DAB2IP inhibits glucose uptake by modulating HIF-1a ubiquitination under hypoxia in breast cancer

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher

Abstract

Abstract Metabolic reprogramming becomes more and more important in tumor biology. Among various metabolic type, glucose metabolism represents as the major energy source and is often dysregulated in breast cancer. DAB2IP is widely reported to be a tumor suppressor and act as a scaffold protein to suppress tumor malignancy in breast cancer. Interesting, DAB2IP was also found to be a potential regulator in glucose uptake, however, the concrete mechanism is still not delineated. In this present research, we found DAB2IP could inhibited glucose uptake under hypoxia condition in breast cancer cells through suppressing HIF-1a signals. Mechanically, DAB2IP could interact with E3 ubiquitin ligase, STUB1, via its PER domain, thus triggering STUB1 mediated HIF-1a ubiquitylation and degradation, and finally inhibit glucose metabolism and tumor progression. Deleting PER domain could abrogate DAB2IP-related inhibitory effect of glucose uptake, intracellular ATP production and lactic acid production in breast cancer. These findings exhibit the biological role of DAB2IP in cancer-related glucose metabolism, and unveils a novel mechanism of DAB2IP in regulating STUB1-driven HIF-1a ubiquitylated degradation in breast cancer.
Full text 115,556 characters · extracted from preprint-html · click to expand
DAB2IP inhibits glucose uptake by modulating HIF-1a ubiquitination under hypoxia in breast cancer | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Help Center Sign In Submit a Preprint Cite Share Download PDF Article DAB2IP inhibits glucose uptake by modulating HIF-1a ubiquitination under hypoxia in breast cancer Jie Shen, Hongliang Dong, Weiyi Jia, Weijian Meng, Rui Zhang, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3825204/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 11 Jun, 2024 Read the published version in Oncogenesis → Version 1 posted 7 You are reading this latest preprint version Abstract Metabolic reprogramming becomes more and more important in tumor biology. Among various metabolic type, glucose metabolism represents as the major energy source and is often dysregulated in breast cancer. DAB2IP is widely reported to be a tumor suppressor and act as a scaffold protein to suppress tumor malignancy in breast cancer. Interesting, DAB2IP was also found to be a potential regulator in glucose uptake, however, the concrete mechanism is still not delineated. In this present research, we found DAB2IP could inhibited glucose uptake under hypoxia condition in breast cancer cells through suppressing HIF-1a signals. Mechanically, DAB2IP could interact with E3 ubiquitin ligase, STUB1, via its PER domain, thus triggering STUB1 mediated HIF-1a ubiquitylation and degradation, and finally inhibit glucose metabolism and tumor progression. Deleting PER domain could abrogate DAB2IP-related inhibitory effect of glucose uptake, intracellular ATP production and lactic acid production in breast cancer. These findings exhibit the biological role of DAB2IP in cancer-related glucose metabolism, and unveils a novel mechanism of DAB2IP in regulating STUB1-driven HIF-1a ubiquitylated degradation in breast cancer. Biological sciences/Cancer/Breast cancer Biological sciences/Cancer/Cancer metabolism Introduction Over past four decades, the incidence of breast cancer has been steadily risen [ 1 ]. During malignant transforming of breast tumor, metabolic reprogramming appears to be a key characteristic of cancer and plays an important role in facilitating tumor cell proliferation [ 2 ]. Among them, glucose metabolism represents as the major energy source and is often dysregulated in breast cancer [ 2 , 3 ]. Multiple transporter and enzymes are reported to involve in glucose metabolism are highly expressed and associated with prognosis in breast malignancy, including glucose transporter 1–6 and 12 (GLUT1-6, 12) [ 4 ], hexokinase 2 (HK2) [ 5 ], 6-phosphofructo-2-kinase/fructose-2, 6-biphosphatase 3 (PFKFB3) [ 6 ], and pyruvate kinase M2 (PKM2) [ 7 ]. Various signals are reported to be involved in the regulation of GLUTs and glucose related enzymes expression, such as PI3K/AKT, AMPK, MAPKs, Wnt, and mTOR pathways [ 8 – 12 ], however, the concrete upstream that control glucose metabolic process in breast cancer is still not delineated. DAB2IP, also called ASK1 interacting protein, was reported to modulate multiple oncogenic pathways and acted as a tumor suppressor in multiple tumor [ 13 ]. In breast cancer, DAB2IP is reported to be aberrant methylated and inactivated, thus inducing tumor invasive and lymphatic metastasis [ 14 ]. Traditionally, DAB2IP is a member of Ras GTPase-activating protein family and often interacts directly with DAB2 to regulate various biological process such as cell proliferation, apoptosis, and metastasis [ 15 ]. Our recent research showed that DAB2IP could also act as a scaffold protein to suppress tumor malignancy and invasiveness in ubiquitylation dependent manner [ 16 , 17 ]. Interesting, DAB2IP was found to regulate glucose uptake in type 2 diabetes [ 18 ]. However, whether DAB2IP could affect glucose metabolism in cancer is still uncertain. In our current study, we found DAB2IP could inhibited glucose uptake under hypoxia condition in breast cancer cells through suppressing HIF-1a signals. Mechanically, DAB2IP could interact with E3 ubiquitin ligase, STUB1, thus triggering STUB1 mediated HIF-1a ubiquitylation and degradation and finally inhibit glucose metabolism and tumor progression. Furthermore, we unveiled that the PER domain of DAB2IP was essential for STUB1 mediated HIF-1a ubiquitylation, deleting PER domain could cancel DAB2IP-related inhibitory effect of glucose uptake, intracellular ATP production and lactic acid production in breast cancer. In conclusion, our research exhibits the biological role of DAB2IP in cancer-related glucose metabolism, and unveils a novel mechanism of DAB2IP in regulating STUB1-driven HIF-1a ubiquitylated degradation in breast cancer. Our finding also revealed that DAB2IP appeared to be a potential therapeutic target for interfering aberrant HIF-1a signaling in tumor-target therapy. Results DAB2IP acted as a tumor suppressor and involved in glucose metabolism in breast cancer Firstly, we evaluated the expression level of DAB2IP in public database of breast cancer (TCGA-BRCA) and normal breast tissue (GTEx). Compared with normal tissue, DAB2IP gene expression significantly decreased in breast cancer (Fig. 1 A). Similarly, IHC examination of four paired clinical human breast cancer specimens showed that, DAB2IP staining intensity was higher in para-cancerous tissue than in tumor tissue (Fig. 1 B). Therefore, we deduced DAB2IP could act as a potential tumor suppressor in breast cancer. Next, we screened potential DAB2IP correlated genes (p ≤ 0.05) in TCGA-BRCA via R2 platform (S. Figure 1 A). Through gene set enrichment analysis, we found DAB2IP could negatively regulate oxidative phosphorylation (S. Figure 1 B), which acted as a downstream of glucose metabolism. To further determine whether DAB2IP expression was associated with glucometabolic, we retrospectively collected 24 breast cancer patients receiving 18F-FDG PET/CT scan and tumor biopsy. IHC staining and PET/CT showed that DAB2IP expression level was negative correlated with 18F-FDG maximum standard uptake value (SUV max) in primary tumor (R=-0.914, p < 0.001) (Fig. 1 C). These results indicated DAB2IP could acted as a tumor suppressor and negatively regulated glucose uptake in breast cancer. DAB2IP inhibited glucose uptake of breast cancer cells during hypoxia To evaluate the role of DAB2IP in glucose metabolism, we first examined its expression level in six breast cancer cell lines. Western blot assay showed that DAB2IP was highly expressed in MCF7, T47D and ZR-75-1, and was relatively abrogated in MDA-MB-231, MDA-MB-468 and HCC1937 (S. Figure 1 C). MDA-MB-231 and MCF7 were reported to have relatively high and low tumor aggressiveness [ 19 ], thus these two cell lines were selected in further study. DAB2IP stably knocking down and overexpressing efficiency in MCF7 and MDA-MB-231 was validated via western blot assay (Fig. 2 A). Glucose and lactate detection assay revealed that DAB2IP could only inhibit glucose uptake and lactate production of MCF7 and MDA-MB-231 cells under hypoxic condition, rather than under normoxic condition (Fig. 2 B, C). Knocking down DAB2IP could significantly increase intracellular ATP level and improving cell viability in MCF7 under hypoxic condition (Fig. 2 D, S. Figure 1 D), while overexpressing DAB2IP could in reverse decrease intracellular ATP level and cell viability in MDA-MB-231 (Fig. 2 E, S. Figure 1 E). Additionally, Seahorse system was used to evaluate real-time ECAR in both MCF7 and MDA-MB-231. The results showed that knocking down DAB2IP could significantly increase ECAR of basal glycolysis and glycolytic capacity in MCF7 (Fig. 2 F), while overexpressing DAB2IP could in reverse decrease ECAR in MDA-MB-231 (Fig. 2 G). To investigate whether DAB2IP could suppress tumor growth in vivo, MCF7 cells with stable shDAB2IP lentivirus infection and MDA-MB-231 cells with DAB2IP overexpression was subcutaneously transplanted into female nude mice. The tumors grew faster in the MCF7-shDAB2IP group than in control group (Fig. 2 H), meanwhile, overexpressing DAB2IP in MDA-MB-231 could significantly inhibit tumor growth (Fig. 2 I). These results indicated DAB2IP could decrease glucose uptake under hypoxia and suppress tumor growth in breast cancer. DAB2IP regulated glucose uptake through inducing HIF-1a ubiquitylation To unveil the potential pathway involved in DAB2IP-related glucose metabolism, we re-analyzed DAB2IP correlated genes in hallmark of cancer gene-set (Broad institute, h1: hallmark of cancer 2019, p < 0.05) in TCGA-BRCA database via KEGG enrichment, and found DAB2IP was negatively associated with HIF-1 signaling (S. Figure 1 F). Western blot validated that knocking down DAB2IP could induce HIF-1α and its downstream (GLUT1 and PGK1) expression in MCF7, while overexpressing DAB2IP could down-regulate the protein level of HIF-1α, GLUT1 and PGK1 in MDA-MB-231 (Fig. 3 A). To confirm the role of HIF-1α in DAB2IP regulated glucose metabolism, we first knocked down endogenous HIF-1α in MCF7 stably transfected with shDAB2IP plasmid (Fig. 3 B). Our results showed that knocking down HIF-1α could reverse the increasement of glucose uptake (Fig. 3 C), intracellular ATP production (Fig. 3 D) and cell viability (Fig. 3 E) triggered by shDAB2IP in MCF7 cells under hypoxic condition. Additionally, knocking down HIF-1α could significantly decrease ECAR in MCF7 transfected with shDAB2IP (Fig. 3 F). To further explore the mechanism underlying DAB2IP-suppressed HIF-1α signaling, we used cycloheximide (CHX), an inhibitor of protein synthesis, to indirect measure the half-life of HIF-1α in breast cancer cells with different DAB2IP expression level. The half-life of HIF-1α was significantly extent in MCF7 with DAB2IP knockdown (Fig. 3 G), and was significantly shorten in MDA-MD-231 with DAB2IP overexpression (Fig. 3 H). Co-immunoprecipitation assay showed that either endogenous or exogenous DAB2IP could bind with HIF-1α in MCF7 and HEK293T cells under hypoxic condition (S. Figure 1 G, H). Meanwhile, knocking down DAB2IP could inhibit HIF-1a ubiquitination in MCF7 (Fig. 3 I), in contrary, overexpressing DAB2IP could increase exogenous HIF-1a ubiquitination level in HEK293T cells (Fig. 3 J). These results indicated that DAB2IP could interact with HIF-1a and induce its ubiquitin degradation in breast cancer. DAB2IP could interacted with E3 ubiquitin ligase STUB1 To determine the detailed E3 ubiquitin ligase involved in DAB2IP induced HIF-1a ubiquitination, immunoprecipitation and mass spectrometry were performed to identify DAB2IP and HIF-1a binding proteins in HEK293T with exogeneous Myc-DAB2IP or Flag-HIF-1a overexpression. By comparing and analyzing these proteins, four E3 ubiquitin ligase (STUB1, OTUB1, ATG3 and UBE2E2) could combine with both DAB2IP and HIF-1a, in which STUB1 represented the highest matching score in DAB2IP immune complex from HEK293T-Myc-DAB2IP cells (Sequest score: 19.7) (Fig. 4 A). Co-immunoprecipitation assay demonstrated that STUB1 could interact with both DAB2IP and HIF-1a (Fig. 4 B, C). Meanwhile, overexpressing STUB1 could mediate HIF-1a ubiquitination in MCF7 cells (Fig. 4 D). Therefore, STUB1 was selected as the potential E3 ubiquitin ligase for further study. To further unveil the regulating model of DAB2IP-STUB1-HIF-1a, we re-analyzed the mass spectrum data of STUB1 peptide sequence in exogeneous DAB2IP and HIF-1a immune complex from HEK293T-Myc-DAB2IP and HEK293T-Flag-HIF-1a cells, respectively. The results showed that DAB2IP could bind both N-terminal region (56–66, 86–95, 129–140) and C-terminal region (154–167) of STUB1 protein, while HIF-1a could only bind C-terminal region (154–167) of STUB1 protein (S. Figure 1 I). Considering the previous results that HIF-1a could interact with DAB2IP, we assumed that DAB2IP could act as a scaffold protein that coordinated the interaction between STUB1 and HIF-1a, and promoted STUB1 mediating HIF-1a ubiquitination. To verify this hypothesis, PLA assay was performed and demonstrated that overexpressing DAB2IP could promote proximity ligation between STUB1 and HIF-1a (Fig. 4 E). Furthermore, we transfected DAB2IP plasmid into HEK293T at the indicated level, and found that the binding capacity of STUB1 to HIF-1a gradually increased with an increasement of DAB2IP protein level (Fig. 4 F). Meanwhile, knocking down DAB2IP could reduce the interaction between STUB1 and HIF-1a in MCF7 cells (Fig. 4 G). DAB2IP induced HIF-1a ubiquitination via STUB1 Next, we validated whether DAB2IP induced HIF-1a ubiquitination through STUB1. Ubiquitination assay showed that knocking down endogenous STUB1 could significantly reverse DAB2IP induced HIF-1a ubiquitination in HEK293T cells (Fig. 5 A). Similarly, knocking down endogenous STUB1 in MDA-MB-231 cells could reverse DAB2IP induced HIF-1a and its downstream, GLUT1 and PGK1, expression (Fig. 5 B). Phenotype experiments showed that knocking down STUB1 could inhibit glucose uptake, intracellular ATP and lactate production in MDA-MB-231 cells with DAB2IP overexpression (Fig. 5 C-E). Meanwhile, overexpressing STUB1 could in reverse induce HIF-1a, GLUT1, PGK1 expression (Fig. 5 F), and upregulate glucose uptake rate and intracellular ATP/lactate production in MCF7 with DAB2IP knockdown cells (Fig. 5 G-I). Thus, we concluded DAB2IP could regulate HIF-1a related glucose metabolism in STUB1 mediate ubiquitination dependent manner. The PER domain of DAB2IP was essential for STUB1 mediated HIF-1a ubiquitination To determine the key domain of DAB2IP which involved in STUB1 mediated HIF-1a ubiquitination, three previously established DAB2IP truncated mutants (full length: 1-1189; N-terminal: 1-563; C-terminal: 564–1189) (16) were used to screen the potential DAB2IP region that interacted with STUB1 (S. Figure 1 J). Co-immunoprecipitation assay showed that the DA2IP C-terminal mutant could pull down STUB1 in HEK293T while the N-terminal mutant did not (Fig. 6 A). C-terminal segment of DAB2IP contained three domains, including period-like domain (PER: 591–719), proline-rich domain (PR: 727–736), and leucine zipper domain (LZ: 842–861) [ 13 ]. Therefore, we established the PER (△PER), PR(△PR) and LZ (△LZ) domain deletion based on DAB2IP C-terminal truncated mutation plasmid (S. Figure 1 K). When deleted PER, the C-terminal segment of DAB2IP could neither immunoprecipitated STUB1, nor induce HIF-1a ubiquitination in HEK293T cells (Fig. 6 B, C). Moreover, compared with full length and C-terminal segment of DAB2IP, PER depletion mutant could not inhibit HIF-1a and its downstream expression in MCF7 with DAB2IP knock out (DAB2IP-DAB2IP-KO) cells and MDA-MB-231 cells (Fig. 6 D, E). Glucose uptake and intracellular ATP/lactate production assay also showed that PER domain was essential for DAB2IP inhibited glucose uptake (Fig. 6 F, G), intracellular ATP production (Fig. 6 H, I) and lactate production (Fig. 6 J-K) in both MCF7 and MDA-MB-231 cells. In summary, our study unveiled a potential mechanism that DAB2IP could act as a scaffold to enhance the combination between HIF-1a and STUB1, thus inducing HIF-1a ubiquitylation degradation and inhibiting glucose uptake of breast cancer cells during hypoxia (Fig. 6 L). Discussion DAB2IP is an important tumor suppressor in multiple key oncogenic pathways, including TNFα/NF-κB, WNT/β-catenin, PI3K/AKT, and androgen receptors, therefore, inactivated DAB2IP is widely reported to trigger tumor initiating and cancer progressing [ 13 , 15 ]. As a scaffold protein, DAB2IP could function as a competitor, or scavenger, by binding with multiple signaling regulator and preventing their interaction with other up/downstream effectors, thus potentially modulating a remarkable array of cancer-related pathway [ 13 ]. Our previous studies first unveiled the tumor suppression effect and mechanism of DAB2IP in prostate cancer [ 20 – 22 ], and demonstrated DAB2IP could inhibit cell proliferation, epithelial-mesenchymal transition (EMT) and stem cell-like features in human colorectal cancer, especially in p53 wild type subgroup [ 16 , 23 ]. Additionally, we also reported that DAB2IP could inhibit invasiveness and metastasis in breast cancer through inhibiting invadopodia formation [ 17 ]. Currently, reprogrammed glucose metabolism appears to be a hallmark of cancer [ 24 ], it could often increase the hypoxic adaptation of tumor cells thus leading a poor cancer survival [ 25 ]. Interesting, some studies have pointed out DAB2IP could involve in hypoxia-related regulation in breast and liver cancer [ 26 , 27 ]. However, the concrete role of DAB2IP in metabolic reprograming of tumor under hypoxia condition is still uncertain. In this research, we first revealed that DAB2IP could decrease glucose uptake under hypoxia condition, therefore inhibited glycolysis and intracellular ATP production in breast cancer. Considering the critical role of glucose in the energy supplement of cancer cells, intervention on DAB2IP could be a potential strategy to coordinately dampen tumor related metabolic reprogramming, thus limiting cancer progression on a wide spectrum. Our study also demonstrated DAB2IP could downregulate glucose transporter 1 (GLUT1) and its downstream PGK1 through suppressing HIF-1a signaling. Coincidently, Zhou J, et al. reported that loss of DAB2IP could induce HIF-2a expression through activating mTOR pathway in renal cell cancer [ 28 ], while Wang B, et al. found DAB2IP could regulate EMT through destabilizing HIF-1a protein in prostate cancer [ 29 ]. However, little was known on the detailed biological function of DAB2IP in the HIF1-a related signaling. Our study provided evidences that DAB2IP could induce HIF-1a degradation in an ubiquitylation dependent manner. Moreover, we have identified the ubiquitin E3 ligase, STUB1, which was essential in DAB2IP mediate HIF-1a ubiquitylation. Our results revealed a new possibility of DAB2IP mediate tumor suppression in breast cancer. Ubiquitylation is a crucial component of post-translational modification and affected the function of target proteins under healthy or pathological events [ 30 ]. In HIF-1 signaling, ubiquitylation plays an essential role in determining the half-life and transcriptional activity of HIF-1a, thus controlling the hypoxic response of mammalian cells [ 31 ]. Multiple oncogenic pathways, including CDC20/PHD3 [ 32 ], SENP1/USP28 [ 33 ], and ATF4/pVHL [ 34 ] have been demonstrated to dysregulate HIF-1a ubiquitylation and induce tumor progression. In our current research, we found DAB2IP could induce HIF-1a ubiquitylation and degradation through STUB1. STUB1 (also known as CHIP) is an essential E3 ligase involved in protein quality control, and could degrade oncoproteins to exert tumor-suppressive functions [ 35 ]. Recently, STUB1 has emerged as an important player in regulating aging, autophagy, cancer immunity [ 35 ]. In 2010, Luo W, et al. and Bento CF, et al. observed that STUB1 could selectively mediate ubiquitylated degradation of HIF-1a [ 36 , 37 ], however the deeply mechanism still needed to be clarified. Our finding showed that DAB2IP could act as a platform to recruit STUB1 and HIF-1a protein, and induced STUB1 mediated HIF-1a degradation through enhancing their interaction. These results partially unveiled the regulation details of STUB1 mediated ubiquitylation. Whether DAB2IP could involve in STUB1-driven ubiquitylated degradation of other oncogenic proteins should be explored in the future. Another question raised from this research is the paradox role of DAB2IP in regulating protein ubiquitylation. In this study, DAB2IP functioned as an inducer of STUB1-driven HIF-1a ubiquitylation. However, our previous study showed that DAB2IP could act as an inhibitor of wild-type p53 ubiquitylation through antagonizing GRP75 in colorectal cancer [ 16 ]. Meanwhile, DAB2IP could induce the deubiquitylation of ALK through USP10 in breast cancer [ 17 ]. Similarly, other researches also reported that DAB2IP could induce PARP-1 protein ubiquitylation [ 38 ], while in contrast inhibited p27 protein ubiquitylation [ 39 ] in renal carcinoma. The biological function of DAB2IP in regulating ubiquitylation and protein stabilization still needed to be evaluated in the future. As a scaffold protein, DAB2IP consists of several domains, including the pleckstrin homology (PH) domain, PKC-conserved region 2 (C2) domain, Ras-GTPase activating protein (Ras-GAP) domain, C-terminal period-like (PER) domain, proline-rich (PR) domain, and leucine-zipper motif (LZ) [ 15 ]. In this research, we identified the PER domain of DAB2IP was essential for STUB1 mediated HIF-1a ubiquitination. PER domain was a non-described region involved in protein-protein interaction [ 13 ]. The biological role of PER domain in DAB2IP has still no certainty. Zhang HZ et al. reported that it could interact with TRAF2, thus inhibiting NF-kB activity [ 40 ], while Zhang H et al. observed that PER of DAB2IP could displace the binding between 14-3-3 and ASK1 protein, then enhanced ASK1 auto-phosphorylation and pro-apoptotic signals [ 41 ]. Furthermore, PER domain could also be important for modulating PI3K-Akt activity, therefore connecting both survival and death signals and maintaining cell homeostasis in prostate cancer cells [ 20 ]. This study unveiled that DAB2IP could interact with STUB1 and induced HIF-1a ubiquitylated degradation via the PER-domain. Interesting, we have previously found that DAB2IP could bind to GRP75 and enhance wild-type p53 stability via its Ras-GAP domain [ 16 ]. The concrete functions of different domain in DAB2IP-mediated ubiquitylation regulation need further investigation. There are still some limitations in this study. First, we found loss of DAB2IP could significantly induce glucose uptake, then subsequently increase lactate and intracellular ATP production in breast cancer cells under hypoxic condition. However, the influence of DAB2IP expression on glucose metabolism under normoxia was not obvious. The reason might be that DAB2IP regulate glucose metabolism was dependent on HIF-1a signal, which was significantly induced by hypoxia. Other potential pathways involved in metabolic reprogramming should be validated in the further research. Second, although we found DAB2IP could inhibit GLUT1 and PGK1 expression thereby affect ECAR in breast cancer cells, however, other key enzymes involved in glucose metabolism, such as hexokinase (HK), glucose-6-phosphate isomerase (GPI), phosphofructokinase (PEK), pyruvate dehydrogenase (PDH) and lactate dehydrogenase A/B (LDHA/B) [ 42 ], were not well investigated. Third, tumor cells were found to derived the energy required for uncontrolled replication through rapidly consuming glucose and converting it into lactate (Warburg effect) [ 43 ]. Although loss of DAB2IP could induce lactate and ATP production, whether DAB2IP could subsequently regulate glycolysis or Warburg effect in breast cancer cells is still uncertain. Finally, PER domain has been identified as the key region and potential target for DAB2IP-mediated glucose metabolism, therefore, additional studies are required to synthesized short peptides or small molecular compounds targetting this motif, and to prove its therapeutic value. In conclusion, our research exhibited a novel function of DAB2IP on STUB1-driven HIF-1a ubiquitylated degradation and glucose metabolic reprogramming in breast cancer. These findings enriched our understanding of the crosstalk between DAB2IP and hypoxia signaling pathway, and provided new potential target for cancer therapy. Materials/Subjects and Methods Clinical breast cancer specimens and immunohistochemistry (IHC) Between 2018.12 and 2021.12, 24 breast cancer patients from Tongji Hospital, Huazhong University of Science and Technology receiving 18F-FDG PET/CT scan and tumor biopsy were retrospectively collected and analyzed. The maximum standard uptake value (SUVmax) of primary tumor was collected from PET/CT scan and analyzed by Department of Radiology, Tongji Hospital. The paraffin sections of primary tumor were also obtained from these patients through surgical resection or biopsy and the immunohistochemistry (IHC) staining using DAB2IP antibody (Abcam, Cat. #ab87811) was performed as previously described [ 16 ]. The IHC results were analyzed under a microscope with 200x magnification. For each specimen, five visual fields were randomly chosen and scored through summing proportion score and staining score. The proportion score reflected the fraction of positive staining cells (0, none; 1, ≤ 25%; 2, 25–50%; 3, 50–75%; 4, > 75%), and the staining score revealed the staining intensity (0, no staining; 1, weak; 2, intermediate; 3, strong). The DAB2IP IHC intensity was the sum of the proportion score and the staining score. The final DAB2IP IHC intensity score was the average score of the five visual fields. Cell lines, culture, and hypoxia induction Breast cancer cell lines MCF7, T47D, ZR-75-1, MDA-MD-231, MDA-MD-468, HCC1937, and human embryonic kidney cell line HEK293T were purchased from the American Type Culture Collection (Manassas, VA, US) and cultured at 37°C in a 5% CO 2 incubator. MCF7 and HEK293T cell was cultured in Dulbecco's modified Eagle`s medium (DMEM) (KeyGEN, Cat. #KGM12800N), T47D, ZR-75-1 and HCC1937 was cultured in RPMI-1640 medium (1640) (KeyGEN, Cat. #KGM31800N). MDA-MB-231 and MDA-MB-468 cells were cultured in Leibovitz's L-15 medium (L15) (KeyGEN, Cat. #KGM41300N). All culture media were supplemented with 10% fetal bovine serum (MULTICELL, Cat. #086–150) and 1% penicillin/streptomycin (KeyGEN, Cat. #KGY0023). To stimulate hypoxic condition, cells were cultured in anaerobic incubator (5% CO 2, 1% O 2 ) at 37°C for 12 hours before further experiments were conducted. Small interfering RNA, plasmid and site-directed mutagenesis The small interfering RNAs were purchased from TsingkeBiotechnolog Co., Ltd. (Beijing, China). pcDNA3.1-Flag-tagged-DAB2IP, pcDNA3.1-Myc-tagged-DAB2IP, pcDNA3.1-Myc-tagged-DAB2IP-C-terminal and pcDNA3.1-Myc-tagged-DAB2IP-N-terminal overexpressing plasmids were obtained as previously described (16). HIF-1a and STUB1 overexpressing plasmids were purchased from TsingkeBiotechnolog Co., Ltd. (Beijing, China). The truncated and site-directed mutagenesis of DAB2IP plasmids were constructed using the Mut Express II Fast Mutagenesis Kit V2 (Vazyme, Cat. # C214-01) via manufacturer`s protocol. The siRNAs sequence and primers used in plasmid mutagenesis in this study were listed in S.Table 1. CRISPR/Cas9 DAB2IP was knocked out via CRISPR/Cas technique. Briefly, sgRNAs targeting DAB2IP were designed using the website software E-CRISP ( http://www.e-crisp.org/E-CRISP/ ) (target sequence: 5`-3` GGAGGTCCTCCTACTACTAC). Then, the sgRNA was synthetized and packaged into CRISPR/Cas9 lentivirus (performed by Shanghai Genechem Co., Ltd). After infection, cells were treated with 2µg/mL puromycin for one week. Then the remaining cells were trypsinized and seeded into 96-well plate to obtain single cell clone. After single-cell expansion, western blot was used to identify DAB2IP-KO clone. Transfection and stable cell lines establishment Transient transfections of small interfering RNA (siRNA) and plasmid were performed using the Lipofectamine 3000 reagent (Thermo Fisher, Cat. #L3000015) according to the manufacturer`s protocol. Biological and biochemical experiments were performed 48 hours after transfection. Recombinant lentiviruses of sh-scramble and sh-DAB2IP (previously obtained in [ 16 ] ) were used to establish stable DAB2IP knockdown (DAB2IP-KD) cell lines. Stable DAB2IP overexpressing lentivirus was established via pLVX (backbone) - psPAX2/pMD2.G (packaging vector) system. DAB2IP gene from the pcDNA3.1-DAB2IP plasmid was cloned into the pLVX vector and the virus particles were packaged via HEK293T. 48 hours after lentivirus infection, cells were treated with 2µg/mL puromycin until all cells in blank group had died. Western blot was used to validate the DAB2IP protein level in stable cell lines. Cell viability examination Briefly, 5000 cells per well were seeded in 96-well plate and treated with CoCl 2 at a concentration of 150µM to induce hypoxia. Then the cells were cultured at 37°C in a 5% CO 2 incubator for three days. Cell viability was examined at 24 hours, 48 hours, and 72 hours, respectively. During each examination, medium was replaced and added 10µL Cell Counting Kit-8 (CCK8) solution (MCE, Cat. #: HY-K0301). After 120 minutes incubation at 37°C, 450nm optical density (OD) was detected via spectrometer. Glucose uptake assay Glucose uptake assay was performed by Glucose Uptake Assay Kit (Promega, Cat. #: J1341). Briefly, 2-Deoxy-D-glucose (2-DG) was added into the culture medium at a concentration of 1mM. After 10 minutes incubation at 37°C, the 25ul reaction stop solution, 25ul neutralization buffer, and 100 ul 2-Deoxy-D-glucose 6-phosphate (2-DG-6P) solution provided by the kit were sequentially added into the medium according to the manufacturer’s instruction. Then, the luminescence signal was detected and recorded using a GloMax® 20/20 Luminometer, 3 bio-replications were performed for each experiment. Intracellular adenosine triphosphate (ATP) examination The intracellular ATP was examined via ATP detection kit (Beyotime, Cat. #S0026). Briefly, 2x10 6 cells were collected and lysed in 200ul ATP detection lysis buffer 4°C for 10 minutes. Then cell lysate was centrifuged at 4°C, 12000g for 5 minutes, and the supernatant was collected. Meanwhile, the detection working solution and standards were prepared according to the manufacturer`s instruction. The detection working solution was mixed with the supernatants or standards at 4°C for 5 minutes, and the luminescence intensity was measured by GloMax® 20/20 Luminometer, 3 bio-replications were performed for each experiment. Lactate production examination The culture medium was collected and centrifuged at 14000g at 4 ℃ for 5 min. Then the lactate level in supernatants was measured using lactate content detection kit (Nanjing Jian-Cheng Biotech Co., Ltd, Cat. #A019-2-1) via a multimode plate reader according to the manufacturer`s instruction. Seahorse extracellular acidification rate (ECAR) examination Seahorse XF Pro instrument (Agilent, US) was used to detected ECAR. Briefly, 5x10 5 cells per well were seeded into the XF24 plate and the XF flux sensor was hydrated without CO 2 overnight according to the protocol. On the day of the experiment, the sensor cartridge of the instrument was pre-warmed at 37℃ for 5 hours. The culture medium of samples was replaced by the analytic buffer, and the XF24 plate was incubated without CO 2 at 37°C for 60 minutes. Then the XF24 plate was placed into the instrument and the measurement was started. During measuring, the glucose, oligomycin, and 2-DG from Glycolysis Stress Test Kit (Agilent, Cat. #:103020) were sequentially added into the sample at an appropriate concentration according to the instruction. The ECAR values were recorded and analyzed using GraphPad Prism. Three bio-replications were performed for each experiment. Western blot and co-immunoprecipitation (Co-IP) assay Western blot and Co-IP assay were performed as previously described [ 16 ]. Antibodies used in the experiment were listed in S.Table 2. Ubiquitination assay Ubiquitination assay was performed as previously described [ 16 ]. Briefly, cells transfected with HA-tagged-ubiquitin plasmid were treated with MG-132 at a dose of 10uM for 8 h. Then cells were lysed in NP40 buffer and centrifuged at 12000g at 4 ℃ for 15 min. Cell lysates were immunoprecipitated with the agarose beads which were incubated with indicated primary antibody overnight at 4 ℃. The target protein ubiquitination was examined by anti-HA antibody via western blotting. Proximity ligation assay (PLA) Cells were fixed with 4% paraformaldehyde at 25°C for 20 minutes and were permeabilized with 0.1% Triton-X100 for 10 min. Then nonspecific staining was blocked by incubation with goat serum for 1 hour. Subsequently, cells were incubated with the primary antibodies STUB1 (C3B6, CST Cat# 2080, RRID: AB_2198052) of 1:100 dilution at 4°C overnight. After washing, hybridization, ligation, amplification and staining were performed by PLA detection kit (Duolink® PLA Control Kit – PPI, Sigma Aldrich, Cat. # DUO92202) according to the manufacturer`s protocol. Images were captured using fluorescence microscope (OLYMPUS IX71) at 400 magnification. PLA were visualized by green signal. Mass spectrum analysis Mass spectrum analysis was performed by Shanghai Lu-Ming Biotech Co., Ltd as previously described [ 16 ]. The results of mass spectrum were analyzed by Proteome Discoverer 2.3 search engine (Thermo Scientific, MA, US) and Uniprot-Homo database using Sequest algorithm [ 44 ]. Animal study All animal experiments were approved by Ethical Committee of Tongji Hospital. Briefly, female BABL/c nude mice (age four weeks) were purchased from Shulaibao (Wuhan) Biotechnology Co., Ltd. The mice were subcutaneously injected 1x10 6 tumor cells with Matrigel (Corning), six mice per group. After 30–36 days, the mice were euthanized, and the tumors were removed embedded, sliced and strained by hematoxylin-eosin (HE). The expression of DAB2IP was evaluated via immunohistochemistry. Bioinformatics and statistical analysis Gene expression profile and prognosis data of clinical breast cancer patients was obtained from The Cancer Genome Atlas – breast invasive carcinoma (TCGA-BRCA) database ( http://portal.gdc.cancer.gov ) and analyzed via GEPIA software ( http://gepia.cancer-pku.cn/index.html ) [ 45 ] and R2: Genomics Analysis and Visualization Platform ( http://hgserver1.amc.nl/cgi-bin/r2/main.cgi ). Potential protein interaction was analyzed via STRING database ( https://www.string-db.org/ ). All continuous data were reported as the mean ± SD and analyzed via Student’s t-test or analysis of variance (ANOVA). Categorical variables were compared using the χ2 test or Fisher test. P < 0.05 was considered statistically significant. Statistical analysis was performed using the software package SPSS (version 19.0 for Windows; IBM, USA) and GraphPad Prism (version 9.41 for Mac; GraphPad Software, Inc., USA). Declarations Competing Interests The authors declare that they have no conflict of interest. Funding This study was supported by the Hubei Provincial Natural Science Foundation of China (Grant numbers: 2023AFB118; 2023AFB1031); The Natural Science Foundation of Chongqing (Grant numbers: cstc2020jcyj-msxmX0288) and the National Natural Science Foundation of China (Grant No. 81702897; 81602090). The funders had no roles in study design, data collection and analysis, the decision to publish, or preparation of the manuscript. Author Contributions L.L. and J.S. were responsible for study design and project administration. H.D., W.J. and W.M. were responsible for performing experiments and data collecting; Z.Q., Z.C., R.Z. and S.X. contributed to extracting and analyzing data; J.S. wrote this manuscript; J.S. and L.L. revised and edited this manuscript; J.M., L.L. and J.S. contributed to funding acquisition. Acknowledgements We would like to thank the Experimental Medicine Center of Tongji Hospital for providing support to our experiment. We thank and the Department of Pathology of Tongji Hospital for providing assistance of pathological analysis. We also thank the Department of Radiology of Tongji Hospital for providing assistance of PET/CT scan analysis. Data Availability Statement The datasets used and/or analyzed during the present study are available from the corresponding author upon reasonable request. References Heer E, Harper A, Escandor N, Sung H, McCormack V, Fidler-Benaoudia MM. Global burden and trends in premenopausal and postmenopausal breast cancer: a population-based study. Lancet Glob Health. 2020;8(8):e1027-e37. Zhang D, Xu X, Ye Q. Metabolism and immunity in breast cancer. Front Med. 2021;15(2):178–207. Shin E, Koo JS. Glucose Metabolism and Glucose Transporters in Breast Cancer. Front Cell Dev Biol. 2021;9:728759. Barron CC, Bilan PJ, Tsakiridis T, Tsiani E. Facilitative glucose transporters: Implications for cancer detection, prognosis and treatment. Metabolism. 2016;65(2):124–39. Brown RS, Goodman TM, Zasadny KR, Greenson JK, Wahl RL. Expression of hexokinase II and Glut-1 in untreated human breast cancer. Nucl Med Biol. 2002;29(4):443–53. O'Neal J, Clem A, Reynolds L, Dougherty S, Imbert-Fernandez Y, Telang S, et al. Inhibition of 6-phosphofructo-2-kinase (PFKFB3) suppresses glucose metabolism and the growth of HER2 + breast cancer. Breast Cancer Res Treat. 2016;160(1):29–40. Lin Y, Lv F, Liu F, Guo X, Fan Y, Gu F, et al. High Expression of Pyruvate Kinase M2 is Associated with Chemosensitivity to Epirubicin and 5-Fluorouracil in Breast Cancer. J Cancer. 2015;6(11):1130–9. Engelman JA, Luo J, Cantley LC. The evolution of phosphatidylinositol 3-kinases as regulators of growth and metabolism. Nat Rev Genet. 2006;7(8):606–19. Han J, Zhang L, Guo H, Wysham WZ, Roque DR, Willson AK, et al. Glucose promotes cell proliferation, glucose uptake and invasion in endometrial cancer cells via AMPK/mTOR/S6 and MAPK signaling. Gynecol Oncol. 2015;138(3):668–75. Cai CF, Ye GD, Shen DY, Zhang W, Chen ML, Chen XX, et al. Chibby suppresses aerobic glycolysis and proliferation of nasopharyngeal carcinoma via the Wnt/β-catenin-Lin28/let7-PDK1 cascade. J Exp Clin Cancer Res. 2018;37(1):104. Hibdon ES, Razumilava N, Keeley TM, Wong G, Solanki S, Shah YM, et al. Notch and mTOR Signaling Pathways Promote Human Gastric Cancer Cell Proliferation. Neoplasia. 2019;21(7):702–12. Irey EA, Lassiter CM, Brady NJ, Chuntova P, Wang Y, Knutson TP, et al. JAK/STAT inhibition in macrophages promotes therapeutic resistance by inducing expression of protumorigenic factors. Proc Natl Acad Sci U S A. 2019;116(25):12442–51. Bellazzo A, Di Minin G, Collavin L. Block one, unleash a hundred. Mechanisms of DAB2IP inactivation in cancer. Cell Death Differ. 2017;24(1):15–25. Dote H, Toyooka S, Tsukuda K, Yano M, Ouchida M, Doihara H, et al. Aberrant promoter methylation in human DAB2 interactive protein (hDAB2IP) gene in breast cancer. Clin Cancer Res. 2004;10(6):2082–9. Liu L, Xu C, Hsieh JT, Gong J, Xie D. DAB2IP in cancer. Oncotarget. 2016;7(4):3766–76. Feng S, Huang Q, Deng J, Jia W, Gong J, Xie D, et al. DAB2IP suppresses tumor malignancy by inhibiting GRP75-driven p53 ubiquitination in colon cancer. Cancer Lett. 2022;532:215588. Huang Q, Zhang R, Xia Y, Shen J, Dong H, Li X, et al. DAB2IP suppresses invadopodia formation through destabilizing ALK by interacting with USP10 in breast cancer. iScience. 2023;26(9):107606. Song Z, Chen C, He J, Liu B, Ji W, Wu L, et al. ASK1-Interacting Protein 1 Acts as a Novel Predictor of Type 2 Diabetes. Front Endocrinol (Lausanne). 2022;13:896753. Yang H, Wang B, Wang T, Xu L, He C, Wen H, et al. Toll-like receptor 4 prompts human breast cancer cells invasiveness via lipopolysaccharide stimulation and is overexpressed in patients with lymph node metastasis. PLoS One. 2014;9(10):e109980. Xie D, Gore C, Zhou J, Pong RC, Zhang H, Yu L, et al. DAB2IP coordinates both PI3K-Akt and ASK1 pathways for cell survival and apoptosis. Proc Natl Acad Sci U S A. 2009;106(47):19878–83. Xie D, Gore C, Liu J, Pong RC, Mason R, Hao G, et al. Role of DAB2IP in modulating epithelial-to-mesenchymal transition and prostate cancer metastasis. Proc Natl Acad Sci U S A. 2010;107(6):2485–90. Wu K, Xie D, Zou Y, Zhang T, Pong RC, Xiao G, et al. The mechanism of DAB2IP in chemoresistance of prostate cancer cells. Clin Cancer Res. 2013;19(17):4740–9. Min J, Liu L, Li X, Jiang J, Wang J, Zhang B, et al. Absence of DAB2IP promotes cancer stem cell like signatures and indicates poor survival outcome in colorectal cancer. Sci Rep. 2015;5:16578. Halma MTJ, Tuszynski JA, Marik PE. Cancer Metabolism as a Therapeutic Target and Review of Interventions. Nutrients. 2023;15(19). Huang M, Yang L, Peng X, Wei S, Fan Q, Yang S, et al. Autonomous glucose metabolic reprogramming of tumour cells under hypoxia: opportunities for targeted therapy. J Exp Clin Cancer Res. 2020;39(1):185. Zhang X, Wang Q, Zhang R, Kong Z. DAB2IP-knocking down resulted in radio-resistance of breast cancer cells is associated with increased hypoxia and vasculogenic mimicry formation. Int J Radiat Biol. 2023;99(10):1595–606. Chen S, Liu R, Wang H, Liu Q. Hypoxia-driven miR-1307-3p promotes hepatocellular carcinoma cell proliferation and invasion by modulating DAB2 interacting protein. Pathol Res Pract. 2022;237:154066. Zhou J, Luo J, Wu K, Yun EJ, Kapur P, Pong RC, et al. Loss of DAB2IP in RCC cells enhances their growth and resistance to mTOR-targeted therapies. Oncogene. 2016;35(35):4663–74. Wang B, Huang J, Zhou J, Hui K, Xu S, Fan J, et al. DAB2IP regulates EMT and metastasis of prostate cancer through targeting PROX1 transcription and destabilizing HIF1α protein. Cell Signal. 2016;28(11):1623–30. Dutta H, Jain N. Post-translational modifications and their implications in cancer. Front Oncol. 2023;13:1240115. Brahimi-Horn C, Mazure N, Pouysségur J. Signalling via the hypoxia-inducible factor-1alpha requires multiple posttranslational modifications. Cell Signal. 2005;17(1):1–9. Shi M, Dai WQ, Jia RR, Zhang QH, Wei J, Wang YG, et al. APC(CDC20)-mediated degradation of PHD3 stabilizes HIF-1a and promotes tumorigenesis in hepatocellular carcinoma. Cancer Lett. 2021;496:144–55. Du SC, Zhu L, Wang YX, Liu J, Zhang D, Chen YL, et al. SENP1-mediated deSUMOylation of USP28 regulated HIF-1α accumulation and activation during hypoxia response. Cancer Cell Int. 2019;19:4. Zhu K, Jiao H, Li S, Cao H, Galson DL, Zhao Z, et al. ATF4 promotes bone angiogenesis by increasing VEGF expression and release in the bone environment. J Bone Miner Res. 2013;28(9):1870–84. Liu Y, Zhou H, Tang X. STUB1/CHIP: New insights in cancer and immunity. Biomed Pharmacother. 2023;165:115190. Luo W, Zhong J, Chang R, Hu H, Pandey A, Semenza GL. Hsp70 and CHIP selectively mediate ubiquitination and degradation of hypoxia-inducible factor (HIF)-1alpha but Not HIF-2alpha. J Biol Chem. 2010;285(6):3651–63. Bento CF, Fernandes R, Ramalho J, Marques C, Shang F, Taylor A, et al. The chaperone-dependent ubiquitin ligase CHIP targets HIF-1α for degradation in the presence of methylglyoxal. PLoS One. 2010;5(11):e15062. Yun EJ, Lin CJ, Dang A, Hernandez E, Guo J, Chen WM, et al. Downregulation of Human DAB2IP Gene Expression in Renal Cell Carcinoma Results in Resistance to Ionizing Radiation. Clin Cancer Res. 2019;25(14):4542–51. Zhou J, Deng Z, Pei X, Lai J, Qu W. DAB2IP stabilizes p27(Kip1) via suppressing PI3K/AKT signaling in clear cell renal cell carcinoma. Funct Integr Genomics. 2023;23(4):326. Zhang H, Zhang R, Luo Y, D'Alessio A, Pober JS, Min W. AIP1/DAB2IP, a novel member of the Ras-GAP family, transduces TRAF2-induced ASK1-JNK activation. J Biol Chem. 2004;279(43):44955–65. Zhang H, Zhang H, Lin Y, Li J, Pober JS, Min W. RIP1-mediated AIP1 phosphorylation at a 14-3-3-binding site is critical for tumor necrosis factor-induced ASK1-JNK/p38 activation. J Biol Chem. 2007;282(20):14788–96. Ye L, Jiang Y, Zhang M. Crosstalk between glucose metabolism, lactate production and immune response modulation. Cytokine Growth Factor Rev. 2022;68:81–92. Bose S, Le A. Glucose Metabolism in Cancer. Adv Exp Med Biol. 2018;1063:3–12. Eng JK, McCormack AL, Yates JR. An approach to correlate tandem mass spectral data of peptides with amino acid sequences in a protein database. J Am Soc Mass Spectrom. 1994;5(11):976–89. Tang Z, Li C, Kang B, Gao G, Li C, Zhang Z. GEPIA: a web server for cancer and normal gene expression profiling and interactive analyses. Nucleic Acids Res. 2017;45(W1):W98-w102. Additional Declarations There is NO conflict of interest to disclose. Supplementary Files Suppl.pdf Cite Share Download PDF Status: Published Journal Publication published 11 Jun, 2024 Read the published version in Oncogenesis → Version 1 posted Editorial decision: revise 29 Feb, 2024 Review # 1 received at journal 12 Feb, 2024 Reviewer # 1 agreed at journal 04 Feb, 2024 Reviewers invited by journal 16 Jan, 2024 Submission checks completed at journal 02 Jan, 2024 Editor assigned by journal 31 Dec, 2023 First submitted to journal 31 Dec, 2023 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3825204","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":267395372,"identity":"1cb94e67-553b-451a-bef2-320e0d6e22c1","order_by":0,"name":"Jie Shen","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA+klEQVRIie3Ov2vCQBTA8RcOkuUF14O0zb+QIAT/nGTRpUKhIC1kOBB0OXD133Bx7cGDTNfOhTgIBacOQhan0lyLdvLMWPC+y/3gPtwDcLn+Yd4UgLXrHYBuF/y5TDqRPhqiuhCTIYU0PyjoQNicUfPwtBm9eK+K7W/WhQimaw7lxjKYP4yWejeW8Ja3g9WFwGrCodpZCGYsnFFLdPJL+H3GPUEW0mua8ItGeCLx5yWCEIWC8j/C8RLxswgrSqXSidJY92c4fBzk1XmSLuijwZLiYKnT7bOsbxcBrd73pYWI444rUJ4E8M0hPwsA4tOuZ/DB8tTlcrmutm+ZulbBdCSoMQAAAABJRU5ErkJggg==","orcid":"https://orcid.org/0000-0002-8442-7268","institution":"","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Jie","middleName":"","lastName":"Shen","suffix":""},{"id":267395373,"identity":"12e4961c-7c17-41a4-b4b4-aa2be8d332e7","order_by":1,"name":"Hongliang Dong","email":"","orcid":"","institution":"","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Hongliang","middleName":"","lastName":"Dong","suffix":""},{"id":267395374,"identity":"768eaac4-7b2d-4251-a9f7-77ad5b438915","order_by":2,"name":"Weiyi Jia","email":"","orcid":"","institution":"","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Weiyi","middleName":"","lastName":"Jia","suffix":""},{"id":267395375,"identity":"6ced979a-e673-4b4c-8308-f917694aac6f","order_by":3,"name":"Weijian Meng","email":"","orcid":"","institution":"","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Weijian","middleName":"","lastName":"Meng","suffix":""},{"id":267395376,"identity":"643fd8c2-e84d-43f1-960d-1d8093475f4a","order_by":4,"name":"Rui Zhang","email":"","orcid":"","institution":"","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Rui","middleName":"","lastName":"Zhang","suffix":""},{"id":267395377,"identity":"cce58d76-35fa-405e-a997-d0bb5cfff5e0","order_by":5,"name":"Zhihong Qi","email":"","orcid":"","institution":"","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Zhihong","middleName":"","lastName":"Qi","suffix":""},{"id":267395378,"identity":"f3b99c63-54ca-49d7-b8b1-6777ca5a50d2","order_by":6,"name":"Zhuo Chen","email":"","orcid":"","institution":"","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Zhuo","middleName":"","lastName":"Chen","suffix":""},{"id":267395379,"identity":"e7fe1bab-f8f1-4840-ac45-c8d8e185508c","order_by":7,"name":"Sophia Xie","email":"","orcid":"","institution":"","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Sophia","middleName":"","lastName":"Xie","suffix":""},{"id":267395380,"identity":"cd91c1b9-df36-4577-bda9-405b78ba24dd","order_by":8,"name":"Jiang Min","email":"","orcid":"","institution":"","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Jiang","middleName":"","lastName":"Min","suffix":""},{"id":267395381,"identity":"834bec40-66fb-4aa3-891b-0cd07a001f9a","order_by":9,"name":"Liang Liu","email":"","orcid":"","institution":"","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Liang","middleName":"","lastName":"Liu","suffix":""}],"badges":[],"createdAt":"2023-12-31 05:25:15","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3825204/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3825204/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41389-024-00523-4","type":"published","date":"2024-06-11T04:00:00+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":58185658,"identity":"5555e37c-b0d7-48ec-841d-20622a63596b","added_by":"auto","created_at":"2024-06-12 07:12:40","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":647824,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3825204/v1/87dd2ed1-0f62-443c-bfd2-65cbcb203eb6.pdf"},{"id":49794044,"identity":"e59020f6-e3bc-4abd-a43c-1ff0f2cada6b","added_by":"auto","created_at":"2024-01-18 06:38:12","extension":"pdf","order_by":8,"title":"","display":"","copyAsset":false,"role":"supplement","size":1084032,"visible":true,"origin":"","legend":"","description":"","filename":"Suppl.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3825204/v1/dd16406f757c57a89623b707.pdf"}],"financialInterests":"There is \u003cb\u003eNO\u003c/b\u003e conflict of interest to disclose.","formattedTitle":"DAB2IP inhibits glucose uptake by modulating HIF-1a ubiquitination under hypoxia in breast cancer","fulltext":[{"header":"Introduction","content":"\u003cp\u003eOver past four decades, the incidence of breast cancer has been steadily risen [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. During malignant transforming of breast tumor, metabolic reprogramming appears to be a key characteristic of cancer and plays an important role in facilitating tumor cell proliferation [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Among them, glucose metabolism represents as the major energy source and is often dysregulated in breast cancer [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Multiple transporter and enzymes are reported to involve in glucose metabolism are highly expressed and associated with prognosis in breast malignancy, including glucose transporter 1\u0026ndash;6 and 12 (GLUT1-6, 12) [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e], hexokinase 2 (HK2) [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e], 6-phosphofructo-2-kinase/fructose-2, 6-biphosphatase 3 (PFKFB3) [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e], and pyruvate kinase M2 (PKM2) [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Various signals are reported to be involved in the regulation of GLUTs and glucose related enzymes expression, such as PI3K/AKT, AMPK, MAPKs, Wnt, and mTOR pathways [\u003cspan additionalcitationids=\"CR9 CR10 CR11\" citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e], however, the concrete upstream that control glucose metabolic process in breast cancer is still not delineated.\u003c/p\u003e \u003cp\u003eDAB2IP, also called ASK1 interacting protein, was reported to modulate multiple oncogenic pathways and acted as a tumor suppressor in multiple tumor [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. In breast cancer, DAB2IP is reported to be aberrant methylated and inactivated, thus inducing tumor invasive and lymphatic metastasis [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Traditionally, DAB2IP is a member of Ras GTPase-activating protein family and often interacts directly with DAB2 to regulate various biological process such as cell proliferation, apoptosis, and metastasis [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Our recent research showed that DAB2IP could also act as a scaffold protein to suppress tumor malignancy and invasiveness in ubiquitylation dependent manner [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Interesting, DAB2IP was found to regulate glucose uptake in type 2 diabetes [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. However, whether DAB2IP could affect glucose metabolism in cancer is still uncertain.\u003c/p\u003e \u003cp\u003eIn our current study, we found DAB2IP could inhibited glucose uptake under hypoxia condition in breast cancer cells through suppressing HIF-1a signals. Mechanically, DAB2IP could interact with E3 ubiquitin ligase, STUB1, thus triggering STUB1 mediated HIF-1a ubiquitylation and degradation and finally inhibit glucose metabolism and tumor progression. Furthermore, we unveiled that the PER domain of DAB2IP was essential for STUB1 mediated HIF-1a ubiquitylation, deleting PER domain could cancel DAB2IP-related inhibitory effect of glucose uptake, intracellular ATP production and lactic acid production in breast cancer. In conclusion, our research exhibits the biological role of DAB2IP in cancer-related glucose metabolism, and unveils a novel mechanism of DAB2IP in regulating STUB1-driven HIF-1a ubiquitylated degradation in breast cancer. Our finding also revealed that DAB2IP appeared to be a potential therapeutic target for interfering aberrant HIF-1a signaling in tumor-target therapy.\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eDAB2IP acted as a tumor suppressor and involved in glucose metabolism in breast cancer\u003c/h2\u003e \u003cp\u003eFirstly, we evaluated the expression level of DAB2IP in public database of breast cancer (TCGA-BRCA) and normal breast tissue (GTEx). Compared with normal tissue, DAB2IP gene expression significantly decreased in breast cancer (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). Similarly, IHC examination of four paired clinical human breast cancer specimens showed that, DAB2IP staining intensity was higher in para-cancerous tissue than in tumor tissue (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). Therefore, we deduced DAB2IP could act as a potential tumor suppressor in breast cancer. Next, we screened potential DAB2IP correlated genes (p\u0026thinsp;\u0026le;\u0026thinsp;0.05) in TCGA-BRCA via R2 platform (S. Figure\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). Through gene set enrichment analysis, we found DAB2IP could negatively regulate oxidative phosphorylation (S. Figure\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB), which acted as a downstream of glucose metabolism.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo further determine whether DAB2IP expression was associated with glucometabolic, we retrospectively collected 24 breast cancer patients receiving 18F-FDG PET/CT scan and tumor biopsy. IHC staining and PET/CT showed that DAB2IP expression level was negative correlated with 18F-FDG maximum standard uptake value (SUV max) in primary tumor (R=-0.914, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). These results indicated DAB2IP could acted as a tumor suppressor and negatively regulated glucose uptake in breast cancer.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eDAB2IP inhibited glucose uptake of breast cancer cells during hypoxia\u003c/h2\u003e \u003cp\u003eTo evaluate the role of DAB2IP in glucose metabolism, we first examined its expression level in six breast cancer cell lines. Western blot assay showed that DAB2IP was highly expressed in MCF7, T47D and ZR-75-1, and was relatively abrogated in MDA-MB-231, MDA-MB-468 and HCC1937 (S. Figure\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). MDA-MB-231 and MCF7 were reported to have relatively high and low tumor aggressiveness [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e], thus these two cell lines were selected in further study. DAB2IP stably knocking down and overexpressing efficiency in MCF7 and MDA-MB-231 was validated via western blot assay (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). Glucose and lactate detection assay revealed that DAB2IP could only inhibit glucose uptake and lactate production of MCF7 and MDA-MB-231 cells under hypoxic condition, rather than under normoxic condition (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB, C). Knocking down DAB2IP could significantly increase intracellular ATP level and improving cell viability in MCF7 under hypoxic condition (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD, S. Figure\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD), while overexpressing DAB2IP could in reverse decrease intracellular ATP level and cell viability in MDA-MB-231 (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE, S. Figure\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE). Additionally, Seahorse system was used to evaluate real-time ECAR in both MCF7 and MDA-MB-231. The results showed that knocking down DAB2IP could significantly increase ECAR of basal glycolysis and glycolytic capacity in MCF7 (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF), while overexpressing DAB2IP could in reverse decrease ECAR in MDA-MB-231 (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eG).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo investigate whether DAB2IP could suppress tumor growth in vivo, MCF7 cells with stable shDAB2IP lentivirus infection and MDA-MB-231 cells with DAB2IP overexpression was subcutaneously transplanted into female nude mice. The tumors grew faster in the MCF7-shDAB2IP group than in control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eH), meanwhile, overexpressing DAB2IP in MDA-MB-231 could significantly inhibit tumor growth (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eI). These results indicated DAB2IP could decrease glucose uptake under hypoxia and suppress tumor growth in breast cancer.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eDAB2IP regulated glucose uptake through inducing HIF-1a ubiquitylation\u003c/h2\u003e \u003cp\u003eTo unveil the potential pathway involved in DAB2IP-related glucose metabolism, we re-analyzed DAB2IP correlated genes in hallmark of cancer gene-set (Broad institute, h1: hallmark of cancer 2019, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) in TCGA-BRCA database via KEGG enrichment, and found DAB2IP was negatively associated with HIF-1 signaling (S. Figure\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eF). Western blot validated that knocking down DAB2IP could induce HIF-1α and its downstream (GLUT1 and PGK1) expression in MCF7, while overexpressing DAB2IP could down-regulate the protein level of HIF-1α, GLUT1 and PGK1 in MDA-MB-231 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). To confirm the role of HIF-1α in DAB2IP regulated glucose metabolism, we first knocked down endogenous HIF-1α in MCF7 stably transfected with shDAB2IP plasmid (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). Our results showed that knocking down HIF-1α could reverse the increasement of glucose uptake (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC), intracellular ATP production (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD) and cell viability (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE) triggered by shDAB2IP in MCF7 cells under hypoxic condition. Additionally, knocking down HIF-1α could significantly decrease ECAR in MCF7 transfected with shDAB2IP (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo further explore the mechanism underlying DAB2IP-suppressed HIF-1α signaling, we used cycloheximide (CHX), an inhibitor of protein synthesis, to indirect measure the half-life of HIF-1α in breast cancer cells with different DAB2IP expression level. The half-life of HIF-1α was significantly extent in MCF7 with DAB2IP knockdown (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eG), and was significantly shorten in MDA-MD-231 with DAB2IP overexpression (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eH). Co-immunoprecipitation assay showed that either endogenous or exogenous DAB2IP could bind with HIF-1α in MCF7 and HEK293T cells under hypoxic condition (S. Figure\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eG, H). Meanwhile, knocking down DAB2IP could inhibit HIF-1a ubiquitination in MCF7 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eI), in contrary, overexpressing DAB2IP could increase exogenous HIF-1a ubiquitination level in HEK293T cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eJ). These results indicated that DAB2IP could interact with HIF-1a and induce its ubiquitin degradation in breast cancer.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eDAB2IP could interacted with E3 ubiquitin ligase STUB1\u003c/h2\u003e \u003cp\u003eTo determine the detailed E3 ubiquitin ligase involved in DAB2IP induced HIF-1a ubiquitination, immunoprecipitation and mass spectrometry were performed to identify DAB2IP and HIF-1a binding proteins in HEK293T with exogeneous Myc-DAB2IP or Flag-HIF-1a overexpression. By comparing and analyzing these proteins, four E3 ubiquitin ligase (STUB1, OTUB1, ATG3 and UBE2E2) could combine with both DAB2IP and HIF-1a, in which STUB1 represented the highest matching score in DAB2IP immune complex from HEK293T-Myc-DAB2IP cells (Sequest score: 19.7) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). Co-immunoprecipitation assay demonstrated that STUB1 could interact with both DAB2IP and HIF-1a (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB, C). Meanwhile, overexpressing STUB1 could mediate HIF-1a ubiquitination in MCF7 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). Therefore, STUB1 was selected as the potential E3 ubiquitin ligase for further study.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo further unveil the regulating model of DAB2IP-STUB1-HIF-1a, we re-analyzed the mass spectrum data of STUB1 peptide sequence in exogeneous DAB2IP and HIF-1a immune complex from HEK293T-Myc-DAB2IP and HEK293T-Flag-HIF-1a cells, respectively. The results showed that DAB2IP could bind both N-terminal region (56\u0026ndash;66, 86\u0026ndash;95, 129\u0026ndash;140) and C-terminal region (154\u0026ndash;167) of STUB1 protein, while HIF-1a could only bind C-terminal region (154\u0026ndash;167) of STUB1 protein (S. Figure\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eI). Considering the previous results that HIF-1a could interact with DAB2IP, we assumed that DAB2IP could act as a scaffold protein that coordinated the interaction between STUB1 and HIF-1a, and promoted STUB1 mediating HIF-1a ubiquitination. To verify this hypothesis, PLA assay was performed and demonstrated that overexpressing DAB2IP could promote proximity ligation between STUB1 and HIF-1a (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE). Furthermore, we transfected DAB2IP plasmid into HEK293T at the indicated level, and found that the binding capacity of STUB1 to HIF-1a gradually increased with an increasement of DAB2IP protein level (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF). Meanwhile, knocking down DAB2IP could reduce the interaction between STUB1 and HIF-1a in MCF7 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eG).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eDAB2IP induced HIF-1a ubiquitination via STUB1\u003c/h2\u003e \u003cp\u003eNext, we validated whether DAB2IP induced HIF-1a ubiquitination through STUB1. Ubiquitination assay showed that knocking down endogenous STUB1 could significantly reverse DAB2IP induced HIF-1a ubiquitination in HEK293T cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). Similarly, knocking down endogenous STUB1 in MDA-MB-231 cells could reverse DAB2IP induced HIF-1a and its downstream, GLUT1 and PGK1, expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). Phenotype experiments showed that knocking down STUB1 could inhibit glucose uptake, intracellular ATP and lactate production in MDA-MB-231 cells with DAB2IP overexpression (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC-E). Meanwhile, overexpressing STUB1 could in reverse induce HIF-1a, GLUT1, PGK1 expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eF), and upregulate glucose uptake rate and intracellular ATP/lactate production in MCF7 with DAB2IP knockdown cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eG-I). Thus, we concluded DAB2IP could regulate HIF-1a related glucose metabolism in STUB1 mediate ubiquitination dependent manner.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eThe PER domain of DAB2IP was essential for STUB1 mediated HIF-1a ubiquitination\u003c/h2\u003e \u003cp\u003eTo determine the key domain of DAB2IP which involved in STUB1 mediated HIF-1a ubiquitination, three previously established DAB2IP truncated mutants (full length: 1-1189; N-terminal: 1-563; C-terminal: 564\u0026ndash;1189) (16) were used to screen the potential DAB2IP region that interacted with STUB1 (S. Figure\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eJ). Co-immunoprecipitation assay showed that the DA2IP C-terminal mutant could pull down STUB1 in HEK293T while the N-terminal mutant did not (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA). C-terminal segment of DAB2IP contained three domains, including period-like domain (PER: 591\u0026ndash;719), proline-rich domain (PR: 727\u0026ndash;736), and leucine zipper domain (LZ: 842\u0026ndash;861) [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Therefore, we established the PER (△PER), PR(△PR) and LZ (△LZ) domain deletion based on DAB2IP C-terminal truncated mutation plasmid (S. Figure\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eK). When deleted PER, the C-terminal segment of DAB2IP could neither immunoprecipitated STUB1, nor induce HIF-1a ubiquitination in HEK293T cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB, C). Moreover, compared with full length and C-terminal segment of DAB2IP, PER depletion mutant could not inhibit HIF-1a and its downstream expression in MCF7 with DAB2IP knock out (DAB2IP-DAB2IP-KO) cells and MDA-MB-231 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eD, E). Glucose uptake and intracellular ATP/lactate production assay also showed that PER domain was essential for DAB2IP inhibited glucose uptake (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eF, G), intracellular ATP production (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eH, I) and lactate production (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eJ-K) in both MCF7 and MDA-MB-231 cells. In summary, our study unveiled a potential mechanism that DAB2IP could act as a scaffold to enhance the combination between HIF-1a and STUB1, thus inducing HIF-1a ubiquitylation degradation and inhibiting glucose uptake of breast cancer cells during hypoxia (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eL).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eDAB2IP is an important tumor suppressor in multiple key oncogenic pathways, including TNFα/NF-κB, WNT/β-catenin, PI3K/AKT, and androgen receptors, therefore, inactivated DAB2IP is widely reported to trigger tumor initiating and cancer progressing [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. As a scaffold protein, DAB2IP could function as a competitor, or scavenger, by binding with multiple signaling regulator and preventing their interaction with other up/downstream effectors, thus potentially modulating a remarkable array of cancer-related pathway [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Our previous studies first unveiled the tumor suppression effect and mechanism of DAB2IP in prostate cancer [\u003cspan additionalcitationids=\"CR21\" citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e], and demonstrated DAB2IP could inhibit cell proliferation, epithelial-mesenchymal transition (EMT) and stem cell-like features in human colorectal cancer, especially in p53 wild type subgroup [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Additionally, we also reported that DAB2IP could inhibit invasiveness and metastasis in breast cancer through inhibiting invadopodia formation [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Currently, reprogrammed glucose metabolism appears to be a hallmark of cancer [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e], it could often increase the hypoxic adaptation of tumor cells thus leading a poor cancer survival [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. Interesting, some studies have pointed out DAB2IP could involve in hypoxia-related regulation in breast and liver cancer [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. However, the concrete role of DAB2IP in metabolic reprograming of tumor under hypoxia condition is still uncertain.\u003c/p\u003e \u003cp\u003eIn this research, we first revealed that DAB2IP could decrease glucose uptake under hypoxia condition, therefore inhibited glycolysis and intracellular ATP production in breast cancer. Considering the critical role of glucose in the energy supplement of cancer cells, intervention on DAB2IP could be a potential strategy to coordinately dampen tumor related metabolic reprogramming, thus limiting cancer progression on a wide spectrum. Our study also demonstrated DAB2IP could downregulate glucose transporter 1 (GLUT1) and its downstream PGK1 through suppressing HIF-1a signaling. Coincidently, Zhou J, et al. reported that loss of DAB2IP could induce HIF-2a expression through activating mTOR pathway in renal cell cancer [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e], while Wang B, et al. found DAB2IP could regulate EMT through destabilizing HIF-1a protein in prostate cancer [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. However, little was known on the detailed biological function of DAB2IP in the HIF1-a related signaling. Our study provided evidences that DAB2IP could induce HIF-1a degradation in an ubiquitylation dependent manner. Moreover, we have identified the ubiquitin E3 ligase, STUB1, which was essential in DAB2IP mediate HIF-1a ubiquitylation. Our results revealed a new possibility of DAB2IP mediate tumor suppression in breast cancer.\u003c/p\u003e \u003cp\u003eUbiquitylation is a crucial component of post-translational modification and affected the function of target proteins under healthy or pathological events [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. In HIF-1 signaling, ubiquitylation plays an essential role in determining the half-life and transcriptional activity of HIF-1a, thus controlling the hypoxic response of mammalian cells [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. Multiple oncogenic pathways, including CDC20/PHD3 [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e], SENP1/USP28 [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e], and ATF4/pVHL [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e] have been demonstrated to dysregulate HIF-1a ubiquitylation and induce tumor progression. In our current research, we found DAB2IP could induce HIF-1a ubiquitylation and degradation through STUB1. STUB1 (also known as CHIP) is an essential E3 ligase involved in protein quality control, and could degrade oncoproteins to exert tumor-suppressive functions [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. Recently, STUB1 has emerged as an important player in regulating aging, autophagy, cancer immunity [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. In 2010, Luo W, et al. and Bento CF, et al. observed that STUB1 could selectively mediate ubiquitylated degradation of HIF-1a [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e], however the deeply mechanism still needed to be clarified. Our finding showed that DAB2IP could act as a platform to recruit STUB1 and HIF-1a protein, and induced STUB1 mediated HIF-1a degradation through enhancing their interaction. These results partially unveiled the regulation details of STUB1 mediated ubiquitylation. Whether DAB2IP could involve in STUB1-driven ubiquitylated degradation of other oncogenic proteins should be explored in the future.\u003c/p\u003e \u003cp\u003eAnother question raised from this research is the paradox role of DAB2IP in regulating protein ubiquitylation. In this study, DAB2IP functioned as an inducer of STUB1-driven HIF-1a ubiquitylation. However, our previous study showed that DAB2IP could act as an inhibitor of wild-type p53 ubiquitylation through antagonizing GRP75 in colorectal cancer [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Meanwhile, DAB2IP could induce the deubiquitylation of ALK through USP10 in breast cancer [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Similarly, other researches also reported that DAB2IP could induce PARP-1 protein ubiquitylation [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e], while in contrast inhibited p27 protein ubiquitylation [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e] in renal carcinoma. The biological function of DAB2IP in regulating ubiquitylation and protein stabilization still needed to be evaluated in the future.\u003c/p\u003e \u003cp\u003eAs a scaffold protein, DAB2IP consists of several domains, including the pleckstrin homology (PH) domain, PKC-conserved region 2 (C2) domain, Ras-GTPase activating protein (Ras-GAP) domain, C-terminal period-like (PER) domain, proline-rich (PR) domain, and leucine-zipper motif (LZ) [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. In this research, we identified the PER domain of DAB2IP was essential for STUB1 mediated HIF-1a ubiquitination. PER domain was a non-described region involved in protein-protein interaction [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. The biological role of PER domain in DAB2IP has still no certainty. Zhang HZ et al. reported that it could interact with TRAF2, thus inhibiting NF-kB activity [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e], while Zhang H et al. observed that PER of DAB2IP could displace the binding between 14-3-3 and ASK1 protein, then enhanced ASK1 auto-phosphorylation and pro-apoptotic signals [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. Furthermore, PER domain could also be important for modulating PI3K-Akt activity, therefore connecting both survival and death signals and maintaining cell homeostasis in prostate cancer cells [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. This study unveiled that DAB2IP could interact with STUB1 and induced HIF-1a ubiquitylated degradation via the PER-domain. Interesting, we have previously found that DAB2IP could bind to GRP75 and enhance wild-type p53 stability via its Ras-GAP domain [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. The concrete functions of different domain in DAB2IP-mediated ubiquitylation regulation need further investigation.\u003c/p\u003e \u003cp\u003eThere are still some limitations in this study. First, we found loss of DAB2IP could significantly induce glucose uptake, then subsequently increase lactate and intracellular ATP production in breast cancer cells under hypoxic condition. However, the influence of DAB2IP expression on glucose metabolism under normoxia was not obvious. The reason might be that DAB2IP regulate glucose metabolism was dependent on HIF-1a signal, which was significantly induced by hypoxia. Other potential pathways involved in metabolic reprogramming should be validated in the further research. Second, although we found DAB2IP could inhibit GLUT1 and PGK1 expression thereby affect ECAR in breast cancer cells, however, other key enzymes involved in glucose metabolism, such as hexokinase (HK), glucose-6-phosphate isomerase (GPI), phosphofructokinase (PEK), pyruvate dehydrogenase (PDH) and lactate dehydrogenase A/B (LDHA/B) [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e], were not well investigated. Third, tumor cells were found to derived the energy required for uncontrolled replication through rapidly consuming glucose and converting it into lactate (Warburg effect) [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. Although loss of DAB2IP could induce lactate and ATP production, whether DAB2IP could subsequently regulate glycolysis or Warburg effect in breast cancer cells is still uncertain. Finally, PER domain has been identified as the key region and potential target for DAB2IP-mediated glucose metabolism, therefore, additional studies are required to synthesized short peptides or small molecular compounds targetting this motif, and to prove its therapeutic value.\u003c/p\u003e \u003cp\u003eIn conclusion, our research exhibited a novel function of DAB2IP on STUB1-driven HIF-1a ubiquitylated degradation and glucose metabolic reprogramming in breast cancer. These findings enriched our understanding of the crosstalk between DAB2IP and hypoxia signaling pathway, and provided new potential target for cancer therapy.\u003c/p\u003e"},{"header":"Materials/Subjects and Methods","content":"\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eClinical breast cancer specimens and immunohistochemistry (IHC)\u003c/h2\u003e \u003cp\u003eBetween 2018.12 and 2021.12, 24 breast cancer patients from Tongji Hospital, Huazhong University of Science and Technology receiving 18F-FDG PET/CT scan and tumor biopsy were retrospectively collected and analyzed. The maximum standard uptake value (SUVmax) of primary tumor was collected from PET/CT scan and analyzed by Department of Radiology, Tongji Hospital. The paraffin sections of primary tumor were also obtained from these patients through surgical resection or biopsy and the immunohistochemistry (IHC) staining using DAB2IP antibody (Abcam, Cat. #ab87811) was performed as previously described [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe IHC results were analyzed under a microscope with 200x magnification. For each specimen, five visual fields were randomly chosen and scored through summing proportion score and staining score. The proportion score reflected the fraction of positive staining cells (0, none; 1, \u0026le;\u0026thinsp;25%; 2, 25\u0026ndash;50%; 3, 50\u0026ndash;75%; 4, \u0026gt;\u0026thinsp;75%), and the staining score revealed the staining intensity (0, no staining; 1, weak; 2, intermediate; 3, strong). The DAB2IP IHC intensity was the sum of the proportion score and the staining score. The final DAB2IP IHC intensity score was the average score of the five visual fields.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eCell lines, culture, and hypoxia induction\u003c/h2\u003e \u003cp\u003eBreast cancer cell lines MCF7, T47D, ZR-75-1, MDA-MD-231, MDA-MD-468, HCC1937, and human embryonic kidney cell line HEK293T were purchased from the American Type Culture Collection (Manassas, VA, US) and cultured at 37\u0026deg;C in a 5% CO\u003csub\u003e2\u003c/sub\u003e incubator. MCF7 and HEK293T cell was cultured in Dulbecco's modified Eagle`s medium (DMEM) (KeyGEN, Cat. #KGM12800N), T47D, ZR-75-1 and HCC1937 was cultured in RPMI-1640 medium (1640) (KeyGEN, Cat. #KGM31800N). MDA-MB-231 and MDA-MB-468 cells were cultured in Leibovitz's L-15 medium (L15) (KeyGEN, Cat. #KGM41300N). All culture media were supplemented with 10% fetal bovine serum (MULTICELL, Cat. #086\u0026ndash;150) and 1% penicillin/streptomycin (KeyGEN, Cat. #KGY0023). To stimulate hypoxic condition, cells were cultured in anaerobic incubator (5% CO\u003csub\u003e2,\u003c/sub\u003e 1% O\u003csub\u003e2\u003c/sub\u003e) at 37\u0026deg;C for 12 hours before further experiments were conducted.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eSmall interfering RNA, plasmid and site-directed mutagenesis\u003c/h2\u003e \u003cp\u003eThe small interfering RNAs were purchased from TsingkeBiotechnolog Co., Ltd. (Beijing, China). pcDNA3.1-Flag-tagged-DAB2IP, pcDNA3.1-Myc-tagged-DAB2IP, pcDNA3.1-Myc-tagged-DAB2IP-C-terminal and pcDNA3.1-Myc-tagged-DAB2IP-N-terminal overexpressing plasmids were obtained as previously described (16). HIF-1a and STUB1 overexpressing plasmids were purchased from TsingkeBiotechnolog Co., Ltd. (Beijing, China). The truncated and site-directed mutagenesis of DAB2IP plasmids were constructed using the Mut Express II Fast Mutagenesis Kit V2 (Vazyme, Cat. # C214-01) via manufacturer`s protocol. The siRNAs sequence and primers used in plasmid mutagenesis in this study were listed in S.Table\u0026nbsp;1.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eCRISPR/Cas9\u003c/h2\u003e \u003cp\u003eDAB2IP was knocked out via CRISPR/Cas technique. Briefly, sgRNAs targeting DAB2IP were designed using the website software E-CRISP (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.e-crisp.org/E-CRISP/\u003c/span\u003e\u003cspan address=\"http://www.e-crisp.org/E-CRISP/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) (target sequence: 5`-3` GGAGGTCCTCCTACTACTAC). Then, the sgRNA was synthetized and packaged into CRISPR/Cas9 lentivirus (performed by Shanghai Genechem Co., Ltd). After infection, cells were treated with 2\u0026micro;g/mL puromycin for one week. Then the remaining cells were trypsinized and seeded into 96-well plate to obtain single cell clone. After single-cell expansion, western blot was used to identify DAB2IP-KO clone.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eTransfection and stable cell lines establishment\u003c/h2\u003e \u003cp\u003eTransient transfections of small interfering RNA (siRNA) and plasmid were performed using the Lipofectamine 3000 reagent (Thermo Fisher, Cat. #L3000015) according to the manufacturer`s protocol. Biological and biochemical experiments were performed 48 hours after transfection.\u003c/p\u003e \u003cp\u003eRecombinant lentiviruses of sh-scramble and sh-DAB2IP (previously obtained in [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e] ) were used to establish stable DAB2IP knockdown (DAB2IP-KD) cell lines. Stable DAB2IP overexpressing lentivirus was established via pLVX (backbone) - psPAX2/pMD2.G (packaging vector) system. DAB2IP gene from the pcDNA3.1-DAB2IP plasmid was cloned into the pLVX vector and the virus particles were packaged via HEK293T. 48 hours after lentivirus infection, cells were treated with 2\u0026micro;g/mL puromycin until all cells in blank group had died. Western blot was used to validate the DAB2IP protein level in stable cell lines.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eCell viability examination\u003c/h2\u003e \u003cp\u003eBriefly, 5000 cells per well were seeded in 96-well plate and treated with CoCl\u003csub\u003e2\u003c/sub\u003e at a concentration of 150\u0026micro;M to induce hypoxia. Then the cells were cultured at 37\u0026deg;C in a 5% CO\u003csub\u003e2\u003c/sub\u003e incubator for three days. Cell viability was examined at 24 hours, 48 hours, and 72 hours, respectively. During each examination, medium was replaced and added 10\u0026micro;L Cell Counting Kit-8 (CCK8) solution (MCE, Cat. #: HY-K0301). After 120 minutes incubation at 37\u0026deg;C, 450nm optical density (OD) was detected via spectrometer.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eGlucose uptake assay\u003c/h2\u003e \u003cp\u003eGlucose uptake assay was performed by Glucose Uptake Assay Kit (Promega, Cat. #: J1341). Briefly, 2-Deoxy-D-glucose (2-DG) was added into the culture medium at a concentration of 1mM. After 10 minutes incubation at 37\u0026deg;C, the 25ul reaction stop solution, 25ul neutralization buffer, and 100 ul 2-Deoxy-D-glucose 6-phosphate (2-DG-6P) solution provided by the kit were sequentially added into the medium according to the manufacturer\u0026rsquo;s instruction. Then, the luminescence signal was detected and recorded using a GloMax\u0026reg; 20/20 Luminometer, 3 bio-replications were performed for each experiment.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eIntracellular adenosine triphosphate (ATP) examination\u003c/h2\u003e \u003cp\u003eThe intracellular ATP was examined via ATP detection kit (Beyotime, Cat. #S0026). Briefly, 2x10\u003csup\u003e6\u003c/sup\u003e cells were collected and lysed in 200ul ATP detection lysis buffer 4\u0026deg;C for 10 minutes. Then cell lysate was centrifuged at 4\u0026deg;C, 12000g for 5 minutes, and the supernatant was collected. Meanwhile, the detection working solution and standards were prepared according to the manufacturer`s instruction. The detection working solution was mixed with the supernatants or standards at 4\u0026deg;C for 5 minutes, and the luminescence intensity was measured by GloMax\u0026reg; 20/20 Luminometer, 3 bio-replications were performed for each experiment.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eLactate production examination\u003c/h2\u003e \u003cp\u003eThe culture medium was collected and centrifuged at 14000g at 4 ℃ for 5 min. Then the lactate level in supernatants was measured using lactate content detection kit (Nanjing Jian-Cheng Biotech Co., Ltd, Cat. #A019-2-1) via a multimode plate reader according to the manufacturer`s instruction.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eSeahorse extracellular acidification rate (ECAR) examination\u003c/h2\u003e \u003cp\u003eSeahorse XF Pro instrument (Agilent, US) was used to detected ECAR. Briefly, 5x10\u003csup\u003e5\u003c/sup\u003e cells per well were seeded into the XF24 plate and the XF flux sensor was hydrated without CO\u003csub\u003e2\u003c/sub\u003e overnight according to the protocol. On the day of the experiment, the sensor cartridge of the instrument was pre-warmed at 37℃ for 5 hours. The culture medium of samples was replaced by the analytic buffer, and the XF24 plate was incubated without CO\u003csub\u003e2\u003c/sub\u003e at 37\u0026deg;C for 60 minutes. Then the XF24 plate was placed into the instrument and the measurement was started. During measuring, the glucose, oligomycin, and 2-DG from Glycolysis Stress Test Kit (Agilent, Cat. #:103020) were sequentially added into the sample at an appropriate concentration according to the instruction. The ECAR values were recorded and analyzed using GraphPad Prism. Three bio-replications were performed for each experiment.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003eWestern blot and co-immunoprecipitation (Co-IP) assay\u003c/h2\u003e \u003cp\u003eWestern blot and Co-IP assay were performed as previously described [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Antibodies used in the experiment were listed in S.Table\u0026nbsp;2.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003eUbiquitination assay\u003c/h2\u003e \u003cp\u003eUbiquitination assay was performed as previously described [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Briefly, cells transfected with HA-tagged-ubiquitin plasmid were treated with MG-132 at a dose of 10uM for 8 h. Then cells were lysed in NP40 buffer and centrifuged at 12000g at 4 ℃ for 15 min. Cell lysates were immunoprecipitated with the agarose beads which were incubated with indicated primary antibody overnight at 4 ℃. The target protein ubiquitination was examined by anti-HA antibody via western blotting.\u003c/p\u003e \u003cdiv id=\"Sec23\" class=\"Section3\"\u003e \u003ch2\u003eProximity ligation assay (PLA)\u003c/h2\u003e \u003cp\u003eCells were fixed with 4% paraformaldehyde at 25\u0026deg;C for 20 minutes and were permeabilized with 0.1% Triton-X100 for 10 min. Then nonspecific staining was blocked by incubation with goat serum for 1 hour. Subsequently, cells were incubated with the primary antibodies STUB1 (C3B6, CST Cat# 2080, RRID: AB_2198052) of 1:100 dilution at 4\u0026deg;C overnight. After washing, hybridization, ligation, amplification and staining were performed by PLA detection kit (Duolink\u0026reg; PLA Control Kit \u0026ndash; PPI, Sigma Aldrich, Cat. # DUO92202) according to the manufacturer`s protocol. Images were captured using fluorescence microscope (OLYMPUS IX71) at 400 magnification. PLA were visualized by green signal.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec24\" class=\"Section2\"\u003e \u003ch2\u003eMass spectrum analysis\u003c/h2\u003e \u003cp\u003eMass spectrum analysis was performed by Shanghai Lu-Ming Biotech Co., Ltd as previously described [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. The results of mass spectrum were analyzed by Proteome Discoverer 2.3 search engine (Thermo Scientific, MA, US) and Uniprot-Homo database using Sequest algorithm [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e].\u003c/p\u003e \u003cdiv id=\"Sec25\" class=\"Section3\"\u003e \u003ch2\u003eAnimal study\u003c/h2\u003e \u003cp\u003e All animal experiments were approved by Ethical Committee of Tongji Hospital. Briefly, female BABL/c nude mice (age four weeks) were purchased from Shulaibao (Wuhan) Biotechnology Co., Ltd. The mice were subcutaneously injected 1x10\u003csup\u003e6\u003c/sup\u003e tumor cells with Matrigel (Corning), six mice per group. After 30\u0026ndash;36 days, the mice were euthanized, and the tumors were removed embedded, sliced and strained by hematoxylin-eosin (HE). The expression of DAB2IP was evaluated via immunohistochemistry.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec26\" class=\"Section3\"\u003e \u003ch2\u003eBioinformatics and statistical analysis\u003c/h2\u003e \u003cp\u003eGene expression profile and prognosis data of clinical breast cancer patients was obtained from The Cancer Genome Atlas \u0026ndash; breast invasive carcinoma (TCGA-BRCA) database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://portal.gdc.cancer.gov\u003c/span\u003e\u003cspan address=\"http://portal.gdc.cancer.gov\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) and analyzed via GEPIA software (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://gepia.cancer-pku.cn/index.html\u003c/span\u003e\u003cspan address=\"http://gepia.cancer-pku.cn/index.html\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e] and R2: Genomics Analysis and Visualization Platform (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://hgserver1.amc.nl/cgi-bin/r2/main.cgi\u003c/span\u003e\u003cspan address=\"http://hgserver1.amc.nl/cgi-bin/r2/main.cgi\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). Potential protein interaction was analyzed via STRING database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.string-db.org/\u003c/span\u003e\u003cspan address=\"https://www.string-db.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eAll continuous data were reported as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD and analyzed via Student\u0026rsquo;s t-test or analysis of variance (ANOVA). Categorical variables were compared using the χ2 test or Fisher test. P\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered statistically significant. Statistical analysis was performed using the software package SPSS (version 19.0 for Windows; IBM, USA) and GraphPad Prism (version 9.41 for Mac; GraphPad Software, Inc., USA).\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003ch2\u003eCompeting Interests\u003c/h2\u003e \u003cp\u003eThe authors declare that they have no conflict of interest.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e \u003cp\u003eThis study was supported by the Hubei Provincial Natural Science Foundation of China (Grant numbers: 2023AFB118; 2023AFB1031); The Natural Science Foundation of Chongqing (Grant numbers: cstc2020jcyj-msxmX0288) and the National Natural Science Foundation of China (Grant No. 81702897; 81602090). The funders had no roles in study design, data collection and analysis, the decision to publish, or preparation of the manuscript.\u003c/p\u003e\u003ch2\u003eAuthor Contributions\u003c/h2\u003e \u003cp\u003eL.L. and J.S. were responsible for study design and project administration. H.D., W.J. and W.M. were responsible for performing experiments and data collecting; Z.Q., Z.C., R.Z. and S.X. contributed to extracting and analyzing data; J.S. wrote this manuscript; J.S. and L.L. revised and edited this manuscript; J.M., L.L. and J.S. contributed to funding acquisition.\u003c/p\u003e\u003ch2\u003eAcknowledgements\u003c/h2\u003e \u003cp\u003eWe would like to thank the Experimental Medicine Center of Tongji Hospital for providing support to our experiment. We thank and the Department of Pathology of Tongji Hospital for providing assistance of pathological analysis. We also thank the Department of Radiology of Tongji Hospital for providing assistance of PET/CT scan analysis.\u003c/p\u003e\u003ch2\u003eData Availability Statement\u003c/h2\u003e \u003cp\u003eThe datasets used and/or analyzed during the present study are available from the corresponding author upon reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eHeer E, Harper A, Escandor N, Sung H, McCormack V, Fidler-Benaoudia MM. Global burden and trends in premenopausal and postmenopausal breast cancer: a population-based study. Lancet Glob Health. 2020;8(8):e1027-e37.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang D, Xu X, Ye Q. Metabolism and immunity in breast cancer. Front Med. 2021;15(2):178\u0026ndash;207.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShin E, Koo JS. Glucose Metabolism and Glucose Transporters in Breast Cancer. Front Cell Dev Biol. 2021;9:728759.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBarron CC, Bilan PJ, Tsakiridis T, Tsiani E. Facilitative glucose transporters: Implications for cancer detection, prognosis and treatment. Metabolism. 2016;65(2):124\u0026ndash;39.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBrown RS, Goodman TM, Zasadny KR, Greenson JK, Wahl RL. Expression of hexokinase II and Glut-1 in untreated human breast cancer. Nucl Med Biol. 2002;29(4):443\u0026ndash;53.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eO'Neal J, Clem A, Reynolds L, Dougherty S, Imbert-Fernandez Y, Telang S, et al. Inhibition of 6-phosphofructo-2-kinase (PFKFB3) suppresses glucose metabolism and the growth of HER2\u0026thinsp;+\u0026thinsp;breast cancer. Breast Cancer Res Treat. 2016;160(1):29\u0026ndash;40.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLin Y, Lv F, Liu F, Guo X, Fan Y, Gu F, et al. High Expression of Pyruvate Kinase M2 is Associated with Chemosensitivity to Epirubicin and 5-Fluorouracil in Breast Cancer. J Cancer. 2015;6(11):1130\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEngelman JA, Luo J, Cantley LC. The evolution of phosphatidylinositol 3-kinases as regulators of growth and metabolism. Nat Rev Genet. 2006;7(8):606\u0026ndash;19.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHan J, Zhang L, Guo H, Wysham WZ, Roque DR, Willson AK, et al. Glucose promotes cell proliferation, glucose uptake and invasion in endometrial cancer cells via AMPK/mTOR/S6 and MAPK signaling. Gynecol Oncol. 2015;138(3):668\u0026ndash;75.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCai CF, Ye GD, Shen DY, Zhang W, Chen ML, Chen XX, et al. Chibby suppresses aerobic glycolysis and proliferation of nasopharyngeal carcinoma via the Wnt/β-catenin-Lin28/let7-PDK1 cascade. J Exp Clin Cancer Res. 2018;37(1):104.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHibdon ES, Razumilava N, Keeley TM, Wong G, Solanki S, Shah YM, et al. Notch and mTOR Signaling Pathways Promote Human Gastric Cancer Cell Proliferation. Neoplasia. 2019;21(7):702\u0026ndash;12.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIrey EA, Lassiter CM, Brady NJ, Chuntova P, Wang Y, Knutson TP, et al. JAK/STAT inhibition in macrophages promotes therapeutic resistance by inducing expression of protumorigenic factors. Proc Natl Acad Sci U S A. 2019;116(25):12442\u0026ndash;51.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBellazzo A, Di Minin G, Collavin L. Block one, unleash a hundred. Mechanisms of DAB2IP inactivation in cancer. Cell Death Differ. 2017;24(1):15\u0026ndash;25.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDote H, Toyooka S, Tsukuda K, Yano M, Ouchida M, Doihara H, et al. Aberrant promoter methylation in human DAB2 interactive protein (hDAB2IP) gene in breast cancer. Clin Cancer Res. 2004;10(6):2082\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu L, Xu C, Hsieh JT, Gong J, Xie D. DAB2IP in cancer. Oncotarget. 2016;7(4):3766\u0026ndash;76.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFeng S, Huang Q, Deng J, Jia W, Gong J, Xie D, et al. DAB2IP suppresses tumor malignancy by inhibiting GRP75-driven p53 ubiquitination in colon cancer. Cancer Lett. 2022;532:215588.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang Q, Zhang R, Xia Y, Shen J, Dong H, Li X, et al. DAB2IP suppresses invadopodia formation through destabilizing ALK by interacting with USP10 in breast cancer. iScience. 2023;26(9):107606.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSong Z, Chen C, He J, Liu B, Ji W, Wu L, et al. ASK1-Interacting Protein 1 Acts as a Novel Predictor of Type 2 Diabetes. Front Endocrinol (Lausanne). 2022;13:896753.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang H, Wang B, Wang T, Xu L, He C, Wen H, et al. Toll-like receptor 4 prompts human breast cancer cells invasiveness via lipopolysaccharide stimulation and is overexpressed in patients with lymph node metastasis. PLoS One. 2014;9(10):e109980.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXie D, Gore C, Zhou J, Pong RC, Zhang H, Yu L, et al. DAB2IP coordinates both PI3K-Akt and ASK1 pathways for cell survival and apoptosis. Proc Natl Acad Sci U S A. 2009;106(47):19878\u0026ndash;83.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXie D, Gore C, Liu J, Pong RC, Mason R, Hao G, et al. Role of DAB2IP in modulating epithelial-to-mesenchymal transition and prostate cancer metastasis. Proc Natl Acad Sci U S A. 2010;107(6):2485\u0026ndash;90.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu K, Xie D, Zou Y, Zhang T, Pong RC, Xiao G, et al. The mechanism of DAB2IP in chemoresistance of prostate cancer cells. Clin Cancer Res. 2013;19(17):4740\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMin J, Liu L, Li X, Jiang J, Wang J, Zhang B, et al. Absence of DAB2IP promotes cancer stem cell like signatures and indicates poor survival outcome in colorectal cancer. Sci Rep. 2015;5:16578.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHalma MTJ, Tuszynski JA, Marik PE. Cancer Metabolism as a Therapeutic Target and Review of Interventions. Nutrients. 2023;15(19).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang M, Yang L, Peng X, Wei S, Fan Q, Yang S, et al. Autonomous glucose metabolic reprogramming of tumour cells under hypoxia: opportunities for targeted therapy. J Exp Clin Cancer Res. 2020;39(1):185.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang X, Wang Q, Zhang R, Kong Z. DAB2IP-knocking down resulted in radio-resistance of breast cancer cells is associated with increased hypoxia and vasculogenic mimicry formation. Int J Radiat Biol. 2023;99(10):1595\u0026ndash;606.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen S, Liu R, Wang H, Liu Q. Hypoxia-driven miR-1307-3p promotes hepatocellular carcinoma cell proliferation and invasion by modulating DAB2 interacting protein. Pathol Res Pract. 2022;237:154066.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou J, Luo J, Wu K, Yun EJ, Kapur P, Pong RC, et al. Loss of DAB2IP in RCC cells enhances their growth and resistance to mTOR-targeted therapies. Oncogene. 2016;35(35):4663\u0026ndash;74.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang B, Huang J, Zhou J, Hui K, Xu S, Fan J, et al. DAB2IP regulates EMT and metastasis of prostate cancer through targeting PROX1 transcription and destabilizing HIF1α protein. Cell Signal. 2016;28(11):1623\u0026ndash;30.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDutta H, Jain N. Post-translational modifications and their implications in cancer. Front Oncol. 2023;13:1240115.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBrahimi-Horn C, Mazure N, Pouyss\u0026eacute;gur J. Signalling via the hypoxia-inducible factor-1alpha requires multiple posttranslational modifications. Cell Signal. 2005;17(1):1\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShi M, Dai WQ, Jia RR, Zhang QH, Wei J, Wang YG, et al. APC(CDC20)-mediated degradation of PHD3 stabilizes HIF-1a and promotes tumorigenesis in hepatocellular carcinoma. Cancer Lett. 2021;496:144\u0026ndash;55.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDu SC, Zhu L, Wang YX, Liu J, Zhang D, Chen YL, et al. SENP1-mediated deSUMOylation of USP28 regulated HIF-1α accumulation and activation during hypoxia response. Cancer Cell Int. 2019;19:4.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhu K, Jiao H, Li S, Cao H, Galson DL, Zhao Z, et al. ATF4 promotes bone angiogenesis by increasing VEGF expression and release in the bone environment. J Bone Miner Res. 2013;28(9):1870\u0026ndash;84.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu Y, Zhou H, Tang X. STUB1/CHIP: New insights in cancer and immunity. Biomed Pharmacother. 2023;165:115190.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLuo W, Zhong J, Chang R, Hu H, Pandey A, Semenza GL. Hsp70 and CHIP selectively mediate ubiquitination and degradation of hypoxia-inducible factor (HIF)-1alpha but Not HIF-2alpha. J Biol Chem. 2010;285(6):3651\u0026ndash;63.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBento CF, Fernandes R, Ramalho J, Marques C, Shang F, Taylor A, et al. The chaperone-dependent ubiquitin ligase CHIP targets HIF-1α for degradation in the presence of methylglyoxal. PLoS One. 2010;5(11):e15062.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYun EJ, Lin CJ, Dang A, Hernandez E, Guo J, Chen WM, et al. Downregulation of Human DAB2IP Gene Expression in Renal Cell Carcinoma Results in Resistance to Ionizing Radiation. Clin Cancer Res. 2019;25(14):4542\u0026ndash;51.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou J, Deng Z, Pei X, Lai J, Qu W. DAB2IP stabilizes p27(Kip1) via suppressing PI3K/AKT signaling in clear cell renal cell carcinoma. Funct Integr Genomics. 2023;23(4):326.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang H, Zhang R, Luo Y, D'Alessio A, Pober JS, Min W. AIP1/DAB2IP, a novel member of the Ras-GAP family, transduces TRAF2-induced ASK1-JNK activation. J Biol Chem. 2004;279(43):44955\u0026ndash;65.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang H, Zhang H, Lin Y, Li J, Pober JS, Min W. RIP1-mediated AIP1 phosphorylation at a 14-3-3-binding site is critical for tumor necrosis factor-induced ASK1-JNK/p38 activation. J Biol Chem. 2007;282(20):14788\u0026ndash;96.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYe L, Jiang Y, Zhang M. Crosstalk between glucose metabolism, lactate production and immune response modulation. Cytokine Growth Factor Rev. 2022;68:81\u0026ndash;92.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBose S, Le A. Glucose Metabolism in Cancer. Adv Exp Med Biol. 2018;1063:3\u0026ndash;12.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEng JK, McCormack AL, Yates JR. An approach to correlate tandem mass spectral data of peptides with amino acid sequences in a protein database. J Am Soc Mass Spectrom. 1994;5(11):976\u0026ndash;89.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTang Z, Li C, Kang B, Gao G, Li C, Zhang Z. GEPIA: a web server for cancer and normal gene expression profiling and interactive analyses. Nucleic Acids Res. 2017;45(W1):W98-w102.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"oncogenesis","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"oncsis","sideBox":"Learn more about [Oncogenesis](http://www.nature.com/oncsis/)","snPcode":"41389","submissionUrl":"https://mts-oncsis.nature.com/cgi-bin/main.plex","title":"Oncogenesis","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-3825204/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3825204/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eMetabolic reprogramming becomes more and more important in tumor biology. Among various metabolic type, glucose metabolism represents as the major energy source and is often dysregulated in breast cancer. DAB2IP is widely reported to be a tumor suppressor and act as a scaffold protein to suppress tumor malignancy in breast cancer. Interesting, DAB2IP was also found to be a potential regulator in glucose uptake, however, the concrete mechanism is still not delineated. In this present research, we found DAB2IP could inhibited glucose uptake under hypoxia condition in breast cancer cells through suppressing HIF-1a signals. Mechanically, DAB2IP could interact with E3 ubiquitin ligase, STUB1, via its PER domain, thus triggering STUB1 mediated HIF-1a ubiquitylation and degradation, and finally inhibit glucose metabolism and tumor progression. Deleting PER domain could abrogate DAB2IP-related inhibitory effect of glucose uptake, intracellular ATP production and lactic acid production in breast cancer. These findings exhibit the biological role of DAB2IP in cancer-related glucose metabolism, and unveils a novel mechanism of DAB2IP in regulating STUB1-driven HIF-1a ubiquitylated degradation in breast cancer.\u003c/p\u003e","manuscriptTitle":"DAB2IP inhibits glucose uptake by modulating HIF-1a ubiquitination under hypoxia in breast cancer","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-01-18 06:30:07","doi":"10.21203/rs.3.rs-3825204/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"revise","date":"2024-02-29T12:30:38+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"This content is not available.","date":"2024-02-12T16:14:55+00:00","index":1,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2024-02-04T08:45:11+00:00","index":1,"fulltext":"This content is not available."},{"type":"reviewersInvited","content":"","date":"2024-01-16T12:16:40+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-01-02T17:14:05+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2023-12-31T05:23:28+00:00","index":"","fulltext":""},{"type":"submitted","content":"Oncogenesis","date":"2023-12-31T05:23:27+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"oncogenesis","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"oncsis","sideBox":"Learn more about [Oncogenesis](http://www.nature.com/oncsis/)","snPcode":"41389","submissionUrl":"https://mts-oncsis.nature.com/cgi-bin/main.plex","title":"Oncogenesis","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"ca14d8cf-8602-4cf4-8e28-59ff5b9b4cb3","owner":[],"postedDate":"January 18th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":28169714,"name":"Biological sciences/Cancer/Breast cancer"},{"id":28169715,"name":"Biological sciences/Cancer/Cancer metabolism"}],"tags":[],"updatedAt":"2024-06-12T07:12:35+00:00","versionOfRecord":{"articleIdentity":"rs-3825204","link":"https://doi.org/10.1038/s41389-024-00523-4","journal":{"identity":"oncogenesis","isVorOnly":false,"title":"Oncogenesis"},"publishedOn":"2024-06-11 04:00:00","publishedOnDateReadable":"June 11th, 2024"},"versionCreatedAt":"2024-01-18 06:30:07","video":"","vorDoi":"10.1038/s41389-024-00523-4","vorDoiUrl":"https://doi.org/10.1038/s41389-024-00523-4","workflowStages":[]},"version":"v1","identity":"rs-3825204","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3825204","identity":"rs-3825204","version":["v1"]},"buildId":"zQwnuV7TCBrMSSSToR1PI","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00
unpaywall
last seen: 2026-05-26T02:00:01.498150+00:00
License: CC-BY-4.0