn addition, among 39 \u003cem\u003eSalmonella enterica\u003c/em\u003e isolates from different sources, 7 isolates (17.94%) were resistant to cotrimoxazole. Among cotrimoxazole-resistant isolates, 5 (12.8%) had \u003cem\u003esul\u003c/em\u003e-2 gene and 2 (5.12%) had \u003cem\u003esul\u003c/em\u003e-1 gene. The \u003cem\u003esul\u003c/em\u003e-3 gene was not observed in any of the cotrimoxazole-resistant isolates (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003e, \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eAmong 39 \u003cem\u003eSalmonella enterica\u003c/em\u003e isolates, 2 (5.1%) were resistant to ciprofloxacin. None of the isolates had \u003cem\u003eqnr\u003c/em\u003eA and \u003cem\u003eqnr\u003c/em\u003eB genes and only 1 (2.56%) had \u003cem\u003eqnr\u003c/em\u003eS gene. see Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e. Among 39 \u003cem\u003eSalmonella enterica\u003c/em\u003e isolates, 28 isolates (71.8%) were resistant to nalidixic acid antibiotic, of which only 1 isolate had \u003cem\u003egyr\u003c/em\u003eA gene Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e.\u003c/p\u003e"},{"header":"Discussions","content":"\u003cp\u003eSalmonellosis is gastroenteritis caused by infection with various \u003cem\u003eSalmonell\u003c/em\u003ea serovars and is the most common type of food poisoning in the world. Among bacterial pathogens, \u003cem\u003eSalmonella\u003c/em\u003e has a special place and \u003cem\u003eSalmonella enterica\u003c/em\u003e is a subspecies of \u003cem\u003eenterica\u003c/em\u003e serovars enteritidis, one of the most important causes of the epidemic and endemic gastroenteritis in humans worldwide [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. The results of serotyping of human and food \u003cem\u003eSalmonella\u003c/em\u003e isolates highlighted the Enteritidis as the most important serotype.\u003c/p\u003e\u003cp\u003eIn the study by Soltan Dallal, et al (2009), diarrhea samples of 1950 children under 5 years of age were studied and the rate of infection with various bacterial pathogens was (7.5%). The rate of infection with various \u003cem\u003eSalmonella\u003c/em\u003e serovars was (8. 17%) and the most common serovars \u003cem\u003eSalmonella\u003c/em\u003e Enteritidis has been reported [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. The prevalence of \u003cem\u003eSalmonella\u003c/em\u003e Enteritidis infection has increased in many countries and currently is the most predominant serotype in Europe (26). In Germany, between 1985 and 1995 the rate of salmonellosis almost tripled and this phenomenon is due to the excessive increase in the prevalence of serovars Enteritidis [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. The distribution of \u003cem\u003eSalmonella\u003c/em\u003e serovars vary according to geographical area and type of ecology (animal reservoirs). According to the World Health Organization, the global distribution of \u003cem\u003eSalmonella\u003c/em\u003e serovars as follow, \u003cem\u003eSalmonella\u003c/em\u003e Enteritidis with a frequency of (65%), \u003cem\u003eSalmonella\u003c/em\u003e Typhimurium (12%), and \u003cem\u003eSalmonella\u003c/em\u003e Newport (4%,) respectively [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eDespite appropriate measures to control and prevent infections caused by this serovar, \u003cem\u003eSalmonella\u003c/em\u003e Enteritidis is still the most common cause of \u003cem\u003eSalmonella\u003c/em\u003e gastroenteritis worldwide. The high prevalence of multiple antibiotic resistance in foodborne pathogens has been reported in recent years due to the widespread use of antimicrobials in medical and veterinary [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Increasing antibiotic resistance in non-typhoid \u003cem\u003eSalmonella\u003c/em\u003e serovars has led to an increase in the development of multidrug-resistant serovars which is a global public health problem [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Transmission of resistance genes from infected animals to humans through the food chain is a serious risk to human health [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eSoltan Dallal et al, (2020) reported that 24 \u003cem\u003eSalmonella\u003c/em\u003e isolates have been detected in screening of 800 rectal swab samples. The most prevalent serotype was \u003cem\u003eS. enteritidis\u003c/em\u003e (n\u0026thinsp;=\u0026thinsp;10, 41.7%), followed by \u003cem\u003eS. paratyphi\u003c/em\u003e C, (n\u0026thinsp;=\u0026thinsp;6, 25%), \u003cem\u003eS. paratyphi\u003c/em\u003e B (n\u0026thinsp;=\u0026thinsp;4, 16.7%), \u003cem\u003eS. arizonae\u003c/em\u003e 2 (n\u0026thinsp;=\u0026thinsp;2, 8.3%), and \u003cem\u003eS. paratyphi\u003c/em\u003e A (n\u0026thinsp;=\u0026thinsp;2, 8.3%). The highest rates of antibiotic resistance were obtained for nitrofurantoin (100%), followed by nalidixic acid (45.8%), and tetracycline (16.7%). Of 24 \u003cem\u003eS. enteritidis\u003c/em\u003e, 9 distinct antibiotypes (Abs) were observed. In this respect, 3 isolates (12.5%) were resistant to at least three or more antibiotics [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eValdezate (2007) et al. examined the antibiotic resistance pattern of 264 \u003cem\u003eSalmonella enterica\u003c/em\u003e isolates in food, \u003cem\u003eS. entritidis\u003c/em\u003e serovar, which was the most common serovar (36.3%). The most common resistance antibiotic was nalidixic acid (40.6%), tetracycline (15.6%), ampicillin (8.3%), trimethoprim sulfamethoxazole (7.3%), and streptomycin (3.1%) respectively. All the isolates were sensitive to chloramphenicol [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. The fluoroquinolones and third-generation cephalosporin are the drugs of choice for the treatment of salmonellosis in humans and animals. In recent years, resistance to the above antibiotics has developed among \u003cem\u003eSalmonella\u003c/em\u003e serovars, which has complicated the treatment of salmonellosis. Kumar et al. showed that \u003cem\u003eSalmonella typhimurium\u003c/em\u003e isolates with high resistance to nalidixic acid showed reduced sensitivity to ciprofloxacin [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. In a 2007 study by Mart\u0026iacute;nez et al. In Spain it was shown that the MIC of ciprofloxacin for \u003cem\u003eSalmonella brandenburg\u003c/em\u003e isolates from fecal samples of patients with gastroenteritis symptoms and food samples as well as sewage was reported to be 2 \u0026micro;g.ml for some isolates [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eResistance to broad-spectrum cephalosporin among \u003cem\u003eSalmonella\u003c/em\u003e strains has been increasing over the past two decades. The present study showed that \u003cem\u003eS. enterica\u003c/em\u003e isolated in human and foods were resistant to third-generation cephalosporin such as ceftriaxone, cefotaxime and ceftazidime. Studies conducted by Zahraei Salehi et al., in (2011) showed all \u003cem\u003eSalmonella\u003c/em\u003e isolates were susceptible to third-generation cephalosporin [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. In a study by Wu et al., resistance to ceftazidime was not observed [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eTetracycline is the most common antibiotic used in veterinary medicine in many parts of the world. Genes encoding tetracycline resistance are easily propagated by locating on mobile genetic elements such as plasmids and transposons. Recently, a variety of genes have been identified for resistance to tetracycline, including \u003cem\u003etet\u003c/em\u003eA, \u003cem\u003etet\u003c/em\u003eB, \u003cem\u003etet\u003c/em\u003eD, \u003cem\u003etet\u003c/em\u003eE, and \u003cem\u003etet\u003c/em\u003eG. The \u003cem\u003etet\u003c/em\u003eA gene, which encodes the proteins of the efflux pump, is located on the unconjugated transposon Tn / 721. This transposon has been found on mobile and conjugated plasmids in various \u003cem\u003eSalmonella\u003c/em\u003e hosts from various sources. Recent studies have shown that transposon Tn / 721 and transposon Tn3 (which carries the TEM-1 gene) have a similar genetic map and are found in conjugated and non-conjugated plasmids on the host chromosome. These two transposons have been found in different \u003cem\u003eSalmonella\u003c/em\u003e serotypes [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. Previous study shown an upward trend in antimicrobial resistance toward next generation of antibiotics [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e, \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. Investigation of antibiotic resistant in the \u003cem\u003eSalmonella\u003c/em\u003e in the previous study shown that the less than a quarter of isolates have multidrug resistance [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e], however in this study this amount increased to three-quarters of the isolates. Since the increasing the antimicrobial resistant toward antibiotics are increasing rapidly other way to treatment such as phage-therapy can be used [\u003cspan additionalcitationids=\"CR42\" citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. Other strategy can be used against antibiotic resistant isolate is efflux pump inhibitor. Efflux pump inhibitor lead to prevent pump activity that cause the accumulation of antibiotic within the pathogenic bacteria and cause their death [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e].\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003e\u003cem\u003eSalmonella\u003c/em\u003e serovars are resilient microorganisms with a complex genomic system that makes the microorganism able to react to different harsh environmental conditions. Resistance in \u003cem\u003eSalmonella\u003c/em\u003e spp. is rising towards critical levels. Regular monitoring of the pattern of resistance of bacteriological isolates is critical to develop antibiotic policy to combat the problem. Further monitoring will be critical in the coming years to analyses the evolution of \u003cem\u003eSalmonella\u003c/em\u003e strains and their resistance patterns. In addition to monitoring the progress of antimicrobial resistance, using other strategy such as phage-therapy and efflux pump inhibitor also can be used as complementary strategies.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgment\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe would like to thank the Vice Chancellor for Research of Tehran University of Medical Sciences for sponsoring this research project.\u003c/p\u003e\n\u003cp\u003eThis article is the result of a research grant approved by the Zoonoses Research Center, Tehran University of Medical Sciences with the code 39152. We would like to thank the Vice Chancellor for Research of Tehran University of Medical Sciences for sponsoring this research project.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eClinical trial number\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003cstrong\u003eAuthors\u0026rsquo; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMMSD, ZR, designed the study. ZR and EA collected samples and performed experiments and analyzed the data and prepared the graphs. MP wrote the manuscript and contributed in data analyses. MMSD and MP revised the manuscript and made constructive suggestions. All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by Tehran University of Medical Sciences. This article is the result of a research grant approved by the Zoonoses Research Center, Tehran University of Medical Sciences with the code 39152.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe study protocol was approved by the Ethics Committee on Tehran University of Medical Sciences (the ethics code IR.TUMS.VCR.REC.1397.589). All participants were willing to participate in this study and informed consent was obtained. Their choices did not affect the treatment process. This study adheres to the Declaration of Helsinki.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eMarino DD. 2007. Water and food safety in the developing world: global implications for health and nutrition of infants and young children. \u003cem\u003eJAD\u003c/em\u003e\u003cem\u003eA\u003c/em\u003e. 107(11):1930-4.\u003c/li\u003e\n\u003cli\u003eKoluman A, Dikici A. 2013. Antimicrobial resistance of emerging foodborne pathogens: status quo and global trends. \u003cem\u003eCrit Rev\u003c/em\u003e\u003cem\u003e \u003c/em\u003e\u003cem\u003eMicrobiol\u003c/em\u003e. 39(1):57-69.\u003c/li\u003e\n\u003cli\u003eEl Allaoui A, Rhazi FF, Essahale A, Bouchrif B, Karraouan B, Ameur N, et al. 2013. Characterization of antimicrobial susceptibility, virulence genes and identification by 16S ribosomal RNA gene sequencing of \u003cem\u003eSalmonella\u003c/em\u003e serovars isolated from turkey meat in Meknes, Morocco. \u003cem\u003eInt J Microbiol Immunol Res\u003c/em\u003e.1:68-79.\u003c/li\u003e\n\u003cli\u003eNair S, Lin TK, Pang T, Altwegg M. 2002. Characterization of \u003cem\u003eSalmonella\u003c/em\u003e serovars by PCR-single-strand conformation polymorphism analysis. \u003cem\u003eJ \u003c/em\u003e\u003cem\u003eC\u003c/em\u003e\u003cem\u003elin \u003c/em\u003e\u003cem\u003eM\u003c/em\u003e\u003cem\u003eicrobiol\u003c/em\u003e. 40(7):2346-51.\u003c/li\u003e\n\u003cli\u003eSantos AC, Roberts JA, Cook AJC, Simons R, Sheehan R, Lane C, et al. 2011. \u003cem\u003eSalmonella\u003c/em\u003e Typhimurium and Salmonella Enteritidis in England: costs to patients, their families, and primary and community health services of the NHS. \u003cem\u003eEpidemiol Infect\u003c/em\u003e. 139(5):742-53.\u003c/li\u003e\n\u003cli\u003eSchiaffino A, Beuzon CR, Uzzau S, Leori G, Cappuccinelli P, Casades\u0026uacute;s J, et al. 1996. Strain typing with IS200 fingerprints in \u003cem\u003eSalmonella\u003c/em\u003e abortusovis. \u003cem\u003eAppl Environ Microbiol\u003c/em\u003e. 62(7):2375-80.\u003c/li\u003e\n\u003cli\u003eMeunier D, Boyd D, Mulvey MR, Baucheron S, Mammina C, Nastasi A, et al. 2022. \u003cem\u003eSalmonella\u003c/em\u003e enterica serotype Typhimurium DT 104 antibiotic resistance genomic island I in serotype Paratyphi B. \u003cem\u003eEmerg Infect Dis\u003c/em\u003e. 8(4):430.\u003c/li\u003e\n\u003cli\u003eWoodford N, Stigter JM. Molecular investigation of glycopeptide resistance in gram-positive bacteria. Molecular bacteriology: Springer; 1998. p. 579-615.\u003c/li\u003e\n\u003cli\u003eChopra I, Roberts M. 2001. Tetracycline antibiotics: mode of action, applications, molecular biology, and epidemiology of bacterial resistance. \u003cem\u003eM\u003c/em\u003e\u003cem\u003eMBR\u003c/em\u003e. 65(2):232-60.\u003c/li\u003e\n\u003cli\u003eFrech G, Schwarz S. 1998. Tetracycline resistance in \u003cem\u003eSalmonella\u003c/em\u003e enterica subsp. enterica serovar Dublin. \u003cem\u003eAntimicrob Agents Chemother\u003c/em\u003e. 42(5):1288-9.\u003c/li\u003e\n\u003cli\u003eFrech G, Schwarz S. 2000. Molecular analysis of tetracycline resistance in \u003cem\u003eSalmonella\u003c/em\u003e enterica subsp. enterica serovars Typhimurium, Enteritidis, Dublin, Choleraesuis, Hadar and Saintpaul: construction and application of specific gene probes. \u003cem\u003eJ \u003c/em\u003e\u003cem\u003eA\u003c/em\u003e\u003cem\u003eppl \u003c/em\u003e\u003cem\u003eM\u003c/em\u003e\u003cem\u003eicrobiol\u003c/em\u003e. 89(4):633-41.\u003c/li\u003e\n\u003cli\u003eSchwarz S, Chaslus-Dancla E. 2001. Use of antimicrobials in veterinary medicine and mechanisms of resistance. \u003cem\u003eVet \u003c/em\u003e\u003cem\u003eR\u003c/em\u003e\u003cem\u003ees\u003c/em\u003e. 32(3-4):201-25.\u003c/li\u003e\n\u003cli\u003eCattoir V, Weill F-X, Poirel L, Fabre L, Soussy C-J, Nordmann P. 2007. Prevalence of \u003cem\u003eqnr\u003c/em\u003e genes in Salmonella in France. \u003cem\u003eJ Antimicrob Chemother\u003c/em\u003e. 59(4):751-4.\u003c/li\u003e\n\u003cli\u003eRobicsek A, Jacoby GA, Hooper DC. 2006. The worldwide emergence of plasmid-mediated quinolone resistance. \u003cem\u003eLancet \u003c/em\u003e\u003cem\u003eI\u003c/em\u003e\u003cem\u003enfect \u003c/em\u003e\u003cem\u003eD\u003c/em\u003e\u003cem\u003eis\u003c/em\u003e. 6(10):629-40.\u003c/li\u003e\n\u003cli\u003eProcop GW, Church DL, Hall GS, Janda WM. Koneman\u0026apos;s color atlas and textbook of diagnostic microbiology: Jones \u0026amp; Bartlett Publishers; 2020.\u003c/li\u003e\n\u003cli\u003eEshaghi Zadeh SH, Fahimi H, Fardsanei F, Soltan Dallal MM. 2020. Antimicrobial resistance and presence of class 1 integrons among different serotypes of \u003cem\u003eSalmonella\u003c/em\u003e spp. recovered from children with diarrhea in Tehran, Iran. \u003cem\u003eInfect Disord-Drug Targets \u003c/em\u003e(Formerly Current Drug Targets-Infectious Disorders). 20(2):160-6.\u003c/li\u003e\n\u003cli\u003eWayne PA. Clinical and laboratory standards institute. Performance standards for antimicrobial susceptibility testing. 2016.\u003c/li\u003e\n\u003cli\u003ePatel JB, Cockerill FR, Bradford PA. Performance standards for antimicrobial susceptibility testing: twenty-fifth informational supplement. 2015.\u003c/li\u003e\n\u003cli\u003eMirzaie S, Hassanzadeh M, Ashrafi I. 2010. Identification and characterization of \u003cem\u003eSalmonella\u003c/em\u003e isolates from captured house sparrows. \u003cem\u003eTurk J Vet Anim Sci\u003c/em\u003e. 34(2):181-6.\u003c/li\u003e\n\u003cli\u003eAhmed AM, Ishida Y, Shimamoto T. 2009. Molecular characterization of antimicrobial resistance in \u003cem\u003eSalmonella\u003c/em\u003e isolated from animals in Japan. \u003cem\u003eJ \u003c/em\u003e\u003cem\u003eA\u003c/em\u003e\u003cem\u003eppl \u003c/em\u003e\u003cem\u003eM\u003c/em\u003e\u003cem\u003eicrobiol\u003c/em\u003e.106(2):402-9.\u003c/li\u003e\n\u003cli\u003eHoa PTP, Nonaka L, Viet PH, Suzuki S. 2008. Detection of the \u003cem\u003esul1\u003c/em\u003e, \u003cem\u003esul2\u003c/em\u003e, and \u003cem\u003esul3\u003c/em\u003e genes in sulfonamide-resistant bacteria from wastewater and shrimp ponds of north Vietnam. \u003cem\u003eSci Total Environ\u003c/em\u003e. 405(1-3):377-84.\u003c/li\u003e\n\u003cli\u003eSheykhsaran E, Bannazadeh Baghi H, Soroush Barhaghi MH, Alizadeh N, Memar MY, Etemadi S, et al. 2018. The rate of resistance to tetracyclines and distribution of tetA, tetB, tetC, tetD, tetE, tetG, tetJ and tetY genes in Enterobacteriaceae isolated from Azerbaijan, Iran during 2017. \u003cem\u003ePhysiol Pharmacol\u003c/em\u003e. 22(3):205-12.\u003c/li\u003e\n\u003cli\u003eBrown JC, Thomson CJ, Amyes SGB. 1996. Mutations of the gyrA gene of clinical isolates of \u003cem\u003eSalmonella\u003c/em\u003e typhimurium and three other \u003cem\u003eSalmonella\u003c/em\u003e species leading to decreased susceptibilities to 4-quinolone drugs. \u003cem\u003eJ Antimicrob Chemother\u003c/em\u003e. 37(2):351-6.\u003c/li\u003e\n\u003cli\u003ePardo G, Cerd\u0026aacute;n M, Jm JV. 2012. \u003cem\u003eSalmonella\u003c/em\u003e enteritidis bacteraemia as clinical onset of acquired immune deficiency syndrome. \u003cem\u003eRev Esp Anestesiol Reanim\u003c/em\u003e. 60(2):103-5.\u003c/li\u003e\n\u003cli\u003eFardsanei F, Dallal MMS, Douraghi M, Salehi TZ, Mahmoodi M, Memariani H, et al. 2017. Genetic diversity and virulence genes of \u003cem\u003eSalmonella\u003c/em\u003e enterica subspecies enterica serotype Enteritidis isolated from meats and eggs. \u003cem\u003eMicrob \u003c/em\u003e\u003cem\u003eP\u003c/em\u003e\u003cem\u003eathog\u003c/em\u003e. 107:451-6.\u003c/li\u003e\n\u003cli\u003eKist M. 1991. Increase in \u003cem\u003eSalmonella\u003c/em\u003e enteritidis infections in man: a world-wide problem. \u003cem\u003e\u0026Ouml;GD\u003c/em\u003e. 53(10):687-92.\u003c/li\u003e\n\u003cli\u003eFerrari RG, Rosario DKA, Cunha-Neto A, Mano SB, Figueiredo EES, Conte-Junior CA. 2019. Worldwide epidemiology of \u003cem\u003eSalmonella\u003c/em\u003e serovars in animal-based foods: a meta-analysis. \u003cem\u003eAppl \u003c/em\u003e\u003cem\u003eE\u003c/em\u003e\u003cem\u003environ \u003c/em\u003e\u003cem\u003eM\u003c/em\u003e\u003cem\u003eicrobiol\u003c/em\u003e. 85(14):e00591-19.\u003c/li\u003e\n\u003cli\u003eWorld Health O. WHO estimates of the global burden of foodborne diseases: foodborne disease burden epidemiology reference group 2007-2015: World Health Organization; 2015.\u003c/li\u003e\n\u003cli\u003eMeakins S, Fisher IST, Berghold C, Gerner-Smidt P, Tsch\u0026auml;pe H, Cormican M, et al. 2008. Antimicrobial drug resistance in human nontyphoidal Salmonella isolates in Europe 2000\u0026ndash;2004: a report from the Enter-net International Surveillance Network. \u003cem\u003eMD\u003c/em\u003e\u003cem\u003eR\u003c/em\u003e. 14(1):31-5.\u003c/li\u003e\n\u003cli\u003eChoi S-H, Woo JH, Lee JE, Park SJ, Choo EJ, Kwak YG, et al. 2005. Increasing incidence of quinolone resistance in human non-typhoid \u003cem\u003eSalmonella\u003c/em\u003e enterica isolates in Korea and mechanisms involved in quinolone resistance. \u003cem\u003eJ Antimicrob Chemother\u003c/em\u003e. 56(6):1111-4.\u003c/li\u003e\n\u003cli\u003eFardsanei F, Soltan Dallal MM, Memariani M, Sharifi-Yazdi S, Nabatchian F, Sharifi-Yazdi MK. 2020. The Study of Antimicrobial Resistance among \u003cem\u003eSalmonella\u003c/em\u003e enterica Strains Isolated from Children with Gastroenteritisin in Tehran, Iran. \u003cem\u003eJ Med Bacteriol\u003c/em\u003e. 25-32.\u003c/li\u003e\n\u003cli\u003eValdezate S, Arroyo M, Gonz\u0026aacute;lez-Sanz R, Ramiro R, Herrera-Leon S, Usera MA, et al. 2007. Antimicrobial resistance and phage and molecular typing of \u003cem\u003eSalmonella\u003c/em\u003e strains isolated from food for human consumption in Spain. \u003cem\u003eJ \u003c/em\u003e\u003cem\u003eF\u003c/em\u003e\u003cem\u003eood \u003c/em\u003e\u003cem\u003eP\u003c/em\u003e\u003cem\u003erot.\u003c/em\u003e 70(12):2741-8.\u003c/li\u003e\n\u003cli\u003eKumar Y, Sharma A, Mani KR. 2009. High level of resistance to nalidixic acid in \u003cem\u003eSalmonella\u003c/em\u003e enterica serovar Typhi in Central India. \u003cem\u003eJ Infect Dev Ctries\u003c/em\u003e. 3(06):467-9.\u003c/li\u003e\n\u003cli\u003eMart\u0026iacute;nez N, Mendoza MC, Rodr\u0026iacute;guez I, Soto S, Bances M, Rodicio MR. 2007. Detailed structure of integrons and transposons carried by large conjugative plasmids responsible for multidrug resistance in diverse genomic types of \u003cem\u003eSalmonella\u003c/em\u003e enterica serovar Brandenburg. \u003cem\u003eJ \u003c/em\u003e\u003cem\u003eA\u003c/em\u003e\u003cem\u003entimicrob \u003c/em\u003e\u003cem\u003eC\u003c/em\u003e\u003cem\u003ehemother\u003c/em\u003e. 60(6):1227-34.\u003c/li\u003e\n\u003cli\u003eSalehi TZ, Madadgar O, Tadjbakhsh H, Mahzounieh MR, Feizabadi MM. 2011. A molecular study of the \u003cem\u003eSalmonella\u003c/em\u003e enterica serovars Abortusovis, Typhimurium, and Enteritidis. \u003cem\u003eTurk J Vet Anim Sci\u003c/em\u003e. 35(5):281-94.\u003c/li\u003e\n\u003cli\u003eVo ATT, Van Duijkeren E, Gaastra W, Fluit AC. 2010. Antimicrobial resistance, class 1 integrons, and genomic island 1 in \u003cem\u003eSalmonella\u003c/em\u003e isolates from Vietnam. \u003cem\u003ePloS one\u003c/em\u003e. 5(2):e9440.\u003c/li\u003e\n\u003cli\u003ePezzella C, Ricci A, DiGiannatale E, Luzzi I, Carattoli A. 2004. Tetracycline and streptomycin resistance genes, transposons, and plasmids in \u003cem\u003eSalmonella\u003c/em\u003e enterica isolates from animals in Italy. \u003cem\u003eAntimicrob Agents Chemother\u003c/em\u003e. 48(3):903-8.\u003c/li\u003e\n\u003cli\u003eSoltan Dallal MM, Doyle MP, Rezadehbashi M, Dabiri H, Sanaei M, Modarresi S, et al. 2010. Prevalence and antimicrobial resistance profiles of \u003cem\u003eSalmonella\u003c/em\u003e serotypes, \u003cem\u003eCampylobacter\u003c/em\u003e and \u003cem\u003eYersinia\u003c/em\u003e spp. isolated from retail chicken and beef, Tehran, Iran. \u003cem\u003eFood Control\u003c/em\u003e. 21(4):388-92.\u003c/li\u003e\n\u003cli\u003eNadi ZR, Salehi TZ, Tamai IA, Foroushani AR, Sillanpaa M, Dallal MMS. 2020. Evaluation of antibiotic resistance and prevalence of common \u003cem\u003eSalmonella\u003c/em\u003e enterica serovars isolated from foodborne outbreaks. \u003cem\u003eMicrochem J\u003c/em\u003e. 155:104660.\u003c/li\u003e\n\u003cli\u003eSoltan Dallal MM, Taremi M, Gachkar L, Modaresi SH, Sanaei M, Bakhtiari R, et al. 2009. Characterization of antibiotic resistant patterns of \u003cem\u003eSalmonella\u003c/em\u003e serotypes isolated from beef and chicken samples in Tehran. 2009. \u003cem\u003eJundishapur J Microbiol\u003c/em\u003e. 2(4): 124- 131.\u003c/li\u003e\n\u003cli\u003eNikkhahi F, Dallal MMS, Alimohammadi M, Foroushani AR, Rajabi Z, Fardsanei F, et al. 2017. Phage therapy: assessment of the efficacy of a bacteriophage isolated in the treatment of salmonellosis induced by \u003cem\u003eSalmonella\u003c/em\u003e enteritidis in mice. \u003cem\u003eGHFBB\u003c/em\u003e. 10(2):131.\u003c/li\u003e\n\u003cli\u003eVahedi A, Soltan Dallal MM, Douraghi M, Nikkhahi F, Rajabi Z, Yousefi M, et al. 2018. Isolation and identification of specific bacteriophage against enteropathogenic \u003cem\u003eEscherichia coli\u003c/em\u003e (EPEC) and in vitro and in vivo characterization of bacteriophage. \u003cem\u003eFEMS \u003c/em\u003e\u003cem\u003eM\u003c/em\u003e\u003cem\u003eicrobiol\u003c/em\u003e\u003cem\u003e L\u003c/em\u003e\u003cem\u003eett\u003c/em\u003e. 365(16):fny136.\u003c/li\u003e\n\u003cli\u003eTorabi BP, Soltan Dallal MM, Akbarzadeh S. 2018. Isolation and specificity of \u003cem\u003eSalmonella\u003c/em\u003e enteritidis bacteriophage from hospital sewage sample. \u003cem\u003eRJMS\u003c/em\u003e. 25(2): 1-9\u003cspan dir=\"RTL\"\u003e.\u003c/span\u003e \u003c/li\u003e\n\u003cli\u003eKhosravani M, Soltan Dallal MM, Norouzi M. 2019. \u003cem\u003emarA\u003c/em\u003e efflux pump gene expression in \u003cem\u003eSalmonella\u003c/em\u003e enteritidis strains treated with Artemisia tournefortiana hydroalcoholic extract and comparison with commercial efflux pump inhibitor, carbonyl cyanide 3-chlorophenylhydrazone (CCCP). \u003cem\u003eArch Med Lab Sci\u003c/em\u003e. 4(1).\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"bmc-microbiology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mcro","sideBox":"Learn more about [BMC Microbiology](http://bmcmicrobiol.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/mcro","title":"BMC Microbiology","twitterHandle":"#bmcmicrobiology","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Salmonella, Antibiotic resistance, Outbreak, Foodborne disease","lastPublishedDoi":"10.21203/rs.3.rs-7052748/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7052748/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e\u003cp\u003eDue to various reasons, outbreaks of foodborne diseases are spreading worldwide causing significant mortality and morbidity. The purpose of this study was the prevalence of antibiotic resistance genes in different \u003cem\u003eSalmonella enterica\u003c/em\u003e serovars isolated from national food outbreaks.\u003c/p\u003e\u003ch2\u003eMaterials and Methods\u003c/h2\u003e\u003cp\u003eFrom 360 stool swab samples, 39 \u003cem\u003eSalmonella\u003c/em\u003e were isolated based on phenotypic tests. Then the frequency of \u003cem\u003eqnr\u003c/em\u003eA, G test, A, \u003cem\u003eqnr\u003c/em\u003e B, \u003cem\u003eqnr\u003c/em\u003e S, \u003cem\u003egyr\u003c/em\u003e A, \u003cem\u003esul\u003c/em\u003e1, \u003cem\u003esul\u003c/em\u003e2, \u003cem\u003esul\u003c/em\u003e3, \u003cem\u003etet\u003c/em\u003e A, \u003cem\u003etet\u003c/em\u003e B, and \u003cem\u003etet\u003c/em\u003e G resistance genes was assessed using PCR amplification followed by DNA electrophoresis. Also, the pattern of antibiotic susceptibility of the isolates was determined by disk diffusion method.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e\u003cp\u003eAmong 39 \u003cem\u003eSalmonella\u003c/em\u003e isolates, 80% of them were resistant to at least two or more antibiotics. Out of resistant isolates, 7 isolates indicated resistance to cotrimoxazole, 5 of them had \u003cem\u003esul\u003c/em\u003e2 gene and 2 carried \u003cem\u003esul\u003c/em\u003e3 gene. All tetracycline-resistant isolates carried the \u003cem\u003etet\u003c/em\u003eA gene. Only one isolate was found as resistant to nalidixic acid, due to \u003cem\u003egyr\u003c/em\u003eA gene detection.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e\u003cp\u003eIn this study an increase in antibiotic resistance was observed. Therefore, surveying the antibiotic resistance pattern in \u003cem\u003eSalmonella\u003c/em\u003e and similar bacterial enteric pathogens should to be a priority for public health authorities.\u003c/p\u003e","manuscriptTitle":"Prevalence of antibiotic resistance genes in different Salmonella enterica serovars isolated from national food outbreaks","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-08-19 12:31:21","doi":"10.21203/rs.3.rs-7052748/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-08-25T15:02:11+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-08-21T23:58:28+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"111072045454852974191924872633498514274","date":"2025-08-16T20:29:30+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-08-16T06:54:35+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-08-15T14:40:28+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"127239124969559937571140900045592589086","date":"2025-08-13T15:41:04+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"231259313727715508565282091924536468974","date":"2025-08-12T04:55:47+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"47659981615641196980910910532489667057","date":"2025-08-11T21:00:14+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-08-11T20:27:08+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2025-08-06T17:07:22+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-08-05T08:56:02+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-08-05T08:54:17+00:00","index":"","fulltext":""},{"type":"submitted","content":"BMC Microbiology","date":"2025-07-05T11:15:10+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"bmc-microbiology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mcro","sideBox":"Learn more about [BMC Microbiology](http://bmcmicrobiol.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/mcro","title":"BMC Microbiology","twitterHandle":"#bmcmicrobiology","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"5635013f-b709-4013-a4a1-aa2298d3084b","owner":[],"postedDate":"August 19th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"in-revision","subjectAreas":[],"tags":[],"updatedAt":"2025-11-25T17:38:27+00:00","versionOfRecord":[],"versionCreatedAt":"2025-08-19 12:31:21","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7052748","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7052748","identity":"rs-7052748","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00
unpaywall
last seen: 2026-05-26T02:00:01.498150+00:00
License: CC-BY-4.0